WorldWideScience

Sample records for cftr frameshift mutation

  1. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  2. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

    OpenAIRE

    Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

    2014-01-01

    Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

  3. CFTR mutation analysis and haplotype associations in CF patients☆

    OpenAIRE

    Cordovado, S.K.; Hendrix, M.; Greene, C.N.; Mochal, S.; Earley, M.C.; Farrell, P.M.; Kharrazi, M.; Hannon, W.H.; Mueller, P.W.

    2011-01-01

    Most newborn screening (NBS) laboratories use second-tier molecular tests for cystic fibrosis (CF) using dried blood spots (DBS). The Centers for Disease Control and Prevention’s NBS Quality Assurance Program offers proficiency testing (PT) in DBS for CF transmembrane conductance regulator (CFTR) gene mutation detection. Extensive molecular characterization on 76 CF patients, family members or screen positive newborns was performed for quality assurance. The coding, regulatory regions and por...

  4. Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation.

    Science.gov (United States)

    De Stefano, Daniela; Villella, Valeria R; Esposito, Speranza; Tosco, Antonella; Sepe, Angela; De Gregorio, Fabiola; Salvadori, Laura; Grassia, Rosa; Leone, Carlo A; De Rosa, Giuseppe; Maiuri, Maria C; Pettoello-Mantovani, Massimo; Guido, Stefano; Bossi, Anna; Zolin, Anna; Venerando, Andrea; Pinna, Lorenzo A; Mehta, Anil; Bona, Gianni; Kroemer, Guido; Maiuri, Luigi; Raia, Valeria

    2014-01-01

    Restoration of BECN1/Beclin 1-dependent autophagy and depletion of SQSTM1/p62 by genetic manipulation or autophagy-stimulatory proteostasis regulators, such as cystamine, have positive effects on mouse models of human cystic fibrosis (CF). These measures rescue the functional expression of the most frequent pathogenic CFTR mutant, F508del, at the respiratory epithelial surface and reduce lung inflammation in Cftr(F508del) homozygous mice. Cysteamine, the reduced form of cystamine, is an FDA-approved drug. Here, we report that oral treatment with cysteamine greatly reduces the mortality rate and improves the phenotype of newborn mice bearing the F508del-CFTR mutation. Cysteamine was also able to increase the plasma membrane expression of the F508del-CFTR protein in nasal epithelial cells from F508del homozygous CF patients, and these effects persisted for 24 h after cysteamine withdrawal. Importantly, this cysteamine effect after washout was further sustained by the sequential administration of epigallocatechin gallate (EGCG), a green tea flavonoid, both in vivo, in mice, and in vitro, in primary epithelial cells from CF patients. In a pilot clinical trial involving 10 F508del-CFTR homozygous CF patients, the combination of cysteamine and EGCG restored BECN1, reduced SQSTM1 levels and improved CFTR function from nasal epithelial cells in vivo, correlating with a decrease of chloride concentrations in sweat, as well as with a reduction of the abundance of TNF/TNF-alpha (tumor necrosis factor) and CXCL8 (chemokine [C-X-C motif] ligand 8) transcripts in nasal brushing and TNF and CXCL8 protein levels in the sputum. Altogether, these results suggest that optimal schedules of cysteamine plus EGCG might be used for the treatment of CF caused by the F508del-CFTR mutation.

  5. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 92; Issue 1. New frameshift CF mutation 3729delAinsTCT in a Tunisian cystic fibrosis patient. Sondess Hadj Fredj Monia Boudaya Sabrine Oueslati Safa Sahnoun Chaima Sahli Hajer Siala Khedija Boussetta Amina Bibi Taieb Messaoud. Research Note Volume 92 Issue 1 April ...

  6. Heterozygous CAV1 frameshift mutations (MIM 601047 in patients with atypical partial lipodystrophy and hypertriglyceridemia

    Directory of Open Access Journals (Sweden)

    Alston Lindsay

    2008-01-01

    Full Text Available Abstract Background Mice with a deleted Cav1 gene encoding caveolin-1 develop adipocyte abnormalities and insulin resistance. From genomic DNA of patients with atypical lipodystrophy and hypertriglyceridemia who had no mutations in any known lipodystrophy gene, we used DNA sequence analysis to screen the coding regions of human CAV1 (MIM 601047. Results We found a heterozygous frameshift mutation in CAV1, designated I134fsdelA-X137, in a female patient who had atypical partial lipodystrophy, with subcutaneous fat loss affecting the upper part of her body and face, but sparing her legs, gluteal region and visceral fat stores. She had severe type 5 hyperlipoproteinemia, with recurrent pancreatitis. In addition, she had some atypical features, including congenital cataracts and neurological findings. Her father was also heterozygous for this mutation, and had a similar pattern of fat redistribution, hypertriglyceridemia and congenital cataracts, with milder neurological involvement. An unrelated patient had a different heterozygous frameshift mutation in the CAV1 gene, designated -88delC. He also had a partial lipodystrophy phenotype, with subcutaneous fat loss affecting the arms, legs and gluteal region, but sparing his face, neck and visceral fat stores. He also had severe type 5 hyperlipoproteinemia, with recurrent pancreatitis; however he had no clinically apparent neurological manifestations. The mutations were absent from the genomes of 1063 healthy individuals. Conclusion Thus, very rare CAV1 frameshift mutations appear to be associated with atypical lipodystrophy and hypertriglyceridemia.

  7. Novel bandlike signal abnormality suggestive of heterotopia in patient with a KCNQ1 frameshift mutation.

    Science.gov (United States)

    Sabharwal, Priyanka; Devinsky, Orrin; M Shepherd, Timothy

    2017-12-01

    Malformations of cortical development are associated with epilepsy and cognitive dysfunction, and can occur in patients with SCN1A ion channel mutations. We report a novel and subtle bandlike subcortical heterotopia on integrated positron emission tomography-magnetic resonance imaging ( PET-MRI) in a patient with treatment-resistant epilepsy due to a de novo KCNQ1 frameshift mutation. Our case highlights the potential for other channel mutations to cause both epilepsy and cortical malformations. Further scrutiny of high contrast resolution MRI studies is warranted for patients with KCNQ1 and other epilepsy genes to further define their extended phenotype.

  8. A novel frameshift mutation of CHD7 in a Japanese patient with CHARGE syndrome.

    Science.gov (United States)

    Kohmoto, Tomohiro; Shono, Miki; Naruto, Takuya; Watanabe, Miki; Suga, Ken-Ichi; Nakagawa, Ryuji; Kagami, Shoji; Masuda, Kiyoshi; Imoto, Issei

    2016-01-01

    CHARGE syndrome is a rare autosomal dominant developmental disorder involving multiple organs. CHD7 is a major causative gene of CHARGE syndrome. We performed targeted-exome sequencing using a next-generation sequencer for molecular diagnosis of a 4-month-old male patient who was clinically suspected to have CHARGE syndrome, and report a novel monoallelic mutation in CHD7, NM_017780.3(CHD7_v001):c.2966del causing a reading frameshift [p.(Cys989Serfs*3)].

  9. A New Targeted CFTR Mutation Panel Based on Next-Generation Sequencing Technology.

    Science.gov (United States)

    Lucarelli, Marco; Porcaro, Luigi; Biffignandi, Alice; Costantino, Lucy; Giannone, Valentina; Alberti, Luisella; Bruno, Sabina Maria; Corbetta, Carlo; Torresani, Erminio; Colombo, Carla; Seia, Manuela

    2017-09-01

    Searching for mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR) is a key step in the diagnosis of and neonatal and carrier screening for cystic fibrosis (CF), and it has implications for prognosis and personalized therapy. The large number of mutations and genetic and phenotypic variability make this search a complex task. Herein, we developed, validated, and tested a laboratory assay for an extended search for mutations in CFTR using a next-generation sequencing-based method, with a panel of 188 CFTR mutations customized for the Italian population. Overall, 1426 dried blood spots from neonatal screening, 402 genomic DNA samples from various origins, and 1138 genomic DNA samples from patients with CF were analyzed. The assay showed excellent analytical and diagnostic operative characteristics. We identified and experimentally validated 159 (of 188) CFTR mutations. The assay achieved detection rates of 95.0% and 95.6% in two large-scale case series of CF patients from central and northern Italy, respectively. These detection rates are among the highest reported so far with a genetic test for CF based on a mutation panel. This assay appears to be well suited for diagnostics, neonatal and carrier screening, and assisted reproduction, and it represents a considerable advantage in CF genetic counseling. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  10. CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Ewa Ziętkiewicz

    Full Text Available Cystic fibrosis (CF is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR. In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone. The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported

  11. A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome

    DEFF Research Database (Denmark)

    Clendenning, Mark; Senter, Leigha; Hampel, Heather

    2008-01-01

    BACKGROUND: When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (Lynch syndrome cases...... on immunohistochemical analysis. RESULTS: We have identified a frequently occurring frame-shift mutation (c.736_741del6ins11) in 12 ostensibly unrelated Lynch syndrome patients (20% of patients we have identified with a deleterious mutation in PMS2, n=61). These individuals all display the rare allele (population...... are caused by PMS2. This disparity is primarily due to complications in the study of this gene caused by interference from pseudogene sequences. METHODS: Using a recently developed method for detecting PMS2 specific mutations, we have screened 99 patients who are likely candidates for PMS2 mutations based...

  12. A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome

    DEFF Research Database (Denmark)

    Clendenning, Mark; Senter, Leigha; Hampel, Heather

    2008-01-01

    BACKGROUND: When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (Lynch syndrome cases...... on immunohistochemical analysis. RESULTS: We have identified a frequently occurring frame-shift mutation (c.736_741del6ins11) in 12 ostensibly unrelated Lynch syndrome patients (20% of patients we have identified with a deleterious mutation in PMS2, n=61). These individuals all display the rare allele (population...... and Swedish ancestry. We estimate that there are >10,000 carriers of this mutation in the United States alone. The identification of both the mutation and the common haplotype in one Swedish control sample (n = 225), along with evidence that Lynch syndrome associated cancers are rarer than expected...

  13. Frequent alteration of MLL3 frameshift mutations in microsatellite deficient colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Watanabe

    Full Text Available MLL3 is a histone 3-lysine 4 methyltransferase with tumor-suppressor properties that belongs to a family of chromatin regulator genes potentially altered in neoplasia. Mutations in MLL3 were found in a whole genome analysis of colorectal cancer but have not been confirmed by a separate study.We analyzed mutations of coding region and promoter methylation in MLL3 using 126 cases of colorectal cancer. We found two isoforms of MLL3 and DNA sequencing revealed frameshift and other mutations affecting both isoforms of MLL3 in colorectal cancer cells and 19 of 134 (14% primary colorectal samples analyzed. Moreover, frameshift mutations were more common in cases with microsatellite instability (31% both in CRC cell lines and primary tumors. The largest isoform of MLL3 is transcribed from a CpG island-associated promoter that has highly homology with a pseudo-gene on chromosome 22 (psiTPTE22. Using an assay which measured both loci simultaneously we found prominent age related methylation in normal colon (from 21% in individuals less than 25 years old to 56% in individuals older than 70, R = 0.88, p<0.001 and frequent hypermethylation (83% in both CRC cell lines and primary tumors. We next studied the two loci separately and found that age and cancer related methylation was solely a property of the pseudogene CpG island and that the MLL3 loci was unmethylated.We found that frameshift mutations of MLL3 in both CRC cells and primary tumor that were more common in cases with microsatellite instability. Moreover, we have shown CpG island-associated promoter of MLL3 gene has no DNA methylation in CRC cells but also primary tumor and normal colon, and this region has a highly homologous of pseudo gene (psiTPTE22 that was age relate DNA methylation.

  14. A rapid and effective method for screening, sequencing and reporter verification of engineered frameshift mutations in zebrafish

    Directory of Open Access Journals (Sweden)

    Sergey V. Prykhozhij

    2017-06-01

    Full Text Available Clustered regularly interspaced palindromic repeats (CRISPR/Cas-based adaptive immunity against pathogens in bacteria has been adapted for genome editing and applied in zebrafish (Danio rerio to generate frameshift mutations in protein-coding genes. Although there are methods to detect, quantify and sequence CRISPR/Cas9-induced mutations, identifying mutations in F1 heterozygous fish remains challenging. Additionally, sequencing a mutation and assuming that it causes a frameshift does not prove causality because of possible alternative translation start sites and potential effects of mutations on splicing. This problem is compounded by the relatively few antibodies available for zebrafish proteins, limiting validation at the protein level. To address these issues, we developed a detailed protocol to screen F1 mutation carriers, and clone and sequence identified mutations. In order to verify that mutations actually cause frameshifts, we created a fluorescent reporter system that can detect frameshift efficiency based on the cloning of wild-type and mutant cDNA fragments and their expression levels. As proof of principle, we applied this strategy to three CRISPR/Cas9-induced mutations in pycr1a, chd7 and hace1 genes. An insertion of seven nucleotides in pycr1a resulted in the first reported observation of exon skipping by CRISPR/Cas9-induced mutations in zebrafish. However, of these three mutant genes, the fluorescent reporter revealed effective frameshifting exclusively in the case of a two-nucleotide deletion in chd7, suggesting activity of alternative translation sites in the other two mutants even though pycr1a exon-skipping deletion is likely to be deleterious. This article provides a protocol for characterizing frameshift mutations in zebrafish, and highlights the importance of checking mutations at the mRNA level and verifying their effects on translation by fluorescent reporters when antibody detection of protein loss is not possible.

  15. Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

    Directory of Open Access Journals (Sweden)

    Dinić Jelena

    2007-01-01

    Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

  16. The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations

    International Nuclear Information System (INIS)

    Flores-Rozas, H.; Kolodner, R.D.

    1998-01-01

    The Saccharomyces cerevisiae genome encodes four MutL homologs. Of these, MLH1 and PMS1 are known to act in the MSH2-dependent pathway that repairs DNA mismatches. We have investigated the role of NLH3 in mismatch repair. Mutations in MLH3 increased the rate of reversion of the hom3-10 allele by increasing the rate of deletion of a single T in a run of 7 Ts. Combination of mutations in MLH3 and MSH6 caused a synergistic increase in the hom3-10 reversion rate, whereas the hom3-10 reversion rate in an mlh3 msh3 double mutant was the same as in the respective single mutants. Similar results were observed when the accumulation of mutations at frameshift hot spots in the LYS2 gene was analyzed, although mutation of MLH3 did not cause the same extent of affect at every LYS2 frameshift hot spot. MLH3 interacted with MLH1 in a two-hybrid system. These data are consistent with the idea that a proportion of the repair of specific insertion/deletion mispairs by the MSH3-dependent mismatch repair pathway uses a heterodimeric MLH1-MLH3 complex in place of the MLH1-PMS1 complex

  17. De novo frameshift mutation in fibroblast growth factor 8 in a male patient with gonadotropin deficiency.

    Science.gov (United States)

    Suzuki, Erina; Yatsuga, Shuichi; Igarashi, Maki; Miyado, Mami; Nakabayashi, Kazuhiko; Hayashi, Keiko; Hata, Kenichirou; Umezawa, Akihiro; Yamada, Gen; Ogata, Tsutomu; Fukami, Maki

    2014-01-01

    Missense, nonsense, and splice mutations in the Fibroblast Growth Factor 8(FGF8) have recently been identified in patients with hypothalamo-pituitary dysfunction and craniofacial anomalies. Here, we report a male patient with a frameshift mutation in FGF8. The patient exhibited micropenis, craniofacial anomalies, and ventricular septal defect at birth. Clinical evaluation at 16 years and 8 months of age revealed delayed puberty, hyposmia, borderline mental retardation, and mild hearing difficulty. Endocrine findings included gonadotropin deficiency and primary hypothyroidism. Molecular analysis identified a de novo heterozygous p.S192fsX204 mutation in the last exon of FGF8. RT-PCR analysis of normal human tissues detected FGF8 expression in the genital skin, and whole-mount in situ hybridization analysis of mouse embryos revealed Fgf8 expression in the anlage of the penis. The results indicate that frameshift mutations in FGF8 account for a part of the etiology of hypothalamo-pituitary dysfunction. Micropenis in patients with FGF8 abnormalities appears to be caused by gonadotropin deficiency and defective outgrowth of the anlage of the penis.

  18. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Directory of Open Access Journals (Sweden)

    Matei Irina

    2001-08-01

    Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

  19. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Science.gov (United States)

    Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

    2001-01-01

    Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

  20. A new compound heterozygous CFTR mutation in a Chinese family with cystic fibrosis.

    Science.gov (United States)

    Xie, Yingjun; Huang, Xueqiong; Liang, Yujian; Xu, Lingling; Pei, Yuxin; Cheng, Yucai; Zhang, Lidan; Tang, Wen

    2017-11-01

    Cystic fibrosis (CF) is the most common autosomal recessive disease among Caucasians but is rarer in the Chinese population, because mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. To elucidate the causative role of a novel compound heterozygous mutation of CF. In this study, clinical samples were obtained from two siblings with recurrent airway infections, clubbed fingers, salt-sweat and failure to gain weight in a non-consanguineous Chinese family. Next-generation sequencing was performed on the 27 coding exons of CFTR in both children, with confirmation by Sanger sequencing. Next-generation sequencing showed the same compound heterozygous CFTR mutation (c.865A>T p.Arg289X and c.3651_3652insAAAT p.Tyr1219X) in both children. As this mutation is consistent with the clinical manifestations of CF and no other mutations were detected after scanning the gene sequence, we suggest that the CF phenotype is caused by compound heterozygosity for c.865A>T and c.3651_3652insAAAT. As c865A>T is not currently listed in the "Cystic Fibrosis Mutation Database", this information about CF in a Chinese population is of interest. © 2015 John Wiley & Sons Ltd.

  1. Effects of the umuC36 mutation on ultraviolet-radiation-induced base-change and frameshift mutations in Escherichia coli

    International Nuclear Information System (INIS)

    Kato, T.; Nakano, E.

    1981-01-01

    The effects of the umuC36 mutation on the induction of base-change and frameshift mutations were studied. An active umuC gene was necessary in either the uvr + or uvr - strains of Escherichia coli K12 for UV- and X-ray-induced mutations to His + , ColE and Spc, which are presumably base-change mutations, but it was not essential for ethyl methanesulphonate or N-methyl-N'-nitro-N-nitrosoguanidine-induced His + mutations. In contrast, only 1 out of 13 trp - frameshift mutations examined was UV reversible, and the process of mutagenesis was umuC + -dependent, whereas a potent frameshift mutagen, ICR191, effectively induced Trp + mutations in most of the strains regardless of the umu + or umuC genetic background. These results suggest that base substitutions are a major mutational type derived from the umuC + -dependent pathway of error-prone repair. (orig.)

  2. The sequence spectrum of frameshift reversions obtained with a novel adaptive mutation assay in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Erich Heidenreich

    2016-12-01

    Full Text Available Research on the mechanisms of adaptive mutagenesis in resting, i.e. non-replicating cells relies on appropriate mutation assays. Here we provide a novel procedure for the detection of frameshift-reverting mutations in yeast. Proliferation of non-reverted cells in this assay is suppressed by the lack of a fermentable carbon source. The test allele was constructed in a way that the reversions mimic microsatellite instability, a condition often found in cancer cells. We show the cell numbers during these starvation conditions and provide a DNA sequence spectrum of a representative set of revertants. The data in this article support the publication "Glucose starvation as a selective tool for the study of adaptive mutations in Saccharomyces cerevisiae" (Heidenreich and Steinboeck, 2016 [1].

  3. A frame-shift mutation of PMS2 is a widespread cause of Lynch syndrome.

    Science.gov (United States)

    Clendenning, M; Senter, L; Hampel, H; Robinson, K Lagerstedt; Sun, S; Buchanan, D; Walsh, M D; Nilbert, M; Green, J; Potter, J; Lindblom, A; de la Chapelle, A

    2008-06-01

    When compared to the other mismatch repair genes involved in Lynch syndrome, the identification of mutations within PMS2 has been limited (PMS2. This disparity is primarily due to complications in the study of this gene caused by interference from pseudogene sequences. Using a recently developed method for detecting PMS2 specific mutations, we have screened 99 patients who are likely candidates for PMS2 mutations based on immunohistochemical analysis. We have identified a frequently occurring frame-shift mutation (c.736_741del6ins11) in 12 ostensibly unrelated Lynch syndrome patients (20% of patients we have identified with a deleterious mutation in PMS2, n = 61). These individuals all display the rare allele (population frequency 10 000 carriers of this mutation in the USA alone. The identification of both the mutation and the common haplotype in one Swedish control sample (n = 225), along with evidence that Lynch syndrome associated cancers are rarer than expected in the probands' families, would suggest that this is a prevalent mutation with reduced penetrance.

  4. A CNGB1 frameshift mutation in Papillon and Phalene dogs with progressive retinal atrophy.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Progressive retinal degenerations are the most common causes of complete blindness both in human and in dogs. Canine progressive retinal atrophy (PRA or degeneration resembles human retinitis pigmentosa (RP and is characterized by a progressive loss of rod photoreceptor cells followed by a loss of cone function. The primary clinical signs are detected as vision impairment in a dim light. Although several genes have been associated with PRAs, there are still PRAs of unknown genetic cause in many breeds, including Papillons and Phalènes. We have performed a genome wide association and linkage studies in cohort of 6 affected Papillons and Phalènes and 14 healthy control dogs to map a novel PRA locus on canine chromosome 2, with a 1.9 Mb shared homozygous region in the affected dogs. Parallel exome sequencing of a trio identified an indel mutation, including a 1-bp deletion, followed by a 6-bp insertion in the CNGB1 gene. This mutation causes a frameshift and premature stop codon leading to probable nonsense mediated decay (NMD of the CNGB1 mRNA. The mutation segregated with the disease and was confirmed in a larger cohort of 145 Papillons and Phalènes (PFisher = 1.4×10(-8 with a carrier frequency of 17.2 %. This breed specific mutation was not present in 334 healthy dogs from 10 other breeds or 121 PRA affected dogs from 44 other breeds. CNGB1 is important for the photoreceptor cell function its defects have been previously associated with retinal degeneration in both human and mouse. Our study indicates that a frameshift mutation in CNGB1 is a cause of PRA in Papillons and Phalènes and establishes the breed as a large functional animal model for further characterization of retinal CNGB1 biology and possible retinal gene therapy trials. This study enables also the development of a genetic test for breeding purposes.

  5. Photoreactivation reverses ultraviolet radition induced premutagenic lesions leading to frameshift mutations in Escherichia coli

    International Nuclear Information System (INIS)

    Yamamoto, Kazuo

    1985-01-01

    The effect of photoreactivation of the ultraviolet radiation induced reversion of a trpE9777 frameshift mutation was studied in a uvr A6 derivative of Escherichia coli K12. Two different photoreactivation treatments were used, one providing a single flash of photoreactivating light and another providing 10 min of light from fluorescent lamps. The reversion frequency of the trpE9777 frameshift mutation was strongly reduced when subsueqently exposed to visible light. The dose modification factor (the ratio of equally effective doses), for cells challenged with single-flash photoreactivation, for survival and induction of reversion to Trp + was 3.6 and 3.4, respectively. UV induction of RecA protein synthesis was not reversed by a single flash of photoreactivation. The dose modification factor for 10 min of fluorescent lamp photoreactivation for survival and for induction of reversion to Trp + was 6.5 and 6.3, respectively. The dose modification factor for 10 min of photoreactivation for induction of RecA protein was 1.7-2.5. Photoreactivation decreased the reversion of trpE9777 and increased survival to the same extent. We concluded that cyclobutyl pyrimidine dimers are the premutagenic lesions of UV mutagenesis of the trpE9777 allele in a uvr A6 background. (orig.)

  6. Optimizing nasal potential difference analysis for CFTR modulator development: assessment of ivacaftor in CF subjects with the G551D-CFTR mutation.

    Directory of Open Access Journals (Sweden)

    Steven M Rowe

    Full Text Available Nasal potential difference (NPD is used as a biomarker of the cystic fibrosis transmembrane conductance regulator (CFTR and epithelial sodium channel (ENaC activity. We evaluated methods to detect changes in chloride and sodium transport by NPD based on a secondary analysis of a Phase II CFTR-modulator study. Thirty-nine subjects with CF who also had the G551D-CFTR mutation were randomized to receive ivacaftor (Kalydeco™; also known as VX-770 in four doses or placebo twice daily for at least 14 days. All data were analyzed by a single investigator who was blinded to treatment assignment. We compared three analysis methods to determine the best approach to quantify changes in chloride and sodium transport: (1 the average of both nostrils; (2 the most-polarized nostril at each visit; and (3 the most-polarized nostril at screening carried forward. Parameters of ion transport included the PD change with zero chloride plus isoproterenol (CFTR activity, the basal PD, Ringer's PD, and change in PD with amiloride (measurements of ENaC activity, and the delta NPD (measuring CFTR and ENaC activity. The average and most-polarized nostril at each visit were most sensitive to changes in chloride and sodium transport, whereas the most-polarized nostril at screening carried forward was less discriminatory. Based on our findings, NPD studies should assess both nostrils rather than a single nostril. We also found that changes in CFTR activity were more readily detected than changes in ENaC activity, and that rigorous standardization was associated with relatively good within-subject reproducibility in placebo-treated subjects (± 2.8 mV. Therefore, we have confirmed an assay of reasonable reproducibility for detecting chloride-transport improvements in response to CFTR modulation.

  7. Base substitutions, frameshifts, and small deletions constitute ionizing radiation-induced point mutations in mammalian cells

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; de Boer, J.G.; de Jong, P.J.; Drobetsky, E.A.; Glickman, B.W.

    1988-01-01

    The relative role of point mutations and large genomic rearrangements in ionizing radiation-induced mutagenesis has been an issue of long-standing interest. Recent studies using Southern blotting analysis permit the partitioning of ionizing radiation-induced mutagenesis in mammalian cells into detectable deletions and major genomic rearrangements and into point mutations. The molecular nature of these point mutations has been left unresolved; they may include base substitutions as well as small deletions, insertions, and frame-shifts below the level of resolution of Southern blotting analysis. In this investigation, we have characterized a collection of ionizing radiation-induced point mutations at the endogenous adenine phosphoribosyltransferase (aprt) locus of Chinese hamster ovary cells at the DNA sequence level. Base substitutions represented approximately equal to 2/3 of the point mutations analyzed. Although the collection of mutants is relatively small, every possible type of base substitution event has been recovered. These mutations are well distributed throughout the coding sequence with only one multiple occurrence. Small deletions represented the remainder of characterized mutants; no insertions have been observed. Sequence-directed mechanisms mediated by direct repeats could account for some of the observed deletions, while others appear to be directly attributable to radiation-induced strand breakage

  8. Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1.

    Science.gov (United States)

    Duan, Lian; Li, Qian; Tong, An-Li; Mao, Jiang-Feng; Yu, Miao; Yuan, Tao; Chai, Xiao-Feng; Gu, Feng

    2018-01-01

    Wolfram syndrome (WS) is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM) and optic atrophy (OA). We aim to characterize clinical features in Chinese patients who had been poorly studied until now. We performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described. Six patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10-19 years). Blood glucose impairment, OA, and diabetes insipidus were present in all (100%), hearing impairment in four (66.7%), urological abnormalities in four (66.7%), neurological abnormalities in one (16.7%), and endocrine disorder in one (16.7%). Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93) was identified in exon 4 of WFS1 . Our series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

  9. Selective translational repression of truncated proteins from frameshift mutation-derived mRNAs in tumors.

    Directory of Open Access Journals (Sweden)

    Kwon Tae You

    2007-05-01

    Full Text Available Frameshift and nonsense mutations are common in tumors with microsatellite instability, and mRNAs from these mutated genes have premature termination codons (PTCs. Abnormal mRNAs containing PTCs are normally degraded by the nonsense-mediated mRNA decay (NMD system. However, PTCs located within 50-55 nucleotides of the last exon-exon junction are not recognized by NMD (NMD-irrelevant, and some PTC-containing mRNAs can escape from the NMD system (NMD-escape. We investigated protein expression from NMD-irrelevant and NMD-escape PTC-containing mRNAs by Western blotting and transfection assays. We demonstrated that transfection of NMD-irrelevant PTC-containing genomic DNA of MARCKS generates truncated protein. In contrast, NMD-escape PTC-containing versions of hMSH3 and TGFBR2 generate normal levels of mRNA, but do not generate detectable levels of protein. Transfection of NMD-escape mutant TGFBR2 genomic DNA failed to generate expression of truncated proteins, whereas transfection of wild-type TGFBR2 genomic DNA or mutant PTC-containing TGFBR2 cDNA generated expression of wild-type protein and truncated protein, respectively. Our findings suggest a novel mechanism of gene expression regulation for PTC-containing mRNAs in which the deleterious transcripts are regulated either by NMD or translational repression.

  10. A novel frameshift mutation in CX46 associated with hereditary dominant cataracts in a Chinese family

    Directory of Open Access Journals (Sweden)

    Xiu-Kun Cui

    2017-05-01

    Full Text Available AIM: To investigate the genetic mutations that are associated the hereditary autosomal dominant cataract in a Chinese family. METHODS: A Chinese family consisting of 20 cataract patients (including 9 male and 11 female and 2 unaffected individuals from 5 generations were diagnosed to be a typical autosomal dominant cataract pedigree. Genomic DNA samples were extracted from the peripheral blood cells of the participants in this pedigree. Exon sequence was used for genetic mutation screening. In silico analysis was used to study the structure characteristics of connexin 46 (CX46 mutant. Immunoblotting was conduceted for testing the expression of CX46. RESULTS: To determine the involved genetic mutations, 11 well-known cataract-associated genes (cryaa, cryab, crybb1, crybb2, crygc, crygd, Gja3, Gja8, Hsf4, Mip and Pitx3 were chosen for genetic mutation test by using exon sequencing. A novel cytosine insertion at position 1195 of CX46 cDNA (c.1194_1195ins C was found in the samples of 5 tested cataract patients but not in the unaffected 2 individuals nor in normal controls, which resulted in 30 amino acids more extension in CX46C-terminus (cx46fs400 compared with the wild-type CX46. In silico protein structure analysis indicated that the mutant showed distinctive hydrophobicity and protein secondary structure compared with the wild-type CX46. The immunoblot results revealed that CX46 protein, which expressed in the aging cataract lens tissues, was absence in the proband lens. In contrast, CX50, alpha A-crystallin and alphaB-crystallin expressed equally in both proband and aging cataract tissues. Those results revealed that the cx46fs400 mutation could impair CX46 protein expression. CONCLUSION: The insertion of cytosine at position 1195 of CX46 cDNA is a novel mutation site that is associated with the autosomal dominant cataracts in this Chinese family. The C-terminal frameshift mutation is involved in regulating CX46 protein expression.

  11. Clinical Characteristics of Wolfram Syndrome in Chinese Population and a Novel Frameshift Mutation in WFS1

    Directory of Open Access Journals (Sweden)

    Lian Duan

    2018-02-01

    Full Text Available ObjectiveWolfram syndrome (WS is a rare, degenerative, and hereditary disorder characterized by ear diabetes mellitus (DM and optic atrophy (OA. We aim to characterize clinical features in Chinese patients who had been poorly studied until now.MethodsWe performed a retrospective review of patients with WS seen in the Peking Union Medical College Hospital from 2002 to 2017. Data including demographic data, clinical presentations, examination results, family history, and genetic analysis were described.ResultsSix patients with WS were identified, meeting the diagnostic criteria of the coincidence of DM and OA before 15 years old or the existence of two WFS1 mutations. All were male, with the median age of 14.5 years (range 10–19 years. Blood glucose impairment, OA, and diabetes insipidus were present in all (100%, hearing impairment in four (66.7%, urological abnormalities in four (66.7%, neurological abnormalities in one (16.7%, and endocrine disorder in one (16.7%. Rare presentation includes cataract, glaucoma, and spina bifida occulta. Diabetes was insulin-dependent and not ketosis onset, with antibody to glutamic acid decarboxylase and islet cell negative. Genetic analysis revealed mutations in WFS1 in three patients. A novel frameshift mutation (p.Asp151Glufs*93 was identified in exon 4 of WFS1.ConclusionOur series of WS patients indicated that WS is a degenerative disease with a wide and variable spectrum, characterized by ear non-autoimmune DM and bilateral OA. Genetic analysis is recommended when suspected of WS.

  12. Distribution of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR Mutations in a Cohort of Patients Residing in Palestine.

    Directory of Open Access Journals (Sweden)

    Issa Siryani

    Full Text Available Cystic fibrosis (CF is an autosomal recessive inherited life-threatening disorder that causes severe damage to the lungs and the digestive system. In Palestine, mutations in the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR that contributes to the clinical presentation of CF are ill defined. A cohort of thirty three clinically diagnosed CF patients from twenty one different Palestinian families residing in the central and southern part of Palestine were incorporated in this study. Sweat chloride testing was performed using the Sweat Chek Conductivity Analyzer (ELITECH Group, France to confirm the clinical diagnosis of CF. In addition, nucleic acid from the patients' blood samples was extracted and the CFTR mutation profiles were assessed by direct sequencing of the CFTR 27 exons and the intron-exon boundaries. For patient's DNA samples where no homozygous or two heterozygous CFTR mutations were identified by exon sequencing, DNA samples were tested for deletions or duplications using SALSA MLPA probemix P091-D1 CFTR assay. Sweat chloride testing confirmed the clinical diagnosis of CF in those patients. All patients had NaCl conductivity >60 mmol/l. In addition, nine different CFTR mutations were identified in all 21 different families evaluated. These mutations were c.1393-1G>A, F508del, W1282X, G85E, c.313delA, N1303K, deletion exons 17a-17b-18, deletion exons 17a-17b and Q1100P. c.1393-1G>A was shown to be the most frequent occurring mutation among tested families. We have profiled the underling mutations in the CFTR gene of a cohort of 21 different families affected by CF. Unlike other studies from the Arab countries where F508del was reported to be the most common mutation, in southern/central Palestine, the c.1393-1G>A appeared to be the most common. Further studies are needed per sample size and geographic distribution to account for other possible CFTR genetic alterations and their frequencies. Genotype

  13. A frameshift mutation in GON4L is associated with proportionate dwarfism in Fleckvieh cattle.

    Science.gov (United States)

    Schwarzenbacher, Hermann; Wurmser, Christine; Flisikowski, Krzysztof; Misurova, Lubica; Jung, Simone; Langenmayer, Martin C; Schnieke, Angelika; Knubben-Schweizer, Gabriela; Fries, Ruedi; Pausch, Hubert

    2016-03-31

    Low birth weight and postnatal growth restriction are the most evident symptoms of dwarfism. Accompanying skeletal aberrations may compromise the general condition and locomotion of affected individuals. Several paternal half-sibs with a low birth weight and a small size were born in 2013 in the Fleckvieh cattle population. Affected calves were strikingly underweight at birth in spite of a normal gestation length and had craniofacial abnormalities such as elongated narrow heads and brachygnathia inferior. In spite of a normal general condition, their growth remained restricted during rearing. We genotyped 27 affected and 10,454 unaffected animals at 44,672 single nucleotide polymorphisms and performed association tests followed by homozygosity mapping, which allowed us to map the locus responsible for growth failure to a 1.85-Mb segment on bovine chromosome 3. Analysis of whole-genome re-sequencing data from one affected and 289 unaffected animals revealed a 1-bp deletion (g.15079217delC, rs723240647) in the coding region of the GON4L gene that segregated with the dwarfism-associated haplotype. We showed that the deletion induces intron retention and premature termination of translation, which can lead to a severely truncated protein that lacks domains that are likely essential to normal protein function. The widespread use of an undetected carrier bull for artificial insemination has resulted in a tenfold increase in the frequency of the deleterious allele in the female population. A frameshift mutation in GON4L is associated with autosomal recessive proportionate dwarfism in Fleckvieh cattle. The mutation has segregated in the population for more than 50 years without being recognized as a genetic disorder. However, the widespread use of an undetected carrier bull for artificial insemination caused a sudden accumulation of homozygous calves with dwarfism. Our findings provide the basis for genome-based mating strategies to avoid the inadvertent mating of carrier

  14. Clinical expression of patients with the D1152H CFTR mutation.

    Science.gov (United States)

    Terlizzi, Vito; Carnovale, Vincenzo; Castaldo, Giuseppe; Castellani, Carlo; Cirilli, Natalia; Colombo, Carla; Corti, Fabiola; Cresta, Federico; D'Adda, Alice; Lucarelli, Marco; Lucidi, Vincenzina; Macchiaroli, Annamaria; Madarena, Elisa; Padoan, Rita; Quattrucci, Serena; Salvatore, Donatello; Zarrilli, Federica; Raia, Valeria

    2015-07-01

    Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  15. S737F is a new CFTR mutation typical of patients originally from the Tuscany region in Italy.

    Science.gov (United States)

    Terlizzi, Vito; Di Lullo, Antonella Miriam; Comegna, Marika; Centrone, Claudia; Pelo, Elisabetta; Castaldo, Giuseppe; Raia, Valeria; Braggion, Cesare

    2018-01-03

    An increasing number of patients have been described as having a number of Cystic Fibrosis Transmembrane conductance Regulator (CFTR) variants for which it lacks a clear genotype-phenotype correlation. We assesses the clinical features of patients bearing the S737F (p.Ser737Phe) CFTR missense variant and evaluated the residual function of CFTR protein on nasal epithelial cells (NEC). A retrospective database was performed from individuals homozygous or compound heterozygous for the S737F variant followed in the Cystic Fibrosis (CF) Centre of Florence. We performed a nasal brushing in cooperating patients and compared the results with those of patients followed in the pediatric CF Centre of Naples. 9/295 (3%) subjects carrying at least S737F CFTR variant on one allele were identified. Patients were diagnosed in 7/9 cases by newborn screening and in two cases for dehydration with hypochloremic metabolic alkalosis; at diagnosis sweat chloride levels (SCL) were in the pathological range in only one case. After a mean follow up of 8,6 years (range 0,5-15,8), SCL were in the pathological range in 8/9 cases (mean age at CF diagnosis: 1,5 years), all patients were pancreatic sufficiency and respiratory function was normal. The gating activity on NEC was 15.6% and 12.7% in two patients compound heterozygous for W1282X and DelE22_24, while it was ranged between 6,2% and 9,8% in CF patients. S737F is a CFTR mutation associated to hypochloremic alkalosis in childhood, mild CF phenotype in teenage years and a residual function of CFTR protein.

  16. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    Science.gov (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  17. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    Science.gov (United States)

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  18. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

    Science.gov (United States)

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

    2013-03-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

  19. Sweat chloride and immunoreactive trypsinogen in infants carrying two CFTR mutations and not affected by cystic fibrosis.

    Science.gov (United States)

    Castellani, Carlo; Tridello, Gloria; Tamanini, Anna; Assael, Baroukh M

    2017-07-01

    Newborns with raised immunotrypsinogen levels who have non-pathological sweat chloride values and carry two cystic fibrosis transmembrane regulator ( CFTR ) mutations of which at least one is not acknowledged to be cystic fibrosis (CF)-causing are at risk of developing clinical manifestations consistent with CFTR-related disorders or even CF. It is not known whether newborns with similar genotypes and normal immunoreactive trypsinogen (IRT) may share the same risk. This study found that newborns with these characteristics and normal IRT have lower sweat chloride values than those with raised IRT (p=0.007). Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  20. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  1. Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

    DEFF Research Database (Denmark)

    Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars

    2016-01-01

    -threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based...

  2. De novo MECP2 frameshift mutation in a boy with moderate mental retardation, obesity and gynaecomastia.

    NARCIS (Netherlands)

    Kleefstra, T.; Yntema, H.G.; Oudakker, A.R.; Romein, T.; Sistermans, E.A.; Nillessen, W.; Bokhoven, J.H.L.M. van; Vries, L.B.A. de; Hamel, B.C.J.

    2002-01-01

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder caused by mutations in the MECP2 gene, with apparent lethality in male embryos. However, recent studies indicate that mutations in the MECP2 gene can cause congenital encephalopathy, an Angelman-like phenotype and even nonspecific mental

  3. Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

    Science.gov (United States)

    Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

    2016-01-01

    We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  4. An exon 53 frameshift mutation in CUBN abrogates cubam function and causes Imerslund-Gräsbeck syndrome in dogs.

    Science.gov (United States)

    Fyfe, John C; Hemker, Shelby L; Venta, Patrick J; Fitzgerald, Caitlin A; Outerbridge, Catherine A; Myers, Sherry L; Giger, Urs

    2013-08-01

    Cobalamin malabsorption accompanied by selective proteinuria is an autosomal recessive disorder known as Imerslund-Gräsbeck syndrome in humans and was previously described in dogs due to amnionless (AMN) mutations. The resultant vitamin B12 deficiency causes dyshematopoiesis, lethargy, failure to thrive, and life-threatening metabolic disruption in the juvenile period. We studied 3 kindreds of border collies with cobalamin malabsorption and mapped the disease locus in affected dogs to a 2.9Mb region of homozygosity on canine chromosome 2. The region included CUBN, the locus encoding cubilin, a peripheral membrane protein that in concert with AMN forms the functional intrinsic factor-cobalamin receptor expressed in ileum and a multi-ligand receptor in renal proximal tubules. Cobalamin malabsorption and proteinuria comprising CUBN ligands were demonstrated by radiolabeled cobalamin uptake studies and SDS-PAGE, respectively. CUBN mRNA and protein expression were reduced ~10 fold and ~20 fold, respectively, in both ileum and kidney of affected dogs. DNA sequencing demonstrated a single base deletion in exon 53 predicting a translational frameshift and early termination codon likely triggering nonsense mediated mRNA decay. The mutant allele segregated with the disease in the border collie kindred. The border collie disorder indicates that a CUBN mutation far C-terminal from the intrinsic factor-cobalamin binding site can abrogate receptor expression and cause Imerslund-Gräsbeck syndrome. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Non-homologous end joining dependency of {gamma}-irradiation-induced adaptive frameshift mutation formation in cell cycle-arrested yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Heidenreich, Erich [Institute of Cancer Research, Division of Molecular Genetics, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)]. E-mail: erich.heidenreich@meduniwien.ac.at; Eisler, Herfried [Institute of Cancer Research, Division of Molecular Genetics, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)

    2004-11-22

    There is a strong selective pressure favoring adaptive mutations which relieve proliferation-limiting adverse living conditions. Due to their importance for evolution and pathogenesis, we are interested in the mechanisms responsible for the formation of such adaptive, gain-of-fitness mutations in stationary-phase cells. During previous studies on the occurrence of spontaneous reversions of an auxotrophy-causing frameshift allele in the yeast Saccharomyces cerevisiae, we noticed that about 50% of the adaptive reversions depended on a functional non-homologous end joining (NHEJ) pathway of DNA double-strand break (DSB) repair. Here, we show that the occasional NHEJ component Pol4, which is the yeast ortholog of mammalian DNA polymerase lambda, is not required for adaptive mutagenesis. An artificially imposed excess of DSBs by {gamma}-irradiation resulted in a dramatic increase in the incidence of adaptive, cell cycle arrest-releasing frameshift reversions. By the use of DNA ligase IV-deficient strains we detected that the majority of the {gamma}-induced adaptive mutations were also dependent on a functional NHEJ pathway. This suggests that the same mutagenic NHEJ mechanism acts on spontaneously arising as well as on ionizing radiation-induced DSBs. Inaccuracy of the NHEJ repair pathway may extensively contribute to the incidence of frameshift mutations in resting (non-dividing) eukaryotic cells, and thus act as a driving force in tumor development.

  6. Non-homologous end joining dependency of γ-irradiation-induced adaptive frameshift mutation formation in cell cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Heidenreich, Erich; Eisler, Herfried

    2004-01-01

    There is a strong selective pressure favoring adaptive mutations which relieve proliferation-limiting adverse living conditions. Due to their importance for evolution and pathogenesis, we are interested in the mechanisms responsible for the formation of such adaptive, gain-of-fitness mutations in stationary-phase cells. During previous studies on the occurrence of spontaneous reversions of an auxotrophy-causing frameshift allele in the yeast Saccharomyces cerevisiae, we noticed that about 50% of the adaptive reversions depended on a functional non-homologous end joining (NHEJ) pathway of DNA double-strand break (DSB) repair. Here, we show that the occasional NHEJ component Pol4, which is the yeast ortholog of mammalian DNA polymerase lambda, is not required for adaptive mutagenesis. An artificially imposed excess of DSBs by γ-irradiation resulted in a dramatic increase in the incidence of adaptive, cell cycle arrest-releasing frameshift reversions. By the use of DNA ligase IV-deficient strains we detected that the majority of the γ-induced adaptive mutations were also dependent on a functional NHEJ pathway. This suggests that the same mutagenic NHEJ mechanism acts on spontaneously arising as well as on ionizing radiation-induced DSBs. Inaccuracy of the NHEJ repair pathway may extensively contribute to the incidence of frameshift mutations in resting (non-dividing) eukaryotic cells, and thus act as a driving force in tumor development

  7. [Frequency of the most common mutations of the CFTR gene in peruvian patients with cystic fibrosis using the ARMS-PCR technique].

    Science.gov (United States)

    Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit

    2017-01-01

    To determine the frequency of the ten most common mutations of the CFTR gene reported in Latin Americausing amplification-refractory mutation system-polymerase chain reaction (ARMS-PCR) in patients with cystic fibrosis (CF) in two referral hospitals in Peru during the year 2014. The frequency of the ten most common mutations of the CFTR gene was assessed in patients of the Hospital Nacional Edgardo Rebagliati Martins and the Instituto Nacional de Salud del Niño, both located in Lima, Peru. Blood samples were collected from 36 patients with CF, and the ARMS-PCR technique was used to determine the presence of these mutations. The study group included 73.5% of patients with a known diagnosis of CF in the country when the study was carried out. ARMS-PCR allowed three of the mutations to be identified in a combined 30.6% of the alleles from patients with CF, and 64.9% of the mutated alleles were not identified. The mutations found were p.Phe508del (22,2%), p.Gly542* (6,9%), and p.Arg1162* (1,4%). There is significant variability in both the frequency and type of mutations present in our study population and in what has been reported in other Latin American countries. It is necessary to perform studies that use complete sequencing technology for the CFTR gene to identify other mutations present in our population.

  8. Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

    Directory of Open Access Journals (Sweden)

    Abdelaziz Tlili

    Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

  9. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    Science.gov (United States)

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  10. Novel CFTR missense mutations in Brazilian patients with congenital absence of vas deferens: counseling issues Mutações novas no gene CFTR de pacientes brasileiros portadores de agenesia dos vasos deferentes: dificuldades no aconselhamento

    Directory of Open Access Journals (Sweden)

    Patricia de Campos Pieri

    2007-01-01

    Full Text Available PURPOSE: Screening for mutations in the entire Cystic Fibrosis gene (CFTR of Brazilian infertile men with congenital absence of vas deferens, in order to prevent transmission of CFTR mutations to offspring with the use of assisted reproductive technologies. METHOD: Specific polymerase chain reaction (PCR primers were designed to each of the 27 exons and splicing sites of interest followed by single strand conformational polymorphism and Heteroduplex Analysis (SSCP-HA in precast 12.5% polyacrylamide gels at 7ºC and 20ºC. Fragments with abnormal SSCP migration pattern were sequenced. RESULTS: Two novel missense mutations (S753R and G149W were found in three patients (two brothers together with the IVS8-5T allele in hetrozygosis. CONCLUSION: The available screenings for CF mutations do not include the atypical mutations associated to absence of vas deferens and thus, when these tests fail to find mutations, there is still a genetic risk of affected children with the help of assisted reproduction. We recommend the screening of the whole CFTR gene for these infertile couples, as part of the work-up before assisted reproduction.OBJETIVO: Pesquisar mutações em toda a extensão do gene que causa a Fibrose Cística (CFTR de homens brasileiros inférteis por agenesia congênita dos vasos deferentes, com a finalidade de prevenir a transmissão de mutações em CFTR à prole com o uso das tecnologias de reprodução assistida. MÉTODOS: Foram desenhados oligonucleotídeos específicos para realização de reação de polimerização em cadeia (PCR para cada um dos 27 exons e sítios de processamento de interesse no gene CFTR. O PCR foi seguido pela técnica de SSCP-HA (polimorfismos de conformação no DNA de fita simples e na formação de heteroduplexes em géis pré-fabricados de poliacrilamida a 12,5% em duas temperaturas, 7ºC e 20ºC. Os fragmentos com padrão alterado na migração do SSCP foram submetidos a seqüenciamento automatizado

  11. Genomic sequencing in cystic fibrosis newborn screening: what works best, two-tier predefined CFTR mutation panels or second-tier CFTR panel followed by third-tier sequencing?

    Science.gov (United States)

    Currier, Robert J; Sciortino, Stan; Liu, Ruiling; Bishop, Tracey; Alikhani Koupaei, Rasoul; Feuchtbaum, Lisa

    2017-10-01

    PurposeThe purpose of this study was to model the performance of several known two-tier, predefined mutation panels and three-tier algorithms for cystic fibrosis (CF) screening utilizing the ethnically diverse California population.MethodsThe cystic fibrosis transmembrane conductance regulator (CFTR) mutations identified among the 317 CF cases in California screened between 12 August 2008 and 18 December 2012 were used to compare the expected CF detection rates for several two- and three-tier screening approaches, including the current California approach, which consists of a population-specific 40-mutation panel followed by third-tier sequencing when indicated.ResultsThe data show that the strategy of using third-tier sequencing improves CF detection following an initial elevated immunoreactive trypsinogen and detection of only one mutation on a second-tier panel.ConclusionIn a diverse population, the use of a second-tier panel followed by third-tier CFTR gene sequencing provides a better detection rate for CF, compared with the use of a second-tier approach alone, and is an effective way to minimize the referrals of CF carriers for sweat testing. Restricting screening to a second-tier testing to predefined mutation panels, even broad ones, results in some missed CF cases and demonstrates the limited utility of this approach in states that have diverse multiethnic populations.

  12. VHL Frameshift Mutation as Target of Nonsense-Mediated mRNA Decay in Drosophila melanogaster and Human HEK293 Cell Line

    Directory of Open Access Journals (Sweden)

    Lucia Micale

    2009-01-01

    Full Text Available There are many well-studied examples of human phenotypes resulting from nonsense or frameshift mutations that are modulated by Nonsense-Mediated mRNA Decay (NMD, a process that typically degrades transcripts containing premature termination codons (PTCs in order to prevent translation of unnecessary or aberrant transcripts. Different types of germline mutations in the VHL gene cause the von Hippel-Lindau disease, a dominantly inherited familial cancer syndrome with a marked phenotypic variability and age-dependent penetrance. By generating the Drosophila UAS:Upf1D45B line we showed the possible involvement of NMD mechanism in the modulation of the c.172delG frameshift mutation located in the exon 1 of Vhl gene. Further, by Quantitative Real-time PCR (QPCR we demonstrated that the corresponding c.163delG human mutation is targeted by NMD in human HEK 293 cells. The UAS:Upf1D45B line represents a useful system to identify novel substrates of NMD pathway in Drosophila melanogaster. Finally, we suggest the possible role of NMD on the regulation of VHL mutations.

  13. Impact of the CFTR-potentiator ivacaftor on airway microbiota in cystic fibrosis patients carrying a G551D mutation.

    Directory of Open Access Journals (Sweden)

    Cédric Bernarde

    Full Text Available Airway microbiota composition has been clearly correlated with many pulmonary diseases, and notably with cystic fibrosis (CF, an autosomal genetic disorder caused by mutation in the CF transmembrane conductance regulator (CFTR. Recently, a new molecule, ivacaftor, has been shown to re-establish the functionality of the G551D-mutated CFTR, allowing significant improvement in lung function.The purpose of this study was to follow the evolution of the airway microbiota in CF patients treated with ivacaftor, using quantitative PCR and pyrosequencing of 16S rRNA amplicons, in order to identify quantitative and qualitative changes in bacterial communities. Three G551D children were followed up longitudinally over a mean period of more than one year covering several months before and after initiation of ivacaftor treatment.129 operational taxonomy units (OTUs, representing 64 genera, were identified. There was no significant difference in total bacterial load before and after treatment. Comparison of global community composition found no significant changes in microbiota. Two OTUs, however, showed contrasting dynamics: after initiation of ivacaftor, the relative abundance of the anaerobe Porphyromonas 1 increased (p<0.01 and that of Streptococcus 1 (S. mitis group decreased (p<0.05, possibly in relation to the anti-Gram-positive properties of ivacaftor. The anaerobe Prevotella 2 correlated positively with the pulmonary function test FEV-1 (r=0.73, p<0.05. The study confirmed the presumed positive role of anaerobes in lung function.Several airway microbiota components, notably anaerobes (obligate or facultative anaerobes, could be valuable biomarkers of lung function improvement under ivacaftor, and could shed light on the pathophysiology of lung disease in CF patients.

  14. Lumacaftor/ivacaftor, a novel agent for the treatment of cystic fibrosis patients who are homozygous for the F580del CFTR mutation.

    Science.gov (United States)

    Bulloch, Marilyn N; Hanna, Cameron; Giovane, Richard

    2017-10-01

    Cystic Fibrosis (CF) is an autosomal recessive disease affecting up to 90,000 people worldwide. Approximately 73% of patients are homozygous for the F508del cystic fibrosis transmembrane conductance regulator [CFTR] mutation. Traditionally treatment has only included supportive care. Therefore, there is a need for safe and effective novel therapies targeting the underlying molecular defects seen with CF. Areas covered: In 2016, the Food and Drug Administration and the European Commission approved LUM/IVA (Orkambi), a CFTR modulator that includes both a CFTR corrector and potentiator, for CF patients homozygous for the F508del CFTR mutation. This article reviews the pharmacologic features, clinical efficacy, and safety of LUM/IVA and summarize the available pre-clinical and clinical data of LUM/IVA use. Expert commentary: LUM/IVA showed modest, but significant improvements from baseline in percent predicted FEV 1 (ppFEV 1 ) as well as a reduction in pulmonary exacerbations by 35% It was shown to be safe for short- and long-term use. Currently, LUM/IVA is the only oral agent in its class available and represents a milestone the development of therapies for the management of CF. Nonetheless, pharmacoeconomic data are necessary to justify its high cost before is use becomes standard of care.

  15. A Frameshift Mutation in the Cubilin Gene (CUBN) in Border Collies with Imerslund-Gräsbeck Syndrome (Selective Cobalamin Malabsorption)

    Science.gov (United States)

    Owczarek-Lipska, Marta; Jagannathan, Vidhya; Drögemüller, Cord; Lutz, Sabina; Glanemann, Barbara

    2013-01-01

    Imerslund-Gräsbeck syndrome (IGS) or selective cobalamin malabsorption has been described in humans and dogs. IGS occurs in Border Collies and is inherited as a monogenic autosomal recessive trait in this breed. Using 7 IGS cases and 7 non-affected controls we mapped the causative mutation by genome-wide association and homozygosity mapping to a 3.53 Mb interval on chromosome 2. We re-sequenced the genome of one affected dog at ∼10× coverage and detected 17 non-synonymous variants in the critical interval. Two of these non-synonymous variants were in the cubilin gene (CUBN), which is known to play an essential role in cobalamin uptake from the ileum. We tested these two CUBN variants for association with IGS in larger cohorts of dogs and found that only one of them was perfectly associated with the phenotype. This variant, a single base pair deletion (c.8392delC), is predicted to cause a frameshift and premature stop codon in the CUBN gene. The resulting mutant open reading frame is 821 codons shorter than the wildtype open reading frame (p.Q2798Rfs*3). Interestingly, we observed an additional nonsense mutation in the MRC1 gene encoding the mannose receptor, C type 1, which was in perfect linkage disequilibrium with the CUBN frameshift mutation. Based on our genetic data and the known role of CUBN for cobalamin uptake we conclude that the identified CUBN frameshift mutation is most likely causative for IGS in Border Collies. PMID:23613799

  16. The molecular analysis of mutations in exons 4, 11 and 21 of the cystic fibrosis transmembrane conductance regulator (CFTR gene in cystic fibrosis patients in Kermanshah, Iran

    Directory of Open Access Journals (Sweden)

    Nasibe Karimi

    2017-03-01

    Full Text Available Introduction: Cystic fibrosis (CF is a common genetic disorder in white populations with an autosomal recessive pattern, caused by mutations in the CFTR gene. The frequency of more than 1950 various mutations reported in the CFTR gene significantly varies in different populations. ∆F508 is a common mutation in exon 10, which is first addressed in the molecular analysis of the disease. Other exons are required to be investigated owing to failing to identify mutations in the patients. The present study was conducted to investigate mutations in exons 4, 11 and 21 of the CFTR gene using the sequencing method in CF patients in Kermanshah province, Iran. Methods: The present descriptive study was conducted on all patients with CF presenting to the medical genetics center in Kermanshah in 2010-2011. After taking blood samples and extracting DNA using saturated NaCl solution, sequences of exons were amplified using PCR and sequenced for identifying mutations. Results: The frequency of mutations was found to be respectively 0, 0 and 5.5% in exon 11, 21 and 4. The D110H mutation was found to be homozygous in one subject and heterozygous in another. Moreover, the 4029A>G polymorphism (12.9% was found to be homozygous in two subjects and heterozygous in three others. Conclusion: The D110H mutation is recommended to be included in the screening programs of the study population. The results obtained support the effects of ethnic and geographical factors on the distribution of CF mutations.

  17. Ghrelin gene: identification of missense variants and a frameshift mutation in extremely obese children and adolescents and healthy normal weight students.

    Science.gov (United States)

    Hinney, Anke; Hoch, Anne; Geller, Frank; Schäfer, Helmut; Siegfried, Wolfgang; Goldschmidt, Hanspeter; Remschmidt, Helmut; Hebebrand, Johannes

    2002-06-01

    Ghrelin induces obesity via central and peripheral mechanisms. Administration of ghrelin leads to increased food intake and decreased fat utilisation in rodents. Ghrelin levels are decreased in obese individuals. Recently, a polymorphism (Arg-51-Gln) within the ghrelin gene (GHRL) was described to be associated with obesity. We screened the GHRL coding region in 215 extremely obese German Children and adolescents (study group 1) and 93 normal weight students (study group 2) by single strand conformation polymorphism analysis (SSCP). We found the two previously described single nucleotide polymorphisms (SNP: Arg-51-Gln and Leu-72-Met) in similar frequencies in study groups 1 and 2 (allele frequencies were: 0.019 and 0.016 for the 51-Gln allele and 0.091 and 0.086 for the 72-Met allele, respectively). Hence, we could not confirm the previous finding. Additionally, two novel variants were identified within the coding region: (1) We detected one healthy normal weight individual with a frameshift mutation (2bp deletion at codon 34). This frameshift mutation affects the coding region of the mature ghrelin. Hence, it is highly likely that the normal weight student is haplo-insufficient for ghrelin. (2) An A to T transversion leads to an amino acid exchange from Gln to Leu at amino acid position 90. The frequency of the 90-Leu allele was significantly higher in the extremely obese children and adolescents (0.063) than in the normal weight students (0.016; nominal p = 0.011). Additionally, we genotyped 134 underweight students and 44 normal weight adults for this SNP. Genotype frequencies were similar in extremely obese children and adolescents, underweight students and normal weight adults (p > 0.8). In conclusion, we identified four sequence variants in the coding region of the ghrelin gene in individuals belonging to different weight extremes. A frameshift mutation was detected in a normal weight individual. None of the variants seem to influence weight regulation.

  18. Naturally Occurring Frameshift Mutations in the tvb Receptor Gene Are Responsible for Decreased Susceptibility of Chicken to Infection with Avian Leukosis Virus Subgroups B, D, and E.

    Science.gov (United States)

    Li, Xinjian; Chen, Weiguo; Zhang, Huanmin; Li, Aijun; Shu, Dingming; Li, Hongxing; Dai, Zhenkai; Yan, Yiming; Zhang, Xinheng; Lin, Wencheng; Ma, Jingyun; Xie, Qingmei

    2018-04-15

    The group of highly related avian leukosis viruses (ALVs) in chickens are thought to have evolved from a common retroviral ancestor into six subgroups, A to E and J. These ALV subgroups use diverse cellular proteins encoded by four genetic loci in chickens as receptors to gain entry into host cells. Hosts exposed to ALVs might be under selective pressure to develop resistance to ALV infection. Indeed, resistance alleles have previously been identified in all four receptor loci in chickens. The tvb gene encodes a receptor, which determines the susceptibility of host cells to ALV subgroup B (ALV-B), ALV-D, and ALV-E. Here we describe the identification of two novel alleles of the tvb receptor gene, which possess independent insertions each within exon 4. The insertions resulted in frameshift mutations that reveal a premature stop codon that causes nonsense-mediated decay of the mutant mRNA and the production of truncated Tvb protein. As a result, we observed that the frameshift mutations in the tvb gene significantly lower the binding affinity of the truncated Tvb receptors for the ALV-B, ALV-D, and ALV-E envelope glycoproteins and significantly reduce susceptibility to infection by ALV-B, ALV-D and ALV-E in vitro and in vivo Taken together, these findings suggest that frameshift mutation can be a molecular mechanism of reducing susceptibility to ALV and enhance our understanding of virus-host coevolution. IMPORTANCE Avian leukosis virus (ALV) once caused devastating economic loss to the U.S. poultry industry prior the current eradication schemes in place, and it continues to cause severe calamity to the poultry industry in China and Southeast Asia, where deployment of a complete eradication scheme remains a challenge. The tvb gene encodes the cellular receptor necessary for subgroup B, D, and E ALV infection. Two tvb allelic variants that resulted from frameshift mutations have been identified in this study, which have been shown to have significantly reduced

  19. A novel frameshift mutation of SMPX causes a rare form of X-linked nonsyndromic hearing loss in a Chinese family.

    Directory of Open Access Journals (Sweden)

    Zhijie Niu

    Full Text Available X-linked hearing impairment is the rarest form of genetic hearing loss (HL and represents only a minor fraction of all cases. The aim of this study was to investigate the cause of X-linked inherited sensorineural HL in a four-generation Chinese family. A novel duplication variant (c.217dupA, p.Ile73Asnfs*5 in SMPX was identified by whole-exome sequencing. The frameshift mutation predicted to result in the premature truncation of the SMPX protein was co-segregated with the HL phenotype and was absent in 295 normal controls. Subpopulation screening of the coding exons and flanking introns of SMPX was further performed for 338 Chinese patients with nonsydromic HL by Sanger sequencing, and another two potential causative substitutions (c.238C>A and c.55A>G in SMPX were identified in additional sporadic cases of congenital deafness. Collectively, this study is the first to report the role of SMPX in Chinese population and identify a novel frameshift mutation in SMPX that causes not only nonsyndromic late-onset progressive HL, but also congenital hearing impairment. Our findings extend the mutation and phenotypic spectrum of the SMPX gene.

  20. Postmortem diagnosis of Marfan syndrome in a case of sudden death due to aortic rupture: Detection of a novel FBN1 frameshift mutation.

    Science.gov (United States)

    Wang, Yunyun; Chen, Shu; Wang, Rongshuai; Huang, Sizhe; Yang, Mingzhen; Liu, Liang; Liu, Qian

    2016-04-01

    To investigate the sudden death of a 36-year-old Chinese man, a medicolegal autopsy was performed, combining forensic pathological examinations and genetic sequencing analysis to diagnose the cause of death. Genomic DNA samples were extracted from blood and subjected to high-throughput sequencing. Major findings included a dilated aortic root with a ruptured and dissected aorta and consequent tamponade of the pericardial sac. Moreover, arachnodactyly and other skeletal deformities were noted. By sequencing the fibrillin-1 gene (FBN1), five genetic variations were found, including four previously known single nucleotide polymorphisms (SNPs) and a novel frameshift mutation, leading to the diagnosis of Marfan syndrome. The frameshift mutation (c.4921delG, p.glu1641llysFsX9) detected in exon 40 led to a stop codon after the next 8 amino acids. The four SNPs included a splice site mutation (c.3464-5 G>A, rs11853943), a synonymous mutation (p.Asn625Asn, rs25458), and two missense mutations (p.Pro1148Ala, rs140598; p.Cys472Tyr, rs4775765). Genetic screening was recommended for the relatives as it was reported that the father and brother of the deceased had died at the ages of 40 and 25, respectively, from sudden cardiac failure. The son of the deceased lacked the relevant mutations. This report emphasizes the important contribution of medicolegal postmortem analysis on the molecular pathogenesis study of Marfan syndrome and early diagnosis of at-risk relatives. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Cysteamine re-establishes the clearance of Pseudomonas aeruginosa by macrophages bearing the cystic fibrosis-relevant F508del-CFTR mutation.

    Science.gov (United States)

    Ferrari, Eleonora; Monzani, Romina; Villella, Valeria R; Esposito, Speranza; Saluzzo, Francesca; Rossin, Federica; D'Eletto, Manuela; Tosco, Antonella; De Gregorio, Fabiola; Izzo, Valentina; Maiuri, Maria C; Kroemer, Guido; Raia, Valeria; Maiuri, Luigi

    2017-01-12

    Cystic fibrosis (CF), the most common lethal monogenic disease in Caucasians, is characterized by recurrent bacterial infections and colonization, mainly by Pseudomonas aeruginosa, resulting in unresolved airway inflammation. CF is caused by mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which functions as a chloride channel in epithelial cells, macrophages, and other cell types. Impaired bacterial handling by macrophages is a feature of CF airways, although it is still debated how defective CFTR impairs bacterial killing. Recent evidence indicates that a defective autophagy in CF macrophages leads to alterations of bacterial clearance upon infection. Here we use bone marrow-derived macrophages from transgenic mice to provide the genetic proof that defective CFTR compromises both uptake and clearance of internalized Pseudomonas aeruginosa. We demonstrate that the proteostasis regulator cysteamine, which rescues the function of the most common F508del-CFTR mutant and hence reduces lung inflammation in CF patients, can also repair the defects of CF macrophages, thus restoring both bacterial internalization and clearance through a process that involves upregulation of the pro-autophagic protein Beclin 1 and re-establishment of the autophagic pathway. Altogether these results indicate that cysteamine restores the function of several distinct cell types, including that of macrophages, which might contribute to its beneficial effects on CF.

  2. A novel frameshift GRN mutation results in frontotemporal lobar degeneration with a distinct clinical phenotype in two siblings: case report and literature review.

    Science.gov (United States)

    Hosaka, Takashi; Ishii, Kazuhiro; Miura, Takeshi; Mezaki, Naomi; Kasuga, Kensaku; Ikeuchi, Takeshi; Tamaoka, Akira

    2017-09-15

    Progranulin gene (GRN) mutations are major causes of frontotemporal lobar degeneration. To date, 68 pathogenic GRN mutations have been identified. However, very few of these mutations have been reported in Asians. Moreover, some GRN mutations manifest with familial phenotypic heterogeneity. Here, we present a novel GRN mutation resulting in frontotemporal lobar degeneration with a distinct clinical phenotype, and we review reports of GRN mutations associated with familial phenotypic heterogeneity. We describe the case of a 74-year-old woman with left frontotemporal lobe atrophy who presented with progressive anarthria and non-fluent aphasia. Her brother had been diagnosed with corticobasal syndrome (CBS) with right-hand limb-kinetic apraxia, aphasia, and a similar pattern of brain atrophy. Laboratory blood examinations did not reveal abnormalities that could have caused cognitive dysfunction. In the cerebrospinal fluid, cell counts and protein concentrations were within normal ranges, and concentrations of tau protein and phosphorylated tau protein were also normal. Since similar familial cases due to mutation of GRN and microtubule-associated protein tau gene (MAPT) were reported, we performed genetic analysis. No pathological mutations of MAPT were identified, but we identified a novel GRN frameshift mutation (c.1118_1119delCCinsG: p.Pro373ArgX37) that resulted in progranulin haploinsufficiency. This is the first report of a GRN mutation associated with familial phenotypic heterogeneity in Japan. Literature review of GRN mutations associated with familial phenotypic heterogeneity revealed no tendency of mutation sites. The role of progranulin has been reported in this and other neurodegenerative diseases, and the analysis of GRN mutations may lead to the discovery of a new therapeutic target.

  3. UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

    Science.gov (United States)

    Lawrence, C W; O'Brien, T; Bond, J

    1984-01-01

    The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

  4. Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene

    Energy Technology Data Exchange (ETDEWEB)

    Mercier, B.; Audrezet, M.P.; Guillermit, H.; Quere, I.; Verlingue, C.; Ferec, C. (CDTS, Brest (France)); Lissens, W.; Bonduelle, M.; Liebaers, I. (University Hospital VUB, Brussels (Belgium)); Novelli, G.; Sangiuolo, F.; Dallapiccola, B. (IRCCS, Rotondo (Italy)); Kalaydjieva, L. (Inst. of Obstetrics, Sofia (Bulgaria)); Arce, M. De; Cashman, S. (Trinity College, Dublin (Ireland)); Kapranov, N. (NRC of medical Genetics, Moscow (Russian Federation)); Canki Klain, N. (Tozd Univerzitetna Ginekoloska Klinika, Ljubljana (Yugoslavia)); Lenoir, G. (Hopital des Enfants Malades Necker, Paris (France)); Chauveau, P. (Centre Hospitalier General, Le Havre (France)); Lanaerts, C. (Centre Hospitalier Regional et Universitaire, Amiens (France)); Rault, G. (Centre Helio-Marin, Roscoff (France))

    1993-04-01

    Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene, particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.

  5. A disease-associated frameshift mutation in caveolin-1 disrupts caveolae formation and function through introduction of a de novo ER retention signal.

    Science.gov (United States)

    Copeland, Courtney A; Han, Bing; Tiwari, Ajit; Austin, Eric D; Loyd, James E; West, James D; Kenworthy, Anne K

    2017-11-01

    Caveolin-1 (CAV1) is an essential component of caveolae and is implicated in numerous physiological processes. Recent studies have identified heterozygous mutations in the CAV1 gene in patients with pulmonary arterial hypertension (PAH), but the mechanisms by which these mutations impact caveolae assembly and contribute to disease remain unclear. To address this question, we examined the consequences of a familial PAH-associated frameshift mutation in CAV1 , P158PfsX22, on caveolae assembly and function. We show that C-terminus of the CAV1 P158 protein contains a functional ER-retention signal that inhibits ER exit and caveolae formation and accelerates CAV1 turnover in Cav1 -/- MEFs. Moreover, when coexpressed with wild-type (WT) CAV1 in Cav1 -/- MEFs, CAV1-P158 functions as a dominant negative by partially disrupting WT CAV1 trafficking. In patient skin fibroblasts, CAV1 and caveolar accessory protein levels are reduced, fewer caveolae are observed, and CAV1 complexes exhibit biochemical abnormalities. Patient fibroblasts also exhibit decreased resistance to a hypo-osmotic challenge, suggesting the function of caveolae as membrane reservoir is compromised. We conclude that the P158PfsX22 frameshift introduces a gain of function that gives rise to a dominant negative form of CAV1, defining a new mechanism by which disease-associated mutations in CAV1 impair caveolae assembly. © 2017 Copeland, Han, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  6. Frameshift Mutation in KIT is Associated with  White Spotting in the Arabian Camel

    Directory of Open Access Journals (Sweden)

    Heather Holl

    2017-03-01

    Full Text Available While the typical Arabian camel is characterized by a single colored coat, there are rare populations with white spotting patterns. White spotting coat patterns are found in virtually all domesticated species, but are rare in wild species. Theories suggest that white spotting is linked to the domestication process, and is occasionally associated with health disorders. Though mutations have been found in a diverse array of species, fewer than 30 genes have been associated with spotting patterns, thus providing a key set of candidate genes for the Arabian camel. We obtained 26 spotted camels and 24 solid controls for candidate gene analysis. One spotted and eight solid camels were whole genome sequenced as part of a separate project. The spotted camel was heterozygous for a frameshift deletion in KIT (c.1842delG, named KITW1 for White spotting 1, whereas all other camels were wild‐type (KIT+/KIT+. No additional mutations unique to the spotted camel were detected in the EDNRB, EDN3, SOX10, KITLG, PDGFRA, MITF, and PAX3 candidate white spotting genes. Sanger sequencing of the study population identified an additional five kITW1/KIT+ spotted camels. The frameshift results in a premature stop codon five amino acids downstream, thus terminating KIT at the tyrosine kinase domain. An additional 13 spotted camels tested KIT+/KIT+, but due to phenotypic differences when compared to the KITW1/KIT+ camels, they likely represent an independent mutation. Our study suggests that there are at least two causes of white spotting in the Arabian camel, the newly described KITW1 allele and an uncharacterized mutation.

  7. Epistatic participation of REV1 and REV3 in the formation of UV-induced frameshift mutations in cell cycle-arrested yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Heidenreich, Erich [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)]. E-mail: erich.heidenreich@meduniwien.ac.at; Eisler, Herfried [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria); Steinboeck, Ferdinand [Institute of Cancer Research, Department of Medicine I, Medical University of Vienna, Borschkegasse 8a, A-1090 Vienna (Austria)

    2006-01-29

    Mutations arising in times of cell cycle arrest may provide a selective advantage for unicellular organisms adapting to environmental changes. For multicellular organisms, however, they may pose a serious threat, in that such mutations in somatic cells contribute to carcinogenesis and ageing. The budding yeast Saccharomyces cerevisiae presents a convenient model system for studying the incidence and the mechanisms of stationary-phase mutation in a eukaryotic organism. Having studied the emergence of frameshift mutants after several days of starvation-induced cell cycle arrest, we previously reported that all (potentially error-prone) translesion synthesis (TLS) enzymes identified in S. cerevisiae did not contribute to the basal level of spontaneous stationary-phase mutations. However, we observed that an increased frequency of stationary-phase frameshift mutations, brought about by a defective nucleotide excision repair (NER) pathway or by UV irradiation, was dependent on Rev3p, the catalytic subunit of the TLS polymerase zeta (Pol {zeta}). Employing the same two conditions, we now examined the effect of deletions of the genes coding for polymerase eta (Pol {eta}) (RAD30) and Rev1p (REV1). In a NER-deficient strain background, the increased incidence of stationary-phase mutations was only moderately influenced by a lack of Pol {eta} but completely reduced to wild type level by a knockout of the REV1 gene. UV-induced stationary-phase mutations were abundant in wild type and rad30{delta} strains, but substantially reduced in a rev1{delta} as well as a rev3{delta} strain. The similarity of the rev1{delta} and the rev3{delta} phenotype and an epistatic relationship evident from experiments with a double-deficient strain suggests a participation of Rev1p and Rev3p in the same mutagenic pathway. Based on these results, we propose that the response of cell cycle-arrested cells to an excess of exo- or endogenously induced DNA damage includes a novel replication

  8. Molecular characterization of WFS1 in an Iranian family with Wolfram syndrome reveals a novel frameshift mutation associated with early symptoms.

    Science.gov (United States)

    Sobhani, Maryam; Tabatabaiefar, Mohammad Amin; Rajab, Asadollah; Kajbafzadeh, Abdol-Mohammad; Noori-Daloii, Mohammad Reza

    2013-10-10

    Wolfram syndrome (WS) is a rare autosomal recessive neurodegenerative disorder that represents a likely source of childhood diabetes especially among countries in the consanguinity belt. The main responsible gene is WFS1 for which over one hundred mutations have been reported from different ethnic groups. The aim of this study was to identify the molecular etiology of WS and to perform a possible genotype-phenotype correlation in Iranian kindred. An Iranian family with two patients was clinically studied and WS was suspected. Genetic linkage analysis via 5 STR markers was carried out. For identification of mutations, DNA sequencing of WFS1 including all the exons, exon-intron boundaries and the promoter was performed. Linkage analysis indicated linkage to the WFS1 region. After DNA sequencing of WFS1, one novel pathogenic mutation, which causes frameshift alteration c.2177_2178insTCTTC (or c.2173_2177dupTCTTC) in exon eight, was found. The genotype-phenotype correlation analysis suggests that the presence of the homozygous mutation may be associated with early onset of disease symptoms. This study stresses the necessity of considering the molecular analysis of WFS1 in childhood diabetes with some symptoms of WS. © 2013 Elsevier B.V. All rights reserved.

  9. Early-progressive dilated cardiomyopathy in a family with Becker muscular dystrophy related to a novel frameshift mutation in the dystrophin gene exon 27.

    Science.gov (United States)

    Tsuda, Takeshi; Fitzgerald, Kristi; Scavena, Mena; Gidding, Samuel; Cox, Mary O; Marks, Harold; Flanigan, Kevin M; Moore, Steven A

    2015-03-01

    We report a family in which two male siblings with Becker muscular dystrophy (BMD) developed severe dilated cardiomyopathy (DCM) and progressive heart failure (HF) at age 11 years; one died at age 14 years while awaiting heart transplant and the other underwent left ventricular assist device implantation at the same age. Genetic analysis of one sibling showed a novel frameshift mutation in exon 27 of Duchenne muscular dystrophy (DMD) gene (c.3779_3785delCTTTGGAinsGG), in which seven base pairs are deleted and two are inserted. Although this predicts an amino-acid substitution and premature termination (p.Thr1260Argfs*8), muscle biopsy dystrophin immunostaining instead indicates that the mutation is more likely to alter splicing. Despite relatively preserved skeletal muscular performance, both the siblings developed progressive HF secondary to early-onset DCM. In addition, their 7-year-old nephew with delayed gross motor development, mild proximal muscle weakness and markedly elevated serum creatine kinase level (>13 000 IU l(-1)) at 16 months was recently demonstrated to have the familial DMD mutation. Here, we report a novel genotype of BMD with early-onset DCM and progressive lethal HF during early adolescence.

  10. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    Science.gov (United States)

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Incidence and Carrier Frequency of CFTR Gene Mutations in Pregnancies With Echogenic Bowel in Nova Scotia and Prince Edward Island.

    Science.gov (United States)

    Miller, Michelle E; Allen, Victoria M; Brock, Jo-Ann K

    2018-03-01

    Fetal echogenic bowel (echogenic bowel) is associated with cystic fibrosis (CF), with a reported incidence ranging from 1% to 13%. Prenatal testing for CF in the setting of echogenic bowel can be done by screening parental or fetal samples for pathogenic CFTR variants. If only one pathogenic variant is identified, sequencing of the CFTR gene can be undertaken, to identify a second pathogenic variant not covered in the standard screening panel. Full gene sequencing, however, also introduces the potential to identify variants of uncertain significance (VUSs) that can create counselling challenges and cause parental anxiety. To provide accurate counselling for families in the study population, the incidence of CF associated with echogenic bowel and the carrier frequency of CFTR variants were investigated. All pregnancies for which CF testing was undertaken for the indication of echogenic bowel (from Nova Scotia and Prince Edward Island) were identified (January 2007-July 2017). The CFTR screening and sequencing results were reviewed, and fetal outcomes related to CF were assessed. A total of 463 pregnancies with echogenic bowel were tested. Four were confirmed to be affected with CF, giving an incidence of 0.9% in this cohort. The carrier frequency of CF among all parents in the cohort was 5.0% (1 in 20); however, when excluding parents of affected fetuses, the carrier frequency for the population was estimated at 4.1% (1 in 25). CFTR gene sequencing identified an additional VUS in two samples. The incidence of CF in pregnancies with echogenic bowel in Nova Scotia and Prince Edward Island is 0.9%, with an estimated population carrier frequency of 4.1%. These results provide the basis for improved counselling to assess the risk of CF in the pregnancy, after parental carrier screening, using Bayesian probability. Counselling regarding VUSs should be undertaken before gene sequencing. Copyright © 2017 Society of Obstetricians and Gynaecologists of Canada. Published by

  12. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome.

    Science.gov (United States)

    Amiel, Jeanne; Laudier, Béatrice; Attié-Bitach, Tania; Trang, Ha; de Pontual, Loïc; Gener, Blanca; Trochet, Delphine; Etchevers, Heather; Ray, Pierre; Simonneau, Michel; Vekemans, Michel; Munnich, Arnold; Gaultier, Claude; Lyonnet, Stanislas

    2003-04-01

    Congenital central hypoventilation syndrome (CCHS or Ondine's curse; OMIM 209880) is a life-threatening disorder involving an impaired ventilatory response to hypercarbia and hypoxemia. This core phenotype is associated with lower-penetrance anomalies of the autonomic nervous system (ANS) including Hirschsprung disease and tumors of neural-crest derivatives such as ganglioneuromas and neuroblastomas. In mice, the development of ANS reflex circuits is dependent on the paired-like homeobox gene Phox2b. Thus, we regarded its human ortholog, PHOX2B, as a candidate gene in CCHS. We found heterozygous de novo mutations in PHOX2B in 18 of 29 individuals with CCHS. Most mutations consisted of 5-9 alanine expansions within a 20-residue polyalanine tract probably resulting from non-homologous recombination. We show that PHOX2B is expressed in both the central and the peripheral ANS during human embryonic development. Our data support an essential role of PHOX2B in the normal patterning of the autonomous ventilation system and, more generally, of the ANS in humans.

  13. Juvenile-onset Sporadic Amyotrophic Lateral Sclerosis with a Frameshift FUS Gene Mutation Presenting Unique Neuroradiological Findings and Cognitive Impairment.

    Science.gov (United States)

    Hirayanagi, Kimitoshi; Sato, Masayuki; Furuta, Natsumi; Makioka, Kouki; Ikeda, Yoshio

    2016-01-01

    A 24-year-old Japanese woman developed anterocollis, weakness of the proximal arms, and subsequent cognitive impairment. A neurological examination revealed amyotrophic lateral sclerosis (ALS) without a family history. Systemic muscle atrophy progressed rapidly. Cerebral MRI clearly exhibited high signal intensities along the bilateral pyramidal tracts. An analysis of the FUS gene revealed a heterozygous two-base pair deletion, c.1507-1508delAG (p.G504WfsX515). A subset of juvenile-onset familial/sporadic ALS cases with FUS gene mutations reportedly demonstrates mental retardation or learning difficulty. Our study emphasizes the importance of conducting a FUS gene analysis in juvenile-onset ALS cases, even when no family occurrence is confirmed.

  14. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 2; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Shamsudheen Karuthedath Vellarikkal

    2016-07-01

    Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

  15. Case Report: Whole exome sequencing reveals a novel frameshift deletion mutation p.G2254fs in COL7A1 associated with autosomal recessive dystrophic epidermolysis bullosa [version 1; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Shamsudheen Karuthedath Vellarikkal

    2016-05-01

    Full Text Available Dystrophic epidermolysis bullosa simplex (DEB is a phenotypically diverse inherited skin fragility disorder. It is majorly manifested by appearance of epidermal bullae upon friction caused either by physical or environmental trauma. The phenotypic manifestations also include appearance of milia, scarring all over the body and nail dystrophy. DEB can be inherited in a recessive or dominant form and the recessive form of DEB (RDEB is more severe. In the present study, we identify a novel p.G2254fs mutation in COL7A1 gene causing a sporadic case of RDEB by whole exome sequencing (WES. Apart from adding a novel frameshift Collagen VII mutation to the repertoire of known mutations reported in the disease, to the best of our knowledge, this is the first report of a genetically characterized case of DEB from India.

  16. Identification of the CFTR c.1666A>G Mutation in Hereditary Inclusion Body Myopathy Using Next-Generation Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    Yan Lu

    2018-05-01

    Full Text Available Hereditary inclusion body myopathy (HIBM is a rare autosomal recessive adult onset muscle disease which affects one to three individuals per million worldwide. This disease is autosomal dominant and occurs in adulthood. Our previous study reported a new subtype of HIBM linked to the susceptibility locus at 7q22.1-31.1. The present study is aimed to identify the candidate gene responsible for the phenotype in HIBM pedigree. After multipoint linkage analysis, we performed targeted capture sequencing on 16 members and whole-exome sequencing (WES on 5 members. Bioinformatics filtering was performed to prioritize the candidate pathogenic gene variants, which were further genotyped by Sanger sequencing. Our results showed that the highest peak of LOD score (4.70 was on chromosome 7q22.1-31.1.We identified 2 and 22 candidates using targeted capture sequencing and WES respectively, only one of which as CFTRc.1666A>G mutation was well cosegregated with the HIBM phenotype. Using transcriptome analysis, we did not detect the differences of CFTR's mRNA expression in the proband compared with healthy members. Due to low incidence of HIBM and there is no other pedigree to assess, mutation was detected in three patients with duchenne muscular dystrophyn (DMD and five patients with limb-girdle muscular dystrophy (LGMD. And we found that the frequency of mutation detected in DMD and LGMD patients was higher than that of being expected in normal population. We suggested that the CFTRc.1666A>G may be a candidate marker which has strong genetic linkage with the causative gene in the HIBM family.

  17. Introducing a frameshift mutation to the POL sequence of HIV-1 provirus and evaluation of the immunogenic characteristics of the mutated virions (RINNL4-3).

    Science.gov (United States)

    Zabihollahi, Rezvan; Sadat, Seyed Mehdi; Vahabpour, Rouhollah; Salehi, Mansoor; Azadmanesh, Kayhan; Siadat, Seyed Davar; Saraji, Ali Reza Azizi; Pouriavali, Mohamamd Hassan; Momen, Seyed Bahman; Aghasadeghi, Mohamad Reza

    2012-01-01

    Inactivation of the reverse transcriptase (RT) and integrase (IN) enzymes can abolish the replication of the human immunodeficiency virus (HIV) and, thus, its infectivity. Here, inactivated HIV particles convenient for designing virus-like particle (VLP) based vaccines have been produced. Inactivated HIV-provirus was created by introducing a frame shift mutation. HIV provirus DNA was cut in the pol region by Age I restriction enzyme, followed by filling of sticky ends using the Klenow fragment before ligation. The resulting plasmid was named as pRINNL4-3. HEK-293T cells were used as producer, after being transfected with the modified plasmid. Viral particle production and biological activity were assayed by virus capsid protein (p24) quantification and syncytium formation in MT2 cells, respectively. The immunogenicity of the RINNL4-3 virions was investigated in a mouse model. The mutation was expected to inactivate the virus RT and IN enzymes. The results showed that the VLPs were assembled, as measured by the p24 load of the culture supernatant, and contained functional envelope proteins (Env) as monitored by the syncytium formation. However, these VLPs had no ability to infect target MT2 cells, as well as their VSVG (vesicular stomatitis virus-glycoprotein) pseudotyped counterparts infected HEK-293T cells. A high level of antibody response was observed in immunized mice. Since RINNL4-3 virions are replication incompetent, they are convenient for production and use in biomedical studies. Also, RINNL4-3 is a candidate for a vaccine development due to it contains envelope and structural virus proteins which are crucial for triggering neutralizing antibodies and the cellular immune response.

  18. N1303K (c.3909C>G) Mutation and Splicing: Implication of Its c.[744-33GATT(6); 869+11C>T] Complex Allele in CFTR Exon 7 Aberrant Splicing

    Science.gov (United States)

    Farhat, Raëd; Puissesseau, Géraldine; El-Seedy, Ayman; Pasquet, Marie-Claude; Adolphe, Catherine; Corbani, Sandra; Megarbané, André; Kitzis, Alain; Ladeveze, Véronique

    2015-01-01

    Cystic Fibrosis is the most common recessive autosomal rare disease found in Caucasians. It is caused by mutations on the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) that encodes a protein located on the apical membrane of epithelial cells. c.3909C>G (p.Asn1303Lys, old nomenclature: N1303K) is one of the most common worldwide mutations. This mutation has been found at high frequencies in the Mediterranean countries with the highest frequency in the Lebanese population. Therefore, on the genetic level, we conducted a complete CFTR gene screening on c.3909C>G Lebanese patients. The complex allele c.[744-33GATT(6); 869+11C>T] was always associated with the c.3909C>G mutation in cis in the Lebanese population. In cellulo splicing studies, realized by hybrid minigene constructs, revealed no impact of the c.3909C>G mutation on the splicing process, whereas the associated complex allele induces minor exon skipping. PMID:26075213

  19. Mutations in CFTR gene and clinical correlation in Argentine patients with congenital bilateral absence of the vas deferens Correlación de las características clínicas con mutaciones del gen CFTR en pacientes argentinos con ausencia bilateral congénita de vasos deferentes

    Directory of Open Access Journals (Sweden)

    Estrella M Levy

    2004-06-01

    Full Text Available Congenital bilateral absence of the vas deferens (CBAVD is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR gene have been identified. Here we identify different mutations of CFTR and the poly-T variant of intron 8 (IVS8 in Argentine patients and analyze sweat test values and clinical characteristic related to Cystic Fibrosis (CF. For counseling purposes the two most frequent mutations in Argentine CF population: DF508 and G542X were screened in wives. In all cases, it was possible to reduce the risk of CF/CBAVD descendants in these couples because none of the mutation were found in the 36 samples. Eight patients (23% showed abnormal chloride values (> 60 mmol/l. A second group of 6 patients (18% had borderline values of sweat chloride (40-59 mmol/l. We defined another group with 6 patients (18%, with normal sweat chloride levels (30-39 mmo/l and a fourth group of 14 (41% patients with sweat chloride below 30 mmol/l. DF508, the most frequent CF mutation in the Argentine population, was found on 15 of the 72 chromosomes (21%, R117H mutation was detected on 2 of 62 chromosomes (3%. Only one R347P allele was found on 28 chromosomes analyzed (2%. On a sample of 27 patients, IVS8 analysis showed a frequency of 6/56 chromosomes (11% of 5T allele. Even though these findings present an improvement in the detection of mutations related to clinical correlations in Argentine CBAVD population, the search for other common and uncommon mutations should be continued.La ausencia bilateral congénita de vasos deferentes (CBAVD es una forma de infertilidad masculina en la que se han identificado mutaciones en el gen de la conductancia transmembrana de la fibrosis quística (CFTR. Hemos estudiado en pacientes argentinos diferentes mutaciones en el CFTR y la variante poli T del intron 8 (IVS8 y analizado los valores de test del sudor y las características clínicas relacionadas a la Fibrosis Qu

  20. Mechanisms of CFTR Functional Variants That Impair Regulated Bicarbonate Permeation and Increase Risk for Pancreatitis but Not for Cystic Fibrosis

    OpenAIRE

    LaRusch, Jessica; Jung, Jinsei; General, Ignacio J.; Lewis, Michele D.; Park, Hyun Woo; Brand, Randall E.; Gelrud, Andres; Anderson, Michelle A.; Banks, Peter A.; Conwell, Darwin; Lawrence, Christopher; Romagnuolo, Joseph; Baillie, John; Alkaade, Samer; Cote, Gregory

    2014-01-01

    CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev ) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize tha...

  1. EG-VEGF, BV8, and their receptor expression in human bronchi and their modification in cystic fibrosis: Impact of CFTR mutation (delF508).

    Science.gov (United States)

    Chauvet, Sylvain; Traboulsi, Wael; Thevenon, Laura; Kouadri, Amal; Feige, Jean-Jacques; Camara, Boubou; Alfaidy, Nadia; Benharouga, Mohamed

    2015-08-01

    Enhanced lung angiogenesis has been reported in cystic fibrosis (CF). Recently, two highly homologous ligands, endocrine gland vascular endothelial growth factor (EG-VEGF) and mammalian Bv8, have been described as new angiogenic factors. Both ligands bind and activate two closely related G protein-coupled receptors, the prokineticin receptor (PROKR) 1 and 2. Yet, the expression, regulation, and potential role of EG-VEGF, BV8, and their receptors in normal and CF lung are still unknown. The expression of the receptors and their ligands was examined using molecular, biochemical, and immunocytochemistry analyses in lungs obtained from CF patients vs. control and in normal and CF bronchial epithelial cells. Cystic fibrosis transmembrane conductance regulator (CFTR) activity was evaluated in relation to both ligands, and concentrations of EG-VEGF were measured by ELISA. At the mRNA level, EG-VEGF, BV8, and PROKR2 gene expression was, respectively, approximately five, four, and two times higher in CF lungs compared with the controls. At the cellular level, both the ligands and their receptors showed elevated expressions in the CF condition. Similar results were observed at the protein level. The EG-VEGF secretion was apical and was approximately two times higher in CF compared with the normal epithelial cells. This secretion was increased following the inhibition of CFTR chloride channel activity. More importantly, EG-VEGF and BV8 increased the intracellular concentration of Ca(2+) and cAMP and stimulated CFTR-chloride channel activity. Altogether, these data suggest local roles for epithelial BV8 and EG-VEGF in the CF airway peribronchial vascular remodeling and highlighted the role of CFTR activity in both ligand biosynthesis and secretion. Copyright © 2015 the American Physiological Society.

  2. Osteoblast CFTR inactivation reduces differentiation and osteoprotegerin expression in a mouse model of cystic fibrosis-related bone disease.

    Directory of Open Access Journals (Sweden)

    Michael S Stalvey

    Full Text Available Low bone mass and increased fracture risk are recognized complications of cystic fibrosis (CF. CF-related bone disease (CFBD is characterized by uncoupled bone turnover--impaired osteoblastic bone formation and enhanced osteoclastic bone resorption. Intestinal malabsorption, vitamin D deficiency and inflammatory cytokines contribute to CFBD. However, epidemiological investigations and animal models also support a direct causal link between inactivation of skeletal cystic fibrosis transmembrane regulator (CFTR, the gene that when mutated causes CF, and CFBD. The objective of this study was to examine the direct actions of CFTR on bone. Expression analyses revealed that CFTR mRNA and protein were expressed in murine osteoblasts, but not in osteoclasts. Functional studies were then performed to investigate the direct actions of CFTR on osteoblasts using a CFTR knockout (Cftr-/- mouse model. In the murine calvarial organ culture assay, Cftr-/- calvariae displayed significantly less bone formation and osteoblast numbers than calvariae harvested from wildtype (Cftr+/+ littermates. CFTR inactivation also reduced alkaline phosphatase expression in cultured murine calvarial osteoblasts. Although CFTR was not expressed in murine osteoclasts, significantly more osteoclasts formed in Cftr-/- compared to Cftr+/+ bone marrow cultures. Indirect regulation of osteoclastogenesis by the osteoblast through RANK/RANKL/OPG signaling was next examined. Although no difference in receptor activator of NF-κB ligand (Rankl mRNA was detected, significantly less osteoprotegerin (Opg was expressed in Cftr-/- compared to Cftr+/+ osteoblasts. Together, the Rankl:Opg ratio was significantly higher in Cftr-/- murine calvarial osteoblasts contributing to a higher osteoclastogenesis potential. The combined findings of reduced osteoblast differentiation and lower Opg expression suggested a possible defect in canonical Wnt signaling. In fact, Wnt3a and PTH-stimulated canonical Wnt

  3. Applicability and Efficiency of NGS in Routine Diagnosis: In-Depth Performance Analysis of a Complete Workflow for CFTR Mutation Analysis.

    Directory of Open Access Journals (Sweden)

    Adrien Pagin

    Full Text Available Actually, about 2000 sequence variations have been documented in the CFTR gene requiring extensive and multi-step genetic testing in the diagnosis of cystic fibrosis and CFTR-related disorders. We present a two phases study, with validation and performance monitoring, of a single experiment methodology based on multiplex PCR and high throughput sequencing that allows detection of all variants, including large rearrangements, affecting the coding regions plus three deep intronic loci.A total of 340 samples, including 257 patients and 83 previously characterized control samples, were sequenced in 17 MiSeq runs and analyzed with two bioinformatic pipelines in routine diagnostic conditions. We obtained 100% coverage for all the target regions in every tested sample.We correctly identified all the 87 known variants in the control samples and successfully confirmed the 62 variants identified among the patients without observing false positive results. Large rearrangements were identified in 18/18 control samples. Only 17 patient samples showed false positive signals (6.6%, 12 of which showed a borderline result for a single amplicon. We also demonstrated the ability of the assay to detect allele specific dropout of amplicons when a sequence variation occurs at a primer binding site thus limiting the risk for false negative results.We described here the first NGS workflow for CFTR routine analysis that demonstrated equivalent diagnostic performances compared to Sanger sequencing and multiplex ligation-dependent probe amplification. This study illustrates the advantages of NGS in term of scalability, workload reduction and cost-effectiveness in combination with an improvement of the overall data quality due to the simultaneous detection of SNVs and large rearrangements.

  4. An Exon-Based Comparative Variant Analysis Pipeline to Study the Scale and Role of Frameshift and Nonsense Mutation in the Human-Chimpanzee Divergence

    Directory of Open Access Journals (Sweden)

    GongXin Yu

    2009-01-01

    important biological processes such as T cell lineage development, the pathogenesis of inflammatory diseases, and antigen induced cell death. A “less-is-more” model was previously established to illustrate the role of the gene inactivation and disruptions during human evolution. Here this analysis suggested a different model where the chimpanzee-specific exon-disrupting mutations may act as additional evolutionary force that drove the human-chimpanzee divergence. Finally, the analysis revealed a number of sequencing errors in the chimpanzee and human genome sequences and further illustrated that they could be corrected without resequencing.

  5. Alternative Splicing and Tissue-specific Elastin Misassembly Act as Biological Modifiers of Human Elastin Gene Frameshift Mutations Associated with Dominant Cutis Laxa*

    Science.gov (United States)

    Sugitani, Hideki; Hirano, Eiichi; Knutsen, Russell H.; Shifren, Adrian; Wagenseil, Jessica E.; Ciliberto, Christopher; Kozel, Beth A.; Urban, Zsolt; Davis, Elaine C.; Broekelmann, Thomas J.; Mecham, Robert P.

    2012-01-01

    Elastin is the extracellular matrix protein in vertebrates that provides elastic recoil to blood vessels, the lung, and skin. Because the elastin gene has undergone significant changes in the primate lineage, modeling elastin diseases in non-human animals can be problematic. To investigate the pathophysiology underlying a class of elastin gene mutations leading to autosomal dominant cutis laxa, we engineered a cutis laxa mutation (single base deletion) into the human elastin gene contained in a bacterial artificial chromosome. When expressed as a transgene in mice, mutant elastin was incorporated into elastic fibers in the skin and lung with adverse effects on tissue function. In contrast, only low levels of mutant protein incorporated into aortic elastin, which explains why the vasculature is relatively unaffected in this disease. RNA stability studies found that alternative exon splicing acts as a modifier of disease severity by influencing the spectrum of mutant transcripts that survive nonsense-mediated decay. Our results confirm the critical role of the C-terminal region of tropoelastin in elastic fiber assembly and suggest tissue-specific differences in the elastin assembly pathway. PMID:22573328

  6. Targeting the intracellular environment in cystic fibrosis: restoring autophagy as a novel strategy to circumvent the CFTR defect

    Directory of Open Access Journals (Sweden)

    Valeria Rachela Villella

    2013-01-01

    Full Text Available Cystic fibrosis (CF patients harboring the most common deletion mutation of the cystic fibrosis transmembrane conductance regulator (CFTR, F508del, are poor responders to potentiators of CFTR channel activity which can be used to treat a small subset of CF patients who genetically carry plasma membrane-resident CFTR mutants. The misfolded F508del-CFTR protein is unstable in the plasma membrane even if rescued by pharmacological agents that prevent its intracellular retention and degradation. CF is a conformational disease in which defective CFTR induces an impressive derangement of general proteostasis resulting from disabled autophagy. In this review, we discuss how rescuing Beclin 1 (BECN1, a major player of autophagosome formation, either by means of direct gene transfer or indirectly by administration of proteostasis regulators, could stabilize F508del-CFTR at the plasma membrane. We focus on the relationship between the improvement of peripheral proteostasis and CFTR plasma membrane stability in F508del-CFTR homozygous bronchial epithelia or mouse lungs. Moreover, this article reviews recent preclinical evidence indicating that targeting the intracellular environment surrounding the misfolded mutant CFTR instead of protein itself could constitute an attractive therapeutic option to sensitize patients carrying the F508del-CFTR mutation to the beneficial action of CFTR potentiators on lung inflammation.

  7. Targeting the Intracellular Environment in Cystic Fibrosis: Restoring Autophagy as a Novel Strategy to Circumvent the CFTR Defect

    Science.gov (United States)

    Villella, Valeria Rachela; Esposito, Speranza; Bruscia, Emanuela M.; Maiuri, Maria Chiara; Raia, Valeria; Kroemer, Guido; Maiuri, Luigi

    2013-01-01

    Cystic fibrosis (CF) patients harboring the most common deletion mutation of the CF transmembrane conductance regulator (CFTR), F508del, are poor responders to potentiators of CFTR channel activity which can be used to treat a small subset of CF patients who genetically carry plasma membrane (PM)-resident CFTR mutants. The misfolded F508del-CFTR protein is unstable in the PM even if rescued by pharmacological agents that prevent its intracellular retention and degradation. CF is a conformational disease in which defective CFTR induces an impressive derangement of general proteostasis resulting from disabled autophagy. In this review, we discuss how rescuing Beclin 1 (BECN1), a major player of autophagosome formation, either by means of direct gene transfer or indirectly by administration of proteostasis regulators, could stabilize F508del-CFTR at the PM. We focus on the relationship between the improvement of peripheral proteostasis and CFTR PM stability in F508del-CFTR homozygous bronchial epithelia or mouse lungs. Moreover, this article reviews recent pre-clinical evidence indicating that targeting the intracellular environment surrounding the misfolded mutant CFTR instead of protein itself could constitute an attractive therapeutic option to sensitize patients carrying the F508del-CFTR mutation to the beneficial action of CFTR potentiators on lung inflammation. PMID:23346057

  8. Sweat chloride as a biomarker of CFTR activity: proof of concept and ivacaftor clinical trial data.

    Science.gov (United States)

    Accurso, Frank J; Van Goor, Fredrick; Zha, Jiuhong; Stone, Anne J; Dong, Qunming; Ordonez, Claudia L; Rowe, Steven M; Clancy, John Paul; Konstan, Michael W; Hoch, Heather E; Heltshe, Sonya L; Ramsey, Bonnie W; Campbell, Preston W; Ashlock, Melissa A

    2014-03-01

    We examined data from a Phase 2 trial {NCT00457821} of ivacaftor, a CFTR potentiator, in cystic fibrosis (CF) patients with aG551D mutation to evaluate standardized approaches to sweat chloride measurement and to explore the use of sweat chloride and nasal potential difference (NPD) to estimate CFTR activity. Sweat chloride and NPD were secondary endpoints in this placebo-controlled, multicenter trial. Standardization of sweat collection, processing,and analysis was employed for the first time. Sweat chloride and chloride ion transport (NPD) were integrated into a model of CFTR activity. Within-patient sweat chloride determinations showed sufficient precision to detect differences between dose-groups and assess ivacaftor treatment effects. Analysis of changes in sweat chloride and NPD demonstrated that patients treated with ivacaftor achieved CFTR activity equivalent to approximately 35%–40% of normal. Sweat chloride is useful in multicenter trials as a biomarker of CFTR activity and to test the effect of CFTR potentiators.

  9. Determination of CFTR densities in erythrocyte plasma membranes using recognition imaging

    Energy Technology Data Exchange (ETDEWEB)

    Ebner, Andreas; Hinterdorfer, Peter [Institute for Biophysics, University of Linz, A-4040 Linz (Austria); Nikova, Dessy; Lange, Tobias; Bruns, Reimer; Oberleithner, Hans; Schillers, Hermann [Institute of Physiology II, University of Muenster, D-48149 Muenster (Germany); Haeberle, Johannes; Falk, Sabine; Duebbers, Angelika [Department of Pediatrics, University Hospitals of Muenster, D-48149 Muenster (Germany)], E-mail: schille@uni-muenster.de

    2008-09-24

    CFTR (cystic fibrosis transmembrane conductance regulator) is a cAMP-regulated chloride (Cl{sup -}) channel that plays an important role in salt and fluid movement across epithelia. Cystic fibrosis (CF), the most common genetic disease among Caucasians, is caused by mutations in the gene encoding CFTR. The most predominant mutation, F508del, disturbs CFTR protein trafficking, resulting in a reduced number of CFTR in the plasma membrane. Recent studies indicate that CFTR is not only found in epithelia but also in human erythrocytes. Although considerable attempts have been made to quantify CFTR in cells, conclusions on numbers of CFTR molecules localized in the plasma membrane have been drawn indirectly. AFM has the power to provide the needed information, since both sub-molecular spatial resolution and direct protein recognition via antibody-antigen interaction can be observed. We performed a quantification study of the CFTR copies in erythrocyte membranes at the single molecule level, and compared the difference between healthy donors and CF patients. We detected that the number of CFTR molecules is reduced by 70% in erythrocytes of cystic fibrosis patients.

  10. Determination of CFTR densities in erythrocyte plasma membranes using recognition imaging

    International Nuclear Information System (INIS)

    Ebner, Andreas; Hinterdorfer, Peter; Nikova, Dessy; Lange, Tobias; Bruns, Reimer; Oberleithner, Hans; Schillers, Hermann; Haeberle, Johannes; Falk, Sabine; Duebbers, Angelika

    2008-01-01

    CFTR (cystic fibrosis transmembrane conductance regulator) is a cAMP-regulated chloride (Cl - ) channel that plays an important role in salt and fluid movement across epithelia. Cystic fibrosis (CF), the most common genetic disease among Caucasians, is caused by mutations in the gene encoding CFTR. The most predominant mutation, F508del, disturbs CFTR protein trafficking, resulting in a reduced number of CFTR in the plasma membrane. Recent studies indicate that CFTR is not only found in epithelia but also in human erythrocytes. Although considerable attempts have been made to quantify CFTR in cells, conclusions on numbers of CFTR molecules localized in the plasma membrane have been drawn indirectly. AFM has the power to provide the needed information, since both sub-molecular spatial resolution and direct protein recognition via antibody-antigen interaction can be observed. We performed a quantification study of the CFTR copies in erythrocyte membranes at the single molecule level, and compared the difference between healthy donors and CF patients. We detected that the number of CFTR molecules is reduced by 70% in erythrocytes of cystic fibrosis patients

  11. Sphingosine-1-Phosphate Is a Novel Regulator of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR Activity.

    Directory of Open Access Journals (Sweden)

    Firhan A Malik

    Full Text Available The cystic fibrosis transmembrane conductance regulator (CFTR attenuates sphingosine-1-phosphate (S1P signaling in resistance arteries and has emerged as a prominent regulator of myogenic vasoconstriction. This investigation demonstrates that S1P inhibits CFTR activity via adenosine monophosphate-activated kinase (AMPK, establishing a potential feedback link. In Baby Hamster Kidney (BHK cells expressing wild-type human CFTR, S1P (1μmol/L attenuates forskolin-stimulated, CFTR-dependent iodide efflux. S1P's inhibitory effect is rapid (within 30 seconds, transient and correlates with CFTR serine residue 737 (S737 phosphorylation. Both S1P receptor antagonism (4μmol/L VPC 23019 and AMPK inhibition (80μmol/L Compound C or AMPK siRNA attenuate S1P-stimluated (i AMPK phosphorylation, (ii CFTR S737 phosphorylation and (iii CFTR activity inhibition. In BHK cells expressing the ΔF508 CFTR mutant (CFTRΔF508, the most common mutation causing cystic fibrosis, both S1P receptor antagonism and AMPK inhibition enhance CFTR activity, without instigating discernable correction. In summary, we demonstrate that S1P/AMPK signaling transiently attenuates CFTR activity. Since our previous work positions CFTR as a negative S1P signaling regulator, this signaling link may positively reinforce S1P signals. This discovery has clinical ramifications for the treatment of disease states associated with enhanced S1P signaling and/or deficient CFTR activity (e.g. cystic fibrosis, heart failure. S1P receptor/AMPK inhibition could synergistically enhance the efficacy of therapeutic strategies aiming to correct aberrant CFTR trafficking.

  12. Insulin-like growth factor 1 (IGF-1 enhances the protein expression of CFTR.

    Directory of Open Access Journals (Sweden)

    Ha Won Lee

    Full Text Available Low levels of insulin-like growth factor 1 (IGF-1 have been observed in the serum of cystic fibrosis (CF patients. However, the effects of low serum IGF-1 on the cystic fibrosis transmembrane conductance regulator (CFTR, whose defective function is the primary cause of cystic fibrosis, have not been studied. Here, we show in human cells that IGF-1 increases the steady-state levels of mature wildtype CFTR in a CFTR-associated ligand (CAL- and TC10-dependent manner; moreover, IGF-1 increases CFTR-mediated chloride transport. Using an acceptor photobleaching fluorescence resonance energy transfer (FRET assay, we have confirmed the binding of CAL and CFTR in the Golgi. We also show that CAL overexpression inhibits forskolin-induced increases in the cell-surface expression of CFTR. We found that IGF-1 activates TC10, and active TC10 alters the functional association between CAL and CFTR. Furthermore, IGF-1 and active TC10 can reverse the CAL-mediated reduction in the cell-surface expression of CFTR. IGF-1 does not increase the expression of ΔF508 CFTR, whose processing is arrested in the ER. This finding is consistent with our observation that IGF-1 alters the functional interaction of CAL and CFTR in the Golgi. However, when ΔF508 CFTR is rescued with low temperature or the corrector VRT-325 and proceeds to the Golgi, IGF-1 can increase the expression of the rescued ΔF508 CFTR. Our data support a model indicating that CAL-CFTR binding in the Golgi inhibits CFTR trafficking to the cell surface, leading CFTR to the degradation pathway instead. IGF-1-activated TC10 changes the interaction of CFTR and CAL, allowing CFTR to progress to the plasma membrane. These findings offer a potential strategy using a combinational treatment of IGF-1 and correctors to increase the post-Golgi expression of CFTR in cystic fibrosis patients bearing the ΔF508 mutation.

  13. Manipulating proteostasis to repair the F508del-CFTR defect in cystic fibrosis.

    Science.gov (United States)

    Esposito, Speranza; Tosco, Antonella; Villella, Valeria R; Raia, Valeria; Kroemer, Guido; Maiuri, Luigi

    2016-12-01

    Cystic fibrosis (CF) is a lethal monogenic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that entails the (diagnostic) increase in sweat electrolyte concentrations, progressive lung disease with chronic inflammation and recurrent bacterial infections, pancreatic insufficiency, and male infertility. Therapies aimed at restoring the CFTR defect have emerged. Thus, a small molecule which facilitates chloride channel opening, the potentiator Ivacaftor, has been approved for the treatment of CF patients bearing a particular class of rare CFTR mutations. However, small molecules that directly target the most common misfolded CFTR mutant, F508del, and improve its intracellular trafficking in vitro, have been less effective than expected when tested in CF patients, even in combination with Ivacaftor. Thus, new strategies are required to circumvent the F508del-CFTR defect. Airway and intestinal epithelial cells from CF patients bearing the F508del-CFTR mutation exhibit an impressive derangement of cellular proteostasis, with oxidative stress, overactivation of the tissue transglutaminase (TG2), and disabled autophagy. Proteostasis regulators such as cysteamine can rescue and stabilize a functional F508del-CFTR protein through suppressing TG2 activation and restoring autophagy in vivo in F508del-CFTR homozygous mice, in vitro in CF patient-derived cell lines, ex vivo in freshly collected primary patient's nasal cells, as well as in a pilot clinical trial involving homozygous F508del-CFTR patients. Here, we discuss how the therapeutic normalization of defective proteostasis can be harnessed for the treatment of CF patients with the F508del-CFTR mutation.

  14. Side chain and backbone contributions of Phe508 to CFTR folding

    Energy Technology Data Exchange (ETDEWEB)

    Thibodeau, Patrick H.; Brautigam, Chad A.; Machius, Mischa; Thomas, Philip J. (U. of Texas-SMED)

    2010-12-07

    Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an integral membrane protein, cause cystic fibrosis (CF). The most common CF-causing mutant, deletion of Phe508, fails to properly fold. To elucidate the role Phe508 plays in the folding of CFTR, missense mutations at this position were generated. Only one missense mutation had a pronounced effect on the stability and folding of the isolated domain in vitro. In contrast, many substitutions, including those of charged and bulky residues, disrupted folding of full-length CFTR in cells. Structures of two mutant nucleotide-binding domains (NBDs) reveal only local alterations of the surface near position 508. These results suggest that the peptide backbone plays a role in the proper folding of the domain, whereas the side chain plays a role in defining a surface of NBD1 that potentially interacts with other domains during the maturation of intact CFTR.

  15. CFTR Genotype and Maximal Exercise Capacity in Cystic Fibrosis: A Cross-sectional Study.

    Science.gov (United States)

    Radtke, Thomas; Hebestreit, Helge; Gallati, Sabina; Schneiderman, Jane E; Braun, Julia; Stevens, Daniel; Hulzebos, Erik Hj; Takken, Tim; Boas, Steven R; Urquhart, Don S; Lands, Larry C; Tejero, Sergio; Sovtic, Aleksandar; Dwyer, Tiffany; Petrovic, Milos; Harris, Ryan A; Karila, Chantal; Savi, Daniela; Usemann, Jakob; Mei-Zahav, Meir; Hatziagorou, Elpis; Ratjen, Felix; Kriemler, Susi

    2018-02-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is expressed in human skeletal muscle cells. Variations of CFTR dysfunction among patients with cystic fibrosis may be an important determinant of maximal exercise capacity in cystic fibrosis. Previous studies on the relationship between CFTR genotype and maximal exercise capacity are scarce and contradictory. This study was designed to explore factors influencing maximal exercise capacity, expressed as peak oxygen uptake (V.O2peak), with a specific focus on CFTR genotype in children and adults with cystic fibrosis. In an international, multicenter, cross-sectional study, we collected data on CFTR genotype and cardiopulmonary exercise tests in patients with cystic fibrosis who were ages 8 years and older. CFTR mutations were classified into functional classes I–V. The final analysis included 726 patients (45% females; age range, 8–61 yr; forced expiratory volume in 1 s, 16 to 123% predicted) from 17 cystic fibrosis centers in North America, Europe, Australia, and Asia, all of whom had both valid maximal cardiopulmonary exercise tests and complete CFTR genotype data. Overall, patients exhibited exercise intolerance (V.O2peak, 77.3 ± 19.1% predicted), but values were comparable among different CFTR classes. We did not detect an association between CFTR genotype functional classes I–III and either V.O2peak (percent predicted) (adjusted β = −0.95; 95% CI, −4.18 to 2.29; P = 0.57) or maximum work rate (Wattmax) (adjusted β = −1.38; 95% CI, −5.04 to 2.27; P = 0.46) compared with classes IV–V. Those with at least one copy of a F508del-CFTR mutation and one copy of a class V mutation had a significantly lower V.O2peak (β = −8.24%; 95% CI, −14.53 to −2.99; P = 0.003) and lower Wattmax (adjusted β = −7.59%; 95% CI, −14.21 to −0.95; P = 0.025) than those with two copies of a class II mutation. On the basis of linear regression analysis adjusted for

  16. Biophysical characterisation of calumenin as a charged F508del-CFTR folding modulator.

    Directory of Open Access Journals (Sweden)

    Rashmi Tripathi

    Full Text Available The cystic fibrosis transmembrane regulator (CFTR is a cyclic-AMP dependent chloride channel expressed at the apical surface of epithelial cells lining various organs such as the respiratory tract. Defective processing and functioning of this protein caused by mutations in the CFTR gene results in loss of ionic balance, defective mucus clearance, increased proliferation of biofilms and inflammation of human airways observed in cystic fibrosis (CF patients. The process by which CFTR folds and matures under the influence of various chaperones in the secretory pathway remains incompletely understood. Recently, calumenin, a secretory protein, belonging to the CREC family of low affinity calcium binding proteins has been identified as a putative CFTR chaperone whose biophysical properties and functions remain uncharacterized. We compared hydropathy, instability, charge, unfoldability, disorder and aggregation propensity of calumenin and other CREC family members with CFTR associated chaperones and calcium binding proteins, wild-type and mutant CFTR proteins and intrinsically disordered proteins (IDPs. We observed that calumenin, along with other CREC proteins, was significantly more charged and less folded compared to CFTR associated chaperones. Moreover like IDPs, calumenin and other CREC proteins were found to be less hydrophobic and aggregation prone. Phylogenetic analysis revealed a close link between calumenin and other CREC proteins indicating how evolution might have shaped their similar biophysical properties. Experimentally, calumenin was observed to significantly reduce F508del-CFTR aggregation in a manner similar to AavLEA1, a well-characterized IDP. Fluorescence microscopy based imaging analysis also revealed altered trafficking of calumenin in bronchial cells expressing F508del-CFTR, indicating its direct role in the pathophysiology of CF. In conclusion, calumenin is characterized as a charged protein exhibiting close similarity with

  17. CFTR Modulators: Shedding Light on Precision Medicine for Cystic Fibrosis

    Science.gov (United States)

    Lopes-Pacheco, Miquéias

    2016-01-01

    Cystic fibrosis (CF) is the most common life-threatening monogenic disease afflicting Caucasian people. It affects the respiratory, gastrointestinal, glandular and reproductive systems. The major cause of morbidity and mortality in CF is the respiratory disorder caused by a vicious cycle of obstruction of the airways, inflammation and infection that leads to epithelial damage, tissue remodeling and end-stage lung disease. Over the past decades, life expectancy of CF patients has increased due to early diagnosis and improved treatments; however, these patients still present limited quality of life. Many attempts have been made to rescue CF transmembrane conductance regulator (CFTR) expression, function and stability, thereby overcoming the molecular basis of CF. Gene and protein variances caused by CFTR mutants lead to different CF phenotypes, which then require different treatments to quell the patients’ debilitating symptoms. In order to seek better approaches to treat CF patients and maximize therapeutic effects, CFTR mutants have been stratified into six groups (although several of these mutations present pleiotropic defects). The research with CFTR modulators (read-through agents, correctors, potentiators, stabilizers and amplifiers) has achieved remarkable progress, and these drugs are translating into pharmaceuticals and personalized treatments for CF patients. This review summarizes the main molecular and clinical features of CF, emphasizes the latest clinical trials using CFTR modulators, sheds light on the molecular mechanisms underlying these new and emerging treatments, and discusses the major breakthroughs and challenges to treating all CF patients. PMID:27656143

  18. From the endoplasmic reticulum to the plasma membrane: mechanisms of CFTR folding and trafficking.

    Science.gov (United States)

    Farinha, Carlos M; Canato, Sara

    2017-01-01

    CFTR biogenesis starts with its co-translational insertion into the membrane of endoplasmic reticulum and folding of the cytosolic domains, towards the acquisition of a fully folded compact native structure. Efficiency of this process is assessed by the ER quality control system that allows the exit of folded proteins but targets unfolded/misfolded CFTR to degradation. If allowed to leave the ER, CFTR is modified at the Golgi and reaches the post-Golgi compartments to be delivered to the plasma membrane where it functions as a cAMP- and phosphorylation-regulated chloride/bicarbonate channel. CFTR residence at the membrane is a balance of membrane delivery, endocytosis, and recycling. Several adaptors, motor, and scaffold proteins contribute to the regulation of CFTR stability and are involved in continuously assessing its structure through peripheral quality control systems. Regulation of CFTR biogenesis and traffic (and its dysregulation by mutations, such as the most common F508del) determine its overall activity and thus contribute to the fine modulation of chloride secretion and hydration of epithelial surfaces. This review covers old and recent knowledge on CFTR folding and trafficking from its synthesis to the regulation of its stability at the plasma membrane and highlights how several of these steps can be modulated to promote the rescue of mutant CFTR.

  19. Investigating CFTR and KCa3.1 Protein/Protein Interactions.

    Directory of Open Access Journals (Sweden)

    Hélène Klein

    Full Text Available In epithelia, Cl- channels play a prominent role in fluid and electrolyte transport. Of particular importance is the cAMP-dependent cystic fibrosis transmembrane conductance regulator Cl- channel (CFTR with mutations of the CFTR encoding gene causing cystic fibrosis. The bulk transepithelial transport of Cl- ions and electrolytes needs however to be coupled to an increase in K+ conductance in order to recycle K+ and maintain an electrical driving force for anion exit across the apical membrane. In several epithelia, this K+ efflux is ensured by K+ channels, including KCa3.1, which is expressed at both the apical and basolateral membranes. We show here for the first time that CFTR and KCa3.1 can physically interact. We first performed a two-hybrid screen to identify which KCa3.1 cytosolic domains might mediate an interaction with CFTR. Our results showed that both the N-terminal fragment M1-M40 of KCa3.1 and part of the KCa3.1 calmodulin binding domain (residues L345-A400 interact with the NBD2 segment (G1237-Y1420 and C- region of CFTR (residues T1387-L1480, respectively. An association of CFTR and F508del-CFTR with KCa3.1 was further confirmed in co-immunoprecipitation experiments demonstrating the formation of immunoprecipitable CFTR/KCa3.1 complexes in CFBE cells. Co-expression of KCa3.1 and CFTR in HEK cells did not impact CFTR expression at the cell surface, and KCa3.1 trafficking appeared independent of CFTR stimulation. Finally, evidence is presented through cross-correlation spectroscopy measurements that KCa3.1 and CFTR colocalize at the plasma membrane and that KCa3.1 channels tend to aggregate consequent to an enhanced interaction with CFTR channels at the plasma membrane following an increase in intracellular Ca2+ concentration. Altogether, these results suggest 1 that the physical interaction KCa3.1/CFTR can occur early during the biogenesis of both proteins and 2 that KCa3.1 and CFTR form a dynamic complex, the formation of which

  20. Cellular chloride and bicarbonate retention alters intracellular pH regulation in Cftr KO crypt epithelium

    Science.gov (United States)

    Walker, Nancy M.; Liu, Jinghua; Stein, Sydney R.; Stefanski, Casey D.; Strubberg, Ashlee M.

    2015-01-01

    Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR), an anion channel providing a major pathway for Cl− and HCO3− efflux across the apical membrane of the epithelium. In the intestine, CF manifests as obstructive syndromes, dysbiosis, inflammation, and an increased risk for gastrointestinal cancer. Cftr knockout (KO) mice recapitulate CF intestinal disease, including intestinal hyperproliferation. Previous studies using Cftr KO intestinal organoids (enteroids) indicate that crypt epithelium maintains an alkaline intracellular pH (pHi). We hypothesized that Cftr has a cell-autonomous role in downregulating pHi that is incompletely compensated by acid-base regulation in its absence. Here, 2′,7′-bis(2-carboxyethyl)-5(6)-carboxyfluorescein microfluorimetry of enteroids showed that Cftr KO crypt epithelium sustains an alkaline pHi and resistance to cell acidification relative to wild-type. Quantitative real-time PCR revealed that Cftr KO enteroids exhibit downregulated transcription of base (HCO3−)-loading proteins and upregulation of the basolateral membrane HCO3−-unloader anion exchanger 2 (Ae2). Although Cftr KO crypt epithelium had increased Ae2 expression and Ae2-mediated Cl−/HCO3− exchange with maximized gradients, it also had increased intracellular Cl− concentration relative to wild-type. Pharmacological reduction of intracellular Cl− concentration in Cftr KO crypt epithelium normalized pHi, which was largely Ae2-dependent. We conclude that Cftr KO crypt epithelium maintains an alkaline pHi as a consequence of losing both Cl− and HCO3− efflux, which impairs pHi regulation by Ae2. Retention of Cl− and an alkaline pHi in crypt epithelium may alter several cellular processes in the proliferative compartment of Cftr KO intestine. PMID:26542396

  1. Cellular chloride and bicarbonate retention alters intracellular pH regulation in Cftr KO crypt epithelium.

    Science.gov (United States)

    Walker, Nancy M; Liu, Jinghua; Stein, Sydney R; Stefanski, Casey D; Strubberg, Ashlee M; Clarke, Lane L

    2016-01-15

    Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR), an anion channel providing a major pathway for Cl(-) and HCO3 (-) efflux across the apical membrane of the epithelium. In the intestine, CF manifests as obstructive syndromes, dysbiosis, inflammation, and an increased risk for gastrointestinal cancer. Cftr knockout (KO) mice recapitulate CF intestinal disease, including intestinal hyperproliferation. Previous studies using Cftr KO intestinal organoids (enteroids) indicate that crypt epithelium maintains an alkaline intracellular pH (pHi). We hypothesized that Cftr has a cell-autonomous role in downregulating pHi that is incompletely compensated by acid-base regulation in its absence. Here, 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein microfluorimetry of enteroids showed that Cftr KO crypt epithelium sustains an alkaline pHi and resistance to cell acidification relative to wild-type. Quantitative real-time PCR revealed that Cftr KO enteroids exhibit downregulated transcription of base (HCO3 (-))-loading proteins and upregulation of the basolateral membrane HCO3 (-)-unloader anion exchanger 2 (Ae2). Although Cftr KO crypt epithelium had increased Ae2 expression and Ae2-mediated Cl(-)/HCO3 (-) exchange with maximized gradients, it also had increased intracellular Cl(-) concentration relative to wild-type. Pharmacological reduction of intracellular Cl(-) concentration in Cftr KO crypt epithelium normalized pHi, which was largely Ae2-dependent. We conclude that Cftr KO crypt epithelium maintains an alkaline pHi as a consequence of losing both Cl(-) and HCO3 (-) efflux, which impairs pHi regulation by Ae2. Retention of Cl(-) and an alkaline pHi in crypt epithelium may alter several cellular processes in the proliferative compartment of Cftr KO intestine. Copyright © 2016 the American Physiological Society.

  2. Transmembrane helical interactions in the CFTR channel pore.

    Directory of Open Access Journals (Sweden)

    Jhuma Das

    2017-06-01

    Full Text Available Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR gene affect CFTR protein biogenesis or its function as a chloride channel, resulting in dysregulation of epithelial fluid transport in the lung, pancreas and other organs in cystic fibrosis (CF. Development of pharmaceutical strategies to treat CF requires understanding of the mechanisms underlying channel function. However, incomplete 3D structural information on the unique ABC ion channel, CFTR, hinders elucidation of its functional mechanism and correction of cystic fibrosis causing mutants. Several CFTR homology models have been developed using bacterial ABC transporters as templates but these have low sequence similarity to CFTR and are not ion channels. Here, we refine an earlier model in an outward (OWF and develop an inward (IWF facing model employing an integrated experimental-molecular dynamics simulation (200 ns approach. Our IWF structure agrees well with a recently solved cryo-EM structure of a CFTR IWF state. We utilize cysteine cross-linking to verify positions and orientations of residues within trans-membrane helices (TMHs of the OWF conformation and to reconstruct a physiologically relevant pore structure. Comparison of pore profiles of the two conformations reveal a radius sufficient to permit passage of hydrated Cl- ions in the OWF but not the IWF model. To identify structural determinants that distinguish the two conformations and possible rearrangements of TMHs within them responsible for channel gating, we perform cross-linking by bifunctional reagents of multiple predicted pairs of cysteines in TMH 6 and 12 and 6 and 9. To determine whether the effects of cross-linking on gating observed are the result of switching of the channel from open to close state, we also treat the same residue pairs with monofunctional reagents in separate experiments. Both types of reagents prevent ion currents indicating that pore blockage is primarily responsible.

  3. Current insights into the role of PKA phosphorylation in CFTR channel activity and the pharmacological rescue of cystic fibrosis disease-causing mutants.

    Science.gov (United States)

    Chin, Stephanie; Hung, Maurita; Bear, Christine E

    2017-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) channel gating is predominantly regulated by protein kinase A (PKA)-dependent phosphorylation. In addition to regulating CFTR channel activity, PKA phosphorylation is also involved in enhancing CFTR trafficking and mediating conformational changes at the interdomain interfaces of the protein. The major cystic fibrosis (CF)-causing mutation is the deletion of phenylalanine at position 508 (F508del); it causes many defects that affect CFTR trafficking, stability, and gating at the cell surface. Due to the multiple roles of PKA phosphorylation, there is growing interest in targeting PKA-dependent signaling for rescuing the trafficking and functional defects of F508del-CFTR. This review will discuss the effects of PKA phosphorylation on wild-type CFTR, the consequences of CF mutations on PKA phosphorylation, and the development of therapies that target PKA-mediated signaling.

  4. The HDAC inhibitor SAHA does not rescue CFTR membrane expression in Cystic Fibrosis.

    Science.gov (United States)

    Bergougnoux, Anne; Petit, Aurélie; Knabe, Lucie; Bribes, Estelle; Chiron, Raphaël; De Sario, Albertina; Claustres, Mireille; Molinari, Nicolas; Vachier, Isabelle; Taulan-Cadars, Magali; Bourdin, Arnaud

    2017-07-01

    The development of suitable Cystic Fibrosis (CF) models for preclinical bench tests of therapeutic candidates is challenging. Indeed, the validation of molecules to rescue the p.Phe508del-CFTR channel (encoded by the Cystic Fibrosis Transmembrane conductance Regulator gene carrying the p.Phe508del mutation) requires taking into account their overall effects on the epithelium. Suberoylanilide Hydroxamic Acid (SAHA), a histone deacetylase inhibitor (HDACi), was previously shown to be a CFTR corrector via proteostasis modulation in CFTR-deficient immortalized cells. Here, we tested SAHA effects on goblet cell metaplasia using an ex vivo model based on the air-liquid interface (ALI) culture of differentiated airway epithelial cells obtained by nasal scraping from CF patients and healthy controls. Ex vivo epithelium grew successfully in ALI cultures with significant rise in the expression of CFTR and of markers of airway epithelial differentiation compared to monolayer cell culture. SAHA decreased CFTR transcript and protein levels in CF and non-CF epithelia. Whereas SAHA induced lysine hyperacetylation, it did not change histone modifications at the CFTR promoter. SAHA reduced MUC5AC and MUC5B expression and inhibited goblet epithelial cell differentiation. Similar effects were obtained in CF and non-CF epithelia. All the effects were fully reversible within five days from SAHA withdrawal. We conclude that, ex vivo, SAHA modulate the structure of airway epithelia without specific effect on CFTR gene and protein suggesting that HDACi cannot be useful for CF treatment. Copyright © 2017. Published by Elsevier Ltd.

  5. The human CFTR protein expressed in CHO cells activates aquaporin-3 in a cAMP-dependent pathway: study by digital holographic microscopy

    KAUST Repository

    Jourdain, P.

    2013-12-11

    The transmembrane water movements during cellular processes and their relationship to ionic channel activity remain largely unknown. As an example, in epithelial cells it was proposed that the movement of water could be directly linked to cystic fibrosis transmembrane conductance regulator (CFTR) protein activity through a cAMP-stimulated aqueous pore, or be dependent on aquaporin. Here, we used digital holographic microscopy (DHM) an interferometric technique to quantify in situ the transmembrane water fluxes during the activity of the epithelial chloride channel, CFTR, measured by patch-clamp and iodide efflux techniques. We showed that the water transport measured by DHM is fully inhibited by the selective CFTR blocker CFTRinh172 and is absent in cells lacking CFTR. Of note, in cells expressing the mutated version of CFTR (F508del-CFTR), which mimics the most common genetic alteration encountered in cystic fibrosis, we also show that the water movement is profoundly altered but restored by pharmacological manipulation of F508del-CFTR-defective trafficking. Importantly, whereas activation of this endogenous water channel required a cAMP-dependent stimulation of CFTR, activation of CFTR or F508del-CFTR by two cAMP-independent CFTR activators, genistein and MPB91, failed to trigger water movements. Finally, using a specific small-interfering RNA against the endogenous aquaporin AQP3, the water transport accompanying CFTR activity decreased. We conclude that water fluxes accompanying CFTR activity are linked to AQP3 but not to a cAMP-stimulated aqueous pore in the CFTR protein.

  6. Cholesterol modulates CFTR confinement in the plasma membrane of primary epithelial cells.

    Science.gov (United States)

    Abu-Arish, Asmahan; Pandzic, Elvis; Goepp, Julie; Matthes, Elizabeth; Hanrahan, John W; Wiseman, Paul W

    2015-07-07

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a plasma-membrane anion channel that, when mutated, causes the disease cystic fibrosis. Although CFTR has been detected in a detergent-resistant membrane fraction prepared from airway epithelial cells, suggesting that it may partition into cholesterol-rich membrane microdomains (lipid rafts), its compartmentalization has not been demonstrated in intact cells and the influence of microdomains on CFTR lateral mobility is unknown. We used live-cell imaging, spatial image correlation spectroscopy, and k-space image correlation spectroscopy to examine the aggregation state of CFTR and its dynamics both within and outside microdomains in the plasma membrane of primary human bronchial epithelial cells. These studies were also performed during treatments that augment or deplete membrane cholesterol. We found two populations of CFTR molecules that were distinguishable based on their dynamics at the cell surface. One population showed confinement and had slow dynamics that were highly cholesterol dependent. The other, more abundant population was less confined and diffused more rapidly. Treatments that deplete the membrane of cholesterol caused the confined fraction and average number of CFTR molecules per cluster to decrease. Elevating cholesterol had the opposite effect, increasing channel aggregation and the fraction of channels displaying confinement, consistent with CFTR recruitment into cholesterol-rich microdomains with dimensions below the optical resolution limit. Viral infection caused the nanoscale microdomains to fuse into large platforms and reduced CFTR mobility. To our knowledge, these results provide the first biophysical evidence for multiple CFTR populations and have implications for regulation of their surface expression and channel function. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. Evidence that CFTR is expressed in rat tracheal smooth muscle cells and contributes to bronchodilation

    Directory of Open Access Journals (Sweden)

    Mettey Yvette

    2006-08-01

    Full Text Available Abstract Background The airway functions are profoundly affected in many diseases including asthma, chronic obstructive pulmonary disease (COPD and cystic fibrosis (CF. CF the most common lethal autosomal recessive genetic disease is caused by mutations of the CFTR gene, which normally encodes a multifunctional and integral membrane protein, the CF transmembrane conductance regulator (CFTR expressed in airway epithelial cells. Methods To demonstrate that CFTR is also expressed in tracheal smooth muscle cells (TSMC, we used iodide efflux assay to analyse the chloride transports in organ culture of rat TSMC, immunofluorescence study to localize CFTR proteins and isometric contraction measurement on isolated tracheal rings to observe the implication of CFTR in the bronchodilation. Results We characterized three different pathways stimulated by the cAMP agonist forskolin and the isoflavone agent genistein, by the calcium ionophore A23187 and by hypo-osmotic challenge. The pharmacology of the cAMP-dependent iodide efflux was investigated in detail. We demonstrated in rat TSMC that it is remarkably similar to that of the epithelial CFTR, both for activation (using three benzo [c]quinolizinium derivatives and for inhibition (glibenclamide, DPC and CFTRinh-172. Using rat tracheal rings, we observed that the activation of CFTR by benzoquinolizinium derivatives in TSMC leads to CFTRinh-172-sensitive bronchodilation after constriction with carbachol. An immunolocalisation study confirmed expression of CFTR in tracheal myocytes. Conclusion Altogether, these observations revealed that CFTR in the airways of rat is expressed not only in the epithelial cells but also in tracheal smooth muscle cells leading to the hypothesis that this ionic channel could contribute to bronchodilation.

  8. Purification and crystallization of the cystic fibrosis transmembrane conductance regulator (CFTR).

    Science.gov (United States)

    Rosenberg, Mark F; Kamis, Alhaji Bukar; Aleksandrov, Luba A; Ford, Robert C; Riordan, John R

    2004-09-10

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a membrane protein that is mutated in patients suffering from cystic fibrosis. Here we report the purification and first crystallization of wild-type human CFTR. Functional characterization of the material showed it to be highly active. Electron crystallography of negatively stained two-dimensional crystals of CFTR has revealed the overall architecture of this channel for two different conformational states. These show a strong structural homology to two conformational states of another eukaryotic ATP-binding cassette transporter, P-glycoprotein. In contrast to P-glycoprotein, however, both conformational states can be observed in the presence of a nucleotide, which may be related to the role of CFTR as an ion channel rather than a transporter. The hypothesis that the two conformations could represent the "open" and "closed" states of the channel is considered.

  9. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    International Nuclear Information System (INIS)

    Taulan, M.; Lopez, E.; Guittard, C.; Rene, C.; Baux, D.; Altieri, J.P.; DesGeorges, M.; Claustres, M.; Romey, M.C.

    2007-01-01

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter

  10. Genotype-phenotype correlation and functional studies in patients with cystic fibrosis bearing CFTR complex alleles.

    Science.gov (United States)

    Terlizzi, Vito; Castaldo, Giuseppe; Salvatore, Donatello; Lucarelli, Marco; Raia, Valeria; Angioni, Adriano; Carnovale, Vincenzo; Cirilli, Natalia; Casciaro, Rosaria; Colombo, Carla; Di Lullo, Antonella Miriam; Elce, Ausilia; Iacotucci, Paola; Comegna, Marika; Scorza, Manuela; Lucidi, Vincenzina; Perfetti, Anna; Cimino, Roberta; Quattrucci, Serena; Seia, Manuela; Sofia, Valentina Maria; Zarrilli, Federica; Amato, Felice

    2017-04-01

    The effect of complex alleles in cystic fibrosis (CF) is poorly defined for the lack of functional studies. To describe the genotype-phenotype correlation and the results of either in vitro and ex vivo studies performed on nasal epithelial cells (NEC) in a cohort of patients with CF carrying cystic fibrosis transmembrane conductance regulator ( CFTR ) complex alleles. We studied 70 homozygous, compound heterozygous or heterozygous for CFTR mutations: p.[Arg74Trp;Val201Met;Asp1270Asn], n=8; p.[Ile148Thr;Ile1023_Val1024del], n=5; p.[Arg117Leu;Leu997Phe], n=6; c.[1210-34TG[12];1210-12T[5];2930C>T], n=3; p.[Arg74Trp;Asp1270Asn], n=4; p.Asp1270Asn, n=2; p.Ile148Thr, n=6; p.Leu997Phe, n=36. In 39 patients, we analysed the CFTR gating activity on NEC in comparison with patients with CF (n=8) and carriers (n=4). Finally, we analysed in vitro the p.[Arg74Trp;Val201Met;Asp1270Asn] complex allele. The p.[Ile148Thr;Ile1023_Val1024del] caused severe CF in five compound heterozygous with a class I-II mutation. Their CFTR activity on NEC was comparable with patients with two class I-II mutations (mean 7.3% vs 6.9%). The p.[Arg74Trp;Asp1270Asn] and the p.Asp1270Asn have scarce functional effects, while p.[Arg74Trp;Val201Met;Asp1270Asn] caused mild CF in four of five subjects carrying a class I-II mutation in trans , or CFTR-related disorders (CFTR-RD) in three having in trans a class IV-V mutation. The p.[Arg74Trp;Val201Met;Asp1270Asn] causes significantly (pT] and a class I-II mutation had mild CF or CFTR-RD (gating activity: 18.5-19.0%). The effect of complex alleles partially depends on the mutation in trans . Although larger studies are necessary, the CFTR activity on NEC is a rapid contributory tool to classify patients with CFTR dysfunction. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. Computational design of a PDZ domain peptide inhibitor that rescues CFTR activity.

    Directory of Open Access Journals (Sweden)

    Kyle E Roberts

    Full Text Available The cystic fibrosis transmembrane conductance regulator (CFTR is an epithelial chloride channel mutated in patients with cystic fibrosis (CF. The most prevalent CFTR mutation, ΔF508, blocks folding in the endoplasmic reticulum. Recent work has shown that some ΔF508-CFTR channel activity can be recovered by pharmaceutical modulators ("potentiators" and "correctors", but ΔF508-CFTR can still be rapidly degraded via a lysosomal pathway involving the CFTR-associated ligand (CAL, which binds CFTR via a PDZ interaction domain. We present a study that goes from theory, to new structure-based computational design algorithms, to computational predictions, to biochemical testing and ultimately to epithelial-cell validation of novel, effective CAL PDZ inhibitors (called "stabilizers" that rescue ΔF508-CFTR activity. To design the "stabilizers", we extended our structural ensemble-based computational protein redesign algorithm K* to encompass protein-protein and protein-peptide interactions. The computational predictions achieved high accuracy: all of the top-predicted peptide inhibitors bound well to CAL. Furthermore, when compared to state-of-the-art CAL inhibitors, our design methodology achieved higher affinity and increased binding efficiency. The designed inhibitor with the highest affinity for CAL (kCAL01 binds six-fold more tightly than the previous best hexamer (iCAL35, and 170-fold more tightly than the CFTR C-terminus. We show that kCAL01 has physiological activity and can rescue chloride efflux in CF patient-derived airway epithelial cells. Since stabilizers address a different cellular CF defect from potentiators and correctors, our inhibitors provide an additional therapeutic pathway that can be used in conjunction with current methods.

  12. NM23 proteins: innocent bystanders or local energy boosters for CFTR?

    Science.gov (United States)

    Muimo, Richmond; Alothaid, Hani Mm; Mehta, Anil

    2018-03-01

    NM23 proteins NDPK-A and -B bind to the cystic fibrosis (CF) protein CFTR in different ways from kinases such as PKA, CK2 and AMPK or linkers to cell calcium such as calmodulin and annexins. NDPK-A (not -B) interacts with CFTR through reciprocal AMPK binding/control, whereas NDPK-B (not -A) binds directly to CFTR. NDPK-B can activate G proteins without ligand-receptor coupling, so perhaps NDPK-B's binding influences energy supply local to a nucleotide-binding site (NBD1) needed for CFTR to function. Curiously, CFTR (ABC-C7) is a member of the ATP-binding cassette (ABC) protein family that does not obey 'clan rules'; CFTR channels anions and is not a pump, regulates disparate processes, is itself regulated by multiple means and is so pleiotropic that it acts as a hub that orchestrates calcium signaling through its consorts such as calmodulin/annexins. Furthermore, its multiple partners make CFTR dance to different tunes in different cellular and subcellular locations as it recycles from the plasma membrane to endosomes. CFTR function in airway apical membranes is inhibited by smoking which has been dubbed 'acquired CF'. CFTR alone among family members possesses a trap for other proteins that it unfurls as a 'fish-net' and which bears consensus phosphorylation sites for many protein kinases, with PKA being the most canonical. Recently, the site of CFTR's commonest mutation has been proposed as a knock-in mutant that alters allosteric control of kinase CK2 by log orders of activity towards calmodulin and other substrates after CFTR fragmentation. This link from CK2 to calmodulin that binds the R region invokes molecular paths that control lumen formation, which is incomplete in the tracheas of some CF-affected babies. Thus, we are poised to understand the many roles of NDPK-A and -B in CFTR function and, especially lumen formation, which is defective in the gut and lungs of many CF babies.

  13. Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.

    Science.gov (United States)

    LaRusch, Jessica; Jung, Jinsei; General, Ignacio J; Lewis, Michele D; Park, Hyun Woo; Brand, Randall E; Gelrud, Andres; Anderson, Michelle A; Banks, Peter A; Conwell, Darwin; Lawrence, Christopher; Romagnuolo, Joseph; Baillie, John; Alkaade, Samer; Cote, Gregory; Gardner, Timothy B; Amann, Stephen T; Slivka, Adam; Sandhu, Bimaljit; Aloe, Amy; Kienholz, Michelle L; Yadav, Dhiraj; Barmada, M Michael; Bahar, Ivet; Lee, Min Goo; Whitcomb, David C

    2014-07-01

    CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<0.0001). WNK1-SPAK pathway-activated increases in CFTR

  14. Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.

    Directory of Open Access Journals (Sweden)

    Jessica LaRusch

    2014-07-01

    Full Text Available CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev cause complete loss of CFTR function and result in cystic fibrosis (CF, a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002. Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005 and male infertility (OR 395, p<<0.0001. WNK1-SPAK pathway-activated increases in

  15. Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

    Science.gov (United States)

    Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

    2018-03-01

    There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

  16. Les vésicules extracellulaires comme vecteurs de macromolécules bioactives : modèle du transporteur ABCC7 (CFTR) et application à la biothérapie de la mucoviscidose

    OpenAIRE

    Vituret , Cyrielle

    2015-01-01

    Cystic fibrosis is a genetic disease in which its prognosis depends on the lung damage. It is caused by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR), resulting in a dysfunctional CFTR protein normally located at the plasma membrane of epithelial cells. This thesis is a study of a novel therapeutic approach to use extracellular vesicles (EVs), microvesicles and exosomes, as transfer vectors for CFTR mRNA and protein to target cells. The proof of concept for ...

  17. Genetic Mutations in Cancer

    Science.gov (United States)

    Many different types of genetic mutations are found in cancer cells. This infographic outlines certain types of alterations that are present in cancer, such as missense, nonsense, frameshift, and chromosome rearrangements.

  18. Functional interaction between CFTR and the sodium-phosphate co-transport type 2a in Xenopus laevis oocytes.

    Directory of Open Access Journals (Sweden)

    Naziha Bakouh

    Full Text Available A growing number of proteins, including ion transporters, have been shown to interact with Cystic Fibrosis Transmembrane conductance Regulator (CFTR. CFTR is an epithelial chloride channel that is involved in Cystic Fibrosis (CF when mutated; thus a better knowledge of its functional interactome may help to understand the pathophysiology of this complex disease. In the present study, we investigated if CFTR and the sodium-phosphate co-transporter type 2a (NPT2a functionally interact after heterologous expression of both proteins in Xenopus laevis oocytes.NPT2a was expressed alone or in combination with CFTR in X. laevis oocytes. Using the two-electrode voltage-clamp technique, the inorganic phosphate-induced current (IPi was measured and taken as an index of NPT2a activity. The maximal IPi for NPT2a substrates was reduced when CFTR was co-expressed with NPT2a, suggesting a decrease in its expression at the oolemna. This was consistent with Western blot analysis showing reduced NPT2a plasma membrane expression in oocytes co-expressing both proteins, whereas NPT2a protein level in total cell lysate was the same in NPT2a- and NPT2a+CFTR-oocytes. In NPT2a+CFTR- but not in NPT2a-oocytes, IPi and NPT2a surface expression were increased upon PKA stimulation, whereas stimulation of Exchange Protein directly Activated by cAMP (EPAC had no effect. When NPT2a-oocytes were injected with NEG2, a short amino-acid sequence from the CFTR regulatory domain that regulates PKA-dependent CFTR trafficking to the plasma membrane, IPi values and NPT2a membrane expression were diminished, and could be enhanced by PKA stimulation, thereby mimicking the effects of CFTR co-expression.We conclude that when both CFTR and NPT2a are expressed in X. laevis oocytes, CFTR confers to NPT2a a cAMPi-dependent trafficking to the membrane. This functional interaction raises the hypothesis that CFTR may play a role in phosphate homeostasis.

  19. The hypertonic environment differentially regulates wild-type CFTR and TNR-CFTR chloride channels.

    Science.gov (United States)

    Lassance-Soares, Roberta M; Cheng, Jie; Krasnov, Kristina; Cebotaru, Liudmila; Cutting, Garry R; Souza-Menezes, Jackson; Morales, Marcelo M; Guggino, William B

    2010-01-01

    This study tested the hypotheses that the hypertonic environment of the renal medulla regulates the expression of cystic fibrosis transmembrane conductance regulator protein (CFTR) and its natural splice variant, TNR-CFTR. To accomplish this, Madin-Darby canine kidney (MDCK) stable cell lines expressing TNR-CFTR or CFTR were used. The cells were treated with hypertonic medium made with either NaCl or urea or sucrose (480 mOsm/kg or 560 mOsm/kg) to mimic the tonicity of the renal medulla environment. Western blot data showed that CFTR and TNR-CFTR total cell protein is increased by hypertonic medium, but using the surface biotinylation technique, only CFTR was found to be increased in cell plasma membrane. Confocal microscopy showed TNR-CFTR localization primarily at the endoplasmic reticulum and plasma membrane. In conclusion, CFTR and TNR-CFTR have different patterns of distribution in MDCK cells and they are modulated by a hypertonic environment, suggesting their physiological importance in renal medulla. Copyright © 2010 S. Karger AG, Basel.

  20. Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients

    Energy Technology Data Exchange (ETDEWEB)

    Mercier, B.; Verlingue, C.; Audrezet, M.P.; Ferec, C. [Centre de Biogenetique C.D.T.S., Brest (France); Lissens, W.; Bonduelle, M. [University Hospital VUB, Brussels (United Kingdom); Silber, S.J. [St. Luke`s Hospital, St. Louis, MO (United States); Novelli, G. [Catholic Univ. of Rome (Italy)

    1995-01-01

    Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier ({delta}F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD. 35 refs., 2 figs., 1 tab.

  1. Important role of platelets in modulating endotoxin-induced lung inflammation in CFTR-deficient mice.

    Directory of Open Access Journals (Sweden)

    Caiqi Zhao

    Full Text Available Mutation of CFTR (cystic fibrosis transmembrane conductance regulator leads to cystic fibrosis (CF. Patients with CF develop abnormalities of blood platelets and recurrent lung inflammation. However, whether CFTR-mutated platelets play a role in the development of lung inflammation is elusive. Therefore, we intratracheally challenged wildtype and F508del (a common type of CFTR mutation mice with LPS to observe changes of F508del platelets in the peripheral blood and indexes of lung inflammation (BAL neutrophils and protein levels. Furthermore, we investigated whether or not and how F508del platelets modulate the LPS-induced acute lung inflammation by targeting anti-platelet aggregation, depletion of neutrophils, reconstitution of bone marrow or neutrophils, blockade of P-selectin glycoprotein ligand-1 (PSGL-1, platelet activating factor (PAF, and correction of mutated CFTR trafficking. We found that LPS-challenged F508del mice developed severe thrombocytopenia and had higher levels of plasma TXB2 coincided with neutrophilic lung inflammation relative to wildtype control. Inhibition of F508del platelet aggregation or depletion of F508del neutrophils diminished the LPS-induced lung inflammation in the F508del mice. Moreover, wildtype mice reconstituted with either F508del bone marrow or neutrophils developed worse thrombocytopenia. Blocking PSGL-1, platelet activating factor (PAF, or rectifying trafficking of mutated CFTR in F508del mice diminished and alveolar neutrophil transmigration in the LPS-challenged F508del mice. These findings suggest that F508del platelets and their interaction with neutrophils are requisite for the development of LPS-induced lung inflammation and injury. As such, targeting platelets might be an emerging strategy for dampening recurrent lung inflammation in cystic fibrosis patients.

  2. Characterization of nasal potential difference in cftr knockout and F508del-CFTR mice.

    Directory of Open Access Journals (Sweden)

    Emilie Lyne Saussereau

    Full Text Available BACKGROUND: Treatments designed to correct cystic fibrosis transmembrane conductance regulator (CFTR defects must first be evaluated in preclinical experiments in the mouse model of cystic fibrosis (CF. Mice nasal mucosa mimics the bioelectric defect seen in humans. The use of nasal potential difference (V(TE to assess ionic transport is a powerful test evaluating the restoration of CFTR function. Nasal V(TE in CF mice must be well characterized for correct interpretation. METHODS: We performed V(TE measurements in large-scale studies of two mouse models of CF--B6;129 cftr knockout and FVB F508del-CFTR--and their respective wild-type (WT littermates. We assessed the repeatability of the test for cftr knockout mice and defined cutoff points distinguishing between WT and F508del-CFTR mice. RESULTS: We determined the typical V(TE values for CF and WT mice and demonstrated the existence of residual CFTR activity in F508del-CFTR mice. We characterized intra-animal variability in B6;129 mice and defined the cutoff points for F508del-CFTR chloride secretion rescue. Hyperpolarization of more than -2.15 mV after perfusion with a low-concentration Cl(- solution was considered to indicate a normal response. CONCLUSIONS: These data will make it possible to interpret changes in nasal V(TE in mouse models of CF, in future preclinical studies.

  3. Analysis of cystic fibrosis gener product (CFTR) function in patients with pancreas divisum and recurrent acute pancreatitis.

    Science.gov (United States)

    Gelrud, Andres; Sheth, Sunil; Banerjee, Subhas; Weed, Deborah; Shea, Julie; Chuttani, Ram; Howell, Douglas A; Telford, Jennifer J; Carr-Locke, David L; Regan, Meredith M; Ellis, Lynda; Durie, Peter R; Freedman, Steven D

    2004-08-01

    The mechanism by which pancreas divisum may lead to recurrent episodes of acute pancreatitis in a subset of individuals is unknown. Abnormalities of the cystic fibrosis gene product (CFTR) have been implicated in the genesis of idiopathic chronic pancreatitis. The aim of this study was to determine if CFTR function is abnormal in patients with pancreas divisum and recurrent acute pancreatitis (PD/RAP). A total of 69 healthy control subjects, 12 patients with PD/RAP, 16 obligate heterozygotes with a single CFTR mutation, and 95 patients with cystic fibrosis were enrolled. CFTR function was analyzed by nasal transepithelial potential difference testing in vivo. The outcomes of the PD/RAP patients following endoscopic and surgical treatments were concomitantly analyzed. Direct measurement of CFTR function in nasal epithelium in response to isoproterenol demonstrated that the values for PD/RAP were intermediate between those observed for healthy controls and cystic fibrosis patients. The median value was 13 mV for PD/RAP subjects, which was statistically different from healthy controls (22 mV, p= 0.001) and cystic fibrosis pancreatic sufficient (-1 mV, p < 0.0001) and pancreatic insufficient (-3 mV, p < 0.0001) patients. These results suggest a link between CFTR dysfunction and recurrent acute pancreatitis in patients with pancreas divisum and may explain why a subset of patients with pancreas divisum develops recurrent acute pancreatitis. Copyright 2004 American College of Gastroenterology

  4. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  5. Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

    Science.gov (United States)

    Liphardt, J; Napthine, S; Kontos, H; Brierley, I

    1999-05-07

    RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those

  6. All azoospermic males should be screened for cystic fibrosis mutations before intracytoplasmic sperm injection.

    LENUS (Irish Health Repository)

    Mocanu, Edgar

    2012-02-01

    We assessed the frequency of CFTR mutations in groups with varying degrees of sub-fertility and compared these groups to a fertile male group with proven paternity. Screening for CFTR mutations should be routine for all azoospermic males, irrespective of obstructive or non-obstructive etiology, prior to proposing ICSI treatment. CFTR testing has no value in the investigation of non-azoospermic infertile males.

  7. All azoospermic males should be screened for cystic fibrosis mutations before intracytoplasmic sperm injection.

    LENUS (Irish Health Repository)

    Mocanu, Edgar

    2010-11-01

    We assessed the frequency of CFTR mutations in groups with varying degrees of sub-fertility and compared these groups to a fertile male group with proven paternity. Screening for CFTR mutations should be routine for all azoospermic males, irrespective of obstructive or non-obstructive etiology, prior to proposing ICSI treatment. CFTR testing has no value in the investigation of non-azoospermic infertile males.

  8. A little CFTR goes a long way: CFTR-dependent sweat secretion from G551D and R117H-5T cystic fibrosis subjects taking ivacaftor.

    Directory of Open Access Journals (Sweden)

    Jessica E Char

    Full Text Available To determine if oral dosing with the CFTR-potentiator ivacaftor (VX-770, Kalydeco improves CFTR-dependent sweating in CF subjects carrying G551D or R117H-5T mutations, we optically measured sweat secretion from 32-143 individually identified glands in each of 8 CF subjects; 6 F508del/G551D, one G551D/R117H-5T, and one I507del/R117H-5T. Two subjects were tested only (- ivacaftor, 3 only (+ ivacaftor and 3 (+/- ivacaftor (1-5 tests per condition. The total number of gland measurements was 852 (- ivacaftor and 906 (+ ivacaftor. A healthy control was tested 4 times (51 glands. For each gland we measured both CFTR-independent (M-sweat and CFTR-dependent (C-sweat; C-sweat was stimulated with a β-adrenergic cocktail that elevated [cAMP]i while blocking muscarinic receptors. Absent ivacaftor, almost all CF glands produced M-sweat on all tests, but only 1/593 glands produced C-sweat (10 tests, 5 subjects. By contrast, 6/6 subjects (113/342 glands produced C-sweat in the (+ ivacaftor condition, but with large inter-subject differences; 3-74% of glands responded with C/M sweat ratios 0.04%-2.57% of the average WT ratio of 0.265. Sweat volume losses cause proportionally larger underestimates of CFTR function at lower sweat rates. The losses were reduced by measuring C/M ratios in 12 glands from each subject that had the highest M-sweat rates. Remaining losses were estimated from single channel data and used to correct the C/M ratios, giving estimates of CFTR function (+ ivacaftor  = 1.6%-7.7% of the WT average. These estimates are in accord with single channel data and transcript analysis, and suggest that significant clinical benefit can be produced by low levels of CFTR function.

  9. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants.

    Science.gov (United States)

    Sánchez, Karen; de Mendonca, Elizabeth; Matute, Xiorama; Chaustre, Ismenia; Villalón, Marlene; Takiff, Howard

    2016-01-01

    The mutations in the CFTR gene found in patients with cystic fibrosis (CF) have geographic differences, but there are scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in a group of Venezuelan patients with CF. The 27 exons of the CFTR gene from 110 Venezuelan patients in the National CF Program were amplified and sequenced. A total of 36 different mutations were identified, seven with frequencies greater than 1%: p.Phe508del (27.27%), p.Gly542* (3.18%), c.2988+1G>A (3.18%), p.Arg334Trp (1.36%), p.Arg1162* (1.36%), c.1-8G>C (1.36%), and p.[Gly628Arg;Ser1235Arg](1.36). In 40% of patients, all with a clinical diagnosis of CF, no mutations were found. This report represents the largest cohort of Venezuelan patients with CF ever examined, and includes a wider mutation panel than has been previously studied in this population. Mutations common in Southern European populations predominate, and several new mutations were discovered, but no mutations were found in 40% of the cohort.

  10. CFTR depletion results in changes in fatty acid composition and promotes lipogenesis in intestinal Caco 2/15 cells.

    Directory of Open Access Journals (Sweden)

    Geneviève Mailhot

    2010-05-01

    Full Text Available Abnormal fatty acid composition (FA in plasma and tissue lipids frequently occurs in homozygous and even in heterozygous carriers of cystic fibrosis transmembrane conductance regulator (CFTR mutations. The mechanism(s underlying these abnormalities remained, however, poorly understood despite the potentially CFTR contributing role.The aim of the present study was to investigate the impact of CFTR depletion on FA uptake, composition and metabolism using the intestinal Caco-2/15 cell line. shRNA-mediated cftr gene silencing induced qualitative and quantitative modifications in FA composition in differentiated enterocytes as determined by gas-liquid chromatography. With the cftr gene disruption, there was a 1,5 fold increase in the total FA amount, largely attributable to monounsaturated and saturated FA compared to controls. The activity of delta-7 desaturase, estimated by the 16:1(n-7/16:0, was significantly higher in knockdown cells and consistent with the striking elevation of the n-7 FA family. When incubated with [14C]-oleic acid, CFTR-depleted cells were capable of quick incorporation and export to the medium concomitantly with the high protein expression of L-FABP known to promote intracellular FA trafficking. Accordingly, lipoprotein vehicles (CM, VLDL, LDL and HDL, isolated from CFTR knockdown cells, exhibited higher levels of radiolabeled FA. Moreover, in the presence of [14C]-acetate, knockdown cells exhibited enhanced secretion of newly synthesized phospholipids, triglycerides, cholesteryl esters and free FA, thereby suggesting a stimulation of the lipogenic pathway. Conformably, gene expression of SREBP-1c, a key lipogenic transcription factor, was increased while protein expression of the phosphorylated and inactive form of acetylCoA carboxylase was reduced, confirming lipogenesis induction. Finally, CFTR-depleted cells exhibited lower gene expression of transcription factors (PPARalpha, LXRalpha, LXRbeta and RXRalpha

  11. A Homozygous Frameshift Mutation in LRAT Causes Retinitis Punctata Albescens

    NARCIS (Netherlands)

    Littink, Karin W.; van Genderen, Maria M.; van Schooneveld, Mary J.; Visser, Linda; Riemslag, Frans C. C.; Keunen, Jan E. E.; Bakker, Bjorn; Zonneveld, Marijke N.; den Hollander, Anneke I.; Cremers, Frans P. M.; van den Born, L. Ingeborgh

    2012-01-01

    Purpose: To determine the genetic defect and to describe the clinical characteristics in patients with retinitis punctata albescens (RPA) and fundus albipunctatus (FAP). Design: Case series/observational study. Participants: We included 13 patients affected by RPA or FAP. Methods: Thirteen patients

  12. A Homozygous Frameshift Mutation in LRAT Causes Retinitis Punctata Albescens.

    NARCIS (Netherlands)

    Littink, K.W.; Genderen, M.M. van; Schooneveld, M.J. van; Visser, L.; Riemslag, F.C.; Keunen, J.E.E.; Bakker, B.; Zonneveld, M.N.; Hollander, A.I. den; Cremers, F.P.M.; Born, L.I. van den

    2012-01-01

    PURPOSE: To determine the genetic defect and to describe the clinical characteristics in patients with retinitis punctata albescens (RPA) and fundus albipunctatus (FAP). DESIGN: Case series/observational study. PARTICIPANTS: We included 13 patients affected by RPA or FAP. METHODS: Thirteen patients

  13. Conserved allosteric hot spots in the transmembrane domains of cystic fibrosis transmembrane conductance regulator (CFTR) channels and multidrug resistance protein (MRP) pumps.

    Science.gov (United States)

    Wei, Shipeng; Roessler, Bryan C; Chauvet, Sylvain; Guo, Jingyu; Hartman, John L; Kirk, Kevin L

    2014-07-18

    ATP-binding cassette (ABC) transporters are an ancient family of transmembrane proteins that utilize ATPase activity to move substrates across cell membranes. The ABCC subfamily of the ABC transporters includes active drug exporters (the multidrug resistance proteins (MRPs)) and a unique ATP-gated ion channel (cystic fibrosis transmembrane conductance regulator (CFTR)). The CFTR channel shares gating principles with conventional ligand-gated ion channels, but the allosteric network that couples ATP binding at its nucleotide binding domains (NBDs) with conformational changes in its transmembrane helices (TMs) is poorly defined. It is also unclear whether the mechanisms that govern CFTR gating are conserved with the thermodynamically distinct MRPs. Here we report a new class of gain of function (GOF) mutation of a conserved proline at the base of the pore-lining TM6. Multiple substitutions of this proline promoted ATP-free CFTR activity and activation by the weak agonist, 5'-adenylyl-β,γ-imidodiphosphate (AMP-PNP). TM6 proline mutations exhibited additive GOF effects when combined with a previously reported GOF mutation located in an outer collar of TMs that surrounds the pore-lining TMs. Each TM substitution allosterically rescued the ATP sensitivity of CFTR gating when introduced into an NBD mutant with defective ATP binding. Both classes of GOF mutations also rescued defective drug export by a yeast MRP (Yor1p) with ATP binding defects in its NBDs. We conclude that the conserved TM6 proline helps set the energy barrier to both CFTR channel opening and MRP-mediated drug efflux and that CFTR channels and MRP pumps utilize similar allosteric mechanisms for coupling conformational changes in their translocation pathways to ATP binding at their NBDs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Lipoxin A4 and platelet activating factor are involved in E. coli or LPS-induced lung inflammation in CFTR-deficient mice.

    Directory of Open Access Journals (Sweden)

    Haiya Wu

    Full Text Available CFTR (cystic fibrosis transmembrane conductance regulator is expressed by both neutrophils and platelets. Lack of functional CFTR could lead to severe lung infection and inflammation. Here, we found that mutation of CFTR (F508del or inhibition of CFTR in mice led to more severe thrombocytopenia, alveolar neutrocytosis and bacteriosis, and lower lipoxin A4/MIP-2 (macrophage inhibitory protein-2 or lipoxin A4/neutrophil ratios in the BAL (bronchoalveolar lavage during acute E. coli pneumonia. In vitro, inhibition of CFTR promotes MIP-2 production in LPS-stimulated neutrophils; however, lipoxin A4 could dose-dependently suppress this effect. In LPS-induced acute lung inflammation, blockade of PSGL-1 (P-selectin glycoprotein ligand-1 or P-selectin, antagonism of PAF by WEB2086, or correction of mutated CFTR trafficking by KM11060 could significantly increase plasma lipoxin A4 levels in F508del relevant to wildtype mice. Concurrently, F508del mice had higher plasma platelet activating factor (PAF levels and PAF-AH activity compared to wildtype under LPS challenge. Inhibiting hydrolysis of PAF by a specific PAF-AH (PAF-acetylhydrolase inhibitor, MAFP, could worsen LPS-induced lung inflammation in F508del mice compared to vehicle treated F508del group. Particularly, depletion of platelets in F508del mice could significantly decrease plasma lipoxin A4 and PAF-AH activity and deteriorate LPS-induced lung inflammation compared to control F508del mice. Taken together, lipoxin A4 and PAF are involved in E. coli or LPS-induced lung inflammation in CFTR-deficient mice, suggesting that lipoxin A4 and PAF might be therapeutic targets for ameliorating CFTR-deficiency deteriorated lung inflammation.

  15. Evidence for a Rad18-independent frameshift mutagenesis pathway in human cell-free extracts.

    Directory of Open Access Journals (Sweden)

    Régine Janel-Bintz

    Full Text Available Bypass of replication blocks by specialized DNA polymerases is crucial for cell survival but may promote mutagenesis and genome instability. To gain insight into mutagenic sub-pathways that coexist in mammalian cells, we examined N-2-acetylaminofluorene (AAF-induced frameshift mutagenesis by means of SV40-based shuttle vectors containing a single adduct. We found that in mammalian cells, as previously observed in E. coli, modification of the third guanine of two target sequences, 5'-GGG-3' (3G and 5'-GGCGCC-3' (NarI site, induces -1 and -2 frameshift mutations, respectively. Using an in vitro assay for translesion synthesis, we investigated the biochemical control of these events. We showed that Pol eta, but neither Pol iota nor Pol zeta, plays a major role in the frameshift bypass of the AAF adduct located in the 3G sequence. By complementing PCNA-depleted extracts with either a wild-type or a non-ubiquitinatable form of PCNA, we found that this Pol eta-mediated pathway requires Rad18 and ubiquitination of PCNA. In contrast, when the AAF adduct is located within the NarI site, TLS is only partially dependent upon Pol eta and Rad18, unravelling the existence of alternative pathways that concurrently bypass this lesion.

  16. CFTR-France, a national relational patient database for sharing genetic and phenotypic data associated with rare CFTR variants.

    Science.gov (United States)

    Claustres, Mireille; Thèze, Corinne; des Georges, Marie; Baux, David; Girodon, Emmanuelle; Bienvenu, Thierry; Audrezet, Marie-Pierre; Dugueperoux, Ingrid; Férec, Claude; Lalau, Guy; Pagin, Adrien; Kitzis, Alain; Thoreau, Vincent; Gaston, Véronique; Bieth, Eric; Malinge, Marie-Claire; Reboul, Marie-Pierre; Fergelot, Patricia; Lemonnier, Lydie; Mekki, Chadia; Fanen, Pascale; Bergougnoux, Anne; Sasorith, Souphatta; Raynal, Caroline; Bareil, Corinne

    2017-10-01

    Most of the 2,000 variants identified in the CFTR (cystic fibrosis transmembrane regulator) gene are rare or private. Their interpretation is hampered by the lack of available data and resources, making patient care and genetic counseling challenging. We developed a patient-based database dedicated to the annotations of rare CFTR variants in the context of their cis- and trans-allelic combinations. Based on almost 30 years of experience of CFTR testing, CFTR-France (https://cftr.iurc.montp.inserm.fr/cftr) currently compiles 16,819 variant records from 4,615 individuals with cystic fibrosis (CF) or CFTR-RD (related disorders), fetuses with ultrasound bowel anomalies, newborns awaiting clinical diagnosis, and asymptomatic compound heterozygotes. For each of the 736 different variants reported in the database, patient characteristics and genetic information (other variations in cis or in trans) have been thoroughly checked by a dedicated curator. Combining updated clinical, epidemiological, in silico, or in vitro functional data helps to the interpretation of unclassified and the reassessment of misclassified variants. This comprehensive CFTR database is now an invaluable tool for diagnostic laboratories gathering information on rare variants, especially in the context of genetic counseling, prenatal and preimplantation genetic diagnosis. CFTR-France is thus highly complementary to the international database CFTR2 focused so far on the most common CF-causing alleles. © 2017 Wiley Periodicals, Inc.

  17. A novel FLNC frameshift and an OBSCN variant in a family with distal muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Rossi, Daniela; Palmio, Johanna; EvilaÈ, Anni; Galli, Lucia; Barone, Virginia; Caldwell, Tracy A.; Policke, Rachel A.; Aldkheil, Esraa; Berndsen, Christopher E.; Wright, Nathan T.; Malfatti, Edoardo; Brochier, Guy; Pierantozzi, Enrico; Jordanova, Albena; Guergueltcheva, Velina; Romero, Norma Beatriz; Hackman, Peter; Eymard, Bruno; Udd, Bjarne; Sorrentino, Vincenzo (Antwerp); (U. Sofia); (Siena); (Tampere); (J Madison); (Helsinki)

    2017-10-26

    A novel FLNC c.5161delG (p.Gly1722ValfsTer61) mutation was identified in two members of a French family affected by distal myopathy and in one healthy relative. This FLNC c.5161delG mutation is one nucleotide away from a previously reported FLNC mutation (c.5160delC) that was identified in patients and in asymptomatic carriers of three Bulgarian families with distal muscular dystrophy, indicating a low penetrance of the FLNC frameshift mutations. Given these similarities, we believe that the two FLNC mutations alone can be causative of distal myopathy without full penetrance. Moreover, comparative analysis of the clinical manifestations indicates that patients of the French family show an earlier onset and a complete segregation of the disease. As a possible explanation of this, the two French patients also carry a OBSCN c.13330C>T (p.Arg4444Trp) mutation. The p.Arg4444Trp variant is localized within the OBSCN Ig59 domain that, together with Ig58, binds to the ZIg9/ZIg10 domains of titin at Z-disks. Structural and functional studies indicate that this OBSCN p.Arg4444Trp mutation decreases titin binding by ~15-fold. On this line, we suggest that the combination of the OBSCN p.Arg4444Trp variant and of the FLNC c.5161delG mutation, can cooperatively affect myofibril stability and increase the penetrance of muscular dystrophy in the French family.

  18. Model of the pathway of −1 frameshifting: Long pausing

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2016-03-01

    Full Text Available It has been characterized that the programmed ribosomal −1 frameshifting often occurs at the slippery sequence on the presence of a downstream mRNA pseudoknot. In some prokaryotic cases such as the dnaX gene of Escherichia coli, an additional stimulatory signal—an upstream, internal Shine–Dalgarno (SD sequence—is also necessary to stimulate the efficient −1 frameshifting. However, the molecular and physical mechanism of the −1 frameshifting is poorly understood. Here, we propose a model of the pathway of the −1 translational frameshifting during ribosome translation of the dnaX −1 frameshift mRNA. With the model, the single-molecule fluorescence data (Chen et al. (2014 [29] on the dynamics of the shunt either to long pausing or to normal translation, the tRNA transit and sampling dynamics in the long-paused rotated state, the EF-G sampling dynamics, the mean rotated-state lifetimes, etc., are explained quantitatively. Moreover, the model is also consistent with the experimental data (Yan et al. (2015 [30] on translocation excursions and broad branching of frameshifting pathways. In addition, we present some predicted results, which can be easily tested by future optical trapping experiments.

  19. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    Directory of Open Access Journals (Sweden)

    Neng Chen

    2014-07-01

    Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.

  20. CFTR-dependent chloride efflux in cystic fibrosis mononuclear cells is increased by ivacaftor therapy.

    Science.gov (United States)

    Guerra, Lorenzo; D'Oria, Susanna; Favia, Maria; Castellani, Stefano; Santostasi, Teresa; Polizzi, Angela M; Mariggiò, Maria A; Gallo, Crescenzio; Casavola, Valeria; Montemurro, Pasqualina; Leonetti, Giuseppina; Manca, Antonio; Conese, Massimo

    2017-07-01

    The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) potentiator ivacaftor (Kalydeco®) improves clinical outcome in G551D cystic fibrosis (CF) patients. Here, we have investigated whether ivacaftor has a clinical impact on non-G551D gating mutations and function of circulating leukocytes as well. Seven patients were treated with ivacaftor and evaluated at baseline, and at 1-3 and 6 months. Besides clinical and systemic inflammatory parameters, circulating mononuclear cells (MNC) were evaluated for CFTR-dependent chloride efflux by spectrofluorimetry, neutrophils for oxidative burst by cytofluorimetry and HVCN1 mRNA expression by real time PCR. Ivacaftor determined a significant decrease in sweat chloride concentrations at all time points during treatment. Body mass index (BMI), FEV 1 , and FVC showed an increasing trend. While C-reactive protein decreased significantly at 2 months, the opposite behavior was noticed for circulating monocytes. CFTR activity in MNC was found to increase significantly at 3 and 6 months. Neutrophil oxidative burst peaked at 2 months and then decreased to baseline. HVCN1 mRNA expression was significantly higher than baseline at 1-3 months and decreased after 6 months of treatment. The chloride efflux in MNC correlated positively with both FEV 1 and FVC. On the other hand, sweat chloride correlated positively with CRP and WBC, and negatively with both respiratory function tests. A cluster analysis confirmed that sweat chloride, FEV 1 , FVC, BMI, and MNC chloride efflux behaved as a single entity over time. In patients with non-G551D mutations, ivacaftor improved both chloride transport in sweat ducts and chloride efflux in MNC, that is, functions directly imputed to CFTR. © 2017 Wiley Periodicals, Inc.

  1. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  2. Orphan missense mutations in the cystic fibrosis transmembrane conductance regulator: A three-step biological approach to establishing a correlation between genotype and phenotype.

    Science.gov (United States)

    Fresquet, Fleur; Clement, Romain; Norez, Caroline; Sterlin, Adélaïde; Melin, Patricia; Becq, Frédéric; Kitzis, Alain; Thoreau, Vincent; Bilan, Frédéric

    2011-09-01

    More than 1860 mutations have been found within the human cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence. These mutations can be classified according to their degree of severity in CF disease. Although the most common mutations are well characterized, few data are available for rare mutations. Thus, genetic counseling is particularly difficult when fetuses or patients with CF present these orphan variations. We describe a three-step in vitro assay that can evaluate rare missense CFTR mutation consequences to establish a correlation between genotype and phenotype. By using a green fluorescent protein-tagged CFTR construct, we expressed mutated proteins in COS-7 cells. CFTR trafficking was visualized by confocal microscopy, and the cellular localization of CFTR was determined using intracellular markers. We studied the CFTR maturation process using Western blot analysis and evaluated CFTR channel activity by automated iodide efflux assays. Of six rare mutations that we studied, five have been isolated in our laboratory. The cellular and functional impact that we observed in each case was compared with the clinical data concerning the patients in whom we encountered these mutations. In conclusion, we propose that performing this type of analysis for orphan CFTR missense mutations can improve CF genetic counseling. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  3. Cystic fibrosis transmembrane conductance regulator intracellular processing, trafficking, and opportunities for mutation-specific treatment.

    LENUS (Irish Health Repository)

    Rogan, Mark P

    2012-02-01

    Recent advances in basic science have greatly expanded our understanding of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR), the chloride and bicarbonate channel that is encoded by the gene, which is mutated in patients with CF. We review the structure, function, biosynthetic processing, and intracellular trafficking of CFTR and discuss the five classes of mutations and their impact on the CF phenotype. The therapeutic discussion is focused on the significant progress toward CFTR mutation-specific therapies. We review the results of encouraging clinical trials examining orally administered therapeutics, including agents that promote read-through of class I mutations (premature termination codons); correctors, which overcome the CFTR misfolding that characterizes the common class II mutation F508del; and potentiators, which enhance the function of class III or IV mutated CFTR at the plasma membrane. Long-term outcomes from successful mutation-specific treatments could finally answer the question that has been lingering since and even before the CFTR gene discovery: Will therapies that specifically restore CFTR-mediated chloride secretion slow or arrest the deleterious cascade of events leading to chronic infection, bronchiectasis, and end-stage lung disease?

  4. Cystic fibrosis transmembrane conductance regulator (CFTR allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Serena Schippa

    Full Text Available INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF. CFTR mutations (F508del is the most common lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1 presence/absence of F508del mutation; 2 disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

  5. Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.

    Science.gov (United States)

    Schippa, Serena; Iebba, Valerio; Santangelo, Floriana; Gagliardi, Antonella; De Biase, Riccardo Valerio; Stamato, Antonella; Bertasi, Serenella; Lucarelli, Marco; Conte, Maria Pia; Quattrucci, Serena

    2013-01-01

    In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

  6. F508del-CFTR rescue: a matter of cell stress response.

    Science.gov (United States)

    Nieddu, Erika; Pollarolo, Benedetta; Merello, Luisa; Schenone, Silvia; Mazzei, Mauro

    2013-01-01

    Cystic fibrosis (CF) is a common inherited fatal disease affecting 70,000 people worldwide, with a median predicted age of survival of approximately 38 years. The deletion of Phenylalanine in position 508 of the Cystic Fibrosis Transmembrane conductance Regulator (F508del-CFTR) is the most common mutation in CF patients: the deleted protein, not properly folded, is degraded. To date no commercial drugs are available. Low temperature, some osmolytes and conditions able to induce heat shock protein 70 (Hsp70) expression and heat shock cognate 70 (Hsc70) inhibition result in F508del-CFTR rescue, hence restoring its physiological function: this review sheds light on the correlation between these several evidences. Interestingly, all these approaches have a role in the cell stress response (CSR), a set of cell reactions to stress. In addition, unpredictably, F508del-CFTR rescue has to be considered in the frame of CSR: entities that induce - or are induced during - the CSR are, in general, also able to correct trafficking defect of CFTR. Specifically, the low temperature induces, by definition, a CSR; osmolytes, such as glycerol and trimethylamine N-oxide (TMAO), are products of the CSR; pharmacological correctors, such as Matrine and 4-phenylbutirric acid (4PBA), down-regulate the constitutive Hsc70 in favor of an up-regulation of the inducible chaperone Hsp70, another component of the CSR. The identification of a common mechanism of action for different types of correctors could drive the discovery of new active molecules in CF, overcoming methods clinically inapplicable, such as the low temperature.

  7. Purinergic regulation of CFTR and Ca2+ -activated Cl- channels and K+ channels in human pancreatic duct epithelium

    DEFF Research Database (Denmark)

    Wang, Jing; Haanes, Kristian A; Novak, Ivana

    2013-01-01

    mutated CFTR, basolateral ATP and UTP had negligible effects. In addition to Cl(-) transport in Capan-1 cells, the effects of 5,6-dichloro-1-ethyl-1,3-dihydro-2H-benzimidazol-2-one (DC-EBIO) and clotrimazole indicated functional expression of the intermediate conductance K(+) channels (IK, KCa3...

  8. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    Directory of Open Access Journals (Sweden)

    Suneeth F Mathew

    Full Text Available HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon' contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1.

  9. Interaction between a novel TGFB1 haplotype and CFTR genotype is associated with improved lung function in cystic fibrosis.

    Science.gov (United States)

    Bremer, Lindsay A; Blackman, Scott M; Vanscoy, Lori L; McDougal, Kathryn E; Bowers, Amanda; Naughton, Kathleen M; Cutler, David J; Cutting, Garry R

    2008-07-15

    Cystic fibrosis (CF), the most common lethal single gene disorder in Caucasians, is due to mutations in the CFTR gene. Twin and sibling analysis indicates that modifier genes, rather than allelic variation in CFTR, are responsible for most of the variability in severity of lung disease, the major cause of mortality in CF patients. We used a family-based approach to test for association between lung function and two functional SNPs (rs1800469, '-509' and rs1982073, 'codon 10') in the 5' region of transforming growth factor-beta1 (TGFB1), a putative CF modifier gene. Quantitative transmission disequilibrium testing of 472 CF patient-parent-parent trios revealed that both TGFB1 SNPs showed significant transmission distortion when patients were stratified by CFTR genotype. Although lung function and nutritional status are correlated in CF patients, there was no evidence of association between the TGFB1 SNPs and variation in nutritional status. Additional tagging SNPs (rs8179181, rs2278422, rs8110090, rs4803455 and rs1982072) that capture most of the diversity in TGFB1 were also typed but none showed association with variation in lung function. However, a haplotype composed of the -509 C and codon 10 T alleles along with the C allele of the 3' SNP rs8179181 was highly associated with increased lung function in patients grouped by CFTR genotype. These results demonstrate that TGFB1 is a modifier of CF lung disease and reveal a previously unrecognized beneficial effect of TGFB1 variants upon the pulmonary phenotype.

  10. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants

    OpenAIRE

    Sánchez, Karen; De Mendonca,Elizabeth; Matute,Xiorama; Chaustre,Ismenia; Villalon,Marlene; Takiff,Howard

    2016-01-01

    Karen Sánchez,1 Elizabeth de Mendonca,1 Xiorama Matute,2 Ismenia Chaustre,2 Marlene Villalón,3 Howard Takiff4 1Unit of Genetic and Forensic Studies, Venezuelan Institute for Scientific Research (IVIC), 2Hospital JM de los Ríos, 3Hospital José Ignacio Baldo, Algodonal, National Reference Unit, 4Laboratory of Molecular Genetics, Venezuelan Institute for Scientific Research (IVIC), Caracas, Venezuela. Abstract: The mutations in the CFTR gene found in ...

  11. Predominant constitutive CFTR conductance in small airways

    Directory of Open Access Journals (Sweden)

    Lytle Christian

    2005-01-01

    Full Text Available Abstract Background The pathological hallmarks of chronic obstructive pulmonary disease (COPD are inflammation of the small airways (bronchiolitis and destruction of lung parenchyma (emphysema. These forms of disease arise from chronic prolonged infections, which are usually never present in the normal lung. Despite the fact that primary hygiene and defense of the airways presumably requires a well controlled fluid environment on the surface of the bronchiolar airway, very little is known of the fluid and electrolyte transport properties of airways of less than a few mm diameter. Methods We introduce a novel approach to examine some of these properties in a preparation of minimally traumatized porcine bronchioles of about 1 mm diameter by microperfusing the intact bronchiole. Results In bilateral isotonic NaCl Ringer solutions, the spontaneous transepithelial potential (TEP; lumen to bath of the bronchiole was small (mean ± sem: -3 ± 1 mV; n = 25, but when gluconate replaced luminal Cl-, the bionic Cl- diffusion potentials (-58 ± 3 mV; n = 25 were as large as -90 mV. TEP diffusion potentials from 2:1 NaCl dilution showed that epithelial Cl- permeability was at least 5 times greater than Na+ permeability. The anion selectivity sequence was similar to that of CFTR. The bionic TEP became more electronegative with stimulation by luminal forskolin (5 μM+IBMX (100 μM, ATP (100 μM, or adenosine (100 μM, but not by ionomycin. The TEP was partially inhibited by NPPB (100 μM, GlyH-101* (5–50 μM, and CFTRInh-172* (5 μM. RT-PCR gave identifying products for CFTR, α-, β-, and γ-ENaC and NKCC1. Antibodies to CFTR localized specifically to the epithelial cells lining the lumen of the small airways. Conclusion These results indicate that the small airway of the pig is characterized by a constitutively active Cl- conductance that is most likely due to CFTR.

  12. A novel frameshift deletion in the albumin gene causes analbuminemia in a young Turkish woman.

    Science.gov (United States)

    Dagnino, Monica; Caridi, Gianluca; Aydin, Zeki; Ozturk, Savas; Karaali, Zeynep; Kazancioglu, Rumeyza; Cefle, Kivanc; Gursu, Meltem; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

    2010-11-11

    Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin. The analbuminemic trait was diagnosed in a young Turkish woman on the basis of her clinical symptoms (bilateral lower limb edema) and biochemical findings (minimal albumin amount and variable increases in other protein fractions). Total DNA from the analbuminemic proband and her parents was PCR-amplified using oligonucleotide primers designed to amplify the 14 exons of the albumin gene (ALB) and the flanking intron regions. The products were screened for mutations by single-strand conformation polymorphism (SSCP) and heteroduplex analyses (HA). HA allowed the identification of the mutation site in exon 12. Direct DNA sequencing of this abnormal fragment revealed that the analbuminemic trait was caused by a homozygous CA deletion at nucleotide positions c. 1614-1615 in the codons for Cys538 and Thr539. The subsequent frameshift should give rise to a putative truncated albumin variant in which the sequence Cys(538)-Thr-Leu-Ser has been changed to Cys(538)-Thr-Phe-Stop. The parents were heterozygous for the same mutation. Gel-based mutation detection and DNA sequencing substantiate the clinical diagnosis of congenital analbuminemia in our patient and show that the condition is caused by a novel mutation within the ALB gene. These results contribute to shed light on the molecular basis of this rare condition. 2010 Elsevier B.V. All rights reserved.

  13. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    Science.gov (United States)

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  14. Structural diversity of frameshifting signals : reprogramming the programmed

    NARCIS (Netherlands)

    Yu, Chien-Hung

    2011-01-01

    Programmed ribosomal frameshifting (PRF) is one kind of recoding events that is mostly utilized by RNA viruses to synthesize more proteins with defined ratio from their compact genome and it is known that the stoichiometric is critical to virus infection and propagation. Two cis-acting RNA elements

  15. Dendrimer-based selective autophagy-induction rescues ΔF508-CFTR and inhibits Pseudomonas aeruginosa infection in cystic fibrosis.

    Directory of Open Access Journals (Sweden)

    Scott Mackenzie Brockman

    Full Text Available Cystic Fibrosis (CF is a genetic disorder caused by mutation(s in the CF-transmembrane conductance regulator (Cftr gene. The most common mutation, ΔF508, leads to accumulation of defective-CFTR protein in aggresome-bodies. Additionally, Pseudomonas aeruginosa (Pa, a common CF pathogen, exacerbates obstructive CF lung pathology. In the present study, we aimed to develop and test a novel strategy to improve the bioavailability and potentially achieve targeted drug delivery of cysteamine, a potent autophagy-inducing drug with anti-bacterial properties, by developing a dendrimer (PAMAM-DEN-based cysteamine analogue.We first evaluated the effect of dendrimer-based cysteamine analogue (PAMAM-DENCYS on the intrinsic autophagy response in IB3-1 cells and observed a significant reduction in Ub-RFP and LC3-GFP co-localization (aggresome-bodies by PAMAM-DENCYS treatment as compared to plain dendrimer (PAMAM-DEN control. Next, we observed that PAMAM-DENCYS treatment shows a modest rescue of ΔF508-CFTR as the C-form. Moreover, immunofluorescence microscopy of HEK-293 cells transfected with ΔF508-CFTR-GFP showed that PAMAM-DENCYS is able to rescue the misfolded-ΔF508-CFTR from aggresome-bodies by inducing its trafficking to the plasma membrane. We further verified these results by flow cytometry and observed significant (p<0.05; PAMAM-DEN vs. PAMAM-DENCYS rescue of membrane-ΔF508-CFTR with PAMAM-DENCYS treatment using non-permeabilized IB3-1 cells immunostained for CFTR. Finally, we assessed the autophagy-mediated bacterial clearance potential of PAMAM-DENCYS by treating IB3-1 cells infected with PA01-GFP, and observed a significant (p<0.01; PAMAM-DEN vs. PAMAM-DENCYS decrease in intracellular bacterial counts by immunofluorescence microscopy and flow cytometry. Also, PAMAM-DENCYS treatment significantly inhibits the growth of PA01-GFP bacteria and demonstrates potent mucolytic properties.We demonstrate here the efficacy of dendrimer-based autophagy

  16. Nutritional Status Improved in Cystic Fibrosis Patients with the G551D Mutation After Treatment with Ivacaftor

    NARCIS (Netherlands)

    Borowitz, Drucy; Lubarsky, Barry; Wilschanski, Michael; Munck, Anne; Gelfond, Daniel; Bodewes, Frank; Schwarzenberg, Sarah Jane

    The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gating mutation G551D prevents sufficient ion transport due to reduced channel-open probability. Ivacaftor, an oral CFTR potentiator, increases the channel-open probability. To further analyze improvements in weight and body mass

  17. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    Science.gov (United States)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  18. Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome.

    Science.gov (United States)

    Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; von Knebel Doeberitz, Magnus

    2010-06-01

    High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n = 69), healthy Lynch syndrome mutation carriers (n = 31) and healthy controls (n = 52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (P = 0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients.

  19. Serum antibodies against frameshift peptides in microsatellite unstable colorectal cancer patients with Lynch syndrome

    Science.gov (United States)

    Reuschenbach, Miriam; Kloor, Matthias; Morak, Monika; Wentzensen, Nicolas; Germann, Anja; Garbe, Yvette; Tariverdian, Mirjam; Findeisen, Peter; Neumaier, Michael; Holinski-Feder, Elke; Doeberitz, Magnus von Knebel

    2014-01-01

    High level microsatellite instability (MSI-H) occurs in about 15% of colorectal cancer (CRCs), either as sporadic cancers or in the context of hereditary non-polyposis cancer (HNPCC) or Lynch syndrome. In MSI-H CRC, mismatch repair deficiency leads to insertion/deletion mutations at coding microsatellites (cMS) and thus to the translation of frameshift peptides (FSPs). FSPs are potent inductors of T cell responses in vitro and in vivo. The present study aims at the identification of FSP-specific humoral immune responses in MSI-H CRC and Lynch syndrome. Sera from patients with history of MSI-H CRC (n=69), healthy Lynch syndrome mutation carriers (n=31) and healthy controls (n=52) were analyzed for antibodies against FSPs using peptide ELISA. Reactivities were measured against FSPs derived from genes frequently mutated in MSI-H CRCs, AIM2, TGFBR2, CASP5, TAF1B, ZNF294, and MARCKS. Antibody reactivity against FSPs was significantly higher in MSI-H CRC patients than in healthy controls (p=0.036, Mann-Whitney) and highest in patients with shortest interval between tumor resection and serum sampling. Humoral immune responses in patients were most frequently directed against FSPs derived from mutated TAF1B (11.6%, 8/69) and TGFBR2 (10.1%, 7/69). Low level FSP-specific antibodies were also detected in healthy mutation carriers. Our results show that antibody responses against FSPs are detectable in MSI-H CRC patients and healthy Lynch syndrome mutation carriers. Based on the high number of defined FSP antigens, measuring FSP-specific humoral immune responses is a highly promising tool for future diagnostic application in MSI-H cancer patients. PMID:19957108

  20. The CFTR-Associated Ligand Arrests the Trafficking of the Mutant ΔF508 CFTR Channel in the ER Contributing to Cystic Fibrosis

    Directory of Open Access Journals (Sweden)

    Emily Bergbower

    2018-01-01

    Full Text Available Background/Aims: The CFTR-Associated Ligand (CAL, a PDZ domain containing protein with two coiled-coil domains, reduces cell surface WT CFTR through degradation in the lysosome by a well-characterized mechanism. However, CAL’s regulatory effect on ΔF508 CFTR has remained almost entirely uninvestigated. Methods: In this study, we describe a previously unknown pathway for CAL by which it regulates the membrane expression of ΔF508 CFTR through arrest of ΔF508 CFTR trafficking in the endoplasmic reticulum (ER using a combination of cell biology, biochemistry and electrophysiology. Results: We demonstrate that CAL is an ER localized protein that binds to ΔF508 CFTR and is degraded in the 26S proteasome. When CAL is inhibited, ΔF508 CFTR retention in the ER decreases and cell surface expression of mature functional ΔF508 CFTR is observed alongside of enhanced expression of plasma membrane scaffolding protein NHERF1. Chaperone proteins regulate this novel process, and ΔF508 CFTR binding to HSP40, HSP90, HSP70, VCP, and Aha1 changes to improve ΔF508 CFTR cell surface trafficking. Conclusion: Our results reveal a pathway in which CAL regulates the cell surface availability and intracellular retention of ΔF508 CFTR.

  1. Gene expression patterns of chicken neuregulin 3 in association with copy number variation and frameshift deletion.

    Science.gov (United States)

    Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho

    2017-07-21

    NRG3 are structural mutations that occurred before the establishment of commercial chicken lines. Our results further suggest that the putative frameshift deletion in exon 2 may potentially affect the expression level of particular isoforms of chicken NRG3.

  2. Screening for calreticulin mutations in a cohort of patients suspected ...

    African Journals Online (AJOL)

    Of the 36 types of insertions and deletions identified, type 1 (a. 52-base pair deletion) and type 2 (a 5-base pair insertion) mutations account for >80% of CALR mutations.[7] Phenotypic differences between type 1 and type 2 carriers have been implicated. [3] All recurrent mutations cause a frameshift in the region encoding.

  3. Compounds that correct F508del-CFTR trafficking can also correct other protein trafficking diseases: an in vitro study using cell lines

    Directory of Open Access Journals (Sweden)

    Sampson Heidi M

    2013-01-01

    Full Text Available Abstract Background Many genetic diseases are due to defects in protein trafficking where the mutant protein is recognized by the quality control systems, retained in the endoplasmic reticulum (ER, and degraded by the proteasome. In many cases, the mutant protein retains function if it can be trafficked to its proper cellular location. We have identified structurally diverse correctors that restore the trafficking and function of the most common mutation causing cystic fibrosis, F508del-CFTR. Most of these correctors do not act directly as ligands of CFTR, but indirectly on other pathways to promote folding and correction. We hypothesize that these proteostasis regulators may also correct other protein trafficking diseases. Methods To test our hypothesis, we used stable cell lines or transient transfection to express 2 well-studied trafficking disease mutations in each of 3 different proteins: the arginine-vasopressin receptor 2 (AVPR2, also known as V2R, the human ether-a-go-go-related gene (KCNH2, also known as hERG, and finally the sulfonylurea receptor 1 (ABCC8, also known as SUR1. We treated cells expressing these mutant proteins with 9 structurally diverse F508del-CFTR correctors that function through different cellular mechanisms and assessed whether correction occurred via immunoblotting and functional assays. Results were deemed significantly different from controls by a one-way ANOVA (p  Results Here we show that F508del-CFTR correctors RDR1, KM60 and KM57 also correct some mutant alleles of other protein trafficking diseases. We also show that one corrector, the cardiac glycoside ouabain, was found to alter the glycosylation of all mutant alleles tested. Conclusions Correctors of F508del-CFTR trafficking might have broader applications to other protein trafficking diseases.

  4. Steviol reduces MDCK Cyst formation and growth by inhibiting CFTR channel activity and promoting proteasome-mediated CFTR degradation.

    Directory of Open Access Journals (Sweden)

    Chaowalit Yuajit

    Full Text Available Cyst enlargement in polycystic kidney disease (PKD involves cAMP-activated proliferation of cyst-lining epithelial cells and transepithelial fluid secretion into the cyst lumen via cystic fibrosis transmembrane conductance regulator (CFTR chloride channel. This study aimed to investigate an inhibitory effect and detailed mechanisms of steviol and its derivatives on cyst growth using a cyst model in Madin-Darby canine kidney (MDCK cells. Among 4 steviol-related compounds tested, steviol was found to be the most potent at inhibiting MDCK cyst growth. Steviol inhibition of cyst growth was dose-dependent; steviol (100 microM reversibly inhibited cyst formation and cyst growth by 72.53.6% and 38.2±8.5%, respectively. Steviol at doses up to 200 microM had no effect on MDCK cell viability, proliferation and apoptosis. However, steviol acutely inhibited forskolin-stimulated apical chloride current in MDCK epithelia, measured with the Ussing chamber technique, in a dose-dependent manner. Prolonged treatment (24 h with steviol (100 microM also strongly inhibited forskolin-stimulated apical chloride current, in part by reducing CFTR protein expression in MDCK cells. Interestingly, proteasome inhibitor, MG-132, abolished the effect of steviol on CFTR protein expression. Immunofluorescence studies demonstrated that prolonged treatment (24 h with steviol (100 microM markedly reduced CFTR expression at the plasma membrane. Taken together, the data suggest that steviol retards MDCK cyst progression in two ways: first by directly inhibiting CFTR chloride channel activity and second by reducing CFTR expression, in part, by promoting proteasomal degradation of CFTR. Steviol and related compounds therefore represent drug candidates for treatment of polycystic kidney disease.

  5. Position-dependent termination and widespread obligatory frameshifting in Euplotes translation

    Energy Technology Data Exchange (ETDEWEB)

    Lobanov, Alexei V.; Heaphy, Stephen M.; Turanov, Anton A.; Gerashchenko, Maxim V.; Pucciarelli, Sandra; Devaraj, Raghul R.; Xie, Fang; Petyuk, Vladislav A.; Smith, Richard D.; Klobutcher, Lawrence A.; Atkins, John F.; Miceli, Cristina; Hatfield, Dolph L.; Baranov, Pavel V.; Gladyshev, Vadim N.

    2016-11-21

    The ribosome can change its reading frame during translation in a process known as programmed ribosomal frameshifting. These rare events are supported by complex mRNA signals. However, we found that the ciliates Euplotes crassus and Euplotes focardii exhibit widespread frameshifting at stop codons. 47 different codons preceding stop signals resulted in either +1 or +2 frameshifts, and +1 frameshifting at AAA was the most frequent. The frameshifts showed unusual plasticity and rapid evolution, and had little influence on translation rates. The proximity of a stop codon to the 3' mRNA end, rather than its occurrence or sequence context, appeared to designate termination. Thus, a ‘stop codon’ is not a sufficient signal for translation termination, and the default function of stop codons in Euplotes is frameshifting, whereas termination is specific to certain mRNA positions and probably requires additional factors.

  6. CFTR is a tumor suppressor gene in murine and human intestinal cancer

    NARCIS (Netherlands)

    Than, B. L. N.; Linnekamp, J. F.; Starr, T. K.; Largaespada, D. A.; Rod, A.; Zhang, Y.; Bruner, V.; Abrahante, J.; Schumann, A.; Luczak, T.; Niemczyk, A.; O'Sullivan, M. G.; Medema, J. P.; Fijneman, R. J. A.; Meijer, G. A.; van den Broek, E.; Hodges, C. A.; Scott, P. M.; Vermeulen, L.; Cormier, R. T.

    2016-01-01

    CFTR, the cystic fibrosis (CF) gene, encodes for the CFTR protein that plays an essential role in anion regulation and tissue homeostasis of various epithelia. In the gastrointestinal (GI) tract CFTR promotes chloride and bicarbonate secretion, playing an essential role in ion and acid-base

  7. Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant

    Energy Technology Data Exchange (ETDEWEB)

    Atwell, Shane; Brouillette, Christie G.; Conners, Kris; Emtage, Spencer; Gheyi, Tarun; Guggino, William B.; Hendle, Jorg; Hunt, John F.; Lewis, Hal A.; Lu, Frances; Protasevich, Irina I.; Rodgers, Logan A.; Romero, Rich; Wasserman, Stephen R.; Weber, Patricia C.; Wetmore, Diana; Zhang, Feiyu F.; Zhao, Xun (Cystic); (UAB); (JHU); (Columbia); (Lilly)

    2010-04-26

    Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646({Delta}405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-{angstrom} resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The {Delta}F508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

  8. Compounds that correct F508del-CFTR trafficking can also correct other protein trafficking diseases: an in vitro study using cell lines

    OpenAIRE

    Sampson Heidi M; Lam Hung; Chen Pei-Chun; Zhang Donglei; Mottillo Cristina; Mirza Myriam; Qasim Karim; Shrier Alvin; Shyng Show-Ling; Hanrahan John W; Thomas David Y

    2013-01-01

    Abstract Background Many genetic diseases are due to defects in protein trafficking where the mutant protein is recognized by the quality control systems, retained in the endoplasmic reticulum (ER), and degraded by the proteasome. In many cases, the mutant protein retains function if it can be trafficked to its proper cellular location. We have identified structurally diverse correctors that restore the trafficking and function of the most common mutation causing cystic fibrosis, F508del-CFTR...

  9. CFTR, Mucins, and Mucus Obstruction in Cystic Fibrosis

    Science.gov (United States)

    Kreda, Silvia M.; Davis, C. William; Rose, Mary Callaghan

    2012-01-01

    Mucus pathology in cystic fibrosis (CF) has been known for as long as the disease has been recognized and is sometimes called mucoviscidosis. The disease is marked by mucus hyperproduction and plugging in many organs, which are usually most fatal in the airways of CF patients, once the problem of meconium ileus at birth is resolved. After the CF gene, CFTR, was cloned and its protein product identified as a cAMP-regulated Cl− channel, causal mechanisms underlying the strong mucus phenotype of the disease became obscure. Here we focus on mucin genes and polymeric mucin glycoproteins, examining their regulation and potential relationships to a dysfunctional cystic fibrosis transmembrane conductance regulator (CFTR). Detailed examination of CFTR expression in organs and different cell types indicates that changes in CFTR expression do not always correlate with the severity of CF disease or mucus accumulation. Thus, the mucus hyperproduction that typifies CF does not appear to be a direct cause of a defective CFTR but, rather, to be a downstream consequence. In organs like the lung, up-regulation of mucin gene expression by inflammation results from chronic infection; however, in other instances and organs, the inflammation may have a non-infectious origin. The mucus plugging phenotype of the β-subunit of the epithelial Na+ channel (βENaC)-overexpressing mouse is proving to be an archetypal example of this kind of inflammation, with a dehydrated airway surface/concentrated mucus gel apparently providing the inflammatory stimulus. Data indicate that the luminal HCO3 − deficiency recently described for CF epithelia may also provide such a stimulus, perhaps by causing a mal-maturation of mucins as they are released onto luminal surfaces. In any event, the path between CFTR dysfunction and mucus hyperproduction has proven tortuous, and its unraveling continues to offer its own twists and turns, along with fascinating glimpses into biology. PMID:22951447

  10. Dystrophin in frameshift deletion patients with Becker Muscular Dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Gangopadhyay, S.B.; Ray, P.N.; Worton, R.G.; Sherratt, T.G.; Heckmatt, J.Z.; Dubowitz, V.; Strong, P.N.; Miller, G. (Penn State College of Medicine, Hershey, PA (United States)); Shokeir, M. (Univ. Hospital, Saskatchewan (Canada))

    1992-09-01

    In a previous study the authors identified 14 cases with Duchenne muscular dystrophy (DMD) or its milder variant, Becker muscular dystrophy (BMD), with a deletion of exons 3-7, a deletion that would be expected to shift the translational reading frame of the mRNA and give a severe phenotype. They have examined dystrophin and its mRNA from muscle biopsies of seven cases with either mild or intermediate phenotypes. In all cases they detected slightly lower-molecular-weight dystrophin in 12%-15% abundance relative to the normal. By sequencing amplified mRNA they have found that exon 2 is spliced to exon 8, a splice that produces a frameshifted mRNA, and have found no evidence for alternate splicing that might be involved in restoration of dystrophin mRNA reading frame in the patients with a mild phenotype. Other transcriptional and posttranscriptional mechanisms such as cryptic promoter, ribosomal frameshifting, and reinitiation are suggested that might play some role in restoring the reading frame. 34 refs., 5 figs. 1 tab.

  11. six novel mutations in the TSC1 and TSC2 genes

    Indian Academy of Sciences (India)

    M. GLUSHKOVA

    2018-04-30

    Apr 30, 2018 ... RESEARCH ARTICLE ... nant disorder caused by inactivating TSC1 or TSC2 gene variants (Van ... premature protein truncation, while missense mutations are rare ..... TSC2 variants in our cohort are missense, frame-shift.

  12. Activation of CFTR by ASBT-mediated bile salt absorption

    NARCIS (Netherlands)

    Bijvelds, MJC; Jorna, H; Verkade, HJ; Bot, AGM; Hofmann, F; Agellon, LB; Sinaasappel, M; de Jonge, HR

    2005-01-01

    In cholangiocytes, bile salt (BS) uptake via the apical sodium-dependent bile acid transporter (ASBT) may evoke ductular flow by enhancing cAMP-mediated signaling to the cystic fibrosis transmembrane conductance regulator (CFTR) anion channel. We considered that ASBT-mediated BS uptake in the distal

  13. Mutation induction in Haemophilus influenzae by ICR-191. Pt. 1

    International Nuclear Information System (INIS)

    Perdue, S.W.; Kimball, R.F.; McGray, P.C.; Tennessee Univ., Oak Ridge

    1981-01-01

    The investigation of mutagenic mechanisms in Haemophilus influenzae has been confined until now to mutagens that normally produce mainly base pair substitutions. This paper describes the development of a system suitable for detecting frameshift mutations induced by ICR-191. The system involves reversions from thymidine dependence to thymidine independence. Evidence is presented from a comparison of the responses to ICR-191 and to N-methyl-N'-nitro-N-nitrosoguanidine that the system is specific for frameshift mutations. The genetic recombination involved in transformation leads to a marked increase in spontaneous reversion of the frameshift mutations but not of the base substitution mutations. Presumably, this is a consequence of mispairing, with consequent change in the number of bases, during the recombination. (orig.)

  14. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  15. Thermodynamic study of the native and phosphorylated regulatory domain of the CFTR

    Energy Technology Data Exchange (ETDEWEB)

    Marasini, Carlotta, E-mail: marasini@ge.ibf.cnr.it [Istituto di Biofisica, Consiglio Nazionale delle Ricerche, Via De Marini 6, 16149 Genova (Italy); Galeno, Lauretta; Moran, Oscar [Istituto di Biofisica, Consiglio Nazionale delle Ricerche, Via De Marini 6, 16149 Genova (Italy)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer CFTR mutations produce cystic fibrosis. Black-Right-Pointing-Pointer Chloride transport depends on the regulatory domain phosphorylation. Black-Right-Pointing-Pointer Regulatory domain is intrinsically disordered. Black-Right-Pointing-Pointer Secondary structure and protein stability change upon phosphorylation. -- Abstract: The regulatory domain (RD) of the cystic fibrosis transmembrane conductance regulator (CFTR), the defective protein in cystic fibrosis, is the region of the channel that regulates the CFTR activity with multiple phosphorylation sites. This domain is an intrinsically disordered protein, characterized by lack of stable or unique tertiary structure. The disordered character of a protein is directly correlated with its function. The flexibility of RD may be important for its regulatory role: the continuous conformational change may be necessary for the progressive phosphorylation, and thus activation, of the channel. However, the lack of a defined and stable structure results in a considerable limitation when trying to in build a unique molecular model for the RD. Moreover, several evidences indicate significant structural differences between the native, non-phosphorylated state, and the multiple phosphorylated state of the protein. The aim of our work is to provide data to describe the conformations and the thermodynamic properties in these two functional states of RD. We have done the circular dichroism (CD) spectra in samples with a different degree of phosphorylation, from the non-phosphorylated state to a bona fide completely phosphorylated state. Analysis of CD spectra showed that the random coil and {beta}-sheets secondary structure decreased with the polypeptide phosphorylation, at expenses of an increase of {alpha}-helix. This observation lead to interpret phosphorylation as a mechanism favoring a more structured state. We also studied the thermal denaturation curves of the protein in the two

  16. Thermodynamic study of the native and phosphorylated regulatory domain of the CFTR

    International Nuclear Information System (INIS)

    Marasini, Carlotta; Galeno, Lauretta; Moran, Oscar

    2012-01-01

    Highlights: ► CFTR mutations produce cystic fibrosis. ► Chloride transport depends on the regulatory domain phosphorylation. ► Regulatory domain is intrinsically disordered. ► Secondary structure and protein stability change upon phosphorylation. -- Abstract: The regulatory domain (RD) of the cystic fibrosis transmembrane conductance regulator (CFTR), the defective protein in cystic fibrosis, is the region of the channel that regulates the CFTR activity with multiple phosphorylation sites. This domain is an intrinsically disordered protein, characterized by lack of stable or unique tertiary structure. The disordered character of a protein is directly correlated with its function. The flexibility of RD may be important for its regulatory role: the continuous conformational change may be necessary for the progressive phosphorylation, and thus activation, of the channel. However, the lack of a defined and stable structure results in a considerable limitation when trying to in build a unique molecular model for the RD. Moreover, several evidences indicate significant structural differences between the native, non-phosphorylated state, and the multiple phosphorylated state of the protein. The aim of our work is to provide data to describe the conformations and the thermodynamic properties in these two functional states of RD. We have done the circular dichroism (CD) spectra in samples with a different degree of phosphorylation, from the non-phosphorylated state to a bona fide completely phosphorylated state. Analysis of CD spectra showed that the random coil and β-sheets secondary structure decreased with the polypeptide phosphorylation, at expenses of an increase of α-helix. This observation lead to interpret phosphorylation as a mechanism favoring a more structured state. We also studied the thermal denaturation curves of the protein in the two conditions, monitoring the changes of the mean residue ellipticity measured at 222 nm as a function of temperature

  17. A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

    Directory of Open Access Journals (Sweden)

    Alexandre Bolze

    Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

  18. The rad2 mutation affects the molecular nature of UV and acridine-mustard-induced mutations in the ADE2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Ivanov, E.L.; Kovaltzova, S.V.; Kassinova, G.V.; Gracheva, L.M.; Korolev, V.G.; Zakharov, I.A.

    1986-01-01

    The authors have studied the molecular nature of ade2 mutations induced by UV light and bifunctional acridine-mustard (BAM) in wild-type (RAD) and in excision-deficient (rad2) strains of the yeast, Saccharomyces cerevisiae. In the RAD strain, UV causes 45% GC → AT transitions among all mutations; in the rad2 strain this value is 77%. BAM was shown to be highly specific for frameshift mutagenesis: 60% frameshifts in the RAD strain, and as many as 84% frameshifts in the rad2 strain were induced. Therefore, the rad2 mutation affects the specificity of UV- and BAM-induced mutagenesis in yeast. Experimental data agree with the view that the majority of mutations in the RAD strain are induced by a prereplicative mechanism, whereas mutations in the rad2 strain are predominantly postreplicative events. (Auth.)

  19. CFTR mediates noradrenaline-induced ATP efflux from DRG neurons.

    Science.gov (United States)

    Kanno, Takeshi; Nishizaki, Tomoyuki

    2011-09-24

    In our earlier study, noradrenaline (NA) stimulated ATP release from dorsal root ganglion (DRG) neurons as mediated via β(3) adrenoceptors linked to G(s) protein involving protein kinase A (PKA) activation, to cause allodynia. The present study was conducted to understand how ATP is released from DRG neurons. In an outside-out patch-clamp configuration from acutely dissociated rat DRG neurons, single-channel currents, sensitive to the P2X receptor inhibitor PPADS, were evoked by approaching the patch-electrode tip close to a neuron, indicating that ATP is released from DRG neurons, to activate P2X receptor. NA increased the frequency of the single-channel events, but such NA effect was not found for DRG neurons transfected with the siRNA to silence the cystic fibrosis transmembrane conductance regulator (CFTR) gene. In the immunocytochemical study using acutely dissociated rat DRG cells, CFTR was expressed in neurons alone, but not satellite cells, fibroblasts, or Schwann cells. It is concluded from these results that CFTR mediates NA-induced ATP efflux from DRG neurons as an ATP channel.

  20. Structure and Dynamics of NBD1 from CFTR Characterized Using Crystallography and Hydrogen/Deuterium Exchange Mass Spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, H.A.; Wang, C.; Zhao, X.; Hamuro, Y.; Conners, K.; Kearins, M.C.; Lu, F.; Sauder, J.M.; Molnar, K.S.; Coales, S.J.; Maloney, P.C.; Guggino, W.B.; Wetmore, D.R.; Weber, P.C.; Hunt, J.F. (SGX); (ExSAR); (Cystic); (JHU-MED); (Columbia)

    2012-04-30

    The {Delta}F508 mutation in nucleotide-binding domain 1 (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) is the predominant cause of cystic fibrosis. Previous biophysical studies on human F508 and {Delta}F508 domains showed only local structural changes restricted to residues 509-511 and only minor differences in folding rate and stability. These results were remarkable because {Delta}F508 was widely assumed to perturb domain folding based on the fact that it prevents trafficking of CFTR out of the endoplasmic reticulum. However, the previously reported crystal structures did not come from matched F508 and {Delta}F508 constructs, and the {Delta}F508 structure contained additional mutations that were required to obtain sufficient protein solubility. In this article, we present additional biophysical studies of NBD1 designed to address these ambiguities. Mass spectral measurements of backbone amide {sup 1}H/{sup 2}H exchange rates in matched F508 and {Delta}F508 constructs reveal that {Delta}F508 increases backbone dynamics at residues 509-511 and the adjacent protein segments but not elsewhere in NBD1. These measurements also confirm a high level of flexibility in the protein segments exhibiting variable conformations in the crystal structures. We additionally present crystal structures of a broader set of human NBD1 constructs, including one harboring the native F508 residue and others harboring the {Delta}F508 mutation in the presence of fewer and different solubilizing mutations. The only consistent conformational difference is observed at residues 509-511. The side chain of residue V510 in this loop is mostly buried in all non-{Delta}F508 structures but completely solvent exposed in all {Delta}F508 structures. These results reinforce the importance of the perturbation {Delta}F508 causes in the surface topography of NBD1 in a region likely to mediate contact with the transmembrane domains of CFTR. However, they also suggest that increased

  1. SHIFT: server for hidden stops analysis in frame-shifted translation.

    Science.gov (United States)

    Gupta, Arun; Singh, Tiratha Raj

    2013-02-23

    Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

  2. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

    Science.gov (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

    2016-09-06

    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Common Β- Thalassaemia Mutations in

    Directory of Open Access Journals (Sweden)

    P Azarfam

    2005-01-01

    Full Text Available Introduction: β –Thalassaemia was first explained by Thomas Cooly as Cooly’s anaemia in 1925. The β- thalassaemias are hereditary autosomal disorders with decreased or absent β-globin chain synthesis. The most common genetic defects in β-thalassaemias are caused by point mutations, micro deletions or insertions within the β-globin gene. Material and Methods: In this research , 142 blood samples (64 from childrens hospital of Tabriz , 15 samples from Shahid Gazi hospital of Tabriz , 18 from Urumia and 45 samples from Aliasghar hospital of Ardebil were taken from thalassaemic patients (who were previously diagnosed .Then 117 non-familial samples were selected . The DNA of the lymphocytes of blood samples was extracted by boiling and Proteinase K- SDS procedure, and mutations were detected by ARMS-PCR methods. Results: From the results obtained, eleven most common mutations,most of which were Mediterranean mutations were detected as follows; IVS-I-110(G-A, IVS-I-1(G-A ،IVS-I-5(G-C ,Frameshift Codon 44 (-C,( codon5(-CT,IVS-1-6(T-C, IVS-I-25(-25bp del ,Frameshift 8.9 (+G ,IVS-II-1(G-A ,Codon 39(C-T, Codon 30(G-C the mutations of the samples were defined. The results showed that Frameshift 8.9 (+G, IVS-I-110 (G-A ,IVS-II-I(G-A, IVS-I-5(G-C, IVS-I-1(G-A , Frameshift Codon 44(-C , codon5(-CT , IVS-1-6(T-C , IVS-I-25(-25bp del with a frequency of 29.9%, 25.47%,17.83%, 7.00%, 6.36% , 6.63% , 3.8% , 2.5% , 0.63% represented the most common mutations in North - west Iran. No mutations in Codon 39(C-T and Codon 30(G-C were detected. Cunclusion: The frequency of the same mutations in patients from North - West of Iran seems to be different as compared to other regions like Turkey, Pakistan, Lebanon and Fars province of Iran. The pattern of mutations in this region is more or less the same as in the Mediterranean region, but different from South west Asia and East Asia.

  4. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    Science.gov (United States)

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  5. Cftr Modulates Wnt/β-Catenin Signaling and Stem Cell Proliferation in Murine Intestine

    Directory of Open Access Journals (Sweden)

    Ashlee M. Strubberg

    2018-01-01

    Conclusions: CF intestine shows increased ISC proliferation and Wnt/β-catenin signaling. Loss of Cftr increases pHi in ISCs, which stabilizes the plasma membrane association of the Wnt transducer Dvl, likely facilitating Wnt/β-catenin signaling. Absence of Cftr-dependent suppression of ISC proliferation in the CF intestine may contribute to increased risk for intestinal tumors.

  6. Rescuing mutant CFTR: a multi-task approach to a better outcome in treating cystic fibrosis.

    Science.gov (United States)

    Amaral, Margarida D; Farinha, Carlos M

    2013-01-01

    Correcting multiple defects of mutant CFTR with small molecule compounds has been the goal of an increasing number of recent Cystic Fibrosis (CF) drug discovery programmes. However, the mechanism of action (MoA) by which these molecules restore mutant CFTR is still poorly understood, in particular of CFTR correctors, i.e., compounds rescuing to the cells surface the most prevalent mutant in CF patients--F508del-CFTR. However, there is increasing evidence that to fully restore the multiple defects associated with F508del-CFTR, different small molecules with distinct corrective properties may be required. Towards this goal, a better insight into MoA of correctors is needed and several constraints should be addressed. The methodological approaches to achieve this include: 1) testing the combined effect of compounds with that of other (non-pharmacological) rescuing strategies (e.g., revertants or low temperature); 2) assessing effects in multiple cellular models (non-epithelial vs epithelial, non-human vs human, immortalized vs primary cultures, polarized vs non polarized, cells vs tissues); 3) assessing compound effects on isolated CFTR domains (e.g., compound binding by surface plasmon resonance, assessing effects on domain folding and aggregation); and finally 4) assessing compounds specificity in rescuing different CFTR mutants and other mutant proteins. These topics are reviewed and discussed here so as to provide a state-of-the art review on how to combine multiple ways of rescuing mutant CFTR to the ultimate benefit of CF patients.

  7. Evaluation of potential regulatory elements identified as DNase I hypersensitive sites in the CFTR gene

    DEFF Research Database (Denmark)

    Phylactides, M.; Rowntree, R.; Nuthall, H.

    2002-01-01

    hypersensitive sites (DHS) within the locus. We previously identified at least 12 clusters of DHS across the CFTR gene and here further evaluate DHS in introns 2,3,10,16,17a, 18, 20 and 21 to assess their functional importance in regulation of CFTR gene expression. Transient transfections of enhancer/reporter...

  8. TNF Lectin-Like Domain Restores Epithelial Sodium Channel Function in Frameshift Mutants Associated with Pseudohypoaldosteronism Type 1B

    Directory of Open Access Journals (Sweden)

    Anita Willam

    2017-05-01

    Full Text Available Previous in vitro studies have indicated that tumor necrosis factor (TNF activates amiloride-sensitive epithelial sodium channel (ENaC current through its lectin-like (TIP domain, since cyclic peptides mimicking the TIP domain (e.g., solnatide, showed ENaC-activating properties. In the current study, the effects of TNF and solnatide on individual ENaC subunits or ENaC carrying mutated glycosylation sites in the α-ENaC subunit were compared, revealing a similar mode of action for TNF and solnatide and corroborating the previous assumption that the lectin-like domain of TNF is the relevant molecular structure for ENaC activation. Accordingly, TNF enhanced ENaC current by increasing open probability of the glycosylated channel, position N511 in the α-ENaC subunit being identified as the most important glycosylation site. TNF significantly increased Na+ current through ENaC comprising only the pore forming subunits α or δ, was less active in ENaC comprising only β-subunits, and showed no effect on ENaC comprising γ-subunits. TNF did not increase the membrane abundance of ENaC subunits to the extent observed with solnatide. Since the α-subunit is believed to play a prominent role in the ENaC current activating effect of TNF and TIP, we investigated whether TNF and solnatide can enhance αβγ-ENaC current in α-ENaC loss-of-function frameshift mutants. The efficacy of solnatide has been already proven in pathological conditions involving ENaC in phase II clinical trials. The frameshift mutations αI68fs, αT169fs, αP197fs, αE272fs, αF435fs, αR438fs, αY447fs, αR448fs, αS452fs, and αT482fs have been reported to cause pseudohypoaldosteronism type 1B (PHA1B, a rare, life-threatening, salt-wasting disease, which hitherto has been treated only symptomatically. In a heterologous expression system, all frameshift mutants showed significantly reduced amiloride-sensitive whole-cell current compared to wild type αβγ-ENaC, whereas membrane

  9. Embryonal rhabdomyosarcoma in a patient with a heterozygous frameshift variant in the DICER1 gene and additional manifestations of the DICER1 syndrome.

    Science.gov (United States)

    Fremerey, Julia; Balzer, Stefan; Brozou, Triantafyllia; Schaper, Joerg; Borkhardt, Arndt; Kuhlen, Michaela

    2017-07-01

    Germline mutations in the DICER1 gene are associated with an inherited cancer predisposition syndrome also known as the DICER1-syndrome, which is implicated in a broad range of tumors including pleuropulmonary blastoma, ovarian Sertoli-Leydig cell tumors, ciliary body medulloepithelioma (CBME), pituitary blastoma, embryonal rhabdomyosarcoma (eRMS), anaplastic renal sarcoma as well as ocular, sinonasal tumors ovarian sex-cord tumors, thyroid neoplasia and cystic nephroma. This study describes a novel, heterozygous frameshift DICER1 mutation in a patient, who is affected by different tumors of the DICER1-syndrome, including eRMS, CBME and suspected pleuropulmonary blastoma type I. By whole-exome sequencing of germline material using peripheral blood-derived DNA, we identified a single base pair duplication within the DICER1 gene (c.3405 dupA) that leads to a frameshift and results in a premature stop in exon 21 (p.Gly1136Arg). The metachronous occurrence of two unrelated tumor entities (eRMS and CBME) in a very young child within a short timeframe should have raised the suspicion of an underlying cancer susceptibility syndrome and should be prompt tested for DICER1.

  10. Rab4GTPase modulates CFTR function by impairing channel expression at plasma membrane

    International Nuclear Information System (INIS)

    Saxena, Sunil K.; Kaur, Simarna; George, Constantine

    2006-01-01

    Cystic fibrosis (CF), an autosomal recessive disorder, is caused by the disruption of biosynthesis or the function of a membrane cAMP-activated chloride channel, CFTR. CFTR regulatory mechanisms include recruitment of channel proteins to the cell surface from intracellular pools and by protein-protein interactions. Rab proteins are small GTPases involved in regulated trafficking controlling vesicle docking and fusion. Rab4 controls recycling events from endosome to the plasma membrane, fusion, and degradation. The colorectal cell line HT-29 natively expresses CFTR and responds to cAMP stimulation with an increase in CFTR-mediated currents. Rab4 over-expression in HT-29 cells inhibits both basal and cAMP-stimulated CFTR-mediated currents. GTPase-deficient Rab4Q67L and GDP locked Rab4S22N both inhibit channel activity, which appears characteristically different. Active status of Rab4 was confirmed by GTP overlay assay, while its expression was verified by Western blotting. The pull-down and immunoprecipitation experiments suggest that Rab4 physically interacts with CFTR through protein-protein interaction. Biotinylation with cell impermeant NHS-Sulfo-SS-Biotin implies that Rab4 impairs CFTR expression at cell surface. The enhanced cytosolic CFTR indicates that Rab4 expression restrains CFTR appearance at the cell membrane. The study suggests that Rab4 regulates the channel through multiple mechanisms that include protein-protein interaction, GTP/GDP exchange, and channel protein trafficking. We propose that Rab4 is a dynamic molecule with a significant role in CFTR function

  11. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients

    DEFF Research Database (Denmark)

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J

    2013-01-01

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomi...

  12. A natural frameshift mutation in Campanula EIL2 correlates with ethylene insensitivity in flowers

    DEFF Research Database (Denmark)

    Jensen, Line; Hegelund, Josefine Nymark; Olsen, Andreas

    2016-01-01

    BACKGROUND: The phytohormone ethylene plays a central role in development and senescence of climacteric flowers. In ornamental plant production, ethylene sensitive plants are usually protected against negative effects of ethylene by application of chemical inhibitors. In Campanula, flowers...... are sensitive to even minute concentrations of ethylene. RESULTS: Monitoring flower longevity in three Campanula species revealed C. portenschlagiana (Cp) as ethylene sensitive, C. formanekiana (Cf) with intermediate sensitivity and C. medium (Cm) as ethylene insensitive. We identified key elements in ethylene...... signal transduction, specifically in Ethylene Response Sensor 2 (ERS2), Constitutive Triple Response 1 (CTR1) and Ethylene Insensitive 3- Like 1 and 2 (EIL1 and EIL2) homologous. Transcripts of ERS2, CTR1 and EIL1 were constitutively expressed in all species both throughout flower development...

  13. Novel compound heterozygous frameshift mutations of C2orf37 in a ...

    Indian Academy of Sciences (India)

    uterus with two thin-walled cysts in the right half of the pelvis with no ... including intellectual disability, deafness, hypogonadism, alo- pecia and diabetes ... for more study and research on the key roles played by the nucleolus in humans.

  14. A frameshift mutation in GON4L is associated with proportionate dwarfism in Fleckvieh cattle

    OpenAIRE

    Schwarzenbacher, Hermann; Wurmser, Christine M.; Flisikowski, Krzysztof; Misurova, Lubica; Jung, Simone; Langenmayer, Martin C.; Schnieke, Angelika; Knubben-Schweizer, Gabriela; Fries, Ruedi; Pausch, Hubert

    2016-01-01

    Background Low birth weight and postnatal growth restriction are the most evident symptoms of dwarfism. Accompanying skeletal aberrations may compromise the general condition and locomotion of affected individuals. Several paternal half-sibs with a low birth weight and a small size were born in 2013 in the Fleckvieh cattle population. Results Affected calves were strikingly underweight at birth in spite of a normal gestation length and had craniofacial abnormalities such as elongated narrow h...

  15. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang

    2012-01-01

    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  16. The cystic fibrosis transmembrane recruiter the alter ego of CFTR as a multi-kinase anchor.

    Science.gov (United States)

    Mehta, Anil

    2007-11-01

    This review focuses on a newly discovered interaction between protein kinases involved in cellular energetics, a process that may be disturbed in cystic fibrosis for unknown reasons. I propose a new model where kinase-mediated cellular transmission of energy provides mechanistic insight to a latent role of the cystic fibrosis transmembrane conductance regulator (CFTR). I suggest that CFTR acts as a multi-kinase recruiter to the apical epithelial membrane. My group finds that, in the cytosol, two protein kinases involved in cell energy homeostasis, nucleoside diphosphate kinase (NDPK) and AMP-activated kinase (AMPK), bind one another. Preliminary data suggest that both can also bind CFTR (function unclear). The disrupted role of this CFTR-kinase complex as 'membrane transmitter to the cell' is proposed as an alternative paradigm to the conventional ion transport mediated and CFTR/chloride-centric view of cystic fibrosis pathogenesis. Chloride remains important, but instead, chloride-induced control of the phosphohistidine content of one kinase component (NDPK, via a multi-kinase complex that also includes a third kinase, CK2; formerly casein kinase 2). I suggest that this complex provides the necessary near-equilibrium conditions needed for efficient transmission of phosphate energy to proteins controlling cellular energetics. Crucially, a new role for CFTR as a kinase controller is proposed with ionic concentration acting as a signal. The model posits a regulatory control relay for energy sensing involving a cascade of protein kinases bound to CFTR.

  17. Advancing clinical development pathways for new CFTR modulators in cystic fibrosis.

    Science.gov (United States)

    Mayer-Hamblett, Nicole; Boyle, Michael; VanDevanter, Donald

    2016-05-01

    Cystic fibrosis (CF) is a life-shortening genetic disease affecting approximately 70,000 individuals worldwide. Until recently, drug development efforts have emphasised therapies treating downstream signs and symptoms resulting from the underlying CF biological defect: reduced function of the CF transmembrane conductance regulator (CFTR) protein. The current CF drug development landscape has expanded to include therapies that enhance CFTR function by either restoring wild-type CFTR protein expression or increasing (modulating) the function of mutant CFTR proteins in cells. To date, two systemic small-molecule CFTR modulators have been evaluated in pivotal clinical trials in individuals with CF and specific mutant CFTR genotypes that have led to regulatory review and/or approval. Advances in the discovery of CFTR modulators as a promising new class of therapies have been impressive, yet work remains to develop highly effective, disease-modifying modulators for individuals of all CF genotypes. The objectives of this review are to outline the challenges and opportunities in drug development created by systemic genotype-specific CFTR modulators, highlight the advantages of sweat chloride as an established biomarker of CFTR activity to streamline early-phase development and summarise options for later phase clinical trial designs that respond to the adoption of approved genotype-specific modulators into standard of care. An optimal development framework will be needed to move the most promising therapies efficiently through the drug development pipeline and ultimately deliver efficacious and safe therapies to all individuals with CF. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  18. Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy

    Directory of Open Access Journals (Sweden)

    Nardone Anna

    2004-04-01

    Full Text Available Abstract Background Cystic fibrosis (CF is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000 and functionally important polymorphisms (>200. Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. Methods We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy characterised by an extensive allelic heterogeneity. Results We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R and one microdeletion (4167delCTAAGCC. Conclusion Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%.

  19. Molecular mechanisms of induced-mutations

    International Nuclear Information System (INIS)

    Kato, Takeshi

    1985-01-01

    The outcome of recent studies on mechanisms of induced-mutations is outlined with particular emphasis on the dependence of recA gene function in Escherichia coli. Genes involved in spontaneous mutation and x-ray- and chemical-induced mutation and genes involved in adaptive response are presented. As for SOS mutagenesis, SOS-induced regulation mechanisms and mutagenic routes are described. Furthermore, specificity of mutagens themselves are discussed in relation to mechanisms of base substitution, frameshift, and deletion mutagenesis. (Namekawa, K.)

  20. A survey of detergents for the purification of stable, active human cystic fibrosis transmembrane conductance regulator (CFTR).

    Science.gov (United States)

    Hildebrandt, Ellen; Zhang, Qinghai; Cant, Natasha; Ding, Haitao; Dai, Qun; Peng, Lingling; Fu, Yu; DeLucas, Lawrence J; Ford, Robert; Kappes, John C; Urbatsch, Ina L

    2014-11-01

    Structural knowledge of the cystic fibrosis transmembrane conductance regulator (CFTR) requires developing methods to purify and stabilize this aggregation-prone membrane protein above 1mg/ml. Starting with green fluorescent protein- and epitope-tagged human CFTR produced in mammalian cells known to properly fold and process CFTR, we devised a rapid tandem affinity purification scheme to minimize CFTR exposure to detergent in order to preserve its ATPase function. We compared a panel of detergents, including widely used detergents (maltosides, neopentyl glycols (MNG), C12E8, lysolipids, Chaps) and innovative detergents (branched alkylmaltosides, facial amphiphiles) for CFTR purification, function, monodispersity and stability. ATPase activity after reconstitution into proteoliposomes was 2-3 times higher when CFTR was purified using facial amphiphiles. ATPase activity was also demonstrated in purified CFTR samples without detergent removal using a novel lipid supplementation assay. By electron microscopy, negatively stained CFTR samples were monodisperse at low concentration, and size exclusion chromatography showed a predominance of monomer even after CFTR concentration above 1mg/ml. Rates of CFTR aggregation quantified in an electrophoretic mobility shift assay showed that detergents which best preserved reconstituted ATPase activity also supported the greatest stability, with CFTR monomer half-lives of 6-9days in MNG or Chaps, and 12-17days in facial amphiphile. Cryoelectron microscopy of concentrated CFTR in MNG or facial amphiphile confirmed mostly monomeric protein, producing low resolution reconstructions in conformity with similar proteins. These protocols can be used to generate samples of pure, functional, stable CFTR at concentrations amenable to biophysical characterization. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. CFTR chloride channel as a molecular target of anthraquinone compounds in herbal laxatives

    Science.gov (United States)

    Yang, Hong; Xu, Li-na; He, Cheng-yan; Liu, Xin; Fang, Rou-yu; Ma, Tong-hui

    2011-01-01

    Aim: To clarify whether CFTR is a molecular target of intestinal fluid secretion caused by the anthraquinone compounds from laxative herbal plants. Methods: A cell-based fluorescent assay to measure I− influx through CFTR chloride channel. A short-circuit current assay to measure transcellular Cl− current across single layer FRT cells and freshly isolated colon mucosa. A closed loop experiment to measure colon fluid secretion in vivo. Results: Anthraquinone compounds rhein, aloe-emodin and 1,8-dihydroxyanthraquinone (DHAN) stimulated I− influx through CFTR chloride channel in a dose-dependent manner in the presence of physiological concentration of cAMP. In the short-circuit current assay, the three compound enhanced Cl− currents in epithelia formed by CFTR-expressing FRT cells with EC50 values of 73±1.4, 56±1.7, and 50±0.5μmol/L, respectively, and Rhein also enhanced Cl− current in freshly isolated rat colonic mucosa with a similar potency. These effects were completely reversed by the CFTR selective blocker CFTRinh-172. In in vivo closed loop experiments, rhein 2 mmol/L stimulated colonic fluid accumulation that was largely blocked by CFTRinh-172. The anthraquinone compounds did not elevate cAMP level in cultured FRT cells and rat colonic mucosa, suggesting a direct effect on CFTR activity. Conclusion: Natural anthraquinone compounds in vegetable laxative drugs are CFTR potentiators that stimulated colonic chloride and fluid secretion. Thus CFTR chloride channel is a molecular target of vegetable laxative drugs. PMID:21602836

  2. A host defense mechanism involving CFTR-mediated bicarbonate secretion in bacterial prostatitis.

    Directory of Open Access Journals (Sweden)

    Chen Xie

    Full Text Available BACKGROUND: Prostatitis is associated with a characteristic increase in prostatic fluid pH; however, the underlying mechanism and its physiological significance have not been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: In this study a primary culture of rat prostatic epithelial cells and a rat prostatitis model were used. Here we reported the involvement of CFTR, a cAMP-activated anion channel conducting both Cl(- and HCO(3(-, in mediating prostate HCO(3(- secretion and its possible role in bacterial killing. Upon Escherichia coli (E. coli-LPS challenge, the expression of CFTR and carbonic anhydrase II (CA II, along with several pro-inflammatory cytokines was up-regulated in the primary culture of rat prostate epithelial cells. Inhibiting CFTR function in vitro or in vivo resulted in reduced bacterial killing by prostate epithelial cells or the prostate. High HCO(3(- content (>50 mM, rather than alkaline pH, was found to be responsible for bacterial killing. The direct action of HCO(3(- on bacterial killing was confirmed by its ability to increase cAMP production and suppress bacterial initiation factors in E. coli. The relevance of the CFTR-mediated HCO(3(- secretion in humans was demonstrated by the upregulated expression of CFTR and CAII in human prostatitis tissues. CONCLUSIONS/SIGNIFICANCE: The CFTR and its mediated HCO(3(- secretion may be up-regulated in prostatitis as a host defense mechanism.

  3. Birt-Hogg-Dubé syndrome: novel FLCN frameshift deletion in daughter and father with renal cell carcinomas.

    Science.gov (United States)

    Näf, Ernst; Laubscher, Dominik; Hopfer, Helmut; Streit, Markus; Matyas, Gabor

    2016-01-01

    Germline mutation of the FLCN gene causes Birt-Hogg-Dubé syndrome (BHD), a rare autosomal dominant condition characterized by skin fibrofolliculomas, lung cysts, spontaneous pneumothorax and renal tumours. We identified a hitherto unreported pathogenic FLCN frameshift deletion c.563delT (p.Phe188Serfs*35) in a family of a 46-year-old woman presented with macrohematuria due to bilateral chromophobe renal carcinomas. A heritable renal cancer was suspected due to the bilaterality of the tumour and as the father of this woman had suffered from renal cancer. Initially, however, BHD was overlooked by the medical team despite the highly suggestive clinical presentation. We assume that BHD is underdiagnosed, at least partially, due to low awareness of this variable condition and to insufficient use of appropriate genetic testing. Our study indicates that BHD and FLCN testing should be routinely considered in patients with positive family or personal history of renal tumours. In addition, we demonstrate how patients and their families can play a driving role in initiating genetic diagnosis, presymptomatic testing of at-risk relatives, targeted disease management, and genetic counselling of rare diseases such as BHD.

  4. Involvement of the Cdc42 pathway in CFTR post-translational turnover and in its plasma membrane stability in airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Romain Ferru-Clément

    Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR is a chloride channel that is expressed on the apical plasma membrane (PM of epithelial cells. The most common deleterious allele encodes a trafficking-defective mutant protein undergoing endoplasmic reticulum-associated degradation (ERAD and presenting lower PM stability. In this study, we investigated the involvement of the Cdc42 pathway in CFTR turnover and trafficking in a human bronchiolar epithelial cell line (CFBE41o- expressing wild-type CFTR. Cdc42 is a small GTPase of the Rho family that fulfils numerous cell functions, one of which is endocytosis and recycling process via actin cytoskeleton remodelling. When we treated cells with chemical inhibitors such as ML141 against Cdc42 and wiskostatin against the downstream effector N-WASP, we observed that CFTR channel activity was inhibited, in correlation with a decrease in CFTR amount at the cell surface and an increase in dynamin-dependent CFTR endocytosis. Anchoring of CFTR to the cortical cytoskeleton was then presumably impaired by actin disorganization. When we performed siRNA-mediated depletion of Cdc42, actin polymerization was not impacted, but we observed actin-independent consequences upon CFTR. Total and PM CFTR amounts were increased, resulting in greater activation of CFTR. Pulse-chase experiments showed that while CFTR degradation was slowed, CFTR maturation through the Golgi apparatus remained unaffected. In addition, we observed increased stability of CFTR in PM and reduction of its endocytosis. This study highlights the involvement of the Cdc42 pathway at several levels of CFTR biogenesis and trafficking: (i Cdc42 is implicated in the first steps of CFTR biosynthesis and processing; (ii it contributes to the stability of CFTR in PM via its anchoring to cortical actin; (iii it promotes CFTR endocytosis and presumably its sorting toward lysosomal degradation.

  5. Calreticulin Mutations in Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Noa Lavi

    2014-10-01

    Full Text Available With the discovery of the JAK2V617F mutation in patients with Philadelphia chromosome-negative (Ph− myeloproliferative neoplasms (MPNs in 2005, major advances have been made in the diagnosis of MPNs, in understanding of their pathogenesis involving the JAK/STAT pathway, and finally in the development of novel therapies targeting this pathway. Nevertheless, it remains unknown which mutations exist in approximately one-third of patients with non-mutated JAK2 or MPL essential thrombocythemia (ET and primary myelofibrosis (PMF. At the end of 2013, two studies identified recurrent mutations in the gene encoding calreticulin (CALR using whole-exome sequencing. These mutations were revealed in the majority of ET and PMF patients with non-mutated JAK2 or MPL but not in polycythemia vera patients. Somatic 52-bp deletions (type 1 mutations and recurrent 5-bp insertions (type 2 mutations in exon 9 of the CALR gene (the last exon encoding the C-terminal amino acids of the protein calreticulin were detected and found always to generate frameshift mutations. All detected mutant calreticulin proteins shared a novel amino acid sequence at the C-terminal. Mutations in CALR are acquired early in the clonal history of the disease, and they cause activation of JAK/STAT signaling. The CALR mutations are the second most frequent mutations in Ph− MPN patients after the JAK2V617F mutation, and their detection has significantly improved the diagnostic approach for ET and PMF. The characteristics of the CALR mutations as well as their diagnostic, clinical, and pathogenesis implications are discussed in this review.

  6. A European regulatory perspective on cystic fibrosis: current treatments, trends in drug development and translational challenges for CFTR modulators.

    Science.gov (United States)

    Ponzano, Stefano; Nigrelli, Giulia; Fregonese, Laura; Eichler, Irmgard; Bertozzi, Fabio; Bandiera, Tiziano; Galietta, Luis J V; Papaluca, Marisa

    2018-06-30

    In this article we analyse the current authorised treatments and trends in early drug development for cystic fibrosis (CF) in the European Union for the time period 2000-2016. The analysis indicates a significant improvement in the innovation and development of new potential medicines for CF, shifting from products that act on the symptoms of the disease towards new therapies targeting the cause of CF. However, within these new innovative medicines, results for CF transmembrane conductance regulator (CFTR) modulators indicate that one major challenge for turning a CF concept product into an actual medicine for the benefit of patients resides in the fact that, although pre-clinical models have shown good predictability for certain mutations, a good correlation to clinical end-points or biomarkers ( e.g. forced expiratory volume in 1 s and sweat chloride) for all mutations has not yet been achieved. In this respect, the use of alternative end-points and innovative nonclinical models could be helpful for the understanding of those translational discrepancies. Collaborative endeavours to promote further research and development in these areas as well as early dialogue with the regulatory bodies available at the European competent authorities are recommended. Copyright ©ERS 2018.

  7. Rab-GDI complex dissociation factor expressed through translational frameshifting in filamentous ascomycetes.

    Directory of Open Access Journals (Sweden)

    Fabienne Malagnac

    Full Text Available In the model fungus Podospora anserina, the PaYIP3 gene encoding the orthologue of the Saccharomyces cerevisiae YIP3 Rab-GDI complex dissociation factor expresses two polypeptides, one of which, the long form, is produced through a programmed translation frameshift. Inactivation of PaYIP3 results in slightly delayed growth associated with modification in repartition of fruiting body on the thallus, along with reduced ascospore production on wood. Long and short forms of PaYIP3 are expressed in the mycelium, while only the short form appears expressed in the maturing fruiting body (perithecium. The frameshift has been conserved over the evolution of the Pezizomycotina, lasting for over 400 million years, suggesting that it has an important role in the wild.

  8. Rab-GDI complex dissociation factor expressed through translational frameshifting in filamentous ascomycetes.

    Science.gov (United States)

    Malagnac, Fabienne; Fabret, Céline; Prigent, Magali; Rousset, Jean-Pierre; Namy, Olivier; Silar, Philippe

    2013-01-01

    In the model fungus Podospora anserina, the PaYIP3 gene encoding the orthologue of the Saccharomyces cerevisiae YIP3 Rab-GDI complex dissociation factor expresses two polypeptides, one of which, the long form, is produced through a programmed translation frameshift. Inactivation of PaYIP3 results in slightly delayed growth associated with modification in repartition of fruiting body on the thallus, along with reduced ascospore production on wood. Long and short forms of PaYIP3 are expressed in the mycelium, while only the short form appears expressed in the maturing fruiting body (perithecium). The frameshift has been conserved over the evolution of the Pezizomycotina, lasting for over 400 million years, suggesting that it has an important role in the wild.

  9. Laser desorption mass spectrometry for point mutation detection

    Energy Technology Data Exchange (ETDEWEB)

    Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others

    1996-10-01

    A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments generated by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.

  10. Laser desorption mass spectrometry for point mutation detection

    Energy Technology Data Exchange (ETDEWEB)

    Taranenko, N.I.; Chung, C.N.; Zhu, Y.F. [Oak Ridge National Lab., TN (United States)] [and others

    1996-12-31

    A point mutation can be associated with the pathogenesis of inherited or acquired diseases. Laser desorption mass spectrometry coupled with allele specific polymerase chain reaction (PCR) was first used for point mutation detection. G551D is one of several mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene present in 1-3% of the mutant CFTR alleles in most European populations. In this work, two different approaches were pursued to detect G551D point mutation in the cystic fibrosis gene. The strategy is to amplify the desired region of DNA template by PCR using two primers that overlap one base at the site of the point mutation and which vary in size. If the two primers based on the normal sequence match the target DNA sequence, a normal PCR product will be produced. However, if the alternately sized primers that match the mutant sequence recognize the target DNA, an abnormal PCR product will be produced. Thus, the mass spectrometer can be used to identify patients that are homozygous normal, heterozygous for a mutation or homozygous abnormal at a mutation site. Another approach to identify similar mutations is the use of sequence specific restriction enzymes which respond to changes in the DNA sequence. Mass spectrometry is used to detect the length of the restriction fragments by digestion of a PCR generated target fragment. 21 refs., 10 figs., 2 tabs.

  11. Altered intestinal bile salt biotransformation in a cystic fibrosis (Cftr-/-) mouse model with hepato-biliary pathology.

    Science.gov (United States)

    Bodewes, Frank A J A; van der Wulp, Mariëtte Y M; Beharry, Satti; Doktorova, Marcela; Havinga, Rick; Boverhof, Renze; James Phillips, M; Durie, Peter R; Verkade, Henkjan J

    2015-07-01

    Cftr(-/-tm1Unc) mice develop progressive hepato-biliary pathology. We hypothesize that this liver pathology is related to alterations in biliary bile hydrophobicity and bile salt metabolism in Cftr(-/-tm1Unc) mice. We determined bile production, biliary and fecal bile salt- and lipid compositions and fecal bacterial composition of C57BL/6J Cftr(-/-tm1Unc) and control mice. We found no differences between the total biliary bile salt or lipid concentrations of Cftr(-/-) and controls. Compared to controls, Cftr(-/-) mice had a ~30% higher bile production and a low bile hydrophobicity, related to a ~7 fold higher concentration of the choleretic and hydrophilic bile salt ursocholate. These findings coexisted with a significantly smaller quantity of fecal Bacteroides bacteria. Liver pathology in Cftr(-/-tm1Unc) is not related to increased bile hydrophobicity. Cftr(-/-) mice do however display a biliary phenotype characterized by increased bile production and decreased biliary hydrophobicity. Our findings suggest Cftr dependent, alterations in intestinal bacterial biotransformation of bile salts. Copyright © 2014. Published by Elsevier B.V.

  12. Resveratrol increases F508del-CFTR dependent salivary secretion in cystic fibrosis mice

    Directory of Open Access Journals (Sweden)

    Barbara Dhooghe

    2015-07-01

    Full Text Available Cystic fibrosis (CF is a fatal genetic disease associated with widespread exocrine gland dysfunction. Studies have suggested activating effects of resveratrol, a naturally-occurring polyphenol compound with antioxidant and anti-inflammatory properties, on CF transmembrane conductance regulator (CFTR protein function. We assayed, in F508del-CFTR homozygous (CF and in wild-type mice, the effect of resveratrol on salivary secretion in basal conditions, in response to inhibition by atropine (basal β-adrenergic-dependent component and to stimulation by isoprenaline (CFTR-dependent component. Both components of the salivary secretion were smaller in CF mice than in controls. Two hours after intraperitoneal administration of resveratrol (50 mg/kg dissolved in DMSO, the compound was detected in salivary glands. As in both CF and in wild-type mice, DMSO alone increased the response to isoprenaline in males but not in females, the effect of resveratrol was only measured in females. In wild-type mice, isoprenaline increased secretion by more than half. In CF mice, resveratrol rescued the response to isoprenaline, eliciting a 2.5-fold increase of β-adrenergic-stimulated secretion. We conclude that the salivary secretion assay is suitable to test DMSO-soluble CFTR modulators in female mice. We show that resveratrol applied in vivo to mice reaches salivary glands and increases β-adrenergic secretion. Immunolabelling of CFTR in human bronchial epithelial cells suggests that the effect is associated with increased CFTR protein expression. Our data support the view that resveratrol is beneficial for treating CF. The salivary secretion assay has a potential application to test efficacy of novel CF therapies.

  13. (TSC) in Bulgaria: six novel mutations in the TSC1 and TSC2 genes

    Indian Academy of Sciences (India)

    G2-Trombo

    Zdrave” str., ... Our data is similar to previous studies with .... The TSC1 and TSC2 protein products, hamartin (TSC1) with 1164 amino acids and tuberin ... cohort are missense, frameshift and nonsense mutations, while in the TSC1 gene most of ...

  14. Novel TBX22 mutations in Chinese nonsyndromic cleft lip/palate ...

    Indian Academy of Sciences (India)

    Jiewen Dai

    2018-06-06

    Jun 6, 2018 ... sense, frame-shift, splice-site, or missense mutation (Pauws et al. 2013). Except for ... 0.4.0, http:// · frodo.wi.mit.edu/) was used for primer design. The poly- ..... Sternberg M. J. 2015 The Phyre2 web portal for protein modeling ...

  15. NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features

    DEFF Research Database (Denmark)

    Andersen, Morten Tolstrup; Andersen, Mette Klarskov; Christiansen, D.H.

    2008-01-01

    Frameshift mutations of the nucleophosmin gene (NPM1) were recently reported as a frequently occurring abnormality in patients with de novo acute myeloid leukemia (AML). To evaluate the frequency of NPM1 mutations in patients with therapy-related myelodysplasia (t-MDS) and therapy-related AML (t......-/-7, the most frequent abnormalities of t-MDS/t-AML, were not observed (P=0.002). This raises the question whether some of the cases presenting NPM1 mutations were in fact cases of de novo leukemia. The close association to class I mutations and the inverse association to class II mutations suggest...

  16. Mutations in TGFbeta-RII and BAX mediate tumor progression in the later stages of colorectal cancer with microsatellite instability

    International Nuclear Information System (INIS)

    Yashiro, Masakazu; Hirakawa, Kosei; Boland, C Richard

    2010-01-01

    Microsatellite instability (MSI) occurs in 15% of colorectal cancers (CRC). The genetic targets for mutation in the MSI phenotype include somatic mutations in the transforming growth factor beta receptor typeII (TGFbetaRII), BAX, hMSH3 and hMSH6. It is not clear how mutations of these genes mediate tumor progression in the MSI pathway, and the temporal sequence of these mutations remains uncertain. In this study, early stage CRCs were examined for frameshift mutations in these target genes, and compared with late stage tumors and CRC cell lines. We investigated 6 CRC cell lines and 71 sporadic CRCs, including 61 early stage cancers and 10 late stage cancers. Mutations of repetitive mononucleotide tracts in the coding regions of TGFbetaRII, BAX, hMSH3, hMSH6, IGFIIR and Fas antigen were identified by direct sequencing. Thirteen (18.3%) of 71 CRC, including 9/61 (14.7%) early stage cancers and 4/10 (40%) late stage cancers, were identified as MSI and analyzed for frameshift mutations. No mutation in the target genes was observed in any of the 9 early stage MSI CRCs. In contrast, frameshift mutations of TGFbetaRII, BAX, hMSH3 and hMSH6 were present in 3/4 late stage MSI tumors. There is a statistical association (p = 0.014) between mutation in any one gene and tumor stage. TGFbetaRII, BAX, hMSH3 and hMSH6 mutations are relatively late events in the genesis of MSI CRCs. The frameshift mutations in these target genes might mediate progression from early to late stage cancer, rather than mediating the adenoma to carcinoma transition

  17. Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding.

    Directory of Open Access Journals (Sweden)

    Adrian W R Serohijos

    2008-02-01

    Full Text Available The absence of a functional ATP Binding Cassette (ABC protein called the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR from apical membranes of epithelial cells is responsible for cystic fibrosis (CF. Over 90% of CF patients carry at least one mutant allele with deletion of phenylalanine at position 508 located in the N-terminal nucleotide binding domain (NBD1. Biochemical and cell biological studies show that the DeltaF508 mutant exhibits inefficient biosynthetic maturation and susceptibility to degradation probably due to misfolding of NBD1 and the resultant misassembly of other domains. However, little is known about the direct effect of the Phe508 deletion on the NBD1 folding, which is essential for rational design strategies of cystic fibrosis treatment. Here we show that the deletion of Phe508 alters the folding dynamics and kinetics of NBD1, thus possibly affecting the assembly of the complete CFTR. Using molecular dynamics simulations, we find that meta-stable intermediate states appearing on wild type and mutant folding pathways are populated differently and that their kinetic accessibilities are distinct. The structural basis of the increased misfolding propensity of the DeltaF508 NBD1 mutant is the perturbation of interactions in residue pairs Q493/P574 and F575/F578 found in loop S7-H6. As a proof-of-principle that the S7-H6 loop conformation can modulate the folding kinetics of NBD1, we virtually design rescue mutations in the identified critical interactions to force the S7-H6 loop into the wild type conformation. Two redesigned NBD1-DeltaF508 variants exhibited significantly higher folding probabilities than the original NBD1-DeltaF508, thereby partially rescuing folding ability of the NBD1-DeltaF508 mutant. We propose that these observed defects in folding kinetics of mutant NBD1 may also be modulated by structures separate from the 508 site. The identified structural determinants of increased misfolding propensity of

  18. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

    2014-02-15

    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  19. [Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

    Science.gov (United States)

    Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

    2008-06-01

    To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

  20. Gene mutations in children with chronic pancreatitis.

    Science.gov (United States)

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  1. HNPCC: Six new pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Epplen Joerg T

    2004-06-01

    Full Text Available Abstract Background Hereditary non-polyposis colorectal cancer (HNPCC is an autosomal dominant disease with a high risk for colorectal and endometrial cancer caused by germline mutations in DNA mismatch-repair genes (MMR. HNPCC accounts for approximately 2 to 5% of all colorectal cancers. Here we present 6 novel mutations in the DNA mismatch-repair genes MLH1, MSH2 and MSH6. Methods Patients with clinical diagnosis of HNPCC were counselled. Tumor specimen were analysed for microsatellite instability and immunohistochemistry for MLH1, MSH2 and MSH6 protein was performed. If one of these proteins was not detectable in the tumor mutation analysis of the corresponding gene was carried out. Results We identified 6 frameshift mutations (2 in MLH1, 3 in MSH2, 1 in MSH6 resulting in a premature stop: two mutations in MLH1 (c.2198_2199insAACA [p.N733fsX745], c.2076_2077delTG [p.G693fsX702], three mutations in MSH2 (c.810_811delGT [p.C271fsX282], c.763_766delAGTGinsTT [p.F255fsX282], c.873_876delGACT [p.L292fsX298] and one mutation in MSH6 (c.1421_1422dupTG [p.C475fsX480]. All six tumors tested for microsatellite instability showed high levels of microsatellite instability (MSI-H. Conclusions HNPCC in families with MSH6 germline mutations may show an age of onset that is comparable to this of patients with MLH1 and MSH2 mutations.

  2. Lack of effect of delta F508 mutation on aerobic capacity in patients with cystic fibrosis.

    Science.gov (United States)

    Kaplan, T A; Moccia-Loos, G; Rabin, M; McKey, R M

    1996-10-01

    As aerobic exercise capacity, as defined by VO2max, is associated with patient functioning and possibly prognosis in cystic fibrosis (CF), correlations between VO2max phenotype and genotype may be of value. Retrospective clinical series. Cystic fibrosis referral clinic. Convenience sample of 35 patients with CF consecutively referred for exercise testing. Blood samples were examined for mutations of cystic fibrosis transmembrane regulator (CFTR), Height, wight, pulmonary function, resting-energy expenditure, VO2max, and other exercise variables were assessed in each referred patient. Statistical comparison of 10 patients who were homozygous for the dF508 mutation of CFTR with 20 patients heterozygous for dF508 revealed no significant differences for height, weight, pulmonary function, resting-energy expenditure, VO2max, or any other exercise variables. These results imply a limited effect of the mutation status on overall patient functioning and prognosis. Future identification of more rare CFTR mutations and other genes and subsequent classification of patients in a manner reflective of the cellular physiology may lead to different results.

  3. Repeated nebulisation of non-viral CFTR gene therapy in patients with cystic fibrosis: a randomised, double-blind, placebo-controlled, phase 2b trial.

    Science.gov (United States)

    Alton, Eric W F W; Armstrong, David K; Ashby, Deborah; Bayfield, Katie J; Bilton, Diana; Bloomfield, Emily V; Boyd, A Christopher; Brand, June; Buchan, Ruaridh; Calcedo, Roberto; Carvelli, Paula; Chan, Mario; Cheng, Seng H; Collie, D David S; Cunningham, Steve; Davidson, Heather E; Davies, Gwyneth; Davies, Jane C; Davies, Lee A; Dewar, Maria H; Doherty, Ann; Donovan, Jackie; Dwyer, Natalie S; Elgmati, Hala I; Featherstone, Rosanna F; Gavino, Jemyr; Gea-Sorli, Sabrina; Geddes, Duncan M; Gibson, James S R; Gill, Deborah R; Greening, Andrew P; Griesenbach, Uta; Hansell, David M; Harman, Katharine; Higgins, Tracy E; Hodges, Samantha L; Hyde, Stephen C; Hyndman, Laura; Innes, J Alastair; Jacob, Joseph; Jones, Nancy; Keogh, Brian F; Limberis, Maria P; Lloyd-Evans, Paul; Maclean, Alan W; Manvell, Michelle C; McCormick, Dominique; McGovern, Michael; McLachlan, Gerry; Meng, Cuixiang; Montero, M Angeles; Milligan, Hazel; Moyce, Laura J; Murray, Gordon D; Nicholson, Andrew G; Osadolor, Tina; Parra-Leiton, Javier; Porteous, David J; Pringle, Ian A; Punch, Emma K; Pytel, Kamila M; Quittner, Alexandra L; Rivellini, Gina; Saunders, Clare J; Scheule, Ronald K; Sheard, Sarah; Simmonds, Nicholas J; Smith, Keith; Smith, Stephen N; Soussi, Najwa; Soussi, Samia; Spearing, Emma J; Stevenson, Barbara J; Sumner-Jones, Stephanie G; Turkkila, Minna; Ureta, Rosa P; Waller, Michael D; Wasowicz, Marguerite Y; Wilson, James M; Wolstenholme-Hogg, Paul

    2015-09-01

    Lung delivery of plasmid DNA encoding the CFTR gene complexed with a cationic liposome is a potential treatment option for patients with cystic fibrosis. We aimed to assess the efficacy of non-viral CFTR gene therapy in patients with cystic fibrosis. We did this randomised, double-blind, placebo-controlled, phase 2b trial in two cystic fibrosis centres with patients recruited from 18 sites in the UK. Patients (aged ≥12 years) with a forced expiratory volume in 1 s (FEV1) of 50-90% predicted and any combination of CFTR mutations, were randomly assigned, via a computer-based randomisation system, to receive 5 mL of either nebulised pGM169/GL67A gene-liposome complex or 0.9% saline (placebo) every 28 days (plus or minus 5 days) for 1 year. Randomisation was stratified by % predicted FEV1 (<70 vs ≥70%), age (<18 vs ≥18 years), inclusion in the mechanistic substudy, and dosing site (London or Edinburgh). Participants and investigators were masked to treatment allocation. The primary endpoint was the relative change in % predicted FEV1. The primary analysis was per protocol. This trial is registered with ClinicalTrials.gov, number NCT01621867. Between June 12, 2012, and June 24, 2013, we randomly assigned 140 patients to receive placebo (n=62) or pGM169/GL67A (n=78), of whom 116 (83%) patients comprised the per-protocol population. We noted a significant, albeit modest, treatment effect in the pGM169/GL67A group versus placebo at 12 months' follow-up (3.7%, 95% CI 0.1-7.3; p=0.046). This outcome was associated with a stabilisation of lung function in the pGM169/GL67A group compared with a decline in the placebo group. We recorded no significant difference in treatment-attributable adverse events between groups. Monthly application of the pGM169/GL67A gene therapy formulation was associated with a significant, albeit modest, benefit in FEV1 compared with placebo at 1 year, indicating a stabilisation of lung function in the treatment group. Further improvements in

  4. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  5. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  6. Unusual long survival despite severe lung disease of a child with biallelic loss of function mutations in ABCA-3

    Directory of Open Access Journals (Sweden)

    P. El Boustany

    Full Text Available Homozygous or compound heterozygous for frameshift or nonsense mutations in the ATP–binding cassette transporter A3 (ABCA3 is associated with neonatal respiratory failure and death within the first year of life without lung transplantation. We report the case of a newborn baby girl who developed severe respiratory distress soon after birth. She was diagnosed with compound heterozygous frameshift mutation of the ABCA3 gene. Despite extensive treatment (intravenous corticosteroids pulse therapy, oral corticosteroids, azithromycin, and hydroxychloroquine, she developed chronic respiratory failure. As the parents refused cardio-pulmonary transplantation and couldn't resolve to an accompaniment of end of life, a tracheostomy was performed resulting in continuous mechanical ventilation. A neurodevelopmental delay and an overall muscular dystrophy were noted. At the age of 5 years, after 2 episodes of pneumothorax, the patient died from severe respiratory failure. To our knowledge, this was the first case of a child with compound heterozygous frameshift mutation who posed such an ethical dilemma with a patient surviving till the age of five years. Keywords: ABCA3 deficiency, Compound heterozygous frameshift mutation, Neonatal respiratory failure, Tracheostomy, Mechanical ventilation, Ethical dilemma

  7. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.

    2010-01-01

    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  8. Replacement of Murine Leukemia Virus Readthrough Mechanism by Human Immunodeficiency Virus Frameshift Allows Synthesis of Viral Proteins and Virus Replication

    Science.gov (United States)

    Brunelle, Marie-Noëlle; Brakier-Gingras, Léa; Lemay, Guy

    2003-01-01

    Retroviruses use unusual recoding strategies to synthesize the Gag-Pol polyprotein precursor of viral enzymes. In human immunodeficiency virus, ribosomes translating full-length viral RNA can shift back by 1 nucleotide at a specific site defined by the presence of both a slippery sequence and a downstream stimulatory element made of an extensive secondary structure. This so-called frameshift mechanism could become a target for the development of novel antiviral strategies. A different recoding strategy is used by other retroviruses, such as murine leukemia viruses, to synthesize the Gag-Pol precursor; in this case, a stop codon is suppressed in a readthrough process, again due to the presence of a specific structure adopted by the mRNA. Development of antiframeshift agents will greatly benefit from the availability of a simple animal and virus model. For this purpose, the murine leukemia virus readthrough region was rendered inactive by mutagenesis and the frameshift region of human immunodeficiency virus was inserted to generate a chimeric provirus. This substitution of readthrough by frameshift allows the synthesis of viral proteins, and the chimeric provirus sequence was found to generate infectious viruses. This system could be a most interesting alternative to study ribosomal frameshift in the context of a virus amenable to the use of a simple animal model. PMID:12584361

  9. Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

    Science.gov (United States)

    Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

    2017-08-25

    Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    Directory of Open Access Journals (Sweden)

    Gregory N. Thyssen

    2016-06-01

    Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  11. A frameshift variant of CYP2C8 was identified in a patient who suffered from rhabdomyolysis after administration of cerivastatin.

    Science.gov (United States)

    Ishikawa, Chikako; Ozaki, Hiroshi; Nakajima, Toshiaki; Ishii, Toshihiro; Kanai, Saburo; Anjo, Saeko; Shirai, Kohji; Inoue, Ituro

    2004-01-01

    A hypercholesterolemic patient medicated with cerivastatin for 22 days resulted in acute rhabdomyolysis. CYP2C8 and CYP3A4 are the major enzymes responsible for the metabolism of cerivastatin, and a transporter, OATP2, contributes to uptake of cerivastatin to the liver. In this study, the patient's DNA was sequenced in order to identify a variant that would lead to the adverse effect of cerivastatin. Three nucleotide variants, 475delA, G874C, and T1551C, were found in the exons of CYP2C8. The patient was homozygous for 475delA variant that leads to frameshift and premature termination. Accordingly, the patient is most likely lacking the enzyme activity. The patient's children were both heterozygous for the mutation. The patient had three nucleotide variants in exon 4 (A388G) and exon 5 (C571T and C597T) of OATP2 that were all heterozygous. No nucleotide variation in the exons of CYP3A4 was identified. To our knowledge, this is the first report showing that the adverse effect of cerivastatin might be caused by the genetic variant of CYP2C8.

  12. DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome

    DEFF Research Database (Denmark)

    White, Janson; Mazzeu, Juliana F; Hoischen, Alexander

    2015-01-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical ...

  13. Effect of endogenous carotenoids on “adaptive” mutation in Escherichia coli FC40

    Science.gov (United States)

    Bridges, Bryn A.; Foster, Patricia L.; Timms, Andrew R.

    2010-01-01

    The appearance over many days of Lac+ frameshift mutations in Escherichia coli strain FC40 incubated on lactose selection plates is a classic example of apparent “adaptive” mutation in an episomal gene. We show that endogenously overproduced carotenoids reduce adaptive mutation under selective conditions by a factor of around two. Carotenoids are known to scavenge singlet oxygen suggesting that the accumulation of oxidative base damage may be an integral part of the adaptive mutation phenomenon. If so, the lesion cannot be 7,8-dihydro-8-oxoguanine since adaptive mutation in FC40 is unaffected by mutM and mutY mutations. If active oxygen species such as singlet oxygen are involved in adaptive mutation then they should also induce frameshift mutations in FC40 under non-selective conditions. We show that such mutations can be induced under non-selective conditions by protoporphyrin photosensitisation and that this photodynamic induction is reduced by a factor of just over two when endogenous carotenoids are present. We argue that the involvement of oxidative damage would in no way be inconsistent with current understanding of the mechanism of adaptive mutation and the role of DNA polymerases. PMID:11166030

  14. Immunodeficiency associated with FCN3 mutation and ficolin-3 deficiency

    DEFF Research Database (Denmark)

    Munthe-Fog, Lea; Hummelshøj, Tina; Honoré, Christian

    2009-01-01

    Ficolin-3, encoded by the FCN3 gene and expressed in the lung and liver, is a recognition molecule in the lectin pathway of the complement system. Heterozygosity for an FCN3 frameshift mutation (rs28357092), leading to a distortion of the C-terminal end of the molecule, occurs in people without...... disease (allele frequency among whites, 0.01). We describe a patient with recurrent infections who was homozygous for this mutation, who had undetectable serum levels of ficolin-3, and who had a deficiency in ficolin-3-dependent complement activation....

  15. Stimulation of Intestinal Cl- Secretion Through CFTR by Caffeine Intake in Salt-Sensitive Hypertensive Rats

    Directory of Open Access Journals (Sweden)

    Xiao Wei

    2018-03-01

    Full Text Available Background/Aims: High salt consumption is a major risk factor for hypertension, and sodium homeostasis is regulated by both intestinal sodium absorption and urinary sodium excretion. Chronic caffeine intake has been reported to attenuate salt-sensitive hypertension by promoting urinary sodium excretion; however, its exact role in intestinal sodium absorption remains unknown. Here, we investigated whether and how chronic caffeine consumption antagonizes salt-sensitive hypertension by inhibiting intestinal sodium absorption. Methods: Dahl salt-sensitive rats were fed 8% NaCl chow and 0.1% caffeine in their drinking water for 15 days. The blood pressure and fecal sodium content were measured. The effect of caffeine on the movement of Cl- in enterocyte cells was determined with the Ussing chamber assay. Results: Rats that were treated with caffeine displayed significantly lower mean blood pressure and higher fecal sodium content than the controls. Consistent with these findings, caffeine intake decreased fluid absorption by the intestine in the fluid perfusion experiment. Further, the results from the Ussing chamber assay indicated that caffeine promoted Cl- secretion through enterocyte apical cystic fibrosis transmembrane conductance regulator (CFTR, and thus inhibited sodium absorption. Moreover, depletion of cAMP or inhibition of CFTR completely abolished the effect of caffeine on Cl- secretion. Conclusion: The results indicate that chronic caffeine consumption reduces sodium absorption by promoting CFTR-mediated Cl- secretion in the intestine, which contributes to the anti-hypertensive effect of caffeine in salt-sensitive rats.

  16. CFTR-dependent defect in alternatively-activated macrophages in cystic fibrosis.

    Science.gov (United States)

    Tarique, Abdullah A; Sly, Peter D; Holt, Patrick G; Bosco, Anthony; Ware, Robert S; Logan, Jayden; Bell, Scott C; Wainwright, Claire E; Fantino, Emmanuelle

    2017-07-01

    The role of the macrophages in cystic fibrosis (CF) lung disease has been poorly studied. We hypothesized that alternatively activated M2 macrophages are abnormal in CF lung disease. Blood samples were collected from adults (n=13) children (n=27) with CF on admission for acute pulmonary exacerbation and when clinically stable. Monocytes were differentiated into macrophages and polarized into classical (M1) and alternatively-activated (M2) phenotypes, function determined ex-vivo and compared with healthy controls. In the absence of functional cystic fibrosis trans-membrane conductance regulator (CFTR), either naturally in patients with CF or induced with CFTR inhibitors, monocyte-derived macrophages do not respond to IL-13/IL-4, fail to polarize into M2s associated with a post-transcriptional failure to produce and express IL-13Rα1 on the macrophage surface Polarization to the M1 phenotype was unaffected. CFTR-dependent imbalance of macrophage phenotypes and functions could contribute to the exaggerated inflammatory response seen in CF lung disease. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  17. Antibodies to the CFTR modulate the turgor pressure of guard cell protoplasts via slow anion channels.

    Science.gov (United States)

    Leonhardt, N; Bazin, I; Richaud, P; Marin, E; Vavasseur, A; Forestier, C

    2001-04-06

    The plasma membrane guard cell slow anion channel is a key element at the basis of water loss control in plants allowing prolonged osmolite efflux necessary for stomatal closure. This channel has been extensively studied by electrophysiological approaches but its molecular identification is still lacking. Recently, we described that this channel was sharing some similarities with the mammalian ATP-binding cassette protein, cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel [Leonhardt, N. et al. (1999) Plant Cell 11, 1141-1151]. Here, using the patch-clamp technique and a bioassay, consisting in the observation of the change in guard cell protoplasts volume, we demonstrated that a functional antibody raised against the mammalian CFTR prevented ABA-induced guard cell protoplasts shrinking and partially inhibited the slow anion current. Moreover, this antibody immunoprecipitated a polypeptide from guard cell protein extracts and immunolabeled stomata in Vicia faba leaf sections. These results indicate that the guard cell slow anion channel is, or is closely controlled by a polypeptide, exhibiting one epitope shared with the mammalian CFTR.

  18. Longevity and plasticity of CFTR provide an argument for noncanonical SNP organization in hominid DNA.

    Directory of Open Access Journals (Sweden)

    Aubrey E Hill

    Full Text Available Like many other ancient genes, the cystic fibrosis transmembrane conductance regulator (CFTR has survived for hundreds of millions of years. In this report, we consider whether such prodigious longevity of an individual gene--as opposed to an entire genome or species--should be considered surprising in the face of eons of relentless DNA replication errors, mutagenesis, and other causes of sequence polymorphism. The conventions that modern human SNP patterns result either from purifying selection or random (neutral drift were not well supported, since extant models account rather poorly for the known plasticity and function (or the established SNP distributions found in a multitude of genes such as CFTR. Instead, our analysis can be taken as a polemic indicating that SNPs in CFTR and many other mammalian genes may have been generated--and continue to accrue--in a fundamentally more organized manner than would otherwise have been expected. The resulting viewpoint contradicts earlier claims of 'directional' or 'intelligent design-type' SNP formation, and has important implications regarding the pace of DNA adaptation, the genesis of conserved non-coding DNA, and the extent to which eukaryotic SNP formation should be viewed as adaptive.

  19. Clinical phenotype of 5 females with a CDKL5 mutation.

    Science.gov (United States)

    Stalpers, Xenia L; Spruijt, Liesbeth; Yntema, Helger G; Verrips, Aad

    2012-01-01

    Mutations in the X-linked cyclin dependent kinase like 5 (CDKL5) gene have been reported in approximately 80 patients since the first description in 2003. The clinical presentation partly corresponds with Rett syndrome, considering clinical features as intellectual disability, hypotonia, and poor visual, language, and motor development. However, these patients do not meet the consensus criteria for Rett syndrome since they lack the clear period of regression. Furthermore, in contrast to Rett syndrome, patients with CDKL5 mutations, have seizures or infantile spasms starting in the first weeks of life. We present clinical phenotype of 5 girls having a mutation in the CDKL5 gene. All mutations are novel and are pathogenic since they either lead to a frameshift in the reading frame or affect a consensus splice site. Four of the mutations are detected de novo in the affected girl.

  20. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Science.gov (United States)

    Salinas, Danieli B; Sosnay, Patrick R; Azen, Colleen; Young, Suzanne; Raraigh, Karen S; Keens, Thomas G; Kharrazi, Martin

    2016-01-01

    Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance. We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C); those with one mutation of varying clinic consequence (VCC); and those with one mutation of unknown disease liability (Unknown). Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared. Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78) and 11% of Unknown (27/244) met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing. While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  1. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Directory of Open Access Journals (Sweden)

    Danieli B Salinas

    Full Text Available Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance.We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C; those with one mutation of varying clinic consequence (VCC; and those with one mutation of unknown disease liability (Unknown. Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared.Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78 and 11% of Unknown (27/244 met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing.While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  2. Stimulation of wild-type, F508del- and G551D-CFTR chloride channels by non toxic modified pyrrolo[2,3-b]pyrazine derivatives

    Directory of Open Access Journals (Sweden)

    Luc eDannhoffer

    2011-08-01

    Full Text Available Cystic Fibrosis is a major inherited disorder involving abnormalities of fluid and electrolyte transport in a number of different organs due to abnormal function of Cystic Fibrosis Transmembrane conductance Regulator (CFTR protein. We recently identified a family of CFTR activators, which contains the hit: RP107 [7-n-butyl-6-(4-hydroxyphenyl[5H]-pyrrolo[2,3-b]pyrazine]. Here, we further evaluated the effect of the chemical modifications of the RP107-OH radical on CFTR activation. The replacement of the OH radical by a fluorine atom at position 2 (RP193 or 4 (RP185 significantly decreased the toxicity of the compounds without altering the ability to activate CFTR, especially for RP193. The non-toxic compound RP193 has no effect on cAMP production but stimulates the channel activity of wild-type CFTR in stably transfected CHO cells, in human bronchial epithelial NuLi-1 cells and in primary culture of human bronchial epithelial cells. Whole cell and single patch clamp recordings showed that RP193 induced a linear, time and voltage-independent current, which was fully inhibited by two different and selective CFTR inhibitors (CFTRinh-172 and GPinh-5a. Moreover, RP193 stimulates CFTR in temperature-rescued CuFi-1 (F508del/F508del human bronchial epithelial cells and in CHO cells stably expressing G551D-CFTR. This study shows that it is feasible to reduce cytotoxicity of chemical compounds without affecting their potency to activate CFTR and to rescue the class 2 F508del-CFTR and class 3 G551D-CFTR CF mutant activities.

  3. Hepatitis C Virus Frameshift/Alternate Reading Frame Protein Suppresses Interferon Responses Mediated by Pattern Recognition Receptor Retinoic-Acid-Inducible Gene-I.

    Directory of Open Access Journals (Sweden)

    Seung Bum Park

    Full Text Available Hepatitis C virus (HCV actively evades host interferon (IFN responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I (RIG-I-mediated IFN induction. Expression of frameshift/alternate reading frame protein (F/ARFP from HCV -2/+1 frame in Huh7 hepatoma cells suppressed type I IFN responses stimulated by HCV RNA pathogen-associated molecular pattern (PAMP and poly(IC. The suppression occurred independently of other HCV factors; and activation of interferon stimulated genes, TNFα, IFN-λ1, and IFN-λ2/3 was likewise suppressed by HCV F/ARFP. Point mutations in the full-length HCV sequence (JFH1 genotype 2a strain were made to introduce premature termination codons in the -2/+1 reading frame coding for F/ARFP while preserving the original reading frame, which enhanced IFNα and IFNβ induction by HCV. The potentiation of IFN response by the F/ARFP mutations was diminished in Huh7.5 cells, which already have a defective RIG-I, and by decreasing RIG-I expression in Huh7 cells. Furthermore, adding F/ARFP back via trans-complementation suppressed IFN induction in the F/ARFP mutant. The F/ARFP mutants, on the other hand, were not resistant to exogenous IFNα. Finally, HCV-infected human liver samples showed significant F/ARFP antibody reactivity, compared to HCV-uninfected control livers. Therefore, HCV F/ARFP likely cooperates with other viral factors to suppress type I and III IFN induction occurring through the RIG-I signaling pathway. This study identifies a novel mechanism of pattern recognition receptor modulation by HCV and suggests a biological function of the HCV alternate reading frame in the modulation of host innate immunity.

  4. New mutations affecting induced mutagenesis in yeast.

    Science.gov (United States)

    Lawrence, C W; Krauss, B R; Christensen, R B

    1985-01-01

    Previously isolated mutations in baker's yeast, Saccharomyces cerevisiae, that impair induced mutagenesis were all identified with the aid of tests that either exclusively or predominantly detect base-pair substitutions. To avoid this bias, we have screened 11 366 potentially mutant clones for UV-induced reversion of the frameshift allele, his4-38, and have identified 10 mutants that give much reduced yields of revertants. Complementation and recombination tests show that 6 of these carry mutations at the previously known REV1, REV1 and REV3 loci, while the remaining 4 define 3 new genes, REV4 (2 mutations), REV5 and REV6. The rev4 mutations are readily suppressed in many genetic backgrounds and, like the rev5 mutation, impart only a limited deficiency for induced mutagenesis: it is likely, therefore that the REV4+ and REV5+ gene functions are only remotely concerned with this process. The rev6 mutants have a more general deficiency, however, as well as marked sensitivity to UV and an increased spontaneous mutation rate, properties that suggest the REV6 gene is directly involved in mutation induction. The REV5 gene is located about 1 cM proximal to CYC1 on chromosome X.

  5. A negative feedback modulator of antigen processing evolved from a frameshift in the cowpox virus genome.

    Directory of Open Access Journals (Sweden)

    Jiacheng Lin

    2014-12-01

    Full Text Available Coevolution of viruses and their hosts represents a dynamic molecular battle between the immune system and viral factors that mediate immune evasion. After the abandonment of smallpox vaccination, cowpox virus infections are an emerging zoonotic health threat, especially for immunocompromised patients. Here we delineate the mechanistic basis of how cowpox viral CPXV012 interferes with MHC class I antigen processing. This type II membrane protein inhibits the coreTAP complex at the step after peptide binding and peptide-induced conformational change, in blocking ATP binding and hydrolysis. Distinct from other immune evasion mechanisms, TAP inhibition is mediated by a short ER-lumenal fragment of CPXV012, which results from a frameshift in the cowpox virus genome. Tethered to the ER membrane, this fragment mimics a high ER-lumenal peptide concentration, thus provoking a trans-inhibition of antigen translocation as supply for MHC I loading. These findings illuminate the evolution of viral immune modulators and the basis of a fine-balanced regulation of antigen processing.

  6. Exon skipping and translation in patients with frameshift deletions in the dystrophin gene

    Energy Technology Data Exchange (ETDEWEB)

    Sherratt, T.G.; Dubowitz, V.; Sewry, C.A.; Strong, P.N. (Royal Postgraduate Medical School, London (United Kingdom)); Vulliamy, T. (Hammersmith Hospital, London (United Kingdom))

    1993-11-01

    Although many Duchenne muscular dystrophy patients have a deletion in the dystrophin gene which disrupts the translational reading frame, they express dystrophin in a small proportion of skeletal muscle fibers ([open quotes]revertant fibers[close quotes]). Antibody studies have shown, indirectly, that dystrophin synthesis in revertant fibers is facilitated by a frame-restoring mechanism; in the present study, the feasibility of mRNA splicing was investigated. Dystrophin transcripts were analyzed in skeletal muscle from individuals possessing revertant fibers and a frameshift deletion in the dystrophin gene. In each case a minor in-frame transcript was detected, in which exons adjacent to those deleted from the genome had been skipped. There appeared to be some correlation between the levels of in-frame transcripts and the predicted translation products. Low levels of alternatively spliced transcripts were also present in normal muscle. The results provide further evidence of exon skipping in the dystrophin gene and indicate that this may be involved in the synthesis of dystrophin by revertant fibers. 44 refs., 12 figs.

  7. Crystallographic and single-particle analyses of native- and nucleotide-bound forms of the cystic fibrosis transmembrane conductance regulator (CFTR) protein.

    Science.gov (United States)

    Awayn, N H; Rosenberg, M F; Kamis, A B; Aleksandrov, L A; Riordan, J R; Ford, R C

    2005-11-01

    Cystic fibrosis, one of the major human inherited diseases, is caused by defects in the CFTR (cystic fibrosis transmembrane conductance regulator), a cell-membrane protein. CFTR acts as a chloride channel which can be opened by ATP. Low-resolution structural studies of purified recombinant human CFTR are described in the present paper. Localization of the C-terminal decahistidine tag in CFTR was achieved by Ni2+-nitriloacetate nanogold labelling, followed by electron microscopy and single-particle analysis. The presence of the gold label appears to improve the single-particle-alignment procedure. Projection structures of CFTR from two-dimensional crystals analysed by electron crystallography displayed two alternative conformational states in the presence of nucleotide and nanogold, but only one form of the protein was observed in the quiescent (nucleotide-free) state.

  8. Screening of 1331 Danish breast and/or ovarian cancer families identified 40 novel BRCA1 and BRCA2 mutations

    DEFF Research Database (Denmark)

    Hansen, Thomas V O; Jønson, Lars; Steffensen, Ane Y

    2011-01-01

    Germ-line mutations in the tumour suppressor genes BRCA1 and BRCA2 predispose to breast and ovarian cancer. Since 1999 we have performed mutational screening of breast and/or ovarian cancer patients in East Denmark. During this period we have identified 40 novel sequence variations in BRCA1...... and BRCA2 in high risk breast and/or ovarian cancer families. The mutations were detected via pre-screening using dHPLC or high-resolution melting and direct sequencing. We identified 16 variants in BRCA1, including 9 deleterious frame-shift mutations, 2 intronic variants, 4 missense mutations, and 1......, the presumed significance of the missense mutations was predicted in silico using the align GVGD algorithm. In conclusion, the mutation screening identified 40 novel variants in the BRCA1 and BRCA2 genes and thereby extends the knowledge of the BRCA1/BRCA2 mutation spectrum. Nineteen of the mutations were...

  9. A review on architecture of the gag-pol ribosomal frameshifting RNA in human immunodeficiency virus: a variability survey of virus genotypes.

    Science.gov (United States)

    Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan

    2017-06-01

    Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.

  10. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

  11. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    Science.gov (United States)

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  12. Rare mutations predisposing to familial adenomatous polyposis in Greek FAP patients

    International Nuclear Information System (INIS)

    Mihalatos, Markos; Fountzilas, George; Agnantis, Niki J; Nasioulas, Georgios; Apessos, Angela; Dauwerse, Hans; Velissariou, Voula; Psychias, Aristidis; Koliopanos, Alexander; Petropoulos, Konstantinos; Triantafillidis, John K; Danielidis, Ioannis

    2005-01-01

    Familial Adenomatous Polyposis (FAP) is caused by germline mutations in the APC (Adenomatous Polyposis Coli) gene. The vast majority of APC mutations are point mutations or small insertions / deletions which lead to truncated protein products. Splicing mutations or gross genomic rearrangements are less common inactivating events of the APC gene. In the current study genomic DNA or RNA from ten unrelated FAP suspected patients was examined for germline mutations in the APC gene. Family history and phenotype were used in order to select the patients. Methods used for testing were dHPLC (denaturing High Performance Liquid Chromatography), sequencing, MLPA (Multiplex Ligation – dependent Probe Amplification), Karyotyping, FISH (Fluorescence In Situ Hybridization) and RT-PCR (Reverse Transcription – Polymerase Chain Reaction). A 250 Kbp deletion in the APC gene starting from intron 5 and extending beyond exon 15 was identified in one patient. A substitution of the +5 conserved nucleotide at the splice donor site of intron 9 in the APC gene was shown to produce frameshift and inefficient exon skipping in a second patient. Four frameshift mutations (1577insT, 1973delAG, 3180delAAAA, 3212delA) and a nonsense mutation (C1690T) were identified in the rest of the patients. Screening for APC mutations in FAP patients should include testing for splicing defects and gross genomic alterations

  13. Compound heterozygous ASPM mutations in Pakistani MCPH families

    DEFF Research Database (Denmark)

    Muhammad, Farooq; Mahmood Baig, Shahid; Hansen, Lars

    2009-01-01

    Autosomal recessive primary microcephaly (MCPH) is characterized by reduced head circumference (50% of all reported families. In spite of the high frequency of MCPH in Pakistan only one case of compound heterozygosity for mutations in ASPM has been reported yet. In this large MCPH study we...... confirmed compound heterozygosity in two and homozygous mutations in 20 families, respectively, showing that up to 10% of families with MCPH caused by ASPM are compound heterozygous. In total we identified 16 different nonsense or frameshift mutations of which 12 were novel thereby increasing the number...... of mutations in ASPM significantly from 35 to 47. We found no correlation between the severity of the condition and the site of truncation. We suggest that the high frequency of compound heterozygosity observed in this study is taken into consideration as part of future genetic testing and counseling...

  14. Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

    International Nuclear Information System (INIS)

    Kimura, Hiroshi; Kato, Takesi.

    1992-01-01

    X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

  15. An immortal cell line to study the role of endogenous CFTR in electrolyte absorption.

    Science.gov (United States)

    Bell, C L; Quinton, P M

    1995-01-01

    The intact human reabsorptive sweat duct (RD) has been a reliable model for investigations of the functional role of "endogenous" CFTR (cystic fibrosis transmembrane conductance regulator) in normal and abnormal electrolyte absorptive function. But to overcome the limitations imposed by the use of fresh, intact tissue, we transformed cultured RD cells using the chimeric virus Ad5/SV40 1613 ori-. The resultant cell line, RD2(NL), has remained differentiated forming a polarized epithelium that expressed two fundamental components of absorption, a cAMP activated Cl- conductance (GCl) and an amiloride-sensitive Na+ conductance (GNa). In the unstimulated state, there was a low level of transport activity; however, addition of forskolin (10(-5) M) significantly increased the Cl- diffusion potential (Vt) generated by a luminally directed Cl- gradient from -15.3 +/- 0.7 mV to -23.9 +/- 1.1 mV, n = 39; and decreased the transepithelial resistance (Rt) from 814.8 +/- 56.3 omega.cm2 to 750.5 +/- 47.5 omega.cm2, n = 39, (n = number of cultures). cAMP activation, anion selectivity (Cl- > I- > gluconate), and a dependence upon metabolic energy (metabolic poisoning inhibited GCl), all indicate that the GCl expressed in RD2(NL) is in fact CFTR-GCl. The presence of an apical amiloride-sensitive GNa was shown by the amiloride (10(-5) M) inhibition of GNa as indicated by a reduction of Vt and equivalent short circuit current by 78.0 +/- 3.1% and 77.9 +/- 2.6%, respectively, and an increase in Rt by 7.2 +/- 0.8%, n = 36. In conclusion, the RD2(NL) cell line presents the first model system in which CFTR-GCl is expressed in a purely absorptive tissue.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Association between F508 deletion in CFTR and chronic pancreatitis risk.

    Science.gov (United States)

    Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

    2017-09-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  17. The UGG Isoacceptor of tRNAPro Is Naturally Prone to Frameshifts

    Directory of Open Access Journals (Sweden)

    Howard B. Gamper

    2015-07-01

    Full Text Available Native tRNAs often contain post-transcriptional modifications to the wobble position to expand the capacity of reading the genetic code. Some of these modifications, due to the ability to confer imperfect codon-anticodon pairing at the wobble position, can induce a high propensity for tRNA to shift into alternative reading frames. An example is the native UGG isoacceptor of E. coli tRNAPro whose wobble nucleotide U34 is post-transcriptionally modified to cmo5U34 to read all four proline codons (5ʹ-CCA, 5ʹ-CCC, 5ʹ-CCG, and 5ʹ-CCU. Because the pairing of the modified anticodon to CCC codon is particularly weak relative to CCA and CCG codons, this tRNA can readily shift into both the +1 and +2-frame on the slippery mRNA sequence CCC-CG. We show that the shift to the +2-frame is more dominant, driven by the higher stability of the codon-anticodon pairing at the wobble position. Kinetic analysis suggests that both types of shifts can occur during stalling of the tRNA in a post-translocation complex or during translocation from the A to the P-site. Importantly, while the +1-frame post complex is active for peptidyl transfer, the +2-frame complex is a poor peptidyl donor. Together with our recent work, we draw a mechanistic distinction between +1 and +2-frameshifts, showing that while the +1-shifts are suppressed by the additional post-transcriptionally modified m1G37 nucleotide in the anticodon loop, the +2-shifts are suppressed by the ribosome, supporting a role of the ribosome in the overall quality control of reading-frame maintenance.

  18. Implementation of the first worldwide quality assurance program for cystic fibrosis multiple mutation detection in population-based screening.

    Science.gov (United States)

    Earley, Marie C; Laxova, Anita; Farrell, Philip M; Driscoll-Dunn, Rena; Cordovado, Suzanne; Mogayzel, Peter J; Konstan, Michael W; Hannon, W Harry

    2011-07-15

    CDC's Newborn Screening Quality Assurance Program collaborated with several U.S. Cystic Fibrosis Care Centers to collect specimens for development of a molecular CFTR proficiency testing program using dried-blood spots for newborn screening laboratories. Adult and adolescent patients or carriers donated whole blood that was aliquoted onto filter paper cards. Five blind-coded specimens were sent to participating newborn screening laboratories quarterly. Proficiency testing results were evaluated based on presumptive clinical assessment. Individual evaluations and summary reports were sent to each participating laboratory and technical consultations were offered if incorrect assessments were reported. The current CDC repository contains specimens with 39 different CFTR mutations. Up to 45 laboratories have participated in the program. Three years of data showed that correct assessments were reported 97.7% of the time overall when both mutations could be determined. Incorrect assessments that could have lead to a missed case occurred 0.9% of the time, and no information was reported 1.1% of the time due to sample failure. Results show that laboratories using molecular assays to detect CFTR mutations are performing satisfactorily. The programmatic results presented demonstrate the importance and complexity of providing proficiency testing for DNA-based assays. Published by Elsevier B.V.

  19. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Significance of somatic mutations and content alteration of mitochondrial DNA in esophageal cancer

    Directory of Open Access Journals (Sweden)

    Wang Yu-Fen

    2006-04-01

    Full Text Available Abstract Background The roles of mitochondria in energy metabolism, the generation of ROS, aging, and the initiation of apoptosis have implicated their importance in tumorigenesis. In this study we aim to establish the mutation spectrum and to understand the role of somatic mtDNA mutations in esophageal cancer. Methods The entire mitochondrial genome was screened for somatic mutations in 20 pairs (18 esophageal squamous cell carcinomas, one adenosquamous carcinoma and one adenocarcinoma of tumor/surrounding normal tissue of esophageal cancers, using temporal temperature gradient gel electrophoresis (TTGE, followed by direct DNA sequencing to identify the mutations. Results Fourteen somatic mtDNA mutations were identified in 55% (11/20 of tumors analyzed, including 2 novel missense mutations and a frameshift mutation in ND4L, ATP6 subunit, and ND4 genes respectively. Nine mutations (64% were in the D-loop region. Numerous germline variations were found, at least 10 of them were novel and five were missense mutations, some of them occurred in evolutionarily conserved domains. Using real-time quantitative PCR analysis, the mtDNA content was found to increase in some tumors and decrease in others. Analysis of molecular and other clinicopathological findings does not reveal significant correlation between somatic mtDNA mutations and mtDNA content, or between mtDNA content and metastatic status. Conclusion Our results demonstrate that somatic mtDNA mutations in esophageal cancers are frequent. Some missense and frameshift mutations may play an important role in the tumorigenesis of esophageal carcinoma. More extensive biochemical and molecular studies will be necessary to determine the pathological significance of these somatic mutations.

  1. Juvenil polypose-syndrom og hereditær hæmoragisk telangiektasi hos en patient med SMAD4-mutation

    DEFF Research Database (Denmark)

    Jelsig, Anne Marie; Tørring, Pernille Mathiesen; Wikman, Friedrik

    2014-01-01

    Germ line mutations in SMAD4 can cause both juvenile polyposis syndrome and hereditary haemorrhagic telangiectasia syndrome. In this case we present a 37-year-old man with a frameshift mutation in SMAD4. The patient had multiple polyps in the gastrointestinal tract and was diagnosed with colon ca...... cancer at the age of 21 and gastro-oesophageal junction cancer at the age of 37. Furthermore the patient had telangiectasias and recurrent epistaxis....

  2. Restoration of CFTR Activity in Ducts Rescues Acinar Cell Function and Reduces Inflammation in Pancreatic and Salivary Glands of Mice.

    Science.gov (United States)

    Zeng, Mei; Szymczak, Mitchell; Ahuja, Malini; Zheng, Changyu; Yin, Hongen; Swaim, William; Chiorini, John A; Bridges, Robert J; Muallem, Shmuel

    2017-10-01

    Sjögren's syndrome and autoimmune pancreatitis are disorders with decreased function of salivary, lacrimal glands, and the exocrine pancreas. Nonobese diabetic/ShiLTJ mice and mice transduced with the cytokine BMP6 develop Sjögren's syndrome and chronic pancreatitis and MRL/Mp mice are models of autoimmune pancreatitis. Cystic fibrosis transmembrane conductance regulator (CFTR) is a ductal Cl -  channel essential for ductal fluid and HCO 3 - secretion. We used these models to ask the following questions: is CFTR expression altered in these diseases, does correction of CFTR correct gland function, and most notably, does correcting ductal function correct acinar function? We treated the mice models with the CFTR corrector C18 and the potentiator VX770. Glandular, ductal, and acinar cells damage, infiltration, immune cells and function were measured in vivo and in isolated duct/acini. In the disease models, CFTR expression is markedly reduced. The salivary glands and pancreas are inflamed with increased fibrosis and tissue damage. Treatment with VX770 and, in particular, C18 restored salivation, rescued CFTR expression and localization, and nearly eliminated the inflammation and tissue damage. Transgenic overexpression of CFTR exclusively in the duct had similar effects. Most notably, the markedly reduced acinar cell Ca 2+ signaling, Orai1, inositol triphosphate receptors, Aquaporin 5 expression, and fluid secretion were restored by rescuing ductal CFTR. Our findings reveal that correcting ductal function is sufficient to rescue acinar cell function and suggests that CFTR correctors are strong candidates for the treatment of Sjögren's syndrome and pancreatitis. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  3. Gq activity- and β-arrestin-1 scaffolding-mediated ADGRG2/CFTR coupling are required for male fertility

    Science.gov (United States)

    Lin, Hui; Li, Rui-Rui; Liang, Zong-Lai; Gao, Yuan; Yang, Zhao; He, Dong-Fang; Lin, Amy; Mo, Hui; Lu, Yu-Jing; Li, Meng-Jing; Kong, Wei; Chung, Ka Young; Yi, Fan; Li, Jian-Yuan; Qin, Ying-Ying; Li, Jingxin; Thomsen, Alex R B; Kahsai, Alem W; Chen, Zi-Jiang; Xu, Zhi-Gang; Liu, Mingyao

    2018-01-01

    Luminal fluid reabsorption plays a fundamental role in male fertility. We demonstrated that the ubiquitous GPCR signaling proteins Gq and β-arrestin-1 are essential for fluid reabsorption because they mediate coupling between an orphan receptor ADGRG2 (GPR64) and the ion channel CFTR. A reduction in protein level or deficiency of ADGRG2, Gq or β-arrestin-1 in a mouse model led to an imbalance in pH homeostasis in the efferent ductules due to decreased constitutive CFTR currents. Efferent ductule dysfunction was rescued by the specific activation of another GPCR, AGTR2. Further mechanistic analysis revealed that β-arrestin-1 acts as a scaffold for ADGRG2/CFTR complex formation in apical membranes, whereas specific residues of ADGRG2 confer coupling specificity for different G protein subtypes, this specificity is critical for male fertility. Therefore, manipulation of the signaling components of the ADGRG2-Gq/β-arrestin-1/CFTR complex by small molecules may be an effective therapeutic strategy for male infertility. PMID:29393851

  4. Identification of novel FBN1 and TGFBR2 mutations in 65 probands with Marfan syndrome or Marfan-like phenotypes.

    Science.gov (United States)

    Chung, Brian Hon-Yin; Lam, Stephen Tak-Sum; Tong, Tony Ming-For; Li, Susanna Yuk-Han; Lun, Kin-Shing; Chan, Daniel Hon-Chuen; Fok, Susanna Fung-Shan; Or, June Siu-Fong; Smith, David Keith; Yang, Wanling; Lau, Yu-Lung

    2009-07-01

    Marfan syndrome is an autosomal dominant connective tissue disorder, and mutations in the FBN1 and TGFBR2 genes have been identified in probands with MFS and related phenotypes. Using DHPLC and sequencing, we studied the mutation spectrum in 65 probands with Marfan syndrome and related phenotypes. A total of 24 mutations in FBN1 were identified, of which 19 (nine missense, six frameshift, two nonsense and two affecting splice junctions) were novel. In the remaining 41 probands, six were identified to have novel TGFBR2 mutations (one frameshift and five missense mutations). All novel mutations found in this study were confirmed to be absent in 50 unrelated normal individuals of the same ethnic background. In probands who fulfilled the Ghent criteria (n = 16), mutations in FBN1 were found in 81% of cases. None of those with TGFBR2 mutations fulfilled the Ghent criteria. Novel missense mutations of unknown significance were classified according to the latest ACMG guidelines and their likelihood to be causative was evaluated.

  5. SERPINB11 frameshift variant associated with novel hoof specific phenotype in Connemara ponies.

    Directory of Open Access Journals (Sweden)

    Carrie J Finno

    2015-04-01

    Full Text Available Horses belong to the order Perissodactyla and bear the majority of their weight on their third toe; therefore, tremendous force is applied to each hoof. An inherited disease characterized by a phenotype restricted to the dorsal hoof wall was identified in the Connemara pony. Hoof wall separation disease (HWSD manifests clinically as separation of the dorsal hoof wall along the weight-bearing surface of the hoof during the first year of life. Parents of affected ponies appeared clinically normal, suggesting an autosomal recessive mode of inheritance. A case-control allelic genome wide association analysis was performed (ncases = 15, ncontrols = 24. Population stratification (λ = 1.48 was successfully improved by removing outliers (ncontrols = 7 identified on a multidimensional scaling plot. A genome-wide significant association was detected on chromosome 8 (praw = 1.37x10-10, pgenome = 1.92x10-5. A homozygous region identified in affected ponies spanned from 79,936,024-81,676,900 bp and contained a family of 13 annotated SERPINB genes. Whole genome next-generation sequencing at 6x coverage of two cases and two controls revealed 9,758 SNVs and 1,230 indels within the ~1.7-Mb haplotype, of which 17 and 5, respectively, segregated with the disease and were located within or adjacent to genes. Additional genotyping of these 22 putative functional variants in 369 Connemara ponies (ncases = 23, ncontrols = 346 and 169 horses of other breeds revealed segregation of three putative variants adjacent or within four SERPIN genes. Two of the variants were non-coding and one was an insertion within SERPINB11 that introduced a frameshift resulting in a premature stop codon. Evaluation of mRNA levels at the proximal hoof capsule (ncases = 4, ncontrols = 4 revealed that SERPINB11 expression was significantly reduced in affected ponies (p<0.001. Carrier frequency was estimated at 14.8%. This study describes the first genetic variant associated with a hoof wall

  6. Hybridization alters spontaneous mutation rates in a parent-of-origin-dependent fashion in Arabidopsis.

    Science.gov (United States)

    Bashir, Tufail; Sailer, Christian; Gerber, Florian; Loganathan, Nitin; Bhoopalan, Hemadev; Eichenberger, Christof; Grossniklaus, Ueli; Baskar, Ramamurthy

    2014-05-01

    Over 70 years ago, increased spontaneous mutation rates were observed in Drosophila spp. hybrids, but the genetic basis of this phenomenon is not well understood. The model plant Arabidopsis (Arabidopsis thaliana) offers unique opportunities to study the types of mutations induced upon hybridization and the frequency of their occurrence. Understanding the mutational effects of hybridization is important, as many crop plants are grown as hybrids. Besides, hybridization is important for speciation and its effects on genome integrity could be critical, as chromosomal rearrangements can lead to reproductive isolation. We examined the rates of hybridization-induced point and frameshift mutations as well as homologous recombination events in intraspecific Arabidopsis hybrids using a set of transgenic mutation detector lines that carry mutated or truncated versions of a reporter gene. We found that hybridization alters the frequency of different kinds of mutations. In general, Columbia (Col)×Cape Verde Islands and Col×C24 hybrid progeny had decreased T→G and T→A transversion rates but an increased C→T transition rate. Significant changes in frameshift mutation rates were also observed in some hybrids. In Col×C24 hybrids, there is a trend for increased homologous recombination rates, except for the hybrids from one line, while in Col×Cape Verde Islands hybrids, this rate is decreased. The overall genetic distance of the parents had no influence on mutation rates in the progeny, as closely related accessions on occasion displayed higher mutation rates than accessions that are separated farther apart. However, reciprocal hybrids had significantly different mutation rates, suggesting parent-of-origin-dependent effects on the mutation frequency.

  7. Aquagenic keratoderma associated with a mutation of the cystic fibrosis gene

    Directory of Open Access Journals (Sweden)

    V. Coelho-Macias

    2013-05-01

    Full Text Available Reported for the first time in 1996, aquagenic keratoderma is a rare condition which is characterized by edematous flat-topped papules appearing on palmar skin after water immersion. Multiple anecdotal associations have been described but, recently, the association with cystic fibrosis gene mutations (CFTR has been highlighted.The authors describe an 18-year-old female, with one-month complaints of pruritus and swelling of palmar skin after water immersion. On examination, palmar skin was unremarkable but, 5 min after water immersion, multiple whitish papules became apparent. CFTR genotype study showed a F508del mutation in one allele (nonhomozygous. She had no other symptoms and no relevant family history.Aquagenic keratoderma is probably an under-diagnosed entity that might represent a manifestation of CFTR mutations, making carrier state identification and genetic counseling possible. Resumo: Descrita em 1996, a acroqueratodermia aquagénica é uma entidade rara, caracterizada pelo aparecimento de pápulas edematosas palmares após contacto com água. Múltiplas associações foram enumeradas mas, recentemente, a associação a mutações do gene da fibrose quística foi demonstrada.Descreve-se o caso de uma mulher de 18 anos, saudável, com prurido e edema palmar após imersão em água. O exame objetivo inicial não mostrava alterações mas, 5 min após imersão em água, observavam-se múltiplas pápulas esbranquiçadas palmares. O estudo do gene da fibrose quística (CFTR revelou uma mutação F508del num dos alelos. A doente negava outras queixas ou história familiar relevante.A acroqueratodermia aquagénica é uma entidade provavelmente subdiagnosticada que poderá constituir uma manifestação de mutações do gene CFTR, o que possibilitaria a identificação de portadores e aconselhamento genético. Keywords: Aquagenic keratoderma, Cystic fibrosis, Genetic counseling, Palavras-chave: Acroqueratodermia aquagénica, Fibrose qu

  8. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    Science.gov (United States)

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  9. Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

    Science.gov (United States)

    Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

    2007-07-01

    Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

  10. The importance of functional tests to assess the effect of a new CFTR variant when genotype-phenotype correlation is not possible.

    Science.gov (United States)

    Hinzpeter, Alexandre; Reboul, Marie-Pierre; Callebaut, Isabelle; Zordan, Cécile; Costes, Bruno; Guichoux, Julie; Iron, Albert; Lacombe, Didier; Martin, Natacha; Arveiler, Benoit; Fanen, Pascale; Fergelot, Patricia; Girodon, Emmanuelle

    2017-05-01

    In vitro functional tests aimed to investigate CFTR dysfunction appear critical to help elucidate the functional impact of new variants of uncertain clinical significance and solve inconclusive cases, especially in early deceased newborns.

  11. Combined Bicarbonate Conductance-Impairing Variants in CFTR and SPINK1 Are Associated with Chronic Pancreatitis in Patients without Cystic Fibrosis

    Science.gov (United States)

    Schneider, Alexander; LaRusch, Jessica; Sun, Xiumei; Aloe, Amy; Lamb, Janette; Hawes, Robert; Cotton, Peter; Brand, Randall E.; Anderson, Michelle A.; Money, Mary E.; Banks, Peter A.; Lewis, Michele D.; Baillie, John; Sherman, Stuart; DiSario, James; Burton, Frank R.; Gardner, Timothy B.; Amann, Stephen T.; Gelrud, Andres; George, Ryan; Kassabian, Sirvart; Martinson, Jeremy; Slivka, Adam; Yadav, Dhiraj; Oruc, Nevin; Barmada, M. Michael; Frizzell, Raymond; Whitcomb, David C.

    2010-01-01

    Background & Aims Idiopathic chronic pancreatitis (ICP) is a complex inflammatory disorder associated with multiple genetic and environmental factors. In individuals without cystic fibrosis (CF), variants of CFTR that inhibit bicarbonate conductance but maintain chloride conductance might selectively impair secretion of pancreatic juice, leading to trypsin activation and pancreatitis. We investigated whether sequence variants in the gene encoding the pancreatic secretory trypsin inhibitor, SPINK1, further increase the risk of pancreatitis in these patients. Methods We screened patients with ICP (sporadic or familial) and controls for variants in SPINK1 associated with chronic pancreatitis (CP) risk (in exon 3) and in all 27 exons of CFTR. The final study group included 53 patients with sporadic ICP, 27 probands with familial ICP, and 150 unrelated controls, plus 503 controls for limited genotyping. CFTR wild-type (wt) and p.R75Q were cloned and expressed in HEK293 cells and relative conductances of HCO3− and Cl− were measured. Results SPINK1 variants were identified in 36% of subjects and 3% controls (odds ratio [OR]=16.5). One variant of CFTR that has not been associated with CF, p.R75Q, was found in 16% of subjects and 5.4% controls (OR=3.4). Co-inheritance of CFTR p.R75Q and SPINK1 variants occurred in 8.75% of patients and 0.15% controls (OR=62.5). Patch-clamp recordings of cells that expressed CFTR p.R75Q demonstrated normal chloride currents but significantly reduced bicarbonate currents (P=0.0001). Conclusions The CFTR variant p.R75Q causes a selective defect in bicarbonate conductance and increases risk for pancreatitis. Co-inheritance of CF-associated, and some not associated, CFTR variants with SPINK1 variants significantly increase risk of ICP. PMID:20977904

  12. Impact of the [delta]F508 Mutation in First Nucleotide-binding Domain of Human Cystic Fibrosis Transmembrane Conductance Regulator on Domain Folding and Structure

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Hal A.; Zhao, Xun; Wang, Chi; Sauder, J. Michael; Rooney, Isabelle; Noland, Brian W.; Lorimer, Don; Kearins, Margaret C.; Conners, Kris; Condon, Brad; Maloney, Peter C.; Guggino, William B.; Hunt, John F.; Emtage, Spencer (SG); (Columbia); (JHU)

    2010-07-19

    Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformation but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.

  13. Missense Mutation in the USH2A Gene: Association with Recessive Retinitis Pigmentosa without Hearing Loss

    OpenAIRE

    Rivolta, Carlo; Sweklo, Elizabeth A.; Berson, Eliot L.; Dryja, Thaddeus P.

    2000-01-01

    Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an...

  14. Gap Junctions Are Involved in the Rescue of CFTR-Dependent Chloride Efflux by Amniotic Mesenchymal Stem Cells in Coculture with Cystic Fibrosis CFBE41o- Cells

    Directory of Open Access Journals (Sweden)

    Annalucia Carbone

    2018-01-01

    Full Text Available We previously found that human amniotic mesenchymal stem cells (hAMSCs in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein. In order to explore the role of gap junction- (GJ- mediated intercellular communication (GJIC in this rescue, cocultures (hAMSC : CFBE, 1 : 5 ratio were studied for the formation of GJIC, before and after silencing connexin 43 (Cx43, a major component of GJs. Functional GJs in cocultures were inhibited when the expression of the Cx43 protein was downregulated. Transfection of cocultures with siRNA against Cx43 resulted in the absence of specific CFTR signal on the apical membrane and reduction in the mature form of CFTR (band C, and in parallel, the CFTR-dependent chloride channel activity was significantly decreased. Cx43 downregulation determined also a decrease in transepithelial resistance and an increase in paracellular permeability as compared with control cocultures, implying that GJIC may regulate CFTR expression and function that in turn modulate airway epithelium tightness. These results indicate that GJIC is involved in the correction of CFTR chloride channel activity upon the acquisition of an epithelial phenotype by hAMSCs in coculture with CF cells.

  15. Gap Junctions Are Involved in the Rescue of CFTR-Dependent Chloride Efflux by Amniotic Mesenchymal Stem Cells in Coculture with Cystic Fibrosis CFBE41o- Cells.

    Science.gov (United States)

    Carbone, Annalucia; Zefferino, Roberto; Beccia, Elisa; Casavola, Valeria; Castellani, Stefano; Di Gioia, Sante; Giannone, Valentina; Seia, Manuela; Angiolillo, Antonella; Colombo, Carla; Favia, Maria; Conese, Massimo

    2018-01-01

    We previously found that human amniotic mesenchymal stem cells (hAMSCs) in coculture with CF immortalised airway epithelial cells (CFBE41o- line, CFBE) on Transwell® filters acquired an epithelial phenotype and led to the expression of a mature and functional CFTR protein. In order to explore the role of gap junction- (GJ-) mediated intercellular communication (GJIC) in this rescue, cocultures (hAMSC : CFBE, 1 : 5 ratio) were studied for the formation of GJIC, before and after silencing connexin 43 (Cx43), a major component of GJs. Functional GJs in cocultures were inhibited when the expression of the Cx43 protein was downregulated. Transfection of cocultures with siRNA against Cx43 resulted in the absence of specific CFTR signal on the apical membrane and reduction in the mature form of CFTR (band C), and in parallel, the CFTR-dependent chloride channel activity was significantly decreased. Cx43 downregulation determined also a decrease in transepithelial resistance and an increase in paracellular permeability as compared with control cocultures, implying that GJIC may regulate CFTR expression and function that in turn modulate airway epithelium tightness. These results indicate that GJIC is involved in the correction of CFTR chloride channel activity upon the acquisition of an epithelial phenotype by hAMSCs in coculture with CF cells.

  16. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

    1996-07-26

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

  17. Mutations in REEP6 Cause Autosomal-Recessive Retinitis Pigmentosa.

    Science.gov (United States)

    Arno, Gavin; Agrawal, Smriti A; Eblimit, Aiden; Bellingham, James; Xu, Mingchu; Wang, Feng; Chakarova, Christina; Parfitt, David A; Lane, Amelia; Burgoyne, Thomas; Hull, Sarah; Carss, Keren J; Fiorentino, Alessia; Hayes, Matthew J; Munro, Peter M; Nicols, Ralph; Pontikos, Nikolas; Holder, Graham E; Asomugha, Chinwe; Raymond, F Lucy; Moore, Anthony T; Plagnol, Vincent; Michaelides, Michel; Hardcastle, Alison J; Li, Yumei; Cukras, Catherine; Webster, Andrew R; Cheetham, Michael E; Chen, Rui

    2016-12-01

    Retinitis pigmentosa (RP) is the most frequent form of inherited retinal dystrophy. RP is genetically heterogeneous and the genes identified to date encode proteins involved in a wide range of functional pathways, including photoreceptor development, phototransduction, the retinoid cycle, cilia, and outer segment development. Here we report the identification of biallelic mutations in Receptor Expression Enhancer Protein 6 (REEP6) in seven individuals with autosomal-recessive RP from five unrelated families. REEP6 is a member of the REEP/Yop1 family of proteins that influence the structure of the endoplasmic reticulum but is relatively unstudied. The six variants identified include three frameshift variants, two missense variants, and a genomic rearrangement that disrupts exon 1. Human 3D organoid optic cups were used to investigate REEP6 expression and confirmed the expression of a retina-specific isoform REEP6.1, which is specifically affected by one of the frameshift mutations. Expression of the two missense variants (c.383C>T [p.Pro128Leu] and c.404T>C [p.Leu135Pro]) and the REEP6.1 frameshift mutant in cultured cells suggest that these changes destabilize the protein. Furthermore, CRISPR-Cas9-mediated gene editing was used to produce Reep6 knock-in mice with the p.Leu135Pro RP-associated variant identified in one RP-affected individual. The homozygous knock-in mice mimic the clinical phenotypes of RP, including progressive photoreceptor degeneration and dysfunction of the rod photoreceptors. Therefore, our study implicates REEP6 in retinal homeostasis and highlights a pathway previously uncharacterized in retinal dystrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. TP53 mutation spectrum in smokers and never smoking lung cancer patients

    Directory of Open Access Journals (Sweden)

    Ann Rita Halvorsen

    2016-05-01

    Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.

  19. RNF43 is mutated less frequently in Lynch Syndrome compared with sporadic microsatellite unstable colorectal cancers.

    Science.gov (United States)

    Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J

    2018-01-01

    The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers

  20. Four Novel Mutations in the ALPL Gene in Chinese patients with Odonto, Childhood and Adult Hypophosphatasia.

    Science.gov (United States)

    Xu, Lijun; Pang, Qianqian; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiaoping; Xia, Weibo

    2018-05-03

    Background and purpose: Hypophosphatasiais (HPP) is a rare inherited disorder characterized by defective bone and/or dental mineralization, and decreased serum alkaline phosphatase activity. ALPL , the only gene related with HPP, encodes tissue non-specific alkaline phosphatase (TNSALP). Few studies were carried out in ALPL gene mutations in the Chinese population with HPP. The purpose of this study is to elucidate the clinical and genetic characteristics of HPP in 5 unrelated Chinese families and 2 sporadic patients. Methods : 10 clinically diagnosed HPP patients from 5 unrelated Chinese families and 2 sporadic patients and 50 healthy controls were genetic investigated. All 12 exons and exon-intron boundaries of the ALPL gene were amplified by polymerase chain reaction and directly sequenced. The laboratory and radiological investigations were conducted simultaneously in these 10 HPP patients. A three-dimensional model of the TNSALP was used to predict the dominant negative effect of identified missense mutations. Results : 3 odonto, 3 childhood and 4 adult types of HPP were clinically diagnosed. 10 mutations were identified in 5 unrelated Chinese families and 2 sporadic patients, including 8 missense mutations and 2 frameshift mutations. Of which, 4 were novel: 1 frameshift mutation (p.R138Pfsx45); 3 missense mutations (p.C201R, p.V459A, p.C497S). No identical mutations and any other new ALPL mutations were found in unrelated 50 healthy controls. Conclusions : Our study demonstrated that the ALPL  gene mutations are responsible for HPP in these Chinese families. These findings will be useful for clinicians to improve understanding of this heritable bone disorder. ©2018 The Author(s).

  1. Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

    Science.gov (United States)

    Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

    2014-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

  2. Novel GABRG2 mutations cause familial febrile seizures

    Science.gov (United States)

    Boillot, Morgane; Morin-Brureau, Mélanie; Picard, Fabienne; Weckhuysen, Sarah; Lambrecq, Virginie; Minetti, Carlo; Striano, Pasquale; Zara, Federico; Iacomino, Michele; Ishida, Saeko; An-Gourfinkel, Isabelle; Daniau, Mailys; Hardies, Katia; Baulac, Michel; Dulac, Olivier; Leguern, Eric; Nabbout, Rima

    2015-01-01

    Objective: To identify the genetic cause in a large family with febrile seizures (FS) and temporal lobe epilepsy (TLE) and subsequently search for additional mutations in a cohort of 107 families with FS, with or without epilepsy. Methods: The cohort consisted of 1 large family with FS and TLE, 64 smaller French families recruited through a national French campaign, and 43 Italian families. Molecular analyses consisted of whole-exome sequencing and mutational screening. Results: Exome sequencing revealed a p.Glu402fs*3 mutation in the γ2 subunit of the GABAA receptor gene (GABRG2) in the large family with FS and TLE. Three additional nonsense and frameshift GABRG2 mutations (p.Arg136*, p.Val462fs*33, and p.Pro59fs*12), 1 missense mutation (p.Met199Val), and 1 exonic deletion were subsequently identified in 5 families of the follow-up cohort. Conclusions: We report GABRG2 mutations in 5.6% (6/108) of families with FS, with or without associated epilepsy. This study provides evidence that GABRG2 mutations are linked to the FS phenotype, rather than epilepsy, and that loss-of-function of GABAA receptor γ2 subunit is the probable underlying pathogenic mechanism. PMID:27066572

  3. X-ray-induced mutations in Escherichia coli K-12 strains with altered DNA polymerase I activities

    International Nuclear Information System (INIS)

    Nagata, Yuki; Kawata, Masakado; Komura, Jun-ichiro; Ono, Tetsuya; Yamamoto, Kazuo

    2003-01-01

    Spectra of ionizing radiation mutagenesis were determined by sequencing X-ray-induced endogenous tonB gene mutations in Escherichia coli polA strains. We used two polA alleles, the polA1 mutation, defective for Klenow domain, and the polA107 mutation, defective for flap domain. We demonstrated that irradiation of 75 and 50 Gy X-rays could induce 3.8- and 2.6-fold more of tonB mutation in polA1 and polA107 strains, respectively, than spontaneous level. The radiation induced spectrum of 51 tonB mutations in polA1 and 51 in polA107 indicated that minus frameshift, A:T→T:A transversion and G:C→T:A transversion were the types of mutations increased. Previously, we have reported essentially the same X-ray-induced tonB mutation spectra in the wild-type strain. These results indicate that (1) X-rays can induce minus frameshift, A:T→T:A transversion and G:C→T:A transversion in E. coli and (2) presence or absence of polymerase I (PolI) of E. coli does not have any effects on the process of X-ray mutagenesis

  4. Intra-individual biological variation in sweat chloride concentrations in CF, CFTR dysfunction, and healthy pediatric subjects.

    Science.gov (United States)

    Cirilli, Natalia; Raia, Valeria; Rocco, Ilaria; De Gregorio, Fabiola; Tosco, Antonella; Salvadori, Laura; Sepe, Angela Ornella; Buzzetti, Roberto; Minicuci, Nadia; Castaldo, Giuseppe

    2018-04-02

    The sweat test is one of the main diagnostic tools used in newborn screening programs and as a confirmatory test, in case of suspect of Cystic Fibrosis (CF). Since sweat chloride (Cl) concentration is also considered an appropriate parameter to explore the efficacy of CFTR modulators in clinical trials, it is crucial to evaluate the biological variability of this test in healthy and pathological conditions. The aim of this pilot study was to determine the intra-individual biological variability of sweat Cl, both in healthy individuals and CF patients and to assess its correlation with diet, season, and menstrual cycle. Thirty-five out of 36 selected subjects (6-18 years) were enrolled by 2 CF care centers and assigned to 3 cohorts: CF, CFTR-related disorder (CFTR-RD) and healthy volunteers. Each participant was subjected to eight sweat tests in different conditions and time of the year. Data were analyzed using linear mixed effects models for repeated measures, taking also into account intra-individual correlations. We observed a high intra-individual variability of sweat Cl, with the lowest mean CV% values among CF patients (20.21 in CF, 29.74 in CFTR-RD, and 31.15 in healthy subjects). Gender and diet had no influence on sweat Cl variability, nor had pubertal age and menstrual phase. Results of this pilot study confirmed that sweat Cl variability is high in CF patients, although non-CF individuals displayed even higher mean CV% values. Season significantly influenced sweat test values only in CF patients, likely due to changes in their hydration status. © 2018 Wiley Periodicals, Inc.

  5. Solenopsis invicta virus 3: mapping of structural proteins, ribosomal frameshifting, and similarities to Acyrthosiphon pisum virus and Kelp fly virus.

    Directory of Open Access Journals (Sweden)

    Steven M Valles

    Full Text Available Solenopsis invicta virus 3 (SINV-3 is a positive-sense single-stranded RNA virus that infects the red imported fire ant, Solenopsis invicta. We show that the second open reading frame (ORF of the dicistronic genome is expressed via a frameshifting mechanism and that the sequences encoding the structural proteins map to both ORF2 and the 3' end of ORF1, downstream of the sequence that encodes the RNA-dependent RNA polymerase. The genome organization and structural protein expression strategy resemble those of Acyrthosiphon pisum virus (APV, an aphid virus. The capsid protein that is encoded by the 3' end of ORF1 in SINV-3 and APV is predicted to have a jelly-roll fold similar to the capsid proteins of picornaviruses and caliciviruses. The capsid-extension protein that is produced by frameshifting, includes the jelly-roll fold domain encoded by ORF1 as its N-terminus, while the C-terminus encoded by the 5' half of ORF2 has no clear homology with other viral structural proteins. A third protein, encoded by the 3' half of ORF2, is associated with purified virions at sub-stoichiometric ratios. Although the structural proteins can be translated from the genomic RNA, we show that SINV-3 also produces a subgenomic RNA encoding the structural proteins. Circumstantial evidence suggests that APV may also produce such a subgenomic RNA. Both SINV-3 and APV are unclassified picorna-like viruses distantly related to members of the order Picornavirales and the family Caliciviridae. Within this grouping, features of the genome organization and capsid domain structure of SINV-3 and APV appear more similar to caliciviruses, perhaps suggesting the basis for a "Calicivirales" order.

  6. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    Science.gov (United States)

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  7. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  8. Mutations in HPSE2 Cause Urofacial Syndrome

    Science.gov (United States)

    Daly, Sarah B.; Urquhart, Jill E.; Hilton, Emma; McKenzie, Edward A.; Kammerer, Richard A.; Lewis, Malcolm; Kerr, Bronwyn; Stuart, Helen; Donnai, Dian; Long, David A.; Burgu, Berk; Aydogdu, Ozgu; Derbent, Murat; Garcia-Minaur, Sixto; Reardon, Willie; Gener, Blanca; Shalev, Stavit; Smith, Rupert; Woolf, Adrian S.; Black, Graeme C.; Newman, William G.

    2010-01-01

    Urinary voiding dysfunction in childhood, manifesting as incontinence, dysuria, and urinary frequency, is a common condition. Urofacial syndrome (UFS) is a rare autosomal recessive disease characterized by facial grimacing when attempting to smile and failure of the urinary bladder to void completely despite a lack of anatomical bladder outflow obstruction or overt neurological damage. UFS individuals often have reflux of infected urine from the bladder to the upper renal tract, with a risk of kidney damage and renal failure. Whole-genome SNP mapping in one affected individual defined an autozygous region of 16 Mb on chromosome 10q23-q24, within which a 10 kb deletion encompassing exons 8 and 9 of HPSE2 was identified. Homozygous exonic deletions, nonsense mutations, and frameshift mutations in five further unrelated families confirmed HPSE2 as the causative gene for UFS. Mutations were not identified in four additional UFS patients, indicating genetic heterogeneity. We show that HPSE2 is expressed in the fetal and adult central nervous system, where it might be implicated in controlling facial expression and urinary voiding, and also in bladder smooth muscle, consistent with a role in renal tract morphology and function. Our findings have broader implications for understanding the genetic basis of lower renal tract malformations and voiding dysfunction. PMID:20560210

  9. Mutations in HPSE2 cause urofacial syndrome.

    Science.gov (United States)

    Daly, Sarah B; Urquhart, Jill E; Hilton, Emma; McKenzie, Edward A; Kammerer, Richard A; Lewis, Malcolm; Kerr, Bronwyn; Stuart, Helen; Donnai, Dian; Long, David A; Burgu, Berk; Aydogdu, Ozgu; Derbent, Murat; Garcia-Minaur, Sixto; Reardon, Willie; Gener, Blanca; Shalev, Stavit; Smith, Rupert; Woolf, Adrian S; Black, Graeme C; Newman, William G

    2010-06-11

    Urinary voiding dysfunction in childhood, manifesting as incontinence, dysuria, and urinary frequency, is a common condition. Urofacial syndrome (UFS) is a rare autosomal recessive disease characterized by facial grimacing when attempting to smile and failure of the urinary bladder to void completely despite a lack of anatomical bladder outflow obstruction or overt neurological damage. UFS individuals often have reflux of infected urine from the bladder to the upper renal tract, with a risk of kidney damage and renal failure. Whole-genome SNP mapping in one affected individual defined an autozygous region of 16 Mb on chromosome 10q23-q24, within which a 10 kb deletion encompassing exons 8 and 9 of HPSE2 was identified. Homozygous exonic deletions, nonsense mutations, and frameshift mutations in five further unrelated families confirmed HPSE2 as the causative gene for UFS. Mutations were not identified in four additional UFS patients, indicating genetic heterogeneity. We show that HPSE2 is expressed in the fetal and adult central nervous system, where it might be implicated in controlling facial expression and urinary voiding, and also in bladder smooth muscle, consistent with a role in renal tract morphology and function. Our findings have broader implications for understanding the genetic basis of lower renal tract malformations and voiding dysfunction.

  10. Funciones de los canales iónicos CFTR y ENAC en la fibrosis quística

    Directory of Open Access Journals (Sweden)

    Alejandra G. Palma

    2014-04-01

    Full Text Available La fibrosis quística se debe a la ausencia o defecto del canal transmembrana regulador de la fibrosis quística (CFTR, un canal de cloruro codificado en el gen cftr que juega un papel clave en la homeostasis del agua e iones. El CFTR es activado por el AMPc y se localiza en las membranas apicales y basolaterales de las vías aéreas, intestino y glándulas exocrinas. Una de sus funciones primarias en los pulmones es mantener la capa de líquido superficial a través de su función de canal y regular el canal epitelial de sodio sensible al amiloride (ENaC. Se han identificado más de 1900 mutaciones en el gen cftr. La enfermedad se caracteriza por secreciones viscosas en las glándulas exocrinas y por niveles elevados de cloruro de sodio en el sudor. En la fibrosis quística el CFTR no funciona y el ENaC está desregulado; el resultado es un aumento en la reabsorción de sodio y agua con la formación de un líquido viscoso. En las glándulas sudoríparas tanto el Na+ como el Cl- se retienen en el lumen causando una pérdida de electrolitos durante la sudoración y el NaCl se elimina al sudor. Así, los niveles elevados de NaCl son la base del test del sudor inducido por pilocarpina, un método de diagnóstico para la enfermedad. En esta revisión se discuten los movimientos de Cl- y Na+ en las glándulas sudoríparas y pulmón así como el papel del ENaC en la patogénesis de la enfermedad.

  11. Progranulin mutation causes frontotemporal dementia in the Swedish Karolinska family.

    Science.gov (United States)

    Chiang, Huei-Hsin; Rosvall, Lina; Brohede, Jesper; Axelman, Karin; Björk, Behnosh F; Nennesmo, Inger; Robins, Tiina; Graff, Caroline

    2008-11-01

    Frontotemporal dementia (FTD) is a neurodegenerative disease characterized by cognitive impairment, language dysfunction, and/or changes in personality. Recently it has been shown that progranulin (GRN) mutations can cause FTD as well as other neurodegenerative phenotypes. DNA from 30 family members, of whom seven were diagnosed with FTD, in the Karolinska family was available for GRN sequencing. Fibroblast cell mRNA from one affected family member and six control individuals was available for relative quantitative real-time polymerase chain reaction to investigate the effect of the mutation. Furthermore, the cDNA of an affected individual was sequenced. Clinical and neuropathologic findings of a previously undescribed family branch are presented. A frameshift mutation in GRN (g.102delC) was detected in all affected family members and absent in four unaffected family members older than 70 years. Real-time polymerase chain reaction data showed an approximately 50% reduction of GRN fibroblast mRNA in an affected individual. The mutated mRNA transcripts were undetectable by cDNA sequencing. Segregation and RNA analyses showed that the g.102delC mutation, previously reported, causes FTD in the Karolinska family. Our findings add further support to the significance of GRN in FTD etiology and the presence of modifying genes, which emphasize the need for further studies into the mechanisms of clinical heterogeneity. However, the results already call for attention to the complexity of predictive genetic testing of GRN mutations.

  12. Growth Hormone Receptor Mutations Related to Individual Dwarfism

    Science.gov (United States)

    Li, Charles; Zhang, Xiquan

    2018-01-01

    Growth hormone (GH) promotes body growth by binding with two GH receptors (GHRs) at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin-like growth factor (IGF) synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature), including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development. PMID:29748515

  13. Growth Hormone Receptor Mutations Related to Individual Dwarfism

    Directory of Open Access Journals (Sweden)

    Shudai Lin

    2018-05-01

    Full Text Available Growth hormone (GH promotes body growth by binding with two GH receptors (GHRs at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin‐like growth factor (IGF synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature, including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development.

  14. The identification of point mutations in Duchenne muscular dystrophy patients by using reverse-transcription PCR and the protein truncation test

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, R.J.; Bobrow, M.; Roberts, R.G. [St. Thomas`s Hospitals, London (United Kingdom)

    1995-08-01

    The protein truncation test (PTT) is a mutation-detection method that monitors the integrity of the open reading frame (ORF). More than 60% of cases of Duchenne muscular dystrophy (DMD) result from gross frameshifting deletions in the dystrophin gene that are detectable by multiplex PCR system. It has become apparent that virtually all of the remaining DMD mutations also disrupt the translational reading frame, making the PTT a logical next step toward a comprehensive strategy for the identification of all DMD mutations. We report here a pilot study involving 22 patients and describe the mutations characterized. These constitute 12 point mutations or small insertions/deletions and 4 gross rearrangements. We also have a remaining five patients in whom there does not appear to be mutation in the ORF. We believe that reverse-transcription-PCR/PTT is an efficient method by which to screen for small mutations in DMD patients with no deletion. 29 refs., 2 figs., 3 tabs.

  15. Microparticle-mediated transfer of the viral receptors CAR and CD46, and the CFTR channel in a CHO cell model confers new functions to target cells.

    Directory of Open Access Journals (Sweden)

    Gaëlle Gonzalez

    Full Text Available Cell microparticles (MPs released in the extracellular milieu can embark plasma membrane and intracellular components which are specific of their cellular origin, and transfer them to target cells. The MP-mediated, cell-to-cell transfer of three human membrane glycoproteins of different degrees of complexity was investigated in the present study, using a CHO cell model system. We first tested the delivery of CAR and CD46, two monospanins which act as adenovirus receptors, to target CHO cells. CHO cells lack CAR and CD46, high affinity receptors for human adenovirus serotype 5 (HAdV5, and serotype 35 (HAdV35, respectively. We found that MPs derived from CHO cells (MP-donor cells constitutively expressing CAR (MP-CAR or CD46 (MP-CD46 were able to transfer CAR and CD46 to target CHO cells, and conferred selective permissiveness to HAdV5 and HAdV35. In addition, target CHO cells incubated with MP-CD46 acquired the CD46-associated function in complement regulation. We also explored the MP-mediated delivery of a dodecaspanin membrane glycoprotein, the CFTR to target CHO cells. CFTR functions as a chloride channel in human cells and is implicated in the genetic disease cystic fibrosis. Target CHO cells incubated with MPs produced by CHO cells constitutively expressing GFP-tagged CFTR (MP-GFP-CFTR were found to gain a new cellular function, the chloride channel activity associated to CFTR. Time-course analysis of the appearance of GFP-CFTR in target cells suggested that MPs could achieve the delivery of CFTR to target cells via two mechanisms: the transfer of mature, membrane-inserted CFTR glycoprotein, and the transfer of CFTR-encoding mRNA. These results confirmed that cell-derived MPs represent a new class of promising therapeutic vehicles for the delivery of bioactive macromolecules, proteins or mRNAs, the latter exerting the desired therapeutic effect in target cells via de novo synthesis of their encoded proteins.

  16. De novo mutations in the genome organizer CTCF cause intellectual disability

    DEFF Research Database (Denmark)

    Gregor, Anne; Oti, Martin; Kouwenhoven, Evelyn N

    2013-01-01

    An increasing number of genes involved in chromatin structure and epigenetic regulation has been implicated in a variety of developmental disorders, often including intellectual disability. By trio exome sequencing and subsequent mutational screening we now identified two de novo frameshift...... mutations and one de novo missense mutation in CTCF in individuals with intellectual disability, microcephaly, and growth retardation. Furthermore, an individual with a larger deletion including CTCF was identified. CTCF (CCCTC-binding factor) is one of the most important chromatin organizers in vertebrates...... and is involved in various chromatin regulation processes such as higher order of chromatin organization, enhancer function, and maintenance of three-dimensional chromatin structure. Transcriptome analyses in all three individuals with point mutations revealed deregulation of genes involved in signal transduction...

  17. A novel heterozygous SOX2 mutation causing congenital bilateral anophthalmia, hypogonadotropic hypogonadism and growth hormone deficiency.

    Science.gov (United States)

    Macchiaroli, Annamaria; Kelberman, Daniel; Auriemma, Renata Simona; Drury, Suzanne; Islam, Lily; Giangiobbe, Sara; Ironi, Gabriele; Lench, Nicholas; Sowden, Jane C; Colao, Annamaria; Pivonello, Rosario; Cavallo, Luciano; Gasperi, Maurizio; Faienza, Maria Felicia

    2014-01-25

    Heterozygous de novo mutations in SOX2 have been reported in approximately 10-20% of patients with unilateral or bilateral anophthalmia or microphthalmia. An additional phenotype of hypopituitarism, with anterior pituitary hypoplasia and hypogonadotropic hypogonadism, has been reported in patients carrying SOX2 alterations. We report a novel heterozygous mutation in the SOX2 gene in a male affected with congenital bilateral anophthalmia, hypogonadotrophic hypogonadism and growth hormone deficiency. The mutation we describe is a cytosine deletion in position 905 (c905delC) which causes frameshift and an aberrant C-terminal domain. Our report highlights the fact that subjects affected with eye anomalies and harboring SOX2 mutations are at high risk for gonadotropin deficiency, which has important implications for their clinical management. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Induction of spontaneous and UV-induced mutations during commitment to meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Machida, I.; Nakai, S.

    1980-01-01

    Inductions of reversions of nonsense, missense and frameshift-type mutations were investigated in a diploid cell population of Saccharomyces cerevisiae during commitment to meiosis, by using the medium-transfer technique from sporulation medium to vegetative medium. The yields of spontaneous reverse mutations obtained from the cells that were committed to different stages during meiosis were rather constant irrespective of the alleles tested, although the yields of both intergenic and intragenic recombinations markedly increased. The susceptibilities to UV-induced reverse mutations examined during commitment to meiosis were not changed appreciably. It is concluded that induction of base-change-type mutations in meiosis is not essentially different from that in mitosis. (orig.)

  19. Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

    Science.gov (United States)

    Yan, Denise; Ouyang, Xiaomei; Patterson, D Michael; Du, Li Lin; Jacobson, Samuel G; Liu, Xue-Zhong

    2009-12-01

    Usher syndrome type II (USH2) is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). To identify novel mutations and determine the frequency of USH2A mutations as a cause of USH2, we have carried out mutation screening of all 72 coding exons and exon-intron splice sites of the USH2A gene. A total of 20 USH2 American probands of European descent were analyzed using single strand conformational polymorphism (SSCP) and direct sequencing methods. Ten different USH2A mutations were identified in 55% of the probands, five of which were novel mutations. The detected mutations include three missense, three frameshifts and four nonsense mutations, with c.2299delG/p.E767fs mutation, accounting for 38.9% of the pathological alleles. Two cases were homozygotes, two cases were compound heterozygotes and one case had complex allele with three variants. In seven probands, only one USH2A mutation was detected and no pathological mutation was found in the remaining eight individuals. Altogether, our data support the fact that c.2299delG/p.E767fs is indeed the most common USH2A mutation found in USH2 patients of European Caucasian background. Thus, if screening for mutations in USH2A is considered, it is reasonable to screen for the c.2299delG mutation first.

  20. The ichthyotoxic alga Chattonella marina induces Na+, K+-ATPase, and CFTR proteins expression in fish gill chloride cells in vivo

    International Nuclear Information System (INIS)

    Tang, Janet Y.M.; Wong, Chris K.C.; Au, Doris W.T.

    2007-01-01

    Our previous studies demonstrated that the ichthyotoxic Chattonella marina stimulated proliferation of branchial chloride cell (CC) and induced osmotic distress akin to hyperactive elimination of ions in fish (Rhabdosargus sarba). To ascertain the in vivo effects of C. marina on key CC ion transporters, the localization and expression of Na + , K + -ATPase (NKA) and cystic fibrosis transmembrane conductance regulator (CFTR) proteins in response to C. marina exposure were investigated, using a quantitative immunocytochemical approach. The polarized distributions of NKA (α subunit) and CFTR proteins in branchial CCs of R. sarba remained unchanged under C. marina exposure. However, significant inductions of these two ion-transporters were detected in CCs of fish after 6 h exposure. By real-time PCR, no significant changes in gill NKA and CFTR mRNA expressions were detected, suggesting a post-transcriptional pathway is likely involved in regulating the ion transporters abundance. This study is the first to demonstrate the in vivo effects of harmful algal toxin on NKA and CFTR protein expressions in gill transepithelial cells. Taken together, an augmentation of branchial CCs together with hyper-stimulation of NKA and CFTR in CCs attribute to the rapid development of osmotic distress in C. marina susceptible fish

  1. [Relation between gene mutations and pancreatic exocrine function in patients with cystic fibrosis].

    Science.gov (United States)

    Radivojević, D; Guć-Sćekić, M; Djurisić, M; Lalić, T; Minić, P; Kanavakis, E

    2001-01-01

    Cystic fibrosis (CF), is the most common autosomal-recessive disease in Caucasians, with an incidence of approximately 1:2500 live births and a carrier frequency of approximately 4-5%. Causes of the disease are mutations in the CF gene which is located on chromosome 7 (region 7q31). Although a single mutation, a deletion of phenylalanine at position 508 (DF508) in exon 10, accounts for almost 70% of all CF chromosomes, over 900 other mutations have been identified in this large gene. CF gene encodes a membrane protein, which functions as aion channel- CFTR (cystic fibrosis transmembrane regulator protein). The exocrine pancreas is a gland that secretes water, enzymes and electrolytes into the intestinal lumen. These enzymes are needed for the normal digestion of food, and their reduced secretion in cystic fibrosis will cause malabsortion and malnutrition in CF patients. Pancreatic dysfunction in CF begins in uteri. Most patients with CF typically present insufficient pancreatic exocrine function (PI phenotype) and 10-15% of CF patients are pancreatic sufficient (PS phenotype). It has been shown elsewhere that the pancreatic function status in CF could be correlated to mutations in the CFTR gene. To determine the relation between genotype and pancreatic status, we analyzed 32 CF patients in whom both CF gene mutant alleles were identified (Table 1). Patients included in this study attended the Paediatric Department of Mother and Child Health Institute in Belgrade. The diagnosis was based on typical clinical manifestations and high levels of sweat chloride concentration (higher than 60 mmol/L). Of the 32 patients studied, only one (3.12%) was PS and the rest (96.88%) had PI phenotype. For each CF genotype the number of patients who were PI or PS is given in Table 1. The most striking observation was that all given genotypes correlated with either PI or PS, but not with both. On the basis of both preceding hypotheses and our present data (Table 2 and Table 3), it was

  2. A de novo frameshift in HNRNPK causing a Kabuki-like syndrome with nodular heterotopia.

    Science.gov (United States)

    Lange, L; Pagnamenta, A T; Lise, S; Clasper, S; Stewart, H; Akha, E S; Quaghebeur, G; Knight, S J L; Keays, D A; Taylor, J C; Kini, U

    2016-09-01

    Kabuki syndrome is a heterogeneous condition characterized by distinctive facial features, intellectual disability, growth retardation, skeletal abnormalities and a range of organ malformations. Although at least two major causative genes have been identified, these do not explain all cases. Here we describe a patient with a complex Kabuki-like syndrome that included nodular heterotopia, in whom testing for several single-gene disorders had proved negative. Exome sequencing uncovered a de novo c.931_932insTT variant in HNRNPK (heterogeneous nuclear ribonucleoprotein K). Although this variant was identified in March 2012, its clinical relevance could only be confirmed following the August 2015 publication of two cases with HNRNPK mutations and an overlapping phenotype that included intellectual disability, distinctive facial dysmorphism and skeletal/connective tissue abnormalities. Whilst we had attempted (unsuccessfully) to identify additional cases through existing collaborators, the two published cases were 'matched' using GeneMatcher, a web-based tool for connecting researchers and clinicians working on identical genes. Our report therefore exemplifies the importance of such online tools in clinical genetics research and the benefits of periodically reviewing cases with variants of unproven significance. Our study also suggests that loss of function variants in HNRNPK should be considered as a molecular basis for patients with Kabuki-like syndrome. © 2016 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular dystrophy patients: introducing three novel variants.

    Science.gov (United States)

    Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar

    2016-06-01

    Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.

  4. Mercury toxicity in the shark (Squalus acanthias) rectal gland: apical CFTR chloride channels are inhibited by mercuric chloride.

    Science.gov (United States)

    Ratner, Martha A; Decker, Sarah E; Aller, Stephen G; Weber, Gerhard; Forrest, John N

    2006-03-01

    In the shark rectal gland, basolateral membrane proteins have been suggested as targets for mercury. To examine the membrane polarity of mercury toxicity, we performed experiments in three preparations: isolated perfused rectal glands, primary monolayer cultures of rectal gland epithelial cells, and Xenopus oocytes expressing the shark cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In perfused rectal glands we observed: (1) a dose-dependent inhibition by mercury of forskolin/3-isobutyl-1-methylxanthine (IBMX)-stimulated chloride secretion; (2) inhibition was maximal when mercury was added before stimulation with forskolin/IBMX; (3) dithiothrietol (DTT) and glutathione (GSH) completely prevented inhibition of chloride secretion. Short-circuit current (Isc) measurements in monolayers of rectal gland epithelial cells were performed to examine the membrane polarity of this effect. Mercuric chloride inhibited Isc more potently when applied to the solution bathing the apical vs. the basolateral membrane (23 +/- 5% and 68 +/- 5% inhibition at 1 and 10 microM HgCl2 in the apical solution vs. 2 +/- 0.9% and 14 +/- 5% in the basolateral solution). This inhibition was prevented by pre-treatment with apical DTT or GSH; however, only the permeant reducing agent DTT reversed mercury inhibition when added after exposure. When the shark rectal gland CFTR channel was expressed in Xenopus oocytes and chloride conductance was measured by two-electrode voltage clamping, we found that 1 microM HgCl2 inhibited forskolin/IBMX conductance by 69.2 +/- 2.0%. We conclude that in the shark rectal gland, mercury inhibits chloride secretion by interacting with the apical membrane and that CFTR is the likely site of this action. Copyright 2006 Wiley-Liss, Inc.

  5. [Suspected pathogenic mutation identified in two cases with oculocutaneous albinism].

    Science.gov (United States)

    He, Jiangmei; Zheng, Meiling; Zhang, Guilin; Hua, Ailing

    2015-08-01

    To detect potential mutations in genes related with non-syndromic oculocutaneous albinism I-IV and ocular albinism type I in two couples who had given births to children with albinism. All exons of the non-syndromic albinism related genes TYR, OCA2, TYRP-1, MITF, SLC45A2 and GPR143 were subjected to deep sequencing. The results were verified with Sanger sequencing. For the two female carriers, the coding region of the TYR gene was found to harbor a frameshift mutation c.925_926insC, which was also suspected to have been pathogenic. In one of the male partners, a nonsense mutations c.832C>T was found, which was also known to be pathogenic. Another male partner was found to harbor a TYR gene mutation c.346C>T, which was also known to be a pathogenic nonsense mutation. The coding region of the TYR gene c.925_926insC (p.Thr309ThrfsX9) probably underlies the OCA1 disease phenotype.

  6. Truncating Mutations of MAGEL2, a Gene within the Prader-Willi Locus, Are Responsible for Severe Arthrogryposis

    Science.gov (United States)

    Mejlachowicz, Dan; Nolent, Flora; Maluenda, Jérome; Ranjatoelina-Randrianaivo, Hanitra; Giuliano, Fabienne; Gut, Ivo; Sternberg, Damien; Laquerrière, Annie; Melki, Judith

    2015-01-01

    Arthrogryposis multiplex congenita (AMC) is characterized by the presence of multiple joint contractures resulting from reduced or absent fetal movement. Here, we report two unrelated families affected by lethal AMC. By genetic mapping and whole-exome sequencing in a multiplex family, a heterozygous truncating MAGEL2 mutation leading to frameshift and a premature stop codon (c.1996delC, p.Gln666Serfs∗36) and inherited from the father was identified in the probands. In another family, a distinct heterozygous truncating mutation leading to frameshift (c.2118delT, p.Leu708Trpfs∗7) and occurring de novo on the paternal allele of MAGEL2 was identified in the affected individual. In both families, RNA analysis identified the mutated paternal MAGEL2 transcripts only in affected individuals. MAGEL2 is one of the paternally expressed genes within the Prader-Willi syndrome (PWS) locus. PWS is associated with, to varying extents, reduced fetal mobility, severe infantile hypotonia, childhood-onset obesity, hypogonadism, and intellectual disability. MAGEL2 mutations have been recently reported in affected individuals with features resembling PWS and called Schaaf-Yang syndrome. Here, we show that paternal MAGEL2 mutations are also responsible for lethal AMC, recapitulating the clinical spectrum of PWS and suggesting that MAGEL2 is a PWS-determining gene. PMID:26365340

  7. Mitochondrial Mutation Rate, Spectrum and Heteroplasmy in Caenorhabditis elegans Spontaneous Mutation Accumulation Lines of Differing Population Size.

    Science.gov (United States)

    Konrad, Anke; Thompson, Owen; Waterston, Robert H; Moerman, Donald G; Keightley, Peter D; Bergthorsson, Ulfar; Katju, Vaishali

    2017-06-01

    Mitochondrial genomes of metazoans, given their elevated rates of evolution, have served as pivotal markers for phylogeographic studies and recent phylogenetic events. In order to determine the dynamics of spontaneous mitochondrial mutations in small populations in the absence and presence of selection, we evolved mutation accumulation (MA) lines of Caenorhabditis elegans in parallel over 409 consecutive generations at three varying population sizes of N = 1, 10, and 100 hermaphrodites. The N =1 populations should have a minimal influence of natural selection to provide the spontaneous mutation rate and the expected rate of neutral evolution, whereas larger population sizes should experience increasing intensity of selection. New mutations were identified by Illumina paired-end sequencing of 86 mtDNA genomes across 35 experimental lines and compared with published genomes of natural isolates. The spontaneous mitochondrial mutation rate was estimated at 1.05 × 10-7/site/generation. A strong G/C→A/T mutational bias was observed in both the MA lines and the natural isolates. This suggests that the low G + C content at synonymous sites is the product of mutation bias rather than selection as previously proposed. The mitochondrial effective population size per worm generation was estimated to be 62. Although it was previously concluded that heteroplasmy was rare in C. elegans, the vast majority of mutations in this study were heteroplasmic despite an experimental regime exceeding 400 generations. The frequencies of frameshift and nonsynonymous mutations were negatively correlated with population size, which suggests their deleterious effects on fitness and a potent role for selection in their eradication. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Endogenous ribosomal frameshift signals operate as mRNA destabilizing elements through at least two molecular pathways in yeast.

    Science.gov (United States)

    Belew, Ashton T; Advani, Vivek M; Dinman, Jonathan D

    2011-04-01

    Although first discovered in viruses, previous studies have identified operational -1 ribosomal frameshifting (-1 RF) signals in eukaryotic genomic sequences, and suggested a role in mRNA stability. Here, four yeast -1 RF signals are shown to promote significant mRNA destabilization through the nonsense mediated mRNA decay pathway (NMD), and genetic evidence is presented suggesting that they may also operate through the no-go decay pathway (NGD) as well. Yeast EST2 mRNA is highly unstable and contains up to five -1 RF signals. Ablation of the -1 RF signals or of NMD stabilizes this mRNA, and changes in -1 RF efficiency have opposing effects on the steady-state abundance of the EST2 mRNA. These results demonstrate that endogenous -1 RF signals function as mRNA destabilizing elements through at least two molecular pathways in yeast. Consistent with current evolutionary theory, phylogenetic analyses suggest that -1 RF signals are rapidly evolving cis-acting regulatory elements. Identification of high confidence -1 RF signals in ∼10% of genes in all eukaryotic genomes surveyed suggests that -1 RF is a broadly used post-transcriptional regulator of gene expression.

  9. Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

    Science.gov (United States)

    Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

    2016-12-01

    Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

  10. Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

    Science.gov (United States)

    Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

    2017-01-01

    Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.

  11. Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient

    Energy Technology Data Exchange (ETDEWEB)

    Choy, F.Y.M.; Humphries, M.L. [Univ. of Victoria, British Columbia (Canada); Ferreira, P. [Univ. of Alberta, Edmonton (Canada)

    1997-01-20

    Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.

  12. Preleukemic and second-hit mutational events in an acute myeloid leukemia patient with a novel germline RUNX1 mutation.

    Science.gov (United States)

    Ng, Isaac Ks; Lee, Joanne; Ng, Christopher; Kosmo, Bustamin; Chiu, Lily; Seah, Elaine; Mok, Michelle Meng Huang; Tan, Karen; Osato, Motomi; Chng, Wee-Joo; Yan, Benedict; Tan, Lip Kun

    2018-01-01

    Germline mutations in the RUNX1 transcription factor give rise to a rare autosomal dominant genetic condition classified under the entity: Familial Platelet Disorders with predisposition to Acute Myeloid Leukaemia (FPD/AML). While several studies have identified a myriad of germline RUNX1 mutations implicated in this disorder, second-hit mutational events are necessary for patients with hereditary thrombocytopenia to develop full-blown AML. The molecular picture behind this process remains unclear. We describe a patient of Malay descent with an unreported 7-bp germline RUNX1 frameshift deletion, who developed second-hit mutations that could have brought about the leukaemic transformation from a pre-leukaemic state. These mutations were charted through the course of the treatment and stem cell transplant, showing a clear correlation between her clinical presentation and the mutations present. The patient was a 27-year-old Malay woman who presented with AML on the background of hereditary thrombocytopenia affecting her father and 3 brothers. Initial molecular testing revealed the same novel RUNX1 mutation in all 5 individuals. The patient received standard induction, consolidation chemotherapy, and a haploidentical stem cell transplant from her mother with normal RUNX1 profile. Comprehensive genomic analyses were performed at diagnosis, post-chemotherapy and post-transplant. A total of 8 mutations ( RUNX1 , GATA2 , DNMT3A , BCORL1 , BCOR , 2 PHF6 and CDKN2A ) were identified in the pre-induction sample, of which 5 remained ( RUNX1 , DNMT3A , BCORL1 , BCOR and 1 out of 2 PHF6 ) in the post-treatment sample and none were present post-transplant. In brief, the 3 mutations which were lost along with the leukemic cells at complete morphological remission were most likely acquired leukemic driver mutations that were responsible for the AML transformation from a pre-leukemic germline RUNX1 -mutated state. On the contrary, the 5 mutations that persisted post

  13. Clinical study of DMD gene point mutation causing Becker muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Ji-qing CAO

    2015-07-01

    Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

  14. Prevalence of Novel MAGED2 Mutations in Antenatal Bartter Syndrome.

    Science.gov (United States)

    Legrand, Anne; Treard, Cyrielle; Roncelin, Isabelle; Dreux, Sophie; Bertholet-Thomas, Aurélia; Broux, Françoise; Bruno, Daniele; Decramer, Stéphane; Deschenes, Georges; Djeddi, Djamal; Guigonis, Vincent; Jay, Nadine; Khalifeh, Tackwa; Llanas, Brigitte; Morin, Denis; Morin, Gilles; Nobili, François; Pietrement, Christine; Ryckewaert, Amélie; Salomon, Rémi; Vrillon, Isabelle; Blanchard, Anne; Vargas-Poussou, Rosa

    2018-02-07

    Mutations in the MAGED2 gene, located on the X chromosome, have been recently detected in males with a transient form of antenatal Bartter syndrome or with idiopathic polyhydramnios. The aim of this study is to analyze the proportion of the population with mutations in this gene in a French cohort of patients with antenatal Bartter syndrome. The French cohort of patients with antenatal Bartter syndrome encompasses 171 families. Mutations in genes responsible for types 1-4 have been detected in 75% of cases. In patients without identified genetic cause ( n =42), transient antenatal Bartter syndrome was reported in 12 cases. We analyzed the MAGED2 gene in the entire cohort of negative cases by Sanger sequencing and retrospectively collected clinical data regarding pregnancy as well as the postnatal outcome for positive cases. We detected mutations in MAGED2 in 17 patients, including the 12 with transient antenatal Bartter syndrome, from 16 families. Fifteen different mutations were detected (one whole deletion, three frameshift, three splicing, three nonsense, two inframe deletions, and three missense); 13 of these mutations had not been previously described. Interestingly, two patients are females; in one of these patients our data are consistent with selective inactivation of chromosome X explaining the severity. The phenotypic presentation in our patients was variable and less severe than that of the originally described cases. MAGED2 mutations explained 9% of cases of antenatal Bartter syndrome in a French cohort, and accounted for 38% of patients without other characterized mutations and for 44% of male probands of negative cases. Our study confirmed previously published data and showed that females can be affected. As a result, this gene must be included in the screening of the most severe clinical form of Bartter syndrome. Copyright © 2018 by the American Society of Nephrology.

  15. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Two Salt Bridges Differentially Contribute to the Maintenance of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Channel Function*

    Science.gov (United States)

    Cui, Guiying; Freeman, Cody S.; Knotts, Taylor; Prince, Chengyu Z.; Kuang, Christopher; McCarty, Nael A.

    2013-01-01

    Previous studies have identified two salt bridges in human CFTR chloride ion channels, Arg352-Asp993 and Arg347-Asp924, that are required for normal channel function. In the present study, we determined how the two salt bridges cooperate to maintain the open pore architecture of CFTR. Our data suggest that Arg347 not only interacts with Asp924 but also interacts with Asp993. The tripartite interaction Arg347-Asp924-Asp993 mainly contributes to maintaining a stable s2 open subconductance state. The Arg352-Asp993 salt bridge, in contrast, is involved in stabilizing both the s2 and full (f) open conductance states, with the main contribution being to the f state. The s1 subconductance state does not require either salt bridge. In confirmation of the role of Arg352 and Asp993, channels bearing cysteines at these sites could be latched into a full open state using the bifunctional cross-linker 1,2-ethanediyl bismethanethiosulfonate, but only when applied in the open state. Channels remained latched open even after washout of ATP. The results suggest that these interacting residues contribute differently to stabilizing the open pore in different phases of the gating cycle. PMID:23709221

  17. Isolated hypogonadotropic hypogonadism with SOX2 mutation and anophthalmia/microphthalmia in offspring.

    Science.gov (United States)

    Stark, Zornitza; Storen, Rebecca; Bennetts, Bruce; Savarirayan, Ravi; Jamieson, Robyn V

    2011-07-01

    Isolated hypogonadotropic hypogonadism (IHH) is a genetically heterogeneous condition in which patients frequently require assisted reproduction to achieve fertility. In patients with IHH who are otherwise well, no particular increased risk of congenital anomalies in the resultant offspring has been highlighted. Heterozygous mutations in SOX2 are the commonest single-gene cause of anophthalmia/microphthalmia (A/M) and sometimes result in pituitary abnormalities. We report a family with a novel frameshift mutation in the SOX2 transactivation domain, p.Gly280AlafsX91, resulting in bilateral anophthalmia and subtle endocrinological abnormalities in a male sibling, and unilateral microphthalmia in a female sibling. The mutation is present in their mother who has IHH, but has no eye disorders or other anomalies. She underwent assisted reproduction to achieve fertility. This report has important implications for the evaluation of patients with IHH, particularly in the setting of planned infertility treatment.

  18. A novel mutation in the EDAR gene causes severe autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Henningsen, Emil; Svendsen, Mathias Tiedemann; Lildballe, Dorte Launholt; Jensen, Peter Kjestrup Axel

    2014-08-01

    We report on a 2-year-old girl presenting with a severe form of hypohidrotic ectodermal dysplasia (HED). The patient presented with hypotrichosis, anodontia, hypohidrosis, frontal bossing, prominent lips and ears, dry, pale skin, and dermatitis. The patient had chronic rhinitis with malodorous nasal discharge. The girl was the second born child of first-cousin immigrants from Northern Iraq. A novel homozygous mutation (c.84delC) in the EDAR gene was identified. This mutation most likely causes a frameshift in the protein product (p.S29fs*74). This results in abolition of all ectodysplasin-mediated NF-kB signalling. This complete loss-of-function mutation likely accounts for the severe clinical abnormalities in ectodermal structures in the described patient. © 2014 Wiley Periodicals, Inc.

  19. Missense mutation in the USH2A gene: association with recessive retinitis pigmentosa without hearing loss.

    Science.gov (United States)

    Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P

    2000-06-01

    Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.

  20. Kinetics of gene and chromosome mutations induced by UV-C in yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Koltovaya, N.; Kokoreva, A.; Senchenko, D.; Shvaneva, N.; Zhuchkina, N.

    2017-01-01

    The systematic study of the kinetics of UV-induced gene and structural mutations in eukaryotic cells was carried out on the basis of model yeast S. cerevisiae. A variety of genetic assays (all types of base pair substitutions, frameshifts, forward mutations canl, chromosomal and plasmid rearrangements) in haploid strains were used. Yeast cells were treated by UV-C light of fluence of energy up to 200 J/m"2. The kinetics of the induced gene and structural mutations is represented by a linear-quadratic and exponential functions. The slope of curves in log-log plots was not constant, had the value 2-4 and depended on the interval of doses. It was suggested that it is the superposition and dynamics of different pathways form the mutagenic responses of eukaryotic cells to UV-C light that cause the high-order curves. [ru

  1. Prenatal diagnosis of autosomal dominant hereditary spastic paraplegia (SPG4) using direct mutation detection

    DEFF Research Database (Denmark)

    Nielsen, Jørgen E; Koefoed, Pernille; Kjaergaard, Susanne

    2004-01-01

    OBJECTIVE: To present a report on prenatal diagnosis using direct SPG4 gene analysis in a family with autosomal dominant hereditary spastic paraplegia (AD-HSP). METHODS: Genetic linkage and haplotype analysis were previously carried out with chromosome 2p markers. DNA was obtained from affected...... individuals, the affected father, the mother, and fetal DNA from an ongoing pregnancy by chorionic villus sampling (CVS) in the first trimester. The spastin gene (SPG4) was completely sequenced. RESULTS: A novel 832insGdelAA frameshift mutation, predicted to cause loss of functional protein, was identified...... in the affected father and in the fetal DNA. CONCLUSIONS: This is the first report on direct prenatal diagnosis of chromosome 2p-linked AD-HSP (SPG4). In addition, we report a novel SPG4-combined small insertion/deletion mutation in exon 5, which may be the first SPG4 mutational hot spot....

  2. TBC1D24 Mutations in a Sibship with Multifocal Polymyoclonus

    Directory of Open Access Journals (Sweden)

    Adeline Ngoh

    2017-04-01

    Full Text Available Background: Advances in molecular genetic technologies have improved our understanding of genetic causes of rare neurological disorders with features of myoclonus.Case Report: A family with two affected siblings, presenting with multifocal polymyoclonus and neurodevelopmental delay, was recruited for whole-exome sequencing following unyielding diagnostic neurometabolic investigations. Compound heterozygous mutations in TBC1D24, a gene previously associated with various epilepsy phenotypes and hearing loss, were identified in both siblings. The mutations included a missense change c.457G>A (p.Glu157Lys, and a novel frameshift mutation c.545del (p.Thr182Serfs*6.Discussion: We propose that TBC1D24-related diseases should be in the differential diagnosis for children with polymyoclonus. 

  3. Naturally occurred frame-shift mutations in the tvb receptor gene are responsible for decreased susceptibility to subgroups B, D, and E avian leukosis virus infection in chicken

    Science.gov (United States)

    The group of highly related avian leukosis viruses (ALVs) in chickens were thought to have evolved from a common retroviral ancestor into six subgroups, A to E and J. These ALV subgroups use diverse cellular proteins encoded by four genetic loci in chickens as receptors to gain entry into host cells...

  4. Normosmic congenital hypogonadotropic hypogonadism due to TAC3/TACR3 mutations: characterization of neuroendocrine phenotypes and novel mutations.

    Directory of Open Access Journals (Sweden)

    Bruno Francou

    Full Text Available CONTEXT: TAC3/TACR3 mutations have been reported in normosmic congenital hypogonadotropic hypogonadism (nCHH (OMIM #146110. In the absence of animal models, studies of human neuroendocrine phenotypes associated with neurokinin B and NK3R receptor dysfunction can help to decipher the pathophysiology of this signaling pathway. OBJECTIVE: To evaluate the prevalence of TAC3/TACR3 mutations, characterize novel TACR3 mutations and to analyze neuroendocrine profiles in nCHH caused by deleterious TAC3/TACR3 biallelic mutations. RESULTS: From a cohort of 352 CHH, we selected 173 nCHH patients and identified nine patients carrying TAC3 or TACR3 variants (5.2%. We describe here 7 of these TACR3 variants (1 frameshift and 2 nonsense deleterious mutations and 4 missense variants found in 5 subjects. Modeling and functional studies of the latter demonstrated the deleterious consequence of one missense mutation (Tyr267Asn probably caused by the misfolding of the mutated NK3R protein. We found a statistically significant (p<0.0001 higher mean FSH/LH ratio in 11 nCHH patients with TAC3/TACR3 biallelic mutations than in 47 nCHH patients with either biallelic mutations in KISS1R, GNRHR, or with no identified mutations and than in 50 Kallmann patients with mutations in KAL1, FGFR1 or PROK2/PROKR2. Three patients with TAC3/TACR3 biallelic mutations had an apulsatile LH profile but low-frequency alpha-subunit pulses. Pulsatile GnRH administration increased alpha-subunit pulsatile frequency and reduced the FSH/LH ratio. CONCLUSION: The gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations is related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio. This ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations.

  5. Clusters of Cl- channels in CFTR-expressing em>Sf>9 cells switch spontaneously between slow and fast gating modes

    DEFF Research Database (Denmark)

    Larsen, Erik Hviid; Price, E. M.; Gabriel, S. E.

    1996-01-01

    channel. Excised outside-out patches of CFTR-infected and forskolin-stimulated cells exhibited wave-like gating kinetics of well-resolved current transitions. All-point Gaussian distributions revealed contributions from several (five to nine) identical channels. Such channels, in excised outside...

  6. Interplay between DMD point mutations and splicing signals in Dystrophinopathy phenotypes.

    Directory of Open Access Journals (Sweden)

    Jonàs Juan-Mateu

    Full Text Available DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements.

  7. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

    DEFF Research Database (Denmark)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

    2016-01-01

    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2...... Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large...... deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder...

  8. Novel BRCA1 splice-site mutation in ovarian cancer patients of Slavic origin.

    Science.gov (United States)

    Krivokuca, Ana; Dragos, Vita Setrajcic; Stamatovic, Ljiljana; Blatnik, Ana; Boljevic, Ivana; Stegel, Vida; Rakobradovic, Jelena; Skerl, Petra; Jovandic, Stevo; Krajc, Mateja; Magic, Mirjana Brankovic; Novakovic, Srdjan

    2018-04-01

    Mutations in breast cancer susceptibility gene 1 (BRCA1) lead to defects in a number of cellular pathways including DNA damage repair and transcriptional regulation, resulting in the elevated genome instability and predisposing to breast and ovarian cancers. We report a novel mutation LRG_292t1:c.4356delA,p.(Ala1453Glnfs*3) in the 12th exon of BRCA1, in the splice site region near the donor site of intron 12. It is a frameshift mutation with the termination codon generated on the third amino acid position from the site of deletion. Human Splice Finder 3.0 and MutationTaster have assessed this variation as disease causing, based on the alteration of splicing, creation of premature stop codon and other potential alterations initiated by nucleotide deletion. Among the most important alterations are frameshift and splice site changes (score of the newly created donor splice site: 0.82). c.4356delA was associated with two ovarian cancer cases in two families of Slavic origin. It was detected by next generation sequencing, and confirmed with Sanger sequencing in both cases. Because of the fact that it changes the reading frame of the protein, novel mutation c.4356delA p.(Ala1453Glnfs*3) in BRCA1 gene might be of clinical significance for hereditary ovarian cancer. Further functional as well as segregation analyses within the families are necessary for appropriate clinical classification of this variant. Since it has been detected in two ovarian cancer patients of Slavic origin, it is worth investigating founder effect of this mutation in Slavic populations.

  9. Mutation spectrum of homogentisic acid oxidase (HGD) in alkaptonuria.

    Science.gov (United States)

    Vilboux, Thierry; Kayser, Michael; Introne, Wendy; Suwannarat, Pim; Bernardini, Isa; Fischer, Roxanne; O'Brien, Kevin; Kleta, Robert; Huizing, Marjan; Gahl, William A

    2009-12-01

    Alkaptonuria (AKU) is a rare autosomal recessive metabolic disorder, characterized by accumulation of homogentisic acid, leading to darkened urine, pigmentation of connective tissue (ochronosis), joint and spine arthritis, and destruction of cardiac valves. AKU is due to mutations in the homogentisate dioxygenase gene (HGD) that converts homogentisic acid to maleylacetoacetic acid in the tyrosine catabolic pathway. Here we report a comprehensive mutation analysis of 93 patients enrolled in our study, as well as an extensive update of all previously published HGD mutations associated with AKU. Within our patient cohort, we identified 52 HGD variants, of which 22 were novel. This yields a total of 91 identified HGD variations associated with AKU to date, including 62 missense, 13 splice site, 10 frameshift, 5 nonsense, and 1 no-stop mutation. Most HGD variants reside in exons 3, 6, 8, and 13. We assessed the potential effect of all missense variations on protein function, using five bioinformatic tools specifically designed for interpretation of missense variants (SIFT, POLYPHEN, PANTHER, PMUT, and SNAP). We also analyzed the potential effect of splice-site variants using two different tools (BDGP and NetGene2). This study provides valuable resources for molecular analysis of alkaptonuria and expands our knowledge of the molecular basis of this disease.

  10. Impact of two myostatin (MSTN mutations on weight gain and lamb carcass classification in Norwegian White Sheep (Ovis aries

    Directory of Open Access Journals (Sweden)

    Blichfeldt Thor

    2010-01-01

    Full Text Available Abstract Background Our aim was to estimate the effect of two myostatin (MSTN mutations in Norwegian White Sheep, one of which is close to fixation in the Texel breed. Methods The impact of two known MSTN mutations was examined in a field experiment with Norwegian White Sheep. The joint effect of the two MSTN mutations on live weight gain and weaning weight was studied on 644 lambs. Carcass weight gain from birth to slaughter, carcass weight, carcass conformation and carcass fat classes were calculated in a subset of 508 lambs. All analyses were carried out with a univariate linear animal model. Results The most significant impact of both mutations was on conformation and fat classes. The largest difference between the genotype groups was between the wild type for both mutations and the homozygotes for the c.960delG mutation. Compared to the wild types, these mutants obtained a conformation score 5.1 classes higher and a fat score 3.0 classes lower, both on a 15-point scale. Conclusions Both mutations reduced fatness and increased muscle mass, although the effect of the frameshift mutation (c.960delG was more important as compared to the 3'-UTR mutation (c.2360G>A. Lambs homozygous for the c.960delG mutation grew more slowly than those with other MSTN genotypes, but had the least fat and the largest muscle mass. Only c.960delG showed dominance effects.

  11. Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?

    Science.gov (United States)

    Eaton, T E; Weiner Miller, P; Garrett, J E; Cutting, G R

    2002-05-01

    Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. These results lend further support to a possible link between CF mutations and ABPA.

  12. Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

    Science.gov (United States)

    Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

    2013-02-15

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. A novel DNMT1 mutation associated with early onset hereditary sensory and autonomic neuropathy, cataplexy, cerebellar atrophy, scleroderma, endocrinopathy, and common variable immune deficiency.

    Science.gov (United States)

    Fox, Robin; Ealing, John; Murphy, Helen; Gow, David P; Gosal, David

    2016-09-01

    DNA methyltransferase 1 (DNMT1) is an enzyme which has a role in methylation of DNA, gene regulation, and chromatin stability. Missense mutations in the DNMT1 gene have been previously associated with two neurological syndromes: hereditary sensory and autonomic neuropathy type 1 with dementia and deafness (HSAN1E) and autosomal dominant cerebellar ataxia, deafness, and narcolepsy (ADCA-DN). We report a case showing overlap of both of these syndromes plus associated clinical features of common variable immune deficiency, scleroderma, and endocrinopathy that could also be mutation associated. Our patient was found to be heterozygous for a previously unreported frameshift mutation, c.1635_1637delCAA p.(Asn545del) in the DNMT1 gene exon 20. This case displays both the first frameshift mutation described in the literature which is associated with a phenotype with a high degree of overlap between HSAN1E and ADCA-DN and early age of onset (c. 8 years). Our case is also of interest as the patient displays a number of new non-neurological features, which could also be DNMT1 mutation related. © 2016 Peripheral Nerve Society.

  14. KIT Mutation and Loss of 14q May Be Sufficient for the Development of Clinically Symptomatic Very Low-Risk GIST.

    Directory of Open Access Journals (Sweden)

    Olaf Karl Klinke

    Full Text Available The aim of this study was to determine the minimal set of genetic alterations required for the development of a very low risk clinically symptomatic gastro-intestinal stromal tumour within the stomach wall. We studied the genome of a very low-risk gastric gastro-intestinal stromal tumour by whole-genome sequencing, comparative genomic hybridisation and methylation profiling. The studied tumour harboured two typical genomic lesions: loss of the long arm of chromosome 14 and an activating mutation in exon 11 of KIT. Besides these genetic lesions, only two point mutations that may affect tumour progression were identified: A frame-shift deletion in RNF146 and a missense mutation in a zinc finger of ZNF407. Whilst the frameshift deletion in RNF146 seemed to be restricted to this particular tumour, a similar yet germline mutation in ZNF407 was found in a panel of 52 gastro-intestinal stromal tumours from different anatomical sites and different categories. Germline polymorphisms in the mitotic checkpoint proteins Aurora kinase A and BUB1 kinase B may have furthered tumour growth. The epigenetic profile of the tumour matches that of other KIT-mutant tumours. We have identified mutations in three genes and loss of the long arm of chromosome 14 as the so far minimal set of genetic abnormalities sufficient for the development of a very low risk clinically symptomatic gastric stromal tumour.

  15. A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.

    Science.gov (United States)

    Modiano, Guido; Bombieri, Cristina; Ciminelli, Bianca Maria; Belpinati, Francesca; Giorgi, Silvia; Georges, Marie des; Scotet, Virginie; Pompei, Fiorenza; Ciccacci, Cinzia; Guittard, Caroline; Audrézet, Marie Pierre; Begnini, Angela; Toepfer, Michael; Macek, Milan; Ferec, Claude; Claustres, Mireille; Pignatti, Pier Franco

    2005-02-01

    Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

  16. The CFTR Met 470 allele is associated with lower birth rates in fertile men from a population isolate.

    Directory of Open Access Journals (Sweden)

    Gülüm Kosova

    2010-06-01

    Full Text Available Although little is known about the role of the cystic fibrosis transmembrane regulator (CFTR gene in reproductive physiology, numerous variants in this gene have been implicated in etiology of male infertility due to congenital bilateral absence of the vas deferens (CBAVD. Here, we studied the fertility effects of three CBAVD-associated CFTR polymorphisms, the (TGm and polyT repeat polymorphisms in intron 8 and Met470Val in exon 10, in healthy men of European descent. Homozygosity for the Met470 allele was associated with lower birth rates, defined as the number of births per year of marriage (P = 0.0029. The Met470Val locus explained 4.36% of the phenotypic variance in birth rate, and men homozygous for the Met470 allele had 0.56 fewer children on average compared to Val470 carrier men. The derived Val470 allele occurs at high frequencies in non-African populations (allele frequency = 0.51 in HapMap CEU, whereas it is very rare in African population (Fst = 0.43 between HapMap CEU and YRI. In addition, haplotypes bearing Val470 show a lack of genetic diversity and are thus longer than haplotypes bearing Met470 (measured by an integrated haplotype score [iHS] of -1.93 in HapMap CEU. The fraction of SNPs in the HapMap Phase2 data set with more extreme Fst and iHS measures is 0.003, consistent with a selective sweep outside of Africa. The fertility advantage conferred by Val470 relative to Met470 may provide a selective mechanism for these population genetic observations.

  17. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus.

    Science.gov (United States)

    Smith, Emily M; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2016-01-07

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  18. Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.

    Science.gov (United States)

    Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H

    2018-04-01

    To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.

  19. Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.

    Science.gov (United States)

    Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry

    2012-07-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head growth, which resembles Rett syndrome. However, some clinical discrepancies suggested the influence of genetics and/or environmental factors. No genotype-phenotype correlation has been defined and thus there is a need to examine individual mutations. In this study, we analyzed eight recurrent CDKL5 mutations to test whether the clinical phenotype of patients with the same mutation is similar and whether patients with specific CDKL5 mutations have a milder phenotype than those with other CDKL5 mutations. Patients bearing missense mutations in the ATP binding site such as the p.Ala40Val mutation typically walked unaided, had normocephaly, better hand use ability, and less frequent refractory epilepsy when compared to girls with other CDKL5 mutations. In contrast, patients with mutations in the kinase domain (such as p.Arg59X, p.Arg134X, p.Arg178Trp/Pro/Gln, or c.145 + 2T > C) and frameshift mutations in the C-terminal region (such as c.2635_2636delCT) had a more severe phenotype with infantile spasms, refractory epileptic encephalopathy, absolute microcephaly, and inability to walk. It is important for clinicians to have this information when such patients are diagnosed. Copyright © 2012 Wiley Periodicals, Inc.

  20. ATM (ataxia-telangiectasia mutated) abnormality and diseases

    International Nuclear Information System (INIS)

    Takagi, Masatoshi; Nakata, Shinichiro; Mizutani, Shuki

    2007-01-01

    Ataxia-Telangiectasia (A-T) is an autosomal recessive inherited disease due to mutation of ATM gene on chromosome 11q22.3, with major symptoms of ataxia, telangiectasia, immunodeficiency and frequent complication of cancer, and the cells have characters of chromosomal break, high sensitivity to radiation and inappropriate continuation of DNA synthesis after radiation. This review describes past and present studies of ATM functions with clinical features in the following order: Clinical symptoms and epidemiology; ATM gene mutation in A-T patients, mainly by frame-shift (80-90%); ATM, whose gene consisted from 66 exons (150 kb), functions in phosphoinositide-3-kinase related kinase family which protecting cells from stress and integrating their system, at response to DNA double strand break, and in the cell cycle checkpoints at G1/S, S and G2/M phases; ATM nonsense/missense mutations in embryonic cells leading to carcinogenesis and role of ATM in the suppression of carcinogenesis in somatic cells; Chromosomal translocation which relating to carcinogenesis, by functional defect of ATM; and Other functions of ATM in neuronal growth, immunodeficiency, carbohydrate and lipid metabolism, early senescence, and virus infection. ATM is thus an essential molecule to maintain growth and homeostasis. (T.I.)

  1. Mutational spectrum analysis of umuC-independent and umuC-dependent γ-radiation mutagenesis in Escherichia coli

    International Nuclear Information System (INIS)

    Sargentini, N.J.; Smith, K.C.

    1989-01-01

    γ-radiation mutagenesis Escherichia coli K-12. Mutagenesis (argE3(OC) A rg + ) was blocked in a δ(recA-srlR)306 strain at the same doses that induced mutations in umuC122::Tn5 and wild-type strains, indicating that both umuC-independent and umuC-dependent mechanisms function within recA-dependent misrepair. Analyses of various suppressor and back mutations that result in argE3 and hisG4 ochre reversion and an analysis of trpE9777 reversion were performed on umuC and wild-type cells irradiated in the presence and absence of oxygen. While the umuC strain showed the γ-radiation induction of base substitution and frameshifts when irradiated in the absence of oxygen, the umuC mutation blocked all oxygen-dependent base-substitution mutagenesis, but non all oxygen-dependent frameshift mutagenesis. For anoxically irradiated cells, the yields of GC T and AT GC transitions were essentially umuC independent, while the yields of (AT or GC) TA transversions were heavily umuC dependent. These data suggest new concepts about the nature of the DNA lesions and the mutagenic mechanisms that lead to γ-radiation mutagenesis. (author). 48 refs.; 1 tab.; 6 refs

  2. Highly preferential association of NonF508del CF mutations with the M470 allele.

    Science.gov (United States)

    Ciminelli, B M; Bonizzato, A; Bombieri, C; Pompei, F; Gabaldo, M; Ciccacci, C; Begnini, A; Holubova, A; Zorzi, P; Piskackova, T; Macek, M; Castellani, C; Modiano, G; Pignatti, P F

    2007-01-01

    On the basis of previous findings on random individuals, we hypothesized a preferential association of CF causing mutations with the M allele of the M470V polymorphic site of the CFTR gene. We have determined the M/V-CF mutation haplotype in a series of 201 North East Italian and 73 Czech CF patients who were not F508del homozygotes, as F508del was already known to be fully associated with the M allele. Out of 358 not F508del CF genes, 84 carried the V allele and 274 the less common M allele. In the N-E Italian population, MM subjects have a risk of carrying a CF causing mutation 6.9x greater than VV subjects when F508del is excluded and 15.4x when F508del is included. In the Czech population a similar, although less pronounced, association is observed. Besides the possible biological significance of this association, the possibility of exploiting it for a pilot screening program has been explored in a local North East Italian population for which CF patients were characterized for their CF mutation. General M470V genotyping followed by common CF mutation screening limited to couples in which each partner carries at least one M allele would need testing only 39% of the couples, which contribute 89% of the total risk, with a cost benefit.

  3. Wiskott-Aldrich Syndrome With Normal-Sized Platelets in an Eighteen-Month-Old Boy: A Rare Mutation

    Directory of Open Access Journals (Sweden)

    Jayitri Mazumdar

    2015-07-01

    Full Text Available Introduction: Wiskott-Aldrich syndrome (WAS is an X-linked recessive disorder characterized by thrombocytopenia, eczema, and recurrent infections. The disease is usually associated with small defective platelets. Case Presentation: We described an 18-month-old boy who presented with lower gastrointestinal bleeding, eczema, and recurrent infections. There was pancytopenia with normal-sized platelets. In addition, the CD4 count was significantly low and serum IgA and IgE levels were increased. The diagnosis of WAS was confirmed by detecting a mutation of WAS gene, which was due to a deletion mutation resulting in frameshift (c.177DelT. Conclusions: Usually microplatelets with mean platelet volume of 4-5 fL are seen in WAS, but in this case, the patient had normal-sized platelets with a rare mutation of WAS gene. Therefore, high index of clinical suspicion is needed to diagnose WAS.

  4. Autosomal-dominant Leber Congenital Amaurosis Caused by a Heterozygous CRX Mutation in a Father and Son.

    Science.gov (United States)

    Arcot Sadagopan, Karthikeyan; Battista, Robert; Keep, Rosanne B; Capasso, Jenina E; Levin, Alex V

    2015-06-01

    Leber congenital amaurosis (LCA) is most often an autosomal recessive disorder. We report a father and son with autosomal dominant LCA due to a mutation in the CRX gene. DNA screening using an allele specific assay of 90 of the most common LCA-causing variations in the coding sequences of AIPL1, CEP290, CRB1, CRX, GUCY2D, RDH12 and RPE65 was performed on the father. Automated DNA sequencing of his son examining exon 3 of the CRX gene was subsequently performed. Both father and son have a heterozygous single base pair deletion of an adenine at codon 153 in the coding sequence of the CRX gene resulting in a frameshift mutation. Mutations involving the CRX gene may demonstrate an autosomal dominant inheritance pattern for LCA.

  5. A novel c.240_241insGG mutation in NDP gene in a family with Norrie disease.

    Science.gov (United States)

    Andarva, Monavvar; Jamshidi, Javad; Ghaedi, Hamid; Daftarian, Narsis; Emamalizadeh, Babak; Alehabib, Elham; Taghavi, Shaghyegh; Pouriran, Ramin; Darvish, Hossein

    2018-03-01

    Norrie disease (ND) is a rare, X-linked recessive disorder with the main characteristic of early childhood blindness. The aim of the present study was to identify the genetic cause of the disease and the phenotypic characteristics of the patients in an Iranian family with four affected males with ND. Norrie disease pseudoglioma (NDP) gene was sequenced and clinical examination was performed on patients. A GG dinucleotide insertion in exon 3 (c.240_241insGG) of NDP was detected in all patients. The mutation caused a frameshift and an early stop codon (p.Phe81Glyfs*23). A novel mutation was found in the NDP gene in the affected males of the family. As the mutation was absent in the normal male members of the family, it should be the genetic cause of the disease. © 2017 Optometry Australia.

  6. A novel SERPINA1 mutation causing serum alpha(1-antitrypsin deficiency.

    Directory of Open Access Journals (Sweden)

    Darren N Saunders

    Full Text Available Mutations in the SERPINA1 gene can cause deficiency in the circulating serine protease inhibitor α(1-Antitrypsin (α(1AT. α(1AT deficiency is the major contributor to pulmonary emphysema and liver disease in persons of European ancestry, with a prevalence of 1 in 2500 in the USA. We present the discovery and characterization of a novel SERPINA1 mutant from an asymptomatic Middle Eastern male with circulating α(1AT deficiency. This 49 base pair deletion mutation (T379Δ, originally mistyped by IEF, causes a frame-shift replacement of the last sixteen α(1AT residues and adds an extra twenty-four residues. Functional analysis showed that the mutant protein is not secreted and prone to intracellular aggregation.

  7. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease.

    Science.gov (United States)

    Casari, G; De Fusco, M; Ciarmatori, S; Zeviani, M; Mora, M; Fernandez, P; De Michele, G; Filla, A; Cocozza, S; Marconi, R; Dürr, A; Fontaine, B; Ballabio, A

    1998-06-12

    Hereditary spastic paraplegia (HSP) is characterized by progressive weakness and spasticity of the lower limbs due to degeneration of corticospinal axons. We found that patients from a chromosome 16q24.3-linked HSP family are homozygous for a 9.5 kb deletion involving a gene encoding a novel protein, named Paraplegin. Two additional Paraplegin mutations, both resulting in a frameshift, were found in a complicated and in a pure form of HSP. Paraplegin is highly homologous to the yeast mitochondrial ATPases, AFG3, RCA1, and YME1, which have both proteolytic and chaperon-like activities at the inner mitochondrial membrane. Immunofluorescence analysis and import experiments showed that Paraplegin localizes to mitochondria. Analysis of muscle biopsies from two patients carrying Paraplegin mutations showed typical signs of mitochondrial OXPHOS defects, thus suggesting a mechanism for neurodegeneration in HSP-type disorders.

  8. Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations.

    Science.gov (United States)

    Pompei, Fiorenza; Ciminelli, Bianca Maria; Bombieri, Cristina; Ciccacci, Cinzia; Koudova, Monika; Giorgi, Silvia; Belpinati, Francesca; Begnini, Angela; Cerny, Milos; Des Georges, Marie; Claustres, Mireille; Ferec, Claude; Macek, Milan; Modiano, Guido; Pignatti, Pier Franco

    2006-01-01

    An average of about 1700 CFTR (cystic fibrosis transmembrane conductance regulator) alleles from normal individuals from different European populations were extensively screened for DNA sequence variation. A total of 80 variants were observed: 61 coding SNSs (results already published), 13 noncoding SNSs, three STRs, two short deletions, and one nucleotide insertion. Eight DNA variants were classified as non-CF causing due to their high frequency of occurrence. Through this survey the CFTR has become the most exhaustively studied gene for its coding sequence variability and, though to a lesser extent, for its noncoding sequence variability as well. Interestingly, most variation was associated with the M470 allele, while the V470 allele showed an 'extended haplotype homozygosity' (EHH). These findings make us suggest a role for selection acting either on the M470V itself or through an hitchhiking mechanism involving a second site. The possible ancient origin of the V allele in an 'out of Africa' time frame is discussed.

  9. Identification of a novel BRCA1 nucleotide 4803delCC/c.4684delCC mutation and a nucleotide 249T>A/c.130T>A (p.Cys44Ser) mutation in two Greenlandic Inuit families

    DEFF Research Database (Denmark)

    Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders

    2010-01-01

    Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...

  10. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Science.gov (United States)

    Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine

    2015-01-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  11. Germline PMS2 mutation screened by mismatch repair protein immunohistochemistry of colorectal cancer in Japan.

    Science.gov (United States)

    Sugano, Kokichi; Nakajima, Takeshi; Sekine, Shigeki; Taniguchi, Hirokazu; Saito, Shinya; Takahashi, Masahiro; Ushiama, Mineko; Sakamoto, Hiromi; Yoshida, Teruhiko

    2016-11-01

    Germline PMS2 gene mutations were detected by RT-PCR/direct sequencing of total RNA extracted from puromycin-treated peripheral blood lymphocytes (PBL) and multiplex ligation-dependent probe amplification (MLPA) analyses of Japanese patients with colorectal cancer (CRC) fulfilling either the revised Bethesda Guidelines or being an age at disease onset of younger than 70 years, and screened by mismatch repair protein immunohistochemistry of formalin-fixed paraffin embedded sections. Of the 501 subjects examined, 7 (1.40%) showed the downregulated expression of the PMS2 protein alone and were referred to the genetic counseling clinic. Germline PMS2 mutations were detected in 6 (85.7%), including 3 nonsense and 1 frameshift mutations by RT-PCR/direct sequencing and 2 genomic deletions by MLPA. No mutations were identified in the other MMR genes (i.e. MSH2, MLH1 and MSH6). The prevalence of the downregulated expression of the PMS2 protein alone was 1.40% among the subjects examined and IHC results predicted the presence of PMS2 germline mutations. RT-PCR from puromycin-treated PBL and MLPA may be employed as the first screening step to detect PMS2 mutations without pseudogene interference, followed by the long-range PCR/nested PCR validation using genomic DNA. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  12. Osteogenesis imperfecta type 3 in South Africa: Causative mutations in FKBP10

    Directory of Open Access Journals (Sweden)

    Alvera Vorster

    2017-05-01

    Full Text Available Background. A relatively high frequency of autosomal recessively inherited osteogenesis imperfecta (OI type 3 (OI-3 is present in the indigenous black southern African population. Affected persons may be severely handicapped as a result of frequent fractures, progressive deformity of the tubular bones and spinal malalignment. Objective. To delineate the molecular basis for the condition. Methods. Molecular investigations were performed on 91 affected persons from seven diverse ethnolinguistic groups in this population. Results. Following polymerase chain reaction amplification and direct cycle sequencing, FKBP10 mutations were identified in 45.1% (41/91 OI-3-affected persons. The homozygous FKBP10 c.831dupC frameshift mutation was confirmed in 35 affected individuals in the study cohort. Haplotype analysis suggests that this mutation is identical among these OI-3-affected persons by descent, thereby confirming that they had a common ancestor. Compound heterozygosity of this founder mutation was observed, in combination with three different deleterious FKBP10 mutations, in six additional persons in the cohort. Four of these individuals had the c.831delC mutation. Conclusion. The burden of the disorder, both in frequency and severity, warrants the establishment of a dedicated service for molecular diagnostic confirmation and genetic management of persons and families with OI in southern Africa.

  13. Somatic mutation analysis of MYH11 in breast and prostate cancer

    International Nuclear Information System (INIS)

    Alhopuro, Pia; Karhu, Auli; Winqvist, Robert; Waltering, Kati; Visakorpi, Tapio; Aaltonen, Lauri A

    2008-01-01

    MYH11 (also known as SMMHC) encodes the smooth-muscle myosin heavy chain, which has a key role in smooth muscle contraction. Inversion at the MYH11 locus is one of the most frequent chromosomal aberrations found in acute myeloid leukemia. We have previously shown that MYH11 mutations occur in human colorectal cancer, and may also be associated with Peutz-Jeghers syndrome. The mutations found in human intestinal neoplasia result in unregulated proteins with constitutive motor activity, similar to the mutant myh11 underlying the zebrafish meltdown phenotype characterized by disrupted intestinal architecture. Recently, MYH1 and MYH9 have been identified as candidate breast cancer genes in a systematic analysis of the breast cancer genome. The aim of this study was to investigate the role of somatic MYH11 mutations in two common tumor types; breast and prostate cancers. A total of 155 breast cancer and 71 prostate cancer samples were analyzed for those regions in MYH11 (altogether 8 exons out of 42 coding exons) that harboured mutations in colorectal cancer in our previous study. In breast cancer samples only germline alterations were observed. One prostate cancer sample harbored a frameshift mutation c.5798delC, which we have previously shown to result in a protein with unregulated motor activity. Little evidence for a role of somatic MYH11 mutations in the formation of breast or prostate cancers was obtained in this study

  14. Whole-exome sequencing revealed two novel mutations in Usher syndrome.

    Science.gov (United States)

    Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

    2015-06-01

    Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Directory of Open Access Journals (Sweden)

    Zied Riahi

    Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  16. Genotype-phenotype correlation in a large population of muscular dystrophy patients with LAMA2 mutations.

    LENUS (Irish Health Repository)

    Geranmayeh, Fatemeh

    2010-04-01

    Merosin deficient congenital muscular dystrophy 1A (MDC1A) results from mutations in the LAMA2 gene. We report 51 patients with MDC1A and examine the relationship between degree of merosin expression, genotype and clinical features. Thirty-three patients had absence of merosin and 13 showed some residual merosin. Compared to the residual merosin group, patients with absent merosin had an earlier presentation (<7days) (P=0.0073), were more likely to lack independent ambulation (P=0.0215), or require enteral feeding (P=0.0099) and ventilatory support (P=0.0354). We identified 33 novel LAMA2 mutations; these were distributed throughout the gene in patients with absent merosin, with minor clusters in exon 27, 14, 25 and 26 (55% of mutations). Patients with residual merosin often carried at least one splice site mutation and less frequently frameshift mutations. This large study identified novel LAMA2 mutations and highlights the role of immunohistochemical studies for merosin status in predicting clinical severity of MDC1A.

  17. A case of early onset rectal cancer of Lynch syndrome with a novel deleterious PMS2 mutation.

    Science.gov (United States)

    Nomura, Sachio; Fujimoto, Yoshiya; Yamamoto, Noriko; Sato, Yuri; Ashihara, Yuumi; Kita, Mizuho; Yamaguchi, Junya; Ishikawa, Yuichi; Ueno, Masashi; Arai, Masami

    2015-10-01

    Heterozygous deleterious mutation of the PMS2 gene is a cause of Lynch syndrome, an autosomal dominant cancer disease. However, the frequency of PMS2 mutation is rare compared with that of the other causative genes; MSH2, MLH1 and MSH6. PMS2 mutation has so far only been reported once from a Japanese facility. Detection of PMS2 mutation is relatively complicated due to the existence of 15 highly homologous pseudogenes, and its gene conversion event with the pseudogene PMS2CL. Therefore, for PMS2 mutation analysis, it is crucial to clearly distinguish PMS2 from its pseudogenes. We report here a novel deleterious 11 bp deletion mutation of exon 11 of PMS2 distinguished from PMS2CL in a 34-year-old Japanese female with rectal cancer. PMS2 mutated at c.1492del11 results in a truncated 500 amino acid protein rather than the wild-type protein of 862 amino acids. This is supported by the fact that, although there is usually concordance between MLH1 and PMS2 expression, cells were immunohistochemically positive for MLH1, whereas PMS2 could not be immunohistochemically stained using an anti-C-terminal PMS2 antibody, or effective PMS2 mRNA degradation with NMD caused by the frameshift mutation. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Two novel mutations in the homogentisate-1,2-dioxygenase gene identified in Chinese Han Child with Alkaptonuria.

    Science.gov (United States)

    Li, Hongying; Zhang, Kaihui; Xu, Qun; Ma, Lixia; Lv, Xin; Sun, Ruopeng

    2015-03-01

    Alkaptonuria (AKU) is an autosomal recessive disorder of tyrosine metabolism, which is caused by a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) with subsequent accumulation of homogentisic acid. Presently, more than 100 HGD mutations have been identified as the cause of the inborn error of metabolism across different populations worldwide. However, the HGD mutation is very rarely reported in Asia, especially China. In this study, we present mutational analyses of HGD gene in one Chinese Han child with AKU, which had been identified by gas chromatography-mass spectrometry detection of organic acids in urine samples. PCR and DNA sequencing of the entire coding region as well as exon-intron boundaries of HGD have been performed. Two novel mutations were identified in the HGD gene in this AKU case, a frameshift mutation of c.115delG in exon 3 and the splicing mutation of IVS5+3 A>C, a donor splice site of the exon 5 and exon-intron junction. The identification of these mutations in this study further expands the spectrum of known HGD gene mutations and contributes to prenatal molecular diagnosis of AKU.

  19. Functional analysis of the novel TBX5 c.1333delC mutation resulting in an extended TBX5 protein

    Directory of Open Access Journals (Sweden)

    Ekman-Joelsson Britt-Marie

    2008-10-01

    Full Text Available Abstract Background Autosomal dominant Holt-Oram syndrome (HOS is caused by mutations in the TBX5 gene and is characterized by congenital heart and preaxial radial ray upper limb defects. Most of the TBX5 mutations found in patients with HOS cause premature truncation of the primary TBX5 transcript. TBX5 missense mutations alter the three-dimensional structure of the protein and result in failed nuclear localization or reduced binding to target DNA. In this study we present our functional analyses of the novel and unusual c.1333delC mutation found in a patient with classical HOS. Methods The functional impact of this novel mutation was assessed by investigating the intracellular localization of the resulting TBX5 protein and its ability to activate the expression of its downstream target ANF. Results The deletion of the cytosine is the first TBX5 frameshift mutation predicted to result in an elongated TBX5 protein with 74 miscoding amino acids and 62 supernumerary C-terminal amino acids. The c.1333delC mutation affects neither the nuclear localization, nor its colocalization with SALL4, but severely affects the activation of the ANF promoter. Conclusion The mutation c.1333delC does not locate within functional domains, but impairs the activation of the downstream target. This suggests that misfolding of the protein prevents its biological function.

  20. New truncation mutation of the NR2E3 gene in a Japanese patient with enhanced S-cone syndrome.

    Science.gov (United States)

    Kuniyoshi, Kazuki; Hayashi, Takaaki; Sakuramoto, Hiroyuki; Mishima, Hiroshi; Tsuneoka, Hiroshi; Tsunoda, Kazushige; Iwata, Takeshi; Shimomura, Yoshikazu

    2016-11-01

    The enhanced S-cone syndrome (ESCS) is a rare hereditary retinal degeneration that has enhanced short wavelength-sensitive cone (S-cone) functions. The longitudinal clinical course of this disease has been rarely reported, and the genetic aspects of ESCS have not been well investigated in the Japanese population. In this report, we present our clinical and genetic findings for 2 patients with ESCS. The patients were 2 unrelated Japanese men. Standard ophthalmic examinations and mutation screening for the NR2E3 gene were performed. Patient 1 was a 36-year-old man, and his clinical findings were typical of ESCS. His decimal best-corrected visual acuity (BCVA) was 1.0 OD and 0.5 OS after removal of cataracts. Genetic investigations revealed a homozygous truncation frameshift, the p.I307LfsX33 mutation. Patient 2 was an 11-year-old boy when he was first examined by us. His clinical findings were typical of ESCS except for uveitis in the left eye. His decimal BCVA at the age of 39 years was maintained at 1.5 in each eye, although the retinal degeneration and visual field impairments had progressed during the follow-up period. The genetic investigations revealed homozygous mutations of p.R104Q in the NR2E3 gene. The frameshift mutation, p.I307LfsX33, in the NR2E3 gene is a new causative mutation for ESCS. The clinical observations for patient 2 are the longest ever reported. The retinal degeneration caused by this mutation is slowly progressive, and these patients maintained good vision with maintenance of the foveal structure until their late thirties.

  1. Clinical and Neurobehavioral Features of Three Novel Kabuki Syndrome Patients with Mosaic KMT2D Mutations and a Review of Literature.

    Science.gov (United States)

    Lepri, Francesca Romana; Cocciadiferro, Dario; Augello, Bartolomeo; Alfieri, Paolo; Pes, Valentina; Vancini, Alessandra; Caciolo, Cristina; Squeo, Gabriella Maria; Malerba, Natascia; Adipietro, Iolanda; Novelli, Antonio; Sotgiu, Stefano; Gherardi, Renzo; Digilio, Maria Cristina; Dallapiccola, Bruno; Merla, Giuseppe

    2017-12-28

    Kabuki syndrome (KS) is a rare disorder characterized by multiple congenital anomalies and variable intellectual disability caused by mutations in KMT2D/MLL2 and KDM6A/UTX , two interacting chromatin modifier responsible respectively for 56-75% and 5-8% of the cases. To date, three KS patients with mosaic KMT2D deletions in blood lymphocytes have been described. We report on three additional subjects displaying KMT2D gene mosaics including one in which a single nucleotide change results in a new frameshift mutation (p.L1199HfsX7), and two with already-known nonsense mutations (p.R4484X and p.R5021X). Consistent with previously published cases, mosaic KMT2D mutations may result in mild KS facial dysmorphisms and clinical and neurobehavioral features, suggesting that these characteristics could represent the handles for genetic testing of individuals with slight KS-like traits.

  2. Clinical and Neurobehavioral Features of Three Novel Kabuki Syndrome Patients with Mosaic KMT2D Mutations and a Review of Literature

    Directory of Open Access Journals (Sweden)

    Francesca Romana Lepri

    2017-12-01

    Full Text Available Kabuki syndrome (KS is a rare disorder characterized by multiple congenital anomalies and variable intellectual disability caused by mutations in KMT2D/MLL2 and KDM6A/UTX, two interacting chromatin modifier responsible respectively for 56–75% and 5–8% of the cases. To date, three KS patients with mosaic KMT2D deletions in blood lymphocytes have been described. We report on three additional subjects displaying KMT2D gene mosaics including one in which a single nucleotide change results in a new frameshift mutation (p.L1199HfsX7, and two with already-known nonsense mutations (p.R4484X and p.R5021X. Consistent with previously published cases, mosaic KMT2D mutations may result in mild KS facial dysmorphisms and clinical and neurobehavioral features, suggesting that these characteristics could represent the handles for genetic testing of individuals with slight KS-like traits.

  3. DMD Mutations in 576 Dystrophinopathy Families: A Step Forward in Genotype-Phenotype Correlations.

    Directory of Open Access Journals (Sweden)

    Jonas Juan-Mateu

    Full Text Available Recent advances in molecular therapies for Duchenne muscular dystrophy (DMD require precise genetic diagnosis because most therapeutic strategies are mutation-specific. To understand more about the genotype-phenotype correlations of the DMD gene we performed a comprehensive analysis of the DMD mutational spectrum in a large series of families. Here we provide the clinical, pathological and genetic features of 576 dystrophinopathy patients. DMD gene analysis was performed using the MLPA technique and whole gene sequencing in blood DNA and muscle cDNA. The impact of the DNA variants on mRNA splicing and protein functionality was evaluated by in silico analysis using computational algorithms. DMD mutations were detected in 576 unrelated dystrophinopathy families by combining the analysis of exonic copies and the analysis of small mutations. We found that 471 of these mutations were large intragenic rearrangements. Of these, 406 (70.5% were exonic deletions, 64 (11.1% were exonic duplications, and one was a deletion/duplication complex rearrangement (0.2%. Small mutations were identified in 105 cases (18.2%, most being nonsense/frameshift types (75.2%. Mutations in splice sites, however, were relatively frequent (20%. In total, 276 mutations were identified, 85 of which have not been previously described. The diagnostic algorithm used proved to be accurate for the molecular diagnosis of dystrophinopathies. The reading frame rule was fulfilled in 90.4% of DMD patients and in 82.4% of Becker muscular dystrophy patients (BMD, with significant differences between the mutation types. We found that 58% of DMD patients would be included in single exon-exon skipping trials, 63% from strategies directed against multiexon-skipping exons 45 to 55, and 14% from PTC therapy. A detailed analysis of missense mutations provided valuable information about their impact on the protein structure.

  4. Novel mutations in the USH1C gene in Usher syndrome patients.

    Science.gov (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  5. Identification of novel mutations in Chinese Hans with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Yu Chaowen

    2011-12-01

    Full Text Available Abstract Background Autosomal dominant polycystic kidney disease (ADPKD is the most common inherited renal disease with an incidence of 1 in 400 to 1000. The disease is genetically heterogeneous, with two genes identified: PKD1 (16p13.3 and PKD2 (4q21. Molecular diagnosis of the disease in at-risk individuals is complicated due to the structural complexity of PKD1 gene and the high diversity of the mutations. This study is the first systematic ADPKD mutation analysis of both PKD1 and PKD2 genes in Chinese patients using denaturing high-performance liquid chromatography (DHPLC. Methods Both PKD1 and PKD2 genes were mutation screened in each proband from 65 families using DHPLC followed by DNA sequencing. Novel variations found in the probands were checked in their family members available and 100 unrelated normal controls. Then the pathogenic potential of the variations of unknown significance was examined by evolutionary comparison, effects of amino acid substitutions on protein structure, and effects of splice site alterations using online mutation prediction resources. Results A total of 92 variations were identified, including 27 reported previously. Definitely pathogenic mutations (ten frameshift, ten nonsense, two splicing defects and one duplication were identified in 28 families, and probably pathogenic mutations were found in an additional six families, giving a total detection level of 52.3% (34/65. About 69% (20/29 of the mutations are first reported with a recurrent mutation rate of 31%. Conclusions Mutation study of PKD1 and PKD2 genes in Chinese Hans with ADPKD may contribute to a better understanding of the genetic diversity between different ethnic groups and enrich the mutation database. Besides, evaluating the pathogenic potential of novel variations should also facilitate the clinical diagnosis and genetic counseling of the disease.

  6. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    Science.gov (United States)

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  7. Spectrum of SMPD1 mutations in Asian-Indian patients with acid sphingomyelinase (ASM)-deficient Niemann-Pick disease.

    Science.gov (United States)

    Ranganath, Prajnya; Matta, Divya; Bhavani, Gandham SriLakshmi; Wangnekar, Savita; Jain, Jamal Mohammed Nurul; Verma, Ishwar C; Kabra, Madhulika; Puri, Ratna Dua; Danda, Sumita; Gupta, Neerja; Girisha, Katta M; Sankar, Vaikom H; Patil, Siddaramappa J; Ramadevi, Akella Radha; Bhat, Meenakshi; Gowrishankar, Kalpana; Mandal, Kausik; Aggarwal, Shagun; Tamhankar, Parag Mohan; Tilak, Preetha; Phadke, Shubha R; Dalal, Ashwin

    2016-10-01

    Acid sphingomyelinase (ASM)-deficient Niemann-Pick disease is an autosomal recessive lysosomal storage disorder caused by biallelic mutations in the SMPD1 gene. To date, around 185 mutations have been reported in patients with ASM-deficient NPD world-wide, but the mutation spectrum of this disease in India has not yet been reported. The aim of this study was to ascertain the mutation profile in Indian patients with ASM-deficient NPD. We sequenced SMPD1 in 60 unrelated families affected with ASM-deficient NPD. A total of 45 distinct pathogenic sequence variants were found, of which 14 were known and 31 were novel. The variants included 30 missense, 4 nonsense, and 9 frameshift (7 single base deletions and 2 single base insertions) mutations, 1 indel, and 1 intronic duplication. The pathogenicity of the novel mutations was inferred with the help of the mutation prediction software MutationTaster, SIFT, Polyphen-2, PROVEAN, and HANSA. The effects of the identified sequence variants on the protein structure were studied using the structure modeled with the help of the SWISS-MODEL workspace program. The p. (Arg542*) (c.1624C>T) mutation was the most commonly identified mutation, found in 22% (26 out of 120) of the alleles tested, but haplotype analysis for this mutation did not identify a founder effect for the Indian population. To the best of our knowledge, this is the largest study on mutation analysis of patients with ASM-deficient Niemann-Pick disease reported in literature and also the first study on the SMPD1 gene mutation spectrum in India. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Rescue of defective ATP8B1 trafficking by CFTR correctors as a therapeutic strategy for familial intrahepatic cholestasis

    NARCIS (Netherlands)

    van der Woerd, Wendy L.; Wichers, Catharina G. K.; Vestergaard, Anna L.; Andersen, Jens Peter; Paulusma, Coen C.; Houwen, Roderick H. J.; van de Graaf, Stan F. J.

    Background & Aims ATP8B1 deficiency is an autosomal recessive liver disease characterized by intrahepatic cholestasis. ATP8B1 mutation p.I661T, the most frequent mutation in European patients, results in protein misfolding and impaired targeting to the plasma membrane. Similarly, mutations in cystic

  9. Rescue of defective ATP8B1 trafficking by CFTR correctors as a therapeutic strategy for familial intrahepatic cholestasis

    NARCIS (Netherlands)

    van der Woerd, Wendy L.; Wichers, Catharina G. K.; Vestergaard, Anna L.; Andersen, Jens Peter; Paulusma, Coen C.; Houwen, Roderick H. J.; van de Graaf, Stan F. J.

    2016-01-01

    ATP8B1 deficiency is an autosomal recessive liver disease characterized by intrahepatic cholestasis. ATP8B1 mutation p.I661T, the most frequent mutation in European patients, results in protein misfolding and impaired targeting to the plasma membrane. Similarly, mutations in cystic fibrosis

  10. CtIP Mutations Cause Seckel and Jawad Syndromes.

    Directory of Open Access Journals (Sweden)

    Per Qvist

    2011-10-01

    Full Text Available Seckel syndrome is a recessively inherited dwarfism disorder characterized by microcephaly and a unique head profile. Genetically, it constitutes a heterogeneous condition, with several loci mapped (SCKL1-5 but only three disease genes identified: the ATR, CENPJ, and CEP152 genes that control cellular responses to DNA damage. We previously mapped a Seckel syndrome locus to chromosome 18p11.31-q11.2 (SCKL2. Here, we report two mutations in the CtIP (RBBP8 gene within this locus that result in expression of C-terminally truncated forms of CtIP. We propose that these mutations are the molecular cause of the disease observed in the previously described SCKL2 family and in an additional unrelated family diagnosed with a similar form of congenital microcephaly termed Jawad syndrome. While an exonic frameshift mutation was found in the Jawad family, the SCKL2 family carries a splicing mutation that yields a dominant-negative form of CtIP. Further characterization of cell lines derived from the SCKL2 family revealed defective DNA damage induced formation of single-stranded DNA, a critical co-factor for ATR activation. Accordingly, SCKL2 cells present a lowered apoptopic threshold and hypersensitivity to DNA damage. Notably, over-expression of a comparable truncated CtIP variant in non-Seckel cells recapitulates SCKL2 cellular phenotypes in a dose-dependent manner. This work thus identifies CtIP as a disease gene for Seckel and Jawad syndromes and defines a new type of genetic disease mechanism in which a dominant negative mutation yields a recessively inherited disorder.

  11. A conservative assessment of the major genetic causes of idiopathic chronic pancreatitis: data from a comprehensive analysis of PRSS1, SPINK1, CTRC and CFTR genes in 253 young French patients.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Masson

    Full Text Available Idiopathic chronic pancreatitis (ICP has traditionally been defined as chronic pancreatitis in the absence of any obvious precipitating factors (e.g. alcohol abuse and family history of the disease. Studies over the past 15 years have revealed that ICP has a highly complex genetic architecture involving multiple gene loci. Here, we have attempted to provide a conservative assessment of the major genetic causes of ICP in a sample of 253 young French ICP patients. For the first time, conventional types of mutation (comprising coding sequence variants and variants at intron/exon boundaries and gross genomic rearrangements were screened for in all four major pancreatitis genes, PRSS1, SPINK1, CTRC and CFTR. For the purposes of the study, synonymous, intronic and 5'- or 3'-untranslated region variants were excluded from the analysis except where there was persuasive evidence of functional consequences. The remaining sequence variants/genotypes were classified into causative, contributory or neutral categories by consideration of (i their allele frequencies in patient and normal control populations, (ii their presumed or experimentally confirmed functional effects, (iii the relative importance of their associated genes in the pathogenesis of chronic pancreatitis and (iv gene-gene interactions wherever applicable. Adoption of this strategy allowed us to assess the pathogenic relevance of specific variants/genotypes to their respective carriers to an unprecedented degree. The genetic cause of ICP could be assigned in 23.7% of individuals in the study group. A strong genetic susceptibility factor was also present in an additional 24.5% of cases. Taken together, up to 48.2% of the studied ICP patients were found to display evidence of a genetic basis for their pancreatitis. Whereas these particular proportions may not be extrapolable to all ICP patients, the approach employed should serve as a useful framework for acquiring a better understanding of the

  12. Assessment of the structural and functional impact of in-frame mutations of the DMD gene, using the tools included in the eDystrophin online database

    Directory of Open Access Journals (Sweden)

    Nicolas Aurélie

    2012-07-01

    Full Text Available Abstract Background Dystrophin is a large essential protein of skeletal and heart muscle. It is a filamentous scaffolding protein with numerous binding domains. Mutations in the DMD gene, which encodes dystrophin, mostly result in the deletion of one or several exons and cause Duchenne (DMD and Becker (BMD muscular dystrophies. The most common DMD mutations are frameshift mutations resulting in an absence of dystrophin from tissues. In-frame DMD mutations are less frequent and result in a protein with partial wild-type dystrophin function. The aim of this study was to highlight structural and functional modifications of dystrophin caused by in-frame mutations. Methods and results We developed a dedicated database for dystrophin, the eDystrophin database. It contains 209 different non frame-shifting mutations found in 945 patients from a French cohort and previous studies. Bioinformatics tools provide models of the three-dimensional structure of the protein at deletion sites, making it possible to determine whether the mutated protein retains the typical filamentous structure of dystrophin. An analysis of the structure of mutated dystrophin molecules showed that hybrid repeats were reconstituted at the deletion site in some cases. These hybrid repeats harbored the typical triple coiled-coil structure of native repeats, which may be correlated with better function in muscle cells. Conclusion This new database focuses on the dystrophin protein and its modification due to in-frame deletions in BMD patients. The observation of hybrid repeat reconstitution in some cases provides insight into phenotype-genotype correlations in dystrophin diseases and possible strategies for gene therapy. The eDystrophin database is freely available: http://edystrophin.genouest.org/.

  13. Somatic loss of function mutations in neurofibromin 1 and MYC associated factor X genes identified by exome-wide sequencing in a wild-type GIST case

    International Nuclear Information System (INIS)

    Belinsky, Martin G.; Rink, Lori; Cai, Kathy Q.; Capuzzi, Stephen J.; Hoang, Yen; Chien, Jeremy; Godwin, Andrew K.; Mehren, Margaret von

    2015-01-01

    Approximately 10–15 % of gastrointestinal stromal tumors (GISTs) lack gain of function mutations in the KIT and platelet-derived growth factor receptor alpha (PDGFRA) genes. An alternate mechanism of oncogenesis through loss of function of the succinate-dehydrogenase (SDH) enzyme complex has been identified for a subset of these “wild type” GISTs. Paired tumor and normal DNA from an SDH-intact wild-type GIST case was subjected to whole exome sequencing to identify the pathogenic mechanism(s) in this tumor. Selected findings were further investigated in panels of GIST tumors through Sanger DNA sequencing, quantitative real-time PCR, and immunohistochemical approaches. A hemizygous frameshift mutation (p.His2261Leufs*4), in the neurofibromin 1 (NF1) gene was identified in the patient’s GIST; however, no germline NF1 mutation was found. A somatic frameshift mutation (p.Lys54Argfs*31) in the MYC associated factor X (MAX) gene was also identified. Immunohistochemical analysis for MAX on a large panel of GISTs identified loss of MAX expression in the MAX-mutated GIST and in a subset of mainly KIT-mutated tumors. This study suggests that inactivating NF1 mutations outside the context of neurofibromatosis may be the oncogenic mechanism for a subset of sporadic GIST. In addition, loss of function mutation of the MAX gene was identified for the first time in GIST, and a broader role for MAX in GIST progression was suggested. The online version of this article (doi:10.1186/s12885-015-1872-y) contains supplementary material, which is available to authorized users

  14. Two recessive mutations in FGF5 are associated with the long-hair phenotype in donkeys.

    Science.gov (United States)

    Legrand, Romain; Tiret, Laurent; Abitbol, Marie

    2014-09-25

    Seven donkey breeds are recognized by the French studbook. Individuals from the Pyrenean, Provence, Berry Black, Normand, Cotentin and Bourbonnais breeds are characterized by a short coat, while those from the Poitou breed (Baudet du Poitou) are characterized by a long-hair phenotype. We hypothesized that loss-of-function mutations in the FGF5 (fibroblast growth factor 5) gene, which are associated with a long-hair phenotype in several mammalian species, may account for the special coat feature of Poitou donkeys. To the best of our knowledge, mutations in FGF5 have never been described in Equidae. We sequenced the FGF5 gene from 35 long-haired Poitou donkeys, as well as from a panel of 67 short-haired donkeys from the six other French breeds and 131 short-haired ponies and horses. We identified a recessive c.433_434delAT frameshift deletion in FGF5, present in Poitou and three other donkey breeds and a recessive nonsense c.245G > A substitution, present in Poitou and four other donkey breeds. The frameshift deletion was associated with the long-hair phenotype in Poitou donkeys when present in two copies (n = 31) or combined with the nonsense mutation (n = 4). The frameshift deletion led to a stop codon at position 159 whereas the nonsense mutation led to a stop codon at position 82 in the FGF5 protein. In silico, the two truncated FGF5 proteins were predicted to lack the critical β strands involved in the interaction between FGF5 and its receptor, a mandatory step to inhibit hair growth. Our results highlight the allelic heterogeneity of the long-hair phenotype in donkeys and enlarge the panel of recessive FGF5 loss-of-function alleles described in mammals. Thanks to the DNA test developed in this study, breeders of non-Poitou breeds will have the opportunity to identify long-hair carriers in their breeding stocks.

  15. Mutations in pseudohypoparathyroidism 1a and pseudopseudohypoparathyroidism in ethnic Chinese.

    Directory of Open Access Journals (Sweden)

    Yi-Lei Wu

    Full Text Available An inactivating mutation in the GNAS gene causes either pseudohypoparathyroidism 1a (PHP1A when it is maternally inherited or pseudopseudohypoparathyroidism (PPHP when it is paternally inherited. We investigated clinical manifestations and mutations of the GNAS gene in ethnic Chinese patients with PHP1A or PPHP. Seven patients from 5 families including 4 girls and 2 boys with PHP1A and 1 girl with PPHP were studied. All PHP1A patients had mental retardation. They were treated with calcitriol and CaCO3 with regular monitoring of serum Ca levels, urinary Ca/Cr ratios, and renal sonography. Among them, 5 patients also had primary hypothyroidism suggesting TSH resistance. One female patient had a renal stone which was treated with extracorporeal shockwave lithotripsy. She had an increased urinary Ca/Cr ratio of 0.481 mg/mg when the stone was detected. We detected mutations using PCR and sequencing as well as analysed a splice acceptor site mutation using RT-PCR, sequencing, and minigene construct. We detected 5 mutations: c.85C>T (Q29*, c.103C>T (Q35*, c.840-2A>G (R280Sfs*21, c.1027_1028delGA (D343*, and c.1174G>A (E392K. Mutations c.840-2A>G and c.1027_1028delGA were novel. The c.840-2A>G mutation at the splice acceptor site of intron 10 caused retention of intron 10 in the minigene construct but skipping of exon 11 in the peripheral blood cells. The latter was the most probable mechanism which caused a frameshift, changing Arg to Ser at residue 280 and invoking a premature termination of translation at codon 300 (R280Sfs*21. Five GNAS mutations in ethnic Chinese with PHP1A and PPHP were reported. Two of them were novel. Mutation c.840-2A>G destroyed a spice acceptor site and caused exon skipping. Regular monitoring and adjustment in therapy are mandatory to achieve optimal therapeutic effects and avoid nephrolithiasis in patients with PHP1A.

  16. Case Report: Exome sequencing reveals recurrent RETSAT mutations and a loss-of-function POLDIP2 mutation in a rare undifferentiated tongue sarcoma [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Jason Y. K. Chan

    2018-04-01

    Full Text Available Soft tissue sarcoma of the tongue represents a very rare head and neck cancer with connective tissue features, and the genetics underlying this rare cancer are largely unknown. There are less than 20 cases reported in the literature thus far. Here, we reported the first whole-exome characterization (>×200 depth of an undifferentiated sarcoma of the tongue in a 31-year-old male. Even with a very good sequencing depth, only 19 nonsynonymous mutations were found, indicating a relatively low mutation rate of this rare cancer (lower than that of human papillomavirus (HPV-positive head and neck cancer. Yet, among the few genes that are somatically mutated in this HPV-negative undifferentiated tongue sarcoma, a noticeable deleterious frameshift mutation (with a very high allele frequency of >93% of a gene for DNA replication and repair, namely POLDIP2 (DNA polymerase delta interacting protein 2, and two recurrent mutations of the adipogenesis and adipocyte differentiation gene RETSAT (retinol saturase, were identified. Thus, somatic events likely affecting adipogenesis and differentiation, as well as potential stem mutations to POLDIP2, may be implicated in the formation of this rare cancer. This identified somatic whole-exome sequencing profile appears to be distinct from that of other reported adult sarcomas from The Cancer Genome Atlas, suggesting a potential unique genetic profile for this rare sarcoma of the tongue. Interestingly, this low somatic mutation rate is unexpectedly found to be accompanied by multiple tumor protein p53 and NOTCH1 germline mutations of the patient’s blood DNA. This may explain the very early age of onset of head and neck cancer, with likely hereditary predisposition. Our findings are, to our knowledge, the first to reveal a unique genetic profile of this very rare undifferentiated sarcoma of the tongue.

  17. Two cases of chronic pancreatitis associated with anomalous pancreaticobiliary ductal union and SPINK1 mutation

    Directory of Open Access Journals (Sweden)

    Eun Sam Rho

    2013-05-01

    Full Text Available Chronic pancreatitis is a progressive inflammatory disease resulting from repeated episodes of acute pancreatitis that impair exocrine function and eventually produce endocrine insufficiency. Some causes of chronic pancreatitis appear to be associated with alterations in the serine&#8211;protease inhibitor, Kazal type 1 (SPINK1 , cationic trypsinogen (PRSS1 , and cystic fibrosis&#8211;transmembrane conductance regulator (CFTR genes, or with structural disorders in the pancreaticobiliary ductal system, such as pancreatic divisum or anomalous pancreaticobiliary ductal union (APBDU. However, it is unusual to observe both genetic alteration and structural anomaly. Here, we report 2 cases with both APBDU and a mutation in the SPINK1 genes, and we discuss the implications of these findings in clinical practice.

  18. Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations.

    Science.gov (United States)

    Hadzsiev, Kinga; Polgar, Noemi; Bene, Judit; Komlosi, Katalin; Karteszi, Judit; Hollody, Katalin; Kosztolanyi, Gyorgy; Renieri, Alessandra; Melegh, Bela

    2011-03-01

    Rett syndrome (RTT) is characterized by a relatively specific clinical phenotype. We screened 152 individuals with RTT phenotype. A total of 22 different known MECP2 mutations were identified in 42 subjects (27.6%). Of the 22 mutations, we identified 7 (31.8%) frameshift-causing deletions, 4 (18.2%) nonsense, 10 (45.5%) missense mutations and one insertion (4.5%). The most frequent pathologic changes were: p.Thr158Met (14.2%) and p.Arg133Cys (11.9%) missense, and p.Arg255Stop (9.5%) and p.Arg294Stop (9.5%) nonsense mutations. We also detected the c.925C >T (p.Arg309Trp) mutation in an affected patient, whose role in RTT pathogenesis is still unknown. Patients without detectable MECP2 defects were screened for mutations of cyclin-dependent kinase-like 5 (CDKL5) gene, responsible for the early-onset variant of RTT. We discovered two novel mutations: c.607G >T resulting in a termination codon at aa203, disrupting the catalytic domain, and c.1708G >T leading to a stop at aa570 of the C terminus. Both patients with CDKL5 mutation presented therapy-resistant epilepsy and a phenotype fitting with the diagnosis of early-onset variant of RTT. No FOXG1 mutation was detected in any of the remaining patients. A total of 110 (72.5%) patients remained without molecular genetic diagnosis that necessitates further search for novel gene mutations in this phenotype. Our results also suggest the need of screening for CDKL5 mutations in patients with Rett phenotype tested negative for MECP2 mutations.

  19. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  20. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  1. Novel and recurrent mutations of WISP3 in two Chinese families with progressive pseudorheumatoid dysplasia.

    Directory of Open Access Journals (Sweden)

    Jing Sun

    Full Text Available BACKGROUND: The WNT1-inducible signaling pathway protein 3 (WISP3, which belongs to the CCN (cysteine-rich protein 61, connective tissue growth factor, nephroblastoma overexpressed family, is a secreted cysteine-rich matricellular protein that is involved in chondrogenesis, osteogenesis and tumorigenesis. WISP3 gene mutations are associated with progressive pseudorheumatoid dysplasia (PPD, OMIM208230, an autosomal recessive genetic disease that is characterized by the swelling of multiple joints and disproportionate dwarfism. METHODOLOGY/PRINCIPAL FINDINGS: Four PPD patients from two unrelated Chinese families were recruited for this study. The clinical diagnosis was confirmed by medical history, physical examinations, laboratory results and radiological abnormalities. WISP3 mutations were detected by direct DNA sequence analysis. In total, four different mutations were identified, which consisted of two missense mutations, one deletion and one insertion that spanned exons 3, 5 and 6 of the WISP3 gene. One of the missense mutations (c.342T>G/p.C114W and a seven-base pair frameshift deletion (c.716_722del/p.E239fs*16 were novel. The other missense mutation (c.1000T>C/p. S334P and the insertion mutation (c.866_867insA/p.Q289fs*31 had previously been identified in Chinese patients. All four cases had a compound heterozygous status, and their parents were heterozygous carriers of these mutations. CONCLUSIONS/SIGNIFICANCE: The results of our study expand the spectrum of WISP3 mutations that are associated with PPD and further elucidate the function of WISP3.

  2. Loss of function mutations in EPHB4 are responsible for vein of Galen aneurysmal malformation.

    Science.gov (United States)

    Vivanti, Alexandre; Ozanne, Augustin; Grondin, Cynthia; Saliou, Guillaume; Quevarec, Loic; Maurey, Helène; Aubourg, Patrick; Benachi, Alexandra; Gut, Marta; Gut, Ivo; Martinovic, Jelena; Sénat, Marie Victoire; Tawk, Marcel; Melki, Judith

    2018-04-01

    See Meschia (doi:10.1093/brain/awy066) for a scientific commentary on this article.Vein of Galen aneurysmal malformation is a congenital anomaly of the cerebral vasculature representing 30% of all paediatric vascular malformations. We conducted whole exome sequencing in 19 unrelated patients presenting this malformation and subsequently screened candidate genes in a cohort of 32 additional patients using either targeted exome or Sanger sequencing. In a cohort of 51 patients, we found five affected individuals with heterozygous mutations in EPHB4 including de novo frameshift (p.His191Alafs*32) or inherited deleterious splice or missense mutations predicted to be pathogenic by in silico tools. Knockdown of ephb4 in zebrafish embryos leads to specific anomalies of dorsal cranial vessels including the dorsal longitudinal vein, which is the orthologue of the median prosencephalic vein and the embryonic precursor of the vein of Galen. This model allowed us to investigate EPHB4 loss-of-function mutations in this disease by the ability to rescue the brain vascular defect in knockdown zebrafish co-injected with wild-type, but not truncated EPHB4, mimicking the p.His191Alafs mutation. Our data showed that in both species, loss of function mutations of EPHB4 result in specific and similar brain vascular development anomalies. Recently, EPHB4 germline mutations have been reported in non-immune hydrops fetalis and in cutaneous capillary malformation-arteriovenous malformation. Here, we show that EPHB4 mutations are also responsible for vein of Galen aneurysmal malformation, indicating that heterozygous germline mutations of EPHB4 result in a large clinical spectrum. The identification of EPHB4 pathogenic mutations in patients presenting capillary malformation or vein of Galen aneurysmal malformation should lead to careful follow-up of pregnancy of carriers for early detection of anomaly of the cerebral vasculature in order to propose optimal neonatal care. Endovascular

  3. AIP mutations in young patients with acromegaly and the Tampico Giant: the Mexican experience.

    Science.gov (United States)

    Ramírez-Rentería, Claudia; Hernández-Ramírez, Laura C; Portocarrero-Ortiz, Lesly; Vargas, Guadalupe; Melgar, Virgilio; Espinosa, Etual; Espinosa-de-Los-Monteros, Ana Laura; Sosa, Ernesto; González, Baldomero; Zúñiga, Sergio; Unterländer, Martina; Burger, Joachim; Stals, Karen; Bussell, Anne-Marie; Ellard, Sian; Dang, Mary; Iacovazzo, Donato; Kapur, Sonal; Gabrovska, Plamena; Radian, Serban; Roncaroli, Federico; Korbonits, Márta; Mercado, Moisés

    2016-08-01

    Although aryl hydrocarbon receptor-interacting protein (AIP) mutations are rare in sporadic acromegaly, their prevalence among young patients is nonnegligible. The objectives of this study were to evaluate the frequency of AIP mutations in a cohort of Mexican patients with acromegaly with disease onset before the age of 30 and to search for molecular abnormalities in the AIP gene in teeth obtained from the "Tampico Giant". Peripheral blood DNA from 71 patients with acromegaly (51 females) with disease onset T (p.Arg304Ter), well-known truncating mutation was identified; in one of these two cases and her identical twin sister, the mutation proved to be a de novo event, since neither of their parents were found to be carriers. In the remaining three patients, new mutations were identified: a frameshift mutation (c.976_977insC, p.Gly326AfsTer), an in-frame deletion (c.872_877del, p.Val291_Leu292del) and a nonsense mutation (c.868A > T, p.Lys290Ter), which are predicted to be pathogenic based on in silico analysis. Patients with AIP mutations tended to have an earlier onset of acromegaly and harboured larger and more invasive tumours. A previously described genetic variant of unknown significance (c.869C > T, p.Ala299Val) was identified in DNA from the Tampico Giant. The prevalence of AIP mutations in young Mexican patients with acromegaly is similar to that of European cohorts. Our results support the need for genetic evaluation of patients with early onset acromegaly.

  4. TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma—evidence supporting the clonal relationship of the two lesions

    Science.gov (United States)

    Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

    2016-01-01

    Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and ‘primary peritoneal’ (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. PMID:21990067

  5. TP53 mutations in serous tubal intraepithelial carcinoma and concurrent pelvic high-grade serous carcinoma--evidence supporting the clonal relationship of the two lesions.

    Science.gov (United States)

    Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming

    2012-02-01

    Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and 'primary peritoneal' (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. Mutational effects of γ-rays and carbon ion beams on Arabidopsis seedlings

    International Nuclear Information System (INIS)

    Yoshihara, Ryohei; Nozawa, Shigeki; Hase, Yoshihiro; Sakamoto, Ayako N.; Narumi, Issay; Hidema, Jun

    2013-01-01

    To assess the mutational effects of radiation on vigorously proliferating plant tissue, the mutation spectrum was analyzed with Arabidopsis seedlings using the plasmid-rescue method. Transgenic plants containing the Escherichia coli rpsL gene were irradiated with γ-rays and carbon ion beams (320-MeV 12 C 6+ ), and mutations in the rpsL gene were analyzed. Mutant frequency increased significantly following irradiation by γ-rays, but not by 320-MeV 12 C 6+ . Mutation spectra showed that both radiations increased the frequency of frameshifts and other mutations, including deletions and insertions, but only γ-rays increased the frequency of total base substitutions. These results suggest that the type of DNA lesions which cause base substitutions were less often induced by 320-MeV 12 C 6+ than by γ-rays in Arabidopsis seedlings. Furthermore, γ-rays never increased the frequencies of G:C to T:A or A:T to C:G transversions, which are caused by oxidized guanine; 320-MeV 12 C 6+ , however, produced a slight increase in both transversions. Instead, γ-rays produced a significant increase in the frequency of G:C to A:T transitions. These results suggest that 8-oxoguanine has little effect on mutagenesis in Arabidopsis cells. (author)

  7. Molecular analysis of formaldehyde-induced mutations in human lymphoblasts and E. coli

    International Nuclear Information System (INIS)

    Crosby, R.M.; Richardson, K.K.; Craft, T.R.; Benforado, K.B.; Liber, H.L.; Skopek, T.R.

    1988-01-01

    The molecular nature of formaldehyde (HCHO)-induced mutations was studied in both human lymphoblasts and E. coli. Thirty HPRT - human lymphoblast colonies induced by eight repetitive 150 μM HCHO treatments were characterized by Southern blot analysis. Fourteen of these mutants (47%) had visible deletions of some or all of the X-linked HPRT bands, indicating that HCHO can induce large losses of DNA in human lymphoblasts. In E. coli., DNA alterations induced by HCHO were characterized with use of the xanthine guanine phosphoribosyl transferase (gpt) gene as the genetic target. Exposure of E. coli to 4 mM HCHO for 1 hr induced large insertions (41%), large deletions (18%), and point mutations (41%). Dideoxy DNA sequencing revealed that most of the point mutations were transversions at GC base pairs. In contrast, exposure of E. coli to 40 mM HCHO for 1 hr produced 92% point mutations, 62% of which were transitions at a single AT base pair in the gene. Therefore, HCHO is capable of producing different genetic alterations in E. coli at different concentrations, suggesting fundamental differences in the mutagenic mechanisms operating at the two concentrations used. Naked pSV2gpt plasmid DNA was exposed to 3.3 or 10 mM HCHO and transformed into E. coli. Most of the resulting mutations were frameshifts, again suggesting a different mutagenic mechanism

  8. Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

    Science.gov (United States)

    Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

    2009-02-18

    MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

  9. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    Science.gov (United States)

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  10. A novel STXBP1 mutation causes typical Rett syndrome in a Japanese girl.

    Science.gov (United States)

    Yuge, Kotaro; Iwama, Kazuhiro; Yonee, Chihiro; Matsufuji, Mayumi; Sano, Nozomi; Saikusa, Tomoko; Yae, Yukako; Yamashita, Yushiro; Mizuguchi, Takeshi; Matsumoto, Naomichi; Matsuishi, Toyojiro

    2018-06-01

    Rett syndrome (RTT) is a neurodevelopmental disorder mostly caused by mutations in Methyl-CpG-binding protein 2 (MECP2); however, mutations in various other genes may lead to RTT-like phenotypes. Here, we report the first case of a Japanese girl with RTT caused by a novel syntaxin-binding protein 1 (STXBP1) frameshift mutation (c.60delG, p.Lys21Argfs*16). She showed epilepsy at one year of age, regression of acquired psychomotor abilities thereafter, and exhibited stereotypic hand and limb movements at 3 years of age. Her epilepsy onset was earlier than is typical for RTT patients. However, she fully met the 2010 diagnostic criteria of typical RTT. STXBP1 mutations cause early infantile epileptic encephalopathy (EIEE), various intractable epilepsies, and neurodevelopmental disorders. However, the case described here presented a unique clinical presentation of typical RTT without EIEE and a novel STXBP1 mutation. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  11. Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

    Science.gov (United States)

    Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

    2009-08-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.

  12. A deep intronic CLRN1 (USH3A) founder mutation generates an aberrant exon and underlies severe Usher syndrome on the Arabian Peninsula.

    Science.gov (United States)

    Khan, Arif O; Becirovic, Elvir; Betz, Christian; Neuhaus, Christine; Altmüller, Janine; Maria Riedmayr, Lisa; Motameny, Susanne; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno J

    2017-05-03

    Deafblindness is mostly due to Usher syndrome caused by recessive mutations in the known genes. Mutation-negative patients therefore either have distinct diseases, mutations in yet unknown Usher genes or in extra-exonic parts of the known genes - to date a largely unexplored possibility. In a consanguineous Saudi family segregating Usher syndrome type 1 (USH1), NGS of genes for Usher syndrome, deafness and retinal dystrophy and subsequent whole-exome sequencing each failed to identify a mutation. Genome-wide linkage analysis revealed two small candidate regions on chromosome 3, one containing the USH3A gene CLRN1, which has never been associated with Usher syndrome in Saudi Arabia. Whole-genome sequencing (WGS) identified a homozygous deep intronic mutation, c.254-649T > G, predicted to generate a novel donor splice site. CLRN1 minigene-based analysis confirmed the splicing of an aberrant exon due to usage of this novel motif, resulting in a frameshift and a premature termination codon. We identified this mutation in an additional two of seven unrelated mutation-negative Saudi USH1 patients. Locus-specific markers indicated that c.254-649T > G CLRN1 represents a founder allele that may significantly contribute to deafblindness in this population. Our finding underlines the potential of WGS to uncover atypically localized, hidden mutations in patients who lack exonic mutations in the known disease genes.

  13. Generation and characterization of Kctd15 mutations in zebrafish.

    Directory of Open Access Journals (Sweden)

    Alison Heffer

    Full Text Available Potassium channel tetramerization domain containing 15 (Kctd15 was previously found to have a role in early neural crest (NC patterning, specifically delimiting the region where NC markers are expressed via repression of transcription factor AP-2a and inhibition of Wnt signaling. We used transcription activator-like effector nucleases (TALENs to generate null mutations in zebrafish kctd15a and kctd15b paralogs to study the in vivo role of Kctd15. We found that while deletions producing frame-shift mutations in each paralog showed no apparent phenotype, kctd15a/b double mutant zebrafish are smaller in size and show several phenotypes including some affecting the NC, such as expansion of the early NC domain, increased pigmentation, and craniofacial defects. Both melanophore and xanthophore pigment cell numbers and early markers are up-regulated in the double mutants. While we find no embryonic craniofacial defects, adult mutants have a deformed maxillary segment and missing barbels. By confocal imaging of mutant larval brains we found that the torus lateralis (TLa, a region implicated in gustatory networks in other fish, is absent. Ablation of this brain tissue in wild type larvae mimics some aspects of the mutant growth phenotype. Thus kctd15 mutants show deficits in the development of both neural crest derivatives, and specific regions within the central nervous system, leading to a strong reduction in normal growth rates.

  14. Inherited biallelic CSF3R mutations in severe congenital neutropenia.

    Science.gov (United States)

    Triot, Alexa; Järvinen, Päivi M; Arostegui, Juan I; Murugan, Dhaarini; Kohistani, Naschla; Dapena Díaz, José Luis; Racek, Tomas; Puchałka, Jacek; Gertz, E Michael; Schäffer, Alejandro A; Kotlarz, Daniel; Pfeifer, Dietmar; Díaz de Heredia Rubio, Cristina; Ozdemir, Mehmet Akif; Patiroglu, Turkan; Karakukcu, Musa; Sánchez de Toledo Codina, José; Yagüe, Jordi; Touw, Ivo P; Unal, Ekrem; Klein, Christoph

    2014-06-12

    Severe congenital neutropenia (SCN) is characterized by low numbers of peripheral neutrophil granulocytes and a predisposition to life-threatening bacterial infections. We describe a novel genetic SCN type in 2 unrelated families associated with recessively inherited loss-of-function mutations in CSF3R, encoding the granulocyte colony-stimulating factor (G-CSF) receptor. Family A, with 3 affected children, carried a homozygous missense mutation (NM_000760.3:c.922C>T, NP_000751.1:p.Arg308Cys), which resulted in perturbed N-glycosylation and aberrant localization to the cell surface. Family B, with 1 affected infant, carried compound heterozygous deletions provoking frameshifts and premature stop codons (NM_000760.3:c.948_963del, NP_000751.1:p.Gly316fsTer322 and NM_000760.3:c.1245del, NP_000751.1:p.Gly415fsTer432). Despite peripheral SCN, all patients had morphologic evidence of full myeloid cell maturation in bone marrow. None of the patients responded to treatment with recombinant human G-CSF. Our study highlights the genetic and morphologic SCN variability and provides evidence both for functional importance and redundancy of G-CSF receptor-mediated signaling in human granulopoiesis. © 2014 by The American Society of Hematology.

  15. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  16. Hot-spot KIF5A mutations cause familial ALS.

    Science.gov (United States)

    Brenner, David; Yilmaz, Rüstem; Müller, Kathrin; Grehl, Torsten; Petri, Susanne; Meyer, Thomas; Grosskreutz, Julian; Weydt, Patrick; Ruf, Wolfgang; Neuwirth, Christoph; Weber, Markus; Pinto, Susana; Claeys, Kristl G; Schrank, Berthold; Jordan, Berit; Knehr, Antje; Günther, Kornelia; Hübers, Annemarie; Zeller, Daniel; Kubisch, Christian; Jablonka, Sibylle; Sendtner, Michael; Klopstock, Thomas; de Carvalho, Mamede; Sperfeld, Anne; Borck, Guntram; Volk, Alexander E; Dorst, Johannes; Weis, Joachim; Otto, Markus; Schuster, Joachim; Del Tredici, Kelly; Braak, Heiko; Danzer, Karin M; Freischmidt, Axel; Meitinger, Thomas; Strom, Tim M; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H

    2018-01-12

    Heterozygous missense mutations in the N-terminal motor or coiled-coil domains of the kinesin family member 5A (KIF5A) gene cause monogenic spastic paraplegia (HSP10) and Charcot-Marie-Tooth disease type 2 (CMT2). Moreover, heterozygous de novo frame-shift mutations in the C-terminal domain of KIF5A are associated with neonatal intractable myoclonus, a neurodevelopmental syndrome. These findings, together with the observation that many of the disease genes associated with amyotrophic lateral sclerosis disrupt cytoskeletal function and intracellular transport, led us to hypothesize that mutations in KIF5A are also a cause of amyotrophic lateral sclerosis. Using whole exome sequencing followed by rare variant analysis of 426 patients with familial amyotrophic lateral sclerosis and 6137 control subjects, we detected an enrichment of KIF5A splice-site mutations in amyotrophic lateral sclerosis (2/426 compared to 0/6137 in controls; P = 4.2 × 10-3), both located in a hot-spot in the C-terminus of the protein and predicted to affect splicing exon 27. We additionally show co-segregation with amyotrophic lateral sclerosis of two canonical splice-site mutations in two families. Investigation of lymphoblast cell lines from patients with KIF5A splice-site mutations revealed the loss of mutant RNA expression and suggested haploinsufficiency as the most probable underlying molecular mechanism. Furthermore, mRNA sequencing of a rare non-synonymous missense mutation (predicting p.Arg1007Gly) located in the C-terminus of the protein shortly upstream of the splice donor of exon 27 revealed defective KIF5A pre-mRNA splicing in respective patient-derived cell lines owing to abrogation of the donor site. Finally, the non-synonymous single nucleotide variant rs113247976 (minor allele frequency = 1.00% in controls, n = 6137), also located in the C-terminal region [p.(Pro986Leu) in exon 26], was significantly enriched in familial amyotrophic lateral sclerosis patients (minor allele

  17. Hot-spot KIF5A mutations cause familial ALS

    Science.gov (United States)

    Yilmaz, Rüstem; Müller, Kathrin; Grehl, Torsten; Petri, Susanne; Meyer, Thomas; Grosskreutz, Julian; Weydt, Patrick; Ruf, Wolfgang; Neuwirth, Christoph; Weber, Markus; Pinto, Susana; Claeys, Kristl G; Schrank, Berthold; Jordan, Berit; Knehr, Antje; Günther, Kornelia; Hübers, Annemarie; Zeller, Daniel; Kubisch, Christian; Jablonka, Sibylle; Klopstock, Thomas; de Carvalho, Mamede; Sperfeld, Anne; Borck, Guntram; Volk, Alexander E; Dorst, Johannes; Weis, Joachim; Otto, Markus; Schuster, Joachim; Del Tredici, Kelly; Braak, Heiko; Danzer, Karin M; Freischmidt, Axel; Meitinger, Thomas; Strom, Tim M; Ludolph, Albert C; Andersen, Peter M; Weishaupt, Jochen H; Weyen, Ute; Hermann, Andreas; Hagenacker, Tim; Koch, Jan Christoph; Lingor, Paul; Göricke, Bettina; Zierz, Stephan; Baum, Petra; Wolf, Joachim; Winkler, Andrea; Young, Peter; Bogdahn, Ulrich; Prudlo, Johannes; Kassubek., Jan

    2018-01-01

    Abstract Heterozygous missense mutations in the N-terminal motor or coiled-coil domains of the kinesin family member 5A (KIF5A) gene cause monogenic spastic paraplegia (HSP10) and Charcot-Marie-Tooth disease type 2 (CMT2). Moreover, heterozygous de novo frame-shift mutations in the C-terminal domain of KIF5A are associated with neonatal intractable myoclonus, a neurodevelopmental syndrome. These findings, together with the observation that many of the disease genes associated with amyotrophic lateral sclerosis disrupt cytoskeletal function and intracellular transport, led us to hypothesize that mutations in KIF5A are also a cause of amyotrophic lateral sclerosis. Using whole exome sequencing followed by rare variant analysis of 426 patients with familial amyotrophic lateral sclerosis and 6137 control subjects, we detected an enrichment of KIF5A splice-site mutations in amyotrophic lateral sclerosis (2/426 compared to 0/6137 in controls; P = 4.2 × 10−3), both located in a hot-spot in the C-terminus of the protein and predicted to affect splicing exon 27. We additionally show co-segregation with amyotrophic lateral sclerosis of two canonical splice-site mutations in two families. Investigation of lymphoblast cell lines from patients with KIF5A splice-site mutations revealed the loss of mutant RNA expression and suggested haploinsufficiency as the most probable underlying molecular mechanism. Furthermore, mRNA sequencing of a rare non-synonymous missense mutation (predicting p.Arg1007Gly) located in the C-terminus of the protein shortly upstream of the splice donor of exon 27 revealed defective KIF5A pre-mRNA splicing in respective patient-derived cell lines owing to abrogation of the donor site. Finally, the non-synonymous single nucleotide variant rs113247976 (minor allele frequency = 1.00% in controls, n = 6137), also located in the C-terminal region [p.(Pro986Leu) in exon 26], was significantly enriched in familial amyotrophic lateral sclerosis patients (minor

  18. Novel SCARB2 mutation in action myoclonus-renal failure syndrome and evaluation of SCARB2 mutations in isolated AMRF features

    Directory of Open Access Journals (Sweden)

    Hopfner Franziska

    2011-10-01

    Full Text Available Abstract Background Action myoclonus-renal failure syndrome is a hereditary form of progressive myoclonus epilepsy associated with renal failure. It is considered to be an autosomal-recessive disease related to loss-of-function mutations in SCARB2. We studied a German AMRF family, additionally showing signs of demyelinating polyneuropathy and dilated cardiomyopathy. To test the hypothesis whether isolated appearance of individual AMRF syndrome features could be related to heterozygote SCARB2 mutations, we screened for SCARB2 mutations in unrelated patients showing isolated AMRF features. Methods In the AMRF family all exons of SCARB2 were analyzed by Sanger sequencing. The mutation screening of unrelated patients with isolated AMRF features affected by either epilepsy (n = 103, progressive myoclonus epilepsy or generalized epilepsy, demyelinating polyneuropathy (n = 103, renal failure (n = 192 or dilated cardiomyopathy (n = 85 was performed as high resolution melting curve analysis of the SCARB2 exons. Results A novel homozygous 1 bp deletion (c.111delC in SCARB2 was found by sequencing three affected homozygous siblings of the affected family. A heterozygous sister showed generalized seizures and reduction of nerve conduction velocity in her legs. No mutations were found in the epilepsy, renal failure or dilated cardiomyopathy samples. In the polyneuropathy sample two individuals with demyelinating disease were found to be carriers of a SCARB2 frameshift mutation (c.666delCCTTA. Conclusions Our findings indicate that demyelinating polyneuropathy and dilated cardiomyopathy are part of the action myoclonus-renal failure syndrome. Moreover, they raise the possibility that in rare cases heterozygous SCARB2 mutations may be associated with PNP features.

  19. p.H1069Q mutation in ATP7B and biochemical parameters of copper metabolism and clinical manifestation of Wilson's disease.

    Science.gov (United States)

    Gromadzka, Graznya; Schmidt, Harmut H J; Genschel, Janine; Bochow, Bettina; Rodo, M; Tarnacka, Beatek; Litwin, Thomas; Chabik, Grzegorz; Członkowska, Anna

    2006-02-01

    We compared the effect of the p.H1069Q mutation and other non-p.H1069Q mutations in ATP7B on the phenotypic expression of Wilson's disease (WD), and assessed whether the clinical phenotype of WD in compound heterozygotes depends on the type of mutation coexisting with the p.H1069Q. One hundred forty-two patients with clinically, biochemically, and genetically diagnosed WD were studied. The mutational analysis of ATP7B was performed by direct sequencing. A total number of 26 mutations in ATP7B were identified. The p.His1069Gln was the most common mutation (allelic frequency: 72%). Seventy-three patients were homozygous for this mutation. Of compound heterozygotes, 37 had frameshift/nonsense mutation, and 20 had other missense mutation on one of their ATP7B alleles. Twelve patients had two non-p.H1069Q mutations. Patients homozygous for the p.H1069Q mutation had the less severe disturbances of copper metabolism and the latest presentation of first WD symptoms. The most severely disturbed copper metabolism and the earliest age at initial disease manifestation was noticed in non-p.H1069Q patients. In compound heterozygotes, the type of mutation coexisting with the p.H1069Q to a small extent influenced WD phenotype. The phenotype of WD varied considerably among patients with the same genotype. The p.H1069Q mutation is associated with late WD manifestation and with a mild disruption of copper metabolism. In compound heterozygotes, the phenotype of WD to a small extent depends on the type of mutation coexisting with the p.H1069Q. Besides genotype, additional modifying factors seem to determine WD manifestations. Copyright (c) 2005 Movement Disorder Society.

  20. Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka (Oryzias latipes).

    Science.gov (United States)

    Yeh, Ying-Chun; Kinoshita, Masato; Ng, Tze Hann; Chang, Yu-Hsuan; Maekawa, Shun; Chiang, Yi-An; Aoki, Takashi; Wang, Han-Ching

    2017-09-12

    Myostatin (MSTN) suppresses skeletal muscle development and growth in mammals, but its role in fish is less well understood. Here we used CRISPR/Cas9 to mutate the MSTN gene in medaka (Oryzias latipes) and evaluate subsequent growth performance. We produced mutant F0 fish that carried different frameshifts in the OlMSTN coding sequence and confirmed the heritability of the mutant genotypes to the F1 generation. Two F1 fish with the same heterozygous frame-shifted genomic mutations (a 22 bp insertion in one allele; a 32 bp insertion in the other) were then crossbred to produce subsequent generations (F2~F5). Body length and weight of the MSTN -/- F4 medaka were significantly higher than in the wild type fish, and muscle fiber density in the inner and outer compartments of the epaxial muscles was decreased, suggesting that MSTN null mutation induces muscle hypertrophy. From 3~4 weeks post hatching (wph), the expression of three major myogenic related factors (MRFs), MyoD, Myf5 and Myogenin, was also significantly upregulated. Some medaka had a spinal deformity, and we also observed a trade-off between growth and immunity in MSTN -/- F4 medaka. Reproduction was unimpaired in the fast-growth phenotypes.

  1. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-04-01

    Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

  2. Novel Munc13–4 mutations in children and young adult patients with haemophagocytic lymphohistiocytosis

    Science.gov (United States)

    Santoro, A; Cannella, S; Bossi, G; Gallo, F; Trizzino, A; Pende, D; Dieli, F; Bruno, G; Stinchcombe, J C; Micalizzi, C; De Fusco, C; Danesino, C; Moretta, L; Notarangelo, L D; Griffiths, G M; Aricò, M

    2006-01-01

    Familial haemophagocytic lymphohistiocytosis (FHL) is a genetically heterogeneous disorder characterised by constitutive defects in cellular cytotoxicity resulting in fever, hepatosplenomegaly and cytopenia, and the outcome is fatal unless treated by chemoimmunotherapy followed by haematopoietic stem‐cell transplantation. Since 1999, mutations in the perforin gene giving rise to this disease have been identified; however, these account only for 40% of cases. Lack of a genetic marker hampers the diagnosis, suitability for transplantation, selection of familial donors, identification of carriers, genetic counselling and prenatal diagnosis. Mutations in the Munc13–4 gene have recently been described in patients with FHL. We sequenced the Munc13–4 gene in all patients with haemophagocytic lymphohistiocytosis not due to PRF1 mutations. In 15 of the 30 families studied, 12 novel and 4 known Munc13–4 mutations were found, spread throughout the gene. Among novel mutations, 2650C→T introduced a stop codon; 441del A, 532del C, 3082del C and 3226ins G caused a frameshift, and seven were mis sense mutations. Median age of diagnosis was 4 months, but six patients developed the disease after 5 years of age and one as a young adult of 18 years. Involvement of central nervous system was present in 9 of 15 patients, activity of natural killer cells was markedly reduced or absent in 13 of 13 tested patients. Chemo‐immunotherapy was effective in all patients. Munc13–4 mutations were found in 15 of 30 patients with FHL without PRF1 mutations. Because these patients may develop the disease during adolescence or even later, haematologists should include FHL2 and FHL3 in the differential diagnosis of young adults with fever, cytopenia, splenomegaly and hypercytokinaemia. PMID:16825436

  3. Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

    Science.gov (United States)

    Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

    2015-08-26

    Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

  4. A patient with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and severe hypoganglionosis associated with a novel SOX10 mutation.

    Science.gov (United States)

    Akutsu, Yuko; Shirai, Kentaro; Takei, Akira; Goto, Yudai; Aoyama, Tomohiro; Watanabe, Akimitu; Imamura, Masatoshi; Enokizono, Takashi; Ohto, Tatsuyuki; Hori, Tetsuo; Suzuki, Keiko; Hayashi, Masaharu; Masumoto, Kouji; Inoue, Ken

    2018-05-01

    In this report, we present the case of a female infant with peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH) associated with a novel frameshift mutation (c.842dupT) in exon 5, the last exon of SOX10. She had severe hypoganglionosis in the small intestine and entire colon, and suffered from frequent enterocolitis. The persistence of ganglion cells made both the diagnosis and treatment difficult in the neonatal period. She also showed hypopigmentation of the irises, hair and skin, bilateral sensorineural deafness with hypoplastic inner year, severe demyelinating neuropathy with hypotonia, and diffuse brain hypomyelination. The p.Ser282GlnfsTer12 mutation presumably escapes from nonsense-mediated decay and may generate a dominant-negative effect. We suggest that hypoganglionosis can be a variant intestinal manifestation associated with PCWH and that hypoganglionosis and aganglionosis may share the same pathoetiological mechanism mediated by SOX10 mutations. © 2018 Wiley Periodicals, Inc.

  5. Muscarinic Acetylcholine Receptor M3 Mutation Causes Urinary Bladder Disease and a Prune-Belly-like Syndrome.

    Science.gov (United States)

    Weber, Stefanie; Thiele, Holger; Mir, Sevgi; Toliat, Mohammad Reza; Sozeri, Betül; Reutter, Heiko; Draaken, Markus; Ludwig, Michael; Altmüller, Janine; Frommolt, Peter; Stuart, Helen M; Ranjzad, Parisa; Hanley, Neil A; Jennings, Rachel; Newman, William G; Wilcox, Duncan T; Thiel, Uwe; Schlingmann, Karl Peter; Beetz, Rolf; Hoyer, Peter F; Konrad, Martin; Schaefer, Franz; Nürnberg, Peter; Woolf, Adrian S

    2011-11-11

    Urinary bladder malformations associated with bladder outlet obstruction are a frequent cause of progressive renal failure in children. We here describe a muscarinic acetylcholine receptor M3 (CHRM3) (1q41-q44) homozygous frameshift mutation in familial congenital bladder malformation associated with a prune-belly-like syndrome, defining an isolated gene defect underlying this sometimes devastating disease. CHRM3 encodes the M3 muscarinic acetylcholine receptor, which we show is present in developing renal epithelia and bladder muscle. These observations may imply that M3 has a role beyond its known contribution to detrusor contractions. This Mendelian disease caused by a muscarinic acetylcholine receptor mutation strikingly phenocopies Chrm3 null mutant mice. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  6. Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins

    International Nuclear Information System (INIS)

    Ballatori, Nazzareno; Hammond, Christine L.; Cunningham, Jennifer B.; Krance, Suzanne M.; Marchan, Rosemarie

    2005-01-01

    The initial step in reduced glutathione (GSH) turnover in all mammalian cells is its transport across the plasma membrane into the extracellular space; however, the mechanisms of GSH transport are not clearly defined. GSH export is required for the delivery of its constituent amino acids to other tissues, detoxification of drugs, metals, and other reactive compounds of both endogenous and exogenous origin, protection against oxidant stress, and secretion of hepatic bile. Recent studies indicate that some members of the multidrug resistance-associated protein (MRP/CFTR or ABCC) family of ATP-binding cassette (ABC) proteins, as well as some members of the organic anion transporting polypeptide (OATP or SLC21A) family of transporters contribute to this process. In particular, five of the 12 members of the MRP/CFTR family appear to mediate GSH export from cells namely, MRP1, MRP2, MRP4, MRP5, and CFTR. Additionally, two members of the OATP family, rat Oatp1 and Oatp2, have been identified as GSH transporters. For the Oatp1 transporter, efflux of GSH may provide the driving force for the uptake of extracellular substrates. In humans, OATP-B and OATP8 do not appear to transport GSH; however, other members of this family have yet to be characterized in regards to GSH transport. In yeast, the ABC proteins Ycf1p and Bpt1p transport GSH from the cytosol into the vacuole, whereas Hgt1p mediates GSH uptake across the plasma membrane. Because transport is a key step in GSH homeostasis and is intimately linked to its biological functions, GSH export proteins are likely to modulate essential cellular functions

  7. Frecuencia de las mutaciones más comunes del gen CFTR en pacientes peruanos con fibrosis quística mediante la técnica ARMS-PCR

    OpenAIRE

    Aquino, Ruth; Protzel, Ana; Rivera, Juan; Abarca, Hugo; Dueñas, Milagros; Nestarez, Cecilia; Purizaga, Nestor; Diringer, Benoit

    2017-01-01

    Objetivos. Determinar la frecuencia de las diez mutaciones más comúnmente reportadas en América Latina del gen CFTR mediante Sistema de Mutación Refractario a la amplificación por PCR (ARMS-PCR) en los pacientes con fibrosis quística (FQ) de dos instituciones hospitalarias de referencia en el Perú durante el año 2014. Materiales y métodos. Se evaluó la frecuencia de las diez comúnmente reportadas más comúnmente reportadas del gen CFTR en los pacientes del Hospital Nacional Edgardo Rebagliati ...

  8. De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.

    Science.gov (United States)

    Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan

    2014-06-01

    Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Phenotype/genotype correlation in a case series of Stargardt's patients identifies novel mutations in the ABCA4 gene.

    Science.gov (United States)

    Gemenetzi, M; Lotery, A J

    2013-11-01

    To investigate phenotypic variability in terms of best-corrected visual acuity (BCVA) in patients with Stargardt disease (STGD) and confirmed ABCA4 mutations. Entire coding region analysis of the ABCA4 gene by direct sequencing of seven patients with clinical findings of STGD seen in the Retina Clinics of Southampton Eye Unit between 2002 and 2011.Phenotypic variables recorded were BCVA, fluorescein angiographic appearance, electrophysiology, and visual fields. All patients had heterozygous amino acid-changing variants (missense mutations) in the ABCA4 gene. A splice sequence change was found in a 30-year-old patient with severly affected vision. Two novel sequence changes were identified: a missense mutation in a mildly affected 44-year-old patient and a frameshift mutation in a severly affected 34-year-old patient. The identified ABCA4 mutations were compatible with the resulting phenotypes in terms of BCVA. Higher BCVAs were recorded in patients with missense mutations. Sequence changes, predicted to have more deleterious effect on protein function, resulted in a more severe phenotype. This case series of STGD patients demonstrates novel genotype/phenotype correlations, which may be useful to counselling of patients. This information may prove useful in selection of candidates for clinical trials in ABCA4 disease.

  10. TP53 mutation and human papilloma virus status of oral squamous cell carcinomas in young adult patients.

    Science.gov (United States)

    Braakhuis, B J M; Rietbergen, M M; Buijze, M; Snijders, P J F; Bloemena, E; Brakenhoff, R H; Leemans, C R

    2014-09-01

    Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. TP53 mutations were determined with direct sequencing on paraffin-embedded carcinoma tissue from 31 young patients and compared with two older age OSCC reference groups: one from the same institute (N = 87) and an independent one (N = 675). Biologically active tumour HPV was detected by p16-immunohistochemistry followed by a HPV-DNA GP5 + /6 + -PCR. HPV16 was present in one OSCC (3%). TP53 mutations were found in 14 (45%) OSCC: five were missense and nine resulted in a truncated protein. Six of these latter were insertions or deletions of one or more nucleotides leading to frameshift, one was at a splice site and two resulted in a stop codon. The percentage of truncating mutations (64% of all mutations) was higher than that observed in the institute's reference group (44%, P = 0.23) and in the independent reference group (24%, P = 0.002). This study shows that TP53 mutations are common in OSCC of young adult patients; infection with biologically active HPV is rare. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. The NOD2 3020insC Mutation in Women with Breast Cancer from the Bydgoszcz Region in Poland. First Results

    Directory of Open Access Journals (Sweden)

    Janiszewska Hanna

    2006-01-01

    Full Text Available Abstract The frameshift NOD2 gene mutation 3020insC is predominantly associated with Crohn's disease, but predisposes to many types of common cancers as well. We studied the frequency of this mutant NOD2 allele in 148 breast cancer women from the Bydgoszcz region in Poland. The NOD2 mutation was present in 8.8% of the patients. The mean age at breast cancer diagnosis of the mutation carriers was 43 years. We did not find any mutation in patients diagnosed with breast cancer after the age of 50 years. There was no association of the NOD2 mutation with a strong family history of breast cancer. On the contrary, the mutation frequency (11.4% was two times higher in women from families with a single case of breast cancer and with aggregation of other common types of cancer, especially digestive tract cancers. Low risk of breast cancer in the mutation carriers seems to be confirmed by finding the 3020insC mutation in three healthy parents of probands aged 73, 74 and 83 years, from three separate families.

  12. Genome duplication and mutations in ACE2 cause multicellular, fast-sedimenting phenotypes in evolved Saccharomyces cerevisiae.

    Science.gov (United States)

    Oud, Bart; Guadalupe-Medina, Victor; Nijkamp, Jurgen F; de Ridder, Dick; Pronk, Jack T; van Maris, Antonius J A; Daran, Jean-Marc

    2013-11-05

    Laboratory evolution of the yeast Saccharomyces cerevisiae in bioreactor batch cultures yielded variants that grow as multicellular, fast-sedimenting clusters. Knowledge of the molecular basis of this phenomenon may contribute to the understanding of natural evolution of multicellularity and to manipulating cell sedimentation in laboratory and industrial applications of S. cerevisiae. Multicellular, fast-sedimenting lineages obtained from a haploid S. cerevisiae strain in two independent evolution experiments were analyzed by whole genome resequencing. The two evolved cell lines showed different frameshift mutations in a stretch of eight adenosines in ACE2, which encodes a transcriptional regulator involved in cell cycle control and mother-daughter cell separation. Introduction of the two ace2 mutant alleles into the haploid parental strain led to slow-sedimenting cell clusters that consisted of just a few cells, thus representing only a partial reconstruction of the evolved phenotype. In addition to single-nucleotide mutations, a whole-genome duplication event had occurred in both evolved multicellular strains. Construction of a diploid reference strain with two mutant ace2 alleles led to complete reconstruction of the multicellular-fast sedimenting phenotype. This study shows that whole-genome duplication and a frameshift mutation in ACE2 are sufficient to generate a fast-sedimenting, multicellular phenotype in S. cerevisiae. The nature of the ace2 mutations and their occurrence in two independent evolution experiments encompassing fewer than 500 generations of selective growth suggest that switching between unicellular and multicellular phenotypes may be relevant for competitiveness of S. cerevisiae in natural environments.

  13. Functional characterization of two novel splicing mutations in the OCA2 gene associated with oculocutaneous albinism type II.

    Science.gov (United States)

    Rimoldi, Valeria; Straniero, Letizia; Asselta, Rosanna; Mauri, Lucia; Manfredini, Emanuela; Penco, Silvana; Gesu, Giovanni P; Del Longo, Alessandra; Piozzi, Elena; Soldà, Giulia; Primignani, Paola

    2014-03-01

    Oculocutaneous albinism (OCA) is characterized by hypopigmentation of the skin, hair and eye, and by ophthalmologic abnormalities caused by a deficiency in melanin biosynthesis. OCA type II (OCA2) is one of the four commonly-recognized forms of albinism, and is determined by mutation in the OCA2 gene. In the present study, we investigated the molecular basis of OCA2 in two siblings and one unrelated patient. The mutational screening of the OCA2 gene identified two hitherto-unknown putative splicing mutations. The first one (c.1503+5G>A), identified in an Italian proband and her affected sibling, lies in the consensus sequence of the donor splice site of OCA2 intron 14 (IVS14+5G>A), in compound heterozygosity with a frameshift mutation, c.1450_1451insCTGCCCTGACA, which is predicted to determine the premature termination of the polypeptide chain (p.I484Tfs*19). In-silico prediction of the effect of the IVS14+5G>A mutation on splicing showed a score reduction for the mutant splice site and indicated the possible activation of a newly-created deep-intronic acceptor splice site. The second mutation is a synonymous transition (c.2139G>A, p.K713K) involving the last nucleotide of exon 20. This mutation was found in a young African albino patient in compound heterozygosity with a previously-reported OCA2 missense mutation (p.T404M). In-silico analysis predicted that the mutant c.2139G>A allele would result in the abolition of the splice donor site. The effects on splicing of these two novel mutations were investigated using an in-vitro hybrid-minigene approach that led to the demonstration of the causal role of the two mutations and to the identification of aberrant transcript variants. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

    Science.gov (United States)

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

    2013-10-03

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

  15. CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and nonsyndromic deafness.

    Science.gov (United States)

    Astuto, L M; Bork, J M; Weston, M D; Askew, J W; Fields, R R; Orten, D J; Ohliger, S J; Riazuddin, S; Morell, R J; Khan, S; Riazuddin, S; Kremer, H; van Hauwe, P; Moller, C G; Cremers, C W R J; Ayuso, C; Heckenlively, J R; Rohrschneider, K; Spandau, U; Greenberg, J; Ramesar, R; Reardon, W; Bitoun, P; Millan, J; Legge, R; Friedman, T B; Kimberling, W J

    2002-08-01

    Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP-like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia.

  16. CDH23 Mutation and Phenotype Heterogeneity: A Profile of 107 Diverse Families with Usher Syndrome and Nonsyndromic Deafness

    Science.gov (United States)

    Astuto, L. M.; Bork, J. M.; Weston, M. D.; Askew, J. W.; Fields, R. R.; Orten, D. J.; Ohliger, S. J.; Riazuddin, S.; Morell, R. J.; Khan, S.; Riazuddin, S.; Kremer, H.; van Hauwe, P.; Moller, C. G.; Cremers, C. W. R. J.; Ayuso, C.; Heckenlively, J. R.; Rohrschneider, K.; Spandau, U.; Greenberg, J.; Ramesar, R.; Reardon, W.; Bitoun, P.; Millan, J.; Legge, R.; Friedman, T. B.; Kimberling, W. J.

    2002-01-01

    Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP–like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia. PMID:12075507

  17. CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

    Science.gov (United States)

    Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

    2015-10-01

    A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

  18. Airway Clearance Techniques (ACTs)

    Medline Plus

    Full Text Available ... Series Find Out More About Your Mutations Personalized Medicine Types of CFTR Mutations DIAGNOSIS If you or ... Series Find Out More About Your Mutations Personalized Medicine Types of CFTR Mutations Researcher Resources Researchers, supported ...

  19. Targeted exome sequencing reveals novel USH2A mutations in Chinese patients with simplex Usher syndrome.

    Science.gov (United States)

    Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie

    2015-09-16

    Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.

  20. De novo FBXO11 mutations are associated with intellectual disability and behavioural anomalies.

    Science.gov (United States)

    Fritzen, Daniel; Kuechler, Alma; Grimmel, Mona; Becker, Jessica; Peters, Sophia; Sturm, Marc; Hundertmark, Hela; Schmidt, Axel; Kreiß, Martina; Strom, Tim M; Wieczorek, Dagmar; Haack, Tobias B; Beck-Wödl, Stefanie; Cremer, Kirsten; Engels, Hartmut

    2018-05-01

    Intellectual disability (ID) has an estimated prevalence of 1.5-2%. In most affected individuals, its genetic basis remains unclear. Whole exome sequencing (WES) studies have identified a multitude of novel causative gene defects and have shown that a large proportion of sporadic ID cases results from de novo mutations. Here, we present two unrelated individuals with similar clinical features and deleterious de novo variants in FBXO11 detected by WES. Individual 1, a 14-year-old boy, has mild ID as well as mild microcephaly, corrected cleft lip and alveolus, hyperkinetic disorder, mild brain atrophy and minor facial dysmorphism. WES detected a heterozygous de novo 1 bp insertion in the splice donor site of exon 3. Individual 2, a 3-year-old boy, showed ID and pre- and postnatal growth retardation, postnatal mild microcephaly, hyperkinetic and restless behaviour, as well as mild dysmorphism. WES detected a heterozygous de novo frameshift mutation. While ten individuals with ID and de novo variants in FBXO11 have been reported as part of larger studies, only one of the reports has some additional clinical data. Interestingly, the latter individual carries the identical mutation as our individual 2 and also displays ID, intrauterine growth retardation, microcephaly, behavioural anomalies, and dysmorphisms. Thus, we confirm deleterious de novo mutations in FBXO11 as a cause of ID and start the delineation of the associated clinical picture which may also comprise postnatal microcephaly or borderline small head size and behavioural anomalies.

  1. Analysis of mutations in the human HPRT gene induced by accelerated heavy-ion irradiation

    International Nuclear Information System (INIS)

    Kagawa, Yasuhiro; Yatagai, Fumio; Hanaoka, Fumio; Suzuki, Masao; Kase, Youko; Kobayashi, Akiko; Hirano, Masahiko; Kato, Takesi; Watanabe, Masami.

    1995-01-01

    Multiplex PCR analysis of HPRT(-) mutations in human embryo (HE) cells induced by 230 keV/μm carbon-ion irradiation showed no large deletion around the exon regions of the locus gene in contrast to the irradiations at different LETs. To identify these mutations, the sequence alterations in a cDNA of hprt gene were determined for 18 mutant clones in this study. Missing of exon 6 was the most frequent mutational event (10 clones), and missing of both exons 6 and 8 was next most frequent event (6 clones), then base substitutions (2 clones). These characteristics were not seen in a similar analysis of spontaneous mutations, which showed base substitution (5 clones), frameshift (2 clones), missing of both exons 2 and 3 (2 clones), and a single unidentified clone. Direct sequencing and restriction enzyme digestion of the genomic DNA of the mutants which showed missing of exons 6 and 8 in the cDNA, supports the possibility that they were induced by aberrant mRNA splicing. (author)

  2. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  3. Rediscovery by Whole Genome Sequencing: Classical Mutations and Genome Polymorphisms in Neurospora crassa

    Energy Technology Data Exchange (ETDEWEB)

    McCluskey, Kevin; Wiest, Aric E.; Grigoriev, Igor V.; Lipzen, Anna; Martin, Joel; Schackwitz, Wendy; Baker, Scott E.

    2011-06-02

    Classical forward genetics has been foundational to modern biology, and has been the paradigm for characterizing the role of genes in shaping phenotypes for decades. In recent years, reverse genetics has been used to identify the functions of genes, via the intentional introduction of variation and subsequent evaluation in physiological, molecular, and even population contexts. These approaches are complementary and whole genome analysis serves as a bridge between the two. We report in this article the whole genome sequencing of eighteen classical mutant strains of Neurospora crassa and the putative identification of the mutations associated with corresponding mutant phenotypes. Although some strains carry multiple unique nonsynonymous, nonsense, or frameshift mutations, the combined power of limiting the scope of the search based on genetic markers and of using a comparative analysis among the eighteen genomes provides strong support for the association between mutation and phenotype. For ten of the mutants, the mutant phenotype is recapitulated in classical or gene deletion mutants in Neurospora or other filamentous fungi. From thirteen to 137 nonsense mutations are present in each strain and indel sizes are shown to be highly skewed in gene coding sequence. Significant additional genetic variation was found in the eighteen mutant strains, and this variability defines multiple alleles of many genes. These alleles may be useful in further genetic and molecular analysis of known and yet-to-be-discovered functions and they invite new interpretations of molecular and genetic interactions in classical mutant strains.

  4. Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

    Science.gov (United States)

    Rong, Weining; Chen, Xue; Zhao, Kanxing; Liu, Yani; Liu, Xiaoxing; Ha, Shaoping; Liu, Wenzhou; Kang, Xiaoli; Sheng, Xunlun; Zhao, Chen

    2014-01-01

    Usher syndrome (USH) is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS) approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

  5. GFI1B mutation causes a bleeding disorder with abnormal platelet function.

    Science.gov (United States)

    Stevenson, W S; Morel-Kopp, M-C; Chen, Q; Liang, H P; Bromhead, C J; Wright, S; Turakulov, R; Ng, A P; Roberts, A W; Bahlo, M; Ward, C M

    2013-11-01

    GFI1B is a transcription factor important for erythropoiesis and megakaryocyte development but previously unknown to be associated with human disease. A family with a novel bleeding disorder was identified and characterized. Genetic linkage analysis and massively parallel sequencing were used to localize the mutation causing the disease phenotype on chromosome 9. Functional studies were then performed in megakaryocytic cell lines to determine the biological effects of the mutant transcript. We have identified a family with an autosomal dominant bleeding disorder associated with macrothrombocytopenia, red cell anisopoikilocytosis, and platelet dysfunction. The severity of bleeding is variable with some affected individuals experiencing spontaneous bleeding while other family members exhibit only abnormal bleeding with surgery. A single nucleotide insertion was identified in GFI1B that predicts a frameshift mutation in the fifth zinc finger DNA-binding domain. This mutation alters the transcriptional activity of the protein, resulting in a reduction in platelet α-granule content and aberrant expression of key platelet proteins. GFI1B mutation represents a novel human bleeding disorder, and the described phenotype identifies GFI1B as a critical regulator of platelet shape, number, and function. © 2013 International Society on Thrombosis and Haemostasis.

  6. Novel and recurrent MYO7A mutations in Usher syndrome type 1 and type 2.

    Directory of Open Access Journals (Sweden)

    Weining Rong

    Full Text Available Usher syndrome (USH is a group of disorders manifested as retinitis pigmentosa and bilateral sensorineural hearing loss, with or without vestibular dysfunction. Here, we recruited three Chinese families affected with autosomal recessive USH for detailed clinical evaluations and for mutation screening in the genes associated with inherited retinal diseases. Using targeted next-generation sequencing (NGS approach, three new alleles and one known mutation in MYO7A gene were identified in the three families. In two families with USH type 1, novel homozygous frameshift variant p.Pro194Hisfs*13 and recurrent missense variant p.Thr165Met were demonstrated as the causative mutations respectively. Crystal structural analysis denoted that p.Thr165Met would very likely change the tertiary structure of the protein encoded by MYO7A. In another family affected with USH type 2, novel biallelic mutations in MYO7A, c.[1343+1G>A];[2837T>G] or p.[?];[Met946Arg], were identified with clinical significance. Because MYO7A, to our knowledge, has rarely been correlated with USH type 2, our findings therefore reveal distinguished clinical phenotypes associated with MYO7A. We also conclude that targeted NGS is an effective approach for genetic diagnosis for USH, which can further provide better understanding of genotype-phenotype relationship of the disease.

  7. High frequency of the recurrent c.1310_1313delAAGA BRCA2 mutation in the North-East of Morocco and implication for hereditary breast-ovarian cancer prevention and control.

    Science.gov (United States)

    Laarabi, Fatima-Zahra; Ratbi, Ilham; Elalaoui, Siham Chafai; Mezzouar, Loubna; Doubaj, Yassamine; Bouguenouch, Laila; Ouldim, Karim; Benjaafar, Noureddine; Sefiani, Abdelaziz

    2017-06-02

    To date, a limited number of BRCA1/2 germline mutations have been reported in hereditary breast and/or ovarian cancer in the Moroccan population. Less than 20 different mutations of these two genes have been identified in Moroccan patients, and recently we reported a further BRCA2 mutation (c.1310_1313delAAGA; p.Lys437IlefsX22) in three unrelated patients, all from the North-East of the country. We aimed in this study to evaluate the frequency and geographic distribution of this BRCA2 frameshift mutation, in order to access its use as the first-line BRCA genetic testing strategy for Moroccan patients. We enrolled in this study 122 patients from different regions of Morocco, with suggestive inherited predisposition to breast and ovarian cancers. All subjects gave written informed consent to BRCA1/2 genetic testing. According to available resources of our lab and enrolled families, 51 patients were analyzed by the conventional individual exon-by-exon Sanger sequencing, 23 patients were able to benefit from a BRCA next generation sequencing and a target screening for exon 10 of BRCA2 gene was performed in 48 patients. Overall, and among the 122 patients analyzed for at least the exon 10 of the BRCA2 gene, the c.1310_1313delAAGA frameshift mutation was found in 14 patients. Genealogic investigation revealed that all carriers of this mutation shared the same geographic origin and were descendants of the North-East of Morocco. In this study, we highlighted that c.1310_1313delAAGA mutation of BRCA2 gene is recurrent with high frequency in patients from the North-East region of Morocco. Therefore, we propose to use, in public health strategies, the detection of this mutation as the first-line screening tests in patients with breast and ovarian cancer originated from this region.

  8. A mutational signature reveals alterations underlying deficient homologous recombination repair in breast cancer.

    Science.gov (United States)

    Polak, Paz; Kim, Jaegil; Braunstein, Lior Z; Karlic, Rosa; Haradhavala, Nicholas J; Tiao, Grace; Rosebrock, Daniel; Livitz, Dimitri; Kübler, Kirsten; Mouw, Kent W; Kamburov, Atanas; Maruvka, Yosef E; Leshchiner, Ignaty; Lander, Eric S; Golub, Todd R; Zick, Aviad; Orthwein, Alexandre; Lawrence, Michael S; Batra, Rajbir N; Caldas, Carlos; Haber, Daniel A; Laird, Peter W; Shen, Hui; Ellisen, Leif W; D'Andrea, Alan D; Chanock, Stephen J; Foulkes, William D; Getz, Gad

    2017-10-01

    Biallelic inactivation of BRCA1 or BRCA2 is associated with a pattern of genome-wide mutations known as signature 3. By analyzing ∼1,000 breast cancer samples, we confirmed this association and established that germline nonsense and frameshift variants in PALB2, but not in ATM or CHEK2, can also give rise to the same signature. We were able to accurately classify missense BRCA1 or BRCA2 variants known to impair homologous recombination (HR) on the basis of this signature. Finally, we show that epigenetic silencing of RAD51C and BRCA1 by promoter methylation is strongly associated with signature 3 and, in our data set, was highly enriched in basal-like breast cancers in young individuals of African descent.

  9. A Turkish family with Nance-Horan Syndrome due to a novel mutation.

    Science.gov (United States)

    Tug, Esra; Dilek, Nihal F; Javadiyan, Shahrbanou; Burdon, Kathryn P; Percin, Ferda E

    2013-08-01

    Nance-Horan Syndrome (NHS) is a rare X-linked syndrome characterized by congenital cataract which leads to profound vision loss, characteristic dysmorphic features and specific dental anomalies. Microcornea, microphthalmia and mild or moderate mental retardation may accompany these features. Heterozygous females often manifest similarly but with less severe features than affected males. We describe two brothers who have the NHS phenotype and their carrier mother who had microcornea but not cataract. We identified a previously unreported frameshift mutation (c.558insA) in exon 1 of the NHS gene in these patients and their mother which is predicted to result in the incorporation of 11 aberrant amino acids prior to a stop codon (p.E186Efs11X). We also discussed genotype-phenotype correlation according to relevant literature. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Deletion mutations of bacteriophage

    International Nuclear Information System (INIS)

    Ryo, Yeikou

    1975-01-01

    Resolution of mutation mechanism with structural changes of DNA was discussed through the studies using bacteriophage lambda. One of deletion mutations inductions of phage lambda is the irradiation of ultraviolet ray. It is not clear if the inductions are caused by errors in reparation of ultraviolet-induced damage or by the activation of int gene. Because the effective site of int gene lies within the regions unnecessary for existing, it is considered that int gene is connected to deletion mutations induction. A certain system using prophage complementarity enables to detect deletion mutations at essential hereditary sites and to solve the relations of deletion mutations with other recombination system, DNA reproduction and repairment system. Duplication and multiplication of hereditary elements were discussed. If lambda deletion mutations of the system, which can control recombination, reproduction and repairment of added DNA, are constructed, mutations mechanism with great changes of DNA structure can be solved by phage lambda. (Ichikawa, K.)

  11. SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

    Science.gov (United States)

    Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine

    2012-08-01

    Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

  12. SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

    Directory of Open Access Journals (Sweden)

    Naresh Kumar Hanchate

    2012-08-01

    Full Text Available Kallmann syndrome (KS associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31 and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H. All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H, which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

  13. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    Science.gov (United States)

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  14. Characterization of a splicing mutation in group A xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Satokata, Ichiro; Tanaka, Kiyoji; Miura, Naoyuki; Miyamoto, Iwai; Okada, Yoshio; Satoh, Yoshiaki; Kondo, Seiji

    1990-01-01

    The molecular basis of group A xeroderma pigmentosum (WP) was investigated by comparison of the nucleotide sequences of multiple clones of the XP group A complementing gene (XPAC) from a patient with group A XP with that of a normal gene. The clones showed a G → C substitution at the 3' splice acceptor site of intron 3, which altered the obligatory AG acceptor dinucleotide to AC. Nucleotide sequencing of cDNAs amplified by the polymerase chain reaction revealed that this single base substitution abolishes the canonical 3' splice site, thus creating two abnormally spliced mRNA forms. The larger form is identical with normal mRNA except for a dinucleotide deletion at the 5' end of exon 4. This deletion results in a frameshift with premature translation termination in exon 4. The smaller form has a deletion of the entire exon 3 and the dinucleotide at the 5' end of exon 4. The result of a transfection study provided additional evidence that this single base substitution is the disease-causing mutation. This single base substitution creates a new cleavage site for the restriction nuclease AlwNI. Analysis of AlwNI restriction fragment length polymorphism showed a high frequency of this mutation in Japanese patients with group A XP: 16 of 21 unrelated Japanese patients were homozygous and 4 were heterozygous for this mutation. However, 11 Caucasians and 2 Blacks with group A XP did not have this mutant allele. The polymorphic AlwNI restriction fragments are concluded to be useful for diagnosis of group A XP in Japanese subjects, including prenatal cases and carriers

  15. Curcumin/poly(2-methyl-2-oxazoline-b-tetrahydrofuran-b-2-methyl-2-oxazoline) formulation: An improved penetration and biological effect of curcumin in F508del-CFTR cell lines.

    Science.gov (United States)

    Gonçalves, Cristine; Gomez, Jean-Pierre; Même, William; Rasolonjatovo, Bazoly; Gosset, David; Nedellec, Steven; Hulin, Philippe; Huin, Cécile; Le Gall, Tony; Montier, Tristan; Lehn, Pierre; Pichon, Chantal; Guégan, Philippe; Cheradame, Hervé; Midoux, Patrick

    2017-08-01

    Neutral amphiphilic triblock ABA copolymers are of great interest to solubilize hydrophobic drugs. We reported that a triblock ABA copolymer consisting of methyl-2-oxazoline (MeOx) and tetrahydrofuran (THF) (MeOx 6 -THF 19 -MeOx 6 ) (TBCP2) can solubilize curcumin (Cur) a very hydrophobic molecule exhibiting multiple therapeutic effects but whose insolubility and low stability in water is a major drawback for clinical applications. Here, we provide evidences by flow cytometry and confocal microscopy that Cur penetration in normal and ΔF508-CFTR human airway epithelial cell lines is facilitated by TBCP2. When used on ΔF508-CFTR cell lines, the Cur/TBCP2 formulation promotes the restoration of the expression of the CFTR protein in the plasma membrane. Furthermore, patch-clamp and MQAE fluorescence experiments show that this effect is associated with a correction of a Cl - selective current at the membrane surface of F508del-CFTR cells. The results show the great potential of the neutral amphiphilic triblock copolymer MeOx 6 -THF 19 -MeOx 6 as carrier for curcumin in a Cystic Fibrosis context. We anticipate that other MeOx n -THF m -MeOx n copolymers could have similar behaviours for other highly insoluble therapeutic drugs or cosmetic active ingredients. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Combinatorial effects of genistein and sex-steroids on the level of cystic fibrosis transmembrane regulator (CFTR), adenylate cyclase (AC) and cAMP in the cervix of ovariectomised rats.

    Science.gov (United States)

    Salleh, Naguib; Ismail, Nurain; Muniandy, Sekaran; Korla, Praveen Kumar; Giribabu, Nelli

    2015-12-01

    The combinatorial effects of genistein and estrogen (E) or estrogen plus progesterone (E+P) on CFTR, AC and cAMP levels in cervix were investigated. Ovariectomised adult female rats received 50 or 100mg/kg/day genistein with E or E followed by E+P [E+(E+P)] for seven consecutive days. Cervixes were harvested and analyzed for CFTR mRNA levels by Real-time PCR. Distribution of AC and CFTR proteins in endocervix were observed by immunohistochemistry. Levels of cAMP were measured by enzyme-immunoassay. Molecular docking predicted interaction between genistein and AC. Our results indicate that levels of CFTR, AC and cAMP in cervix of rats receiving genistein plus E were higher than E-only treatment (pcervix of E and E+(E+P)-treated rats by genistein could affect the cervical secretory function which could influence the female reproductive processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.

    Science.gov (United States)

    Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B

    1997-10-01

    Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.

  18. Identification of a de novo mutation of SOX10 in a Chinese patient with Waardenburg syndrome type IV.

    Science.gov (United States)

    Liang, Fenghe; Zhao, Min; Fan, Lynn; Zhang, Hongyan; Shi, Yang; Han, Rui; Qu, Chunyan

    2016-12-01

    Waardenburg syndrome is a rare genetic disorder, characterized by the association of sensorineural hearing loss and pigmentation abnormalities. Four subtypes have been classified. The present study aimed to analyze the clinical feature and investigate the genetic cause for a Chinese case of Waardenburg type IV (WS4). The patient and his family members were subjected to mutation detection in the candidate gene SOX10 by Sanger sequencing. The patient has the clinical features of WS4, including sensorineural hearing loss, bright blue irides, premature graying of the hair and Hirschsprung disease. A novel heterozygous frameshift mutation, c.752_753ins7 (p.Gly252Alafs*31) in the exon 5 of SOX10 was detected in the patient, but not found in the unaffected family members and 100 normal controls. This mutation results in a premature stop codon 31 amino acid downstream. The novel mutation c.752_753ins7 (p.Gly252Alafs*31) arose de novo and was considered as the cause of WS4 in the proband. This study further characterized the molecular complexity of WS4 and provided a clinical case for genotype-phenotype correlation studies of different phenotypes caused by SOX10 mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Garuti Rita

    2010-10-01

    Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

  20. A