WorldWideScience

Sample records for cesium 133 target

  1. Preparation of cesium targets for gamma-spectroscopic studies

    Science.gov (United States)

    Bhattacharyya, S.; Basu, S. K.; Chanda, S.; Deb, P.; Eqbal, Md; Kundu, S.; Joseph, D.

    2000-11-01

    A procedure to prepare monoisotopic cesium compound targets for gamma-spectroscopic experiments is described. Using this procedure, uniform targets up to thicknesses of 0.6-1.2 mg/cm 2 were prepared and used for in-beam spectroscopic studies. The purity of the target was tested by energy dispersive X-ray fluorescence (EDXRF) measurements.

  2. Uptake and translocation of cesium-133 in napiergrass (Pennisetum purpureum Schum.) under hydroponic conditions.

    Science.gov (United States)

    Kang, Dong Jin; Seo, Young-Jin; Saito, Tsukasa; Suzuki, Hiroyuki; Ishii, Yasuyuki

    2012-08-01

    The present study reports the potential remediation of cesium (Cs) using napiergrass, which produces the largest biomass among the herbaceous plants in hydroponic culture containing stable Cs (Cs-133) at concentrations of 50, 150, 300, 1000, and 3,000 μM using cesium chloride (CsCl), with 0 μM Cs as a control concentration. Plant height was significantly decreased in higher Cs-treated conditions (300, 1000, and 3000 μM Cs) at 7 weeks after treatment (WAT), but tiller numbers tended to increase compared with the control plant. No significant difference was observed in the aboveground dry matter weight in all Cs treatments throughout the study period. Cs content in the roots, leaf blades, and leaf sheaths clearly increased with increasing Cs concentration in the solutions. Cs content in the aboveground parts (leaf blades and leaf sheaths) was consistently higher than in the roots at concentration of 3,000 μM. Total Cs contents in the aboveground parts were 6305 and 26,365 mg kg(-1) at 7WAT in 1000- and 3000-μM Cs treatments, respectively. Mean values of transfer factors (TFs) in the aboveground parts were 50 μM=0.78, 150 μM=1.02, 300 μM=0.86, 1,000 μM=0.68, and 3,000 μM=0.94, respectively at 7WAT. Due to its high Cs content and high TF in the aboveground parts, napiergrass may be a candidate plant with high potential for phytoremediation of Cs from Cs-137-contaminated soil.

  3. CD133, Selectively Targeting the Root of Cancer

    Directory of Open Access Journals (Sweden)

    Jörg U. Schmohl

    2016-05-01

    Full Text Available Cancer stem cells (CSC are capable of promoting tumor initiation and self-renewal, two important hallmarks of carcinoma formation. This population comprises a small percentage of the tumor mass and is highly resistant to chemotherapy, causing the most difficult problem in the field of cancer research, drug refractory relapse. Many CSC markers have been reported. One of the most promising and perhaps least ubiquitous is CD133, a membrane-bound pentaspan glycoprotein that is frequently expressed on CSC. There is evidence that directly targeting CD133 with biological drugs might be the most effective way to eliminate CSC. We have investigated two entirely unrelated, but highly effective approaches for selectively targeting CD133. The first involves using a special anti-CD133 single chain variable fragment (scFv to deliver a catalytic toxin. The second utilizes this same scFv to deliver components of the immune system. In this review, we discuss the development and current status of these CD133 associated biological agents. Together, they show exceptional promise by specific and efficient CSC elimination.

  4. Control of the 133 cesium cold collisions, search for a variation of the fine structure constant using a dual rubidium-cesium atomic fountain; Controle des collisions froides du cesium {sup 133}Cs: tests de la variation de la constante de structure fine a l'aide d'une fontaine atomique double rubidium-cesium

    Energy Technology Data Exchange (ETDEWEB)

    Marion, H

    2005-03-15

    We developed a method of measurement of the frequency shift due to the collisions between cold atoms. This is the main systematic limitation for the accuracy of the Cs{sup 133} based fountains ({approx} 10{sup -15} in relative frequency). Consequently, we can measure this effect near 0.5% This opens prospects for improvements of the fountains performances in term of accuracy until 10{sup -16}. The fountain has also obtained a stability about 10{sup -14} at 1 s. We discovered for the first time, at very low magnetic field (5 {+-} 1 mG), Feshbach resonances. We also took a new absolute measurement of the hyperfine transition of the Rb{sup 87}, which is the most precise ever carried out and is used now as definition for the secondary standard. By comparing this value with those measured the previous years, we could carry out a test of the stability of the fine structure constant on the level of 10{sup -15} /yr. We led local comparisons between atomic fountains and the other fountains of the laboratory. Most stable it is unrolled with a combined stability of 5.10{sup -14} at 1 s. The behavior of the difference of the two clocks goes like white frequency noise up to 3.10{sup -16}. The assessment of the dual fountain accuracy budget has been evaluated at 7.10{sup -16} for the cesium part and 8.10{sup -16} for the rubidium part. We contributed to the realization of the scale of International Atomic Time, by series of calibrations of hydrogen masers. An atomic comparison of fountain by satellite links was tested between our laboratory and our German counterpart. This measurement has determined the good agreement between the two clocks. (author)

  5. Correlations between potassium, rubidium and cesium ({sup 133}Cs and {sup 137}Cs) in sporocarps of Suillus variegatus in a Swedish boreal forest

    Energy Technology Data Exchange (ETDEWEB)

    Vinichuk, M., E-mail: Mykhailo.Vinichuk@slu.s [Department of Soil and Environment, Swedish University of Agricultural Sciences, P.O. Box 7014, SE-750 07 Uppsala (Sweden); Department of Ecology, Zhytomyr State Technological University, 103 Cherniakhovsky Str., 10005 Zhytomyr (Ukraine); Rosen, K.; Johanson, K.J. [Department of Soil and Environment, Swedish University of Agricultural Sciences, P.O. Box 7014, SE-750 07 Uppsala (Sweden); Dahlberg, A. [Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, P.O. Box 7026, 750 07 Uppsala (Sweden)

    2011-04-15

    An analysis of sporocarps of ectomycorrhizal fungi Suillus variegatus assessed whether cesium ({sup 133}Cs and {sup 137}Cs) uptake was correlated with potassium (K) or rubidium (Rb) uptake. The question was whether intraspecific correlations of Rb, K and {sup 133}Cs mass concentrations with {sup 137}Cs activity concentrations in sporocarps were higher within, rather than among, different fungal species, and if genotypic origin of sporocarps within a population affected uptake and correlation. Sporocarps (n = 51) from a Swedish forest population affected by the fallout after the Chernobyl accident were studied. The concentrations were 31.9 {+-} 6.79 g kg{sup -1} for K (mean {+-} SD, dwt), 0.40 {+-} 0.09 g kg{sup -1} for Rb, 8.7 {+-} 4.36 mg kg{sup -1} for {sup 133}Cs and 63.7 {+-} 24.2 kBq kg{sup -1} for {sup 137}Cs. The mass concentrations of {sup 133}Cs correlated with {sup 137}Cs activity concentrations (r = 0.61). There was correlation between both {sup 133}Cs concentrations (r = 0.75) and {sup 137}Cs activity concentrations (r = 0.44) and Rb, but the {sup 137}Cs/{sup 133}Cs isotopic ratio negatively correlated with Rb concentration. Concentrations of K and Rb were weakly correlated (r = 0.51). The {sup 133}Cs mass concentrations, {sup 137}Cs activity concentrations and {sup 137}Cs/{sup 133}Cs isotopic ratios did not correlate with K concentrations. No differences between, within or, among genotypes in S. variegatus were found. This suggested the relationships between K, Rb, {sup 133}Cs and {sup 137}Cs in sporocarps of S. variegatus is similar to other fungal species. - Highlights: {yields} We studied uptake of Cs ({sup 133}Cs and {sup 137}Cs), K and Rb by Suillus variegates sporocarps. {yields} Genotypic origin of fungus did not affect uptake of studied elements (isotopes). {yields} Genotypic origin did not affect correlation between Cs ({sup 133}Cs and {sup 137}Cs), K and Rb.

  6. MicroRNA-133a Inhibits Osteosarcoma Cells Proliferation and Invasion via Targeting IGF-1R

    Directory of Open Access Journals (Sweden)

    Guangnan Chen

    2016-02-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs are a class of small noncoding RNAs that regulate gene expression by repressing translation or cleaving RNA transcripts in a sequence-specific manner. Downregulated microRNAs and their roles in cancer development have attracted much attention. A growing body of evidence showed that microRNA-133a (miR-133a has inhibitory effects on cell proliferation, migration, invasion, and metastasis of osteosarcoma. Methods: MiR-133a expression in human osteosarcoma cell lines and human normal osteoblastic cell line hFOB was investigated by real-time PCR (RT-PCR. The role of miR-133a in human osteosarcoma growth and invasion was assessed in cell lines in vitro and in vivo. Then, luciferase reporter assay validated IGF-1R as a downstream and functional target of miR-133a, and functional studies revealed that the anti-tumor effect of miR-133a was probably due to targeting and repressing of IGF-1R expression. Results: MiR-133a was lower expressed in human osteosarcoma cell lines than human normal osteoblastic cell line hFOB and its effect on inhibiting proliferation, invasion and metastasis is mediated by its direct interaction with the IGF-1R. Furthermore, the tumour-suppressive function of miR-133a probably contributed to inhibiting the activation AKT and ERK signaling pathway. Conclusion: MiR-133a suppresses osteosarcoma progression and metastasis by targeting IGF-1R in human osteosarcoma cells, providing a novel candidate prognostic factor and a potential anti-metastasis therapeutic target in osteosarcoma.

  7. RNAi targeting CD133 enhances radiosensitivity in CD133 positive liver cancer stem cells%沉默CD133基因对CD133+肝癌干细胞放射敏感性的影响

    Institute of Scientific and Technical Information of China (English)

    王勇; 唐川; 兰曦; 冉雪琪; 邹冬玲; 曹姝; 李芳; 李少林

    2012-01-01

    Objective To determine the effects of CD133-downregulation on the radiosensitivity of CD133+ HepG2 cancer stem cells (CSCs) in hepatocellular carcinoma. Methods Magnetic-activated cell sorting (MACS) was used to isolate CD133+ and CD133- cells from HepG2 cells. Flow cytometry was used to detect the expression of CD133 before and after cells isolation. The NOD/SCID mice transplantation tumor experiments were performed to validate the cancer stem-like properties of sorted CD133 + cells. Targeted silencing towards CD133 gene was performed, and the cells were divided into blank control group, negative-transfec-tion group and positive-transfection group. RT-PCR and Western blotting were used to detect the mRNA and protein expression of CD133. Colony formation assay was applied to detect colony formation efficiency and survival rate after irradiation at different doses. Survival curve was drawn and radiobiology parameters D0, Dq, N and SER (sensitive enhancement ratio) were counted. Flow cytometry was used to test cell cycle and apoptosis. Results Flow cytometry indicated that the expression rate of CD133 was (1. 36 ± 0. 20) % and ( 87. 62± 1. 92)% respectively before and after MACS isolation. When the obtained CD133+ cells at a dose of 1×103/ml, subcutaneous tumor was found in the NOD/SCID mice after implantation. The expression levels of CD133 at mRNA and protein level were significantly decreased in positive-transfection group. After CD133-downregulation , the cells at G1 and S phase were decreased whereas those at G2 phase and apoptotic rate were increased significantly. Colony formation results showed that D0, Dq, N and SF2 were decreased while and SER was increased significantly in positive-transfection group (P <0. 05). Conclusion CD133 , as a marker of CSCs in liver cancer, could be a target for radiosensitization in liver CSCs treatment.%目的 研究沉默CD133基因对人肝癌CD133+-HepG2干细胞放射敏感性的影响.方法 免疫磁珠分选HepG2细

  8. Transtarget residue products of 47MeV/u 12C ions on 133Cs targets

    Institute of Scientific and Technical Information of China (English)

    LiZong-Wei; YangWei-Fan; 等

    1997-01-01

    The yield of transtarget produced in the reaction of 47MeV/u 12C bombardment on cesium compound targets are measured by means of nuclear chemical method and the offline γ spectrum technique.The measurement results show that reaction cross-sections of transtarget products are considerable.The isotope distribution peak position(mass number) of barium element is 129.7±0.2 and the distribution width parameter is 2.76±0.25,At the same time,the yields of products with up to five charge numbers larger than target nucleus have been obtained.

  9. MicroRNA-133b inhibits hepatocellular carcinoma cell progression by targeting Sirt1.

    Science.gov (United States)

    Tian, Zhijie; Jiang, Hequn; Liu, Ying; Huang, Yong; Xiong, Xin; Wu, Hongwei; Dai, Xiaozhen

    2016-05-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs that function as critical gene regulators by targeting mRNAs for translational repression or degradation. In this study, we showed that the expression level of miR-133b was decreased, while Sirt1 mRNA expression levels were increased in hepatocellular carcinoma (HCC) and cell lines, and we identified Sirt1 as a novel direct target of miR-133b. The over-expression of miR-133b suppressed Sirt1 expression. In addition, miR-133b over-expression resulted in attenuating HCC cell proliferation and invasion together with apoptosis increase in vitro. HepG2 cell transplantation revealed that up-regulation of miR-133b could inhibit HCC tumor genesis in vivo. Forced expression of Sirt1 partly rescued the effect of miR-133b in vitro. Furthermore, our study showed that miR-133b over-expression or Sirt1 down-regulation elevated E-cadherin expression, and repressed glypican-3 (GPC3) and the anti-apoptotic proteins (Bcl-2, Bcl-xL, and Mcl-1) expression. The inhibition of GPC3 expression repressed Bcl-2, Bcl-xL, and Mcl-1 expression, and elevated E-cadherin expression. Moreover, the Sirt1 up-regulation resulted in increases in HCC cell proliferation and invasion together with decreases apoptosis, and increases in the cytosolic accumulation and nuclear translocation of the transcription factor β-catenin in vitro. But the effect of Sirt1 up-regulation was partly reversed by GPC3 down-regulation in vitro. Taken together, these findings provide insight into the role and mechanism of miR-133b in regulating HCC cell proliferation, invasion and apoptosis via the miR-133b/Sirt1/GPC3/Wnt β-catenin axis, and miR-133b may serve as a potential therapeutic target in HCC in the future.

  10. CD133-targeted gene transfer into long-term repopulating hematopoietic stem cells.

    Science.gov (United States)

    Brendel, Christian; Goebel, Benjamin; Daniela, Abriss; Brugman, Martijn; Kneissl, Sabrina; Schwäble, Joachim; Kaufmann, Kerstin B; Müller-Kuller, Uta; Kunkel, Hana; Chen-Wichmann, Linping; Abel, Tobias; Serve, Hubert; Bystrykh, Leonid; Buchholz, Christian J; Grez, Manuel

    2015-01-01

    Gene therapy for hematological disorders relies on the genetic modification of CD34(+) cells, a heterogeneous cell population containing about 0.01% long-term repopulating cells. Here, we show that the lentiviral vector CD133-LV, which uses a surface marker on human primitive hematopoietic stem cells (HSCs) as entry receptor, transfers genes preferentially into cells with high engraftment capability. Transduction of unstimulated CD34(+) cells with CD133-LV resulted in gene marking of cells with competitive proliferative advantage in vitro and in immunodeficient mice. The CD133-LV-transduced population contained significantly more cells with repopulating capacity than cells transduced with vesicular stomatitis virus (VSV)-LV, a lentiviral vector pseudotyped with the vesicular stomatitis virus G protein. Upon transfer of a barcode library, CD133-LV-transduced cells sustained gene marking in vivo for a prolonged period of time with a 6.7-fold higher recovery of barcodes compared to transduced control cells. Moreover, CD133-LV-transduced cells were capable of repopulating secondary recipients. Lastly, we show that this targeting strategy can be used for transfer of a therapeutic gene into CD34(+) cells obtained from patients suffering of X-linked chronic granulomatous disease. In conclusion, direct gene transfer into CD133(+) cells allows for sustained long-term engraftment of gene corrected cells.

  11. Poly(lactic-co-glycolic acid nanoparticles conjugated with CD133 aptamers for targeted salinomycin delivery to CD133+ osteosarcoma cancer stem cells

    Directory of Open Access Journals (Sweden)

    Ni MZ

    2015-03-01

    Full Text Available Miaozhong Ni,1,* Min Xiong,1,* Xinchao Zhang,1,* Guoping Cai,1 Huaiwen Chen,2 Qingmin Zeng,1 Zuochong Yu1 1Department of Orthopedics, Jinshan Hospital, Fudan University, 2International Joint Cancer Institute, the Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Cancer stem cells (CSCs possess the characteristics associated with normal stem cells and are responsible for cancer initiation, recurrence, and metastasis. CD133 is regarded as a CSCs marker of osteosarcoma, which is the most common primary bone malignancy in childhood and adolescence. Salinomycin, a polyether ionophore antibiotic, has been shown to kill various CSCs, including osteosarcoma CSCs. However, salinomycin displayed poor aqueous solubility that hinders its clinical application. The objective of this study was to develop salinomycin-loaded nanoparticles to eliminate CD133+ osteosarcoma CSCs.Methods: The salinomycin-loaded PEGylated poly(lactic-co-glycolic acid nanoparticles (SAL-NP conjugated with CD133 aptamers (Ap-SAL-NP were developed by an emulsion/solvent evaporation method, and the targeting and cytotoxicity of Ap-SAL-NP to CD133+ osteosarcoma CSCs were evaluated.Results: The nanoparticles are of desired particle size (~150 nm, drug encapsulation efficiency (~50%, and drug release profile. After 48 hours treatment of the Saos-2 CD133+ osteosarcoma cells with drugs formulated in Ap-SAL-NP, SAL-NP, and salinomycin, the concentrations needed to kill 50% of the incubated cells were found to be 2.18, 10.72, and 5.07 µg/mL, respectively, suggesting that Ap-SAL-NP could be 4.92 or 2.33 fold more effective than SAL-NP or salinomycin, respectively. In contrast, Ap-SAL-NP was as effective as SAL-NP, and less effective than salinomycin in Saos-2 CD133- cells, suggesting that Ap-SAL-NP possess specific cytotoxicity toward Saos-2 CD133+ cells. Ap-SAL-NP showed the best therapeutic effect in Saos-2

  12. Blocking NOTCH Pathway can Enhance the Effect of EGFR Inhibitor through Targeting CD133+ Endometrial Cancer Cells.

    Science.gov (United States)

    Shang, Chao; Lang, Bin; Meng, Li-Rong

    2016-10-28

    ABSTACT Although the molecular therapeutics targeting key biomarkers such as epithelial growth factor receptor (EGFR), PI3K/AKT/mTOR, and vascular endothelial growth factor (VEGF) shows some success in clinical trials, some internally existing challenges in endothelial cancer biology hinder the drug effects. One of the major challenges stems from cancer stem cell-derived drug resistance. CD133 positive cells are well believed as cancer stem cells (CSC) in endometrial cancers and NOTCH pathway plays a critical role in retaining CD133+ cells by promoting CSC self-renewal and chemoresistance. Here, we initiated a therapeutic strategy to improve effects of EGFR inhibition by targeting NOTCH pathway of CD133+ cells in endometrial cancers. We first detected and purified the CD133+ cell fraction in endometrial cancer cell line Ishikawa (IK), and validated activation of NOTCH pathway in the CD133+ cells that have higher proliferation rate and lower apoptosis rate, comparing to CD133- cells. Results of nude mouse xenograft experiments further demonstrated CD133+ cells retain higher tumorigenesis capacity than CD133- cells, indicating their tumor-initiating property. Last, we applied both NOTCH inhibitor DAPT and EGFR inhibitor AG1478 treatment on endometrial cancer lines IK and HEC-1A and the results suggested improvement effects of the combination therapy compared to the treatments of DAPT or AG1478 alone. These findings indicated targeting NOTCH pathway in CD133+ cells, combining with EGFR inhibition, which provides a novel therapeutic strategy for endometrial cancer diseases.

  13. Targeting the ∆133p53 isoform can restore chemosensitivity in 5-fluorouracil-resistant cholangiocarcinoma cells.

    Science.gov (United States)

    Nutthasirikul, Nichapavee; Hahnvajanawong, Chariya; Techasen, Anchalee; Limpaiboon, Temduang; Leelayuwat, Chanvit; Chau-In, Siri; Jearanaikoon, Patcharee

    2015-12-01

    Lack of the normal p53 transactivation domain, ∆133p53 isoform exhibits anti-p53 function. Many studies report the correlation between ∆133p53 expression and poor survival in various cancers, including cholangiocarcinoma (CCA), which is a cancer of the bile ducts. CCA almost always results in short survival times. The relevance of ∆133p53 to drug resistance in CCA is not yet well understood. This study aimed to demonstrate the association between ∆133p53 and 5-fluorouracil (5-FU) resistance in CCA. ∆133p53 protein was highly expressed in CCA patients with poor outcome compared to favorable outcome but was not statistically significant. However, a significant correlation was found between normalized ∆133p53 levels and 5-FU resistance which was defined by an ex vivo histoculture drug response assay (P=0.019). Two stable 5-FU-resistant CCA cell lines, KKU-M139R (IC50 38.8 µM) and KKU-M214R (IC50 39.5 µM), were used as a model to evaluate the role of ∆133p53. Increased ∆133p53 was correlated with 5-FU in a dose-dependent manner. The transient knockdown of ∆133p53 expression can restore drug sensitivity in both resistant CCA cells with 11- to 45-fold reduction of IC50 compared to control. Upon ∆133p53 silencing, apoptotic signaling was enhanced by the upregulation of Bax and downregulation of Bcl-2. Additionally, p21 and p27 were upregulated, resulting in cell cycle arrest at G2. Inhibition of colony formation and prolong doubling time were also observed. Our findings demonstrated that chemosensitivity can be modulated via targeting of ∆133p53 suggesting the potential use of ∆133p53 as a candidate for targeting therapy in CCA.

  14. CD133-targeted Gene Transfer Into Long-term Repopulating Hematopoietic Stem Cells

    NARCIS (Netherlands)

    Brendel, Christian; Goebel, Benjamin; Daniela, Abriss; Brugman, Martijn; Kneissl, Sabrina; Schwaeble, Joachim; Kaufmann, Kerstin B.; Mueller-Kuller, Uta; Kunkel, Hana; Chen-Wichmann, Linping; Abel, Tobias; Serve, Hubert; Bystrykh, Leonid; Buchholz, Christian J.; Grez, Manuel

    2015-01-01

    Gene therapy for hematological disorders relies on the genetic modification of CD34(+) cells, a heterogeneous cell population containing about 0.01% long-term repopulating cells. Here, we show that the lentiviral vector CD133-LV, which uses a surface marker on human primitive hematopoietic stem cell

  15. Ultrasound-targeted microbubble destruction-mediated downregulation of CD133 inhibits epithelial-mesenchymal transition, stemness and migratory ability of liver cancer stem cells.

    Science.gov (United States)

    Liu, Yan-Min; Li, Xuan-Fei; Liu, Hao; Wu, Xiao-Ling

    2015-12-01

    Hepatocellular carcinoma (HCC) is an aggressive disease with a poor outcome due to the high incidence of metastasis. Cancer stem cells (CSCs) have been identified to be responsible for tumor progression and may be generated by epithelial-mesenchymal transition (EMT) characteristics. CD133 is a specific surface marker for liver cancer stem cells (LCSCs), which is also considered as an important functional factor for tumorigenesis and overall survival in HCC. Ultrasound-targeted microbubble destruction (UTMD) has recently been used as a novel, safe and effective gene transfection technology. The aim of the present study was to elucidate the regulatory mechanism of CD133 and EMT in LCSCs and whether the UTMD-based shRNA delivery system facilitated gene delivery in LCSCs. In the present study, CD133+ cells were isolated from the SMMC-7721 HCC cell line and then transfected with shCD133 mediated by UTMD and liposomes, respectively. Compared to the liposomes group, the UTMD group resulted in significantly improved transfection efficiency. The downregulation of CD133 reversed the EMT program, attenuated self-renewal, proliferation and migration of CD133+ LCSCs and suppressed the growth of CSC tumor xenografts. Additionally, the downregulation of CD133 led to downregulation of the nuclear factor-κB (NF-κB) pathway. The present study demonstrated that CD133 plays a critical role in the regulation of the EMT process, tumor-initiating properties and migratory ability of LCSCs. The UTMD technique targeted for CD133 downregulation may be examined as a potential therapeutic strategy for HCC.

  16. Silencing BMI1 eliminates tumor formation of pediatric glioma CD133+ cells not by affecting known targets but by down-regulating a novel set of core genes.

    Science.gov (United States)

    Baxter, Patricia A; Lin, Qi; Mao, Hua; Kogiso, Mari; Zhao, Xiumei; Liu, Zhigang; Huang, Yulun; Voicu, Horatiu; Gurusiddappa, Sivashankarappa; Su, Jack M; Adesina, Adekunle M; Perlaky, Laszlo; Dauser, Robert C; Leung, Hon-chiu Eastwood; Muraszko, Karin M; Heth, Jason A; Fan, Xing; Lau, Ching C; Man, Tsz-Kwong; Chintagumpala, Murali; Li, Xiao-Nan

    2014-01-01

    Clinical outcome of children with malignant glioma remains dismal. Here, we examined the role of over-expressed BMI1, a regulator of stem cell self-renewal, in sustaining tumor formation in pediatric glioma stem cells. Our investigation revealed BMI1 over-expression in 29 of 54 (53.7%) pediatric gliomas, 8 of 8 (100%) patient derived orthotopic xenograft (PDOX) mouse models, and in both CD133+ and CD133- glioma cells. We demonstrated that lentiviral-shRNA mediated silencing of suppressed cell proliferation in vitro in cells derived from 3 independent PDOX models and eliminated tumor-forming capacity of CD133+ and CD133- cells derived from 2 PDOX models in mouse brains. Gene expression profiling showed that most of the molecular targets of BMI1 ablation in CD133+ cells were different from that in CD133- cells. Importantly, we found that silencing BMI1 in CD133+ cells derived from 3 PDOX models did not affect most of the known genes previously associated with the activated BMI1, but modulated a novel set of core genes, including RPS6KA2, ALDH3A2, FMFB, DTL, API5, EIF4G2, KIF5c, LOC650152, C20ORF121, LOC203547, LOC653308, and LOC642489, to mediate the elimination of tumor formation. In summary, we identified the over-expressed BMI1 as a promising therapeutic target for glioma stem cells, and suggest that the signaling pathways associated with activated BMI1 in promoting tumor growth may be different from those induced by silencing BMI1 in blocking tumor formation. These findings highlighted the importance of careful re-analysis of the affected genes following the inhibition of abnormally activated oncogenic pathways to identify determinants that can potentially predict therapeutic efficacy.

  17. Identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer.

    Science.gov (United States)

    Liu, Yanfang; Zhang, Xin; Zhang, Yujing; Hu, Zunqi; Yang, Dejun; Wang, Changming; Guo, Meng; Cai, Qingping

    2015-12-01

    Gastric cancer (GC) is the fourth most frequent malignant disease and the second leading cause of cancer mortality worldwide, but the molecular mechanisms underlying this clinically heterogeneous disease are complex and remain far from completely understood. Accumulating evidence suggests that abnormal microRNA (miRNA) expression is involved in tumorigenesis. However, their accurate expression pattern, function, and mechanism in GC remain unclear. Here, a heatmap analysis of the miRNomes was performed across TCGA datasets and the expression of miR-133 family was found to be consistently downregulated in GC. This result was confirmed in two GC cell lines and 20 pairs of primary GC tissues, and further study demonstrated that the downregulation of miR-133 was mainly mediated by histone modification within its promoter region. Importantly, restoration of miR-133b/a-3p expression could suppress GC cell proliferation and promote cell apoptosis by targeting anti-apoptotic molecules Mcl-1 and Bcl-xL. Consistent with in vitro results, reintroducing of miR-133b/a-3p expression significantly delayed tumor formation and reduced tumor size of GC cells in xenograft nude mice. And the inverse relationship between miR-133b/a-3p and its targets was verified in xenograft mice. Taken together, our findings suggest that miR-133b/a-3p acts as a tumor suppressor in GC by directly targeting Mcl-1 and Bcl-xL. Revealing novel mechanism for oncogene inhibition by miRNA-mediated pathways offers new avenues for GC treatment.

  18. 21 CFR 133.133 - Cream cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cream cheese. 133.133 Section 133.133 Food and... Products § 133.133 Cream cheese. (a) Description. (1) Cream cheese is the soft, uncured cheese prepared by..., nonfat milk, or cream, as defined in § 133.3, used alone or in combination. (2) Clotting enzymes....

  19. MicroRNA-133b targets glutathione S-transferase π expression to increase ovarian cancer cell sensitivity to chemotherapy drugs

    Directory of Open Access Journals (Sweden)

    Chen S

    2015-09-01

    Full Text Available Shuo Chen,1 Jin-Wen Jiao,2 Kai-Xuan Sun,1 Zhi-Hong Zong,3 Yang Zhao1 1Department of Gynecology, The First Affiliated Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Gynecology, The Affiliated Hospital of Medical College, Qingdao University, Qingdao, People’s Republic of China; 3Department of Biochemistry and Molecular Biology, College of Basic Medicine, China Medical University, Shenyang, People’s Republic of China Background: Accumulating studies reveal that aberrant microRNA (miRNA expression can affect the development of chemotherapy drug resistance by modulating the expression of relevant target proteins. The aim of this study was to investigate the role of miR-133b in the development of drug resistance in ovarian cancer cells. Methods: We examined the levels of miR-133b expression in ovarian carcinoma tissues and the human ovarian carcinoma cell lines (A2780, A2780/DDP and A2780/Taxol, respectively. We determined the cell viability of these cell lines treated with cisplatin or paclitaxel in the presence or absence of miR-133b or anti-miR-133b transfection using the MTT assay. Reverse transcription polymerase chain reaction and Western blotting were used to assess the mRNA and protein expression levels of two drug-resistance-related genes: glutathione S-transferase (GST-π and multidrug resistance protein 1 (MDR1. The dual-luciferase reporter assay was used to detect the promoter activity of GST-π in the presence and absence of miR-133b. Results: The expression of miR-133b was significantly lower in primary resistant ovarian carcinomas than in the chemotherapy-sensitive carcinomas (P<0.05, and the same results were found in primary resistant ovarian cell lines (A2780/Taxol and A2780/DDP compared to the chemotherapy-sensitive cell line (A2780; P<0.05. Following miR-133b transfection, four cell lines showed increased sensitivity to paclitaxel and cisplatin, while anti-miR-133b transfection

  20. Cesium chloride: preventive medicine for radioactive cesium exposure?

    Science.gov (United States)

    Braverman, E R; Sohler, A; Pfeiffer, C C

    1988-06-01

    Cesium is produced in high yield fission of uranium and plutonium. Radioactive cesium needles are a radiation hazard for radiotherapists. In this age of nuclear reactors, i.e. Chernobyl, radioactive cesium exposure may be a growing problem. Furthermore, there are numerous therapeutic potentials for cesium therapy, i.e. cancer, depression and schizophrenia. We explored the clearance of cesium in man and found that an oral dose of 50 mg maintains elevated blood cesium levels for 80 days. Cesium is accumulated mainly in the red blood cell fraction. Larger doses (6-9 grams) produce no observed harmful effects and maintain elevated blood levels of cesium for more than a year. Our data suggests there is a threshold of maximum cesium saturation in blood; if maintained, any additional cesium exposure, i.e. radioactive cesium, would be excreted at a more rapid rate. It is probable that large cesium doses can protect against radiation toxicity by blocking sites on red blood cells and thereby result in increased excretion and clearance of the radioactive forms of cesium. This hypothesis should be easily testable in laboratory animals.

  1. Application of Cesium isotopes in daily life; Aplicacoes dos isotopos do Cesio no cotidiano

    Energy Technology Data Exchange (ETDEWEB)

    Jordao, B.O.; Quaresma, D.S.; Carvalho, R.J., E-mail: bjordan@on.br, E-mail: dansq@on.br, E-mail: carvalho@on.br [Observatorio Nacional (ON/LPTF), Rio de Janeiro, RJ (Brazil). Lab. Nacional de Tempo e Frequencia; Peixoto, J.G.P., E-mail: guilherm@ird.gov.br [Instituto de Radioprotecao e Dosimetria, (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Metrologia das Radiacoes Ionizantes

    2014-07-01

    In the world of science, the desire of the scientific community to discover new chemical elements is crucial for the development of new technologies in various fields of knowledge. And the main chemical element addressed by this article is Cesium, but specifically {sup 133}Cesium isotope and radioisotope {sup 137}Cesium, exemplifying their physical and chemical characteristics, and their applications. This article will also show how these isotopes have provided researchers a breakthrough in the field of radiological medicine and in time and frequency metrology. (author)

  2. MiR-34a targeting of Notch ligand delta-like 1 impairs CD15+/CD133+ tumor-propagating cells and supports neural differentiation in medulloblastoma.

    Directory of Open Access Journals (Sweden)

    Pasqualino de Antonellis

    Full Text Available BACKGROUND: Through negative regulation of gene expression, microRNAs (miRNAs can function as oncosuppressors in cancers, and can themselves show altered expression in various tumor types. Here, we have investigated medulloblastoma tumors (MBs, which arise from an early impairment of developmental processes in the cerebellum, where Notch signaling is involved in many of the cell-fate-determining stages. Notch regulates a subset of MB cells that have stem-cell-like properties and can promote tumor growth. On the basis of this evidence, we hypothesized that miRNAs targeting the Notch pathway can regulate these phenomena, and can be used in anti-cancer therapies. METHODOLOGY/PRINCIPAL FINDINGS: In a screening of potential targets within Notch signaling, miR-34a was seen to be a regulator of the Notch pathway through its targeting of Notch ligand Delta-like 1 (Dll1. Down-regulation of Dll1 expression by miR-34a negatively regulates cell proliferation, and induces apoptosis and neural differentiation in MB cells. Using an inducible tetracycline on-off model of miR-34a expression, we show that in Daoy MB cells, Dll1 is the first target that is regulated in MB, as compared to the other targets analyzed here: Cyclin D1, cMyc and CDK4. MiR-34a expression negatively affects CD133(+/CD15(+ tumor-propagating cells, then we assay through reverse-phase proteomic arrays, Akt and Stat3 signaling hypo-phosphorylation. Adenoviruses carrying the precursor miR-34a induce neurogenesis of tumor spheres derived from a genetic animal model of MB (Patch1(+/- p53(-/-, thus providing further evidence that the miR-34a/Dll1 axis controls both autonomous and non autonomous signaling of Notch. In vivo, miR-34a overexpression carried by adenoviruses reduces tumor burden in cerebellum xenografts of athymic mice, thus demonstrating an anti-tumorigenic role of miR-34a in vivo. CONCLUSIONS/SIGNIFICANCE: Despite advances in our understanding of the pathogenesis of MB, one-third of

  3. MiR-133a regarded as a potential biomarker for benzene toxicity through targeting Caspase-9 to inhibit apoptosis induced by benzene metabolite (1,4-Benzoquinone).

    Science.gov (United States)

    Chen, Yujiao; Sun, Pengling; Bai, Wenlin; Gao, Ai

    2016-11-15

    Benzene is an environmental and industrial chemical which is widely utilized in various applications. Our previous study showed that miR-133a expression was down-regulated in chronic benzene poisoning workers, but the mechanism of miR-133a in benzene-induced hematotoxicity remains unclear. In this population-based study, benzene-exposed group recruited workers whose concentration of air benzene was 3.50±1.60mg/m(3), and control workers who were exposed to 0.06±0.01mg/m(3) air benzene. By comparison, Caspase-9 and Caspase-3 was up-regulated while miR-133a expression decreased in benzene-exposed workers. Pearson correlation analysis showed that miR-133a was reversely correlated with pro-apoptotic gene Caspase-9 in population-based study. Moreover, multiple linear regressions indicated that miR-133a was positively associated with blood cells count. To explore the underlying mechanism of miR-133a in benzene-induced hematotoxicity, AO/EB staining and TEM ultrastructural analysis were conducted to verify the activation of apoptosis in Human Leukemic U937 Cells induced by benzene metabolites (1,4-Benzoquinone, 1,4-BQ), while the mechanism of miR-133a in 1,4-BQ-induced apoptosis was performed using lentivirus vectors transfection. The results demonstrated that 1,4-BQ evidently induced mitochondria-mediated apoptosis and increased pro-apoptotic genes (Caspase-9 and Caspase-3) expression in a dose-dependent manner. The mechanistic study showed 1,4-BQ decreased miR-133a expression and miR-133a over-expression attenuated 1, 4-BQ-caused upregulation of Caspase-9, Caspase-3 and apoptosis. In conclusion, our research suggested that benzene induced hematotoxicity by decreasing miR-133a and caspase-dependent apoptosis which might contribute to the underlying mechanism of miR-133a in benzene-induced hematotoxicity.

  4. Clinical effects of cesium intake.

    Science.gov (United States)

    Melnikov, Petr; Zanoni, Lourdes Zélia

    2010-06-01

    The knowledge about cesium metabolism and toxicity is sparse. Oral intake of cesium chloride has been widely promoted on the basis of the hypothesis referred to as "high pH cancer therapy", a complimentary alternative medicine method for cancer treatment. However, no properly confirmed tumor regression was reported so far in all probability because of neither theoretical nor experimental grounds for this proposal. The aim of the present review was to resume and discuss the material currently available on cesium salts and their applications in medicine. The presence of cesium in the cell does not guarantee high pH of its content, and there is no clinical evidence to support the claims that cancer cells are vulnerable to cesium. Cesium is relatively safe; signs of its mild toxicity are gastrointestinal distress, hypotension, syncope, numbness, or tingling of the lips. Nevertheless, total cesium intakes of 6 g/day have been found to produce severe hypokalemia, hypomagnesemia, prolonged QTc interval, episodes of polymorphic ventricular tachycardia, with or without torsade de pointes, and even acute heart arrest. However, full information on its acute and chronic toxicity is not sufficiently known. Health care providers should be aware of the cardiac complications, as a result of careless cesium usage as alternative medicine.

  5. Cesium chloride protects cerebellar granule neurons from apoptosis induced by low potassium.

    Science.gov (United States)

    Zhong, Jin; Yao, Weiguo; Lee, Weihua

    2007-10-01

    Neuronal apoptosis plays a critical role in the pathogenesis of neurodegenerative disorders, and neuroprotective agents targeting apoptotic signaling could have therapeutic use. Here we report that cesium chloride, an alternative medicine in treating radiological poison and cancer, has neuroprotective actions. Serum and potassium deprivation induced cerebellar granule neurons to undergo apoptosis, which correlated with the activation of caspase-3. Cesium prevented both the activation of caspase-3 and neuronal apoptosis in a dose-dependent manner. Cesium at 8 mM increased the survival of neurons from 45 +/- 3% to 91 +/- 5% of control. Cesium's neuroprotection was not mediated by PI3/Akt or MAPK signaling pathways, since it was unable to activate either Akt or MAPK by phosphorylation. In addition, specific inhibitors of PI3 kinase and MAP kinase did not block cesium's neuroprotective effects. On the other hand, cesium inactivated GSK3beta by phosphorylation of serine-9 and GSK3beta-specific inhibitor SB415286 prevented neuronal apoptosis. These data indicate that cesium's neuroprotection is likely via inactivating GSK3beta. Furthermore, cesium also prevented H(2)O(2)-induced neuronal death (increased the survival of neurons from 72 +/- 4% to 89 +/- 3% of control). Given its relative safety and good penetration of the brain blood barrier, our findings support the potential therapeutic use of cesium in neurodegenerative diseases.

  6. Fiber laser system for cesium and rubidium atom interferometry

    CERN Document Server

    Diboune, Clément; Bidel, Yannick; Cadoret, Malo; Bresson, Alexandre

    2016-01-01

    We present an innovative fiber laser system for both cesium and rubidium manipulation. The architecture is based on frequency conversion of two lasers at 1560 nm and 1878 nm. By taking advantage of existing fiber components at these wavelengths, we demonstrate an all fiber laser system delivering 350 mW at 780 nm for rubidium and 210 mW at 852 nm for cesium. This result highlights the promising nature of such laser system especially for Cs manipulation for which no fiber laser system has been reported. It offers new perspectives for the development of atomic instruments dedicated to onboard applications and opens the way to a new generation of atom interferometers involving three atomic species $^{85}$Rb, $^{87}$Rb and $^{133}$Cs for which we propose an original laser architecture.

  7. Mineral resource of the month: cesium

    Science.gov (United States)

    Angulo, Marc A.

    2010-01-01

    The article offers information on cesium, a golden alkali metal derived from the Latin word caesium which means bluish gray. It mentions that cesium is the first element discovered with the use of spectroscopy. It adds that the leading producer and supplier of cesium is Canada and there are 50,000 kilograms of cesium consumed of the world in a year. Moreover, it states that only 85% of the cesium formate can be retrieved and recycled.

  8. Cesium diffusion in graphite

    Energy Technology Data Exchange (ETDEWEB)

    Evans, R.B. III; Davis, W. Jr.; Sutton, A.L. Jr.

    1980-05-01

    Experiments on diffusion of /sup 137/Cs in five types of graphite were performed. The document provides a completion of the report that was started and includes a presentation of all of the diffusion data, previously unpublished. Except for data on mass transfer of /sup 137/Cs in the Hawker-Siddeley graphite, analyses of experimental results were initiated but not completed. The mass transfer process of cesium in HS-1-1 graphite at 600 to 1000/sup 0/C in a helium atmosphere is essentially pure diffusion wherein values of (E/epsilon) and ..delta..E of the equation D/epsilon = (D/epsilon)/sub 0/ exp (-..delta..E/RT) are about 4 x 10/sup -2/ cm/sup 2//s and 30 kcal/mole, respectively.

  9. Ion microscopy based on laser-cooled cesium atoms

    Energy Technology Data Exchange (ETDEWEB)

    Viteau, M.; Reveillard, M.; Kime, L.; Rasser, B.; Sudraud, P. [Orsay Physics, TESCAN Orsay, 95 Avenue des Monts Auréliens – ZA Saint-Charles – 13710 Fuveau (France); Bruneau, Y.; Khalili, G.; Pillet, P.; Comparat, D. [Laboratoire Aimé Cotton, CNRS, Université Paris-Sud, ENS Cachan, Bât. 505, 91405 Orsay (France); Guerri, I. [Dipartimento di Fisica, Università di Pisa, Largo Pontecorvo 3, 56127 Pisa (Italy); Fioretti, A., E-mail: andrea.fioretti@ino.it [Istituto Nazionale di Ottica, INO-CNR, U.O.S. ”Adriano Gozzini”, via Moruzzi 1, 56124 Pisa (Italy); Consorzio Nazionale Interuniversitario per le Scienze Fisiche della Materia, CNISM, Sezione di Pisa, 56127 Pisa (Italy); Ciampini, D.; Allegrini, M.; Fuso, F. [Dipartimento di Fisica, Università di Pisa, Largo Pontecorvo 3, 56127 Pisa (Italy); Istituto Nazionale di Ottica, INO-CNR, U.O.S. ”Adriano Gozzini”, via Moruzzi 1, 56124 Pisa (Italy); Consorzio Nazionale Interuniversitario per le Scienze Fisiche della Materia, CNISM, Sezione di Pisa, 56127 Pisa (Italy)

    2016-05-15

    We demonstrate a prototype of a Focused Ion Beam machine based on the ionization of a laser-cooled cesium beam and adapted for imaging and modifying different surfaces in the few-tens nanometer range. Efficient atomic ionization is obtained by laser promoting ground-state atoms into a target excited Rydberg state, then field-ionizing them in an electric field gradient. The method allows obtaining ion currents up to 130 pA. Comparison with the standard direct photo-ionization of the atomic beam shows, in our conditions, a 40-times larger ion yield. Preliminary imaging results at ion energies in the 1–5 keV range are obtained with a resolution around 40 nm, in the present version of the prototype. Our ion beam is expected to be extremely monochromatic, with an energy spread of the order of the eV, offering great prospects for lithography, imaging and surface analysis. - Highlights: • We realize a Focused Ion Beam with an ionic source based on laser cooled cesium atoms. • Ionization involves excitation of the laser cooled atoms to Rydberg states. • We use the cesium FIB system to image different materials. • We use the cesium FIB to produce permanent modifications on surfaces. • In the present configuration, the focused probe size of the cesium FIB prototype is about 300 nm for beam energies in the 2–5 keV range.

  10. Cesium chloride-induced torsades de pointes.

    Science.gov (United States)

    Wiens, Matthew; Gordon, Wendy; Baulcomb, Daisy; Mattman, Andre; Mock, Tom; Brown, Robert

    2009-09-01

    The chloride salt of cesium, a group 1A element, is gaining popularity as an alternative treatment of advanced cancers. Cesium chloride has primarily been used in cardiovascular research for arrhythmogenesis in animals because of its potassium-blocking effects. The present report describes a 45-year-old woman with metastatic breast cancer who experienced repeated episodes of torsades de pointes polymorphic ventricular tachycardia after several months of oral cesium therapy. There was a clear temporal relationship between cesium ingestion and the arrhythmia, which later resolved following discontinuation of cesium therapy. Serial cesium plasma and whole blood levels were measured over the ensuing six months and pharmacokinetic analysis was performed.

  11. Construction and identification of replication-competent adenovirus expressing siRNA targeting CD133 gene regulated by survivin promoter and its inhibition of liver cancer cell growth%survivin 启动子调控肿瘤干细胞标记 CD133基因 siRNA增殖型溶瘤腺病毒的构建及对肝癌细胞生长的抑制作用

    Institute of Scientific and Technical Information of China (English)

    牛坚; 王月; 刘斌; 王人颢; 朱志军; 申海莲

    2016-01-01

    目的:构建 survivin 启动子调控的靶向 CD133基因的 siRNA 增殖型溶瘤腺病毒,研究其对肝癌细胞生长的影响。方法RT-PCR 法扩增 survivin 启动子,测序鉴定,双酶切连接,获得 pH-XC2-survivin。酶切 pH-XC2-survivin、pZD55-CD133-siRNA 获得 survivin 启动子表达框的亚克隆和CD133-siRNA 基因表达框的亚克隆,连接获得 survivin 启动子调控的 siRNA 增殖型溶瘤腺病毒表达载体质粒 pT-ZD55-CD133-siRNA。增殖型溶瘤腺病毒 survivin-T-ZD55-CD133-siRNA 经 PCR 和测序鉴定。 qRT-PCR 法检测 CD133表达, Western blot 法检测 E1A,CCK-8法检测细胞生长,流式细胞术检测细胞凋亡。结果成功构建增殖型溶瘤腺病毒 sur-vivin-T-ZD55-CD133-siRNA。 qRT-PCR 法检测 CD133 mRNA明显下降, Western blot 证实 survivin-T-ZD55-CD133-siRNA在肿瘤细胞中表达 E1A 能抑制肝癌细胞 CD133表达及生长。结论构建的增殖型溶瘤腺病毒可有效降低肝癌细胞CD133的表达,用于肝癌基因治疗的进一步研究。%Objective To construct a replication-competent adenovirus expressing siRNA targeting CD133 gene regulated by survivin promoter and investigate its inhibitory effect on Hep 3B cells.Methods The fragment of the survivin promoter was amplified by PCR and inserted into pH -XC2 to reconstruct a recombinant plasmid pH -XC2-survivin.Complete digestion pH-XC2-survivin and pZD55-CD133-siRNA, combinational joining the subclones, then getting replication-competent adenovirus expressing short interference RNA targeting CD 133 gene regulated by survivin promoter, replication-competent adenovirus was constructed .The recombined adenoviruses ( T-ZD55-CD133-siRNA) were verified by PCR and sequencing .The effect of T-ZD55-CD133-siRNA on CD133 expression in Hep3B cells was detected by qRT-PCR.The expression of E1A was detected by Western blot.The antitumor po-tential of replication

  12. The Type I Restriction Enzymes as Barriers to Horizontal Gene Transfer: Determination of the DNA Target Sequences Recognised by Livestock-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complexes 133/ST771 and 398.

    Science.gov (United States)

    Chen, Kai; Stephanou, Augoustinos S; Roberts, Gareth A; White, John H; Cooper, Laurie P; Houston, Patrick J; Lindsay, Jodi A; Dryden, David T F

    2016-01-01

    The Type I DNA restriction-modification (RM) systems of Staphylococcus aureus are known to act as a significant barrier to horizontal gene transfer between S. aureus strains belonging to different clonal complexes. The livestock-associated clonal complexes CC133/771 and CC398 contain Type I RM systems not found in human MRSA strains as yet but at some point transfer will occur. When this does take place, horizontal gene transfer of resistance will happen more easily between these strains. The reservoir of antibiotic resistance, virulence and host-adaptation genes present in livestock-associated MRSA will then potentially contribute to the development of newly evolving MRSA clones. The target sites recognised by the Type I RM systems of CC133/771 and CC398 were identified as CAG(N)5RTGA and ACC(N)5RTGA, respectively. Assuming that these enzymes recognise the methylation state of adenine, the underlined A and T bases indicate the unique positions of methylation. Target methylation points for enzymes from CC1 were also identified. The methylation points for CC1-1 are CCAY(N)5TTAA and those for CC1-2 are CCAY(N)6 TGT with the underline indicating the adenine methylation site thus clearing up the ambiguity noted previously (Roberts et al. 2013, Nucleic Acids Res 41:7472-7484) for the half sites containing two adenine bases.

  13. Comparison of organic and inorganic ion exchange materials for removal of cesium and strontium from tank waste

    Energy Technology Data Exchange (ETDEWEB)

    Brown, G. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    This work is part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. Pacific Northwest National Laboratory (PNNL) staff are investigating novel ion exchangers for use in nuclear waste remediation (groundwater, high-level waste (HLW), and low-level waste (LLW)). Waste components targeted for remediation include cesium, strontium, and technetium.

  14. Decorporation of cesium-137; Decorporation du cesium-137

    Energy Technology Data Exchange (ETDEWEB)

    Le Fleche, Ph.; Destombe, C.; Grasseau, A.; Mathieu, J.; Chancerelle, Y.; Mestries, J.C. [GMR, Direction des Recherches, Etudes et Techniques, 94 - Arcueil (France)

    1997-12-31

    Cesium radio-isotopes, especially cesium-137 ({sup 137}Cs) are among the radionuclides of main importance produced by a fission reaction in reactor or a nuclear weapon explosion. In the environment, {sup 137}Cs is a major contaminant which can cause severe {beta}, {gamma}irradiations and contaminations. {sup 137}Cs is distributed widely and relatively uniformly throughout the body with the highest concentration in skeletal muscles. A treatment becomes difficult afterwards. The purposes of this report are Firstly to compare the Prussian blue verses cobalt and potassium ferrocyanide (D.I. blue) efficiency for the {sup 137}Cs decorporation and secondly to assess a chronological treatment with D.I. blue. (author)

  15. Cesium chloride-induced torsades de pointes

    OpenAIRE

    Wiens, Matthew; Gordon, Wendy; Baulcomb, Daisy; Mattman, Andre; Mock, Tom; Brown, Robert

    2009-01-01

    The chloride salt of cesium, a group 1A element, is gaining popularity as an alternative treatment of advanced cancers. Cesium chloride has primarily been used in cardiovascular research for arrhythmogenesis in animals because of its potassium-blocking effects. The present report describes a 45-year-old woman with metastatic breast cancer who experienced repeated episodes of torsades de pointes polymorphic ventricular tachycardia after several months of oral cesium therapy. There was a clear ...

  16. Chemoresistance of CD133+ cancer stem cells in laryngeal carcinoma

    Institute of Scientific and Technical Information of China (English)

    YANG Jing-pu; LIU Yan; ZHONG Wei; YU Dan; WEN Lian-ji; JIN Chun-shun

    2011-01-01

    Background Mounting evidence suggests that tumors are histologically heterogeneous and are maintained by a small population of tumor cells termed cancer stem cells. CD133 has been identified as a candidate marker of cancer stem cells in laryngeal carcinoma. This study aimed to analyze the chemoresistance of CD133+ cancer stem cells.Methods The response of Hep-2 cells to different chemotherapeutic agents was investigated and the expression of CD133 was studied. Fluorescence-activated cell sorting analysis was used to identify CD133,and the CD133+ subset of cells was separated and analyzed in colony formation assays,cell invasion assays,chemotherapy resistance studies,and analyzed for the expression of the drug resistance gene ABCG2.Results About 1%-2% of Hep-2 cells were CD133+ cells,and the CD133+ proportion was enriched by chemotherapy.CD133+ cancer stem cells exhibited higher potential for clonogenicity and invasion,and were more resistant to chemotherapy. This resistance was correlated with higher expression of ABCG2.Conclusions This study suggested that CD133+ cancer stem cells are more resistant to chemotherapy. The expression of ABCG2 could be partially responsible for this. Targeting this small population of CD133+ cancer stem cells could be a strategy to develop more effective treatments for laryngeal carcinoma.

  17. Strong expression of CD133 is associated with increased cholangiocarcinoma progression

    Institute of Scientific and Technical Information of China (English)

    Kawin Leelawat; Taweesak Thongtawee; Siriluck Narong; Somboon Subwongcharoen; Sa-ad Treepongkaruna

    2011-01-01

    AIM: To determine the role of CD133 in cholangiocar-cinoma progression.METHODS: CD133 protein expression was evaluated by immunohistochemistry in 34 cholangiocarcinoma specimens. In addition, proliferation, chemoresistance and invasive properties of CD133-enriched (CD133+) and CD133-depleted (CD133-) RMCCA1 cholangiocarci-noma cells were studied and compared.RESULTS: Strong CD133 expression was observed in 67.6% (23/34) of the cholangiocarcinoma specimens. Strong expression of CD133 was significantly associat-ed with nodal metastasis (P = 0.009) and positive sur-gical margin status (P = 0.011). In the in vitro study, both the CD133+ and CD133- cells had similar prolifera-tion abilities and resistance to chemotherapeutic drugs. However, the CD133+ cells had a higher invasive ability compared with CD133- cells.CONCLUSION: CD133+ cells play an important role in the invasiveness of cholangiocarcinoma. Targeting of the CD133+ cells may be a useful approach to improve treatment against cholangiocarcinoma.

  18. miRNA-133与高血压左心室肥厚的相关性及预测价值%Relation and diagnosis of miRNA-133 for being used as a prediction target molecular marker of left ventricular hypertrophy with hypertension

    Institute of Scientific and Technical Information of China (English)

    黄雨晴; 余雪菊; 李捷; 周颖玲; 陈纪言; 冯颖青

    2016-01-01

    目的:先前国内外实验研究均表明miRNA-133可通过调控RhoA蛋白、细胞分化周期蛋白-42、参与心脏发生的核因子基因和结缔组织生长因子的表达而影响高血压左心室肥厚,但是上述实验并没有在临床上验证 miRNA-133对高血压左心室肥厚的预测价值,因此本研究旨在验证miRNA-133对高血压左心室肥厚的预测价值。方法收集未服用降压药物且发生左心室肥厚的单纯高血压患者和年龄性别相匹配的正常人外周血浆-80℃保存,采用 RT-PCR 技术验证差异表达miRNA的稳定性;组间比较用t检验,采用受试者工作特征(ROC)曲线验证miRNA-133对高血压左心室肥厚的预测价值。结果66例高血压左心室肥厚和33例正常人入选,血压和左心室质量指数有统计学差异(P<0.05),而年龄、血脂等基线资料无统计学差异(P>0.05);RT-PCR结果显示miRNA-133在正常人和高血压左心室肥厚组相对表达量分别为0.04±0.005、0.30±0.44,差异有统计学意义(P<0.05);调整年龄、性别和体质量指数后,miRNA-133表达水平与左心室肥厚具有相关性(ORs=1.654,95%CI 1.273~2.146,P<0.05);miRNA-133对高血压心肌肥厚预测的ROC曲线下面积(AUC)为0.860(P=0.000),95%CI 0.786~0.934(P<0.05)。结论 miRNA-133对高血压左心室肥厚有较好的预测价值。%ObjectivePrevious experimental studies at home and abroad indicated that miRNA-133 had effect on left ventricular hypertrophy in hypertension by regulating and controlling RhoA protein, cell division cycle protein-42, participating in the heart of nuclear factor gene and the expression of connective tissue growth factor, but those experiments were not clinically validated in the miRNA-133 for the value of hypertensive left ventricular hypertrophy, so this study is to verify the predictive value of miRNA-133 to left ventricular hypertrophy in hypertension

  19. Cesium and strontium ion specific exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Yates, S.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with AlliedSignal, Inc. (Des Plaines, Illinois) to develop inorganic ion exchangers that are selective for strontium and cesium from alkaline high-level waste and groundwater streams.

  20. Preferential removal and immobilization of stable and radioactive cesium in contaminated fly ash with nanometallic Ca/CaO methanol suspension.

    Science.gov (United States)

    Mallampati, Srinivasa Reddy; Mitoma, Yoshiharu; Okuda, Tetsuji; Sakita, Shogo; Simion, Cristian

    2014-08-30

    In this work, the capability of nanometallic Ca/CaO methanol suspension in removing and/or immobilizing stable ((133)Cs) and radioactive cesium species ((134)Cs and (137)Cs) in contaminated fly ash was investigated. After a first methanol and second water washing yielded only 45% of (133)Cs removal. While, after a first methanol washing, the second solvent with nanometallic Ca/CaO methanol suspension yielded simultaneous enhanced removal and immobilization about 99% of (133)Cs. SEM-EDS analysis revealed that the mass percent of detectable (133)Cs on the fly ash surface recorded a 100% decrease. When real radioactive cesium contaminated fly ash (containing an initial 14,040Bqkg(-1)(134)Cs and (137)Cs cumulated concentration) obtained from burning wastes from Fukushima were reduced to 3583Bqkg(-1) after treatment with nanometallic Ca/CaO methanol suspension. Elution test conducted on the treated fly ash gave 100BqL(-1) total (134)Cs and (137)Cs concentrations in eluted solution. Furthermore, both ash content and eluted solution concentrations of (134)Cs and (137)Cs were much lower than the Japanese Ministry of the Environment regulatory limit of 8000Bqkg(-1) and 150BqL(-1) respectively. The results of this study suggest that the nanometallic Ca/CaO methanol suspension is a highly potential amendment for the remediation of radioactive cesium-contaminated fly ash.

  1. Selective lentiviral gene delivery to CD133-expressing human glioblastoma stem cells.

    Directory of Open Access Journals (Sweden)

    N Sumru Bayin

    Full Text Available Glioblastoma multiforme (GBM is a deadly primary brain malignancy. Glioblastoma stem cells (GSC, which have the ability to self-renew and differentiate into tumor lineages, are believed to cause tumor recurrence due to their resistance to current therapies. A subset of GSCs is marked by cell surface expression of CD133, a glycosylated pentaspan transmembrane protein. The study of CD133-expressing GSCs has been limited by the relative paucity of genetic tools that specifically target them. Here, we present CD133-LV, a lentiviral vector presenting a single chain antibody against CD133 on its envelope, as a vehicle for the selective transduction of CD133-expressing GSCs. We show that CD133-LV selectively transduces CD133+ human GSCs in dose-dependent manner and that transduced cells maintain their stem-like properties. The transduction efficiency of CD133-LV is reduced by an antibody that recognizes the same epitope on CD133 as the viral envelope and by shRNA-mediated knockdown of CD133. Conversely, the rate of transduction by CD133-LV is augmented by overexpression of CD133 in primary human GBM cultures. CD133-LV selectively transduces CD133-expressing cells in intracranial human GBM xenografts in NOD.SCID mice, but spares normal mouse brain tissue, neurons derived from human embryonic stem cells and primary human astrocytes. Our findings indicate that CD133-LV represents a novel tool for the selective genetic manipulation of CD133-expressing GSCs, and can be used to answer important questions about how these cells contribute to tumor biology and therapy resistance.

  2. Temporal variation of cesium isotope concentrations and atom ratios in zooplankton in the Pacific off the east coast of Japan

    Science.gov (United States)

    Ikenoue, Takahito; Takata, Hyoe; Kusakabe, Masashi; Kudo, Natsumi; Hasegawa, Kazuyuki; Ishimaru, Takashi

    2017-01-01

    After the Fukushima Daiichi Nuclear Power Plant accident in March 2011, concentrations of cesium isotopes (133Cs, 134Cs, and 137Cs) were measured in zooplankton collected in the Pacific off the east coast of Japan from May 2012 to February 2015. The time series of the data exhibited sporadic 137Cs concentration peaks in zooplankton. In addition, the atom ratio of 137Cs/133Cs in zooplankton was consistently high compared to that in ambient seawater throughout the sampling period. These phenomena cannot be explained fully by the bioaccumulation of 137Cs in zooplankton via ambient seawater intake, the inclusion of resuspended sediment in the plankton sample, or the taxonomic composition of the plankton. Autoradiography revealed highly radioactive particles within zooplankton samples, which could be the main factor underlying the sporadic appearance of high 137Cs concentrations in zooplankton as well as the higher ratio of 137Cs/133Cs in zooplankton than in seawater.

  3. Experiments and simulations for the dynamics of cesium in negative hydrogen ion sources for ITER N-NBI

    Energy Technology Data Exchange (ETDEWEB)

    Gutser, Raphael

    2010-07-21

    The injection of fast neutral particles (NBI) into a fusion plasma is an important method for plasma heating and current drive. A source for negative deuterium ions delivering an 1 MeV beam that is accelerated to a specific energy and neutralized by a gas target is required for the ITER-NBI. Cesium seeding is required to extract high negative ion current densities from these sources. The optimization of the cesium homogeneity and control are major objectives to achieve the source requirements imposed by ITER. Within the scope of this thesis, the Monte Carlo based numerical transport simulation CsFlow3D was developed, which is the first computer model that is capable of simulating the flux and the accumulation of cesium on the surfaces of negative-ion sources. Basic studies that support the code development were performed at a dedicated experiment at the University of Augsburg. Input parameters of the ad- and desorption of cesium at ion source relevant conditions were taken from systematic measurements with a quartz micro balance, while the injection rate of the cesium oven at the ion source was determined by surface ionization detection. This experimental setup was used for further investigations of the work function of cesium-coated samples during plasma exposure. (orig.)

  4. 40 CFR 721.10168 - Cesium tungsten oxide.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Cesium tungsten oxide. 721.10168... Substances § 721.10168 Cesium tungsten oxide. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as cesium tungsten oxide (PMN P-08-275; CAS No....

  5. Preferential removal and immobilization of stable and radioactive cesium in contaminated fly ash with nanometallic Ca/CaO methanol suspension

    Energy Technology Data Exchange (ETDEWEB)

    Mallampati, Srinivasa Reddy, E-mail: srireddys@ulsan.ac.kr [Department of Civil and Environmental Engineering, University of Ulsan, Ulsan 680-749 (Korea, Republic of); Mitoma, Yoshiharu, E-mail: mitomay@pu-hiroshima.ac.jp [Department of Environmental Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka-Cho, Shobara City, Hiroshima 727-0023 (Japan); Okuda, Tetsuji [Environmental Research and Management Center, Hiroshima University, 1-5-3 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8513 (Japan); Sakita, Shogo [Department of Environmental Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka-Cho, Shobara City, Hiroshima 727-0023 (Japan); Simion, Cristian [Politehnica University of Bucharest, Department of Organic Chemistry, Bucharest 060042 (Romania)

    2014-08-30

    Graphical abstract: Schematic representation of possible mechanisms determining the Cs extraction and immobilization in fly ash during water, methanol or n-MCaS extraction. - Highlights: • nMCaS suspension for cesium extraction and immobilization in fly ash was developed. • Enhanced cesium immobilization was done by nanometallic Ca/CaO methanol suspension. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • nMCaS unique and a highly potential amendment for the remediation of Cs. - Abstract: In this work, the capability of nanometallic Ca/CaO methanol suspension in removing and/or immobilizing stable ({sup 133}Cs) and radioactive cesium species ({sup 134}Cs and {sup 137}Cs) in contaminated fly ash was investigated. After a first methanol and second water washing yielded only 45% of {sup 133}Cs removal. While, after a first methanol washing, the second solvent with nanometallic Ca/CaO methanol suspension yielded simultaneous enhanced removal and immobilization about 99% of {sup 133}Cs. SEM-EDS analysis revealed that the mass percent of detectable {sup 133}Cs on the fly ash surface recorded a 100% decrease. When real radioactive cesium contaminated fly ash (containing an initial 14,040 Bq kg{sup −1134}Cs and {sup 137}Cs cumulated concentration) obtained from burning wastes from Fukushima were reduced to 3583 Bq kg{sup −1} after treatment with nanometallic Ca/CaO methanol suspension. Elution test conducted on the treated fly ash gave 100 Bq L{sup −1} total {sup 134}Cs and {sup 137}Cs concentrations in eluted solution. Furthermore, both ash content and eluted solution concentrations of {sup 134}Cs and {sup 137}Cs were much lower than the Japanese Ministry of the Environment regulatory limit of 8000 Bq kg{sup −1} and 150 Bq L{sup −1} respectively. The results of this study suggest that the nanometallic Ca/CaO methanol suspension is

  6. Cyclotron production of cesium radionuclides as analogues for francium-221 biodistribution

    Science.gov (United States)

    Finn, R.; McDevitt, M.; Sheh, Y.; Lom, C.; Qiao, J.; Cai, S.; Burnazi, E.; Nacca, A.; Pillarsetty, N.; Jaggi, J.; Scheinberg, D.

    2005-12-01

    In our clinical investigations focussing on improved therapeutic treatment of specific tumors we have concentrated on a targeted therapy approach utilizing designed radiolabeled monoclonal antibodies as the cytotoxic reagent. The physical characteristics of the alpha particle emitting radionuclide bismuth-213 including the short half-life of 45.6 min, has shown promise for the treatment of specific cancers such as leukemias and lymphomas or micrometastatic carcinomas. In an effort to increase the cytocidal effect of the HuM195, a humanized monoclonal antibody carrier to the CD33 antigen expressed on leukemia cells, our focus is directed toward an "internal" nano-generator composed of Ac-225 radionuclide, the parent of the bismuth-213. The actinium-225 radionuclide decays through several short-lived, alpha emitting daughters including francium-221, astatine-217 and bismuth-213. In order to study the biodistribution and the pharmacokinetics of the individual daughter nuclide, francium-221, the cyclotron production and separation of cesium radionuclides, specifically cesium-132, from a natural xenon gas target was undertaken. The choice of cesium as an analogue for francium was predicated upon both elements being in Group 1A alkali metals and cesium radionuclide possesses a sufficient half-life to allow biodistribution studies to be performed. The preliminary experimental results of this investigation are presented.

  7. Perlite for permanent confinement of cesium

    Science.gov (United States)

    Balencie, J.; Burger, D.; Rehspringer, J.-L.; Estournès, C.; Vilminot, S.; Richard-Plouet, M.; Boos, A.

    2006-06-01

    We present the potential use of expanded perlite, a metastable amorphous hydrated aluminium silicate, as a permanent medium for the long-term confinement of cesium. The method requires simply a loading by mixing an aqueous cesium nitrate solution and expanded perlite at 300 K followed by densification by sintering. The formation of pollucite, CsAlSi2O6, a naturally occurring mineral phase, upon careful heat treatment is demonstrated by X-ray diffraction. Leaching tests on the resulting glass-ceramics reveal a very low Cs departure of 0.5 mg m-2 d-1.

  8. Crystalline silicotitanates for cesium/strontium removal

    Energy Technology Data Exchange (ETDEWEB)

    Brown, N.; Miller, J.; Sherman, J.

    1996-10-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST) has been developed that exhibits very high selectivity for cesium and strontium in the highly alkaline radioactive wastes at the Hanford Site and other DOE sites. Tests have also shown that CSTs have high selectivity for cesium in acidic and neutral solutions. The ESP is supporting an effort at Sandia National Laboratories and Texas A & M University to further develop and characterize the important chemical and physical properties that will determine the applicability of CST to radioactive waste treatment at Hanford and other DOE facilities.

  9. Microbial accumulation of uranium, radium, and cesium

    Energy Technology Data Exchange (ETDEWEB)

    Strandberg, G.W.; Shumate, S.E. II; Parrott, J.R. Jr.; North, S.E.

    1981-05-01

    Diverse microbial species varied considerably in their ability to accumulate uranium, cesium, and radium. Mechanistic differences in uranium uptake by Saccharomyces cerevisiae and Pseudomonas aeruginosa were indicated. S. serevisiae exhibited a slow (hours) surface accumulation of uranium which was subject to environmental factors, while P. aeruginosa accumulated uranium rapidly (minutes) as dense intracellular deposits and did not appear to be affected by environmental parameters. Metabolism was not required for uranium uptake by either organism. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several species tested.

  10. Resonance Ionization Spectroscopy of Cesium Atoms in a Cesium Heat Pipe

    Science.gov (United States)

    Ardis, Robert G.; Gardner, Bernard W.; Smith, R. Seth

    1997-11-01

    A Cesium Heat Pipe has been constructed to produce a cesium metal vapor for use in laser spectroscopy. The heat pipe consists of a 24 inch stainless steel pipe with 2 inch diameter calcium fluoride windows on each end. Electric heaters are used to control the cesium vapor pressure. An argon buffer gas is used to maintain high transmittance through the end windows. Sensors are used to monitor both temperature and pressure. A Nd:YAG-pumped dye laser system is used to probe the cesium atoms via resonance ionization spectroscopy. Details of the construction of the heat pipe and the experimental setup will be presented. The results of the resonance ionization spectroscopy will be discussed. This experimental setup can be utilized with undergraduates in courses such as Optics, Laser Physics, and Senior Laboratory/Research.

  11. The biological difference between CD13+CD133+ and CD13¬CD133¬liver cancer cells and its clinical significance

    Directory of Open Access Journals (Sweden)

    Shi-long JIN

    2013-09-01

    Full Text Available Objective To compare the biological difference between CD13+CD133+ and CD13-CD133- hepatocellular carcinoma (HCC cells in HuH7 cell line and its clinical significance. Methods The status of proliferation, phase of the cell cycle, tumor formation in vivo, differentiation, and their chemoresistance to 5-FU and pirarubicin of CD13+CD133+ and CD13-CD133-HCC cells were studied to analyze the clinical implication of CD13+CD133+HCC cell subset. Results The proliferation rate of CD13+CD133+HCC cells was significantly higher than that of CD13-CD133-HCC cells. The cell-cycle phase study showed that 78.45% of the CD13+CD133+HCC cells were in the G0/G1 phase, 2.19% in G2/M phase, and 19.36% in S phase, while 62.18% CD13-CD133-HCC cells were in the G0/G1 phase, 11.88% in G2/M phase, and 25.95% in S phase. Limiting dilution analysis of HuH7 cells revealed that 1×103 CD13+CD133+ cells could form the tumor, while 1×105 CD13-CD133- cells did. CD13+CD133+ cells showed chemoresistance to 5-FU and pirarubicin, while other three subsets succumbed to the drugs. Conclusion CD13+CD133+ cancer cells in HuH7 showed the characteristics of cancer stem cells (CSCs, which might contribute to the relapse and metastasis of liver cancer, and they may be the main target for chemotherapy in human liver cancer.

  12. Cesium vapor thermionic converter anomalies arising from negative ion emission

    Science.gov (United States)

    Rasor, Ned S.

    2016-08-01

    Compelling experimental evidence is given that a longstanding limit encountered on cesium vapor thermionic energy converter performance improvement and other anomalies arise from thermionic emission of cesium negative ions. It is shown that the energy that characterizes thermionic emission of cesium negative ions is 1.38 eV and, understandably, is not the electron affinity 0.47 eV determined for the photodetachment threshold of the cesium negative ion. The experimental evidence includes measurements of collector work functions and volt-ampere characteristics in quasi-vacuum cesium vapor thermionic diodes, along with reinterpretation of the classic Taylor-Langmuir S-curve data on electron emission in cesium vapor. The quantitative effects of negative ion emission on performance in the ignited, unignited, and quasi-vacuum modes of cesium vapor thermionic converter operation are estimated.

  13. Cesium and Strontium Separation Technologies Literature Review

    Energy Technology Data Exchange (ETDEWEB)

    T. A. Todd; T. A. Todd; J. D. Law; R. S. Herbst

    2004-03-01

    Integral to the Advanced Fuel Cycle Initiative (AFCI) Program’s proposed closed nuclear fuel cycle, the fission products cesium and strontium in the dissolved spent nuclear fuel stream are to be separated and managed separately. A comprehensive literature survey is presented to identify cesium and strontium separation technologies that have the highest potential and to focus research and development efforts on these technologies. Removal of these high-heat-emitting fission products reduces the radiation fields in subsequent fuel cycle reprocessing streams and provides a significant short-term (100 yr) heat source reduction in the repository. This, along with separation of actinides, may provide a substantial future improvement in the amount of fuel that could be stored in a geologic repository. The survey and review of the candidate cesium and strontium separation technologies are presented herein. Because the AFCI program intends to manage cesium and strontium together, technologies that simultaneously separate both elements are of the greatest interest, relative to technologies that separate only one of the two elements.

  14. Chemoresistance of CD133(+) colon cancer may be related with increased survivin expression.

    Science.gov (United States)

    Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah; Cho, Mee-Yon

    2015-07-31

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133(+) colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133(-) cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133(+) and siRNA-induced CD133(-) cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133(+) cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133(+) cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133(+) cells at 96 h after siRNA transfection. From this study, we conclude that CD133(+) cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133(+) colon cancer.

  15. Longitudinal Wobbling in $^{133}$La

    CERN Document Server

    Biswas, S; Garg, U; Bhat, G H; Frauendorf, S; Li, W; Sheikh, J A; Sethi, J; Saha, S; Singh, Purnima; Choudhury, D; Matta, J T; Ayangeakaa, A D; Dar, W >; Singh, V; Sihotra, S

    2016-01-01

    Excited states of $^{133}$La have been investigated to search for the wobbling excitation mode in the low-spin regime. Wobbling bands with $n_\\omega$ = 0 and 1 are identified along with the interconnecting $\\Delta I$ = 1, $E2$ transitions, which are regarded as fingerprints of the wobbling motion. An increase in wobbling frequency %of the $n_\\omega$ = 1 band with spin implies longitudinal wobbling for $^{133}$La, in contrast with the case of transverse wobbling observed in $^{135}$Pr. This is the first observation of a longitudinal wobbling band in nuclei. The experimental observations are accounted for by calculations using the quasiparticle triaxial rotor with harmonic frozen approximation and the triaxial projected shell model approaches, which attribute the appearance of longitudinal wobbling to the early alignment of an h$_{11/2}$ neutron pair.

  16. Chemoresistance of CD133{sup +} colon cancer may be related with increased survivin expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Cho, Mee-Yon, E-mail: meeyon@yonsei.ac.kr [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Institute of Genomic Cohort, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of)

    2015-07-31

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133{sup +} colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133{sup −} cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133{sup +} and siRNA-induced CD133{sup −} cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133{sup +} cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133{sup +} cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133{sup +} cells at 96 h after siRNA transfection. From this study, we conclude that CD133{sup +} cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133{sup +} colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133{sup +} cells and siRNA-induced CD133{sup −} cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133{sup +} colon cancer cells.

  17. 29 CFR 1915.133 - Hand tools.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Hand tools. 1915.133 Section 1915.133 Labor Regulations...) OCCUPATIONAL SAFETY AND HEALTH STANDARDS FOR SHIPYARD EMPLOYMENT Tools and Related Equipment § 1915.133 Hand tools. The provisions of this section shall apply to ship repairing, shipbuilding and shipbreaking....

  18. 49 CFR 383.133 - Testing methods.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Testing methods. 383.133 Section 383.133... STANDARDS; REQUIREMENTS AND PENALTIES Tests § 383.133 Testing methods. (a) All tests shall be constructed in... must be at least as stringent as the Federal standards. (c) States shall determine specific methods...

  19. 7 CFR 930.133 - Compensation rate.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Compensation rate. 930.133 Section 930.133 Agriculture... Regulations § 930.133 Compensation rate. A compensation rate of $250 per meeting shall be paid to the public member and to the alternate public member when attending Board meetings. Such compensation is a...

  20. 14 CFR 125.133 - Fuel valves.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Fuel valves. 125.133 Section 125.133....133 Fuel valves. Each fuel valve must— (a) Comply with § 125.155; (b) Have positive stops or suitable... operation or from accelerated flight conditions are not transmitted to the lines connected to the valve....

  1. 42 CFR 1003.133 - Statistical sampling.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Statistical sampling. 1003.133 Section 1003.133... AUTHORITIES CIVIL MONEY PENALTIES, ASSESSMENTS AND EXCLUSIONS § 1003.133 Statistical sampling. (a) In meeting... statistical sampling study as evidence of the number and amount of claims and/or requests for payment...

  2. 22 CFR 133.655 - Individual.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Individual. 133.655 Section 133.655 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.655 Individual. Individual means a natural person....

  3. 22 CFR 133.670 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Suspension. 133.670 Section 133.670 Foreign... ASSISTANCE) Definitions § 133.670 Suspension. Suspension means an action taken by a Federal agency that...-wide Debarment and Suspension (Nonprocurement), that implements Executive Order 12549 and...

  4. 47 CFR 24.133 - Emission limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Emission limits. 24.133 Section 24.133 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PERSONAL COMMUNICATIONS SERVICES Narrowband PCS § 24.133 Emission limits. (a) The power of any emission shall be attenuated...

  5. 22 CFR 133.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employee. 133.640 Section 133.640 Foreign... ASSISTANCE) Definitions § 133.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2)...

  6. Ion microscopy based on laser-cooled cesium atoms.

    Science.gov (United States)

    Viteau, M; Reveillard, M; Kime, L; Rasser, B; Sudraud, P; Bruneau, Y; Khalili, G; Pillet, P; Comparat, D; Guerri, I; Fioretti, A; Ciampini, D; Allegrini, M; Fuso, F

    2016-05-01

    We demonstrate a prototype of a Focused Ion Beam machine based on the ionization of a laser-cooled cesium beam and adapted for imaging and modifying different surfaces in the few-tens nanometer range. Efficient atomic ionization is obtained by laser promoting ground-state atoms into a target excited Rydberg state, then field-ionizing them in an electric field gradient. The method allows obtaining ion currents up to 130pA. Comparison with the standard direct photo-ionization of the atomic beam shows, in our conditions, a 40-times larger ion yield. Preliminary imaging results at ion energies in the 1-5keV range are obtained with a resolution around 40nm, in the present version of the prototype. Our ion beam is expected to be extremely monochromatic, with an energy spread of the order of the eV, offering great prospects for lithography, imaging and surface analysis.

  7. Nano-Cesium for Anti-Cancer Properties: An Investigation into Cesium Induced Metabolic Interference.

    Science.gov (United States)

    Daza, Enrique A; Misra, Santosh K; Schwartz-Duval, Aaron S; Ohoka, Ayako; Miller, Callie; Pan, Dipanjan

    2016-10-03

    The use of cesium chloride (CsCl) for cancer therapy ("high pH therapy") has been theorized to produce anticancer properties by raising intracellular pH to induce apoptosis. Although considered as "alternative medicine", little scientific evidence supports this theory. Alternatively, cells have no cesium ion (Cs(+)) mediated channels for clearance. Thus, such unstable electrochemical distributions have the severe potential to disrupt electrochemical dependent cellular processes, such as glucose cotransporters. Hence, a detailed investigation of pH changing effects and glucose uptake inhibition are warranted as a possible cesium-induced anticancer therapy. We developed and characterized cesium nanoparticles (38 ± 6 nm), termed NanoCs, for nanoparticle-mediated internalization of the ion, and compared its treatment to free CsCl. Our investigations suggest that neither NanoCs nor CsCl drastically changed the intracellular pH, negating the theory. Alternatively, NanoCs lead to a significant decrease in glucose uptake when compared to free CsCl, suggesting cesium inhibited glucose uptake. An apoptosis assay of observed cell death affirms that NanoCs leads tumor cells to initiate apoptosis rather than follow necrotic behavior. Furthermore, NanoCs lead to in vivo tumor regression, where H&E analysis confirmed apoptotic cell populations. Thus, NanoCs performed pH-independent anticancer therapy by inducing metabolic stasis.

  8. Strategic Design and Optimization of Inorganic Sorbents For Cesium, Strontium and Actinides

    Energy Technology Data Exchange (ETDEWEB)

    Hobbs, D.; Nyman, M.; Clearfield, A.; Maginn, E.

    2006-06-01

    The basic science goal in this project identifies structure/affinity relationships for selected radionuclides and existing sorbents. The task will apply this knowledge to the design and synthesis of new sorbents that will exhibit increased affinity for cesium, strontium and actinide separations. The target problem focuses on the treatment of high-level nuclear wastes. The general approach can likewise be applied to nonradioactive separations.

  9. Interspecies Feshbach resonances in an ultracold, optically trapped Bose-Fermi mixture of cesium and lithium

    Energy Technology Data Exchange (ETDEWEB)

    Repp, Marc

    2013-05-08

    This thesis reports on the tunability of interactions in ultracold Bose-Fermi mixtures of Cesium and Lithium. The first realization of an optically trapped {sup 6}Li - {sup 133}Cs mixture enabled to perform trap loss spectroscopy measurements to identify magnetic Feshbach resonances. A total of 19 interspecies Feshbach resonances, all in the magnetic field range between 650 G and 950 G, were observed for the two energetically lowest spin states of each species. Two 5 G broad and especially two 60 G broad s-wave resonances give perspectives to produce a dipolar quantum gas of LiCs ground state molecules as well as to study the Efimov effect in highly mass imbalanced systems. In addition, a unique relative tunability of intra- and interspecies scattering lengths was found which makes the {sup 6}Li - {sup 133}Cs system also well suited for the investigation of polarons. Evaporative cooling was performed on optically trapped samples which contained only one of the species. In this way, Bose-Einstein condensates of {sup 6}Li molecules as well as {sup 133}Cs samples at a phase-space density of ρ = 4 . 10{sup -2} were prepared. All experiments were performed in a new apparatus, which has been designed and set up during this thesis.

  10. CD133+ anaplastic thyroid cancer cells initiate tumors in immunodeficient mice and are regulated by thyrotropin.

    Directory of Open Access Journals (Sweden)

    Susan Friedman

    Full Text Available BACKGROUND: Anaplastic thyroid cancer (ATC is one of the most lethal human malignancies. Its rapid onset and resistance to conventional therapeutics contribute to a mean survival of six months after diagnosis and make the identification of thyroid-cancer-initiating cells increasingly important. METHODOLOGY/PRINCIPAL FINDINGS: In prior studies of ATC cell lines, CD133(+ cells exhibited stem-cell-like features such as high proliferation, self-renewal and colony-forming ability in vitro. Here we show that transplantation of CD133(+ cells, but not CD133(- cells, into immunodeficient NOD/SCID mice is sufficient to induce growth of tumors in vivo. We also describe how the proportion of ATC cells that are CD133(+ increases dramatically over three months of culture, from 7% to more than 80% of the total. This CD133(+ cell pool can be further separated by flow cytometry into two distinct populations: CD133(+/high and CD133(+/low. Although both subsets are capable of long-term tumorigenesis, the rapidly proliferating CD133(+/high cells are by far the most efficient. They also express high levels of the stem cell antigen Oct4 and the receptor for thyroid stimulating hormone, TSHR. Treating ATC cells with TSH causes a three-fold increase in the numbers of CD133(+ cells and elicits a dose-dependent up-regulation of the expression of TSHR and Oct4 in these cells. More importantly, immunohistochemical analysis of tissue specimens from ATC patients indicates that CD133 is highly expressed on tumor cells but not on neighboring normal thyroid cells. CONCLUSIONS/SIGNIFICANCE: To our knowledge, this is the first report indicating that CD133(+ ATC cells are solely responsible for tumor growth in immunodeficient mice. Our data also give a unique insight into the regulation of CD133 by TSH. These highly tumorigenic CD133(+ cells and the activated TSH signaling pathway may be useful targets for future ATC therapies.

  11. Cesium Atomic Fountain Clocks at NMIJ

    Science.gov (United States)

    2010-11-01

    shift in caesium fountain clocks,” Physical Review Letters, 98, 153002. [10] A. Takamizawa, Y. Shirakawa, S. Yanagimachi et al., 2010, “Proposal of a...beam of laser-cooled cesium atoms,” Physical Review, A 60, R4241-R4244. [13] V. Gerginov, N. Nemitz, S. Weyers, et al., 2010, “Uncertainty evaluation of the caesium fountain clock PTB-CSF2,” Metrologia, 47, 65-79.

  12. Lanthanide doped strontium-barium cesium halide scintillators

    Science.gov (United States)

    Bizarri, Gregory; Bourret-Courchesne, Edith; Derenzo, Stephen E.; Borade, Ramesh B.; Gundiah, Gautam; Yan, Zewu; Hanrahan, Stephen M.; Chaudhry, Anurag; Canning, Andrew

    2015-06-09

    The present invention provides for a composition comprising an inorganic scintillator comprising an optionally lanthanide-doped strontium-barium, optionally cesium, halide, useful for detecting nuclear material.

  13. Surface interactions of cesium and boric acid with stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Grossman-Canfield, N.

    1995-08-01

    In this report, the effects of cesium hydroxide and boric acid on oxidized stainless steel surfaces at high temperatures and near one atmosphere of pressure are investigated. This is the first experimental investigation of this chemical system. The experimental investigations were performed using a mass spectrometer and a mass electrobalance. Surfaces from the different experiments were examined using a scanning electron microscope to identify the presence of deposited species, and electron spectroscopy for chemical analysis to identify the species deposited on the surface. A better understanding of the equilibrium thermodynamics, the kinetics of the steam-accelerated volatilizations, and the release kinetics are gained by these experiments. The release rate is characterized by bulk vaporization/gas-phase mass transfer data. The analysis couples vaporization, deposition, and desorption of the compounds formed by cesium hydroxide and boric acid under conditions similar to what is expected during certain nuclear reactor accidents. This study shows that cesium deposits on an oxidized stainless steel surface at temperatures between 1000 and 1200 Kelvin. Cesium also deposits on stainless steel surfaces coated with boric oxide in the same temperature ranges. The mechanism for cesium deposition onto the oxide layer was found to involve the chemical reaction between cesium and chromate. Some revaporization in the cesium hydroxide-boric acid system was observed. It has been found that under the conditions given, boric acid will react with cesium hydroxide to form cesium metaborate. A model is proposed for this chemical reaction.

  14. Polarizabilities and Shielding Factors of Ions in Cesium Halide Crystals with the Cesium Chloride Structure

    Science.gov (United States)

    Mahbubar, Rahman; Michihiro, Yoshitaka; Nakamura, Koichi; Kanashiro, Tatsuo

    2001-08-01

    The calculated results of the polarizabilities and the quadrupole shielding factor of the ions in cesium halide crystals with the cesium chloride structure are presented. The calculation is done on the basis of the self-consistent field local density approximation and the modified Sternheimer equation. The crystalline potential is treated by the spherical solid model. The size effect is seen in the values of the polarizabilities and the quadrupole shielding factor. The values of the polarizabilities and the quadrupole shielding factor of cesium ion show only slight change in different crystals. The values of chlorine ion show significant reduction and the amount of the reduction is different in the different crystals. The effect of the crystalline environment on the electron states is discussed.

  15. Testing Universality of Efimov Physics in an Ultracold Mixture of Lithium and Cesium Atoms

    Science.gov (United States)

    Johansen, Jacob; Desalvo, Brian; Chin, Cheng

    2016-05-01

    We conduct a survey of Li-Cs-Cs Efimov resonances in a 6 Li-133 Cs mixture in the magnetic field range of 800 to 950 G. In this region, limiting our study to the two lowest Zeeman levels of lithium and the lowest Zeeman level of cesium, there are five Feshbach resonances which may be probed. The Cs-Cs scattering length at these resonances varies from -3600 a0 to +1000 a0, allowing us to study the impact of the Cs-Cs scattering length on the Efimov resonance positions. In addition, a combination of broad and narrow Feshbach resonances in this magnetic field range allows us to probe the influence of molecular physics on the Efimov effect, particularly the variation of the three-body parameter.

  16. DEVELOPMENT OF PROTOTYPE TITANATE ION EXCHANGE LOADED MEMBRANES FOR STRONTIUM, CESIUM AND ACTINIDE DECONTAMINATION FROM AQUEOUS MEDIA

    Energy Technology Data Exchange (ETDEWEB)

    Oji, L; Keisha Martin, K; David Hobbs, D

    2008-05-30

    We have successfully incorporated high surface area particles of titanate ion exchange materials (monosodium titanate and crystalline silicotitanate) with acceptable particle size distribution into porous and inert support membrane fibrils consisting of polytetrafluoroethylene (Teflon{reg_sign}), polyethylene and cellulose materials. The resulting membrane sheets, under laboratory conditions, were used to evaluate the removal of surrogate radioactive materials for cesium-137 and strontium-90 from high caustic nuclear waste simulants. These membrane supports met the nominal requirement for nonchemical interaction with the embedded ion exchange materials and were porous enough to allow sufficient liquid flow. Some of this 47-mm size stamped out prototype titanium impregnated ion exchange membrane discs was found to remove more than 96% of dissolved cesium-133 and strontium-88 from a caustic nuclear waste salt simulants. Since in traditional ion exchange based column technology monosodium titanate (MST) is known to have great affinity for the sorbing of other actinides like plutonium, neptunium and even uranium, we expect that the MST-based membranes developed here, although not directly evaluated for uptake of these three actinides because of costs associated with working with actinides which do not have 'true' experimental surrogates, would also show significant affinity for these actinides in aqueous media. It was also observed that crystalline silicotitanate impregnated polytetrafluoroethylene or polyethylene membranes became less selective and sorbed both cesium and strontium from the caustic aqueous salt simulants.

  17. miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages.

    Science.gov (United States)

    Peng, Xiao-Ping; Huang, Lei; Liu, Zhi-Hong

    2016-08-01

    lipid metabolism is the major causes of atherosclerosis. There is increasing evidence that miR-133a plays an important role in atherosclerosis. However, the regulatory mechanism of miR-133a in macrophages is still unclear. Several lines of evidence indicate that loss of TR4 leads to reduce lipid accumulation in liver and adipose tissues, etc, and lesional macrophages-derived TR4 can greatly increase the foam cell formation through increasing the CD36-mediated the uptake of ox-LDL. Interestingly, computational analysis suggests that TR4 may be a target gene of miR-133a. Here, we examined whether miR-133a regulates TR4 expression in ox-LDL-induced mouse RAW 264.7 macrophages, thereby affecting lipid accumulation. Using ox-LDL-treatment RAW 264.7 macrophages transfected with miR-133a mimics or inhibitors, we have showed that miR-133a can directly regulate the expression of TR4 in RAW 264.7 cells, thereby attenuates CD36-medide lipid accumulation. Furthermore, our studies suggest an additional explanation for the regulatory mechanism of miR-133a regulation to its functional target, TR4 in RAW 264.7 macrophages. Thus, our findings suggest that miR-133a may regulate lipid accumulation in ox-LDL-stimulated RAW 264.7 macrophages via TR4-CD36 pathway.

  18. Selective chemical binding enhances cesium tolerance in plants through inhibition of cesium uptake

    DEFF Research Database (Denmark)

    Adams, Eri; Chaban, Vitaly; Khandelia, Himanshu;

    2015-01-01

    High concentrations of cesium (Cs(+)) inhibit plant growth but the detailed mechanisms of Cs(+) uptake, transport and response in plants are not well known. In order to identify small molecules with a capacity to enhance plant tolerance to Cs(+), chemical library screening was performed using Ara...

  19. Cesium-associated hypokalemia successfully treated with amiloride.

    Science.gov (United States)

    Horn, Sarah; Naidus, Elliot; Alper, Seth L; Danziger, John

    2015-06-01

    Self-treatment of cancer with cesium chloride, despite proven lack of efficacy, continues to produce serious adverse effects. Among these is hypokalemia predisposing to life-threatening arrhythmia. The mechanism of cesium-associated hypokalemia (CAH) has not been described. We report urinary potassium wasting responsive to amiloride therapy in a cancer patient with CAH, and discuss possible mechanisms.

  20. Cesium-associated hypokalemia successfully treated with amiloride

    OpenAIRE

    Horn, Sarah; Naidus, Elliot; Alper, Seth L; Danziger, John

    2015-01-01

    Self-treatment of cancer with cesium chloride, despite proven lack of efficacy, continues to produce serious adverse effects. Among these is hypokalemia predisposing to life-threatening arrhythmia. The mechanism of cesium-associated hypokalemia (CAH) has not been described. We report urinary potassium wasting responsive to amiloride therapy in a cancer patient with CAH, and discuss possible mechanisms.

  1. Distillation device supplies cesium vapor at constant pressure

    Science.gov (United States)

    Basiulis, A.; Shefsiek, P. K.

    1968-01-01

    Distillation apparatus in the form of a U tube supplies small amounts of pure cesium vapor at constant pressure to a thermionic converter. The upstream leg of the U tube is connected to a vacuum pump to withdraw noncondensable impurities, the bottom portion serves as a reservoir for the liquid cesium.

  2. Rac1+ cells distributed in accordance with CD 133+ cells in glioblastomas and the elevated invasiveness of CD 133+ glioma cells with higher Rac1 activity

    Institute of Scientific and Technical Information of China (English)

    ZHANG Bin; SUN Jian; YU Sheng-ping; CHEN Cong; LIU Bin; LIU Zhi-feng; REN Bing-cheng; MING Hao-lang; YANG Xue-jun

    2012-01-01

    the basement membrane of the vessels and myelinated nerve fibers.Rac1 expression was high and diffused in the central parts of the GBMs,and the Rac1+ cells were distributed basically in accordance with CD133+ cells both in the central and peripheral parts of GBMs.In double-labeling immunofluorescence,Rac1 was expressed in (83.14±4.23)% of CD133+ cells,and CD133 and Rac1 co-expressed cells were located around the vessels in GBMs.Significantly higher amounts of Rac1-GTP were expressed in the CD133+ cells (0.378+0.007),compared to CD133-cells (0.195±0.004) (t=27.81; P <0.05).CD133+ cells had stronger ability to migrate (74.34±2.40 vs.38.72±2.60,t=42.71,P <0.005) and invade (52.00±2.28 vs.31.26±1.82,t=30.76,P <0.005),compared to their counterpart CD133-cells in transwell cell migration/invasion assay.Conclusions These data suggest that CD133+ GBM cells highly express Rac1 and have greater potential to migrate and invade through activated Rac1-GTP.The accordance of distribution between Rac1+ cells and CD133+ cells in GBMs implies that Rac1 might be an inhibited target to prevent invasion and migration and to avoid malignant glioma recurrence.

  3. Foliar uptake of cesium from the water column by aquatic macrophytes.

    Science.gov (United States)

    Pinder, J E; Hinton, T G; Whicker, F W

    2006-01-01

    The probable occurrence and rate of foliar absorption of stable cesium (133Cs) from the water column by aquatic macrophyte species was analyzed following the addition of 133Cs into a small reservoir near Aiken, South Carolina, USA. An uptake parameter u (10(3)Lkg(-1)d(-1)) and a loss rate parameter k (d(-1)) were estimated for each species using time series of 133Cs concentrations in the water and plant tissues. Foliar uptake, as indicated by rapid increases in plant concentrations following the 133Cs addition, occurred in two floating-leaf species, Brasenia schreberi and Nymphaea odorata, and two submerged species, Myriophyllum spicatum and Utricularia inflata. These species had values of u> or =0.75 x 10(3)Lkg(-1)d(-1). Less evidence for foliar uptake was observed in three emergent species, including Typha latifolia. Ratios of u to k for B. schreberi, M. spicatum, N. odorata and U. inflata can be used to estimate concentration ratios (CR) at equilibrium, and these estimates were generally within a factor of 2 of the CR for 137Cs for these species in the same reservoir. This correspondence suggests that foliar uptake of Cs was the principal absorption mechanism for these species. Assessments of: (1) the prevalence of foliar uptake of potassium, rubidium and Cs isotopes by aquatic macrophytes and (2) the possible importance of foliar uptake of Cs in other lentic systems are made from a review of foliar uptake studies and estimation of comparable u and k values from lake studies involving Cs releases.

  4. Foliar uptake of cesium from the water column by aquatic macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. [Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States); Hinton, T.G. [Savannah River Ecology Laboratory, University of Georgia, Drawer E, Aiken, SC 29801 (United States)]. E-mail: thinton@srel.edu; Whicker, F.W. [Department of Environmental and Radiological Health Sciences, Colorado State University, Fort Collins, CO 80523-1618 (United States)

    2006-07-01

    The probable occurrence and rate of foliar absorption of stable cesium ({sup 133}Cs) from the water column by aquatic macrophyte species was analyzed following the addition of {sup 133}Cs into a small reservoir near Aiken, South Carolina, USA. An uptake parameter u (10{sup 3} L kg{sup -1} d{sup -1}) and a loss rate parameter k (d{sup -1}) were estimated for each species using time series of {sup 133}Cs concentrations in the water and plant tissues. Foliar uptake, as indicated by rapid increases in plant concentrations following the {sup 133}Cs addition, occurred in two floating-leaf species, Brasenia schreberi and Nymphaea odorata, and two submerged species, Myriophyllum spicatum and Utricularia inflata. These species had values of u {>=} 0.75 x 10{sup 3} L kg{sup -1} d{sup -1}. Less evidence for foliar uptake was observed in three emergent species, including Typha latifolia. Ratios of u to k for B. schreberi, M. spicatum, N. odorata and U. inflata can be used to estimate concentration ratios (CR) at equilibrium, and these estimates were generally within a factor of 2 of the CR for {sup 137}Cs for these species in the same reservoir. This correspondence suggests that foliar uptake of Cs was the principal absorption mechanism for these species. Assessments of: (1) the prevalence of foliar uptake of potassium, rubidium and Cs isotopes by aquatic macrophytes and (2) the possible importance of foliar uptake of Cs in other lentic systems are made from a review of foliar uptake studies and estimation of comparable u and k values from lake studies involving Cs releases.

  5. Adsorption of cesium on cement mortar from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Volchek, Konstantin, E-mail: konstantin.volchek@ec.gc.ca [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Miah, Muhammed Yusuf [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Department of Applied Chemistry and Chemical Technology, Noakhali Science and Technology University (Bangladesh); Kuang, Wenxing; DeMaleki, Zack [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Tezel, F. Handan [Department of Chemical and Biological Engineering, University of Ottawa, 161 Louis-Pasteur, Ottawa, Ontario, Canada K1N 6N5 (Canada)

    2011-10-30

    Highlights: {yields} The adsorption of cesium on cement mortar was investigated in a range of temperatures and cesium concentrations. {yields} The pseudo-second order kinetic model produced a good fit with the experimental kinetic data. {yields} Equilibrium test results correlated well with the Freundlich isotherm adsorption model. {yields} The interaction between cesium ions and cement mortar was dominated by chemical adsorption. - Abstract: The adsorption of cesium on cement mortar from aqueous solutions was studied in series of bench-scale tests. The effects of cesium concentration, temperature and contact time on process kinetics and equilibrium were evaluated. Experiments were carried out in a range of initial cesium concentrations from 0.0103 to 10.88 mg L{sup -1} and temperatures from 278 to 313 K using coupons of cement mortar immersed in the solutions. Non-radioactive cesium chloride was used as a surrogate of the radioactive {sup 137}Cs. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectroscopy. Depending on the initial cesium concentration, its equilibrium concentration in solution ranged from 0.0069 to 8.837 mg L{sup -1} while the respective surface concentration on coupons varied from 0.0395 to 22.34 {mu}g cm{sup -2}. Equilibrium test results correlated well with the Freundlich isotherm model for the entire test duration. Test results revealed that an increase in temperature resulted in an increase in adsorption rate and a decrease in equilibrium cesium surface concentration. Among several kinetic models considered, the pseudo-second order reaction model was found to be the best to describe the kinetic test results in the studied range of concentrations. The adsorption activation energy determined from Arrhenius equation was found to be approximately 55.9 kJ mol{sup -1} suggesting that chemisorption was the prevalent mechanism of interaction between cesium ions and cement mortar.

  6. [Surveillance of radioactive cesium in foods].

    Science.gov (United States)

    Nabeshi, Hiromi; Tsutsumi, Tomoaki; Ikarashi, Atsuko; Hachisuka, Akiko; Matsuda, Rieko

    2013-01-01

    We surveyed foods on the market from areas that had been exposed to radioactive materials contamination following the Fukushima accident. We used a NaI (Tl) scintillation spectrometer for the screening tests and a germanium semiconductor detector for the final tests. Test results from 1,427 samples showed that 6 samples (0.4%) exceeded the regulatory limit of 500 Bq/kg. Considering the detection rate of radioactive cesium in each food category, we suggest that it is necessary to continue monitoring fruits such as chestnuts and ginkgo nuts, mushrooms (especially raw wood-shiitake), mountain vegetables, and sea fish.

  7. Dicty_cDB: SLA133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA133 (Link to dictyBase) - - - Contig-U16455-1 SLA133Z (Link... to Original site) - - SLA133Z 728 - - - - Show SLA133 Library SL (Link to library) Clone ID SLA133 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-B/SLA133Q.Seq.d/ Representative seq. ID SLA13...3Z (Link to Original site) Representative DNA sequence >SLA133 (SLA133Q) /CSM/SL/SLA1-B/SLA133Q.Seq.d/ XXXXX...AAATAATATTTCTTAATAAATAGC ATTTTATAATAATTTTAA sequence update 1998. 4.11 Translated Amino Acid sequence ---rph

  8. Expression of CD133 in acute leukemia.

    Science.gov (United States)

    Tolba, Fetnat M; Foda, Mona E; Kamal, Howyda M; Elshabrawy, Deena A

    2013-06-01

    There have been conflicting results regarding a correlation between CD133 expression and disease outcome. To assess CD133 expression in patients with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) and to evaluate its correlation with the different clinical and laboratory data as well as its relation to disease outcome, the present study included 60 newly diagnosed acute leukemic patients; 30 ALL patients with a male to female ratio of 1.5:1 and their ages ranged from 9 months to 48 years, and 30 AML patients with a male to female ratio of 1:1 and their ages ranged from 17 to 66 years. Flow cytometric assessment of CD133 expression was performed on blast cells. In ALL, no correlations were elicited between CD133 expression and some monoclonal antibodies, but in AML group, there was a significant positive correlation between CD133 and HLA-DR, CD3, CD7 and TDT, CD13 and CD34. In ALL group, patients with negative CD133 expression achieved complete remission more than patients with positive CD133 expression. In AML group, there was no statistically significant association found between positive CD133 expression and treatment outcome. The Kaplan-Meier curve illustrated a high significant negative correlation between CD133 expression and the overall survival of the AML patients. CD133 expression is an independent prognostic factor in acute leukemia, especially ALL patients and its expression could characterize a group of acute leukemic patients with higher resistance to standard chemotherapy and relapse. CD133 expression was highly associated with poor prognosis in acute leukemic patients.

  9. CXCL3 contributes to CD133+ CSCs maintenance and forms a positive feedback regulation loop with CD133 in HCC via Erk1/2 phosphorylation

    Science.gov (United States)

    Zhang, Lin; Zhang, Lixing; Li, Hong; Ge, Chao; Zhao, Fangyu; Tian, Hua; Chen, Taoyang; Jiang, Guoping; Xie, Haiyang; Cui, Ying; Yao, Ming; Li, Jinjun

    2016-01-01

    Although the chemotactic cytokine CXCL3 is thought to play an important role in tumor initiation and invasion, little is known about its function in hepatocellular carcinoma (HCC). In our previous study, we found that Ikaros inhibited CD133 expression via the MAPK pathway in HCC. Here, we showed that Ikaros may indirectly down-regulate CXCL3 expression in HCC cells, which leads to better outcomes in patients with CD133+ cancer stem cell (CSC) populations. CD133 overexpression induced CXCL3 expression, and silencing of CD133 down-regulated CXCL3 in HCC cells. Knockdown of CXCL3 inhibited CD133+ HCC CSCs’ self-renewal and tumorigenesis. The serum CXCL3 level was higher in HCC patients’ samples than that in healthy individual. HCC patients with higher CXCL3 expression displayed a poor prognosis, and a high level of CXCL3 was significantly associated with vascular invasion and tumor capsule formation. Exogenous CXCL3 induced Erk1/2 and ETS1 phosphorylation and promoted CD133 expression, indicating a positive feedback loop between CXCL3 and CD133 gene expression in HCC cells via Erk1/2 activation. Together, our findings indicated that CXCL3 might be a potent therapeutic target for HCC. PMID:27255419

  10. 22 CFR 133.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 133.650 Section 133.650 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  11. 27 CFR 21.133 - Vinegar.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Vinegar. 21.133 Section 21... TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.133 Vinegar. (a) Vinegar, 90-grain: Acidity (as acetic acid). 9.0 percent by weight, minimum. (b) Vinegar,...

  12. 40 CFR 133.102 - Secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Secondary treatment. 133.102 Section... TREATMENT REGULATION § 133.102 Secondary treatment. The following paragraphs describe the minimum level of effluent quality attainable by secondary treatment in terms of the parameters—BOD5, SS and pH....

  13. 37 CFR 1.133 - Interviews.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Interviews. 1.133 Section 1... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Interviews § 1.133 Interviews. (a)(1) Interviews with examiners concerning applications and other matters pending before...

  14. miR-133a Enhances the Protective Capacity of Cardiac Progenitors Cells after Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Alberto Izarra

    2014-12-01

    Full Text Available miR-133a and miR-1 are known as muscle-specific microRNAs that are involved in cardiac development and pathophysiology. We have shown that both miR-1 and miR-133a are early and progressively upregulated during in vitro cardiac differentiation of adult cardiac progenitor cells (CPCs, but only miR-133a expression was enhanced under in vitro oxidative stress. miR-1 was demonstrated to favor differentiation of CPCs, whereas miR-133a overexpression protected CPCs against cell death, targeting, among others, the proapoptotic genes Bim and Bmf. miR-133a-CPCs clearly improved cardiac function in a rat myocardial infarction model by reducing fibrosis and hypertrophy and increasing vascularization and cardiomyocyte proliferation. The beneficial effects of miR-133a-CPCs seem to correlate with the upregulated expression of several relevant paracrine factors and the plausible cooperative secretion of miR-133a via exosomal transport. Finally, an in vitro heart muscle model confirmed the antiapoptotic effects of miR-133a-CPCs, favoring the structuration and contractile functionality of the artificial tissue.

  15. 3-Bromopyruvate inhibits cell proliferation and induces apoptosis in CD133+ population in human glioma.

    Science.gov (United States)

    Xu, Dong-Qiang; Tan, Xiao-Yu; Zhang, Bao-Wei; Wu, Tao; Liu, Ping; Sun, Shao-Jun; Cao, Yin-Guang

    2016-03-01

    The study was aimed to investigate the role of 3-bromopyruvate in inhibition of CD133+ U87 human glioma cell population growth. The results demonstrated that 3-bromopyruvate inhibited the viability of both CD133+ and parental cells derived from U87 human glioma cell line. However, the 3-bromopyruvate-induced inhibition in viability was more prominent in CD133+ cells at 10 μM concentration after 48 h. Treatment of CD133+ cells with 3-bromopyruvate caused reduction in cell population and cell size, membrane bubbling, and degradation of cell membranes. Hoechst 33258 staining showed condensation of chromatin material and fragmentation of DNA in treated CD133+ cells after 48 h. 3-Bromopyruvate inhibited the migration rate of CD133+ cells significantly compared to the parental cells. Flow cytometry revealed that exposure of CD133+ cells to 3-bromopyruvate increased the cell population in S phase from 24.5 to 37.9 % with increase in time from 12 to 48 h. In addition, 3-bromopyruvate significantly enhanced the expression of Bax and cleaved caspase 3 in CD133+ cells compared to the parental cells. Therefore, 3-bromopyruvate is a potent chemotherapeutic agent for the treatment of glioma by targeting stem cells selectively.

  16. Adsorption of cesium on cement mortar from aqueous solutions.

    Science.gov (United States)

    Volchek, Konstantin; Miah, Muhammed Yusuf; Kuang, Wenxing; DeMaleki, Zack; Tezel, F Handan

    2011-10-30

    The adsorption of cesium on cement mortar from aqueous solutions was studied in series of bench-scale tests. The effects of cesium concentration, temperature and contact time on process kinetics and equilibrium were evaluated. Experiments were carried out in a range of initial cesium concentrations from 0.0103 to 10.88 mg L(-1) and temperatures from 278 to 313 K using coupons of cement mortar immersed in the solutions. Non-radioactive cesium chloride was used as a surrogate of the radioactive (137)Cs. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectroscopy. Depending on the initial cesium concentration, its equilibrium concentration in solution ranged from 0.0069 to 8.837 mg L(-1) while the respective surface concentration on coupons varied from 0.0395 to 22.34 μg cm(-2). Equilibrium test results correlated well with the Freundlich isotherm model for the entire test duration. Test results revealed that an increase in temperature resulted in an increase in adsorption rate and a decrease in equilibrium cesium surface concentration. Among several kinetic models considered, the pseudo-second order reaction model was found to be the best to describe the kinetic test results in the studied range of concentrations. The adsorption activation energy determined from Arrhenius equation was found to be approximately 55.9 kJ mol(-1) suggesting that chemisorption was the prevalent mechanism of interaction between cesium ions and cement mortar.

  17. Seaweed against strontium and preussian blue against cesium

    Directory of Open Access Journals (Sweden)

    G Michanek

    1988-06-01

    Full Text Available The fact that alginates bind strontium and cyanates bind cesium and are capable of removing these elements from living organisms is scientifically verified. Zeolites offer another possibility for exchange of these ions. Practical research should be initiated to find the right doses and procedure to decrease the body burden of radioactive isotopes in reindeer.Alger mot strontium och berlinerblått mot cesium.Abstract in Swedish / Sammanfattning: Mitt budskap år kort: Alger binder strontium, Berlinerblått binder cesium, Sätt fart på forskning och forsök!

  18. Immobilization of cesium in alkaline activated fly ash matrix

    Science.gov (United States)

    Fernandez-Jimenez, A.; Macphee, D. E.; Lachowski, E. E.; Palomo, A.

    2005-11-01

    The immobilization potential of alkaline activated fly ash (AAFA) matrices for cesium has been investigated. The presence of Cs in the AAFA pastes, prepared using 8M NaOH solution as activator, showed no significant adverse effects on mechanical strength or microstructure, nor were significant quantities of Cs leached following application of the Toxic Characteristic Leaching Procedure (TCLP) and American Nuclear Society (ANS) 16.1 leaching protocols. Microstructural analysis shows Cs associated with the main reaction product in the AAFA suggesting that cesium is chemically bound rather than physically encapsulated. It is proposed that cesium is incorporated into the alkaline aluminosilicate gel, a precursor for zeolite formation.

  19. Single-Particle States in $^{133}$Sn

    CERN Multimedia

    Huck, A

    2002-01-01

    % IS338 \\\\ \\\\ It is suggested to investigate the $\\beta^- $-decay of $^{133}$In and $^{134}$In in order to determine the single-particle states in $^{133}$Sn, which are so far unknown and needed for the shell-model description of the region close to $^{132}$Sn. Large hyper-pure Ge-detectors will be used for the $\\gamma$-ray spectroscopy. In the experiments with $^{134}$In, delayed neutrons in coincidence with $\\gamma$-rays from excited states in $^{133}$Sn provide the opportunity for a very selective detection of the states in question.

  20. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma

    Directory of Open Access Journals (Sweden)

    Lu Lizhi

    2006-12-01

    Full Text Available Abstract Background Recently, a small population of cancer stem cells in adult and pediatric brain tumors has been identified. Some evidence has suggested that CD133 is a marker for a subset of leukemia and glioblastoma cancer stem cells. Especially, CD133 positive cells isolated from human glioblastoma may initiate tumors and represent novel targets for therapeutics. The gene expression and the drug resistance property of CD133 positive cancer stem cells, however, are still unknown. Results In this study, by FACS analysis we determined the percentage of CD133 positive cells in three primary cultured cell lines established from glioblastoma patients 10.2%, 69.7% and 27.5%, respectively. We also determined the average mRNA levels of markers associated with neural precursors. For example, CD90, CD44, CXCR4, Nestin, Msi1 and MELK mRNA on CD133 positive cells increased to 15.6, 5.7, 337.8, 21.4, 84 and 1351 times, respectively, compared to autologous CD133 negative cells derived from cell line No. 66. Additionally, CD133 positive cells express higher levels of BCRP1 and MGMT mRNA, as well as higher mRNA levels of genes that inhibit apoptosis. Furthermore, CD133 positive cells were significantly resistant to chemotherapeutic agents including temozolomide, carboplatin, paclitaxel (Taxol and etoposide (VP16 compared to autologous CD133 negative cells. Finally, CD133 expression was significantly higher in recurrent GBM tissue obtained from five patients as compared to their respective newly diagnosed tumors. Conclusion Our study for the first time provided evidence that CD133 positive cancer stem cells display strong capability on tumor's resistance to chemotherapy. This resistance is probably contributed by the CD133 positive cell with higher expression of on BCRP1 and MGMT, as well as the anti-apoptosis protein and inhibitors of apoptosis protein families. Future treatment should target this small population of CD133 positive cancer stem cells in

  1. Atmospheric transmission for cesium DPAL using TDLAS

    Science.gov (United States)

    Rice, Christopher A.; Perram, Glen P.

    2012-03-01

    The cesium (Cs) Diode Pumped Alkali Laser (DPAL) operates near 894 nm, in the vicinity of atmospheric water vapor absorption lines. An open-path Tunable Diode Laser Absorption (TDLAS) system composed of narrow band (~300 kHz) diode laser fiber coupled to a 12" Ritchey-Chrétien transmit telescope has been used to study the atmospheric transmission characteristics of Cs DPALs over extended paths. The ruggedized system has been field deployed and tested for propagation distances of greater than 1 km. By scanning the diode laser across many free spectral ranges, many rotational absorption features are observed. Absolute laser frequency is monitored with a High Finesse wavemeter to an accuracy of less than 10 MHz. Phase sensitive detection is employed with an absorbance of less than 1% observable under field conditions.

  2. Low-work-function surfaces produced by cesium carbonate decomposition

    Science.gov (United States)

    Briere, T. R.; Sommer, A. H.

    1977-01-01

    Cesium carbonate (Cs2CO3) was heated to the decomposition temperature of approximately 600 C. The nonvolatile decomposition products were condensed on a nickel substrate while the carbon dioxide was removed by pumping. The deposited material is characterized by an effective work function of between 1.05 and 1.15 eV at 450 K and by photoemission in the visible and near-infrared region of the spectrum. It is suggested that the deposited material consists of Cs2O, possibly Cs2O2, and adsorbed cesium. Silver, evaporated from a heated silver bead, produced the typical photoemissive and thermionic properties of a silver-oxygen-cesium (S-1) photocathode. The material may be of interest for thermionic energy converters and for the formation of silver-oxygen-cesium photocathodes.

  3. Dicty_cDB: CHS133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS133 (Link to dictyBase) - - - - CHS133P (Link to Original site) CHS133F 704 CHS1...33Z 773 CHS133P 1457 - - Show CHS133 Library CH (Link to library) Clone ID CHS133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHS1...-B/CHS133Q.Seq.d/ Representative seq. ID CHS133P (Link to... Original site) Representative DNA sequence >CHS133 (CHS133Q) /CSM/CH/CHS1-B/CHS133Q.Seq.d/ ATTTTTAAATATATAT

  4. Dicty_cDB: VHL133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHL133 (Link to dictyBase) - - - Contig-U15754-1 VHL133P (Link to Original site) VHL1...33F 582 VHL133Z 662 VHL133P 1224 - - Show VHL133 Library VH (Link to library) Clone ID VHL1...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHL1-B/VHL133Q.Seq.d/ Representative seq. ID VHL1...33P (Link to Original site) Representative DNA sequence >VHL133 (VHL133Q) /CSM/VH/VHL1-B/VHL1...E Sequences producing significant alignments: (bits) Value VHL133 (VHL133Q) /CSM/VH/VHL1-B/VHL1

  5. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM133Q.Seq.d/ Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  6. Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133+ liver cancer stem cells and increases their cisplatin chemosensitivity%RNA干扰抑制CD133表达对CD133+肝癌干细胞增殖和化疗敏感性的影响

    Institute of Scientific and Technical Information of China (English)

    兰曦; 王勇; 曹姝; 邹冬玲; 李芳; 李少林

    2012-01-01

    Objective To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133+ cancer stem cells (CSCs) sorted from HepG2 cell line. Methods CD133+ and CD133-cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133+ cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short haipin RNA (shRNA) targeting CD133 were transfected into CD133+ cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133+ cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following ciplatin exposure were detected using CCK-8 assay and flow cytometry. Results The sorted CD133+ cells showed a high purity of (88.74±3.19)%, as compared with the purity of (3.36±1.80)% before cell sorting. CD133+ cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133+ cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Conclusions Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133+ liver cancer stem cells and increases their chemosensitivity to cisplatin.%目的 利用慢病毒介导的RNA干扰技术下调CD133+ HepG2肝癌干细胞中CD133的表达,探讨其对肝癌干细胞增殖及化疗敏感性的影响.方法 利用流式分选技术筛选CD133+ HepG2细胞并检测分选前后CD133表达量,体外成球及体内成瘤实验鉴定

  7. 14 CFR 1264.133 - Evidence.

    Science.gov (United States)

    2010-01-01

    ... PENALTIES ACT OF 1986 § 1264.133 Evidence. (a) The presiding officer shall determine the admissibility of... outweighed by the danger of unfair prejudice, confusion of the issues, or by considerations of undue delay...

  8. 40 CFR 141.133 - Compliance requirements.

    Science.gov (United States)

    2010-07-01

    ... Section 141.133 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Disinfectant Residuals, Disinfection Byproducts, and... samples exceeds the MCL, the system must increase monitoring to once per quarter per treatment plant...

  9. 12 CFR 13.3 - Business conduct.

    Science.gov (United States)

    2010-01-01

    ... Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY GOVERNMENT SECURITIES SALES PRACTICES § 13.3 Business conduct. A bank that is a government securities broker or dealer shall observe high... government securities broker or dealer....

  10. 49 CFR 37.133 - Subscription service.

    Science.gov (United States)

    2010-10-01

    ... DISABILITIES (ADA) Paratransit as a Complement to Fixed Route Service § 37.133 Subscription service. (a) This... paratransit system, subject to the limitations in this section. (b) Subscription service may not absorb...

  11. REL 133 UOP Course Tutorial/TutorialRank

    OpenAIRE

    jhon

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 6 Times, Rating: A+   REL 133 Week 1 Individual Assignment Elements of Religious Traditions Paper (UOP Course) REL 133 Week 1 DQ 1 (UOP Course) REL 133 Week 1 DQ 2 (UOP Course) REL 133 Week 1 DQ 3 (UOP Course) REL 133 Week 1 DQ 4 (UOP Course) REL 133 Week 2 Individual Assignment Four Yogic Paths and Jainism Worksheet (UOP Course) REL 133 Week 2 DQ 1 (UOP Course) REL 133 W...

  12. Dicty_cDB: CHR133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR133 (Link to dictyBase) - - - Contig-U11110-1 | Contig-U13144-1 CHR...133P (Link to Original site) CHR133F 616 CHR133Z 142 CHR133P 738 - - Show CHR133 Library CH (Link to library) Clone ID CHR...10-1 | Contig-U13144-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR...133Q.Seq.d/ Representative seq. ID CHR133P (Link to Original site) Representative DNA sequence >CHR133 (CHR...133Q) /CSM/CH/CHR1-B/CHR133Q.Seq.d/ TTTGTACCAGCATTCAAGGTAATTCCTTATTGGGGTACACAACAACAACGTACTACCATT

  13. Overactivation of Ras signaling pathway in CD133+ MPNST cells.

    Science.gov (United States)

    Borrego-Diaz, Emma; Terai, Kaoru; Lialyte, Kristina; Wise, Amanda L; Esfandyari, Tuba; Behbod, Fariba; Mautner, Victor F; Spyra, Melanie; Taylor, Sarah; Parada, Luis F; Upadhyaya, Meena; Farassati, Faris

    2012-07-01

    Cancer stem cells (CSCs) are believed to be the regenerative pool of cells responsible for repopulating tumors. Gaining knowledge about the signaling characteristics of CSCs is important for understanding the biology of tumors and developing novel anti-cancer therapies. We have identified a subpopulation of cells positive for CD133 (a CSC marker) from human primary malignant peripheral nerve sheath tumor (MPNST) cells which were absent in non-malignant Schwann cells. CD133 was also found to be expressed in human tissue samples and mouse MPNST cells. CD133+ cells were capable of forming spheres in non-adherent/serum-free conditions. The activation levels of Ras and its downstream effectors such as ERK, JNK, PI3K, p38K, and RalA were significantly increased in this population. Moreover, the CD133+ cells showed enhanced invasiveness which was linked to the increased expression of β-Catenin and Snail, two important proteins involved in the epithelial to mesenchymal transition, and Paxilin, a focal adhesion protein. Among other important characteristics of the CD133+ population, endoplasmic reticulum stress marker IRE1α was decreased, implying the potential sensitivity of CD133+ to the accumulation of unfolded proteins. Apoptotic indicators seemed to be unchanged in CD133+ cells when compared to the wild (unsorted) cells. Finally, in order to test the possibility of targeting CD133+ MPNST cells with Ras pathway pharmacological inhibitors, we exposed these cells to an ERK inhibitor. The wild population was more sensitive to inhibition of proliferation by this inhibitor as compared with the CD133+ cells supporting previous studies observing enhanced chemoresistance of these cells.

  14. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juntao; Mao, Zhangfan; Huang, Jie; Xie, Songping; Liu, Tianshu; Mao, Zhifu, E-mail: 48151660@qq.com

    2014-02-21

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G{sub 2}/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were

  15. Cesium-induced QT-interval prolongation in an adolescent.

    Science.gov (United States)

    O'Brien, Catherine E; Harik, Nada; James, Laura P; Seib, Paul M; Stowe, Cindy D

    2008-08-01

    Alternative medicine is becoming increasingly popular, especially with terminally ill patients. Most alternative remedies have not been adequately studied or proven effective for the diseases for which they are promoted. In the worst cases, these therapies are harmful. We describe a 16-year-old girl with metastatic hepatocellular carcinoma who experienced cesium-induced QT-interval prolongation after the start of a cesium chloride-based alternative treatment regimen. She had received seven courses of chemotherapy, with a cumulative doxorubicin dose of 500 mg/m(2) over 5 months, resulting in minimal tumor regression. Against the advice of her oncologist, she abandoned traditional therapy and started an alternative regimen that included cesium chloride supplements. Two weeks later, the patient went to a local emergency department after experiencing two brief syncopal episodes. An electrocardiogram revealed occasional premature ventricular contractions, a QTc interval of 683 msec (normal range for females 450-460 msec), and R on T phenomenon. She was admitted to the hospital and later experienced monomorphic ventricular tachycardia, which resolved spontaneously. Lidocaine therapy was started, and the patient was transferred to a cardiac intensive care unit at our hospital. Her plasma cesium level was 2400 microg/dl (normal cesium level was 1800 microg/dl, and her QTc interval was 494 msec. According to the Naranjo adverse drug reaction probability scale, cesium was the probable cause of the patient's arrhythmia. In animal models, cesium chloride has induced cardiac arrhythmias, including torsade de pointes. It inhibits delayed rectifier potassium channels in the myocardium, causing delayed repolarization and QT-interval prolongation. Patients with cancer should be aware that alternative remedies may be harmful and ineffective. Because patients may be unlikely to self-report alternative remedies, health care providers should specifically ask their patients about any

  16. CD133 and membrane microdomains: Old facets for future hypotheses

    Institute of Scientific and Technical Information of China (English)

    Christine A Fargeas; Jana Karbanová; József Jászai; Denis Corbeil

    2011-01-01

    Understanding all facets of membrane microdomains in normal and cancerous cells within the digestive tract is highly important, not only from a clinical point of view, but also in terms of our basic knowledge of cellular transformation. By studying the normal and cancer stem cell-associated molecule CD133 (prominin-1), novel aspects of the organization and dynamics of polarized epithelial cells have been revealed during the last decade. Its association with particular membrane microdomains is highly relevant in these contexts and might also offer new avenues in diagnosis and/or targeting of cancer stem cells.

  17. CD133/Src axis mediates tumor initiating property and epithelial-mesenchymal transition of head and neck cancer.

    Directory of Open Access Journals (Sweden)

    Yu-Syuan Chen

    Full Text Available BACKGROUND: Head and Neck squamous cell carcinoma (HNSCC is a human lethal cancer with clinical, pathological, phenotypical and biological heterogeneity. Caner initiating cells (CICs, which are responsible for tumor growth and coupled with gain of epithelial-mesenchymal transition (EMT, have been identified. Previously, we enriched a subpopulation of head and neck cancer initiating cells (HN-CICs with up-regulation of CD133 and enhancement of EMT. Others demonstrate that Src kinase interacts with and phosphorylates the cytoplasmic domain of CD133. However, the physiological function of CD133/Src signaling in HNSCCs has not been uncovered. METHODOLOGY/PRINCIPAL FINDING: Herein, we determined the critical role of CD133/Src axis modulating stemness, EMT and tumorigenicity of HNSCC and HN-CICs. Initially, down-regulation of CD133 significantly reduced the self-renewal ability and expression of stemness genes, and promoted the differentiation and apoptotic capability of HN-CICs. Additionally, knockdown of CD133 in HN-CICs also lessened both in vitro malignant properties including cell migration/cell invasiveness/anchorage independent growth, and in vivo tumor growth by nude mice xenotransplantation assay. In opposite, overexpression of CD133 enhanced the stemness properties and tumorigenic ability of HNSCCs. Lastly, up-regulation of CD133 increased phosphorylation of Src coupled with EMT transformation in HNSCCs, on the contrary, silence of CD133 or treatment of Src inhibitor inversely abrogated above phenotypic effects, which were induced by CD133 up-regulation in HNSCCs or HN-CICs. CONCLUSION/SIGNIFICANCE: Our results suggested that CD133/Src signaling is a regulatory switch to gain of EMT and of stemness properties in HNSCC. Finally, CD133/Src axis might be a potential therapeutic target for HNSCC by eliminating HN-CICs.

  18. Cesium toxicity: a case of self-treatment by alternate therapy gone awry.

    Science.gov (United States)

    Lyon, Andrew W; Mayhew, William J

    2003-02-01

    Cesium salts have been used in animal models to induce cardiac arrhythmias for several decades, but the sequelae of human cesium toxicity have seldom been described. The authors describe a case of cesium toxicity manifested by syncope, polymorphic ventricular tachycardia, hypokalemia, and a QT interval prolonged to 650 milliseconds that resolved over 4 days following withdrawal of cesium. The patient had a 2-year history of colon cancer and had self-treated with cesium chloride, 3 g/d, for several weeks, using cesium as a form of alternate therapy for cancer. The authors describe the pathophysiologic correlates and risks of cesium consumption and conclude that cesium toxicity should be considered among the differential diagnoses of prolonged QT interval.

  19. A novel role for methyl cysteinate, a cysteine derivative, in cesium accumulation in Arabidopsis thaliana

    Science.gov (United States)

    Adams, Eri; Miyazaki, Takae; Hayaishi-Satoh, Aya; Han, Minwoo; Kusano, Miyako; Khandelia, Himanshu; Saito, Kazuki; Shin, Ryoung

    2017-01-01

    Phytoaccumulation is a technique to extract metals from soil utilising ability of plants. Cesium is a valuable metal while radioactive isotopes of cesium can be hazardous. In order to establish a more efficient phytoaccumulation system, small molecules which promote plants to accumulate cesium were investigated. Through chemical library screening, 14 chemicals were isolated as ‘cesium accumulators’ in Arabidopsis thaliana. Of those, methyl cysteinate, a derivative of cysteine, was found to function within the plant to accumulate externally supplemented cesium. Moreover, metabolite profiling demonstrated that cesium treatment increased cysteine levels in Arabidopsis. The cesium accumulation effect was not observed for other cysteine derivatives or amino acids on the cysteine metabolic pathway tested. Our results suggest that methyl cysteinate, potentially metabolised from cysteine, binds with cesium on the surface of the roots or inside plant cells and improve phytoaccumulation. PMID:28230101

  20. Regulation of CD133 by HDAC6 Promotes β-Catenin Signaling to Suppress Cancer Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Anthony B. Mak

    2012-10-01

    Full Text Available The pentaspan membrane glycoprotein CD133 marks lineage-specific cancer progenitor cells and is associated with poor prognosis in a number of tumor types. Despite its utility as a cancer progenitor cell marker, CD133 protein regulation and molecular function remain poorly understood. We find that the deacetylase HDAC6 physically associates with CD133 to negatively regulate CD133 trafficking down the endosomal-lysosomal pathway for degradation. We further demonstrate that CD133, HDAC6, and the central molecule of the canonical Wnt signaling pathway, β-catenin, can physically associate as a ternary complex. This association stabilizes β-catenin via HDAC6 deacetylase activity, which leads to activation of β-catenin signaling targets. Downregulation of either CD133 or HDAC6 results in increased β-catenin acetylation and degradation, which correlates with decreased proliferation in vitro and tumor xenograft growth in vivo. Given that CD133 marks progenitor cells in a wide range of cancers, targeting CD133 may be a means to treat multiple cancer types.

  1. Pm-miR-133 hosting in one potential lncRNA regulates RhoA expression in pearl oyster Pinctada martensii.

    Science.gov (United States)

    Zheng, Zhe; Huang, RongLian; Tian, RongRong; Jiao, Yu; Du, Xiaodong

    2016-10-15

    Long non-coding RNAs (LncRNAs) are abundant in the genome of higher forms of eukaryotes and implicated in regulating the diversity of biological processes partly because they host microRNAs (miRNAs), which are repressors of target gene expression. In vertebrates, miR-133 regulates the differentiation and proliferation of cardiac and skeletal muscles. Pinctada martensii miR-133 (pm-miR-133) was identified in our previous research through Solexa deep sequencing. In the present study, the precise sequence of mature pm-miR-133 was validated through miR-RACE. Stem loop qRT-PCR analysis demonstrated that mature pm-miR-133 was constitutively expressed in the adductor muscle, gonad, hepatopancreas, mantle, foot, and gill of P. martensii. Among these tissues, the adductor muscle exhibited the highest pm-miR-133 expression. Target analysis indicated that pm-RhoA was the potential regulatory target of pm-miR-133. Bioinformatics analyses revealed that a potential LncRNA (designated as Lnc133) with a mature pm-miR-133 could generate a hairpin structure that was highly homologous to that of Lottia gigantea. Lnc133 was also highly expressed in the adductor muscle, gill, hepatopancreas, and gonad. Phylogenetic analysis further showed that the miR-133s derived from chordate and achordate were separated into two classes. Therefore, Lnc133 hosting pm-miR-133 could be involved in regulating the cell proliferation of adductor muscles by targeting pm-RhoA.

  2. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO{sub 4}] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Mallampati, Srinivasa Reddy, E-mail: srireddys@ulsan.ac.kr [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of); Mitoma, Yoshiharu, E-mail: mitomay@pu-hiroshima.ac.jp [Department of Environmental Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka-Cho Shobara City, Hiroshima 727-0023 (Japan); Okuda, Tetsuji [Environmental Research and Management Center, Hiroshima University, 1-5-3 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8513 (Japan); Simion, Cristian [Politehnica University of Bucharest, Department of Organic Chemistry, Bucharest 060042 (Romania); Lee, Byeong Kyu [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of)

    2015-10-30

    Graphical abstract: A possible pathway for immobilization with the nano-Fe/Ca/CaO/[PO{sub 4}] treatment (a) {sup 133}Cs is adsorbed onto the soil particles, (b) Cs encapsulation through the formation of immobile salts, and (c) solid (small/finer or larger/aggregate) soil fraction separation. - Highlights: • Nano-Fe/Ca/CaO/[PO{sub 4}] composite for Cs immobilization in soil was developed. • Enhanced cesium separation and immobilization was done in dry condition. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • Nano-Fe/Ca/CaO/[PO{sub 4}] a highly potential amendment for the remediation of Cs. - Abstract: This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable ({sup 133}Cs) and radioactive cesium species ({sup 134}Cs and {sup 137}Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO{sub 4}], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant {sup 133}Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO{sub 4}], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped {sup 134}Cs and {sup 137}Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that {sup 134}Cs and {sup 137}Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO{sub 4}] treated soil were characterized using SEM–EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil

  3. Applications of cesium in the perovskite solar cells

    Science.gov (United States)

    Ye, Fengjun; Yang, Wenqiang; Luo, Deying; Zhu, Rui; Gong, Qihuang

    2017-01-01

    Perovskite solar cells have experienced an unprecedented rapid development in the power conversion efficiency (PCE) during the past 7 years, and the record PCE has been already comparable to the traditional polycrystalline silicon solar cells. Presently, it is more urgent to address the challenge on device stability for the future commercial application. Recently, the inorganic cesium lead halide perovskite has been intensively studied as one of the alternative candidates to improve device stability through controlling the phase transition. The cesium (Cs)-doped perovskites show more superior stability comparing with organic methylammonium (MA) lead halide perovskite or formamidinium (FA) lead halide perovskite. Here, recent progress of the inorganic cesium application in organic–inorganic perovskite solar cells (PSCs) is highlighted from the viewpoints of the device efficiency and the device stability. Project supported by the 973 Program of China (No. 2015CB932203), the National Natural Science Foundation of China (Nos. 61377025, 91433203), and the Young 1000 Talents Global Recruitment Program of China.

  4. Controllable evaporation of cesium from a dispenser oven

    Science.gov (United States)

    Fantz, U.; Friedl, R.; Fröschle, M.

    2012-12-01

    This instrument allows controlled evaporation of the alkali metal cesium over a wide range of evaporation rates. The oven has three unique features. The first is an alkali metal reservoir that uses a dispenser as a cesium source. The heating current of the dispenser controls the evaporation rate allowing generation of an adjustable and stable flow of pure cesium. The second is a blocking valve, which is fully metallic as is the body of the oven. This construction both reduces contamination of the dispenser and enables the oven to be operated up to 300 °C, with only small temperature variations (metal at a cold spot is significantly hindered. The last feature is an integral surface ionization detector for measuring and controlling the evaporation rate. The dispenser oven can be easily transferred to the other alkali-metals.

  5. Dating of mine waste in lacustrine sediments using cesium-137

    Science.gov (United States)

    Rember, W. C.; Erdman, T. W.; Hoffmann, M. L.; Chamberlain, V. E.; Sprenke, K. F.

    1993-11-01

    For over a century Medicine Lake in northern Idaho has received heavy-metal-laden tailings from the Coeur d'Alene mining district. Establishing the depositional chronology of the lake bottom sediments provides information on the source and rate of deposition of the tailings. Cesium-137, an isotope produced in the atmosphere by nuclear bomb tests, was virtually absent in the environment prior to 1951, but reached its apex in 1964. Our analysis of cesium-137 in the sediments of Medicine Lake revealed that 14 cm of fine-grained tailings were deposited in the lake from 1951 to 1964 and tailing deposition downstream was greatly reduced by the installation of tailings dams in the district in 1968. Cesium-137 analysis is accomplished by a fairly simple gamma-ray counting technique and should be a valuable tool for analyzing sedimentation in any lacustrine environment that was active during the 1950s and 1960s.

  6. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of [sup 137]Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of [sup 137]Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope [sup 137]Cs releases have resulted in a negligible risk to the environment and the population it supports.

  7. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of {sup 137}Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of {sup 137}Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope {sup 137}Cs releases have resulted in a negligible risk to the environment and the population it supports.

  8. 27 CFR 9.133 - Rutherford.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Rutherford. 9.133 Section... Rutherford. (a) Name. The name of the viticultural area described in this section is “Rutherford.” (b) Approved maps. The appropriate maps for determining the boundary of the Rutherford viticultural area...

  9. 21 CFR 133.141 - Gorgonzola cheese.

    Science.gov (United States)

    2010-04-01

    ... time. The mixed curd and whey is placed into forms permitting further drainage. While being placed in... used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, or corresponding... of the terms “milkfat and nonfat milk” or “nonfat milk and milkfat”, as appropriate; “milkfat...

  10. 21 CFR 133.162 - Neufchatel cheese.

    Science.gov (United States)

    2010-04-01

    ... ingredients may be used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3. (2... optional ingredients. (i) Salt. (ii) Cheese whey, concentrated cheese whey, dried cheese whey, or reconstituted cheese whey prepared by addition of water to concentrated cheese whey or dried cheese whey....

  11. 21 CFR 133.106 - Blue cheese.

    Science.gov (United States)

    2010-04-01

    ... time. The mixed curd and whey is placed in forms permitting further drainage. While the curd is being... ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone or in combination. (2) Clotting... of the weight of the milk being bleached, and the weight of the potassium alum, calcium sulfate,...

  12. 21 CFR 133.164 - Nuworld cheese.

    Science.gov (United States)

    2010-04-01

    ... time. The mixed curd and whey is placed into forms permitting further drainage. While being placed in... suitable ingredients may be used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3... of the terms “milkfat and nonfat milk” or “nonfat milk and milkfat”, as appropriate....

  13. 5 CFR 1201.133 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Judicial review. 1201.133 Section 1201... review. An employee, former employee, or applicant for employment who is adversely affected by a final... review of the decision in the United States Court of Appeals for the Federal Circuit. 5 U.S.C....

  14. 47 CFR 13.3 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMERCIAL RADIO OPERATORS General § 13.3 Definitions. The definitions of terms used in part 13 are: (a) COLEM. Commercial operator license examination manager. (b) Commercial radio operator. A person holding a license or licenses specified in § 13.7(b)....

  15. 21 CFR 133.183 - Romano cheese.

    Science.gov (United States)

    2010-04-01

    ... anhydrous calcium chloride, of the weight of the milk) is added to set the milk to be a semisolid mass. The... Products § 133.183 Romano cheese. (a) Romano cheese is the food prepared from cow's milk or sheep's milk or goat's milk or mixtures of two or all of these and other ingredients specified in this section, by...

  16. 21 CFR 133.108 - Brick cheese.

    Science.gov (United States)

    2010-04-01

    ... ingredients may be used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone... microbial origin. (3) Other optional ingredients. (i) Coloring. (ii) Calcium chloride in an amount not more than 0.02 percent (calculated as anhydrous calcium chloride) of the weight of the dairy...

  17. 21 CFR 133.152 - Limburger cheese.

    Science.gov (United States)

    2010-04-01

    ... used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone or in.... (3) Other optional ingredients. (i) Coloring. (ii) Calcium chloride in an amount not more than 0.02 percent (calculated as anhydrous calcium chloride) by weight of the dairy ingredients, used as...

  18. 21 CFR 133.181 - Provolone cheese.

    Science.gov (United States)

    2010-04-01

    ... used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone or in... color of the curd. (ii) Calcium chloride in an amount not more than 0.02 percent (calculated as anhydrous calcium chloride) by weight of the dairy ingredients, used as a coagulation aid. (iii) Enzymes...

  19. 21 CFR 133.113 - Cheddar cheese.

    Science.gov (United States)

    2010-04-01

    ... used: (1) Dairy ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone or in.... (3) Other optional ingredients. (i) Coloring. (ii) Calcium chloride in an amount not more than 0.02 percent (calculated as anhydrous calcium chloride) of the weight of the dairy ingredients, used as...

  20. 21 CFR 133.140 - Gammelost cheese.

    Science.gov (United States)

    2010-04-01

    ... milk, as defined in § 133.3, by the procedure set forth in paragraph (a)(2) of this section, or by any... least 30 minutes. The whey is drained off and the curd removed and placed in forms and pressed. The shaped curd is placed in whey and heated for 3 or 4 hours, and may again be pressed. It is then...

  1. 7 CFR 1150.133 - Nominations.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order National Dairy Promotion and Research Board § 1150.133 Nominations. Nominations for members of...

  2. CAFS: A Cesium Atomic Frequency Standard for GPS block IIR

    Science.gov (United States)

    Wisnia, Jeffry A.

    1993-01-01

    Kernco, Inc. was selected to design the Cesium Atomic Frequency Standards (CAFS) for the GPS Block IIR NAVSTAR satellites. These spacecraft are scheduled to be launched in the mid-1990's to replenish and upgrade the existing constellation of Global Positioning System satellites. The Block IIR CAFS output frequency is 13.4003378 MHz, the 686th submultiple of the cesium atomic resonance frequency. Using an integer submultiple simplifies the design of the atomic frequency standard's rf multiplier circuits, eliminating the secondary frequency synthesizer needed in previous designs. The GPS Block IIR CAFS design, particularly the improvements made on our earlier Block II design is described. Test results are included.

  3. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy.

    Science.gov (United States)

    Liu, Juntao; Mao, Zhangfan; Huang, Jie; Xie, Songping; Liu, Tianshu; Mao, Zhifu

    2014-02-21

    Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133- cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133- cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G2/M phase, and there were half as many cells in S phase compared with the CD133- cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were enhanced when combined with GSI. Interestingly, this effect was especially significant in CD133+ cells, suggesting that Notch pathway blockade may be a useful CSC-targeted therapy in lung cancer.

  4. In situ7Li and 133Cs nuclear magnetic resonance investigations on the role of Cs+ additive in lithium-metal deposition process

    Science.gov (United States)

    Hu, Jian Zhi; Zhao, Zhenchao; Hu, Mary Y.; Feng, Ju; Deng, Xuchu; Chen, Xilin; Xu, Wu; Liu, Jun; Zhang, Ji-Guang

    2016-02-01

    Cesium ion (Cs+) has been reported to be an effective electrolyte additive to suppress Li dendrite growth which prevents the application of lithium (Li) metal as an anode for rechargeable Li batteries. In this work, we investigated the effect of Cs+ additive on Li depositions using quantitative in situ7Li and 133Cs nuclear magnetic resonance (NMR) with planar symmetric Li cells. It's found that the addition of Cs+ can significantly enhance both the formation of well aligned Li nanorods and reversibility of the Li electrode. In situ133Cs NMR directly confirms that Cs+ migrates to Li electrode to form a positively charged electrostatic shield during the charging process. Much more electrochemical "active" Li was found in Li films deposited with Cs+ additive, while more electrochemical "dead" and thicker Li rods were identified in Li films deposited without Cs+. Combining the in situ and the previous ex-situ results, a Li deposition model has been proposed to explain these observations.

  5. Selective chemical binding enhances cesium tolerance in plants through inhibition of cesium uptake

    Science.gov (United States)

    Adams, Eri; Chaban, Vitaly; Khandelia, Himanshu; Shin, Ryoung

    2015-03-01

    High concentrations of cesium (Cs+) inhibit plant growth but the detailed mechanisms of Cs+ uptake, transport and response in plants are not well known. In order to identify small molecules with a capacity to enhance plant tolerance to Cs+, chemical library screening was performed using Arabidopsis. Of 10,000 chemicals tested, five compounds were confirmed as Cs+ tolerance enhancers. Further investigation and quantum mechanical modelling revealed that one of these compounds reduced Cs+ concentrations in plants and that the imidazole moiety of this compound bound specifically to Cs+. Analysis of the analogous compounds indicated that the structure of the identified compound is important for the effect to be conferred. Taken together, Cs+ tolerance enhancer isolated here renders plants tolerant to Cs+ by inhibiting Cs+ entry into roots via specific binding to the ion thus, for instance, providing a basis for phytostabilisation of radiocesium-contaminated farmland.

  6. Magic-wavelength optical dipole trap of cesium and rubidium atoms

    Science.gov (United States)

    Wang, Junmin; Cheng, Yongjie; Guo, Shanlong; Yang, Baodong; He, Jun

    2012-06-01

    Optical dipole traps (ODT) with far-off-resonance laser are important tools in more and more present cold-atom experiments, which allow confinement of laser-cooled atoms with a long storage time. Particularly, the magic wavelength ODT can cancel the position-dependent spatially inhomogeneous light shift of desired atomic transition, which is introduced by the ODT laser beam. Now it plays an important role in the state-insensitive quantum engineering and the atomic optical clock. To verify the magic wavelength or the magic wavelength combination for D2 line transition of cesium (Cs) and rubidium (Rb) atoms, we calculated and analyzed the light shift of the 133Cs 6S1/2 - 6P3/2 transition for a monochromatic ODT, and also the 87Rb 5S1/2 - 5P3/2 transition for a dichromatic ODT with a laser frequency ratio of 2:1. Also a dichromatic magic-wavelength ODT laser system for 87Rb atoms is proposed and experimentally realized by employing the quasi-phase-matched frequency doubling technique with telecom laser and fiber amplifier.

  7. Small cluster ions from source of negative ions by cesium sputtering

    CERN Document Server

    Wang, X M; Shao, L; Liu, J R; Chu, W K

    2002-01-01

    We investigated the delivery of small cluster ions using a source of negative ions by cesium sputtering (SNICS). The negative cluster ions of B sub n , C sub n , Si sub n , Co sub n , Cu sub n , Ge sub n , Au sub n , GeB sub n and SiB sub n have been extracted by SNICS. Adequate beam current of some small clusters was obtained by changing several parameters for cluster ion yield. After a comprehensive study of the operation parameters, such as target material selection, target geometry, sputtering voltage and current, the small cluster ion current can be increased by several orders of magnitude, with little change on the monomer ion yield.

  8. Enhanced cell growth and tumorigenicity of rat glioma cells by stable expression of human CD133 through multiple molecular actions.

    Science.gov (United States)

    Fang, Kuan-Min; Lin, Tzu-Chien; Chan, Ti-Chun; Ma, Shi-Zhang; Tzou, Bo-Cheng; Chang, Wen-Ruei; Liu, Jun-Jen; Chiou, Shih-Hwa; Yang, Chung-Shi; Tzeng, Shun-Fen

    2013-09-01

    CD133 (Prominin-1/AC133) is generally treated as a cell surface marker found on multipotent stem cells and tumor stem-like cells, and its biological function remains debated. Genetically modified rat glioma cell lines were generated by lentiviral gene delivery of human CD133 into rat C6 glioma cells (hCD133(+) -C6) or by infection of C6 cells with control lentivirus (mock-C6). Stable hCD133 expression promoted the self-renewal ability of C6-formed spheres with an increase in the expression of the stemness markers, Bmi-1 and SOX2. Akt phosphorylation, Notch-1 activation, and Notch-1 target gene expression (Hes-1, Hey1 and Hey2) were increased in hCD133(+) -C6 when compared to mock-C6. The inhibition of Akt phosphorylation, Notch-1 activation, and Hes-1 in hCD133(+) -C6 cells effectively suppressed their clonogenic ability, indicating that these factors are involved in expanding the growth of hCD133(+) -C6. An elevated expression of GTPase-activating protein 27 (Arhgap27) was detected in hCD133(+) -C6. A decline in the invasion of hCD133(+) -C6 by knockdown of Arhgap27 expression indicated the critical role of Arhgap27 in promoting cell migration of hCD133(+) -C6. In vivo study further showed that hCD133(+) -C6 formed aggressive tumors in vivo compared to mock-C6. Exposure of hCD133(+) -C6 to arsenic trioxide not only reduced Akt phosphorylation, Notch-1 activation and Hes-1 expression in vitro, but also inhibited their tumorigenicity in vivo. The results show that C6 glioma cells with stable hCD133 expression enhanced their stemness properties with increased Notch-1/Hes-1 signaling, Akt activation, and Arhgap27 action, which contribute to increased cell proliferation and migration of hCD133(+) -C6 in vitro, as well as progressive tumor formation in vivo.

  9. Sorption of cesium in young till soils

    Energy Technology Data Exchange (ETDEWEB)

    Lusa, Merja; Lempinen, Janne; Ahola, Hanna; Soederlund, Mervi; Lehto, Jukka [Helsinki Univ. (Finland). Laboratory of Radiochemistry; Lahdenperae, Anne-Maj [Saanio and Riekkola Oy, Consulting Engineers, Helsinki (Finland); Ikonen, Ari T.K. [Posiva Oy, Eurajoki (Finland)

    2014-10-01

    Soil samples from three forest soil pits were examined down to a depth of approximately three metres using 1 M ammonium acetate extraction and microwave-assisted extraction with concentrated nitric acid (HNO{sub 3}), to study the binding of cesium (Cs) at Olkiluoto Island, southern Finland. Ammonium acetate was used to extract the readily exchangeable Cs fractions roughly representing the Cs fraction in soil which is available for plants. Microwave-assisted HNO{sub 3} extraction dissolves various minerals, e.g. carbonates, most sulphides, arsenides, selenides, phosphates, molybdates, sulphates, iron (Fe) and manganese (Mn) oxides and some silicates (olivine, biotite, zeolite), and reflects the total Cs concentrations. Cs was mostly found in the strongly bound fraction obtained through HNO{sub 3} extraction. The average Cs concentrations found in this fraction were 3.53 ± 0.30 mg/kg (d.w.), 3.06 ± 1.86 mg/kg (d.w.) and 1.83 ± 0.42 mg/kg (d.w.) in the three soil pits, respectively. The average exchangeable Cs found in the ammonium acetate extraction in all three sampling pits was 0.015 ± 0.008 mg/kg (d.w.). In addition, Cs concentrations in the soil solution were determined and in situ distribution coefficients (K{sub d}) for Cs were calculated. Furthermore, the in situ K{sub d} data was compared with the Cs K{sub d} data obtained using the model batch experiments. The in situ K{sub d} values were observed to fairly well follow the trend of batch sorption data with respect to soil depth, but on average the batch distribution coefficients were almost an order of magnitude higher than the in situ K{sub d} data. In situ Cs sorption data could be satisfactory fitted with the Langmuir sorption isotherm, but the Freundlich isotherm failed to fit the data. Finally, distribution coefficients were calculated by an ion exchange approach using soil solution data, the cation exchange capacity (CEC) as well as Cs to sodium (Na) and Cs to potassium (K) ion exchange selectivity

  10. Surface Electrical Conductivity of Single Crystal Spinel in Cesium Vapour.

    Science.gov (United States)

    2007-11-02

    magnesium aluminate spinel at temperatures ranging from 573K to 923K, in the presence of cesium vapour at pressures up to 1Torr. The interest in spinel has...in the core of a nuclear reactor. In contrast to magnesium oxide and alumina, electron irradiation of spinel produces no dislocation structures

  11. Detection of quadrupole relaxation in an optically pumped cesium vapour

    Energy Technology Data Exchange (ETDEWEB)

    Bernabeu, E.; Tornos, J.

    1985-10-01

    The relaxation of quadrupole orientation induced by means of optical pumping in a cesium vapour is experimentally studied, and the results are compared to the theoretical predictions. The optical detection process of this type of orientation is also discussed as a function of the polarization and spectral profile of the detection light.

  12. Fundamental study of cesium decontamination from soil by superconducting magnet

    Energy Technology Data Exchange (ETDEWEB)

    Igarashi, Susumu, E-mail: igarashi@qb.see.eng.osaka-u.ac.jp; Mishima, Fumihito; Akiyama, Yoko, E-mail: yoko-ak@see.eng.osaka-u.ac.jp; Nishijima, Shigehiro

    2013-11-15

    Highlights: •The method for the soil decontamination by the superconducting magnet is proposed. •Cesium ion can be absorbed by Prussian blue in potassium iodide wash fluid. •It is possible to recover Cs{sup +} ion-adsorbing Prussian blue with a high rate by HGMS. •It is expected that HGMS can be applied to the actual soil decontamination. -- Abstract: The radioactive substances have been spread out all over the surrounding area of Fukushima Daiichi Nuclear Power Plant caused by the accident in March 2011. Decontamination and volume reduction of radioactive substances, especially cesium ion, are desired issue. This study proposed a decontamination method of the soil by the magnetic separation using superconducting magnet. Cesium ion was adsorbed by Prussian blue in the potassium iodide solution. We succeeded in separating selectively the cesium ion-adsorbed Prussian blue out of the liquid phase by high gradient magnetic separation. High recovery ratio of the Prussian blue was achieved by this method.

  13. Membrane-based separation technologies for cesium, strontium, and technetium

    Energy Technology Data Exchange (ETDEWEB)

    Kafka, T.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with 3M, St. Paul, Minnesota, working in cooperation with IBC Advanced Technologies, American Fork, Utah.

  14. Suspension of superfluid helium using cesium-coated surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Williams, M.C.; Giese, C.F.; Halley, J.W. [School of Physics and Astronomy, University of Minnesota, Minneapolis, Minnesota 55455 (United States)

    1996-03-01

    We report results of an experiment which demonstrates that a layer of superfluid helium can be suspended over a cesium-coated orifice. By measuring the layer thickness with a capacitance bridge, we have shown in two runs that fluid layers up to 2 mm thick were suspended over a 70-{mu}m-diam cesium-coated orifice in a platinum foil for over 2 h in a cryostat held at 1.2 K. The effect depends on the recently established fact that superfluid helium does not wet cesium-coated surfaces. As a consequence, superfluid helium is expected to form a stable meniscus across such a cesium-coated hole. The observed depths of suspended helium are consistent with a simple theoretical model based on this picture. We briefly discuss the possible application of this method to the performance of a proposed experiment to study quantum coherence in superfluid helium by directing pulsed beams of helium atoms at such a suspended layer of fluid. {copyright} {ital 1996 The American Physical Society.}

  15. Cesium-137 Levels Detected in Otters from Austria

    Directory of Open Access Journals (Sweden)

    Gutleb A.C.

    1991-02-01

    Full Text Available Pollution seems to be one of the most important causes for the decline of the European otter (Lutra lutra. The accident in the Chernobyl nuclear power plant added another aspect to environmental pollution. Few data on cesium-137 contents in otters are available, so levels were measured in 3 otters from Austria. All levels found were very low.

  16. Structural analysis of alkali cations in mixed alkali silicate glasses by 23Na and 133Cs MAS NMR

    Directory of Open Access Journals (Sweden)

    T. Minami

    2014-12-01

    Full Text Available We report the structural analysis of Na+ and Cs+ in sodium cesium silicate glasses by using 23Na and 133Cs magic-angle spinning nuclear magnetic resonance (MAS NMR spectroscopy. In the NMR spectra of cesium silicate crystals, the peak position shifted to higher magnetic field for structures with larger Cs+ coordination numbers and to lower magnetic field for smaller Cs+ coordination numbers. The MAS NMR spectra of xNa2O-yCs2O-2SiO2 (x = 0, 0.2, 0.33, 0.5, 0.66, 0.8, 1.0; x + y = 1 glass reveal that the average coordination number of both the alkali cations decreases with increasing Cs+/(Na+ + Cs+ ratio. In addition, the coordination number of Na+ in xNa2O-yCs2O-2SiO2 glass is smaller than that of Cs+. This difference between the average coordination numbers of the alkali cations is considered to be one structural reason of the mixed alkali effect.

  17. Intercomparision of Standardized Radioactive Solution of 133Ba

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>133Ba is a very important nuclide in the field of radiation, for example applied to efficienency calibration of the γ spectromenter. To ensure the accurate and reliable of measurement results of 133Ba, to

  18. Increased plasma levels of microparticles expressing CD39 and CD133 in acute liver injury

    DEFF Research Database (Denmark)

    Schmelzle, Moritz; Splith, Katrin; Wiuff Andersen, Lars;

    2013-01-01

    BACKGROUND: We have previously demonstrated that CD133 and CD39 are expressed by hematopoietic stem cells (HSC), which are mobilized after liver injury and target sites of injury, limit vascular inflammation, and boost hepatic regeneration. Plasma microparticles (MP) expressing CD39 can block...... endothelial activation. Here, we tested whether CD133 MP might be shed in a CD39-dependent manner in a model of liver injury and could potentially serve as biomarkers of liver failure in the clinic. METHODS: Wild-type and Cd39-null mice were subjected to acetaminophen-induced liver injury. Mice were...

  19. 21 CFR 133.186 - Sap sago cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  20. Selective extraction of cesium: from compound to process; Extraction selective du cesium: de la molecule au procede

    Energy Technology Data Exchange (ETDEWEB)

    Simon, N.; Eymard, S.; Tournois, B.; Dozol, J.F. [CEA Cadarache, Dept. d' Entreposage et de Stockage des Dechets (DCC/DESD/SEP), 13 - Saint-Paul-lez-Durance (France)

    2000-07-01

    Under the French law of 30 December 1991 on nuclear waste management, research is conducted to recover long-lived fission products from high-level radioactive effluents generated by spent fuel reprocessing, in order to destroy them by transmutation or encapsulate them in specific matrices. Cesium extraction with mono and bis-crown calix(4)arenes (Frame 1) is a candidate for process development. These extractants remove cesium from highly acidic or basic pH media even with high salinity. A real raffinate was treated in 1994 in a hot cell to extract cesium with a calix-crown extractant. The success of this one batch experiment confirmed the feasibility of cesium decontamination from high-level liquid waste. It was then decided to develop a process flowchart to extract cesium selectively from high-level raffinate, to be included in the general scheme of long-lived radionuclide partitioning. It was accordingly decided to develop a process based on liquid-liquid extraction and hence optimize a calixarene/diluent solvent according to: - hydraulic properties: density, viscosity, interfacial tension, - chemical criteria: sufficient cesium extraction (depending on the diluent), kinetics, third phase elimination... New mono-crown-calixarenes branched with long aliphatic groups (Frame 2) were designed to be soluble in aliphatic diluents. To prevent third phase formation associated with nitric acid extraction, the addition of modifiers (alcohol, phosphate and amide) in the organic phase was tested (Frame 3). Table 1 shows examples of calixarene/diluent systems suitable for a process flowchart, and Figure 2 provides data on cesium extraction with these new systems. Alongside these improvements, a system based on a modified 1,3-di(n-octyl-oxy)2,4-calix[4]arene crown and a modified diluent was also developed, considering a mixed TPH/NPHE system as the diluent, where TPH (hydrogenated tetra propylene) is a common aliphatic industrial solvent and NPHE is nitrophenyl

  1. 21 CFR 133.134 - Cream cheese with other foods.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cream cheese with other foods. 133.134 Section 133... Cheese and Related Products § 133.134 Cream cheese with other foods. (a) Description. Cream cheese with other foods is the class of foods prepared by mixing, with or without the aid of heat, cream cheese...

  2. 14 CFR 133.23 - Knowledge and skill.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Knowledge and skill. 133.23 Section 133.23... OPERATIONS Certification Rules § 133.23 Knowledge and skill. (a) Except as provided in paragraph (d) of this... the Administrator satisfactory knowledge and skill regarding rotorcraft external-load operations...

  3. 40 CFR 133.104 - Sampling and test procedures.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Sampling and test procedures. 133.104 Section 133.104 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS SECONDARY TREATMENT REGULATION § 133.104 Sampling and test procedures. (a) Sampling and test procedures...

  4. 27 CFR 40.133 - Amount of individual bond.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Amount of individual bond. 40.133 Section 40.133 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU..., AND PROCESSED TOBACCO Bonds and Extensions of Coverage of Bonds § 40.133 Amount of individual...

  5. 40 CFR 133.105 - Treatment equivalent to secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Treatment equivalent to secondary treatment. 133.105 Section 133.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS SECONDARY TREATMENT REGULATION § 133.105 Treatment equivalent to secondary...

  6. 21 CFR 133.121 - Low sodium colby cheese.

    Science.gov (United States)

    2010-04-01

    ... common name or names of the ingredient or ingredients used as a salt substitute. (f) Low sodium colby... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Low sodium colby cheese. 133.121 Section 133.121... Cheese and Related Products § 133.121 Low sodium colby cheese. Low sodium colby cheese is the...

  7. 21 CFR 133.116 - Low sodium cheddar cheese.

    Science.gov (United States)

    2010-04-01

    ... ingredients used as a salt substitute. (d) Low sodium cheddar cheese is subject to § 105.69 of this chapter. ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Low sodium cheddar cheese. 133.116 Section 133.116... Cheese and Related Products § 133.116 Low sodium cheddar cheese. Low sodium cheddar cheese is the...

  8. 21 CFR 133.147 - Grated American cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133... Cheese and Related Products § 133.147 Grated American cheese food. (a)(1) Grated American cheese food is... granular mixture. (2) Grated American cheese food contains not less than 23 percent of milkfat,...

  9. 29 CFR 794.133 - “Bulk” distribution.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âBulkâ distribution. 794.133 Section 794.133 Labor... § 794.133 “Bulk” distribution. “Bulk” distribution of petroleum products typically connotes those methods of distribution in which large quantities of the product are distributed in a single delivery...

  10. Rapid selection and proliferation of CD133+ cells from cancer cell lines: chemotherapeutic implications.

    Directory of Open Access Journals (Sweden)

    Sarah E Kelly

    Full Text Available Cancer stem cells (CSCs are considered a subset of the bulk tumor responsible for initiating and maintaining the disease. Several surface cellular markers have been recently used to identify CSCs. Among those is CD133, which is expressed by hematopoietic progenitor cells as well as embryonic stem cells and various cancers. We have recently isolated and cultured CD133 positive [CD133+] cells from various cancer cell lines using a NASA developed Hydrodynamic Focusing Bioreactor (HFB (Celdyne, Houston, TX. For comparison, another bioreactor, the rotary cell culture system (RCCS manufactured by Synthecon (Houston, TX was used. Both the HFB and the RCCS bioreactors simulate aspects of hypogravity. In our study, the HFB increased CD133+ cell growth from various cell lines compared to the RCCS vessel and to normal gravity control. We observed a +15-fold proliferation of the CD133+ cellular fraction with cancer cells that were cultured for 7-days at optimized conditions. The RCCS vessel instead yielded a (-4.8-fold decrease in the CD133+cellular fraction respect to the HFB after 7-days of culture. Interestingly, we also found that the hypogravity environment of the HFB greatly sensitized the CD133+ cancer cells, which are normally resistant to chemo treatment, to become susceptible to various chemotherapeutic agents, paving the way to less toxic and more effective chemotherapeutic treatment in patients. To be able to test the efficacy of cytotoxic agents in vitro prior to their use in clinical setting on cancer cells as well as on cancer stem cells may pave the way to more effective chemotherapeutic strategies in patients. This could be an important advancement in the therapeutic options of oncologic patients, allowing for more targeted and personalized chemotherapy regimens as well as for higher response rates.

  11. Type 1 collagen as a potential niche component for CD133-positive glioblastoma cells.

    Science.gov (United States)

    Motegi, Hiroaki; Kamoshima, Yuuta; Terasaka, Shunsuke; Kobayashi, Hiroyuki; Houkin, Kiyohiro

    2014-08-01

    Cancer stem cells are thought to be closely related to tumor progression and recurrence, making them attractive therapeutic targets. Stem cells of various tissues exist within niches maintaining their stemness. Glioblastoma stem cells (GSCs) are located at tumor capillaries and the perivascular niche, which are considered to have an important role in maintaining GSCs. There were some extracellular matrices (ECM) on the perivascular connective tissue, including type 1 collagen. We here evaluated whether type 1 collagen has a potential niche for GSCs. Imunohistochemical staining of type 1 collagen and CD133, one of the GSCs markers, on glioblastoma (GBM) tissues showed CD133-positive cells were located in immediate proximity to type 1 collagen around tumor vessels. We cultured human GBM cell lines, U87MG and GBM cells obtained from fresh surgical tissues, T472 and T555, with serum-containing medium (SCM) or serum-free medium with some growth factors (SFM) and in non-coated (Non-coat) or type 1 collagen-coated plates (Col). The RNA expression levels of CD133 and Nestin as stem cell markers in each condition were examined. The Col condition not only with SFM but SCM made GBM cells more enhanced in RNA expression of CD133, compared to Non-coat/SCM. Semi-quantitative measurement of CD133-positive cells by immunocytochemistry showed a statistically significant increase of CD133-positive cells in Col/SFM. In addition, T472 cell line cultured in the Col/SFM had capabilities of sphere formation and tumorigenesis. Type 1 collagen was found in the perivascular area and showed a possibility to maintain GSCs. These findings suggest that type 1 collagen could be one important niche component for CD133-positive GSCs and maintain GSCs in adherent culture.

  12. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Directory of Open Access Journals (Sweden)

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  13. CD133 protein N-glycosylation processing contributes to cell surface recognition of the primitive cell marker AC133 epitope.

    Science.gov (United States)

    Mak, Anthony B; Blakely, Kim M; Williams, Rashida A; Penttilä, Pier-Andrée; Shukalyuk, Andrey I; Osman, Khan T; Kasimer, Dahlia; Ketela, Troy; Moffat, Jason

    2011-11-25

    The AC133 epitope expressed on the CD133 glycoprotein has been widely used as a cell surface marker of numerous stem cell and cancer stem cell types. It has been recently proposed that posttranslational modification and regulation of CD133 may govern cell surface AC133 recognition. Therefore, we performed a large scale pooled RNA interference (RNAi) screen to identify genes involved in cell surface AC133 expression. Gene hits could be validated at a rate of 70.5% in a secondary assay using an orthogonal RNAi system, demonstrating that our primary RNAi screen served as a powerful genetic screening approach. Within the list of hits from the primary screen, genes involved in N-glycan biosynthesis were significantly enriched as determined by Ingenuity Canonical Pathway analyses. Indeed, inhibiting biosynthesis of the N-glycan precursor using the small molecule tunicamycin or inhibiting its transfer to CD133 by generating N-glycan-deficient CD133 mutants resulted in undetectable cell surface AC133. Among the screen hits involved in N-glycosylation were genes involved in complex N-glycan processing, including the poorly characterized MGAT4C, which we demonstrate to be a positive regulator of cell surface AC133 expression. Our study identifies a set of genes involved in CD133 N-glycosylation as a direct contributing factor to cell surface AC133 recognition and provides biochemical evidence for the function and structure of CD133 N-glycans.

  14. Cesium accumulation by aquatic organisms at different trophic levels following an experimental release into a small reservoir

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E., E-mail: jepinder@uga.ed [Savannah River Ecology Laboratory, P. O. Drawer E, Aiken, SC 29802 (United States); Hinton, T.G., E-mail: thomas.hinton@irsn.f [Savannah River Ecology Laboratory, P. O. Drawer E, Aiken, SC 29802 (United States); Taylor, B.E., E-mail: TaylorB@dnr.sc.go [Savannah River Ecology Laboratory, P. O. Drawer E, Aiken, SC 29802 (United States); Whicker, F.W., E-mail: ward.whicker@colostate.ed [Department of Environmental and Radiological Health Sciences, Colorado, State University, Fort Collins, CO 80523-1618 (United States)

    2011-03-15

    The rates of accumulation and subsequent loss of stable cesium ({sup 133}Cs) by organisms at different trophic levels within plankton-based and periphyton-based food chains were measured following the addition of {sup 133}Cs into a small reservoir near Aiken, South Carolina, USA. An uptake parameter u (L kg{sup -1} d{sup -1} dry mass) and a loss rate parameter k (d{sup -1}) were estimated for each organism using time-series measurements of {sup 133}Cs concentrations in water and biota, and these parameters were used to estimate maximum concentrations, times to maximum concentrations, and concentration ratios (C{sub r}). The maximum {sup 133}Cs concentrations for plankton, periphyton, the insect larva Chaoborus punctipennis, which feeds on plankton, and the snail Helisoma trivolvis, which feeds on periphyton, occurred within the first 14 days following the addition, whereas the maximum concentrations for the fish species Lepomis macrochirus and Micropterus salmoides occurred after 170 days. The C{sub r} based on dry mass for plankton and C. punctipennis were 1220 L kg{sup -1} and 5570 L kg{sup -1}, respectively, and were less than the C{sub r} of 8630 L kg{sup -1} for periphyton and 47,700 L kg{sup -1} for H. trivolvis. Although the C{sub r} differed between plankton-based and periphyton-based food chains, they displayed similar levels of biomagnification. Biomagnification was also indicated for fish where the C{sub r} for the mostly nonpiscivorous L. macrochirus of 22,600 L kg{sup -1} was three times less than that for mostly piscivorous M. salmoides of 71,500 L kg{sup -1}. Although the C{sub r} for M. salmoides was greater than those for periphyton and H. trivolvis, the maximum {sup 133}Cs concentrations for periphyton and H. trivolvis were greater than that for M. salmoides. - Research highlights: {yields} A simple uptake and loss model described the Cs dynamics in all the various biota. {yields} Concentrations of Cs were greater in periphyton than in plankton

  15. Radiological protection and calibration of an activity meter with cesium and barium sources in a nuclear medicine center; Proteccion radiologica y calibracion de un activimetro con fuentes de cesio y bario en un centro de medicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Morales L, M.E. [IPEN INEN Centro de Medicina Nuclear, Av. Aviacion 3799, Lima 34 (Peru)

    2005-07-01

    Presently work is shown the results when gauging a team Deluxe Isotope (Caliper 11) with some sources of Cesium 137 and Barium 133, in a Center of Medicine Nuclear that operates from the anus 1983 in a modern building inside the one Institute of Illnesses Neoplasia (Inn). This Center was equipped initially with teams donated by the International Organism of Atomic Energy (Oa) with those that it develops assistance, educational works and of investigation, giving services to patient of the Inn and other public and private medical centers. (Author)

  16. Estimation of Physical Properties of AN-107 Cesium and Technetium Eluate Blend

    Energy Technology Data Exchange (ETDEWEB)

    Choi, A.S.

    2001-06-12

    The objective of this study, as defined in the associated test specifications and task technical and quality assurance plan, was to estimate all the physical properties that are required to design the storage and transport facilities for the concentrated cesium and technetium eluates. Specifically, the scope of this study included: (1) modeling of the aqueous electrolyte chemistry of Tank 241-AN-107 Cs and Tc eluate evaporators, (2) process modeling of semi-batch and continuous evaporation operations, (3) determination of the operating vacuum and target endpoint of each evaporator, (4) calculation of the physical properties of the concentrated Cs and Tc eluate blend, and (5) development of the empirical correlations for the physical properties thus estimated.

  17. Measurement of parity violation in the 6S-7S transition of cesium using stimulated emission; Mesure de la violation de la parite sur la transition 6S-7S du cesium par emission stimulee dans une vapeur atomique

    Energy Technology Data Exchange (ETDEWEB)

    Lintz, M

    2005-11-15

    This document describes the design and implementation of a pump-probe polarimetry experiment in a cesium vapor, aiming at a 1% precision measurement of atomic parity violation (APV) induced by Z{sup 0} boson exchange. The experimental scheme, relying on induced emission by a probe laser, allows a detection efficiency close to unity, and the left-right asymmetry to be measured is amplified during the propagation of the probe beam in the excited vapour. The interest of the result presented here is to cross-check the unique previous result by an experiment with a completely different design, and hence with completely different systematics, that also allows measurements on long-lived isotopes especially {sup 135}Cs (nuclear spin 7/2 like {sup 133}Cs, half-life 3 million years). We have demonstrated improvements in polarimetry techniques (rejection of instrumental errors, implementation of a polarization magnifier), especially in pulsed polarimetry (doubly-differential, balanced-mode polarization analysis). But most importantly, the expected pump-probe chiral optical gain has been observed in a Cs vapor. The precision on the {theta}{sup pv} measurement has been improved to 2.6%, and the achieved signal/noise ratio allows measurements at the 1% precision level. The achieved precision on lm E{sub 1}{sup pv} is 2 x 10{sup -13} ea{sub 0}, 15 times better than the measurements obtained with the lead and thallium atoms. Our result is in agreement with the more precise Boulder result. The required amount of cesium is small enough to allow a measurement with {sup 135}Cs provided one takes reasonable radioprotection measures. (author)

  18. Kelvin Probe Studies of Cesium Telluride Photocathode for AWA Photoinjector

    CERN Document Server

    Wisniewski, Eric; Yusof, Zikri; Spentzouris, Linda; Terry, Jeff; Harkay, Katherine

    2012-01-01

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (~50 nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating.

  19. Nutrients and cancer: an introduction to cesium therapy.

    Science.gov (United States)

    Sartori, H E

    1984-01-01

    A brief overview on the relevance in dietary factors in both development and prevention of cancer is presented. The pharmacologic properties of various food ingredients are discussed. Establishing of a special diet for the cancer patient is suggested. In addition, avoidance of certain foods is recommended to counteract mucus production of cancer cells. Evaluation of the nutrient content of certain diets in regions with low incidence of cancer has advanced the use of certain alkali metals, i.e., rubidium and cesium, as chemotherapeutic agents. The rationale for this approach termed the "high pH" therapy resides in changing the acidic pH range of the cancer cell by cesium towards weak alkalinity in which the survival of the cancer cell is endangered, and the formation of acidic and toxic materials, normally formed in cancer cells, is neutralized and eliminated.

  20. Cesium-137, a drama recounted; Cesio-137, um drama recontado

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Suzane de Alencar

    2013-01-15

    The radiological accident with Cesium-137, which started on Goiania in 1987, did not stop with the end of radiological contamination and continues in a judicial, scientific and narrative process of identification and recognition of new victims. The drama occupies a central place on the dynamics of radiological event, as it extends its limits, inflects its intensity and updates the event. As a narrative of the event, the ethnography incorporates and brings up to date the drama as an analysis landmark and the description of the theme as it is absorbed by a dramatic process. Cesium-137, a drama recounted is a textual experimentation based on real events and characters picked out from statements reported in various narratives about the radiological accident. (author)

  1. New thermodynamic regularity for cesium over the whole liquid range

    CERN Document Server

    Ghatee, M H

    2001-01-01

    In this paper we derive an equation of state for liquid cesium based on a suggested potential function in accord to the characteristics large attraction and soft repulsion at the asymptotes of interaction potentials. By considering the interaction of nearest adjacent atoms in dense fluid, the equation of state predicts that the isotherm is linear function of, where is the compression factor, is the molar volume, and is the molar density. The linear parameters are identified as interaction coefficients related to attraction and repulsion, and are used to evaluate the molecular parameters with interesting implications. The isotherm is intended to resolve the particular thermodynamic properties of alkali metals, which have been known for their unusual change of the nature of intermolecular force as the characteristic metal-nonmetal transition range is approached. When applied to liquid cesium, the isotherms persist linear over the whole liquid range including the metal non-metals transition range and at the crit...

  2. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    Science.gov (United States)

    Zhang, Jun-Hai; Zeng, Xian-Jin; Li, Qing-Meng; Huang, Qiang; Sun, Wei-Min

    2013-05-01

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations. The process, described by a three-level model with the Λ scheme, shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms. The |Fg = 3> → |Fe = 4> resonance pumping can result in the ground state |Fg = 4, mF = 4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg = 4. To enhance the anisotropy in the ground state, we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg = 4> → |Fe = 3> transition, in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field.

  3. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  4. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  5. Study About Origin of Radioactive Cesium in Wild Mushroom in Japan

    OpenAIRE

    鎌田, 素之; 角田, 光淳

    2016-01-01

    Radioactive cesium, released from the Fukushima I nuclear power plant that destroyed by Great East Japan Earthquake, has been detected from various agricultural products. Especially, wild mushrooms are known to assimilate radioactive cesium and other heavy metals. In this study, we focused on the concentration of radioactive cesium in wild mushrooms in Japan, calculated the ratio of 134Cs/137Cs and discussed on their origin whether they were released from the Fukushima I nuclear power plant o...

  6. Fatal Cesium Chloride Toxicity After Alternative Cancer Treatment

    OpenAIRE

    Sessions, Daniel; Heard, Kennon; Kosnett, Michael

    2013-01-01

    Background: Cesium chloride (CsCl) is sold as a treatment for several types of cancers. The purported mechanism of action is alkalinization of relatively acidic neoplastic cells. The efficacy of CsCl has not been demonstrated in controlled experiments. Oral and intravenous CsCl use has been associated with seizures, cardiotoxicity, syncope, and death. Although intratumoral treatment with various antineoplastic agents is described, no cases of intratumoral cancer treatment with CsCl have been ...

  7. Cesium pentazolate: A new nitrogen-rich energetic material

    Science.gov (United States)

    Steele, Brad A.; Stavrous, Elissaios; Prakapenka, Vitali B.; Radousky, Harry; Zaug, Joseph; Crowhurst, Jonathan C.; Oleynik, Ivan I.

    2017-01-01

    We report theoretical and experimental evidence for a new class of high-nitrogen content energetic material compounds consisting of molecular pentazoles, which are stabilized in the crystal phase upon introduction of elemental cesium. First-principles structural predictions show that the material with composition CsN5 is thermodynamically stable above 15 GPa. Indexing of the measured X-ray diffraction spectra indicate the synthesis of this material at 60 GPa as well its stability upon decompression down to 24 GPa.

  8. MECHANISM OF CESIUM EXCHANGE WITH POTASSIUM TITANIUM HEXACYANOFERRATE

    Institute of Scientific and Technical Information of China (English)

    XuShiping; SunYongxia; 等

    1998-01-01

    The mechanism of cesium exchange on potassium titanium hexacyanoferrate (KTiFC) is described in this paper.The dependence of the exchange rate on temperature,particle granule size,and shaking frequency is studied.The results show that ion exchange process is controlled by liquid film diffusion in granule particle.An exchange reaction occurs mainly between K+ in the exchanger and Cs+ in the solution.

  9. Studies on the Separation of Cesium From Fission Products

    Institute of Scientific and Technical Information of China (English)

    QIANLi-juan; ZHANGSheng-dong; GUOJing-ru; CUIAn-zhi; YANGLei; WUWang-suo

    2003-01-01

    135Cs is a long-life fission product. When measuring its thermal cross section, we must separate radiochemical purity cesium from fission products. Except for decontaminating radio- nuclides, others which can be activated must be avoided to come into solution. So ion exchanger is used. Inorganic ion exchangers have received increased attention because of their high resistance to radiation and their very efficient separation of alkali metal ions.

  10. Cerebral blood flow tomography with xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Lassen, N.A.

    1985-10-01

    Cerebral blood flow (CBF) can be measured tomographically by inhalation of Xenon-/sup 133/. The calculation is based on taking a sequence of tomograms during the wash-in and wash-out phase of the tracer. Due to the dynamic nature of the process, a highly sensitive and fast moving single photon emission computed tomograph (SPECT) is required. Two brain-dedicated SPECT systems designed for this purpose are mentioned, and the method is described with special reference to the limitations inherent in the soft energy of the 133Xe primary photons. CBF tomography can be used for a multitude of clinical and investigative purposes. This article discusses in particular its use for the selection of patients with carotid occlusion for extracranial/intracranial bypass surgery, for detection of severe arterial spasm after aneurysm bleeding, and for detection of low flow areas during severe migraine attacks. The use of other tracers for CBF tomography using SPECT is summarized with emphasis on the /sup 99m/Tc chelates that freely pass the intact blood-brain barrier. The highly sensitive brain-dedicated SPECT systems described are a prerequisite for achieving high resolution tomograms with such tracers.

  11. Radioactive cesium dynamics derived from hydrographic observations in the Abukuma River Estuary, Japan.

    Science.gov (United States)

    Kakehi, Shigeho; Kaeriyama, Hideki; Ambe, Daisuke; Ono, Tsuneo; Ito, Shin-ichi; Shimizu, Yugo; Watanabe, Tomowo

    2016-03-01

    Large quantities of radioactive materials were released into the air and the ocean as a result of the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident, caused by the 2011 Tohoku earthquake and the subsequent major tsunami off the Pacific coast. There is much concern about radioactive contamination in both the watershed of the Abukuma River, which flows through Fukushima Prefecture, and its estuary, where it discharges into the sea in Miyagi Prefecture. We investigated radioactive cesium dynamics using mixing diagrams obtained from hydrographic observations of the Abukuma River Estuary. Particulate radioactive cesium dominates the cesium load in the river, whereas the dissolved form dominates in the sea. As the salinity increased from <0.1 to 0.1-2.3, the mixing diagram showed that dissolved radioactive cesium concentrations increased, because of desorption. Desorption from suspended particles explained 36% of dissolved radioactive cesium in estuarine water. However, the dissolved and particulate radioactive cesium concentrations in the sea decreased sharply because of dilution. It is thought that more than 80% of the discharged particulate radioactive cesium was deposited off the river mouth, where the radioactive cesium concentrations in sediment were relatively high (217-2440 Bq kg(-1)). Radioactive cesium that was discharged to the sea was transported southward by currents driven by the density distribution.

  12. Cesium Toxicity Alters MicroRNA Processing and AGO1 Expressions in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Il Lae Jung

    Full Text Available MicroRNAs (miRNAs are short RNA fragments that play important roles in controlled gene silencing, thus regulating many biological processes in plants. Recent studies have indicated that plants modulate miRNAs to sustain their survival in response to a variety of environmental stimuli, such as biotic stresses, cold, drought, nutritional starvation, and toxic heavy metals. Cesium and radio-cesium contaminations have arisen as serious problems that both impede plant growth and enter the food chain through contaminated plants. Many studies have been performed to define plant responses against cesium intoxication. However, the complete profile of miRNAs in plants during cesium intoxication has not been established. Here we show the differential expression of the miRNAs that are mostly down-regulated during cesium intoxication. Furthermore, we found that cesium toxicity disrupts both the processing of pri-miRNAs and AGONOUTE 1 (AGO1-mediated gene silencing. AGO 1 seems to be especially destabilized by cesium toxicity, possibly through a proteolytic regulatory pathway. Our study presents a comprehensive profile of cesium-responsive miRNAs, which is distinct from that of potassium, and suggests two possible mechanisms underlying the cesium toxicity on miRNA metabolism.

  13. MODELING RESULTS FROM CESIUM ION EXCHANGE PROCESSING WITH SPHERICAL RESINS

    Energy Technology Data Exchange (ETDEWEB)

    Nash, C.; Hang, T.; Aleman, S.

    2011-01-03

    Ion exchange modeling was conducted at the Savannah River National Laboratory to compare the performance of two organic resins in support of Small Column Ion Exchange (SCIX). In-tank ion exchange (IX) columns are being considered for cesium removal at Hanford and the Savannah River Site (SRS). The spherical forms of resorcinol formaldehyde ion exchange resin (sRF) as well as a hypothetical spherical SuperLig{reg_sign} 644 (SL644) are evaluated for decontamination of dissolved saltcake wastes (supernates). Both SuperLig{reg_sign} and resorcinol formaldehyde resin beds can exhibit hydraulic problems in their granular (nonspherical) forms. SRS waste is generally lower in potassium and organic components than Hanford waste. Using VERSE-LC Version 7.8 along with the cesium Freundlich/Langmuir isotherms to simulate the waste decontamination in ion exchange columns, spherical SL644 was found to reduce column cycling by 50% for high-potassium supernates, but sRF performed equally well for the lowest-potassium feeds. Reduced cycling results in reduction of nitric acid (resin elution) and sodium addition (resin regeneration), therefore, significantly reducing life-cycle operational costs. These findings motivate the development of a spherical form of SL644. This work demonstrates the versatility of the ion exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. The value of a resin with increased selectivity for cesium over potassium can be assessed for further development.

  14. MicroRNA-133a suppresses multiple oncogenic membrane receptors and cell invasion in non-small cell lung carcinoma.

    Directory of Open Access Journals (Sweden)

    Lu-Kai Wang

    Full Text Available Non-small cell lung cancers (NSCLCs cause high mortality worldwide, and the cancer progression can be activated by several genetic events causing receptor dysregulation, including mutation or amplification. MicroRNAs are a group of small non-coding RNA molecules that function in gene silencing and have emerged as the fine-tuning regulators during cancer progression. MiR-133a is known as a key regulator in skeletal and cardiac myogenesis, and it acts as a tumor suppressor in various cancers. This study demonstrates that miR-133a expression negatively correlates with cell invasiveness in both transformed normal bronchial epithelial cells and lung cancer cell lines. The oncogenic receptors in lung cancer cells, including insulin-like growth factor 1 receptor (IGF-1R, TGF-beta receptor type-1 (TGFBR1, and epidermal growth factor receptor (EGFR, are direct targets of miR-133a. MiR-133a can inhibit cell invasiveness and cell growth through suppressing the expressions of IGF-1R, TGFBR1 and EGFR, which then influences the downstream signaling in lung cancer cell lines. The cell invasive ability is suppressed in IGF-1R- and TGFBR1-repressed cells and this phenomenon is mediated through AKT signaling in highly invasive cell lines. In addition, by using the in vivo animal model, we find that ectopically-expressing miR-133a dramatically suppresses the metastatic ability of lung cancer cells. Accordingly, patients with NSCLCs who have higher expression levels of miR-133a have longer survival rates compared with those who have lower miR-133a expression levels. In summary, we identified the tumor suppressor role of miR-133a in lung cancer outcome prognosis, and we demonstrated that it targets several membrane receptors, which generally produce an activating signaling network during the progression of lung cancer.

  15. Radioactive cesium. Dynamics and transport in forestal food-webs; Radioaktivt cesium. Dynamik och transport i skogliga naeringsvaevar

    Energy Technology Data Exchange (ETDEWEB)

    Palo, T.; Nelin, P. [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Animal Ecology; Bergman, R.; Nylen, T. [FOA NBC Defence, Umeaa (Sweden)

    1995-12-01

    This report summarises results from a radioecological study during 1994-1995 concerning turnover, redistribution and loss of radioactive Cesium (134 and 137) in boreal forest ecosystems, as well as uptake and transfer in important food-chains over moose, vole and vegetation. The basis for this report are 9 publications published 1994-95. These reports are presented in summary form. 9 refs, 17 figs.

  16. Next Generation Solvent Development for Caustic-Side Solvent Extraction of Cesium

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Birdwell, Joseph F. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Bonnesen, Peter V. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Bruffey, Stephanie [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States)

    2014-03-01

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Inter laboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  17. Next Generation Solvent (NGS): Development for Caustic-Side Solvent Extraction of Cesium

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Birdwell, Jr, Joseph F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bonnesen, Peter V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bruffey, Stephanie H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Duncan, Nathan C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ensor, Dale [Tennessee Technological Univ., Cookeville, TN (United States); Hill, Talon G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lee, Denise L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rajbanshi, Arbin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Roach, Benjamin D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Szczygiel, Patricia L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sloop, Jr., Frederick V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Stoner, Erica L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Neil J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-03-01

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Interlaboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  18. Modulation by cocaine of dopamine receptors through miRNA-133b in zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    Katherine Barreto-Valer

    Full Text Available The use of cocaine during pregnancy can affect the mother and indirectly might alter the development of the embryo/foetus. Accordingly, in the present work our aim was to study in vivo (in zebrafish embryos the effects of cocaine on the expression of dopamine receptors and on miR-133b. These embryos were exposed to cocaine hydrochloride (HCl at 5 hours post-fertilization (hpf and were then collected at 8, 16, 24, 48 and 72 hpf to study the expression of dopamine receptors, drd1, drd2a, drd2b and drd3, by quantitative real time PCR (qPCR and in situ hybridization (ISH, only at 24 hpf. Our results indicate that cocaine alters the expression of the genes studied, depending on the stage of the developing embryo and the type of dopamine receptor. We found that cocaine reduced the expression of miR-133b at 24 and 48 hpf in the central nervous system (CNS and at the periphery by qPCR and also that the spatial distribution of miR-133b was mainly seen in somites, a finding that suggests the involvement of miR-133b in the development of the skeletal muscle. In contrast, at the level of the CNS miR-133b had a weak and moderate expression at 24 and 48 hpf. We also analysed the interaction of miR-133b with the Pitx3 and Pitx3 target genes drd2a and drd2b, tyrosine hydroxylase (th and dopamine transporter (dat by microinjection of the Pitx3-3'UTR sequence. Microinjection of Pitx3-3'UTR affected the expression of pitx3, drd2a, drd2b, th and dat. In conclusion, in the present work we describe a possible mechanism to account for cocaine activity by controlling miR-133b transcription in zebrafish. Via miR-133b cocaine would modulate the expression of pitx3 and subsequently of dopamine receptors, dat and th. These results indicate that miRNAs can play an important role during embryogenesis and in drug addiction.

  19. Evaluation of {sup 133}Xe and {sup 133}Xe{sup m} decay data

    Energy Technology Data Exchange (ETDEWEB)

    Galan, M. [Laboratorio de Metrologia de Radiaciones Ionizantes, CIEMAT, Av. Complutense 22, 28040 Madrid (Spain)], E-mail: monica.galan@ciemat.es

    2009-01-15

    This paper presents the decay data evaluation of {sup 133}Xe and {sup 133}Xe{sup m}, which includes the most recent available data, such as half-life results and gamma-ray intensities that have not been considered in previous evaluations. The adopted internal conversion coefficients (ICC) have been calculated using the 'Frozen Orbital' approximation and are compared here to recent measured values. Recent Q-value tabulations, recommended gamma-ray energies for calibrations, as well as new evaluated gamma-ray intensities for the 81- and 233-keV lines (37.0 (3)% and 10.16 (13)%, respectively) are also presented in this evaluation. Atomic radiation emission probabilities (X-ray and Auger electron) associated with nuclear radiations have been deduced and also included in this work.

  20. Clinicopathological characteristics and prognostic value of cancer stem cell marker CD133 in breast cancer: a meta-analysis

    Science.gov (United States)

    Li, Zhan; Yin, Songcheng; Zhang, Lei; Liu, Weiguang; Chen, Bo; Xing, Hua

    2017-01-01

    Background The association of CD133 overexpression with clinicopathological significance and prognosis in patients with breast cancer remains controversial. We thus performed a meta-analysis to evaluate the role of CD133 expression in the development and prognosis of breast cancer. Methods The databases PubMed, Embase, and Cochrane Library (updated to August 1, 2016) were searched. Pooled odds ratios (ORs) or hazard ratios (HRs) with 95% confidence intervals (95% CI) were used to evaluate the impact of CD133 expression on clinicopathological features, overall survival, and disease-free survival. Results A total of 1,734 patients from 13 studies were subject to final analysis. The results showed a significant association between overexpression of CD133 and estrogen receptor status (OR 0.35, 95% CI 0.18–0.70), progesterone receptor status (OR 0.56, 95% CI 0.43–0.74), human epidermal growth factor-2 status (OR 1.81, 95% CI 1.33–2.45), lymph node metastasis (OR 1.98, 95% CI 1.34–2.92), and tumor histological grade (OR 1.79, 95% CI 1.26–2.54) in breast cancer. However, no significant correlation was found between upregulation of CD133 expression and onset age (OR 1.03, 95% CI 0.70–1.53) or tumor size (OR 1.29, 95% CI 0.80–2.09). Moreover, CD133-positive breast cancer patients had a higher risk of mortality (HR 1.91, 95% CI 1.21–3.03) and disease progression (HR 2.70, 95% CI 1.05–6.95). Conclusion This meta-analysis suggested that CD133 might be a predictor of clinical outcomes as well as prognosis and could be a potentially new gene therapy target for breast cancer patients.

  1. Rational Design of Cesium-Selective Ionophores and Chemosensors: Dihydrocalix[4]arene Crown-6 Ethers

    Energy Technology Data Exchange (ETDEWEB)

    Sachleben, Richard A.; Bryan, Jeffrey C.; Brown, Gilbert M.; Engle, Nancy L.; Haverlock, Tamara J.; Hay, Benjamin P.; Urvoas, Agathe; Moyer, Bruce A.

    2003-12-15

    Molecular mechanics calculations performed on calix[4]arene crown-6 ethers predict that the 1,3-dihydro derivatives will exhibit greater complementarity for potassium and cesium ions than the parent 1,3-dialkoxy calix crowns. The X-ray crystal structures of 1,3-alt bis-octyloxycalix[4]arene benzocrown-6 ether, dihydrocalix[4]arene benzocrown-6 ether, and the cesium nitrate complex of dihydrocalix[4]arene benzocrown-6 ether were determined. The cesium complex structure corresponds closely to the structure predicted by molecular mechanics. The dihydrocalix[4]arene crown-6 ethers exhibit enhanced cesium selectivity in the extraction of alkali metal salts and provide a platform for a highly sensitive and selective cesium chemosensor.

  2. [Variation in amount of radioactive cesium before and after cooking dry shiitake and beef].

    Science.gov (United States)

    Nabeshi, Hiromi; Tsutsumi, Tomoaki; Hachisuka, Akiko; Matsuda, Rieko

    2013-01-01

    We investigated the change of radioactive cesium content in food due to cooking in order to estimate the internal radiation exposure due to from radioactive materials in food. Our results revealed that soaking dry shiitake in water decreased the radioactive cesium content by about 50%, compared with that present in uncooked shiitake. Radioactive cesium in beef was decreased by about 10%, 12%, 60-65% and 80% by grilling, frying, boiling and stewing, respectively, compared to uncooked beef. For cooked beef, the decrease in the ratio of radioactive cesium was significantly different among the types of cooking. The decrease ratio of radioactive cesium in boiled and stewed beef was 8 times higher than that in grilled and fried beef.

  3. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO4] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils.

    Science.gov (United States)

    Mallampati, Srinivasa Reddy; Mitoma, Yoshiharu; Okuda, Tetsuji; Simion, Cristian; Lee, Byeong Kyu

    2015-10-30

    This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable ((133)Cs) and radioactive cesium species ((134)Cs and (137)Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO4], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant (133)Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO4], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped (134)Cs and (137)Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that (134)Cs and (137)Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO4] treated soil were characterized using SEM-EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil included Ca/PO4 associated crystalline complexes. These results suggest that simple grinding treatment with nano-Fe/Ca/CaO/[PO4] under dry conditions might be an extremely efficient separation and immobilization method for radioactive cesium contaminated soil.

  4. Deletion 22q13.3 syndrome

    Directory of Open Access Journals (Sweden)

    Phelan Mary C

    2008-05-01

    Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements

  5. Characterizing optical dipole trap via fluorescence of trapped cesium atoms

    Institute of Scientific and Technical Information of China (English)

    LIU Tao; GENG Tao; YAN Shubin; LI Gang; ZHANG Jing; WANG Junmin; PENG Kunchi; ZHANG Tiancai

    2006-01-01

    Optical dipole trap (ODT) is becoming an important tool of manipulating neutral atoms. In this paper ODT is realized with a far-off resonant laser beam strongly focused in the magneto-optical trap (MOT) of cesium atoms. The light shift is measured by simply monitoring the fluorescence of the atoms in the magneto-optical trap and the optical dipole trap simultaneously. The advantages of our experimental scheme are discussed, and the effect of the beam waist and power on the potential of dipole trap as well as heating rate is analyzed.

  6. 21 CFR 133.109 - Brick cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Brick cheese for manufacturing. 133.109 Section... Standardized Cheese and Related Products § 133.109 Brick cheese for manufacturing. Brick cheese for manufacturing conforms to the definition and standard of identity for brick cheese prescribed by §...

  7. 21 CFR 133.145 - Granular cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular cheese for manufacturing. 133.145 Section... Standardized Cheese and Related Products § 133.145 Granular cheese for manufacturing. Granular cheese for manufacturing conforms to the definition and standard of identity prescribed for granular cheese by §...

  8. 21 CFR 133.137 - Washed curd cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd cheese for manufacturing. 133.137... Standardized Cheese and Related Products § 133.137 Washed curd cheese for manufacturing. Washed curd cheese for manufacturing conforms to the definition and standard of identity prescribed for washed curd cheese by §...

  9. 21 CFR 133.119 - Colby cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Colby cheese for manufacturing. 133.119 Section... Standardized Cheese and Related Products § 133.119 Colby cheese for manufacturing. Colby cheese for manufacturing conforms to the definition and standard of identity prescribed for colby cheese by §...

  10. 21 CFR 133.189 - Skim milk cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Skim milk cheese for manufacturing. 133.189... Standardized Cheese and Related Products § 133.189 Skim milk cheese for manufacturing. (a) Skim milk cheese for manufacturing is the food prepared from skim milk and other ingredients specified in this section, by...

  11. 21 CFR 133.114 - Cheddar cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cheddar cheese for manufacturing. 133.114 Section... Standardized Cheese and Related Products § 133.114 Cheddar cheese for manufacturing. Cheddar cheese for manufacturing conforms to the definition and standard of identity prescribed for cheddar cheese by §...

  12. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by §...

  13. 14 CFR 133.41 - Flight characteristics requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Flight characteristics requirements. 133.41... EXTERNAL-LOAD OPERATIONS Airworthiness Requirements § 133.41 Flight characteristics requirements. (a) The applicant must demonstrate to the Administrator, by performing the operational flight checks prescribed...

  14. Promoter hypomethylation regulates CD133 expression in human gliomas

    Institute of Scientific and Technical Information of China (English)

    Kouichi Tabu; Ken Sasai; Taichi Kimura; Lei Wang; Eiko Aoyanagi; Shinji Kohsaka; Mishie Tanino; Hiroshi Nishihara; Shinya Tanaka

    2008-01-01

    Brain tumor-initiating cells (BTICs) have been enriched using antibodies against the cell surface protein CD133;however,the biological relevance and the regulatory mechanism of CD133 expression in human gliomas are not yet understood.In this study,we initially demonstrated that CD133 was overexpressed in high-grade human glioblastomas where CD133-positive cells were focally observed as a micro-cluster.In addition,CD133 transcripts with exon 1A,1B,or 1C were predominantly expressed in glioblastomas.To elucidate the mechanism regulating this aberrant expression of CD133,three proximal promoters (P1,P2,and P3) containing a CpG island were isolated.In U251MG and T98Gglioblastoma cells,the P1 region flanking exon 1A exhibited the highest activity among the three promoters,and this activity was significantly inactivated by in vitro methylation.After treatment with the demethylating agent 5-azacytidine and/or the histone deacetylase inhibitor valproic acid,the expression level of CD133 mRNA was significantly restored in glioma cells.Importantly,hypomethylation of CpG sites within the P1,P2,and P3 regions was observed by bisulfite sequencing in human glioblastoma tissues with abundant CD133 mRNA.Taken together,our results indicate that DNA hypomethylation is an important determinant of CD133 expression in glioblastomas,and this epigenetic event may be associated with the development of BTICs expressing CD133.

  15. CD133 positive embryonal rhabdomyosarcoma stem-like cell population is enriched in rhabdospheres.

    Directory of Open Access Journals (Sweden)

    Dagmar Walter

    Full Text Available Cancer stem cells (CSCs have been identified in a number of solid tumors, but not yet in rhabdomyosarcoma (RMS, the most frequently occurring soft tissue tumor in childhood. Hence, the aim of this study was to identify and characterize a CSC population in RMS using a functional approach. We found that embryonal rhabdomyosarcoma (eRMS cell lines can form rhabdomyosarcoma spheres (short rhabdospheres in stem cell medium containing defined growth factors over several passages. Using an orthotopic xenograft model, we demonstrate that a 100 fold less sphere cells result in faster tumor growth compared to the adherent population suggesting that CSCs were enriched in the sphere population. Furthermore, stem cell genes such as oct4, nanog, c-myc, pax3 and sox2 are significantly upregulated in rhabdospheres which can be differentiated into multiple lineages such as adipocytes, myocytes and neuronal cells. Surprisingly, gene expression profiles indicate that rhabdospheres show more similarities with neuronal than with hematopoietic or mesenchymal stem cells. Analysis of these profiles identified the known CSC marker CD133 as one of the genes upregulated in rhabdospheres, both on RNA and protein levels. CD133(+ sorted cells were subsequently shown to be more tumorigenic and more resistant to commonly used chemotherapeutics. Using a tissue microarray (TMA of eRMS patients, we found that high expression of CD133 correlates with poor overall survival. Hence, CD133 could be a prognostic marker for eRMS. These experiments indicate that a CD133(+ CSC population can be enriched from eRMS which might help to develop novel targeted therapies against this pediatric tumor.

  16. Analysis of high burnup pressurized water reactor fuel using uranium, plutonium, neodymium, and cesium isotope correlations with burnup

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jung Suk; Jeon, Young Shin; Park, Soon Dal; Ha, Yeong Keong; Song, Kyu Seok [Nuclear Chemistry Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-12-15

    The correlation of the isotopic composition of uranium, plutonium, neodymium, and cesium with the burnup for high burnup pressurized water reactor fuels irradiated in nuclear power reactors has been experimentally investigated. The total burnup was determined by Nd-148 and the fractional {sup 235}U burnup was determined by U and Pu mass spectrometric methods. The isotopic compositions of U, Pu, Nd, and Cs after their separation from the irradiated fuel samples were measured using thermal ionization mass spectrometry. The contents of these elements in the irradiated fuel were determined through an isotope dilution mass spectrometric method using {sup 233}U, {sup 242}Pu, {sup 150}Nd, and {sup 133}Cs as spikes. The activity ratios of Cs isotopes in the fuel samples were determined using gamma-ray spectrometry. The content of each element and its isotopic compositions in the irradiated fuel were expressed by their correlation with the total and fractional burnup, burnup parameters, and the isotopic compositions of different elements. The results obtained from the experimental methods were compared with those calculated using the ORIGEN-S code.

  17. Adsorption of sodium and cesium on aggregates of C60

    Science.gov (United States)

    Harnisch, Martina; Daxner, Matthias; Scheier, Paul; Echt, Olof

    2016-09-01

    We explore the formation of C60 sodium and C60 cesium complexes in superfluid helium nanodroplets. Anomalies in mass spectra of these doped droplets reveal anomalies in the stability of ions. (C60) m Cs+ n ions ( m ≤ 6) are particularly abundant if they contain n = 6 m + 1 cesium atoms; (C60) m Cs2+ n dications ( m ≤ 3 or 5) are abundant if n = 6 m + 2. These findings are consistent with the notion that alkali metal atoms (A) transfer their valence electrons into the three-fold degenerate lowest unoccupied orbital of C60, resulting in particularly stable C60A6 building blocks. However, (C60) 4CsCs2+ n dications display an entirely different pattern; instead of an expected anomaly at n = 6 × 4 + 2 = 26 we observe a strong odd-even alternation starting at n = 6. Also surprising is the effect of adding one H2O or CO2 molecule to (C60) m Cs n mono- or dications; anomalies shift by two units as if the impurity were acting as an acceptor for two valence electrons from the alkali metal atoms.

  18. Kelvin probe studies of cesium telluride photocathode for AWA photoinjector

    Energy Technology Data Exchange (ETDEWEB)

    Wisniewski, Eric E., E-mail: ewisniew@anl.gov [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Velazquez, Daniel [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Yusof, Zikri, E-mail: zyusof@hawk.iit.edu [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Spentzouris, Linda; Terry, Jeff [Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Sarkar, Tapash J. [Rice University, 6100 Main, Houston, TX 77005 (United States); Harkay, Katherine [Accelerator Science Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States)

    2013-05-21

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (≈50nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating. -- Highlights: ► The correlation between Quantum Efficiency (QE) and work function. ► How QE and work function evolve together. ► Rejuvenation of the photocathode via heating and the effect on work function. ► The effects on the work function due to exposure to UV light.

  19. Morphological and electrical properties of zirconium vanadate doped with cesium

    Directory of Open Access Journals (Sweden)

    Marwa F. Elkady

    2014-09-01

    Full Text Available Cesium doped zirconium vanadate ZrV2O7 with different Cs dopant content (Cs/Zr varied from 0 to 0.5 in weight ratio were fabricated by hydrothermal technique at 120 °C for 60 min. The synthesized materials are thermally treated using microwave technique. The structural and morphological properties of the synthesized materials and thermally treated samples were investigated using XRD and SEM respectively. It was evident that all synthesized specimens have cubic phase structural without any extra phase but after heat treatment Orthorhombic phase appear with doped samples. However, the morphological structure of the doped synthesized materials has transferred from nanoparticles into rods aspect with heat treatment for the different dopant ratio. Moreover, the electrical properties of both the synthesized and thermally treated materials are studied by AC impedance measurements. The results indicated that the ionic conductivity of Cs-doped ZrV2O7 materials decreased by increasing the dopant ratio while that thermally treated samples the ionic conductivity increase by increasing the dopant ratio. Finally, the concentration of cesium dopants is found to play crucial role in tuning the morphology and electrical properties of nanostructures.

  20. Structure and bonding in crystalline cesium uranyl tetrachloride under pressure.

    Science.gov (United States)

    Osman, Hussien H; Pertierra, Pilar; Salvadó, Miguel A; Izquierdo-Ruiz, F; Recio, J M

    2016-07-21

    A thorough investigation of pressure effects on the structural properties of crystalline cesium uranyl chloride was performed by means of first-principles calculations within the density functional theory framework. Total energies, equilibrium geometries and vibrational frequencies were computed at selected pressures up to 50 GPa. Zero pressure results present good agreement with available experimental and theoretical data. Our calculated equation of state parameters reveal that Cs2UO2Cl4 is a high compressible material, similar to other ionic compounds with cesium cations, and displays a structural anisotropic behavior guided by the uranyl moiety. An unexpected variation of the U-O bond length, dUO, is detected as pressure is applied. It leads to a dUO-stretching frequency relationship that cannot be described by the traditional Badger's rule. Interestingly enough, it can be explained in terms of a change in the main factor controlling dUO. At low pressure, the charge transferred to the uranyl cation induces an increase of the bond length and a red shift of the stretching frequencies, whereas it is the mechanical effect of the applied pressure above 10 GPa that is the dominant factor that leads to a shortening of dUO and a blue shift of the stretching frequencies.

  1. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    Institute of Scientific and Technical Information of China (English)

    Zhang Jun-Hai; Zeng Xian-Jin; Li Qing-Meng; Huang Qiang; Sun Wei-Min

    2013-01-01

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations.The process,described by a three-level model with the A scheme,shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms.The |Fg =3> → |Fe-4> resonance pumping can result in the ground state |Fg =4,mF =4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg =4.To enhance the anisotropy in the ground state,we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg =4> → |Fe =3>transition,in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field.

  2. Equilibrium, kinetic and thermodynamic study of cesium adsorption onto nanocrystalline mordenite from high-salt solution.

    Science.gov (United States)

    Lee, Keun-Young; Park, Minsung; Kim, Jimin; Oh, Maengkyo; Lee, Eil-Hee; Kim, Kwang-Wook; Chung, Dong-Yong; Moon, Jei-Kwon

    2016-05-01

    In this study, the equilibrium, kinetics and thermodynamics of cesium adsorption by nanocrystalline mordenite were investigated under cesium contamination with high-salt solution, simulating the case of an operation and decommissioning of nuclear facilities or an accident during the processes. The adsorption rate constants were determined using a pseudo second-order kinetic model. The kinetic results strongly demonstrated that the cesium adsorption rate of nano mordenite is extremely fast, even in a high-salt solution, and much faster than that of micro mordenite. In the equilibrium study, the Langmuir isotherm model fit the cesium adsorption data of nano mordenite better than the Freundlich model, which suggests that cesium adsorption onto nano mordenite is a monolayer homogeneous adsorption process. The obtained thermodynamic parameters indicated that the adsorption involved a very stable chemical reaction. In particular, the combination of rapid particle dispersion and rapid cesium adsorption of the nano mordenite in the solution resulted in a rapid and effective process for cesium removal without stirring, which may offer great advantages for low energy consumption and simple operation.

  3. Biological Characteristics of CD133+CD44+ Cancer Stem Cells Sorting from Laryngeal Carcinoma Cell Line TU177%喉癌TU177细胞系中CD133+CD44+肿瘤干细胞分选及特性分析

    Institute of Scientific and Technical Information of China (English)

    杨俊岭; 高伟; 王珏; 付荣; 陈波; 李伟艳; 温树信; 王斌全

    2016-01-01

    Objective :Magnetic activated cell sorting was used to separate CD133+CD44+ cancer cells from laryngeal car-cinoma TU177 cell line. Analysis the biological characteristics of these subpopulations .Methods :TU177 cells were subjected to magnetic activated cell sorting to obtain CD133+CD44+、CD133+CD44-、CD133-CD44+、CD133-CD44-cells. Evaluate the efficiency of magnetic separation by flow cytometry . Test cell proliferation,migration,invasion,adhesion,colony forming ability of the cells.Results: CD133+CD44+ cells show higher proliferation,migration,invasion,adhesion,clone ability than other group(P<0.0001).Conclusions:TU177 cells can be serparated by Magnetic activated cell sorting effectively. CD133 is more powerful than CD44.Our study may provide evidence for target treatment of laryngeal cancer.%目的:免疫磁珠分选喉癌TU177细胞系中的CD133+CD44+细胞,探讨CD133+CD44+细胞作为肿瘤干细胞的生物学特性。方法:培养喉癌TU177细胞,采用免疫磁珠分选技术分选CD133+CD44+、CD133+CD44-、CD133-CD44+、CD133-CD44-细胞,流式检测分选效率,检测各组细胞的增殖、侵袭、迁移、粘附、克隆形成能力。结果:CD133+CD44+细胞的增殖、迁移、侵袭、粘附、克隆能力均明显高于其他组,差异有统计学意义(P<0.0001)。结论:免疫磁珠技术能有效进行TU177细胞系的分选,CD133+CD44+细胞亚群具有强增殖、侵袭、迁移、粘附、克隆形成能力,具有肿瘤干细胞特征,CD133作为干细胞标志物,其干细胞特性强于CD44,可为喉癌的进一步靶向治疗提供依据。

  4. Preliminary Evaluation of Cesium Distribution for Wet Sieving Process Planned for Soil Decontamination in Japan - 13104

    Energy Technology Data Exchange (ETDEWEB)

    Enokida, Y.; Tanada, Y.; Hirabayashi, D. [Graduate School of Engineering, 1 Furo-cho Nagoya-shi, Aichi-ken, 4648603 (Japan); Sawada, K. [EcoTopia Science Institute, Nagoya University, 1 Furo-cho Nagoya-shi, Aichi-ken, 4648603 (Japan)

    2013-07-01

    For the purpose of decontaminating radioactive cesium from a huge amount of soil, which has been estimated to be 1.2x10{sup 8} m{sup 3} by excavating to a 5-cm depth from the surface of Fukushima Prefecture where a severe nuclear accident occurred at TEPCO's power generating site and has emitted a significant amount of radioactive materials, mainly radioactive cesium, a wet sieving process was selected as one of effective methods available in Japan. Some private companies have demonstrated this process for soil treatment in the Fukushima area by testing at their plants. The results were very promising, and a full-fledged application is expected to follow. In the present study, we spiked several aqueous samples containing soil collected from an industrial wet sieving plant located near our university for the recycling of construction wastes with non-radioactive cesium hydroxide. The present study provides scientific data concerning the effectiveness in volume reduction of the contaminated soil by a wet sieving process as well as the cesium distribution between the liquid phase and clay minerals for each sub-process of the full-scale one, but a simulating plant equipped with a process of coagulating sedimentation and operational safety fundamentals for the plant. Especially for the latter aspect, the study showed that clay minerals of submicron size strongly bind a high content of cesium, which was only slightly removed by coagulation with natural sedimentation (1 G) nor centrifugal sedimentation (3,700 G) and some of the cesium may be transferred to the effluent or recycled water. By applying ultracentrifugation (257,000 G), most of submicron clay minerals containing cesium was removed, and the cesium amount which might be transferred to the effluent or recycled water, could be reduced to less than 2.3 % of the original design by the addition of a cesium barrier consisting of ultracentrifugation or a hollow fiber membrane. (authors)

  5. Importance of Quantitative Evaluation of Colorectal Cancer CD133+ Cells%结直肠癌CD133+细胞定量评估的意义

    Institute of Scientific and Technical Information of China (English)

    缪刚; 李尧; 赵艳阳; 黄美雄; 韦军民

    2012-01-01

    efficiently modified as feasible procedures. Patients were divided into two groups with percentage of CD133+ cancer stem cells ≥3% or <3% . In the ≥3% group, a increase of tumor size and lymphatic metastasis was observed, expression of the specific proliferation protein Ki - 67 was significantly increased, production of the tumor metastasis suppressor protein e - cadherin and the apoptotic protein caspase - 3 was decreased. Conclusion A precisely quantitative evaluation system of the primary colorectal cancer stem cells was feasibly established in our study. The system can be used as indicators of prognosis and sensibility to chemotherapy in colorectal cancer patients. The technique also functions as a platform in purification of colorectal cancer stem cells and cancer - stem - cell - targeted therapy in the future.

  6. High voltage holding in the negative ion sources with cesium deposition

    Energy Technology Data Exchange (ETDEWEB)

    Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)

    2016-02-15

    High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.

  7. Historical Cost Curves for Hydrogen Masers and Cesium Beam Frequency and Timing Standards

    Science.gov (United States)

    Remer, D. S.; Moore, R. C.

    1985-01-01

    Historical cost curves were developed for hydrogen masers and cesium beam standards used for frequency and timing calibration in the Deep Space Network. These curves may be used to calculate the cost of future hydrogen masers or cesium beam standards in either future or current dollars. The cesium beam standards are decreasing in cost by about 2.3% per year since 1966, and hydrogen masers are decreasing by about 0.8% per year since 1978 relative to the National Aeronautics and Space Administration inflation index.

  8. The Diagnostics Of Hydrogen-Cesium Plasma Using Fully Relativistic Electron Impact Cross Sections

    Science.gov (United States)

    Priti, Priti; Dipti, Dipti; Gangwar, Reetesh; Srivastava, Rajesh

    2016-10-01

    Electron excitation cross-sections and rate coefficients have been calculated using fully relativistic distorted wave theory for several fine-structure transitions from the ground as well as excited states of cesium atom in the wide range of incident electron energy. These processes play dominant role in low pressure hydrogen-cesium plasma relevant to the negative ion based neutral beam injectors for the ITER project. The calculated cross-sections are used to construct a reliable collisional radiative (CR) model to characterize the hydrogen-cesium plasma. The calculated plasma parameters are compared with the available experimental and theoretical results.

  9. Comparative analysis of cesium and potassium uptake in onion Allium cepa L.

    Science.gov (United States)

    Urban, P. Ł.; Bystrzejewska-Piotrowska, G.

    2003-01-01

    Cesium uptake in onion (from 0.3 mM CsCl solution traced with 137CsCl) has been examined. The highest uptake occurred at pH 4-5 and it decreased with increasing pH. The intensity of Cs translocation depended on acidity of the solution. For acidic solutions, translocation of cesium into bulbs and leaves was greater than in case of alkaline solutions, where most of the cesium remained in the roots. Addition of potassium into the solutions (millimolar K concentrations) inhibits Cs uptake. The potassium pH-influx/efflux characteristic does not coincide with the Cs uptake.

  10. Fission of Multiply Charged Cesium and Potassium Clusters in Helium Droplets - Approaching the Rayleigh Limit

    OpenAIRE

    Renzler, Michael; Harnisch, Martina; Daxner, Matthias; Kranabetter, Lorenz; Kuhn, Martin; Scheier, Paul; Echt, Olof

    2016-01-01

    Electron ionization of helium droplets doped with cesium or potassium results in doubly and, for cesium, triply charged cluster ions. The smallest observable doubly charged clusters are $Cs_{9}^{2+}$ and $K_{11}^{2+}$; they are a factor two smaller than reported previously. The size of potassium dications approaches the Rayleigh limit nRay for which the fission barrier is calculated to vanish, i.e. their fissilities are close to 1. Cesium dications are even smaller than nRay, implying that th...

  11. Test procedures and instructions for single shell tank saltcake cesium removal with crystalline silicotitanate

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, J.B.

    1997-01-07

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Single Shell Tank Saltcake from tanks 24 t -BY- I 10, 24 1 -U- 108, 24 1 -U- 109, 24 1 -A- I 0 1, and 24 t - S-102, in a bench-scale column. The cesium sorbent to be tested is crystalline siticotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-024, Hanford Single Shell Tank Saltcake Cesium Removal Test Plan.

  12. Effect of Rare Earth Elements on Exchange Performances of Cesium Ion-Sieve

    Institute of Scientific and Technical Information of China (English)

    张惠源; 王榕树; 林灿生; 张先业

    2003-01-01

    The exchange performances and the distribution coefficient of Cesium Ion-Sieve (Cs-IS) for cesium and for some rare earth elements were compared. In particular, the effects of neodymium on the cesium ion exchange and the Cs+ selectivity variation on Cs-IS owing to introduction of rare earth elements into HLLW were studied. Though rare earth elements exhibit a small influence on the distribution coefficient for Cs+, they impair Cs-exchange capacity of Cs-IS to some extent. This interruption on the selectivity to Cs+ can be significantly eliminated provided an appropriate ratio of liquid to solid V:m is used.

  13. Cesium leaching from {gamma}-irradiated CsA and CsX zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Enrique [Universidad Autonoma Metropolitana, Iztapalapa, A. P. 55-532, Av. San Rafael Atlixco No. 186 Col. Vicentina, 09340 Mexico, D.F. (Mexico)], E-mail: lima@xanum.uam.mx; Ibarra, Ilich A.; Lara, Victor [Universidad Autonoma Metropolitana, Iztapalapa, A. P. 55-532, Av. San Rafael Atlixco No. 186 Col. Vicentina, 09340 Mexico, D.F. (Mexico); Bosch, Pedro [Instituto de Investigaciones en Materiales, A. P. 70-360, Universidad Nacional Autonoma de Mexico, Circuito Exterior, Ciudad Universitaria, 04510 Mexico, D.F. (Mexico); Bulbulian, Silvia [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, Col. Escandon, Delegacion Miguel Hidalgo, 11801 Mexico, D.F. (Mexico)

    2008-12-30

    The present study discusses the effect of {gamma}-irradiation on Cs{sup +}-exchanged X and A zeolites. The incorporation of Cs{sup +} ions into A and X zeolites was performed using three different cesium salts (chloride, nitrate or acetate). Cs{sup +} ions immobilized into the vitrified zeolites by thermal treatment are located in different sites of the zeolite networks. It is found that {gamma}-irradiation favors cesium retention depending on the cesium precursor salt used in the cationic exchange step.

  14. First-principles study of cesium adsorption to weathered micaceous clay minerals

    Science.gov (United States)

    Okumura, Masahiko; Nakamura, Hiroki; Machida, Masahiko

    2014-05-01

    A large amount of radioactive nuclides was produced into environment due to the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident. Residents near FDNPP were suffering from radioactive cesium and then evacuated, because which has long half-life and is retained by surface soil for long time. The Japanese government has been decontaminating the cesium by removing the surface soil in order to return them to their home. This decontamination method is very effective, but which produces huge amount of waste soil. This becomes another big problem in Fukushima, because it is not easy to find large storage sites. Then effective and economical methods to reduce the volume of the waste soil are needed. However, it has not been invented yet. One of the reasons is lack of knowledge about microscopic process of adsorption/desorption of cesium to/from soil. It is known that weathered micaceous clay minerals play crucial role on adsorption and retention of cesium. They are expected to have special sorption sites, called frayed edge sites (FESs), which adsorb cesium selectively and irreversibly. Properties of FES have been intensely investigated by experiments. But microscopic details of the adsorption process on FES are still unclear. Because direct observation of the process with current experimental techniques is quite difficult. We investigated the adsorption of cesium to FES in muscovite, which is a typical micaceous clay mineral, via first-principles calculations (density functional theory). We made a minimal model of FES and evaluate the energy difference before and after cesium adsorption to FES. This is the first numerical modeling of FES. It was shown that FES does adsorb cesium if the weathering of muscovite has been weathered. In addition, we revealed the mechanism of cesium adsorption to FES, which is competition between ion radius of cesium and the degree of weathering. I plan to discuss volume reduction of the waste soil based on our result. Reference M. Okumura

  15. A New Pumping-Probing Scheme for the Optically Pumped Cesium Beam Frequency Standard

    Institute of Scientific and Technical Information of China (English)

    陈景标; 朱程锦; 王凤芝; 杨东海

    2001-01-01

    A new pumping-probing scheme for the optically pumped cesium beam frequency standard has been experimentally tested in our laboratory. The stability of the optically pumped cesium beam frequency standard was measured by comparing its 10 MHz output with an HP5071A commercial cesium atomic clock. The result shows that the frequency stability for the 1 s and 30000s sample times are 1.2 × 10-11 and 3.7 × 10-13, respectively. It was proved that the new pumping scheme works well.

  16. Role of miR-1 and miR-133a in myocardial ischemic postconditioning

    Directory of Open Access Journals (Sweden)

    Xie Bing

    2011-03-01

    Full Text Available Abstract Background Ischemic postconditioning (IPost has aroused much attention since 2003 when it was firstly reported. The role of microRNAs (miRNAs or miRs in IPost has rarely been reported. The present study was undertaken to investigate whether miRNAs were involved in the protective effect of IPost against myocardial ischemia-reperfusion (IR injury and the probable mechanisms involved. Methods Thirty SD rats weighing 250-300 g were equally randomized to three groups: Control group, where the rats were treated with thoracotomy only; IR group, where the rats were treated with ischemia for 60 min and reperfusion for 180 min; and IPost group, where the rats were treated with 3 cycles of transient IR just before reperfusion. The extent of myocardial infarction, LDH and CK activities were measured immediately after treatment. Myocardial apoptosis was detected by TUNEL assay. The myocardial tissue was collected after IR or IPost stimulation to evaluate the miRNAs expression level by miRNA-microarray and quantitative real-time RT-PCR. Real-time PCR was conducted to identify changes in mRNA expression of apoptosis-related genes such as Bcl-2, Bax and Caspase-9 (CASP9, and Western blot was used to compare the protein expression level of CASP9 in the three groups. The miRNA mimics and anti-miRNA oligonucleotides (AMO were transferred into the cultured neonatal cardiomyocytes and myocardium before they were treated with IR. The effect of miRNAs on apoptosis was determined by flow cytometry and TUNEL assay. CASP9, as one of the candidate target of miR-133a, was compared during IR after the miR-133a mimic or AMO-133a was transferred into the myocardium. Results IPost reduced the IR-induced infarct size of the left ventricle, and decreased CK and LDH levels. TUNEL assay showed that myocardial apoptosis was attenuated by IPost compared with IR. MiRNA-microarray and RT-PCR showed that myocardial-specific miR-1 and miR-133a were down-regulated by IR, and up

  17. Common molecular pathways involved in human CD133+/CD34+ progenitor cell expansion and cancer

    Directory of Open Access Journals (Sweden)

    Vêncio Ricardo Z

    2007-06-01

    Full Text Available Abstract Background Uncovering the molecular mechanism underlying expansion of hematopoietic stem and progenitor cells is critical to extend current therapeutic applications and to understand how its deregulation relates to leukemia. The characterization of genes commonly relevant to stem/progenitor cell expansion and tumor development should facilitate the identification of novel therapeutic targets in cancer. Methods CD34+/CD133+ progenitor cells were purified from human umbilical cord blood and expanded in vitro. Correlated molecular changes were analyzed by gene expression profiling using microarrays covering up to 55,000 transcripts. Genes regulated during progenitor cell expansion were identified and functionally classified. Aberrant expression of such genes in cancer was indicated by in silico SAGE. Differential expression of selected genes was assessed by real-time PCR in hematopoietic cells from chronic myeloid leukemia patients and healthy individuals. Results Several genes and signaling pathways not previously associated with ex vivo expansion of CD133+/CD34+ cells were identified, most of which associated with cancer. Regulation of MEK/ERK and Hedgehog signaling genes in addition to numerous proto-oncogenes was detected during conditions of enhanced progenitor cell expansion. Quantitative real-time PCR analysis confirmed down-regulation of several newly described cancer-associated genes in CD133+/CD34+ cells, including DOCK4 and SPARCL1 tumor suppressors, and parallel results were verified when comparing their expression in cells from chronic myeloid leukemia patients Conclusion Our findings reveal potential molecular targets for oncogenic transformation in CD133+/CD34+ cells and strengthen the link between deregulation of stem/progenitor cell expansion and the malignant process.

  18. 肿瘤干细胞表面标志物CD133单链抗体基因的分离与鉴定%Identification and characterization of single chain antibody of cancer stem cell surface marker CD133 scFv CD133

    Institute of Scientific and Technical Information of China (English)

    韩瑜; 周炳喜; 张延瑞; 韩双印

    2011-01-01

    Objective To identify,construct and express scFv CD133,verify its biological function.Methods VL and VH were isolated from hybridoma of mAb CD133 by using antibody engineering technology.Its DNA sequencing and CDR were determined.scFv CD133 was then cloned into pET32a,transformed into Origami,induced by IPTG,purified by Ni2+-NTA His resin.Its affinity and specificity were tested by NH4SCN elution and ELISA.Results The size of VL and VH of scFv CD133 was 339 bp and 342 bp,which coded 113 and 114 amino acid separately.Its VL belonged to mouse Igκ chain and VH belonged to mouse IgG heavy chain subtype I.The molecular weight of scFv CD133 was about 27 × 103 which was testified by SDSPAGE and Western blot.Its affinity and specificity were also verified.Conclusion scFv CD133 has been successfully constructed and expressed in Origami,which could supply basis for target therapy of CD+133 cancer stem cell.%目的 分离、构建和表达抗人CD133单链抗体(scFvCD133),测定其生物学活性.方法 用抗体工程技术从抗人CD133单克隆抗体(mAb)杂交瘤细胞中分离抗体可变区基因(VL和VH),测定DNA序列并确定抗体互补决定区(CDR);将scFv CD133基因克隆至pET32a中,转化Origami菌株,IPTG诱导,Ni2+-NTA His树脂纯化单链抗体,梯度硫氰酸盐洗脱法和酶联免疫吸附(ELISA)法检测其亲和性和特异性.结果 scFvCD133基因VL和VH长度分别为339 bp和342 bp,各编码113和114个氨基酸,其中VL隶属于小鼠Ig κ轻链,VH隶属于小鼠Ig重链Ⅰ亚类.scFvCD133经SDS-PAGE和Western blot 分析证明相对分子质量为27 × 103,体外实验具有一定的亲和性和特异性.结论 获得scFv CD133基因,为CD+133肿瘤干细胞的靶向治疗奠定了基础.

  19. a Biokinetic Model for CESIUM-137 in the Fetus

    Science.gov (United States)

    Jones, Karen Lynn

    1995-01-01

    Previously, there was no method to determine the dose to the embryo, fetus, fetal organs or placenta from radionuclides within the embryo, fetus, or placenta. In the past, the dose to the fetus was assumed to be equivalent to the dose to the uterus. Watson estimated specific absorbed fractions from various maternal organs to the uterine contents which included the fetus, placenta, and amniotic fluid and Sikov estimated the absorbed dose to the embryo/fetus after assuming 1 uCi of radioactivity was made available to the maternal blood.^{1,2} However, this method did not allow for the calculation of a dose to individual fetal organs or the placenta. The radiation dose to the embryo or fetus from Cs-137 in the fetus and placenta due to a chronic ingestion by the mother was determined. The fraction of Cs-137 in the maternal plasma crossing the placenta to the fetal plasma was estimated. The absorbed dose from Cs-137 in each modelled fetal organ was estimated. Since there has been more research regarding potassium in the human body, and particularly in the pregnant woman, a biokinetic model for potassium was developed first and used as a basis and confirmation of the cesium model. Available pertinent information in physiology, embryology, biokinetics, and radiation dosimetry was utilized. Due to the rapid growth of the fetus and placenta, the pregnancy was divided into four gestational periods. The numerous physiological changes that occurred during pregnancy were considered and an appropriate biokinetic model was developed for each of the gestational periods. The amount of cesium in the placenta, embryo, and fetus was estimated for each period. The dose to the fetus from cesium deposited in the embryo or fetus and in the placenta was determined for each period using Medical Internal Radiation Dosimetry (MIRD) methodology. An uncertainty analysis was also performed to account for the variability of the parameters in the biokinetic model based on the experimental data

  20. Characterization of CD133~+ parenchymal cells in the liver: Histology and culture

    Institute of Scientific and Technical Information of China (English)

    Seiichi Yoshikawa; Yoh Zen; Takahiko Fujii; Yasunori Sato; Tetsuo Ohta; Yutaka Aoyagi; Yasuni Nakanuma

    2009-01-01

    AIM: To reveal the characteristics of CD133~+ cells in the liver.METHODS: This study examined the histological characteristics of CD133~+ cells in non-neoplastic and neoplastic liver tissues by immunostaining, and also analyzed the biological characteristics of CD133~+ cells derived from human hepatocellular carcinoma (HCC) or cholangiocarcinoma cell lines.RESULTS: Immunostaining revealed constant expression of CD133 in non-neoplastic and neoplastic biliary epithelium, and these cells had the immunophenotype CD133~+/CK19+/HepPar-1~-. A small number of CD133~+/CK19~-/HepPar-1~+ cells were also identified in HCC and combined hepatocellular and cholangiocarcinoma. In addition, small ductal structures, resembling the canal of Hering, partly surrounded by hepatocytes were positive for CD133. CD133 expression was observed in three HCC (HuH7, PLC5 and HepG2) and two cholangiocarcinoma cell and HepG2) and two cholangiocarcinoma cell lines (HuCCT1 and CCKS1). Fluorescence-activated cell sorting (FACS) revealed that CD133~+ and CD133~-cells derived from HuH7 and HuCCT1 cells similarly produced CD133~+ and CD133~-cells during subculture. To examine the relationship between CD133~+ cells and the side population (SP) phenotype, FACS was performed using Hoechst 33342 and a monoclonal antibody against CD133. The ratios of CD133~+/CD133~-cells were almost identical in the SP and non-SP in HuH7. In addition, four different cellular populations (SP/CD133~+, SP/CD133~-, non-SP/CD133~+, and non-SP/CD133~-) could similarly produce CD133~+ and CD133~-cells during subculture. CONCLUSION: This study revealed that CD133 could be a biliary and progenitor cell marker in vivo. However, CD133 alone is not sufficient to detect tumor-initiating cells in cell lines.

  1. 21 CFR 133.148 - Hard grating cheeses.

    Science.gov (United States)

    2010-04-01

    ... than 32 percent of milkfat, as determined by the methods prescribed in § 133.5 (a), (b), and (d). Hard... harmless preparation of enzymes of animal or plant origin capable of aiding in the curing or development...

  2. Mechanical valve assembly for xenon 133 gas delivery systems

    Energy Technology Data Exchange (ETDEWEB)

    Round, W.H. (Royal Brisbane Hospital, Herston (Australia))

    Some gas delivery systems used in pulmonary ventilation scanning are unable to satisfactorily supply /sup 133/Xe gas to bed-ridden patients. A mechanical gas valve assembly to control the flow of gas in such systems was constructed. A commercially produced /sup 133/Xe gas delivery system when fitted with the new assembly was able to ventilate almost all patients whereas previously this could be achieved with approximately only 50% of patients.

  3. Coherence properties of nanofiber-trapped cesium atoms.

    Science.gov (United States)

    Reitz, D; Sayrin, C; Mitsch, R; Schneeweiss, P; Rauschenbeutel, A

    2013-06-14

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized ∼ 200 nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time of T(2)(*) = 0.6 ms and an irreversible dephasing time of T(2)(') = 3.7 ms. By modeling the signals, we find that, for our experimental parameters, T(2)(*) and T(2)(') are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  4. Coherence properties of nanofiber-trapped cesium atoms

    CERN Document Server

    Reitz, D; Mitsch, R; Schneeweiss, P; Rauschenbeutel, A

    2013-01-01

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized 200 nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time $T_2^\\ast=0.6$ ms and an irreversible dephasing time $T_2^\\prime=3.7$ ms. By theoretically modelling the signals, we find that, for our experimental parameters, $T_2^\\ast$ and $T_2^\\prime$ are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  5. Morphological effects in the quantum yield of cesium iodide

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, J. [Ecole Politechnique Federale, Lausanne (Switzerland). DP-IPA PH-Ecublens; Barbo, F. [Sincrotrone Trieste SpA, Padriciano 99, 34012 Trieste (Italy); Bertolo, M. [Sincrotrone Trieste SpA, Padriciano 99, 34012 Trieste (Italy); Bianco, A. [Sincrotrone Trieste SpA, Padriciano 99, 34012 Trieste (Italy); Braem, A. [European Organization for Nuclear Research, Geneva (Switzerland). Div. Particle Physics Experiments; Cerasari, S. [Sincrotrone Trieste SpA, Padriciano 99, 34012 Trieste (Italy); Coluzza, C. [Ecole Politechnique Federale, Lausanne (Switzerland). DP-IPA PH-Ecublens; Dell`Orto, T. [Ecole Politechnique Federale, Lausanne (Switzerland). DP-IPA PH-Ecublens; Fontana, S. [Sincrotrone Trieste SpA, Padriciano 99, 34012 Trieste (Italy); Margaritondo, G. [Ecole Politechnique Federale, Lausanne (Switzerland). DP-IPA PH-Ecublens; Nappi, E. [Istituto Nazionale di Fisica Nucleare, Bari (Italy); Paic, G. [European Organization for Nuclear Research, Geneva (Switzerland). Div. Particle Physics Experiments; Piuz, F. [European Organization for Nuclear Research, Geneva (Switzerland). Div. Particle Physics Experiments; Sanjines, R. [Ecole Politechnique Federale, Lausanne (Switzerland). DP-IPA PH-Ecublens; Scognetti, T. [Istituto Nazionale di Fisica Nucleare, Bari (Italy); Sgobba, S. [European Organization for Nuclear Research, Geneva (Switzerland). Div. Particle Physics Experiments

    1995-07-15

    We demonstrated that polycrystalline cesium iodide (CsI) on large area Ni/Au coated printed board provides a quantum efficiency (QE) higher by a factor of 2 than the films deposited on the standard Cu/Au printed circuits. This is the most important result of the present systematic study of the QE lateral inhomogeneity for CsI on different substrates. We found a strong correlation between the QE lateral variation and the morphological homogeneity of the films. The QE was measured by UV photoelectron emission microscopy and spatially resolved X-ray photoemission, and the morphology studies were performed by secondary electron microscopy, X-ray diffraction and scanning tunneling microscopy. (orig.).

  6. Hyperfine relaxation of an optically pumped cesium vapor

    Energy Technology Data Exchange (ETDEWEB)

    Tornos, J.; Amare, J.C.

    1986-07-01

    The relaxation of hyperfine orientation indirectly induced by optical pumping with a sigma-polarized D/sub 1/-light in a cesium vapor in the presence of Ar is experimentally studied. The detection technique ensures the absence of quadrupole relaxation contributions in the relaxation signals. The results from the dependences of the hyperfine relaxation rate on the temperature and argon pressure are: diffusion coefficient of Cs in Ar, D/sub 0/ = 0.101 +- 0.010 cm/sup 2/s/sup -1/ at 0/sup 0/C and 760 Torr; relaxation cross section by Cs-Ar collisions, sigma/sub c/ = (104 +- 5) x 10/sup -23/ cm/sup 2/; relaxation cross section by Cs-Cs (spin exchange) collisions, sigma/sub e//sub x/ = (1.63 +- 0.13) x 10/sup -14/ cm/sup 2/.

  7. New Efimov resonances in an ultracold cesium gas

    Energy Technology Data Exchange (ETDEWEB)

    Zenesini, Alessandro; Berninger, Martin; Besler, Stefan; Naegerl, Hanns-Christoph; Ferlaino, Francesca [Institut fuer Experimentalphysik, Universitaet Innsbruck, 6020 Innsbruck (Austria); Huang, Bo; Grimm, Rudolf [Institut fuer Experimentalphysik, Universitaet Innsbruck, 6020 Innsbruck (Austria); Institut fuer Quantenoptik und Quanteninformation, Oesterreichische Akademie der Wissenschaften, 6020 Innsbruck (Austria)

    2011-07-01

    Efimov trimer states represent the paradigm of universality in few-body physics. Although these exotic three-body weakly-bound states have been experimentally investigated in an increasing number of ultracold atomic systems, many fundamental aspects remain unclear. An intriguing open question is related to how short-range physics influences the Efimov effect in real systems. Short range contributions are commonly included in universal theory via a single parameter, known as ''three-body parameter''. An open question is whether this parameter is constant or whether it can vary significantly when Feshbach resonances are employed for interaction tuning. Cesium is a very promising candidate to address this issue because of the many broad and narrow Feshbach resonances with different partial-wave character. Our experimental results reveal new Efimov features close to different Feshbach resonances and shed new light on the three-body parameter.

  8. Mercury and cesium-137 in urban gray squirrels

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, J.H. (Univ. of Georgia, Athens); Davis, A.H.; Bigler, W.J.; Hoff, G.L.

    1980-08-01

    Recent emphasis upon the revitalization of major cities has underscored a need for urban wildlife management. Intensive management of the wildlife populations indigenous to metropolitan areas will enhance our quality of life in many ways. One important benefit is that certain species can serve as sensitive indicators of environmental change. The gray squirrel (Sciurus carolinensis) is usually abundant in cities and they are often subject to a variety of destructive environmental factors. In an attempt to evaluate the gray squirrel as an indicator of zoonoses and pollutants, the Health Program Office of the Department of Health and Rehabilitative Services conducted a multifaceted study in Jacksonvlle, Florida during 1974. This report presents baseline measurements of body burdens of mercury and cesium-137.

  9. Trade study for the disposition of cesium and strontium capsules

    Energy Technology Data Exchange (ETDEWEB)

    Claghorn, R.D.

    1996-03-01

    This trade study analyzes alternatives for the eventual disposal of cesium and strontium capsules currently stored at the Waste Encapsulation and Storage Facility as by-product. However, for purposes of this study, it is assumed that at some time in the future, the capsules will be declared high-level waste and therefore will require disposal at an offsite geologic repository. The study considered numerous alternatives and selected three for detailed analysis: (1) overpack and storage at high-level waste canister storage building, (2) overpack at the high-level waste vitrification facility followed by storage at a high-level waste canister storage building, and (3) blend capsule contents with other high-level waste feed streams and vitrify at the high-level waste vitrification facility.

  10. Fission of Multiply Charged Cesium and Potassium Clusters in Helium Droplets - Approaching the Rayleigh Limit

    CERN Document Server

    Renzler, Michael; Daxner, Matthias; Kranabetter, Lorenz; Kuhn, Martin; Scheier, Paul; Echt, Olof

    2016-01-01

    Electron ionization of helium droplets doped with cesium or potassium results in doubly and, for cesium, triply charged cluster ions. The smallest observable doubly charged clusters are $Cs_{9}^{2+}$ and $K_{11}^{2+}$; they are a factor two smaller than reported previously. The size of potassium dications approaches the Rayleigh limit nRay for which the fission barrier is calculated to vanish, i.e. their fissilities are close to 1. Cesium dications are even smaller than nRay, implying that their fissilities have been significantly overestimated. Triply charged cesium clusters as small as $Cs_{19}^{3+}$ are observed; they are a factor 2.6 smaller than previously reported. Mechanisms that may be responsible for enhanced formation of clusters with high fissilities are discussed.

  11. Biological effects of cesium-137 injected in beagle dogs of different ages

    Energy Technology Data Exchange (ETDEWEB)

    Nikula, K.J.; Muggenburg, B.A.; Griffith, W.C. [and others

    1995-12-01

    The toxicity of cesium-137 ({sup 137}Cs) in the Beagle dog was investigated at the Argonne National Laboratory (ANL) as part of a program to evaluate the biological effects of internally deposited radionuclides. The toxicity and health effects of {sup 137}Cs are important to understand because {sup 137}Cs is produced in large amounts in light-water nuclear reactors. Large quantities of cesium radioisotopes have entered the human food chain as a result of atmospheric nuclear weapons test, and additional cesium radioisotopes were released during the Chernobyl accident. Although the final analyses are not complete, three findings are significant: older dogs dies significantly earlier than juvenile and young adult dogs; greater occurrence of sarcomas in the cesium-137 injected dogs; the major nonneoplastic effect in dogs surviving beyond 52 d appears to be testicular atrophy.

  12. MODELING AN ION EXCHANGE PROCESS FOR CESIUM REMOVAL FROM ALKALINE RADIOACTIVE WASTE SOLUTIONS

    Energy Technology Data Exchange (ETDEWEB)

    Smith, F; Luther Hamm, L; Sebastian Aleman, S; Johnston Michael, J

    2008-08-26

    The performance of spherical Resorcinol-Formaldehyde ion-exchange resin for the removal of cesium from alkaline radioactive waste solutions has been investigated through computer modeling. Cesium adsorption isotherms were obtained by fitting experimental data using a thermodynamic framework. Results show that ion-exchange is an efficient method for cesium removal from highly alkaline radioactive waste solutions. On average, two 1300 liter columns operating in series are able to treat 690,000 liters of waste with an initial cesium concentration of 0.09 mM in 11 days achieving a decontamination factor of over 50,000. The study also tested the sensitivity of ion-exchange column performance to variations in flow rate, temperature and column dimensions. Modeling results can be used to optimize design of the ion exchange system.

  13. Preparation, structure and application of a new ecomaterials cesium ion-sieve

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A new ecomaterials cesium ion-sieve (Cs-IS), which has high selectivity to cesium and excellent acid resistance, is prepared with zirconyl molybdopyrophosphate as its matrix by specific chemical sieve-making means. Cs-IS has large exchange capacity ( 1.83mmol@g-1) and high distribution coefficient (4.09 x 104 mL@ L-1) in the medium of 3 mol@ L- 1 HNO3. In the static exchange with strongly acidic high-level radioactive liquid waste (HLLW) (3 mol@ L-1 HNO3), Cs-IS exhibits high exchange rate for cesium (above 96.53 % ) and large separation factor (greater than 958.41). These indicate the possible use of Cs-IS in cesium-137 selective removal and recovery from highly saline acidic HLLW system.

  14. Cold cesium molecules produced directly in a magneto-optical trap

    Institute of Scientific and Technical Information of China (English)

    Zhang Hong-Shan; Ji Zhong-Hua; Yuan Jin-Peng; Zhao Yan-Ting; Ma Jie; Wang Li-Rong; Xiao Lian-Tuan; Jia Suo-Tang

    2011-01-01

    We report on the observation of ultracold ground electric-state cesium molecules produced directly in a magnetooptical trap with a good signal-to-noise ratio.These molecules arise from the photoassociation of magneto-optical trap lasers and they are detected by resonantly enhanced multiphoton ionization technology.The production rate of ultracold cesium molecules is up to 4× 104 s-1.We measure the characteristic time of the ground electric-state cesium molecules generated in the experiment and investigate the Cs2+ molecular ion intensity as a function of the trapping laser intensity and the ionization pulse laser energy.We conclude that the production of cold cesium molecules may be enhanced by using appropriate experimental parameters,which is useful for future experiments involving the production and trapping of ultracold ground electric-state molecules.

  15. Synthesis of novel calix[4]crown telomers and selective extraction of cesium ions

    Institute of Scientific and Technical Information of China (English)

    Hai Bing Li; Yuan Yin Chen; De Jun Xiong; Jun Yan Zhan; Cui Ping Han

    2007-01-01

    p-tert-Butylcalix[4]diazacrown-4 telomer, which contains hard and soft ion binding sites, was synthesized. It exhibited high selectivity toward cesium ions. The binding sites may complex alkali metal ions selectively.

  16. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium.

    Science.gov (United States)

    Hu, Baiyang; Fugetsu, Bunshi; Yu, Hongwen; Abe, Yoshiteru

    2012-05-30

    We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  17. Total deposition of cesium-137 measured in Finland during the exercise `RESUME 95` in August 1995

    Energy Technology Data Exchange (ETDEWEB)

    Geer, L.E. De; Vintersved, I.; Arntsing, R. [National Defence Research Establisment, Nuclear Detection Group, Stockholm (Sweden)

    1997-12-31

    In the exercise called `RESUME 95` the Nuclear Detection Group from the National Defence Research Establishment in Stockholm participated with field gamma ray measurements combined with soil sampling and profile measurements. The results are presented in this report for the measurements of cesium-137. We considered the measurements of cesium-137 at the airfield the most important part of the in-situ exercise. Data was of course collected also for cesium-134 and natural radionuclides but time has not permitted a full analysis of these radionuclides. The methodology would, however, be the same as applied for cesium-137. Less attention was paid for area II and due to limited personnel resources the search exercise was not fully carried out. (au).

  18. Review of xenon-133 production and related problems; Estudio bibliografico de la produccion de xenon-133 y problemas afines

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Ropero, M.

    1980-07-01

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs.

  19. Calculation of fully relativistic cross sections for electron excitation of cesium atom and its application to the diagnostics of hydrogen-cesium plasma

    Science.gov (United States)

    Priti; Dipti; Gangwar, R. K.; Srivastava, R.

    2017-01-01

    Electron impact excitation cross-sections and rate coefficients have been calculated using fully relativistic distorted wave theory for several fine-structure transitions from the ground as well as excited states of cesium atom in the wide range of incident electron energy. These processes play dominant role in low pressure hydrogen-cesium plasma, which is relevant to the negative ion based neutral beam injectors for the ITER project. As an application, the calculated detailed cross-sections are used to construct a reliable collisional radiative (CR) model to characterize the hydrogen-cesium plasma. Other processes such as radiative population transfer, electron impact ionization and mutual neutralization of Cs+ ion with negative hydrogen ion along with their reverse processes are also taken into account. The calculated cross-sections and the extracted plasma parameters from the present model are compared with the available experimental and theoretical results.

  20. Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma

    Directory of Open Access Journals (Sweden)

    Wuwei Li

    2014-01-01

    Full Text Available Adenoid cystic carcinoma (ACC is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs.

  1. Synergistically strengthened 3D micro-scavenger cage adsorbent for selective removal of radioactive cesium

    Science.gov (United States)

    Jang, Sung-Chan; Kang, Sung-Min; Haldorai, Yuvaraj; Giribabu, Krishnan; Lee, Go-Woon; Lee, Young-Chul; Hyun, Moon Seop; Han, Young-Kyu; Roh, Changhyun; Huh, Yun Suk

    2016-12-01

    A novel microporous three-dimensional pomegranate-like micro-scavenger cage (P-MSC) composite has been synthesized by immobilization of iron phyllosilicates clay onto a Prussian blue (PB)/alginate matrix and tested for the removal of radioactive cesium from aqueous solution. Experimental results show that the adsorption capacity increases with increasing the inactive cesium concentration from 1 ppm to 30 ppm, which may be attributed to greater number of adsorption sites and further increase in the inactive cesium concentration has no effect. The P-MSC composite exhibit maximum adsorption capacity of 108.06 mg of inactive cesium per gram of adsorbent. The adsorption isotherm is better fitted to the Freundlich model than the Langmuir model. In addition, kinetics studies show that the adsorption process is consistent with a pseudo second-order model. Furthermore, at equilibrium, the composite has an outstanding adsorption capacity of 99.24% for the radioactive cesium from aqueous solution. This may be ascribed to the fact that the AIP clay played a substantial role in protecting PB release from the P-MSC composite by cross-linking with alginate to improve the mechanical stability. Excellent adsorption capacity, easy separation, and good selectivity make the adsorbent suitable for the removal of radioactive cesium from seawater around nuclear plants and/or after nuclear accidents.

  2. Export of radioactive cesium from agricultural fields under simulated rainfall in Fukushima.

    Science.gov (United States)

    Thai, Phong K; Suka, Yuma; Sakai, Masaru; Nanko, Kazuki; Yen, Jui-Hung; Watanabe, Hirozumi

    2015-06-01

    In this study, we investigated the impact of rainfall on runoff, soil erosion and consequently on the discharge of radioactive cesium in agricultural fields in Fukushima prefecture using a rainfall simulator. Simulated heavy rainfalls (50 mm h(-1)) generated significant runoff and soil erosion. The average concentration of radioactive cesium (the sum of (134)Cs and (137)Cs) in the runoff sediments was ∼3500 Bq kg(-1) dry soil, more than double the concentrations measured in the field soils which should be considered in studies using the (137)Cs loss to estimate long-term soil erosion. However, the estimated mass of cesium discharged through one runoff event was less than 2% of the cesium inventory in the field. This suggested that cesium discharge via soil erosion is not a significant factor in reducing the radioactivity of contaminated soils in Fukushima prefecture. However, the eroded sediment carrying radioactive cesium will deposit into the river systems and potentially pose a radioactivity risk for aquatic living organisms.

  3. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Baiyang [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Fugetsu, Bunshi, E-mail: hu@ees.hokudai.ac.jp [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Yu, Hongwen [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Abe, Yoshiteru [Kyoei Engineering Corporation, Niigata 959-1961 (Japan)

    2012-05-30

    Highlights: Black-Right-Pointing-Pointer Prussian blue was sealed in cavities of diatomite using carbon nanotubes. Black-Right-Pointing-Pointer The caged Prussian blue after being permanently immobilized in polyurethane spongy showed a 167 mg/g capability for absorbing cesium. Black-Right-Pointing-Pointer Cesium elimination was accomplished by simply adding the Prussian-blue based spongiform adsorbent to radioactive water. - Abstract: We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  4. Review and assessment of technologies for the separation of cesium from acidic media

    Energy Technology Data Exchange (ETDEWEB)

    Orth, R.J.; Brooks, K.P.; Kurath, D.E.

    1994-09-01

    A preliminary literature survey has been conducted to identify and evaluate methods for the separation of cesium from acidic waste. The most promising solvent extraction, precipitation, and ion exchange methods, along with some of the attributes for each method, are listed. The main criteria used in evaluating the separation methods were as follows: (1) good potential for cesium separation must be demonstrated (i.e., cesium decontamination factors on the order of 50 to 100). (2) Good selectivity for cesium over bulk components must be demonstrated. (3) The method must show promise for evolving into a practical and fairly simple process. (4) The process should be safe to operate. (5) The method must be robust (i.e., capable of separating cesium from various acidic waste types). (6) Secondary waste generation must be minimized. (7) The method must show resistance to radiation damage. The most promising separation methods did not necessarily satisfy all of the above criteria, thus key areas requiring further development are suggested for each method. The report discusses in detail these and other areas requiring further development, as well as alternative solvent extraction, precipitation, ion exchange, and {open_quote}other{close_quote} technologies that, based on current information, show less promise for the separation of cesium from acidic wastes because of significant process limitations. When appropriate, the report recommends areas of future development.

  5. Enhanced electronic injection in organic light-emitting diodes by incorporating silver nanoclusters and cesium carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying-Chung; Gao, Chia-Yuan [Department of Electrical Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan (China); Chen, Kan-Lin [Department of Electronic Engineering, Fortune Institute of Technology, Kaohsiung, Taiwan (China); Sze, Po-Wen [Department of Electro-Optical Science and Engineering, Kao Yuan University, Kaohsiung, Taiwan (China); Huang, Chien-Jung, E-mail: chien@nuk.edu.tw [Department of Applied Physics, National University of Kaohsiung, Kaohsiung, Taiwan (China)

    2015-10-01

    Highlights: • The localized electric field around SNCs is enhanced. • When the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained. • The structure for efficient electron injection is critical to characteristics of the device. - Abstract: The influence of the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure (CSC-EIS) on the performance of organic light-emitting diodes is investigated in this study. The silver nanoclusters (SNCs) are introduced between the electron-injection layers by means of thermal evaporation. When the CSC-EIS replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained because the electron-injection barrier between the cathode and the electron-transport layer is remarkably reduced from 1.2 to 0 eV. In addition, surface plasmon resonance effect will cause the enhanced localized electric field around the SNCs, resulting that electron-injection ability is further enhanced from the cathode to the emitting layer.

  6. Modeling Ion-Exchange Processing With Spherical Resins For Cesium Removal

    Energy Technology Data Exchange (ETDEWEB)

    Hang, T.; Nash, C. A.; Aleman, S. E.

    2012-09-19

    The spherical Resorcinol-Formaldehyde and hypothetical spherical SuperLig(r) 644 ion-exchange resins are evaluated for cesium removal from radioactive waste solutions. Modeling results show that spherical SuperLig(r) 644 reduces column cycling by 50% for high-potassium solutions. Spherical Resorcinol Formaldehyde performs equally well for the lowest-potassium wastes. Less cycling reduces nitric acid usage during resin elution and sodium addition during resin regeneration, therefore, significantly decreasing life-cycle operational costs. A model assessment of the mechanism behind ''cesium bleed'' is also conducted. When a resin bed is eluted, a relatively small amount of cesium remains within resin particles. Cesium can bleed into otherwise decontaminated product in the next loading cycle. The bleed mechanism is shown to be fully isotherm-controlled vs. mass transfer controlled. Knowledge of residual post-elution cesium level and resin isotherm can be utilized to predict rate of cesium bleed in a mostly non-loaded column. Overall, this work demonstrates the versatility of the ion-exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. This evaluation justifies further development of a spherical form of the SL644 resin.

  7. The effects of K+ growth conditions on the accumulation of cesium by the bacterium Thermus sp. TibetanG6

    Institute of Scientific and Technical Information of China (English)

    WANG; Hailei; KONG; Fanjing; ZHENG; Mianping

    2006-01-01

    The accumulation of cesium by the bacterium Thermus sp. TibetanG6 was examined under different K+ growth conditions. The effects of external pH and Na+ on the accumulation of cesium were also studied, and the mechanism involved was discussed. K+ regimes played an important role in the accumulation of cesium by the strain TibetanG6. The quantity of cesium accumulated (24 h) was much higher in K+-deficient regime than that in K+-sufficient regime. The pH and Na+ had different effects on the accumulation of cesium in the two K+ regimes. IR spectra analyses indicated that the biosorption is a process of homeostasis with cesium initially accumulated on the cell wall.

  8. Enhanced invasion in vitro and the distribution patterns in vivo of CD133+ glioma stem cells

    Institute of Scientific and Technical Information of China (English)

    YU Sheng-ping; YANG Xue-jun; ZHANG Bin; MING Hao-lang; CHEN Cong; REN Bing-cheng; LIU Zhi-feng; LIU Bin

    2011-01-01

    Background Recent studies have suggested that cancer stem cells cause tumor recurrence based on their resistance to radiotherapy and chemotherapy.Although the highly invasive nature of glioblastoma cells is also implicated in the failure of current therapies,it is not clear whether cancer stem cells are involved in invasiveness.This study aimed to assess invasive ability of glioma stem cells (GSCs) derived from C6 glioma cell line and the distribution patterns of GSCs in Sprague-Dawley (SD) rat brain tumor.Methods Serum-free medium culture and magnetic isolation were used to gain purely CD133+ GSCs.The invasive stem cell markers and luxol fast blue staining for white matter tracts were performed to show the distribution patterns of GSCs in brain tumor of rats and the relationship among GSCs,vessels,and white matter tracts.The results of matrigel invasion assay were estimated using the Student's t test and the analysis of Western blotting was performed using the one-way analysis of variance (ANOVA) test.Results CD133+GSCs(number:85.3±4.1)were significantly more invasive in vitro than matched CD133- cells(number:25.9±3.1) (t=14.5,P <0.005).GSCs invaded into the brain diffusely and located in perivascular niche of tumor-brain interface or resided within perivascular niche next to white fiber tracts.The polarity of glioma cells containing GSCs was parallel to the white matter tracts.Conclusions Our data suggest that CD133+ GSCs exhibit more aggressive invasion in vitro and GSCs in vivo probably disseminate along the long axis of blood vessels and transit through the white matter tracts.The therapies targeting GSCs invasion combined with traditional glioblastoma multiforme therapeutic paradigms might be a new approach for avoiding malignant glioma recurrence.

  9. Engineered Materials for Cesium and Strontium Storage Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Sean M. McDeavitt

    2010-04-14

    Closing the nuclear fuel cycle requires reprocessing spent fuel to recover the long-lived components that still have useful energy content while immobilizing the remnant waste fission products in stable forms. At the genesis of this project, next generation spent fuel reprocessing methods were being developed as part of the U.S. Department of Energy's Advanced Fuel Cycle Initiative. One of these processes was focused on solvent extraction schemes to isolate cesium (Cs) and strontium (Sr) from spent nuclear fuel. Isolating these isotopes for short-term decay storage eases the design requirements for long-term repository disposal; a significant amount of the radiation and decay heat in fission product waste comes from Cs-137 and Sr-90. For the purposes of this project, the Fission Product Extraction (FPEX) process is being considered to be the baseline extraction method. The objective of this project was to evaluate the nature and behavior of candidate materials for cesium and strontium immobilization; this will include assessments with minor additions of yttrium, barium, and rubidium in these materials. More specifically, the proposed research achieved the following objectives (as stated in the original proposal): (1) Synthesize simulated storage ceramics for Cs and Sr using an existing labscale steam reformer at Purdue University. The simulated storage materials will include aluminosilicates, zirconates and other stable ceramics with the potential for high Cs and Sr loading. (2) Characterize the immobilization performance, phase structure, thermal properties and stability of the simulated storage ceramics. The ceramic products will be stable oxide powders and will be characterized to quantify their leach resistance, phase structure, and thermophysical properties. The research progressed in two stages. First, a steam reforming process was used to generate candidate Cs/Sr storage materials for characterization. This portion of the research was carried out at

  10. Efficiency of aluminum-pillared montmorillonite on the removal of cesium and copper from aqueous solutions.

    Science.gov (United States)

    Karamanis, D; Assimakopoulos, P A

    2007-05-01

    Aluminum-pillared-layered montmorillonites (PILMs) were tested for their potential application in the removal of copper or cesium from aqueous solutions. By varying the initial conditions, several PILMs were prepared and characterized by means of X-ray fluorescence (XRF), proton induced gamma-ray emission (PIGE), X-ray diffraction (XRD) and sorption isotherms. Uptake of metals was studied by means of XRF spectrometry for copper sorption or gamma-ray spectrometry for cesium, using 137Cs as radiotracer. The sorption kinetics and capacity of PILMs were determined in relation to the effects of factors such as the initial metal concentration, initial pH of the solution and the presence of competitive cations. Kinetic studies showed that an equilibrium time of few minutes was needed for the adsorption of metal ions on PILMs. A pseudo-first-order equation was used to describe the sorption process for either copper or cesium. The most effective pH range for the removal of copper and cesium was found to be 4.0-6.0 and 3.0-8.0, respectively. Cesium sorption isotherms were best represented by a two-site Langmuir model while copper isotherms followed the Freundlich or the two-site Langmuir model. Cesium sorption experiments with inorganic or organic competitive cations as blocking agents revealed that the high selective sites of PILMs for cesium sorption (1-2% of total) are surface and edge sites in addition to interlayer exchange sites. In copper sorption, the two sites were determined as interlayer sites of PILMs after restoring their cation exchange capacity and sites associated with the pillar oxides.

  11. Chromatic instabilities in cesium-doped tungsten bronze nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Kenji, E-mail: kenji-adachi@ni.smm.co.jp; Ota, Yosuke; Tanaka, Hiroyuki; Okada, Mika; Oshimura, Nobumitsu; Tofuku, Atsushi [Ichikawa Research Laboratories, Sumitomo Metal Mining Co., Ltd., Ichikawa 272-8588 (Japan)

    2013-11-21

    Nanoparticles of alkali-doped tungsten bronzes are an excellent near-infrared shielding material, but exhibit slight chromatic instabilities typically upon applications of strong ultra-violet light or heating in humid environment, which acts detrimentally to long-life commercial applications. Origin of the chromatic instabilities in cesium-doped tungsten bronze has been investigated, and it has been found that the coloration and bleaching processes comprised electronic exchanges which accelerate or depress the polaron excitation and the localized surface plasmon resonance. Coloration on UV illumination is evidenced by electron diffraction as due to the formation of H{sub x}WO{sub 3}, which is considered to take place in the surface Cs-deficient WO{sub 3} region via the double charge injection mechanism. On the other hand, bleaching on heating in air and in humid environment is shown to accompany the extraction of Cs and electrons from Cs{sub 0.33}WO{sub 3} by X-ray photoelectron spectroscopy and X-ray diffraction analysis and is concluded to be an oxidation of Cs{sub 0.33}WO{sub 3} on the particle surface.

  12. The crystal structures of potassium and cesium trivanadates

    Science.gov (United States)

    Evans, H.T.; Block, S.

    1966-01-01

    Potassium and cesium trivanadates are monoclinic and isomorphous, space group P21/m, with the following dimensions (Z = 2): KV3O8, a = 7.640 A, b = 8.380 A, c = 4.979 A, ??= 96?? 57???; CsV3O8, a = 8.176 A, b = 8.519 A, c = 4.988 A, ?? = 95?? 32???. The crystal structure of KV3O8 has been determined from hk0, 0kl, and h0l Weissenberg data with an R factor of 0.15. The structure of CsV3O8 has been refined with 1273 hkl Weissenberg data to an R factor of 0.089. The structures consist of corrugated sheets based on a linkage of distorted VO6, octahedra. Two of the vanadium atoms lie in double, square-pyramid groups V2O8, which are linked through opposite basal corners into chains along the b axis. The chains are joined laterally along the c axis into sheets by the third vanadium atom in VO groups, also forming part of a square-pyramid coordination. Various aspects of these structures are compared with other known oxovanadate structures.

  13. Photoionization spectroscopy of excited states of cold cesium dimers

    CERN Document Server

    Bouloufa, Nadia; Viteau, Matthieu; Chotia, Amodsen; Fioretti, Andrea; Gabbanini, Carlo; Allegrini, Maria; Aymar, Mireille; Comparat, Daniel; Dulieu, Olivier; Pillet, Pierre

    2010-01-01

    Photoionization spectroscopy of cold cesium dimers obtained by photoassociation of cold atoms in a magneto-optical trap is reported here. In particular, we report on the observation and on the spectroscopic analysis of all the excited states that have actually been used for efficient detection of cold molecules stabilized in the triplet a^3Sigma_u^+ ground state. They are: the (1)^3Sigma_g^+ state connected to the 6s+6p asymptote, the (2)^3Sigma_g^+ and (2)^3Pi_g states connected to the 6s+5d asymptote and finally the (3)^3Sigma_g^+ state connected to the 6s + 7s asymptote. The detection through these states spans a wide range of laser energies, from 8000 to 16500 cm-1, obtained with different laser dyes and techniques. Information on the initial distribution of cold molecules among the different vibrational levels of the a^3Sigma_u^+ ground state is also provided. This spectroscopic knowledge is important when conceiving schemes for quantum manipulation, population transfer and optical detection of cold cesi...

  14. Ion exchange performance of commercial crystalline silicotitanates for cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Braun, R.; Dangieri, T.J.; Fennelly, D.J. [and others

    1996-03-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST), invented by researchers at Sandia National Laboratories and Texas A&M University, has been commercialized in a joint Sandia-UOP effort. The original developmental materials exhibited high selectivity for the ion exchange of cesium, strontium, and several other radionuclides from highly alkaline solutions containing molar concentrations of Na{sup +}. The materials also showed excellent chemical and radiation stability. Together, the high selectivity and stability of the CSTs made them excellent candidates for treatment of solutions such as the Hanford tank supernates and other DOE radwastes. Sandia National Laboratories and UOP have teamed under a Cooperative Research and Development Agreement (CRADA) to develop CSTs in the powdered form and in an engineered form suitable for column ion exchange use. A continuous-flow, column ion exchange process is expected to be used to remove Cs and other radionuclides from the Hanford supernatant. The powder material invented by the Sandia and Texas A&M team consists of submicron-size particles. It is not designed for column ion exchange but may be used in other applications.

  15. Chromatic instabilities in cesium-doped tungsten bronze nanoparticles

    Science.gov (United States)

    Adachi, Kenji; Ota, Yosuke; Tanaka, Hiroyuki; Okada, Mika; Oshimura, Nobumitsu; Tofuku, Atsushi

    2013-11-01

    Nanoparticles of alkali-doped tungsten bronzes are an excellent near-infrared shielding material, but exhibit slight chromatic instabilities typically upon applications of strong ultra-violet light or heating in humid environment, which acts detrimentally to long-life commercial applications. Origin of the chromatic instabilities in cesium-doped tungsten bronze has been investigated, and it has been found that the coloration and bleaching processes comprised electronic exchanges which accelerate or depress the polaron excitation and the localized surface plasmon resonance. Coloration on UV illumination is evidenced by electron diffraction as due to the formation of HxWO3, which is considered to take place in the surface Cs-deficient WO3 region via the double charge injection mechanism. On the other hand, bleaching on heating in air and in humid environment is shown to accompany the extraction of Cs and electrons from Cs0.33WO3 by X-ray photoelectron spectroscopy and X-ray diffraction analysis and is concluded to be an oxidation of Cs0.33WO3 on the particle surface.

  16. Hanford Isotope Project strategic business analysis Cesium-137 (Cs-137)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    The purpose of this business analysis is to address the beneficial reuse of Cesium 137 (Cs-137) in order to utilize a valuable national asset and possibly save millions of tax dollars. Food irradiation is the front runner application along with other uses. This business analysis supports the objectives of the Department of Energy National Isotope Strategy distributed in August 1994 which describes the DOE plans for the production and distribution of isotope products and services. As part of the Department`s mission as stated in that document. ``The Department of Energy will also continue to produce and distribute other radioisotopes and enriched stable isotopes for medical diagnostics and therapeutics, industrial, agricultural, and other useful applications on a businesslike basis. This is consistent with the goals and objectives of the National Performance Review. The Department will endeavor to look at opportunities for private sector to co-fund or invest in new ventures. Also, the Department will seek to divest from ventures that can more profitably or reliably be operated by the private sector.``

  17. Radiological protection and routinary controls of an activimeter with a cesium and barium sources in an nuclear medicine center; Proteccion radiologica y controles rutinarios de un activimetro con fuentes de cesio y bario en un centro de medicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Morales L, M.E. [IPEN INEN, Centro de Medicina Nuclear, Av. Aviacion 3799, Lima 34 (Peru)]. e-mail: toyoco3000@hotmail.com

    2006-07-01

    In the present work the results when carrying out the routine controls in a Deluxe Isotope (Calibrator II) equipment, with some sources of Cesium 137 and Barium 133, in a Nuclear Medicine Center that operates from the year 1983 in a modern one construction inside the Institute of Neoplastic Illnesses (INEN) are shown. Taking in account the Radiological Protection measures to verify if the equipment responds to the personnel's demands in the measurements of activities of the diverse radionuclides that are used in different types of exams that are carried out in this Nuclear Medicine Center are the objectives of this work. This Center was equipped initially with donated equipment by the International Atomic Energy Agency (IAEA) with those that it develops assistance, educational works and of research, giving services to patients of the INEN and other public and private medical centers. (Author)

  18. Removal of cesium from simulated liquid waste with countercurrent two-stage adsorption followed by microfiltration

    Energy Technology Data Exchange (ETDEWEB)

    Han, Fei; Zhang, Guang-Hui [School of Environmental Science and Engineering, Tianjin University, Tianjin, 300072 (China); Gu, Ping, E-mail: guping@tju.edu.cn [School of Environmental Science and Engineering, Tianjin University, Tianjin, 300072 (China)

    2012-07-30

    Highlights: Black-Right-Pointing-Pointer The adsorption isotherm of cesium by copper ferrocyanide followed a Freundlich model. Black-Right-Pointing-Pointer Decontamination factor of cesium was higher in lab-scale test than that in jar test. Black-Right-Pointing-Pointer A countercurrent two-stage adsorption-microfiltration process was achieved. Black-Right-Pointing-Pointer Cesium concentration in the effluent could be calculated. Black-Right-Pointing-Pointer It is a new cesium removal process with a higher decontamination factor. - Abstract: Copper ferrocyanide (CuFC) was used as an adsorbent to remove cesium. Jar test results showed that the adsorption capacity of CuFC was better than that of potassium zinc hexacyanoferrate. Lab-scale tests were performed by an adsorption-microfiltration process, and the mean decontamination factor (DF) was 463 when the initial cesium concentration was 101.3 {mu}g/L, the dosage of CuFC was 40 mg/L and the adsorption time was 20 min. The cesium concentration in the effluent continuously decreased with the operation time, which indicated that the used adsorbent retained its adsorption capacity. To use this capacity, experiments on a countercurrent two-stage adsorption (CTA)-microfiltration (MF) process were carried out with CuFC adsorption combined with membrane separation. A calculation method for determining the cesium concentration in the effluent was given, and batch tests in a pressure cup were performed to verify the calculated method. The results showed that the experimental values fitted well with the calculated values in the CTA-MF process. The mean DF was 1123 when the dilution factor was 0.4, the initial cesium concentration was 98.75 {mu}g/L and the dosage of CuFC and adsorption time were the same as those used in the lab-scale test. The DF obtained by CTA-MF process was more than three times higher than the single-stage adsorption in the jar test.

  19. Potential of Calendula alata for phytoremediation of stable cesium and lead from solutions.

    Science.gov (United States)

    Borghei, Mehdi; Arjmandi, Reza; Moogouei, Roxana

    2011-10-01

    Calendula alata plants were tested for their potential to remove stable cesium and lead from solutions in a 15-day period. The plants were grown hydroponically and placed in solutions containing CsCl and Pb(C₂H₃O₂)₂ at different concentrations (0.6, 2 and 5 mg l⁻¹). When plants were incubated in CsCl solutions 46.84 ± 2.12%, 41.35 ± 1.59%, and 52.06 ± 1.02% cesium was found to be remediated after 15 days. Moreover, more than 99% lead was removed from the Pb(C₂H₃O₂)₂ solution in all three concentrations after 15 days during the same period. When both CsCl and Pb(C₂H₃O₂)₂ were supplemented together in the solution, 9.92 ± 1.22%, 45.56 ± 3.52%, and 46.16 ± 1.48% cesium and 95.30 ± 0.72%, 96.64 ± 0.30%, and 99.02 ± 0.04% lead were removed after 15 days. The present study suggests that hydroponically grown C. alata could be used as a potential candidate plant for phytoremediation of cesium and lead from solutions; however, plants were found to be more efficient for the remediation of lead than cesium.

  20. Preparation of Modified Kaolin Filler with Cesium and Its Application in Security Paper

    Directory of Open Access Journals (Sweden)

    Houssni El-Saied

    2013-01-01

    Full Text Available In this study, cesium was added intentionally during paper manufacture for protecting the papers against forgery and counterfeiting by sorbing cesium ions (Cs+ on kaolin, used as special filler in papermaking. The sorption of cesium from aqueous solution by kaolin was studied as a function of pH, shaking time, cesium initial concentration, and mass of kaolin using batch technique. The results showed that a solution containing 10 mg/L Cs+ and 250 mg of kaolin at pH 6 can be used to modify the kaolin. Paper handsheets were prepared containing various percentages of the modified kaolin. The mechanical and optical properties of paper handsheets were studied. The prepared paper handsheets were irradiated by gamma irradiation using different doses. Fourier transform infrared (FTIR spectroscopy was used to study the effect of kaolin modification by cesium and gamma irradiation on paper handsheets properties. The results indicated that modified kaolin enhanced the mechanical and optical properties of paper handsheets. Electron spin resonance (ESR spectroscopy and laser-induced breakdown spectroscopy (LIBS were also used. They provided rapid, sensitive and nondestructive techniques in differentiating between different questioned documents. This study presents a new concept in manufacturing security papers and anticounterfeiting applications.

  1. 40 CFR 35.133 - Programs eligible for inclusion.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Programs eligible for inclusion. 35.133... Programs eligible for inclusion. (a) Eligible programs. Except as provided in paragraph (b) of this section, the environmental programs eligible, in accordance with appropriation acts, for inclusion in...

  2. 21 CFR 133.195 - Swiss and emmentaler cheese.

    Science.gov (United States)

    2010-04-01

    ... firm. The acidity of the whey at this point, calculated as lactic acid, does not exceed 0.13 percent... ingredients. Milk, nonfat milk, or cream, as defined in § 133.3, used alone or in combination. (2) Clotting... than 0.002 percent of the weight of the milk being bleached, and the weight of the potassium...

  3. 21 CFR 133.155 - Mozzarella cheese and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... separation of whey from the curd. The whey is drained, and the curd may be washed with cold water and the... safe and suitable ingredients may be used: (1) Dairy ingredients. Cow's milk, nonfat milk, or cream, as defined in § 133.3, or the corresponding products of water buffalo origin, except that cow's milk...

  4. 49 CFR 237.133 - Supervision of repairs and modifications.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Supervision of repairs and modifications. 237.133... Supervision of repairs and modifications. Each repair or modification pursuant to this part shall be performed under the immediate supervision of a railroad bridge supervisor as defined in § 237.55 of this part...

  5. 41 CFR 105-53.133 - Information Security Oversight Office.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Security... FUNCTIONS Central Offices § 105-53.133 Information Security Oversight Office. (a) Creation and authority. The Information Security Oversight Office (ISOO), headed by the Director of ISOO, who is appointed...

  6. Dicty_cDB: VFJ133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fqpmvlekk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFJ133 (VFJ1...A Score E Sequences producing significant alignments: (bits) Value N ( BJ432622 ) Dictyostelium discoideum c... significant alignments: (bits) Value AB292732_1( AB292732 |pid:none) Dictyosteli

  7. 40 CFR 164.133 - Emergency waiver of hearing.

    Science.gov (United States)

    2010-07-01

    ... Section 164.133 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS RULES OF PRACTICE GOVERNING HEARINGS, UNDER THE FEDERAL INSECTICIDE, FUNGICIDE, AND RODENTICIDE ACT... he determines: (1) That the application presents a situation involving need to use the pesticide...

  8. Sympathetic cooling in a rubidium cesium mixture: Production of ultracold cesium atoms; Sympathetisches Kuehlen in einer Rubidium-Caesium-Mischung: Erzeugung ultrakalter Caesiumatome

    Energy Technology Data Exchange (ETDEWEB)

    Haas, M.

    2007-07-01

    This thesis presents experiments for the production of ultracold rubidium cesium mixture in a magnetic trap. The long-termed aim of the experiment is the study of the interaction of few cesium atoms with a Bose-Einstein condensate of rubidium atoms. Especially by controlled variation of the cesium atom number the transition in the description of the interaction by concepts of the one-particle physics to the description by concepts of the many-particle physics shall be studied. The rubidium atoms are trapped in a magneto-optical trap (MOT) and from there reloaded into a magnetic trap. In this the rubidium atoms are stored in the state vertical stroke f=2,m{sub f}=2 right angle of the electronic ground state and evaporatively cooled by means of microwave-induced transitions into the state vertical stroke f=1,m{sub f}=1] (microwave cooling). The cesium atoms are also trppaed in a MOT and into the same magnetic trap reloaded, in which they are stored in the state vertical stroke f=4,m{sub f}=4 right angle of the electronic ground state together with rubidium. Because of the different hyperfine splitting only rubidium is evaporatively cooled, while cesium is cooled jointly sympathetically - i.e. by theramal contact via elastic collisions with rubidium atoms. The first two chapters contain a description of interatomic interactions in ultracold gases as well as a short summary of theoretical concepts in the description of Bose-Einstein condensates. The chapters 3 and 4 contain a short presentation of the methods applied in the experiment for the production of ultracold gases as well as the experimental arrangement; especially in the framework of this thesis a new coil system has been designed, which offers in view of future experiments additionally optical access for an optical trap. Additionally the fourth chapter contains an extensive description of the experimental cycle, which is applied in order to store rubidium and cesium atoms together into the magnetic trap. The

  9. Continuous Separation of Cesium Based on NiHCF/PTCF Electrode by Electrochemically Switched Ion Exchange

    Institute of Scientific and Technical Information of China (English)

    孙斌; 郝晓刚; 王忠德; 张忠林; 刘世斌; 官国清

    2012-01-01

    Nickel hexacyanoferrate (NiHCF) film was synthesized on porous three-dimensional carbon felt (PTCF) substrate by repetitious batch chemical depositions, and the NiHCF/PTCF electrode was used as electrochemically switched ion exchange (ESIX) electrode in a packed bed for continuous separation for cesium ions. The morphologies of the prepared electrodes were characterized by scanning electron microscopy and the effects of solution concentration on the ion-exchange capacity of the electrodes were investigated by cyclic voltammetry technique. Cycling stability and long-term storage stability of NiHCF/PTCF electrodes were also studied. The NiHCF/PTCF electrodes with excellent ion-exchange ability were used to assemble a diaphragm-isolated ESIX reactor for cesium separation. Continuous separation of cesium and regeneration of NiHCF/PTCF electrode based on the diaphragm-isolated reactor were performed in a laboratory-scale two-electrode system.

  10. The effects of using Cesium-137 teletherapy sources as a radiological weapon (dirty bomb)

    CERN Document Server

    Liolios, Theodore

    2009-01-01

    While radioactive sources used in medical diagnosis do not pose a great security risk due to their low level of radioactivity, therapeutic sources are extremely radioactive and can presumably be used as a radiological weapon. Cobalt-60 and Cesium-137 sources are the most common ones used in radiotherapy with over 10,000 of such sources currently in use worldwide, especially in the developing world, which cannot afford modern accelerators. The present study uses computer simulations to investigate the effects of using Cesium-137 sources from teletherapy devices as a radiological weapon. Assuming a worst-case terrorist attack scenario, we estimate the ensuing cancer mortality, land contamination, evacuation area, as well as the relevant evacuation, decontamination, and health costs in the framework of the linear risk model. The results indicate that an attack with a Cesium-137 dirty bomb in a large metropolitan city (especially one that would involve several teletherapy sources) although would not cause any sta...

  11. Phosphate ceramic solidification and stabilization of cesium-containing crystalline silicotitanate resins.

    Energy Technology Data Exchange (ETDEWEB)

    Langton, C. A.

    1999-05-11

    This paper reports on the fabrication and testing of magnesium potassium phosphate (MKP)-bonded cesium-loaded crystalline silicotitanate (CST) resins. Typical waste loading of CST resins in the final waste forms was 50 wt.%. Physical and chemical characterization of the MKP materials has shown them to be physically, chemically, and mineralogically stable. Long-term durability studies (using the AN 16.1 standard test) showed a leachability index of {approx}18 for cesium in the phosphate matrix when exposed to deionized water under ambient and elevated temperatures. Leaching of cesium was somewhat higher than in glass waste forms as per PCT and MCC-1 tests. MKP-based final waste forms showed no significant weight changes after exposure to aqueous media for {approx}90 days, indicating the highly insoluble nature of the phosphate matrix. In addition, durability of the CST-MKP waste forms was further established by freeze-thaw cycling tests.

  12. Selection of chemotherapy for metastatic mammary cancer by effect on cesium-131 uptake.

    Science.gov (United States)

    Ferguson, D J; Harper, P V

    1977-09-01

    Cesium-131 was administered intravenously to 39 patients with superficial metastases of mammary carcinoma and the concentration in tumor was compared with that in normal tissue by application of a detector in vivo, before and after 1 to 5 days of chemotherapy with cyclophosphamide (CP), 5-fluorouracil (FU), or diethylstilbestrol. A change of the cesium concentration ratio (tumor/normal tissue) greater than 15% after brief treatment correctly predicted the therapeutic effect after 1 to 39 months on the tumors that were tested in 30 of 33 tests. No reliable correlation could be made in the remaining 21 tests in which the change of ratio was less than 15%. The concentration of cesium-131 in the skin, fat, and skeletal muscle of mice was not appreciably altered by treatment for 5 days with CP or FU.

  13. Method of Preparation for High-Purity Nanocrystalline Anhydrous Cesium Perrhenate

    Directory of Open Access Journals (Sweden)

    Katarzyna Leszczyńska-Sejda

    2017-03-01

    Full Text Available This paper is devoted to the preparation of high-purity anhydrous nanocrystalline cesium perrhenate, which is applied in catalyst preparation. It was found that anhydrous cesium perrhenate with a crystal size <45 nm can be obtained using cesium ion sorption and elution using aqueous solutions of perrhenic acid with subsequent crystallisation, purification, and drying. The following composition of the as-obtained product was reported: 34.7% Cs; 48.6% Re and <2 ppm Bi; <3 ppm Zn; <2 ppm As; <10 ppm Ni; < 3 ppm Mg; <5 ppm Cu; <5 ppm Mo; <5 ppm Pb; <10 ppm K; <2 ppm Na; <5 ppm Ca; <3 ppm Fe.

  14. Cesium removal from liquid acidic wastes with the primary focus on ammonium molybdophosphate as an ion exchanger: A literature review

    Energy Technology Data Exchange (ETDEWEB)

    Miller, C.J.

    1995-03-01

    Many articles have been written concerning the selective removal of cesium from both acidic and alkaline defense wastes. The majority of the work performed for cesium removal from defense wastes involves alkaline feed solutions. Several different techniques for cesium removal from acidic solutions have been evaluated such as precipitation, solvent extraction, and ion exchange. The purpose of this paper is to briefly review various techniques for cesium removal from acidic solutions. The main focus of the review will be on ion exchange techniques, particularly those involving ammonium molybdophosphate as the exchanger. The pertinent literature sources are condensed into a single document for quick reference. The information contained in this document was used as an aid in determining techniques to evaluate cesium removal from the acidic Idaho Chemical Processing Plant waste matrices. 47 refs., 2 tabs.

  15. An Integrated Hydrologic Modeling Approach to Cesium-137 Transport in Forested Fukushima Watersheds

    Science.gov (United States)

    Siirila-Woodburn, E. R.; Steefel, C. I.; Williams, K. H.; Birkholzer, J. T.

    2015-12-01

    The 2011 Fukushima Daiichi Nuclear Power Plant (FDNPP) accident in Japan resulted in a significant dissemination of cesium-137 (Cs-137) over a wide area west of the plant, including the contamination of many watersheds and the subsequent evacuation of many communities. Today approximately 90% of on-land Cs-137 fallout following the accident resides in the upper 5 cm of forest soils. While this can be partially attributed to the forested composition of the prefecture (70%), there is also difficulty in cleanup efforts in these regions due to a lack of understanding and predictive capability of radioisotopes transport at the catchment to watershed scale. Subsequently, there is an uncertain, but likely long-term impact on local communities with implications for the use of nuclear energy use worldwide. Due to the complex nature of forest eco-hydrology, sophisticated modeling tools to accurately predict Cs-137 fluxes across different spatial and temporal scales are required. High fidelity, high resolution numerical modeling techniques in conjunction with parallel high performance computing is required to accurately determine transport and feedbacks in these complex systems. To better understand the fundamental transport of Cs-137, a watershed near the FDNPP is modeled with an integrated hydrologic model that includes variably saturated groundwater and overland flow in addition to atmospheric and vegetative processes via a coupled land surface model. Of specific interest is the impact of land cover type on hydrologic flow in the area, which will likely play an important role in erosion patterns and the consequent transport of Cs-137 strongly sorbed to surface soils. Risk management practices (for example, passive remediation versus active remediation such as targeted logging) for two principal tree types (evergreen and deciduous) are informed given the simulated responses to flow patterns assuming different quantities and spatial distribution patterns of each tree type.

  16. Small-Column Cesium Ion Exchange Elution Testing of Spherical Resorcinol-Formaldehyde

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Garrett N.; Russell, Renee L.; Peterson, Reid A.

    2011-10-21

    This report summarizes the work performed to evaluate multiple, cesium loading, and elution cycles for small columns containing SRF resin using a simple, high-level waste (HLW) simulant. Cesium ion exchange loading and elution curves were generated for a nominal 5 M Na, 2.4E-05 M Cs, 0.115 M Al loading solution traced with 134Cs followed by elution with variable HNO3 (0.02, 0.07, 0.15, 0.23, and 0.28 M) containing variable CsNO3 (5.0E-09, 5.0E-08, and 5.0E-07 M) and traced with 137Cs. The ion exchange system consisted of a pump, tubing, process solutions, and a single, small ({approx}15.7 mL) bed of SRF resin with a water-jacketed column for temperature-control. The columns were loaded with approximately 250 bed volumes (BVs) of feed solution at 45 C and at 1.5 to 12 BV per hour (0.15 to 1.2 cm/min). The columns were then eluted with 29+ BVs of HNO3 processed at 25 C and at 1.4 BV/h. The two independent tracers allowed analysis of the on-column cesium interaction between the loading and elution solutions. The objective of these tests was to improve the correlation between the spent resin cesium content and cesium leached out of the resin in subsequent loading cycles (cesium leakage) to help establish acid strength and purity requirements.

  17. Cesium and Strontium Specific Exchangers for Nuclear Waste Effluent Remediation

    Energy Technology Data Exchange (ETDEWEB)

    A. Clearfield; A. I. Bortun; L. A. Bortun; E. A. Bhlume; P. Sylvester; G. M. Graziano

    2000-09-01

    During the past 50 years, nuclear defense activities have produced large quantities of nuclear waste that now require safe and permanent disposal. The general procedure to be implemented involves the removal of cesium and strontium from the waste solutions for disposal in permanently vitrified media. This requires highly selective sorbents or ion exchangers. Further, at the high radiation doses present in the solution, organic exchangers or sequestrants are likely to decompose over time. Inorganic ion exchangers are resistant to radiation damage and can exhibit remarkably high selectivities. We have synthesized three families of tunnel-type ion exchangers. The crystal structures of these compounds as well as their protonated phases, coupled with ion exchange titrations, were determined and this information was used to develop an understanding of their ion exchange behavior. The ion exchange selectivities of these phases could be regulated by isomorphous replacement of the framework metals by larger or smaller radius metals. In the realm of layered compounds, we prepared alumina, silica, and zirconia pillared clays and sodium micas. The pillared clays yielded very high Kd values for Cs+ and were very effective in removing Cs+ from groundwaters. The sodium micas also had a high affinity for Cs+ but an even greater attraction for S42+. They also possess the property of trapping these ions permanently as the layers slowly decrease their interlayer distance as loading occurs. Sodium nonatitanate exhibited extremely high Kd values for Sr2+ in alkaline tank wastes and should be considered for removal of Sr2+ in such cases. For tank wastes containing complexing agents, we have found that adding Ca2+ to the solution releases the complexed Sr2+ which may then be removed with the CST exchanger.

  18. A direct frequency comb for two-photon transition spectroscopy in a cesium vapor

    Institute of Scientific and Technical Information of China (English)

    Zhang Yi-Chi; Wu Ji-Zhou; Li Yu-Qing; Jin Li; Ma Jie; Wang Li-Rong; Zhao Yan-Ting; Xiao Lian-Tuan; Jia Suo-Tang

    2012-01-01

    A phase-stabilized femtosecond frequency comb is used to measure high-resolution spectra of two-photon transition 62S1/2-62P1/2,3/2-82S1/2 in a cesium vapor.The broadband laser output from a femtosecond frequency comb is split into counter-propagating parts,shaped in an original way,and focused into a room-temperature cesium vapor.We obtain high-resolution two-photon spectroscopy by scanning the repetition rate of femtosecond frequency comb,and through absolute frequency measurements.

  19. Safety evaluation for packaging (onsite) for cesium chloride capsules with type W overpacks

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, J.C.

    1997-09-15

    This Safety Evaluation for Packaging (SEP) documents the evaluation of a new basket design and overpacked cesium chloride capsule payload for the Beneficial Uses Shipping System (BUSS) Cask in accordance with the onsite transportation requirements of the Hazardous Material Packaging and Shipping manual, WHC-CM-2-14. This design supports the one-time onsite shipment of 16 cesium chloride capsules with Type W overpacks from the 324 Building to the 224T Building at the Waste Encapsulation and Storage Facility (WESF). The SEP is valid for a one-time onsite shipment or until August 1, 1998, whichever occurs first.

  20. Synthesis of novel calixcrown derivatives with selective complexation towards cesium ions

    Institute of Scientific and Technical Information of China (English)

    Lu Zhang; Juan Du; Li Hua Yuan; Dong Zhang; Gui Ping Dan; Yuan You Yang; Wen Feng

    2011-01-01

    A series of novel calix [4]arenecrown-6 derivatives with an alkenyl loop of various sizes 5-8 were synthesized via intramolecular ring closing olefin metathesis and characterized by 1H NMR, 13C NMR and ESI-HRMS. Their complexation property towards cesium ion was studied by 'H NMR technique. Two-phase extraction of alkali metal ions using UV-vis spectroscopy revealed remarkably different extractabilities. These results indicate that the complexation capacities towards cesium ions can be tuned and controlled through cooperative regulation of the strain of the loop and conformational change of calixcrown skelton.

  1. Computational study of organo-cesium complexes and the possibility of lanthanide/actinide ions substitution

    Science.gov (United States)

    Rabanal-León, Walter A.; Martinez-Ariza, Guillermo; Roberts, Sue A.; Hulme, Christopher; Arratia-Pérez, Ramiro

    2015-11-01

    Relativistic DFT calculations suggest that two organo-cesium complexes studied herein afford large HOMO-LUMO gaps of around 2.4 eV with the PBE xc-functional, which accounts for their stability. Energy decomposition studies suggest these two complexes are largely ionic with about 20% covalency. However, when the Cs+ ions are substituted by the isoelectronic La3+ and Th4+, their predicted ionicity decreases significantly. The significant increase in covalence indicates that employing Ugi reaction cascades that afford tetramic acid-based organo-cesium complexes may be extended to La3+ and Th4+ organometallics.

  2. Heat Transfer During Evaporation of Cesium From Graphite Surface in an Argon Environment

    Directory of Open Access Journals (Sweden)

    Bespala Evgeny

    2016-01-01

    Full Text Available The article focuses on discussion of problem of graphite radioactive waste formation and accumulation. It is shown that irradiated nuclear graphite being inalienable part of uranium-graphite reactor may contain fission and activation products. Much attention is given to the process of formation of radioactive cesium on the graphite element surface. It is described a process of plasma decontamination of irradiated graphite in inert argon atmosphere. Quasi-one mathematical model is offered, it describes heat transfer process in graphite-cesium-argon system. Article shows results of calculation of temperature field inside the unit cell. Authors determined the factors which influence on temperature change.

  3. Filter Performance of a Cesium Faraday Optical Filter at 852 nm

    Institute of Scientific and Technical Information of China (English)

    掌蕴东; 贾晓玲; 毕勇; 马祖光; 王骐

    2002-01-01

    We have investigated a cesium Faraday filter at 852nm in relatively weak and strong magnetic fields, theoretically and experimentally. With a cesium cell of 0.02m length in an axial magnetic field of 0.06T, the line-centre operation has been achieved. The calculated peak transmission reached 99% with a full width at half maximum (FWHM) bandwidth of only 3.9 GHz. The measured FWHM bandwidth of the filter is 3.29 GHz, which is in general agreement with the theoretical result.

  4. Concentration Ratios for Cesium and Strontium in Produce Near Los Alamos

    Energy Technology Data Exchange (ETDEWEB)

    S. Salazar, M.McNaughton, P.R. Fresquez

    2006-03-01

    The ratios of the concentrations of radionuclides in produce (fruits, vegetables, and grains) to the concentrations in the soil have been measured for cesium and strontium at locations near Los Alamos. The Soil, Foodstuffs, and Biota Team of the Meteorology and Air Quality Group of the Los Alamos National Laboratory (LANL) obtained the data at locations within a radius of 50 miles of LANL. The concentration ratios are in good agreement with previous measurements: 0.01 to 0.06 for cesium-137 and 0.1 to 0.5 for strontium-90 (wet-weight basis).

  5. Reciprocal repression between Fgf8 and miR-133 regulates cardiac induction through Bmp2 signaling

    Directory of Open Access Journals (Sweden)

    Carmen Lopez-Sanchez

    2015-12-01

    Full Text Available This data article contains complementary figures and results related to the research article entitled “Negative Fgf8-Bmp2 feed-back is controlled by miR-130 during early cardiac specification” [15], which reveals what specific role miR-130 plays during the cardiac induction process. This study evidenced miR-130 a putative microRNA that targets Erk1/2 (Mapk1 3′UTR- as a necessary linkage in the control of Fgf8 signaling, mediated by Bmp2. Thus, miR-130 regulates a negative Fgf8-Bmp2 feed-back loop responsible to achieve early cardiac specification. A significant aspect supporting our conclusions is given by the expression pattern of miR-130 during early cardiac specification, as well as by those results obtained after the designed experimental procedures. The data presented here reveal that miR-133 is also expressed within the precardiac areas during early cardiogenesis, pattern which is comparable to that of FGFR1, receptor involved in the Fgf8/ERK signaling pathway. Interestingly, our miR-133 overexpression experiments resulted in a decrease of Fgf8 expression, whereas we observed an increase of Bmp2 and subsequently of cardiac specific markers Nkx-2.5 and Gata4. Additionally, our loss-of-function experiments -through Fgf8 siRNA electroporation- showed an increase of miR-133 expression. Finally, after our Bmp2 experiments, we observed that miR-133 is upstream-regulated by Bmp2. All those results suggest that miR-133 also constitutes a crucial linkage in the crosstalk between Fgf8 and Bmp2 signaling by regulating the Fgf8/ERK pathway during cardiac induction.

  6. Reciprocal repression between Fgf8 and miR-133 regulates cardiac induction through Bmp2 signaling.

    Science.gov (United States)

    Lopez-Sanchez, Carmen; Franco, Diego; Bonet, Fernando; Garcia-Lopez, Virginio; Aranega, Amelia; Garcia-Martinez, Virginio

    2015-12-01

    This data article contains complementary figures and results related to the research article entitled "Negative Fgf8-Bmp2 feed-back is controlled by miR-130 during early cardiac specification" [15], which reveals what specific role miR-130 plays during the cardiac induction process. This study evidenced miR-130 a putative microRNA that targets Erk1/2 (Mapk1) 3'UTR- as a necessary linkage in the control of Fgf8 signaling, mediated by Bmp2. Thus, miR-130 regulates a negative Fgf8-Bmp2 feed-back loop responsible to achieve early cardiac specification. A significant aspect supporting our conclusions is given by the expression pattern of miR-130 during early cardiac specification, as well as by those results obtained after the designed experimental procedures. The data presented here reveal that miR-133 is also expressed within the precardiac areas during early cardiogenesis, pattern which is comparable to that of FGFR1, receptor involved in the Fgf8/ERK signaling pathway. Interestingly, our miR-133 overexpression experiments resulted in a decrease of Fgf8 expression, whereas we observed an increase of Bmp2 and subsequently of cardiac specific markers Nkx-2.5 and Gata4. Additionally, our loss-of-function experiments -through Fgf8 siRNA electroporation- showed an increase of miR-133 expression. Finally, after our Bmp2 experiments, we observed that miR-133 is upstream-regulated by Bmp2. All those results suggest that miR-133 also constitutes a crucial linkage in the crosstalk between Fgf8 and Bmp2 signaling by regulating the Fgf8/ERK pathway during cardiac induction.

  7. New Limits on Local Lorentz Invariance in Mercury and Cesium

    CERN Document Server

    Peck, S K; Stein, D; Orbaker, D; Foss, A; Hummon, M T; Hunter, L R

    2012-01-01

    We report new bounds on Local Lorentz Invariance (LLI) violation in Cs and Hg. The limits are obtained through the observation of the the spin- precession frequencies of 199Hg and 133Cs atoms in their ground states as a function of the orientation of an applied magnetic field with respect to the fixed stars. We measure the amplitudes of the dipole couplings to a preferred direction in the equatorial plane to be 19(11) nHz for Hg and 9(5) microHz for Cs. The upper bounds established here improve upon previous bounds by about a factor of four. The improvement is primarily due to mounting the apparatus on a rotating table. New bounds are established on several terms in the standard model extension including the first bounds on the spin-couplings of the neutron and proton to the z direction, <7e-30 GeV and <7e-29 GeV, respectively.

  8. Differential number of CD34+, CD133+ and CD34+/CD133+ cells in peripheral blood of patients with congestive heart failure

    Directory of Open Access Journals (Sweden)

    Fritzenwanger M

    2009-03-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC which are characterised by the simulateous expression of CD34, CD133 and vascular endothelial growth receptor 2 (VEGF 2 are involved in the pathophysiology of congestive heart failure (CHF and their number and function is reduced in CHF. But so far our knowledge about the number of circulating hematopoietic stem/progenitor cells (CPC expressing the early hematopoietic marker CD133 and CD34 in CHF is spares and therefore we determined their number and correlated them with New York Heart Association (NYHA functional class. Methods CD34 and CD133 surface expression was quantified by flow cytometry in the peripheral venous blood of 41 healthy adults and 101 patients with various degrees of CHF. Results CD34+, CD133+ and CD34+/CD133+ cells correlated inversely with age. Both the number of CD34+ and of CD34+/CD133+ cells inversely correlated with NYHA functional class. The number of CD133+ cells was not affected by NYHA class. Furthermore the number of CD133+ cells did not differ between control and CHF patients. Conclusion In CHF the release of CD34+, CD133+ and CD34+/CD133+ cells from the bone marrow seems to be regulated differently. Modulating the releasing process in CHF may be a tool in CHF treatment.

  9. Seasonal concentrations of cesium-137 in rumen content, skeletal muscles and feces of caribou from the Porcupine herd: lichen ingestion rates and implications for human consumption

    Directory of Open Access Journals (Sweden)

    A. C. Allaye-Chan

    1990-09-01

    Full Text Available The Porcupine caribou herd was monitored for cesium-137 during 1987 to address human health concerns over potential meat contamination by radioactive fallout from the Chernobyl accident, and to determine lichen intake rates based on body burdens of radiocesium. A total of 36 caribou were collected from northwestern Alaska and the Yukon Territories in March, June, September, and November. Mean radiocesium concentrations in skeletal muscle peaked in March at 133 Bq/kg fresh weight. This value should not prove hazardous to human health. Radiocesium concentrations in skeletal muscle (wet weight ranged from approximately 22 to 50% of radiocesium concentrations in rumen contents (dry weight, and from approximately 15 to 37% of radiocesium concentrations in feces (dry weight. Radioactivity in feces was significantly correlated with radioactivity in rumen contents. Computer simulations relating lichen intake rates to radiocesium body burdens are presented for 3 scenarios: (1 when seasonal intakes were adjusted to provide the optimum fit between simulated and observed radiocesium body burdens (2 when seasonal intakes were based on empirical data, and (3 when seasonal intakes were adjusted to yield a "conventional" radiocesium curve of a slow fall build-up prior to a late winter plateau.

  10. Quantum dots affect expression of CD133 surface antigen in melanoma cells

    Directory of Open Access Journals (Sweden)

    Steponkiene S

    2011-10-01

    Full Text Available Simona Steponkiene1-3, Simona Kavaliauskiene1, Rasa Purviniene4, Ricardas Rotomskis3,5, Petras Juzenas11Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Radiumhospital, Oslo, Norway; 2Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania; 3Biomedical Physics Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 4Immunology Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 5Biophotonics Laboratory, Laser Research Center, Vilnius University, Vilnius, LithuaniaBackground: In novel treatment approaches, therapeutics should be designed to target cancer stem cells (CSCs. Quantum dots (QDs are a promising new tool in fighting against cancer. However, little is known about accumulation and cytotoxicity of QDs in CSCs.Methods: Accumulation and cytotoxicity of CdTe-MPA (mercaptopropionic acid QDs in CSCs were assessed using flow cytometry and fluorescence-activated cell sorting techniques as well as a colorimetric cell viability assay.Results: We investigated the expression of two cell surface-associated glycoproteins, CD44 and CD133, in four different cancer cell lines (glioblastoma, melanoma, pancreatic, and prostate adenocarcinoma. Only the melanoma cells were positive to both markers of CD44 and CD133, whereas the other cells were only CD44-positive. The QDs accumulated to a similar extent in all subpopulations of the melanoma cells. The phenotypical response after QD treatment was compared with the response after ionizing radiation treatment. The percentage of the CD44high-CD133high subpopulation decreased from 72% to 55%–58% for both treatments. The stem-like subpopulation CD44highCD133low/- increased from 26%–28% in the untreated melanoma cells to 36%–40% for both treatments.Conclusion: Treatment of melanoma cells with QDs results in an increase of stem-like cell subpopulations. The changes in phenotype distribution of the melanoma cells after

  11. Malignant behaviorial characteristics of CD133(+/-) glioblastoma cells from a Northern Chinese population.

    Science.gov (United States)

    Liu, Xiaozhi; Chen, Lei; Jiang, Zhongmin; Wang, Junfei; Su, Zhiguo; Li, Gang; Yu, Shizhu; Liu, Zhenlin

    2013-01-01

    Following emergence of the tumor stem cell theory, the increasing number of related studies demonstrates the theory's growing importance in cancer research and its potential for clinical applications. Few studies have addressed the in vitro or in vivo properties of glioma stem cells from a Han Chinese population. In the present study, surgically obtained glioblastoma tissue was classified into two subtypes, CD133(+) and CD133(-). The hierarchy, invasiveness, growth tolerance under low nutrient conditions and colony forming abilities of the tissue samples were analyzed. Additionally, the characteristics of tumor cells transplanted subcutaneously or re-transplanted into nude mice were observed. The results demonstrated that CD133(+) glioblastoma cells derived from Han Chinese glioma specimens were more prone to primitive cell differentiation and more invasive than CD133(-) glioblastoma cells, leading to increased tumor malignancy compared with CD133(-) cells. The tumor formation rates of CD133(+) and CD133(-) cells in mice were 26/30 and 2/30, respectively. A comparison of tumor subtypes demonstrated that CD133(+) glioblastoma cells had a lower incidence of cell apoptosis in the tumor tissue and higher protein expression levels of Oct4, Sox2, PCNA, EGFR, Ang2, MMP2 and MMP9 compared with CD133(-) cells. Flow cytometry revealed that in the CD133(+) and CD133(-) glioblastoma cell-induced tumors, the percentage of CD133(+) cells was 2.47±0.67 and 0.44±0.14%, respectively. The tumor formation rates following the re-transplantation of CD133(+) or CD133(-) tumors into nude mice were 10/10 and 4/10, respectively. These findings suggest that the CD133(+) glioblastoma cell subpopulation has a stronger malignant cell phenotype than the CD133(-) subpopulation and that its recurrence rate is increased compared with the primitive tumorigenic rate following in vivo transplantation.

  12. Internal radiotherapy with copper-64-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) reduces CD133{sup +} highly tumorigenic cells and metastatic ability of mouse colon carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Yoshii, Yukie [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Furukawa, Takako [Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan); Kiyono, Yasushi [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Watanabe, Ryo [Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Mori, Tetsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Yoshii, Hiroshi [Faculty of Medical Sciences, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Asai, Tatsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Okazawa, Hidehiko [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Welch, Michael J. [Mallinckrodt Institute of Radiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Fujibayashi, Yasuhisa, E-mail: yfuji@nirs.go.j [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan)

    2011-02-15

    Introduction: {sup 64}Cu-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) ({sup 64}Cu-ATSM) is an imaging agent for positron emission tomography (PET) that targets hypoxic tumors. {sup 64}Cu-ATSM is also reported to be a potential agent for internal radiotherapy. In a mouse colon carcinoma (Colon-26) model, we have shown that {sup 64}Cu-ATSM preferentially localizes in intratumoral regions with a high density of CD133{sup +} cells, which show characteristics of cancer stem cells or cancer stem cell-like cells (collectively referred here as CSCs). In this study, we evaluated the therapeutic effect of {sup 64}Cu-ATSM in relation to CD133 expression using this model. Methods: Systemic administration of 37 MBq {sup 64}Cu-ATSM or saline was conducted twice within a 1-week interval to mice bearing 1-week-old Colon-26 tumors (days 0-7). At day 19, tumor size measurement, flow cytometry analysis and experimental lung metastatic assay were performed. The therapeutic effect of {sup 64}Cu-ATSM on sorted CD133{sup +} and CD133{sup -} Colon-26 cells was also examined in vitro. Results: In vivo studies showed that {sup 64}Cu-ATSM treatment inhibited tumor growth. The percentage of CD133{sup +} cells and metastatic ability in {sup 64}Cu-ATSM treated tumors was decreased compared with that in control animals. In vitro studies demonstrated that {sup 64}Cu-ATSM accumulated in cells under hypoxic conditions and incorporation of {sup 64}Cu-ATSM under hypoxia caused cell death in both CD133{sup +} and CD133{sup -} cells in a similar extent. Conclusions: {sup 64}Cu-ATSM administration reduced tumor volume as well as the percentage of CD133{sup +} cells and the metastatic ability of Colon-26 tumors. Together with our data, it is suggested that {sup 64}Cu-ATSM accumulates in regions high in CD133{sup +} highly tumorigenic cells and kills such regions by radiation, resulting in a decrease of the percentage of CD133{sup +} cells.

  13. Electromagnetically-induced transparency in a multi-V-type system in cesium atomic vapour

    Institute of Scientific and Technical Information of China (English)

    赵建明; 尹王保; 汪丽蓉; 肖连团; 贾锁堂

    2002-01-01

    Electromagnetically-induced transparency is observed in a three-level multi-V-type system in cesium vapour atroom temperature. The absorption property is measured and the hyperfine structures of atomic states can be determined.The results of the experiment agree with the theoretical analysis.

  14. Deciphering the measured ratios of Iodine-131 to Cesium-137 at the Fukushima reactors

    CERN Document Server

    Matsui, T

    2011-01-01

    We calculate the relative abundance of the radioactive isotopes Iodine-131 and Cesium-137 produced by nuclear fission in reactors and compare it with data taken at the troubled Fukushima Dai-ichi nuclear power plant. The ratio of radioactivities of these two isotopes can be used to obtain information about when the nuclear reactions terminated.

  15. Observation of microporous cesium salts of 12-tungstosilicic acid using scanning transmission electron microscopy.

    Science.gov (United States)

    Hiyoshi, Norihito; Kamiya, Yuichi

    2015-06-21

    Heteropolyanions and their arrays in microporous cesium salts of 12-tungstosilicic acid, Cs2.5H1.5[SiW12O40] and Cs4.0[SiW12O40], were observed by aberration-corrected scanning transmission electron microscopy. Microstructures that form micropores in the polyoxometalates were visualized.

  16. Physical barrier effect of geopolymeric waste form on diffusivity of cesium and strontium.

    Science.gov (United States)

    Jang, J G; Park, S M; Lee, H K

    2016-11-15

    The present study investigates the physical barrier effect of geopolymeric waste form on leaching behavior of cesium and strontium. Fly ash-based geopolymers and slag-blended geopolymers were used as solidification agents. The leaching behavior of cesium and strontium from geopolymers was evaluated in accordance with ANSI/ANS-16.1. The diffusivity of cesium and strontium in a fly ash-based geopolymer was lower than that in Portland cement by a factor of 10(3) and 10(4), respectively, showing significantly improved immobilization performance. The leaching resistance of fly ash-based geopolymer was relatively constant regardless of the type of fly ash. The diffusivity of water-soluble cesium and strontium ions were highly correlated with the critical pore diameter of the binder. The critical pore diameter of the fly ash-based geopolymer was remarkably smaller than those of Portland cement and slag-blended geopolymer; consequently, its ability physically to retard the diffusion of nuclides (physical barrier effect) was superior.

  17. Assessment of commercially available ion exchange materials for cesium removal from highly alkaline wastes

    Energy Technology Data Exchange (ETDEWEB)

    Brooks, K.P.; Kim, A.Y.; Kurath, D.E.

    1996-04-01

    Approximately 61 million gallons of nuclear waste generated in plutonium production, radionuclide removal campaigns, and research and development activities is stored on the Department of Energy`s Hanford Site, near Richland, Washington. Although the pretreatment process and disposal requirements are still being defined, most pretreatment scenarios include removal of cesium from the aqueous streams. In many cases, after cesium is removed, the dissolved salt cakes and supernates can be disposed of as LLW. Ion exchange has been a leading candidate for this separation. Ion exchange systems have the advantage of simplicity of equipment and operation and provide many theoretical stages in a small space. The organic ion exchange material Duolite{trademark} CS-100 has been selected as the baseline exchanger for conceptual design of the Initial Pretreatment Module (IPM). Use of CS-100 was chosen because it is considered a conservative, technologically feasible approach. During FY 96, final resin down-selection will occur for IPM Title 1 design. Alternate ion exchange materials for cesium exchange will be considered at that time. The purpose of this report is to conduct a search for commercially available ion exchange materials which could potentially replace CS-100. This report will provide where possible a comparison of these resin in their ability to remove low concentrations of cesium from highly alkaline solutions. Materials which show promise can be studied further, while less encouraging resins can be eliminated from consideration.

  18. Evaluation of Factors Affecting Cesium Extraction Performance by Calix[4]Arene Derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Rumppe, J.L.; Delmau, L.

    2004-01-01

    Novel aza-crown derivatives of dioctyloxy-calix[4]arene crown-6 were examined for their cesium extraction performance at different pH levels. These studies are of interest in addressing high-level waste tank remediation and the removal of 137Cs, a major contributor to heat and radiation generation. Preliminary studies were done to assess the performance of these calixarene compounds under varying conditions. Results showed an increase of cesium extraction with pH as well as expected trends in diluent effects and anion selectivity. Poor extraction performance of some aza-crown derivatives raised questions regarding the possibility of intramolecular hydrogen-bonding. A novel methylated derivative was used to address these questions. Additional experiments were conducted to determine the extraction effect on pH. Results indicate an increase in cesium extraction with pH, as shown in preliminary studies. Mono-aza derivatives were shown to exhibit better cesium extraction performance than their di-aza counterparts. The methylated derivative showed poorer extraction performance than the non-methylated derivative, indicating that completely removing the possibility of intramolecular hydrogen-bonding has negative effects on extraction performance. This suggests that the hydrogen-bonding facilitates anion co-extraction, which would lead to better overall extraction. Mono-aza derivatives were shown to cause unexpected changes in pH. This could possibly be attributed to protonation of the calix crown.

  19. Removal of cesium ion in aqueous solution using immobilized sericite beads

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Choong [Kwandong University, Gangneung (Korea, Republic of); Kim, Jong-Oh [Hanyang University, Seoul (Korea, Republic of); Lee, Seung-Mok [Gangneung-Wonju National University, Gangneung (Korea, Republic of)

    2014-07-15

    To apply sericite effectively in the adsorption process, it was immobilized by entrapment method using sodium alginate. Since the immobilized sericite beads have excellent mechanical strength and swelling characteristics, channeling of flow and the increase of pressure drop were not observed through column operations. In addition, it was also stable under pH 10 and 45 .deg. C of cesium solution. The maximum adsorption capacity and Langmuir adsorption constant was 1.430mg/g and 2.329 L/mg, respectively, at initial pH 5 of cesium solution in batch type and the Langmuir model with higher correlation coefficient of 0.997 fits experimental data better than Freundlich model. The breakthrough point emerged around 15 (1.0 mL/min) and 20 bed volumes (0.5 mL/min), and the cesium ions bound to the immobilized sericite beads were readily released and quantitatively recovered by a few bed volumes of 1.0M of HNO{sub 3} solution. Furthermore, bed volumes of cesium ions for firstly reused sericite beads can be still maintained as 18, which shows good regeneration ability.

  20. Carbon, cesium and iodine isotopes in Japanese cedar leaves from Iwaki, Fukushima

    DEFF Research Database (Denmark)

    Xu, Sheng; Cook, Gordon T.; Cresswell, Alan J.;

    2016-01-01

    Japanese cedar leaves from Iwaki, Fukushima were analyzed for carbon, cesium and iodine isotopic compositions before and after the 2011 nuclear accident. The Δ14C values reflect ambient atmospheric 14C concentrations during the year the leaves were sampled/defoliated, and also previous year...

  1. Molecular analysis of ex-vivo CD133+ GBM cells revealed a common invasive and angiogenic profile but different proliferative signatures among high grade gliomas

    Directory of Open Access Journals (Sweden)

    Garcia Juan L

    2010-08-01

    Full Text Available Abstract Background Gliomas are the most common type of primary brain tumours, and in this group glioblastomas (GBMs are the higher-grade gliomas with fast progression and unfortunate prognosis. Two major aspects of glioma biology that contributes to its awful prognosis are the formation of new blood vessels through the process of angiogenesis and the invasion of glioma cells. Despite of advances, two-year survival for GBM patients with optimal therapy is less than 30%. Even in those patients with low-grade gliomas, that imply a moderately good prognosis, treatment is almost never curative. Recent studies have demonstrated the existence of a small fraction of glioma cells with characteristics of neural stem cells which are able to grow in vitro forming neurospheres and that can be isolated in vivo using surface markers such as CD133. The aim of this study was to define the molecular signature of GBM cells expressing CD133 in comparison with non expressing CD133 cells. This molecular classification could lead to the finding of new potential therapeutic targets for the rationale treatment of high grade GBM. Methods Eight fresh, primary and non cultured GBMs were used in order to study the gene expression signatures from its CD133 positive and negative populations isolated by FACS-sorting. Dataset was generated with Affymetrix U133 Plus 2 arrays and analysed using the software of the Affymetrix Expression Console. In addition, genomic analysis of these tumours was carried out by CGH arrays, FISH studies and MLPA; Results Gene expression analysis of CD133+ vs. CD133- cell population from each tumour showed that CD133+ cells presented common characteristics in all glioblastoma samples (up-regulation of genes involved in angiogenesis, permeability and down-regulation of genes implicated in cell assembly, neural cell organization and neurological disorders. Furthermore, unsupervised clustering of gene expression led us to distinguish between two groups

  2. 27 CFR 478.133 - Records of transactions in semiautomatic assault weapons.

    Science.gov (United States)

    2010-04-01

    ... semiautomatic assault weapons. 478.133 Section 478.133 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... AMMUNITION Records § 478.133 Records of transactions in semiautomatic assault weapons. The evidence specified in § 478.40(c), relating to transactions in semiautomatic assault weapons, shall be retained in...

  3. Preparation and characterization of cesium-137 aluminosilicate pellets for radioactive source applications

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, F.J.; Tompkins, J.A.; Haff, K.W.; Case, F.N.

    1981-07-01

    Twenty-seven fully loaded /sup 137/Cs aluminosilicate pellets were fabricated in a hot cell by the vacuum hot pressing of a cesium carbonate/montmorillonite clay mixture at 1500/sup 0/C and 570 psig. Four pellets were selected for characterization studies which included calorimetric measurements, metallography, scanning electron microscope and electron backscattering (SEM-BSE), electron microprobe, x-ray diffraction, and cesium ion leachability measurements. Each test pellet contained 437 to 450 curies of /sup 137/Cs as determined by calorimetric measurements. Metallographic examinations revealed a two-phase system: a primary, granular, gray matrix phase containing large and small pores and small pore agglomerations, and a secondary fused phase interspersed throughout the gray matrix. SEM-BSE analyses showed that cesium and silicon were uniformly distributed throughout both phases of the pellet. This indicated that the cesium-silicon-clay reaction went to completion. Aluminum homogeneity was unconfirmed due to the high background noise associated with the inherent radioactivity of the test specimens. X-ray diffraction analyses of both radioactive and non-radioactive aluminosilicate pellets confirmed the crystal lattice structure to be pollucite. Cesium ion quasistatic leachability measurements determined the leach rates of fully loaded /sup 137/Cs sectioned pollucite pellets to date to be 4.61 to 34.4 x 10/sup -10/ kg m/sup -2/s/sup -1/, while static leach tests performed on unsectioned fully loaded pellets showed the leach rates of the cesium ion to date to be 2.25 to 3.41 x 10/sup -12/ kg m/sup -2/s/sup -1/. The cesium ion diffusion coefficients through the pollucite pellet were calculated using Fick's first and second laws of diffusion. The diffusion coefficients calculated for three tracer level /sup 137/Cs aluminosilicate pellets were 1.29 x 10/sup -16/m/sup 2/s/sup -1/, 6.88 x 10/sup -17/m/sup 2/s/sup -1/, and 1.35 x 10/sup -17/m/sup 2/s/sup -1

  4. Ion exchange kinetics of cesium for various reaction designs using crystalline silicotitanate, UOP IONSIV IE-911

    Science.gov (United States)

    Kim, Sung Hyun

    Through collaborative efforts at Texas A&M University and Sandia National Laboratories, a crystalline silicotitanate (CST), which shows extremely high selectivity for radioactive cesium removal in highly concentrated sodium solutions, was synthesized. The effect of hydrogen peroxide on a CST under cesium ion exchange conditions has been investigated. The experimental results with hydrogen peroxide showed that the distribution coefficient of cesium decreased and the tetragonal phase, the major component of CST, slowly dissolved at hydrogen peroxide concentrations greater than 1 M. A simple and novel experimental apparatus for a single-layer ion exchange column was developed to generate experimental data for estimation of the intraparticle effective diffusivity. A mathematical model is presented for estimation of effective diffusivities for a single-layer column of CST granules. The intraparticle effective diffusivity for Cs was estimated as a parameter in the analytical solution. By using the least square method, the effective diffusivities of 1.56 +/- 0.14 x 10-11 m2/s and 0.68 +/- 0.09 x 10-11 m2/s, respectively, were obtained. The difference in the two values was due to the different viscosities of the solutions. A good fit of the experimental data was obtained which supports the use of the homogeneous model for this system. A counter-current ion exchange (CCIX) process was designed to treat nuclear waste at the Savannah River Site. A numerical method based on the orthogonal collocation method was used to simulate the concentration profile of cesium in the CCIX loaded with CST granules. To maximize cesium loading onto the CST and minimize the volume of CST, two design cases of a moving bed, where the fresh CST is pulsed into the column at certain periods or at certain concentration of cesium, were investigated. Simulation results showed that cesium removal behavior in the pilot-scale test of CCIX experiment, where the column length is 22 ft and the CST is pulsed

  5. Comparison of Biological Characteristics of CD133+ and CD133- Subpopulation of Hepatocellular Carcinoma Cell Line SMMC7721%肝癌细胞株SMMC7721中CD133+和CD133-亚群生物学特性的比较

    Institute of Scientific and Technical Information of China (English)

    朱殷; 郑青; 汪铮; 王园园; 萧树东

    2011-01-01

    背景:肝癌是常见的恶性肿瘤之一,易复发、转移,术后5年生存率较低.目前肿瘤干细胞学说已成为肿瘤研究的热点,CD133是一种肿瘤干细胞的标记物.目的:比较肝癌细胞株SMMC7721中CD133+和CD133-亚群的生物学特性差异,并初步探讨CD133+亚群的干细胞特性.方法:采用免疫磁珠法(MACS)分选SMMC7721细胞中CD133+和CD133-亚群,以流式细胞术检测CD133表达量,平板克隆形成实验检测CD133体外增殖能力,裸鼠成瘤实验检测体内致瘤性,CCK-8法检测对5-氟尿嘧啶(5-Fu)的敏感性.结果:MACS分选并培养1周后,CD133+亚群中CD133表达量明显下降.与CD133-亚群相比,CD133+亚群的体外克隆形成率明显增高,裸鼠肿瘤的体积明显升高,对5-Fu的敏感性降低,差异均有统计学意义(P<0.05).结论:肝癌SMMC7721细胞中CD133+亚群较CD133-亚群更具有肿瘤干细胞的特性.%Background: Hepatocellular carcinoma is a common malignant tumor with high recurrence rate and metastasis, and the 5-year survival rate is low. Cancer stem cell theory has become a hot spot of study on tumor and CD133 is a marker of cancer stem cells. Aims: To compare the biological characteristics of CD133+ with CD133- subpopulation of hepatocellular carcinoma cell line SMMC7721, and to explore tentatively the stem cell-like characteristics of CD133+ subpopulation.Methods: CD 133+ and CD133- subpopulation were isolated from hepatocellular carcinoma SMMC7721 cells by magnetic activated cell sorting (MACS). CD133 expression was determined by flow cytometry, and the potentials of CD133+ cells for colony formation and tumorigenicity were evaluated by cloning formation on plate and tumor formation in nude mice,respectively. 5-fluorouracil (5-Fu) sensitivity of CD133+ and CD133- cells was determined by CCK-8 assay. Results: After MACS and being cultured for 1 week, CD133 expression in CD133+ subpopulation was obviously decreased. The colonyforming capability was

  6. Synthesis of Iron-ferrocyanide functionalized magnetic nanocluster for the removal of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hee-Man; Jang, Sung-Chan; Lee, Kune Woo; Seo, Bum-Kyoung; Moon, Jei Kwon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-10-15

    In the present study, magnetite nanocluster was synthesized by hydrothermal method, and coated with iron ferrocyanide for the adsorption of cesium in an aqueous solution through simple addition of iron ferrocyanide in acid condition. We describe the morphology, structure, and physical property of these nanoparticles. In addition, their ability to eliminate cesium from water was also evaluated. In this study, we fabricated Iron ferrocyanide immobilized magnetite nanocluster (IFC-MNC) using hydrothermal methods. The CIFC-MNC exhibited easy separation ability from water by an external magnet, and showed a high removal efficiency of cesium in aqueous solutions. Therefore, the IFC-MNC demonstrated good potential for the treatment of water contaminated with radioactive cesium. gnetic nanoadsorbents composed of a magnetic particles core and functional shell, which adsorb the contaminants, has attracted significant attention in environmental remediation owing to their high surface area and unique superparamagnetism. The nuclear accident at the Fukushima Daiichi nuclear power station in 2011 released a huge quantity of radioactive contaminants into the environment. Among these, cesium Cs-137 is the most problematic contaminant due to its long half-life (30.2 years), and high-energy gamma ray (γ-ray) emissions. Among various adsorbents to treat Cs-137 contaminated water, metal ferrocyanides were widely applied to remove the Cs-137 in water. For better separation of metal ferrocyanide from water, recently, our group reported the fabrication of copper ferrocyanide-functionalized magnetic nanoparticles (Cu-FC-EDA-MNPs) using alkoxysilanes, having ethylenediamine (EDA) group, modified Fe{sub 3}O{sub 4} nanoparticles (EDA-MNPs) for the fast and easy magnetic separation of metal ferrocyanide. However, the fabrication method was multistep procedure. Thus, a more simplified fabrication procedure is still desired.

  7. Sorption and desorption of cesium on rapakivi granite and its minerals

    Energy Technology Data Exchange (ETDEWEB)

    Huitti, T.; Hakanen, M. [Helsinki Univ. (Finland); Lindberg, A. [Geological Survey of Finland, Espoo (Finland)

    2000-04-01

    Batch sorption experiments of cesium were performed for rapakivi granite and its main minerals, and also for some fracture minerals. The main minerals quartz, potassium feldspar, plagioclase, biotite and hornblende were magnetically separated from crushed rapakivi granite. The fracture minerals were chlorite, dolomite and kaolinite. Sorption was studied in fresh and saline reference waters containing cesium in the range of 10{sup -8} to 10{sup -3} mol/l. The distribution ratios for rapakivi granite generally decreased with an increasing Cs concentration and an increasing ionic strength. For fresh rapakivi granite, the sorption behaviour was rather complex in both fresh and saline reference waters, being complex for the other alteration stages only in saline water. Sorption increased unexpectedly when the initial cesium concentration was raised to 10{sup -5} - 10{sup -4} mol/l. The sorption on rapakivi granite was non-linear, especially in saline water. Sorption was reversible for rapakivi granite. The sorption on the minerals proved to be very non-linear, especially on biotite. Sorption was also reversible for biotite and kaolinite. For the other minerals, sorption was irreversible to some degree. As to the sorption of cesium investigated by studying thin sections of rapakivi granite and their autoradiograms, the most dominating mineral was biotite. The water analyses made during the sorption experiment revealed the exchange of potassium and cesium. The corresponding changes were difficult to detect in saline water. Calculation of the R{sub d} values for the rock, based on the R{sub d} values of minerals and the portions of minerals in the rock, yielded smaller distribution ratios than the values determined for the rock. (orig.)

  8. Self-renewal of CD133hi cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer

    Science.gov (United States)

    Sansone, Pasquale; Ceccarelli, Claudio; Berishaj, Marjan; Chang, Qing; Rajasekhar, Vinagolu K.; Perna, Fabiana; Bowman, Robert L.; Vidone, Michele; Daly, Laura; Nnoli, Jennifer; Santini, Donatella; Taffurelli, Mario; Shih, Natalie N. C.; Feldman, Michael; Mao, Jun J.; Colameco , Christopher; Chen, Jinbo; DeMichele, Angela; Fabbri, Nicola; Healey, John H.; Cricca, Monica; Gasparre, Giuseppe; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline

    2016-01-01

    The mechanisms of metastatic progression from hormonal therapy (HT) are largely unknown in luminal breast cancer. Here we demonstrate the enrichment of CD133hi/ERlo cancer cells in clinical specimens following neoadjuvant endocrine therapy and in HT refractory metastatic disease. We develop experimental models of metastatic luminal breast cancer and demonstrate that HT can promote the generation of HT-resistant, self-renewing CD133hi/ERlo/IL6hi cancer stem cells (CSCs). HT initially abrogates oxidative phosphorylation (OXPHOS) generating self-renewal-deficient cancer cells, CD133hi/ERlo/OXPHOSlo. These cells exit metabolic dormancy via an IL6-driven feed-forward ERlo-IL6hi-Notchhi loop, activating OXPHOS, in the absence of ER activity. The inhibition of IL6R/IL6-Notch pathways switches the self-renewal of CD133hi CSCs, from an IL6/Notch-dependent one to an ER-dependent one, through the re-expression of ER. Thus, HT induces an OXPHOS metabolic editing of luminal breast cancers, paradoxically establishing HT-driven self-renewal of dormant CD133hi/ERlo cells mediating metastatic progression, which is sensitive to dual targeted therapy. PMID:26858125

  9. Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer.

    Science.gov (United States)

    Sansone, Pasquale; Ceccarelli, Claudio; Berishaj, Marjan; Chang, Qing; Rajasekhar, Vinagolu K; Perna, Fabiana; Bowman, Robert L; Vidone, Michele; Daly, Laura; Nnoli, Jennifer; Santini, Donatella; Taffurelli, Mario; Shih, Natalie N C; Feldman, Michael; Mao, Jun J; Colameco, Christopher; Chen, Jinbo; DeMichele, Angela; Fabbri, Nicola; Healey, John H; Cricca, Monica; Gasparre, Giuseppe; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline

    2016-02-09

    The mechanisms of metastatic progression from hormonal therapy (HT) are largely unknown in luminal breast cancer. Here we demonstrate the enrichment of CD133(hi)/ER(lo) cancer cells in clinical specimens following neoadjuvant endocrine therapy and in HT refractory metastatic disease. We develop experimental models of metastatic luminal breast cancer and demonstrate that HT can promote the generation of HT-resistant, self-renewing CD133(hi)/ER(lo)/IL6(hi) cancer stem cells (CSCs). HT initially abrogates oxidative phosphorylation (OXPHOS) generating self-renewal-deficient cancer cells, CD133(hi)/ER(lo)/OXPHOS(lo). These cells exit metabolic dormancy via an IL6-driven feed-forward ER(lo)-IL6(hi)-Notch(hi) loop, activating OXPHOS, in the absence of ER activity. The inhibition of IL6R/IL6-Notch pathways switches the self-renewal of CD133(hi) CSCs, from an IL6/Notch-dependent one to an ER-dependent one, through the re-expression of ER. Thus, HT induces an OXPHOS metabolic editing of luminal breast cancers, paradoxically establishing HT-driven self-renewal of dormant CD133(hi)/ER(lo) cells mediating metastatic progression, which is sensitive to dual targeted therapy.

  10. MiR-133a Is Functionally Involved in Doxorubicin-Resistance in Breast Cancer Cells MCF-7 via Its Regulation of the Expression of Uncoupling Protein 2.

    Directory of Open Access Journals (Sweden)

    Yuan Yuan

    Full Text Available The development of novel targeted therapies holds promise for conquering chemotherapy resistance, which is one of the major hurdles in current breast cancer treatment. Previous studies indicate that mitochondria uncoupling protein 2 (UCP-2 is involved in the development of chemotherapy resistance in colon cancer and lung cancer cells. In the present study we found that lower level of miR133a is accompanied by increased expression of UCP-2 in Doxorubicin-resistant breast cancer cell cline MCF-7/Dox as compared with its parental cell line MCF-7. We postulated that miR133a might play a functional role in the development of Doxorubicin-resistant in breast cancer cells. In this study we showed that: 1 exogenous expression of miR133a in MCF-7/Dox cells can sensitize their reaction to the treatment of Doxorubicin, which is coincided with reduced expression of UCP-2; 2 knockdown of UCP-2 in MCF-7/Dox cells can also sensitize their reaction to the treatment of Doxorubicin; 3 intratumoral delivering of miR133a can restore Doxorubicin treatment response in Doxorubicin-resistant xenografts in vivo, which is concomitant with the decreased expression of UCP-2. These findings provided direct evidences that the miR133a/UCP-2 axis might play an essential role in the development of Doxorubicin-resistance in breast cancer cells, suggesting that the miR133a/UCP-2 signaling cohort could be served as a novel therapeutic target for the treatment of chemotherapy resistant in breast cancer.

  11. Assessment of right ventricular ejection fraction during intravenous /sup 133/Xe pulmonary ventilation study

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, S.M.; Spencer, R.P.; Herrera, N.E.

    1985-01-01

    Intravenous /sup 133/Xe in saline was used to estimate right-ventricular ejection fraction (RVEF). In three healthy volunteers, the first pass RVEF with /sup 133/Xe was followed by RVEF estimation by intravenous /sup 99m/Tc-pertechnetate. There was agreement between the /sup 133/Xe and 99mTc determined values. Subjects rebreathed the liberated /sup 133/Xe gas, allowing an estimation of regional pulmonary ventilation. Intravenous /sup 133/Xe in saline may have potential use in measuring RVEF, as well as in evaluating pulmonary function in cor pulmonale.

  12. JWH-133, a Selective Cannabinoid CB₂ Receptor Agonist, Exerts Toxic Effects on Neuroblastoma SH-SY5Y Cells.

    Science.gov (United States)

    Wojcieszak, Jakub; Krzemień, Wojciech; Zawilska, Jolanta B

    2016-04-01

    Endocannabinoid system plays an important role in the regulation of diverse physiological functions. Although cannabinoid type 2 receptors (CB2) are involved in the modulation of immune system in peripheral tissues, recent findings demonstrated that they are also expressed in the central nervous system and could constitute a new target for the treatment of neurodegenerative disorders. At present, very little is known about the potential effects of CB2-mimetic drugs on neuronal cells. This study aimed to examine whether JWH-133, a selective CB2 receptor agonist, affects the survival of SH-SY5Y neuroblastoma cell line, a widely used experimental in vitro model to study mechanisms of toxicity and protection in nigral dopaminergic neurons. Cell viability was assessed using two complementary methods: MTT test measuring mitochondrial activity and LDHe test indicating disruption of cell membrane integrity. In addition, cell proliferation was measured using BrdU incorporation assay. JWH-133 (10-40 μM) induced a concentration-dependent decrease of SH-SY5Y cell viability and proliferation rate. Using AM-630, a reverse agonist of CB2 receptors, as well as Z-VAD-FMK, a pan-caspase inhibitor, we demonstrated that the cytotoxic effect of JWH-133 presumably was not mediated by activation of CB2 receptors or by caspase pathway. Results of this work suggest that agonists of CB2 receptors when administered in multiple/high doses may induce neuronal damage.

  13. Acquired long QT syndrome and monomorphic ventricular tachycardia after alternative treatment with cesium chloride for brain cancer.

    Science.gov (United States)

    Dalal, Anuj K; Harding, John D; Verdino, Ralph J

    2004-08-01

    Individuals searching for symptomatic relief or a potential cure are increasingly seeking and using nontraditional therapies for their various diseases. Little is known about the potential adverse effects that patients may encounter while undergoing these alternative treatments. Cesium chloride is an unregulated agent that has been reported to have antineoplastic properties. Cesium chloride is advertised as an alternative agent for many different types of cancers and can be purchased easily on the Internet. Recently, QT prolongation and polymorphic ventricular tachycardia were reported in several patients taking cesium chloride as alternative treatment for cancer. We report acquired QT prolongation and sustained monomorphic ventricular tachycardia in a patient who self-initiated and completed a course of cesium chloride as adjunctive treatment for brain cancer.

  14. Spin-dependent asymmetry functions in the elastic and inelastic electron-cesium scattering at intermediate energies

    CERN Document Server

    Roth, B

    2001-01-01

    In this thesis the measurements of the relative differential cross section, the exchange asymmetry, the spin-orbit asymmetry, and the interference asymmetry for the electron scattering on cesium atoms from 4 to 18 eV is described. (HSI)

  15. Removal of cesium using coconut fiber in raw and modified forms for the treatment of radioactive liquid wastes

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Nella N.M. de; Nobre, Vanessa B.; Potiens Junior, Ademar J.; Sakata, Solange K., E-mail: sksakata@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Di Vitta, Patricia B. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Quimica

    2013-07-01

    Sorption is one of the most studied methods to reduce the volume of radioactive waste streams. Cesium-137 is a radioisotope formed by the fission of uranium and it can cause health problems due to its easy assimilation by cells. The aim of this study is to evaluate the potential of coconut fiber in removing cesium from radioactive liquid wastes; this process can help in disposing radioactive waste. The experiments were performed in batch and the particle size of the fiber ranged between 0.30 mm and 0.50 mm. The fiber was treated with hydrogen peroxide in alkaline medium. The following parameters were analyzed: contact time, pH and concentration of cesium ions in aqueous solution. After the experiments the samples were filtered and cesium remaining in solution was quantified by inductively coupled plasma optical emission spectrometry. (author)

  16. Cesium Platinide Hydride 4Cs2 Pt⋅CsH: An Intermetallic Double Salt Featuring Metal Anions.

    Science.gov (United States)

    Smetana, Volodymyr; Mudring, Anja-Verena

    2016-11-14

    With Cs9 Pt4 H a new representative of ionic compounds featuring metal anions can be added to this rare-membered family. Cs9 Pt4 H exhibits a complex crystal structure containing Cs(+) cations, Pt(2-) and H(-) anions. Being a red, transparent compound its band gap is in the visible range of the electromagnetic spectrum and the ionic type of bonding is confirmed by quantum chemical calculations. This cesium platinide hydride can formally be considered as a double salt of the "alloy" cesium-platinum, or better cesium platinide, Cs2 Pt, and the salt cesium hydride CsH according to Cs9 Pt4 H≡4 Cs2 Pt⋅CsH.

  17. Evaluation of cancer stem cell markers CD133, CD44, CD24: association with AKT isoforms and radiation resistance in colon cancer cells.

    Directory of Open Access Journals (Sweden)

    Sara Häggblad Sahlberg

    Full Text Available The cell surface proteins CD133, CD24 and CD44 are putative markers for cancer stem cell populations in colon cancer, associated with aggressive cancer types and poor prognosis. It is important to understand how these markers may predict treatment outcomes, determined by factors such as radioresistance. The scope of this study was to assess the connection between EGFR, CD133, CD24, and CD44 (including isoforms expression levels and radiation sensitivity, and furthermore analyze the influence of AKT isoforms on the expression patterns of these markers, to better understand the underlying molecular mechanisms in the cell. Three colon cancer cell-lines were used, HT-29, DLD-1, and HCT116, together with DLD-1 isogenic AKT knock-out cell-lines. All three cell-lines (HT-29, HCT116 and DLD-1 expressed varying amounts of CD133, CD24 and CD44 and the top ten percent of CD133 and CD44 expressing cells (CD133high/CD44high were more resistant to gamma radiation than the ten percent with lowest expression (CD133low/CD44low. The AKT expression was lower in the fraction of cells with low CD133/CD44. Depletion of AKT1 or AKT2 using knock out cells showed for the first time that CD133 expression was associated with AKT1 but not AKT2, whereas the CD44 expression was influenced by the presence of either AKT1 or AKT2. There were several genes in the cell adhesion pathway which had significantly higher expression in the AKT2 KO cell-line compared to the AKT1 KO cell-line; however important genes in the epithelial to mesenchymal transition pathway (CDH1, VIM, TWIST1, SNAI1, SNAI2, ZEB1, ZEB2, FN1, FOXC2 and CDH2 did not differ. Our results demonstrate that CD133high/CD44high expressing colon cancer cells are associated with AKT and increased radiation resistance, and that different AKT isoforms have varying effects on the expression of cancer stem cell markers, which is an important consideration when targeting AKT in a clinical setting.

  18. Sugar-metal ion interactions: the complicated coordination structures of cesium ion with D-ribose and myo-inositol.

    Science.gov (United States)

    Hu, Haijian; Xue, Junhui; Wen, Xiaodong; Li, Weihong; Zhang, Chao; Yang, Limin; Xu, Yizhuang; Zhao, Guozhong; Bu, Xiaoxia; Liu, Kexin; Chen, Jia'er; Wu, Jinguang

    2013-11-18

    The novel cesium chloride-D-ribose complex (CsCl·C5H10O5; Cs-R) and cesium chloride-myo-inositol complex (CsCl·C6H12O6; Cs-I) have been synthesized and characterized using X-ray diffraction and FTIR, FIR, THz, and Raman spectroscopy. Cs(+) is eight-coordinated to three chloride ions, O1 and O2 from one D-ribose molecule, O1 from another D-ribose molecule, and O4 and O5 from the third D-ribose molecule in Cs-R. For one D-ribose molecule, the oxygen atom O1 in the ring is coordinated to two cesium ions as an oxygen bridge, O2 is cocoordinated with O1 to one of the two cesium ions, and O4 and O5 are coordinated to the third cesium ion, respectively. O3 does not coordinate to metal ions and only takes part in forming hydrogen bonds. One chloride ion is connected to three cesium ions. Thus, a complicated structure of Cs-D-ribose forms. For Cs-I, Cs(+) is 10-coordinated to three chloride ions, O1 and O2 from one myo-inositol molecule, O3 and O4 from another myo-inositol molecule, O5 and O6 from the third myo-inositol molecule, and O6 from the fourth myo-inositol molecule. One metal ion is connected to four ligands, and one myo-inositol is coordinated to four Cs(+) ions, which is also a complicated coordination structure. Crystal structure results, FTIR, FIR, THz, and Raman spectra provide detailed information on the structure and coordination of hydroxyl groups to metal ions in the cesium chloride-D-ribose and cesium chloride-myo-inositol complexes.

  19. The promotional effects of cesium promoter on higher alcohol synthesis from syngas over cesium-promoted Cu/ZnO/Al2O3 catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Jie; Cai, Qiuxia; Wan, Yan; Wan, Shaolong; Wang, Li; Lin, Jingdong; Mei, Donghai; Wang, Yong

    2016-09-02

    In this study, the promotional effects of cesium promoter on higher alcohol (C2+OH) synthesis from syngas over Cs-Cu/ZnO/Al2O3 catalysts were investigated using a combined experimental and theoretical density functional theory (DFT) calculation method. In the presence of cesium, the C2+OH productivity increases from 77.1 g•kgcat-1•h-1 to 157.3 g•kgcat-1•h-1 at 583 K due to the enhancement of the initial C–C bond formation. Detailed analysis of chain growth probabilities (CGPs) confirms that initial C–C bond formation is the rate-determining step in the temperature range of 543-583 K. Addition of cesium promoter significantly increases the productivities of 2-methyl-1-propanol, while the CGPs values (C3* to 2-methyl-C3*) is almost unaffected. With the assistance of cesium promoter, the CGPs of the initial C–C bond formation step (C1* to C2*) could be increased from 0.13 to 0.25 at 583 K. DFT calculations indicate that the initial C–C bond formation is mainly contributed by the HCO+HCO coupling reaction over the ZnCu(211) model surface. In the presence of the Cs2O, the stabilities of key reaction intermediates such as HCO and H2CO are enhanced which facilitates both HCO+HCO and HCO+H2CO coupling reaction steps with lower activation barriers over the Cs2O-ZnCu(211) surface. The promotional effects of cesium on the C2+OH productivity are also benefited from the competitive CH+HCO coupling reaction over CH hydrogenation that leads to lower alkane formation. In addition, Bader charge analysis suggests that the presence of cesium ions would facilitate the nucleophilic reaction between HCO and H2CO for initial C–C bond formation. This work was supported by the National Natural Science Foundation of China (No. 91545114 and No. 91545203). We appreciate the joint PhD scholarship support from the China Scholarship Council. The authors would also like to thank the support from Collaborative Innovation Center of Chemistry for Energy Materials (2011-iChEM). DM

  20. FY06 ANNUAL REPORT FOR ENVIRONMENTAL MANAGEMENT SCIENCE PROGRAM PROJECT #95061STRATEGIC DESIGN AND OPTIMIZATION OF INORGANIC SORBENTSFOR CESIUM, STRONTIUM AND ACTINIDES

    Energy Technology Data Exchange (ETDEWEB)

    Hobbs, D

    2006-08-10

    The basic science goal in this project identifies structure/affinity relationships for selected radionuclides and existing sorbents. The task will apply this knowledge to the design and synthesis of new sorbents that will exhibit increased affinity for cesium, strontium and actinide separations. The target problem focuses on the treatment of high-level nuclear wastes. The general approach can likewise be applied to nonradioactive separations. During the fifth year of the project our studies focused along the following paths: (1) determination of Cs{sup +} ion exchange mechanism in sodium titanium silicates with sitinikite topology and the influence of crystallinity on ion exchange, (2) synthesis and characterization of novel peroxo-titanate materials for strontium and actinide separations, and (3) further refinements in computational models for the CST and polyoxoniobate materials.

  1. 133例甲亢患者心电图分析%Electrocardiogram analysis of 133 hyperthyroidism patients

    Institute of Scientific and Technical Information of China (English)

    乔洁; 李敬涛; 曲桂一

    2015-01-01

    Objective To investigate the electrocardiogram expression of hyperthyroidism patient. Methods A total of 133 hyperthyroidism patients were taken as hyperthyroidism group (group A), and another 133 healthy people with matched gender and age were taken as normal control group (group B). Analysis and comparison were made on the electrocardiogram data of the two groups. Results There were 111 cases (83.46%)with abnormal change of electrocardiogram in the group A, and 39 cases (29.32%) with abnormal change of electrocardiogram in the group B. The difference had statistical significance (P<0.05). The changes of electrocardiogram in hyperthyroidism patients mainly included nodal tachycardia, atrial premature beats, ST-T change, and auricular fibrillation. Conclusion Incidence of abnormal electrocardiogram is high in hyperthyroidism patient, and it is mainly showed as nodal tachycardia, atrial premature beats, ST-T change, and auricular fibrillation.%目的:探讨甲状腺功能亢进(甲亢)患者的心电图表现。方法133例甲亢患者作为甲亢组(A组),133例性别、年龄匹配的健康体检者作为正常对照组(B组),对两组心电图资料进行分析对比。结果 A组心电图异常改变111例(83.46%), B组心电图异常改变为39例(29.32%),差异有统计学意义(P<0.05)。甲亢患者心电图改变以窦性心动过速(窦速),房性早搏(房早), ST-T改变,心房颤动(房颤)为主。结论甲亢患者心电图异常发生率较高,多表现为窦速、房早、ST-T改变、房颤。

  2. Immunohistochemical detection of CD133 is associated with tumor regression grade after chemoradiotherapy in rectal cancer.

    Science.gov (United States)

    Hongo, Kumiko; Kazama, Shinsuke; Sunami, Eiji; Tsuno, Nelson H; Takahashi, Koki; Nagawa, Hirokazu; Kitayama, Joji

    2012-12-01

    CD133 has been identified as a putative cancer stem cell (CSC) marker in various cancers including colorectal cancer. The relation between CD133 expression and biological characteristics of colorectal cancer remains to be clarified. Protein expression of CD133 was immunohistochemically evaluated in surgical specimens of 225 patients with colorectal cancer who were treated by surgery, as well as those of 78 patients with rectal cancer who received preoperative chemoradiotherapy (CRT) followed by curative resection. The correlation between CD133 expression and clinicopathological features, tumor recurrence and overall survival was analyzed in both populations. Among 225 colorectal cancers without CRT, 93 (41.3%) were positive for CD133 expression, which was enhanced in cases with advanced T stage and venous invasion. Moreover, CD133 was positive in 47 (60.3%) of 78 cases with CRT, which was significantly higher than the CD133-positive rate in non-CRT specimens (P=0.05). Expression of CD133 was independently correlated with the histological tumor regression grade (P<0.01). These results suggest that CD133 is not a distinctive colorectal CSC marker; expression of CD133 is suggested to be one of the key factors associated with resistance to CRT in colorectal cancer.

  3. Kelvin probe studies of cesium telluride photocathode for the AWA photoinjector

    Energy Technology Data Exchange (ETDEWEB)

    Velazquez, D.; Wisniewski, E. E.; Yusof, Z.; Harkay, K.; Spentzouris, L.; Terry, J. [Physics Department at Illinois Institute of Technology, Chicago, IL 60616 and High Energy Physics Division at Argonne National Laboratory, Lemont, IL 60439 (United States); High Energy Physics Division at Argonne National Laboratory, Lemont, IL 60439 (United States); Accelerator Science Division at Argonne National Laboratory, Lemont, IL 60439 (United States); Physics Department at Illinois Institute of Technology, Chicago, IL 60616 (United States)

    2012-12-21

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (> 1%), is robust in a photoinjector, and long lifetime. This photocathode is fabricated in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch ({approx}50 nC) in a long bunch train. We present some results from a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV light exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating.

  4. Low Level Gamma Spectroscopy Measurements of Radium and Cesium in Lucerne (Medicago Sativa)

    Science.gov (United States)

    Fokapić, S.; Bikit, I.; Mrđa, D.; Vesković, M.; Slivka, J.; Mihaljev, Ž.; Ćupić, Ž.

    2007-04-01

    Nineteen years after Chernobyl nuclear accident, activity concentration of 137Cs still could be detected in food and soil samples in Central and Eastern Europe. In this paper radiation levels of radium and cesium in Lucerne will be presented. It is a perennial plant with a deep root system and it is widely grown throughout the world as forage for cattle. The samples of Lucerne were taken from twelve different locations in Vojvodina in the summer period July-September 2004. The samples were specially dried on the air and after that ground, powdered and mineralized by method of dry burning on the temperature of 450°C. Gamma spectrometry measurements of the ash were performed by means of actively shielded germanium detector with maximal background reduction. For cesium 137Cs 10 mBq/kg order of magnitude detection limits were achieved.

  5. Removal of cesium ions from aqueous solution by adsorption onto local Taiwan laterite

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T.-H. [Department of Engineering and System Science, National Tsing Hua University, Hsinchu 300, Taiwan (China); Li, M.-H. [Institute of Hydrological Sciences, National Central University, Jungli 320, Taiwan (China); Yeh, W.-C.; Wei, Y.-Y. [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu 300, Taiwan (China); Teng, S.-P. [Department of Engineering and System Science, National Tsing Hua University, Hsinchu 300, Taiwan (China); Institute of Nuclear Engineering and Science, National Tsing Hua University, Hsinchu 300, Taiwan (China)], E-mail: spteng@ess.nthu.edu.tw

    2008-12-30

    Utilization of local Taiwan laterite (LTL) to remove aqueous cesium was investigated in this work under the conditions of various contact time, cesium (Cs) loading and temperature. Experimental results show that adsorption is instantaneous. Freundlich and Langmuir simulation results demonstrate that local Taiwan laterite has high affinity and sorption capacity for Cs at low temperatures, which may be attributed to enhanced desorption as temperature increased. Thermodynamic parameters including {delta}H, {delta}G and {delta}S were calculated and it is indicated that Cs adsorption on LTL is an exothermic, spontaneous and physical adsorption reaction. Moreover, the adsorbed Cs is distributed evenly on the LTL surface, which is confirmed by SEM/EDS mapping images. Furthermore, the absence of apparent shifting or broadening of the kaolinite signal in XRD patterns after Cs adsorption is an indication of the non-expanding characteristic of kaolinite structure.

  6. Light storage via coherent population oscillation in a thermal cesium vapor

    CERN Document Server

    de Almeida, A J F; Maynard, M -A; Laupretre, T; Bretenaker, F; Felinto, D; Goldfarb, F; Tabosa, J W R

    2014-01-01

    We report on the storage of light via the phenomenon of Coherent Population Oscillation (CPO) in an atomic cesium vapor at room temperature. In the experiment the optical information of a probe field is stored in the CPO of two ground states of a Lambda three-level system formed by the Zeeman sublevels of the hyperfine transition F = 3 - F' = 2 of cesium D2 line. We show directly that this CPO based memory is very insensitive to stray magnetic field inhomogeneities and presents a lifetime which is mainly limited only by atomic motion. A theoretical simulation of the measured spectra was also developed and is in very good agreement with the experiment.

  7. Precision mass measurements of cesium isotopes—new entries in the ISOLTRAP chronicles

    Science.gov (United States)

    Atanasov, D.; Beck, D.; Blaum, K.; Borgmann, Ch; Cakirli, R. B.; Eronen, T.; George, S.; Herfurth, F.; Herlert, A.; Kowalska, M.; Kreim, S.; Litvinov, Yu A.; Lunney, D.; Manea, V.; Neidherr, D.; Rosenbusch, M.; Schweikhard, L.; Wienholtz, F.; Wolf, R. N.; Zuber, K.

    2017-04-01

    Alkali ion beams are among the most intense produced by the ISOLDE facility. These were the first to be studied by the ISOLTRAP mass spectrometer and ever since, new measurements have been regularly reported. Recently the masses of very neutron-rich and short-lived cesium isotopes were determined at ISOLTRAP. The isotope 148Cs was measured directly for the first time by Penning-trap mass spectrometry. Using the new results, the trend of two-neutron separation energies in the cesium isotopic chain is revealed to be smooth and gradually decreasing, similar to the ones of the barium and xenon isotopic chains. Predictions of selected microscopic models are employed for a discussion of the experimental data in the region.

  8. Accumulation of radioactive cesium released from Fukushima Daiichi Nuclear Power Plant in terrestrial cyanobacteria Nostoc commune.

    Science.gov (United States)

    Sasaki, Hideaki; Shirato, Susumu; Tahara, Tomoya; Sato, Kenji; Takenaka, Hiroyuki

    2013-01-01

    The Fukushima Daiichi Nuclear Power Plant accident released large amounts of radioactive substances into the environment and contaminated the soil of Tohoku and Kanto districts in Japan. Removal of radioactive material from the environment is an urgent problem, and soil purification using plants is being considered. In this study, we investigated the ability of 12 seed plant species and a cyanobacterium to accumulate radioactive material. The plants did not accumulate radioactive material at high levels, but high accumulation was observed in the terrestrial cyanobacterium Nostoc commune. In Nihonmatsu City, Fukushima Prefecture, N. commune accumulated 415,000 Bq/kg dry weight (134)Cs and 607,000 Bq kg(-1) dry weight (137)Cs. The concentration of cesium in N. commune tended to be high in areas where soil radioactivity was high. A cultivation experiment confirmed that N. commune absorbed radioactive cesium from polluted soil. These data demonstrated that radiological absorption using N. commune might be suitable for decontaminating polluted soil.

  9. Stark spectra of Rydberg states in atomic cesium in the vicinity of n=18

    Institute of Scientific and Technical Information of China (English)

    Dong Hui-Jie; Wang Ting; Li Chang-Yong; Zhao Jian-Ming; Zhang Lin-Jie

    2013-01-01

    The Stark structures in a cesium atom around n =18 are numerically calculated.The results show that the components of 20D states with a small azimuthal quantum number |m| shift upward a lot,and those with a large |m| shift downward a little within 1100 V/cm.All components of P states shift downward.Experimental work has been performed in ultracold atomic cesium.Atoms initially in 6P3/2 state are excited to high-n Rydberg states by a polarization light perpendicular to the field,and Stark spectra with 丨m丨=1/2,3/2,5/2 are simultaneously observed with a large linewidth for the first time.The observed spectra are analyzed in detail.The relative transition probability is calculated.The experimental results are in good agreement with our numerical computation.

  10. Biology and clinical implications of CD133{sup +} liver cancer stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Stephanie, E-mail: stefma@hku.hk [Department of Clinical Oncology, State Key Laboratory for Liver Research, LKS Faculty of Medicine, The University of Hong Kong (Hong Kong)

    2013-01-15

    Hepatocellular carcinoma (HCC) is the most common primary malignant tumor of the liver, accounting for 80%–90% of all liver cancers. The disease ranks as the fifth most common cancer worldwide and is the third leading cause of all cancer-associated deaths. Although advances in HCC detection and treatment have increased the likelihood of a cure at early stages of the disease, HCC remains largely incurable because of late presentation and tumor recurrence. Only 25% of HCC patients are deemed suitable for curative treatment, with the overall survival at just a few months for inoperable patients. Apart from surgical resection, loco-regional ablation and liver transplantation, current treatment protocols include conventional cytotoxic chemotherapy. But due to the highly resistant nature of the disease, the efficacy of the latter regimen is limited. The recent emergence of the cancer stem cell (CSC) concept lends insight into the explanation of why treatment with chemotherapy often may seem to be initially successful but results in not only a failure to eradicate the tumor but also possibly tumor relapse. Commonly used anti-cancer drugs in HCC work by targeting the rapidly proliferating and differentiated liver cancer cells that constitute the bulk of the tumor. However, a subset of CSCs exists within the tumor, which are more resistant and are able to survive and maintain residence after treatment, thus, growing and self-renewing to generate the development and spread of recurrent tumors in HCC. In the past few years, compelling evidence has emerged in support of the hierarchic CSC model for solid tumors, including HCC. And in particular, CD133 has drawn significant attention as a critical liver CSC marker. Understanding the characteristics and function of CD133{sup +} liver CSCs has also shed light on HCC management and treatment, including the implications for prognosis, prediction and treatment resistance. In this review, a detailed summary of the recent progress

  11. Distinct roles for miR-1 and miR-133a in the proliferation and differentiation of rhabdomyosarcoma cells.

    Science.gov (United States)

    Rao, Prakash K; Missiaglia, Edoardo; Shields, Lauren; Hyde, Greg; Yuan, Bingbing; Shepherd, Christopher J; Shipley, Janet; Lodish, Harvey F

    2010-09-01

    Rhabdomyosarcoma is the most common soft tissue sarcoma in the pediatric population. As this tumor has an undifferentiated myogenic phenotype, agents that promote differentiation hold particular promise as part of a novel therapeutic approach to combat this type of cancer. In this report, we focus on the contribution of two microRNAs (miRNAs) in rhabdomyosarcomas. Levels of miR-1 and miR-133a are drastically reduced in representative cell lines from each major rhabdomyosarcoma subtype (embryonal and alveolar). Introduction of miR-1 and miR-133a into an embryonal rhabdomyosarcoma-derived cell line is cytostatic, thereby suggesting a tumor suppressor-like role for these myogenic miRNAs. Transcriptional profiling of cells after miR-1 and miR-133a expression reveals that miR-1 (but not miR-133a) exerts a strong promyogenic influence on these poorly differentiated tumor cells. We identify mRNAs that are down-regulated by these miRNAs and propose roles for miR-1 and miR-133a in repressing isoforms of genes that are normally not expressed in muscle. Finally, we show that mRNA targets of miR-1 and miR-133a are up-regulated in rhabdomyosarcomas, suggesting a causative role for these miRNAs in the development of rhabdomyosarcomas. More important, these results point to the promise of enhancing rhabdomyosarcoma therapy using miRNAs as agents that mediate cytostasis and promote muscle differentiation.

  12. Study on Growth and Optical, Scintillation Properties of Thallium Doped Cesium Iodide –Scintillator Crystal

    Directory of Open Access Journals (Sweden)

    B. Ravi

    2014-06-01

    Full Text Available Single crystal of Thallium doped cesium Iodide –Scintillator crystal was grown using vertical Bridgeman technique. The grown crystal was included for cutting and polishing for the characterization purpose and this crystal was studied by optical transmission properties, photo luminescence and thermally luminescence characteristics. Gamma-ray detectors were fabricated using the grown crystal that showed good linearity and nearly 7.5% resolution at 662 keV.

  13. Evaporative cooling of cesium atoms in the gravito-optical surface trap

    CERN Document Server

    Hammes, M; Grimm, R

    2000-01-01

    We report on cooling of an atomic cesium gas closely above an evanescent-wave. Our first evaporation experiments show a temperature reduction from 10muK down to 300nK along with a gain in phase-space density of almost two orders of magnitude. In a series of measurements of heating and spin depolarization an incoherent background of resonant photons in the evanescent-wave diode laser light was found to be the limiting factor at this stage.

  14. The effects of using Cesium-137 teletherapy sources as a radiological weapon (dirty bomb)

    OpenAIRE

    Liolios, Theodore

    2009-01-01

    While radioactive sources used in medical diagnosis do not pose a great security risk due to their low level of radioactivity, therapeutic sources are extremely radioactive and can presumably be used as a radiological weapon. Cobalt-60 and Cesium-137 sources are the most common ones used in radiotherapy with over 10,000 of such sources currently in use worldwide, especially in the developing world, which cannot afford modern accelerators. The present study uses computer simulations to investi...

  15. Analysis of SubRamsey Patterns in Cesium Beam Frequency Standards

    Institute of Scientific and Technical Information of China (English)

    CHEN Jingbiao; WANG Fengzhi; YANG Donghai; WANG Yiqiu

    2001-01-01

    Using a precise probability expres-sion under excessive microwave power condition, theRamsey patterns in a cesium atomic beam frequencystandard with Ramsey separated oscillating fields havebeen carefully analyzed by numerical method. TwosubRamsey patterns are produced on both sides ofthe central Ramsey pattern. All factors, including mi-crowave power, excitation region length, drift regionlength and atomic velocity distribution, which affectthe subRamsey pattern have been analyzed, and someexplanations coming from approximated theory havebeen corrected in this paper.

  16. Prussian blue as an antidote for radioactive thallium and cesium poisoning

    Directory of Open Access Journals (Sweden)

    Altagracia-Martinez M

    2012-06-01

    Full Text Available Marina Altagracia-Martínez, Jaime Kravzov-Jinich, Juan Manuel Martínez-Núñez, Camilo Ríos-Castañeda, Francisco López-NaranjoDepartments of Biological Systems and Health Care, Biological and Health Sciences Division, Universidad Autónoma Metropolitana-Xochimilco, Mexico DF, MexicoBackground: Following the attacks on the US on September 11, 2001, potentially millions of people might experience contamination from radioactive metals. However, before the specter of such accidents arose, Prussian blue was known only as an investigational agent for accidental thallium and cesium poisoning. The purpose of this review is to update the state of the art concerning use of Prussian blue as an effective and safe drug against possible bioterrorism attacks and to disseminate medical information in order to contribute to the production of Prussian blue as a biodefense drug.Methods: We compiled articles from a systematic review conducted from January 1, 1960 to March 30, 2011. The electronic databases consulted were Medline, PubMed, the Cochrane Library, and Scopus.Results: Prussian blue is effective and safe for use against radioactive intoxications involving cesium-137 and thallium. The US Food and Drug Administration has approved Prussian blue as a drug, but there is only one manufacturer providing Prussian blue to the US. Based on the evidence, Prussian blue is effective for use against radioactive intoxications involving cesium-137 and thallium, but additional clinical research on and production of Prussian blue are needed.Keywords: Prussian blue, radioactive cesium, thallium, intoxication, biodefense drug

  17. Mössbauer study on the gamma radiolysis of anhydrous cesium tris (oxalato) ferrate(III)

    Science.gov (United States)

    Ladriere, J.; Senterre, V.; Apers, D.

    1992-04-01

    The final product of the gamma radiolysis of anhydrous cesium tris(oxalato) ferrate(III) has been identified by Mössbauer spectroscopy as Cs2Fe(ox)2. The radiolytic decomposition proceeds as a first-order process due to the original compound depletion and to the radiolytic stability of the ferrous compound. Lamb-Mössbauer factors measurements indicate that the recoilless fractions of the iron species are practically unaffected by the radiolysis.

  18. The Effect of Cesium Vapour on the Bulk Conductivity of Plasma - Sprayed Alumina

    Science.gov (United States)

    2007-11-02

    from the NaK coolant channels by a 50 [tm gap filled with helium at around 100 Torr. Ideally there would be no contact between the outer metallic ...reservoir of the liquid metal . The reservoir consists of a one inch diameter stainless steel cylinder clamped between two copper blocks. Cartridge heaters...Cesium is contained within the inter-electrode gap by a metal -ceramic seal at each end of the TFE. Therefore under normal operating conditions the

  19. Photon Driven Transformation of Cesium Lead Halide Perovskites from Few-Monolayer Nanoplatelets to Bulk Phase.

    Science.gov (United States)

    Wang, Yue; Li, Xiaoming; Sreejith, Sivaramapanicker; Cao, Fei; Wang, Zeng; Stuparu, Mihaiela Corina; Zeng, Haibo; Sun, Handong

    2016-12-01

    Influence of light exposure on cesium lead halide nanostructures has been explored. A discovery of photon driven transformation (PDT) in 2D CsPbBr3 nanoplatelets is reported, in which the quantum-confined few-monolayer nanoplatelets will convert to bulk phase under very low irradiation intensity (≈20 mW cm(-2) ). Benefiting from the remarkable emission color change during PDT, the multicolor luminescence photopatterns and facile information photo-encoding are established.

  20. Spatial variability and the fate of cesium in coastal sediments near Fukushima, Japan

    Directory of Open Access Journals (Sweden)

    E. Black

    2014-05-01

    Full Text Available Quantifying the amount of cesium incorporated into marine sediments as a result of the Fukushima Dai-ichi Nuclear Power Plant (FDNPP accident has proven challenging due to the limited multi-core sampling from within the 30 km zone around the facility, the inherent spatial heterogeneities in ocean sediments, and the potential for inventory fluctuations due to physical, biological, and chemical processes. Using 210Pb, 234Th, 137Cs, and 134Cs profiles from 20 sediment cores, coastal sediment inventories were reevaluated. A minimum 137Cs sediment inventory of 100 ± 50 TBq was found for an area of 55 000 km2 using cores from this study and a total of 130 ± 60 TBq using an additional 181 samples. These inventories represent less than 1% of the estimated 15–30 PBq of cesium released during the FDNPP disaster and constitute ~ 90% of the total coastal inventory of 137Cs remaining in 2012. The time needed for surface sediment activities (0 to 3 cm at the 20 locations to reduce by 50% via bioturbation was estimated to range from 0.4 to 26 years, indicating a much greater persistence of cesium in the sediments relative to coastal water activities. However, due to the observed variability in mixing rates, grain size, and inventories, additional cores are needed to further improve estimates and capture the full extent of cesium penetration into the shallow coastal sediments, which was deeper than 14 cm for all cores retrieved from water depths less than 150 m.

  1. Isolation and tumorigenicity of CD133 + subpopulation in human hepatocellular carcinoma%人肝癌CD133+细胞亚群的分离及致瘤性

    Institute of Scientific and Technical Information of China (English)

    李时兵; 郑进方; 张震生; 陈劲松; 孙启刚

    2015-01-01

    Objective To separate the CD133 + subpopulation in human hepatocellular carcinoma (HCC) and investigate the tumorigenicity.Methods The human liver cancer tissues were subcutaneously transplanted into nude mice to generate xenograft tumors which were then isolated to prepare single cell suspension.The expression of CD133 + subpopulation was further detected using flow cytometry.The CD133 + subpopulations were separated and depurated with magnetic-activated cell sorting system.Immunofluorescence was performed to identify the histological phenotype of CD133 + subpopulation.The in vitro and in vivo clone formation assay and in vivo xenograft formation assay were performed, respectively.Results Flow cytometry analysis revealed that a percentage of (4.1 ± 0.6) % CD133 + cells were detected in xenografts.Immunofluorescence studies showed that (86.8 ± 7.5) % of the isolated cells were CD133 +.Compared with CD133-population, CD133 + cells showed a higher capability to generate clone sphere in vitro and a higher tumorigenicity in nude mice (P < 0.05).Conclusion The CD133 + subpopulation in human hepatocellular carcinoma had a potent tumorigenicity and was enriched in cancer stem cells.%目的 从人肝癌组织中分离CD133+细胞亚群并探讨其致瘤能力.方法 将人肝癌组织种植于裸鼠皮下形成移植瘤,将移植瘤标本消化制成单细胞悬液.流式细胞仪检测CD133+的表达.免疫磁珠分选法进一步分离纯化CD133+细胞.免疫荧光检测CD133+细胞亚群的组织表型.对不同亚群细胞进行体外克隆形成实验和裸鼠体内移植瘤形成实验.结果 流式细胞仪检测显示,肝癌组织中(4.1±0.6)%的细胞为CD133+细胞.免疫荧光显示分离纯化的细胞中,CD133+细胞占(86.8±7.5)%.体外培养显示CD133+亚群比CD133-亚群具有更强的克隆球形成能力,在裸鼠体内具有更强的肿瘤形成能力(P<0.05).结论 从人肝癌组织中分离的CD133+细胞亚群具有高致瘤性,可能为肝癌干细胞.

  2. Temperature and number evolution of cold cesium atoms inside a wall-coated glass cell

    Institute of Scientific and Technical Information of China (English)

    黄家强; 张建伟; 王时光; 王力军

    2015-01-01

    We report an experimental study on the temperature and number evolution of cold cesium atoms diffusively cooled inside a wall-coated glass cell by measuring the absorption profile of the 62S1/2 (F=4)→62P3/2(F0=5) transition line with a weak probe laser in the evolution process. We found that the temperature of the cold atoms first gradually decreases from 16 mK to 9 mK, and then rapidly increases. The number of cold atoms first declines slowly from 2.1 × 109 to 3.7 × 108 and then falls drastically. A theoretical model for the number evolution is built and includes the instantaneous temperature of the cold atoms and a fraction p, which represents the part of cold cesium atoms elastically reflected by the coated cell wall. The theory is overall in good agreement with the experimental result, and a nonzero value is obtained for the fraction p, which indicates that the cold cesium atoms are not all heated to the ambient temperature by a single collision with the coated cell wall. These results can provide helpful insight for precision measurements based on diffuse laser cooling.

  3. DFB-ridge laser diodes at 894 nm for Cesium atomic clocks

    Science.gov (United States)

    von Bandel, N.; Garcia, M.; Lecomte, M.; Larrue, A.; Robert, Y.; Vinet, E.; Driss, O.; Parrilaud, O.; Krakowski, M.; Gruet, F.; Matthey, R.; Mileti, G.

    2016-02-01

    Time and frequency applications are in need of high accuracy and high stability clocks. Optically pumped compact industrial Cesium atomic clocks are a promising approach that could satisfy these demands. However, the stability of these clocks relies, among others, on the performances of the laser diodes that are used. This issue has led the III-V Lab to commit to the European Euripides-LAMA project that aims to provide competitive compact optical Cesium clocks for ground applications. This work will provide key experience for further space technology qualification. III-V Lab is in charge of the design, fabrication and reliability of Distributed-Feedback diodes (DFB) at 894 nm (D1 line of Cesium) and 852 nm (D2 line). LTF-Unine is in charge of their spectral characterisation. The use of D1 line for pumping will provide simplified clock architecture compared to the D2 line pumping thanks to simpler atomic transitions and a larger spectral separation between lines in the 894 nm case. Also, D1 line pumping overcomes the issue of unpumped "idle states" that occur with D2 line. The modules should provide narrow linewidth (= 10 Hz and 109 Hz2/Hz @ f >= 10 Hz.

  4. Inhibition of sodium current by taurine magnesium coordination compound prevents cesium chloride-induced arrhythmias.

    Science.gov (United States)

    Yin, Yongqiang; Wen, Ke; Wu, Yanna; Kang, Yi; Lou, Jianshi

    2012-05-01

    The mechanism(s) by which taurine magnesium coordination compound (TMCC) inhibits experimental arrhythmias remains poorly understood. The purpose of this study was to observe the effects of TMCC against cesium chloride-induced arrhythmia in the rabbit heart and find whether the antiarrhythmic activity is related to inhibition of sodium current. Early afterdepolarization was induced by 1.5 mM cesium chloride (1 ml kg(-1)) through intravenous injection. The monophasic action potentials (MAP) and electrocardiograms were simultaneously recorded. The effect of TMCC on functional refractory periods (FRPs) in the left atrium was also observed in vitro. Arrhythmias onset was significantly retarded by TMCC. The number of ventricular premature contractions and incidence of monophasic ventricular tachycardia and polyphasic ventricular tachycardia in 10 min were decreased by TMCC. These effects can be abolished by veratridine (10 μg kg(-1)). MAP duration at 90% repolarization was significantly prolonged by TMCC, which can be prolonged even longer by veratridine (10 μg kg(-1)). In vitro experiments showed that FRPs was prolonged by TMCC which can be cancelled by veratridine (10 μg kg(-1)). TMCC prevents cesium chloride-induced arrhythmias, and inhibition of sodium current, in part, contributes to the antiarrhythmic effect of TMCC.

  5. Immobilization of Cesium Traps from the BN-350 Fast Reactor (Aktau, Kazakhstan)

    Energy Technology Data Exchange (ETDEWEB)

    J. A. Michelbacher; C. Knight; O. G. Romanenko; I. L. Tazhibaeva; I. L. Yakovlev; A. V. Rovneyko; V. I. Maev; D. Wells; A. Herrick

    2011-03-01

    During BN-350 reactor operations and also during the initial stages of decommissioning, cesium traps were used to decontaminate the reactor’s primary sodium coolant. Two different types of carbon-based trap were used – the MAVR series, low ash granulated graphite adsorber (LAG) contained in a carrier designed to be inserted into the reactor core during shutdown; and a series of ex-reactor trap accumulators(TAs) which used reticulated vitreous carbon (RVC) to reduce Cs-137 levels in the sodium after final reactor shutdown. In total four MAVRs and seven TAs were used at BN-350 to remove an estimated cumulative 755 TBq of cesium. The traps, which also contain residual sodium, need to be immobilized in an appropriate way to allow them to be consigned as waste packages for long term storage and, ultimately, disposal. The present paper reports on the current status of the implementation phase, with particular reference to the work done to date on the trap accumulators, which have the most similarity with the cesium traps used at other reactors.

  6. Study on magnetic separation for decontamination of cesium contaminated soil by using superconducting magnet

    Energy Technology Data Exchange (ETDEWEB)

    Igarashi, Susumu, E-mail: igarashi@qb.see.eng.osaka-u.ac.jp; Nomura, Naoki; Mishima, Fumihito; Akiyama, Yoko, E-mail: yoko-ak@see.eng.osaka-u.ac.jp

    2014-09-15

    Highlights: • The method for the soil decontamination by the superconducting magnet is proposed. • Magnetic separation of clay minerals was performed by HGMS. • Soil separation ratio was evaluated by quantitative analysis using XRD. • It is expected that HGMS can be applied to the actual soil decontamination. - Abstract: The accident of Fukushima Daiichi nuclear power plant caused the diffusion of radioactive cesium over the wide area. We examined the possibility of applying magnetic separation method using the superconducting magnet, which can process a large amount of the soil in high speed, to the soil decontamination and volume reduction of the radioactive cesium contaminated soil. Clay minerals are classified as 2:1 and 1:1 types by the difference of their layer structures, and these types of minerals are respectively paramagnetic and diamagnetic including some exception. It is known that most of the radioactive cesium is strongly adsorbed on the clay, especially on 2:1 type clay minerals. It is expected that the method which can separate only 2:1 type clay minerals selectively from the mixture clay minerals can enormously contribute to the volume reduction of the contaminated soil. In this study, the components in the clay before and after separation were evaluated to estimate the magnetic separation efficiency by using X-ray diffraction. From the results, the decontamination efficiency and the volume reduction ratio were estimated in order to examine the appropriate separation conditions for the practical decontamination of the soil.

  7. ION EXCHANGE MODELING FOR REMOVAL OF CESIUM FROM HANFORD WASTE USING SUPERLIG 644 RESIN

    Energy Technology Data Exchange (ETDEWEB)

    Hamm, L

    2004-05-01

    The expected performance of a proposed ion exchange column using SuperLig{reg_sign} 644 resin for the removal of cesium from Hanford high level radioactive alkaline waste is discussed. This report represents a final report on the ability and knowledge with regard to modeling the Cesium-SuperLig{reg_sign} 644 resin ion exchange system. Only the loading phase of the cycle process is addressed within this report. Pertinent bench-scale column tests and batch equilibrium experiments are addressed. The methodology employed and sensitivity analyses are also included (i.e., existing methodology employed is referenced to prior developmental efforts while updated methodology is discussed). Pilot-scale testing is not assessed since no pilot-scale testing was available at the time of this report. Column performance predictions are made considering three selected feed compositions under nominal operating conditions. The sensitivity analyses provided help to identify key parameters that aid in resin procurement acceptance criteria. The methodology and application presented within this report reflect the expected behavior of SuperLig{reg_sign} 644 resin manufactured at the production-scale (i.e, 250 gallon batch size level). The primary objective of this work was, through modeling and verification based on experimental assessments, to predict the cesium removal performance of SuperLig{reg_sign} 644 resin for application in the RPP pretreatment facility.

  8. Novel application of nanozeolite for radioactive cesium removal from high-salt wastewater.

    Science.gov (United States)

    Lee, Keun-Young; Kim, Kwang-Wook; Park, Minsung; Kim, Jimin; Oh, Maengkyo; Lee, Eil-Hee; Chung, Dong-Yong; Moon, Jei-Kwon

    2016-05-15

    Finding a striking peculiarity of nanomaterials and evaluating its feasibility for practical use are interesting topics of research. We investigated the application of nanozeolite's outstanding reactivity for a rapid and effective method for radioactive cesium removal in the wastewater generated from nuclear power plant accident, as a new concept. Extremely fast removal of cesium, even without stirring, was achieved by the nanozeolite at efficiencies never observed with bulk materials. The nanozeolite reached an adsorption equilibrium state within 1 min. Cesium adsorption by nanozeolite was demonstrated at reaction rates of orders of magnitude higher than that of larger zeolite phases. This observation was strongly supported by the positive correlation between the rate constant ratio (k2,bulk/k2,nano) and the initial Cs concentrations with a correlation coefficient (R(2)) of 0.99. A potential drawback of a nanoadsorbent is the difficulty of particle settling and separation because of its high dispersivity in solution. However, our results also demonstrated that the nanozeolite could be easily precipitated from the high-salt solution with ferric flocculant. The flocculation index reached a steady state within 10 min. A series of our experimental results met the goal of rapid processing in the case of emergency by applying the well-suited nanozeolite adsorption and flocculation.

  9. Derivation of cesium-137 residual radioactive material guidelines for the Peek Street site, Schenectady, New York

    Energy Technology Data Exchange (ETDEWEB)

    Jones, L.; Nimmagadda, M.; Yu, C.

    1992-01-01

    Residual radioactive material guidelines for cesium-137 were derived for the Peek rk. The derivation was based on the requirement that the Street site in Schenectady, New York. The derivation was based on the requirement that the 50-year committed effective dose equivalent to a hypothetical individual who lives or works in the immediate vicinity of the Peek Street site should not exceed a dose of 100 mrem/yr following remedial action. The US Department of Energy (DOE) residual radioactive material guideline computer code, RESRAD was used in this evaluation. Three potential scenarios were considered for the site on the assumption that for a period of 1,000 years following remedial action, the site wig be utilized without radiological restrictions. The scenarios vary with regard to use of the site, time spent at the site, and sources of food consumed. Results indicate that the basic dose limit of 100 mrem/yr will not be exceeded for cesium-137 within 1,000 years, provided that the soil concentration of cesium-137 at the Peek Street site does not exceed the following levels: 98 pCi/g for Scenario A (industrial worker: the expected scenario), 240 pCi/g for Scenario B (recreationist: a plausible scenario), and 34 pCi/g for Scenario C (resident farmer ingesting food produced in the decontaminated area: a plausible scenario).

  10. Enhanced capacity and stability for the separation of cesium in electrically switched ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Tawfic, A.F.; Dickson, S.E.; Kim, Y. [McMaster University, Hamilton, ON (Canada); Mekky, W. [AMEC NSS, Power and Process America, Toronto (Canada)

    2015-03-15

    Electrically switched ion exchange (ESIX) can be used to separate ionic contaminants from industrial wastewater, including that generated by the nuclear industry. The ESIX method involves sequential application of reduction and oxidation potentials to an ion exchange film to induce the respective loading and unloading of cesium. This technology is superior to conventional methods (e.g electrodialysis reversal or reverse osmosis) as it requires very little energy for ionic separation. In previous studies, ESIX films have demonstrated relatively low ion exchange capacities and limited film stabilities over repeated potential applications. In this study, the methodology for the deposition of electro-active films (nickel hexacyanoferrate) on nickel electrodes was modified to improve the ion exchange capacity for cesium removal using ESIX. Cyclic voltammetry was used to investigate the ion exchange capacity and stability. Scanning electron microscopy (SEM) was used to characterize the modified film surfaces. Additionally, the films were examined for the separation of cesium ions. This modified film preparation technique enhanced the ion exchange capacity and improves the film stability compared to previous methods for the deposition of ESIX films. (authors)

  11. Cellulose nanofiber backboned Prussian blue nanoparticles as powerful adsorbents for the selective elimination of radioactive cesium

    Science.gov (United States)

    Vipin, Adavan Kiliyankil; Fugetsu, Bunshi; Sakata, Ichiro; Isogai, Akira; Endo, Morinobu; Li, Mingda; Dresselhaus, Mildred S.

    2016-11-01

    On 11 March 2011, the day of the unforgettable disaster of the 9 magnitude Tohoku earthquake and quickly followed by the devastating Tsunami, a damageable amount of radionuclides had dispersed from the Fukushima Daiichi’s damaged nuclear reactors. Decontamination of the dispersed radionuclides from seawater and soil, due to the huge amounts of coexisting ions with competitive functionalities, has been the topmost difficulty. Ferric hexacyanoferrate, also known as Prussian blue (PB), has been the most powerful material for selectively trapping the radioactive cesium ions; its high tendency to form stable colloids in water, however, has made PB to be impossible for the open-field radioactive cesium decontamination applications. A nano/nano combinatorial approach, as is described in this study, has provided an ultimate solution to this intrinsic colloid formation difficulty of PB. Cellulose nanofibers (CNF) were used to immobilize PB via the creation of CNF-backboned PB. The CNF-backboned PB (CNF/PB) was found to be highly tolerant to water and moreover, it gave a 139 mg/g capability and a million (106) order of magnitude distribution coefficient (Kd) for absorbing of the radioactive cesium ion. Field studies on soil and seawater decontaminations in Fukushima gave satisfactory results, demonstrating high capabilities of CNF/PB for practical applications.

  12. WESF cesium capsule behavior at high temperature or during thermal cycling

    Energy Technology Data Exchange (ETDEWEB)

    Tingey, G.L.; Gray, W.J.; Shippell, R.J.; Katayama, Y.B.

    1985-06-01

    Double-walled stainless steel (SS) capsules prepared for storage of radioactive /sup 137/Cs from defense waste are now being considered for use as sources for commercial irradiation. Cesium was recovered at B-plant from the high-level radioactive waste generated during processing of defense nuclear fuel. It was then purified, converted to the chloride form, and encapsulated at the Hanford Waste Encapsulation and Storage Facility (WESF). The molten cesium chloride salt was encapsulated by pouring it into the inner of two concentric SS cylinders. Each cylinder was fitted with a SS end cap that was welded in place by inert gas-tungsten arc welding. The capsule configuration and dimensions are shown in Figure 1. In a recent review of the safety of these capsules, Tingey, Wheelwright, and Lytle (1984) indicated that experimental studies were continuing to produce long-term corrosion data, to reaffirm capsule integrity during a 90-min fire where capsule temperatures reached 800/sup 0/C, to monitor mechanical properties as a function of time, and to assess the effects of thermal cycling due to periodic transfer of the capsules from a water storage pool to the air environment of an irradiator facility. This report covers results from tests that simulated the effects of the 90-min fire and from thermal cycling actual WESF cesium capsules for 3845 cycles over a period of six months. 11 refs., 39 figs., 9 tabs.

  13. Fire Safety Tests for Cesium-Loaded Spherical Resorcinol Formaldehyde Resin: Data Summary Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Sang; Schweiger, Michael J.; Peterson, Reid A.

    2012-09-01

    A draft safety evaluation of the scenario for spherical resorcinol formaldehyde (SRF) resin fire inside the ion exchange column was performed by the Hanford Tank Waste Treatment and Immobilization Plant (WTP) Fire Safety organization. The result of this draft evaluation suggested a potential change of the fire safety classification for the Cesium Ion Exchange Process System (CXP) emergency elution vessels, equipment, and piping. To resolve this question, the fire properties of the SRF resin were measured by Southwest Research Institute (SwRI) through a subcontract managed by Pacific Northwest National Laboratory (PNNL). The results of initial fire safety tests on the SRF resin were documented in a previous report (WTP-RPT-218). The present report summarizes the results of additional tests performed by SwRI on the cesium-loaded SRF resin. The efforts by PNNL were limited to summarizing the test results provided by SwRI into one consolidated data report. The as-received SwRI report is attached to this report in the Appendix A. Where applicable, the precision and bias of each test method, as given by each American Society for Testing and Materials (ASTM) standard procedure, are included and compared with the SwRI test results of the cesium-loaded SRF resin.

  14. Fabrication of stimuli-sensitive hydrogel for the removal of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hee-Man; Bong, Sang Bum; Park, Chan Woo; Lee, Kune Woo; Seo, Bum-Kyoung; Moon, Jei Kwon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-05-15

    The nuclear accident at the Fukushima Daiichi nuclear power station in 2011 released a huge quantity of radioactive contaminants into the environment.1 Among these, cesium Cs-137 is the most problematic contaminant due to its long half-life (30.2 years), and high-energy gamma ray (γ-ray) emissions. 2 Various surface including road, roof, house, building were contaminated with Cs-137. These coating materials have some problems and limitation such as toxic component, and lack of reusability of materials related to the cost. Thus, a more cost-effective and environmental friendly coating materials is still desired. 3 In the present study, the stimuli-sensitive hydrogel were fabricated for the removal of radioactive Cs from solid surface. We describe the morphology, structure, and physical property of these stimuli sensitive hydrogel. In addition, their ability to eliminate cesium was also evaluated. The smart hydrogel coating materials showed an excellent morphology change from the liquid to film by addition of Ca ion. Therefore, the stimuli-sensitive hydrogel demonstrated good potential for the treatment of contaminated surface for the removal of radioactive cesium.

  15. Uptake and transport of radioactive cesium and strontium into grapevines after leaf contamination

    Science.gov (United States)

    Zehnder, H. J.; Kopp, P.; Eikenberg, J.; Feller, U.; Oertli, J. J.

    1995-07-01

    From 1989 to 1993 the foliar uptake of radioactive strontium (Sr-85) and cesium (Cs-134) by selected leaves of grapevine plants and the subsequent redistribution within the plants was examined under controlled conditions in a greenhouse. The radionuclides were applied as chlorides. These plants were grown in large pots containing a mixture of local soil and peat. Plant and soil samples were analyzed throughout the growing season and also during the following vegetation period. Only traces of the applied radiostrontium were taken up by the leaves. This element was essentially not redistributed within the plants. In contrast, radiocesium was easily taken up through the leaf surface, transported to other plant parts and to some extent released from the roots into the soil. Cesium reaching the soil may interact with clay particles causing a very reduced availability for plants. Therefore the soil may act as a long-term sink for radiocesium. On the other hand, grape berries represent transient sinks. The cesium levels in the berries decreased again in a late phase of maturation, but the mechanisms causing this loss are not yet identified. During the second vegetation period, only a very minor proportion of the radiocesium taken up previously by the plants was present in the above ground parts.

  16. Kinetic and equilibrium studies of cesium adsorption on ceiling tiles from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Miah, Muhammed Yusuf [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Department of Applied Chemistry and Chemical Technology, Noakhali Science and Technology University (Bangladesh); Volchek, Konstantin, E-mail: Konstantin.Volchek@ec.gc.ca [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Kuang, Wenxing [SAIC Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Tezel, F. Handan [Department of Chemical and Biological Engineering, University of Ottawa, 161 Louis-Pasteur, Ottawa, Ontario, K1N 6N5 (Canada)

    2010-11-15

    A series of experiments were performed to quantify the adsorption of cesium on ceiling tiles as a representative of urban construction materials. Adsorption was carried out from solutions to mimic wet environmental conditions. Non-radioactive cesium chloride was used as a surrogate of the radioactive {sup 137}Cs. The experiments were performed in the range of initial cesium concentrations of 0.114-23.9 mg L{sup -1} at room temperature (21 deg. C) around three weeks. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectrometry (ICP-MS). The quantity of adsorbed Cs was calculated by mass balance as a function of time. Two kinetic and three equilibrium models were employed to interpret the test results. Determination of kinetic parameters for adsorption was carried out using the first-order reaction model and the intra-particle diffusion model. Adsorption equilibrium was studied using Langmuir, Freundlich and three-parameter Langmuir-Freundlich adsorption isotherm models. A satisfactory correlation between the experimental and the predicted values was observed.

  17. Increased CD133+ cell infiltration in the rat brain following fluid percussion injury

    Institute of Scientific and Technical Information of China (English)

    Ming Wei; Ziwei Zhou; Shenghui Li; Chengwei Jing; Dashi Zhi; Jianning Zhang

    2012-01-01

    The prominin-1/CD133 epitope is expressed in undifferentiated cells. Studies have reported that craniocerebral trauma in animal models of fluid percussion injury induces production of a specific stem cell subgroup. It has been hypothesized that fluid percussion injury induces CD133+ cell infiltration in the brain tissue. The present study established a traumatic brain injury model through fluid percussion injury. Immunohistochemical staining showed significantly increased CD133 antigen expression in the rat brain following injury. CD133+ cells were mainly distributed in hippocampal CA1-3 regions, as well as the dentate gyrus and hilus, of the lesioned hemisphere. Occasional cells were also detected in the cortex. In addition, reverse transcription-PCR revealed that no change in CD133 mRNA expression in injured brain tissue. These results suggested that fluid percussion injury induced CD133 antigen expression in the brain tissues as a result of conformational epitope changes, but not transcriptional expression.

  18. The effect of organic amendment on mobility of cesium in tropical soils - The effect of organic amendment on sorption mechanisms for cesium and cobalt in tropical soils

    Energy Technology Data Exchange (ETDEWEB)

    Wasserman, M.A.V.; Santos-Oliveira, R. [Instituto de Engenharia nuclear/CNEN. Rua Helio de Almeida, 75. Cidade Universitaria - Ilha do Fundao, Rio de Janeiro, RJ. CEP 21941-906 (Brazil); Garcia, R.J.L.; Ferreira, A.C.M.; Rochedo, E.R.R.; Sobrinho, G.A.N. [Instituto de Radioprotecao e Dosimetria/CNEN. Av. Salvador Allende s /no. Rio de Janeiro, RJ. CEP: 22780-160 (Brazil); Perez, D.V. [Centro Nacional de Pesquisa de Solos/EMBRAPA. R. Jardim Botanico, 1024.Rio de Janeiro, RJ, CEP: 22460-000 (Brazil); Wasserman, J.C. [dUFF Network of Environment and Sustainable Development (REMADS-UFF), University Federal Fluminense, Niteroi, RJ (Brazil)

    2014-07-01

    This work aimed to investigate the mechanisms involved in the sorption of {sup 137}Cs and {sup 60}Co as a function of the physico-chemical properties of some types of Brazilian soils and the changes on the behavior of these radionuclides due to changes in soil properties promoted by organic amendment. The experimental study was conducted in a controlled area, where pots containing different types of soils (Ferralsol, Nitisol and Histosol) and different doses of organic amendment (no amendment; 2 kg.m{sup -2} and 4 kg.m{sup -2}) were spiked with {sup 137}Cs and {sup 60}Co. The organic amendment used in this experiment was obtained in the Unit of Compost of the Organic Material of Pinheiral (RJ, Brazil), where the compost is made up from the leaves swept from the streets of the Pinheiral city. The mobility of these radionuclides in the soil was assessed through sequential chemical extraction and desorption studies as a function of pH. The bioavailability was evaluated through the effective absorption of radionuclide by root crops (Raphanus sativus, L). This study evidenced that the organic amendment plays an important role in the desorption processes of cobalt and cesium, reducing desorption of both nuclides beneath higher organic amendment dose. This behavior was observed in acid conditions as well in alkaline. However extreme acid conditions may mobilize both radionuclides, although cobalt mobility was shown to be more sensitive to low pH than cesium. (authors)

  19. Efimov Physics in a 6Li-133Cs Atomic Mixture

    Science.gov (United States)

    Johansen, Jacob; Feng, Lei; Parker, Colin; Chin, Cheng; Wang, Yujun

    2015-05-01

    We investigate Efimov physics based on three-body recombination in an atomic mixture of 6Li and 133Cs in the vicinity of interspecies Feshbach resonances at 843 and 889 G. This allows us to compare the loss spectra near different resonances and test the universality of Efimov states. Theoretically the Efimov spectrum near 889 G is expected to be similar to that near 843 G, except that the first resonance is absent near the former Feshbach resonance. This is due to the difference in the Cs-Cs scattering length near the two resonances: At 843 G it is negative, whereas at 889 G it is positive. Although it is primarily the Li-Cs interactions that lead to Efimov resonances, the Cs-Cs scattering length is expected to influence the spectrum. This work is supported by NSF and Chicago MRSEC.

  20. Shock initiation of 1,3,3-trinitroazetidine (TNAZ)

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, R.L.; Urtiew, P.A.; Tarver, C.M.

    1995-07-19

    The shock sensitivity of the pressed solid explosive 1,3,3-trinitroazetidine (TNAZ) was determined using the embedded manganin pressure gauge technique. At an initial pressure of 1.3 GPa, pressure buildup (exothermic reaction) was observed after ten {mu}s. At 2 GPa, TNAZ reacted rapidly and transitioned to detonation in approximately 13 mm. At 3.6 GPa, detonation occurred in less than 6 mm of shock propagation. Thus, pure TNAZ is more shock sensitive than HMX-based explosives but less shock sensitive than PETN-based explosives. The shocked TNAZ exhibited little reaction directly behind the shock front, followed by an extremely rapid reaction. This reaction caused both a detonation wave and a retonation wave in the partially decomposed TNAZ. An Ignition and Growth reactive model for TNAZ was developed to help understand this complex initiation phenomenon.

  1. STAT3 is a key transcriptional regulator of cancer stem cell marker CD133 in HCC

    Science.gov (United States)

    Ghoshal, Sarani; Fuchs, Bryan C.

    2016-01-01

    Cancer stem cell (CSC) marker CD133 was found to be upregulated in many cancers including hepatocellular carcinoma (HCC). However, the molecular mechanism of CD133 regulation in the liver tumor microenvironment has remained elusive. In this study Won and colleagues report that interleukin-6 (IL-6) mediated signal transducer and activator of transcription factor 3 (STAT3) signaling and hypoxia enhance the expression of CD133 and promote the progression of HCC. PMID:27275460

  2. CD133 Immunohistochemisty in Glioblastoma – Identification of Tumor Stem Cells or a Matter of Coincidence?

    DEFF Research Database (Denmark)

    Hermansen, Simon Kjær; Christensen, Karina Garnier; Jensen, Stine Skov;

    The putative stem cell marker CD133 is the marker of choice for identifying brain tumor stem cells in gliomas, but the use of different antibody clones recognizing different epitopes with different glycosylation status, confuses the field. In this study, we sat out to highlight if current...... suggest that CD133 immunohistochemical studies take this in to consideration by using different CD133 antibody clones together with other stem cell markers and e.g. PCR techniques before too firm conclusions are drawn....

  3. 29 CFR 780.133 - Farmers' cooperative as a “farmer.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Farmers' cooperative as a âfarmer.â 780.133 Section 780.133... General Scope of Agriculture Practices Performed âby A Farmerâ § 780.133 Farmers' cooperative as a “farmer.” (a) The phrase “by a farmer” covers practices performed either by the farmer himself or by the...

  4. MicroRNA Profiling During Craniofacial Development: Potential Roles for Mir23b and Mir133b

    Directory of Open Access Journals (Sweden)

    Hai-Lei Ding

    2016-07-01

    Full Text Available Defects in mid-facial development, including cleft lip/palate, account for a large number of human birth defects annually. In many cases, aberrant gene expression results in either a reduction in the number of neural crest cells (NCCs that reach the frontonasal region and form much of the facial skeleton or subsequent failure of NCC patterning and differentiation into bone and cartilage. While loss of gene expression is often associated with developmental defects, aberrant upregulation of expression can also be detrimental. microRNAs (miRNAs are a class of non-coding RNAs that normally repress gene expression by binding to recognition sequences located in the 3’ UTR of target mRNAs. miRNAs play important roles in many developmental systems, including midfacial development. Here, we take advantage of high throughput RNA sequencing (RNA-seq from different tissues of the developing mouse midface to interrogate the miRs that are expressed in the midface and select a subset for further expression analysis. Among those examined, we focused on four that showed the highest expression level in situ hybridization analysis. Mir23b and Mir24.1 are specifically expressed in the developing mouse frontonasal region, in addition to areas in the perichondrium, tongue musculature and cranial ganglia. Mir23b is also expressed in the palatal shelves and in anterior epithelium of the palate. In contrast, Mir133b and Mir128.2 are mainly expressed in head and trunk musculature. Expression analysis of mir23b and mir133b in zebrafish suggests that mir23b is expressed in the pharyngeal arch, otic vesicle and trunk muscle while mir133b is similarly expressed in head and trunk muscle. Functional analysis by overexpression of mir23b in zebrafish leads to broadening of the ethmoid plate and aberrant cartilage structures in the viscerocranium, while overexpression of mir133b causes a reduction in ethmoid plate size and a significant cleft. These data illustrate that mi

  5. Dicty_cDB: SHI133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 044130 |CR044130.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering ...Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHPP47e19. 50... 0.068 1 CR034434 |CR034434.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering...ion targeting and chromosome engineering clone MHPP142o16. 50 0.068 1 BX990136 |B...X990136.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHP

  6. Sintered bentonite ceramics for the immobilization of cesium- and strontium-bearing radioactive waste

    Science.gov (United States)

    Ortega, Luis Humberto

    The Advanced Fuel Cycle Initiative (AFCI) is a Department of Energy (DOE) program, that has been investigating technologies to improve fuel cycle sustainability and proliferation resistance. One of the program's goals is to reduce the amount of radioactive waste requiring repository disposal. Cesium and strontium are two primary heat sources during the first 300 years of spent nuclear fuel's decay, specifically isotopes Cs-137 and Sr-90. Removal of these isotopes from spent nuclear fuel will reduce the activity of the bulk spent fuel, reducing the heat given off by the waste. Once the cesium and strontium are separated from the bulk of the spent nuclear fuel, the isotopes must be immobilized. This study is focused on a method to immobilize a cesium- and strontium-bearing radioactive liquid waste stream. While there are various schemes to remove these isotopes from spent fuel, this study has focused on a nitric acid based liquid waste. The waste liquid was mixed with the bentonite, dried then sintered. To be effective sintering temperatures from 1100 to 1200°C were required, and waste concentrations must be at least 25 wt%. The product is a leach resistant ceramic solid with the waste elements embedded within alumino-silicates and a silicon rich phase. The cesium is primarily incorporated into pollucite and the strontium into a monoclinic feldspar. The simulated waste was prepared from nitrate salts of stable ions. These ions were limited to cesium, strontium, barium and rubidium. Barium and rubidium will be co-extracted during separation due to similar chemical properties to cesium and strontium. The waste liquid was added to the bentonite clay incrementally with drying steps between each addition. The dry powder was pressed and then sintered at various temperatures. The maximum loading tested is 32 wt. percent waste, which refers to 13.9 wt. percent cesium, 12.2 wt. percent barium, 4.1 wt. percent strontium, and 2.0 wt. percent rubidium. Lower loadings of waste

  7. Additional results for "joint entropy of continuously differentiable ultrasonic waveforms" [J. Acoust. Soc. Am. 133(1), 283-300 (2013)].

    Science.gov (United States)

    Hughes, M S; Marsh, J N; Wickline, S A; McCarthy, J E

    2015-01-01

    Previous results on the use of joint entropy for detection of targeted nanoparticles accumulating in the neovasculature of MDA435 tumors [Fig. 7 of M. S. Hughes et al., J. Acoust. Soc. Am. 133, 283-300 (2013)] are extended, with sensitivity improving by nearly another factor of 2. This result is obtained using a "quasi-optimal" reference waveform in the computation of the joint entropy imaging technique used to image the accumulating nanoparticles.

  8. Identification by Mass Spectrometry and Immune Response Analysis of Guinea Pig Cytomegalovirus (GPCMV Pentameric Complex Proteins GP129, 131 and 133

    Directory of Open Access Journals (Sweden)

    Josephine S. Gnanandarajah

    2014-02-01

    Full Text Available Development of a vaccine against congenital infection with human cytomegalovirus (HCMV is a major public health priority. A potential vaccine target receiving considerable recent attention is the pentameric complex (PC of HCMV proteins consisting of gL, gH, UL128, UL130, and UL131, since some antibodies against these target proteins are capable of potently neutralizing virus at epithelial and endothelial cell surfaces. Recently, homologous proteins have been described for guinea pig cytomegalovirus (GPCMV, consisting of gH, gL, and the GPCMV proteins GP129, GP131, and GP133. To investigate these proteins as potential vaccine targets, expression of GP129-GP133 transcripts was confirmed by reverse-transcriptase PCR. Mass spectrometry combined with western blot assays demonstrated the presence of GP129, GP131, and GP133 proteins in virus particles. Recombinant proteins corresponding to these PC proteins were generated in baculovirus, and as GST fusion proteins. Recombinant proteins were noted to be immunoreactive with convalescent sera from infected animals, suggesting that these proteins are recognized in the humoral immune response to GPCMV infection. These analyses support the study of PC-based recombinant vaccines in the GPCMV congenital infection model.

  9. A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

    Energy Technology Data Exchange (ETDEWEB)

    Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

    2008-07-15

    Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

  10. 21 CFR 133.161 - Muenster and munster cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster...

  11. High CD133 Expression Is Associated with Worse Prognosis in Patients with Glioblastoma.

    Science.gov (United States)

    Zhang, Wei; Chen, Huanran; Lv, Shengqing; Yang, Hui

    2016-05-01

    The CD133 antigen has been identified as a putative stem cell marker in gliomas. However, the prognostic significance of CD133 expression in glioblastoma patients remained controversial. A meta-analysis of published data was performed to comprehensively assess the prognostic role of CD133 expression in glioblastoma patients. Publications assessing the prognostic significance of CD133 expression in glioblastoma patients were identified in PubMed, Embase, and Web of Science up to November 2014. The pooled hazard ratio (HR) with 95% confidence interval (95% CI) was calculated using meta-analysis to evaluate the prognostic significance of CD133 expression in glioblastoma. Ten studies with a total of 715 glioblastoma patients were included into the meta-analysis. Overall, high CD133 expression was associated with poorer overall survival in patients with glioblastoma (HR = 1.96, 95% CI 1.46-2.64, P glioblastoma (HR = 2.03, 95% CI 1.43-2.88, P glioblastoma. Meta-analysis of studies with adjusted estimates further showed that high CD133 expression was an independent prognostic factor of glioblastoma. High CD133 expression is associated with worse prognosis in patients with glioblastoma. More prospective studies with well-design are needed to confirm this finding.

  12. Compensation for geometric changes during monitoring of 133Xe washout from subcutaneous adipose tissue

    DEFF Research Database (Denmark)

    Bülow, J; Madsen, J

    1975-01-01

    A method is described for automatic compensation of changes in geometry during monitoring of 133Xe-washout curves from subcutaneous depots. A 99mTc source is placed on the skin over the 133Xe depot, and both isotopes are counted simultaneously. Variations in the 99mTc activity (corrected for radi...

  13. 12 CFR 204.133 - Multiple savings deposits treated as a transaction account.

    Science.gov (United States)

    2010-01-01

    ... transaction account. 204.133 Section 204.133 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RESERVE REQUIREMENTS OF DEPOSITORY INSTITUTIONS (REGULATION D.... Section 19(b) establishes general reserve requirements on transaction accounts and nonpersonal...

  14. CD133(+) niches and single cells in glioblastoma have different phenotypes

    DEFF Research Database (Denmark)

    Christensen, Karina; Schrøder, Henrik Daa; Kristensen, Bjarne Winther

    2011-01-01

    Putative CD133(+) brain tumor stem cells have been shown to be located in niches and as single cells. This is the first study providing insight into the different phenotypes of CD133(+) cells in glioblastoma according to localization. Paraffin sections were stained by double immunofluorescence...

  15. Cystogenic potential of CD133+ progenitor cells of human polycystic kidneys.

    Science.gov (United States)

    Carvalhosa, Raquel; Deambrosis, Ilaria; Carrera, Paola; Pasquino, Chiara; Rigo, Francesca; Ferrari, Maurizio; Lasaponara, Fedele; Ranghino, Andrea; Biancone, Luigi; Segoloni, Giuseppe; Bussolati, Benedetta; Camussi, Giovanni

    2011-09-01

    In autosomal dominant polycystic kidney disease, cysts arise focally and disrupt normal renal tissue leading to renal failure. In the present study, we show that cyst-lining cells express the stem cell marker CD133. CD133+ progenitor cells isolated from polycystic kidney, carrying mutations of PKD genes, showed a dedifferentiated phenotype similar to CD133+ progenitor cells from normal kidney. However, these cells were more proliferative and presented a defective epithelial differentiation phenotype with respect to normal renal CD133+ cells as they were not able to express all tubular epithelial cell markers when cultured in epithelial differentiation medium. Polycystic CD133+ cells, in contrast to normal renal CD133+ cells, formed cysts in vitro in a three-dimensional culture system and in vivo when injected subcutaneously within Matrigel in SCID mice. Rapamycin treatment reduced in vitro proliferation of polycystic CD133+ cells and decreased cystogenesis both in vitro and in vivo. The in vitro epithelial differentiation was only partially improved by rapamycin. These results indicate that polycystic CD133+ cells retain a dedifferentiated phenotype and the ability to generate cysts.

  16. 42 CFR 422.133 - Return to home skilled nursing facility.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Return to home skilled nursing facility. 422.133....133 Return to home skilled nursing facility. (a) General rule. MA plans must provide coverage of posthospital extended care services to Medicare enrollees through a home skilled nursing facility if...

  17. 21 CFR 133.136 - Washed curd and soaked curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd and soaked curd cheese. 133.136... Standardized Cheese and Related Products § 133.136 Washed curd and soaked curd cheese. (a) Description. (1) Washed curd, soaked curd cheese is the food prepared by the procedure set forth in paragraph (a)(3)...

  18. 46 CFR 133.153 - Survival craft launching and recovery arrangements using falls and a winch.

    Science.gov (United States)

    2010-10-01

    ... falls and a winch. 133.153 Section 133.153 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... launching and recovery arrangements using falls and a winch. Survival craft launching and recovery...) Each fall wire must be of rotation-resistant and corrosion-resistant steel wire rope. (b) The...

  19. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  20. Artifacts in Radar Imaging of Moving Targets

    Science.gov (United States)

    2012-09-01

    leads to the wrong object localization and defocusing on the image. For SAR , a moving target’s physical location varies throughout the imaging...Imaging, Synthetic Aperture Radar, Bistatic Radar, Multistatic Radar, Moving Targets, Backprojection 15. NUMBER OF PAGES 133 16. PRICE CODE 17...broadening and range errors were introduced by target motion. This leads to incorrect object localization and defocusing on the image. For SAR , a

  1. Cesium accumulation by bacterium Thermus sp.TibetanG7: hints for biomineralization of cesiumbearing geyserite in hot springs in Tibet, China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The bacterium Thermus sp. TibetanG7, isolated from hot springs in Tibet, China, was examined for the ability to accumulate cesium from solutions. Environmental conditions were simulated and the effects of pH, K+, Na+ and K+-regimes were then studied to determine the possible role of the bacterium in the formation of cesium-bearing geyserite around these hot springs. In despite of the inhibition of K+ and Na+, the bacterium Thermus sp. TibetanG7 revealed noticeable accumulation of cesium from solutions, with maximum accumulations of 53.49 and 40.41 μmol Cesium/g cell dry weight in Na+ and K+ inhibition experiments, respectively. The accumulation of cesium by this microorganism is rapid, with 40%―50% accumulated within the first 5 min. K+-deficient cells showed a much higher capacity of cesium accumulation compared with K+-sufficient cells. It is evident that the bacteria within the genus thermus play a significant role in the cesium assembly. The formation of cesium-bearing geyserite is also considered.

  2. Immiscibility in a Quantum Degenerate Mixture of $^{87}$Rb and $^{133}$Cs

    CERN Document Server

    McCarron, D J; Jenkin, D L; Köppinger, M P; Cornish, S L

    2011-01-01

    We report a new method for the production of Bose-Einstein condensates of $^{133}$Cs and demonstrate the formation of a quantum degenerate mixture of $^{87}$Rb and $^{133}$Cs. The approach exploits efficient sympathetic cooling of $^{133}$Cs via $^{87}$Rb in a magnetic quadrupole trap prior to further evaporative cooling in a levitated optical trap. Sacrificing all the $^{87}$Rb during the cooling, we create single species $^{133}$Cs condensates of up to $6\\times10^{4}$ atoms. Tailoring the evaporation to retain some $^{87}$Rb, we simultaneously create condensates of $^{87}$Rb and $^{133}$Cs in the same trapping potential, each containing up to $2\\times10^{4}$ atoms. We observe a striking phase separation of the two species revealing the mixture to be immiscible due to strong repulsive interspecies interactions.

  3. LOSS OF HETEROZYGOSITY ON CHROMOSOME 17p13.3 IN OVARIAN CANCER AND CERVICAL CANCER

    Institute of Scientific and Technical Information of China (English)

    Zhang Guoling; Yang Huijian; Xu Kaili; Zhou Jin; Qin Ruidi; Lu Minghua

    1998-01-01

    Objective:To identify the loss of heterozygosity (LOH) on chromosome 17p13.3 in ovarian cancer and cervical cancer. Methods: The frequency of LOH on chromosome 17p13.3 in DNA samples from 24 ovarian cancers, 9 cervical cancers, and 13 non-malignant gynecological diseases were determined respectively, using Southern blot method with probe PYNZ.22. Results:LOH on 17p13.3 was found in 12 of 24 (50.0%) ovarian cancers (including a borderline mucinous cystadenoma), 4of 9 (44.4%) cervical carcinomas, and 1 of 13 (7.7%) nonmalignant gynecological diseases, which was cervical intraepithelial neoplasm HI (CIN Ⅲ) (P<0.01).Conclusion: These results show that LOH on 17p13.3 is associated with ovarian cancer and cervical cancer,suggesting that detection of LOH on 17p13.3 may be helpful to understand the molecular pathogenesis of ovarian cancer and cervical cancer.

  4. STS-133/ET-137 Tanking Test Photogrammetry Assessment

    Science.gov (United States)

    Oliver, Stanley T.

    2012-01-01

    Following the launch scrub of Space Shuttle mission STS-133 on November 5, 2010, an anomalous condition of cracked and raised thermal protection system (TPS) foam was observed on the External Tank (ET). Subsequent dissection of the affected TPS region revealed cracks in the feet of two Intertank (IT) metallic stringers. An extensive investigation into the cause(s) and corrective action(s) for the cracked stringers was initiated, involving a wide array of material and structural tests and nondestructive evaluations, with the intent to culminate into the development of flight rational. One such structural test was the instrumented tanking test performed on December 17, 2010. The tanking test incorporated two three-dimensional optical displacement measurement systems to measure full-field outer surface displacements of the TPS surrounding the affected region that contained the stringer cracks. The results showed that the radial displacement and rotation of the liquid oxygen (LO2) tank flange changed significantly as the fluid level of the LO2 approached and passed the LO2 tank flange.

  5. Cesium Platinide Hydride 4Cs 2 Pt-CsH: An Intermetallic Double Salt Featuring Metal Anions

    Energy Technology Data Exchange (ETDEWEB)

    Smetana, Volodymyr [Ames Laboratory, US Department of Energy, and Critical Materials Institute, Ames Iowa 50011-3020 USA; Mudring, Anja-Verena [Ames Laboratory, US Department of Energy, and Critical Materials Institute, Ames Iowa 50011-3020 USA; Department of Materials Sciences and Engineering, Iowa State University, Ames Iowa 50011-3111 USA

    2016-10-24

    With Cs9Pt4H a new representative of ionic compounds featuring metal anions can be added to this rare-membered family. Cs9Pt4H exhibits a complex crystal structure containing Cs+ cations, Pt2- and H- anions. Being a red, transparent compound its band gap is in the visible range of the electromagnetic spectrum and the ionic type of bonding is confirmed by quantum chemical calculations. This cesium platinide hydride can formally be considered as a double salt of the “alloy” cesium–platinum, or better cesium platinide, Cs2Pt, and the salt cesium hydride CsH according to Cs9Pt4H≡4 Cs2Pt∙CsH.

  6. One Pot Synthesis and Characterization of Cesium Doped SnO2 Nanocrystals via a Hydrothermal Process

    Institute of Scientific and Technical Information of China (English)

    K. Kaviyarasu; Prem Anand Devarajan; S. Stanly John Xavier; S. Augustine Thomas; S. Se]vakumar

    2012-01-01

    The physico-chemical properties of cesium doped SnO2 nanocrystals synthesized by wet chemical method have been investigated. Scanning electron microscopy (SEM), X-ray diffraction (XRD), energy dispersive X-ray analysis (EDAX), inductively coupled plasma (ICP), atomic absorption spectroscopic (AAS) analyses, UV-vis-NIR spectral studies and dielectric studies were carried out for both pure SnO2 and cesium doped SnO2 nano-samples. All samples of SnO2 did not show any metallic cluster, but the sample containing cesium as a dopant displayed significant activity. The products formed were chloride and water representing a competitive advantage from the stand point of environmental protection.

  7. Prussian blue caged in alginate/calcium beads as adsorbents for removal of cesium ions from contaminated water

    Energy Technology Data Exchange (ETDEWEB)

    Vipin, Adavan Kiliyankil; Hu, Baiyang; Fugetsu, Bunshi, E-mail: hu@ees.hokudai.ac.jp

    2013-08-15

    Highlights: • Prussian blue was encapsulated in calcium/alginate beads. •The Prussian blue encapsulated beads were reinforced using carbon nanotubes. • Adsorption behaviors toward cesium were studied with the aid of appropriate mathematical models. • The beads showed high efficiency over a wide range of pH, potassium and sodium ion concentrations. • Continuous column analysis proved that the beads are suitable for large-scale water treatments. -- Abstract: Prussian blue encapsulated in alginate beads reinforced with highly dispersed carbon nanotubes were prepared for the safe removal of cesium ions from aqueous solutions. Equilibrium and kinetic studies were conducted using different models and the goodness of mathematical fitting of the experimental data on the adsorption isotherms was in the order Langmuir > Freundlich, and that of the kinetic models were in the order of pseudo second order > pseudo first order. Fixed bed adsorption column analysis indicated that the beads can be used for large scale treatment of cesium contaminated water.

  8. The role of cesium suboxides in low-work-function surface layers studied by X-ray photoelectron spectroscopy - Ag-O-Cs

    Science.gov (United States)

    Yang, S.-J.; Bates, C. W., Jr.

    1980-01-01

    The oxidation of cesium on silver substrates has been studied using photoyield measurements and X-ray photoelectron spectroscopy. The occurrence of two O1s peaks in the core-level spectrum at 527.5 and 531.5-eV binding energy for cesium and oxygen exposures giving the optimum photoyield proves that two oxides of cesium exist in high-photoyield surfaces, and not Cs2O alone as previously thought. From the shape and position of the cesium peaks and the Auger parameter, the assignment of the O1s peaks at 527.5- and 531.5-eV binding energies to oxygen in Cs2O and Cs11O3, respectively, can be made. Hence the total cesium-oxygen layer is a mixed phase consisting of Cs2O + Cs11O3, approximately 20-40 A thick.

  9. Use of cesium-137 methodology in the evaluation of superficial erosive processes

    Directory of Open Access Journals (Sweden)

    Avacir Casanova Andrello

    2003-06-01

    Full Text Available Superficial erosion is one of the main soil degradation agents and erosion rates estimations for different edaphicclimate conditions for the conventional models, as USLE and RUSLE, are expensive and time-consuming. The use of cesium-137 antrophogenic radionuclide is a new methodology that has been much studied and its application in the erosion soil evaluation has grown in countries as USA, UK, Australia and others. A brief narration of this methodology is being presented, as the development of the equations utilized for the erosion rates quantification through the cesium-137 measurements. Two watersheds studied in Brazil have shown that the cesium-137 methodology was practicable and coherent with the survey in field for applications in erosion studies.A erosão superficial é um dos principais agentes de degradação dos solos e estimativas das taxas de erosão para diferentes condições edafoclimáticas pelos modelos tradicionais como USLE, RUSLE, são onerosos e demorados. Uma metodologia que tem sido muito estudada e sua aplicação no estudo da erosão vem crescendo em países como EUA, Reino Unido, Austrália, e outros, é a do uso do radionuclídeo antropogênico césio-137. Um resumo da história desta metodologia é apresentado, assim como a evolução das equações utilizadas para quantificar as taxas de erosão através da medida do césio-137. Duas bacias estudadas no Brasil mostraram que a metodologia do césio-137 é viável e coerente com as observações em campo para aplicação no estudo da erosão.

  10. Al-free active region laser diodes at 894 nm for compact Cesium atomic clocks

    Science.gov (United States)

    Von Bandel, N.; Bébé Manga Lobé, J.; Garcia, M.; Larrue, A.; Robert, Y.; Vinet, E.; Lecomte, M.; Drisse, O.; Parillaud, O.; Krakowski, M.

    2015-03-01

    Time-frequency applications are in need of high accuracy and high stability clocks. Compact industrial Cesium atomic clocks optically pumped is a promising area that could satisfy these demands. However, the stability of these clocks relies, among others, on the performances of laser diodes that are used for atomic pumping. This issue has led the III-V Lab to commit to the European Euripides-LAMA project that aims to provide competitive compact optical Cesium clocks for earth applications. This work will provide key experience for further space technology qualification. We are in charge of the design, fabrication and reliability of Distributed-Feedback diodes (DFB) at 894nm (D1 line of Cesium) and 852nm (D2 line). The use of D1 line for pumping will provide simplified clock architecture compared to D2 line pumping thanks to simpler atomic transitions and larger spectral separation between lines in the 894nm case. Also, D1 line pumping overcomes the issue of unpumped "dark states" that occur with D2 line. The modules should provide narrow linewidth (<1MHz), very good reliability in time and, crucially, be insensitive to optical feedback. The development of the 894nm wavelength is grounded on our previous results for 852nm DFB. Thus, we show our first results from Al-free active region with InGaAsP quantum well broad-area lasers (100μm width, with lengths ranging from 2mm to 4mm), for further DFB operation at 894nm. We obtained low internal losses below 2cm-1, the external differential efficiency is 0.49W/A with uncoated facets and a low threshold current density of 190A/cm², for 2mm lasers at 20°C.

  11. Distribution of global fallouts cesium-137 in taiga and tundra catenae at the Ob River basin

    Science.gov (United States)

    Semenkov, I. N.; Usacheva, A. A.; Miroshnikov, A. Yu.

    2015-03-01

    The classification of soil catenae at the Ob River basin is developed and applied. This classification reflects the diverse geochemical conditions that led to the formation of certain soil bodies, their combinations and the migration fields of chemical elements. The soil and geochemical diversity of the Ob River basin catenae was analyzed. The vertical and lateral distribution of global fallouts cesium-137 was studied using the example of the four most common catenae types in Western Siberia tundra and taiga. In landscapes of dwarf birches and dark coniferous forests on gleysols, cryosols, podzols, and cryic-stagnosols, the highest 137Cs activity density and specific activity are characteristic of the upper soil layer of over 30% ash, while the moss-grass-shrub cover is characterized by low 137Cs activity density and specific activity. In landscapes of dwarf birches and pine woods on podzols, the maximum specific activity of cesium-137 is typical for moss-grass-shrub cover, while the maximum reserves are concentrated in the upper soil layer of over 30% ash. Bog landscapes and moss-grass-shrub cover are characterized by a minimum activity of 137Cs, and its reserves in soil generally decrease exponentially with depth. The cesium-137 penetration depth increases in oligotrophic histosols from northern to middle taiga landscapes from 10-15 to 40 cm. 137Cs is accumulated in oligotrophic histosols for increases in pH from 3.3 to 4.0 and in concretionary interlayers of pisoplinthic-cryic-histic-stagnosols. Cryogenic movement, on the one hand, leads to burying organic layers enriched in 137Cs and, on the other hand, to deducing specific activity when mixed with low-active material from lower soil layers.

  12. The chemical durability of glass and graphite-glass composite doped with cesium oxide

    Energy Technology Data Exchange (ETDEWEB)

    Hamodi, Nasir H., E-mail: nasirhamodi@yahoo.co.uk [School of Mechanical, Aerospace and Civil Engineering (MACE)/University of Manchester, Pariser Building, F-floor, Manchester M13 9PL (United Kingdom); Abram, Timothy J. [School of Mechanical, Aerospace and Civil Engineering (MACE)/University of Manchester, Pariser Building, F-floor, Manchester M13 9PL (United Kingdom); Lowe, Tristan; Cernik, Robert J. [Henry Mosley Imaging Facility, Material Science Centre, University of Manchester, Manchester M13 9PL (United Kingdom); Lopez-Honorato, Eddie [Centro de Investigacion y Estudios Avanzados del IPN (CINVESTAV), Unidad Saltillo. Carretera Saltillo-Monterrey km 13.5, 25900 Ramos Arizpe, Coahuila (Mexico)

    2013-01-15

    The role of temperature in determining the chemical stability of a waste form, as well as its leach rate, is very complex. This is because the dissolution kinetics is dependent both on temperature and possibility of different rate-controlling mechanisms that appear at different temperature regions. The chemical durability of Alumina-Borosilicate Glass (ABG) and Glass-Graphite Composite (GGC), bearing Tristructural Isotropic (TRISO) fuel particles impregnated with cesium oxide, were compared using a static leach test. The purpose of this study is to examine the chemical durability of glass-graphite composite to encapsulate coated fuel particles, and as a possible alternative for recycling of irradiated graphite. The test was based on the ASTM C1220-98 methodology, where the leaching condition was set at a temperature varying from 298 K to 363 K for 28 days. The release of cesium from ABG was in the permissible limit and followed the Arrhenius's law of a surface controlled reaction; its activation energy (E{sub a}) was 65.6 {+-} 0.5 kJ/mol. Similar values of Ea were obtained for Boron (64.3 {+-} 0.5) and Silicon (69.6 {+-} 0.5 kJ/mol) as the main glass network formers. In contrast, the dissolution mechanism of cesium from GGC was a rapid release, with increasing temperature, and the activation energy of Cs (91.0 {+-} 5 kJ/mol) did not follow any model related to carbon kinetic dissolution in water. Microstructure analysis confirmed the formation of Crystobalite SiO{sub 2} as a gel layer and Cs{sup +1} valence state on the ABG surface.

  13. Estimation of retention factor of cesium in sodium pool under fuel pin failure scenario in SFR

    Energy Technology Data Exchange (ETDEWEB)

    Pradeep, Arjun [Computational Simulation Section, Safety Engineering Division, Nuclear and Safety Engineering Group, Indira Gandhi Centre for Atomic Research, Kalpakkam 603 102 (India); Rao, P. Mangarjuna, E-mail: pmr@igcar.gov.in [Computational Simulation Section, Safety Engineering Division, Nuclear and Safety Engineering Group, Indira Gandhi Centre for Atomic Research, Kalpakkam 603 102 (India); Nashine, B.K.; Chellapandi, P. [Computational Simulation Section, Safety Engineering Division, Nuclear and Safety Engineering Group, Indira Gandhi Centre for Atomic Research, Kalpakkam 603 102 (India)

    2012-02-15

    Highlights: Black-Right-Pointing-Pointer We model retention factor of cesium in infinite dilute solution of sodium pool. Black-Right-Pointing-Pointer We study variation in retention factor with cover gas temperature gradient. Black-Right-Pointing-Pointer Increasing height and temperature difference decreases the retention factor. Black-Right-Pointing-Pointer In infinite dilution regime retention factor is independent of cesium inventory. Black-Right-Pointing-Pointer The retention factor is useful in estimating source term in cover gas region. - Abstract: Radioactive source term in argon (Ar) cover gas region of the primary vessel due to cesium (Cs) leaked from the failed fuel pins into the primary coolant of Sodium cooled Fast Reactor (SFR) depends on its thermodynamic and kinetic behavior with the coolant sodium. Evaluation of this source term requires detailed knowledge on the distribution of Cs between large volume of the liquid sodium, and the inert Ar cover gas. Solute-solvent combination like liquid Cs and sodium, with relative volatility greater than unity, is an important system to be analyzed in the context of SFR safety. Distribution of Cs between Ar cover gas and liquid sodium pool is complicated by the imposition of temperature difference across the cover gas region and its resultant enrichment of the more volatile solute. An analytical model has been developed to obtain the geometry dependent Retention Factor (RF) of Cs in the sodium pool as a function of the height of cover gas, initial mass inventory of Cs, the temperature difference across the cover gas region (between the sodium pool surface and top roof bottom plate) for an infinite dilute solution of Cs in the sodium pool. The model predicted results are validated with available experimental results in the literature and found that they are fairly in good agreement. In the infinite dilute solution (IDS) regime sodium pool is having the retention capacity to keep the Cs from being released into

  14. Research on the treatment of liquid waste containing cesium by an adsorption-microfiltration process with potassium zinc hexacyanoferrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Changping, E-mail: melindazhang@yahoo.com.cn [School of Environmental Science and Engineering, Tianjin University, Tianjin, 300072 (China); Gu Ping, E-mail: guping@tju.edu.cn [School of Environmental Science and Engineering, Tianjin University, Tianjin, 300072 (China); Zhao Jun; Zhang Dong; Deng Yue [Institute of Nuclear Physics and Chemistry, Chinese Academy of Engineering Physics, Mianyang 621900 (China)

    2009-08-15

    The removal of cesium from an aqueous solution by an adsorption-microfiltration (AMF) process was investigated in jar tests and lab-scale tests. The adsorbent was K{sub 2}Zn{sub 3}[Fe(CN){sub 6}]{sub 2}. The obtained cesium data in the jar test fit a Freundlich-type isotherm well. In the lab-scale test, the mean cesium concentration of the raw water and the effluent were 106.87 {mu}g/L and 0.59 {mu}g/L, respectively, the mean removal of cesium was 99.44%, and the mean decontamination factors (DF) and concentration factors (CF) were 208 and 539, respectively. The removal of cesium in the lab-scale test was better than that in the jar test because the old adsorbents remaining in the reactor still had adsorption capacity with the premise of no significant desorption being observed, and the continuous renewal of the adsorbent surface improved the adsorption capacity of the adsorbent. Some of the suspended solids were deposited on the bottom of the reactor, which would affect the mixing of adsorbents with the raw water and the renewing of the adsorbent surface. Membrane fouling was the main physical fouling mechanism, and the cake layer was the main filtration resistance. Specific flux (SF) decreased step by step during the whole period of operation due to membrane fouling and concentration polarization. The quality of the effluent was good and the turbidity remained lower than 0.1 NTU, and the toxic anion, CN{sup -}, could not be detected because of its low concentration, this indicated that the effluent was safe. The AMF process was feasible for practical application in the treatment of liquid waste containing cesium.

  15. Design of a Carousel Process for Removing Cesium from SRS Waste Using Crystalline Silicotitanate Ion Exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Walker, D.D.

    1999-01-15

    Designs of a three-column carousel process based on crystalline silicotitanate (CST) ion exchanger have been developed for removing radioactive 137Cs+ from Savannah River Site's (SRS) nuclear wastes. A multicomponent ion exchange equilibrium model (Zheng et al., 1997) from Texas A&M University, which is based on batch data obtained from CST powder, is used to generate cesium loading data at different cesium concentrations for various types of SRS wastes. These loading data are fit to the Langmuir equation to obtain effective single-component cesium isotherm parameters. The predictions are in reasonable agreement with batch test data obtained from CST powder, an early CST pellet batch (38B), and a later batch (IE911) using two SRS waste simulants. The ratios between experimental cesium distribution coefficients and predicted values are between 0.56 and 1.0. The variation appears to be due to inadequate equilibration time in some of the batches. Mass transfer parameters are estimated by analyzing column data of a simulated SRS waste and Melton Valley Storage Tank W29 (MVST-W29) waste. The intraparticle diffusivity estimated for the two wastes can be well correlated by means of the Stokes-Einstein equation.Simulations are performed to determine the length of the mass transfer zone for given feed compositions, Cs+ concentrations, and linear velocities. In order to ensure high column utilization during both the transient and cyclic steady state periods, the length of a single segment in the carousel process is chosen to be the mass transfer zone length after the concentration wave achieves a constant pattern. Analysis of the dimensionless groups in the differential mass balance equations reveals that the normalized mass transfer zone length is linearly proportional to the particle Peclet number. The proportionality constant is a function of the waste composition and the Cs+ concentration in the waste. The higher the effective Cs+ capacity and the higher the Cs

  16. Optical and evaporative cooling of cesium atoms in the gravito-optical surface trap

    CERN Document Server

    Hammes, M; Druzhinina, V; Moslener, U; Manek-Hönninger, I; Grimm, R

    2000-01-01

    We report on cooling of an atomic cesium gas closely above an evanescent-wave atom mirror. At high densitities, optical cooling based on inelastic reflections is found to be limited by a density-dependent excess temperature and trap loss due to ultracold collisions involving repulsive molecular states. Nevertheless, very good starting conditions for subsequent evaporative cooling are obtained. Our first evaporation experiments show a temperature reduction from 10muK down to 300nK along with a gain in phase-space density of almost two orders of magnitude.

  17. Enhanced four-wave mixing via crossover resonance in cesium vapor

    CERN Document Server

    de Silans, T Passerat; Felinto, D; Tabosa, J W R

    2011-01-01

    We report on the observation of enhanced four-wave mixing via crossover resonance in a Doppler broadened cesium vapor. Using a single laser frequency, a resonant parametric process in a double-$\\Lambda$ level configuration is directly excited for a specific velocity class. We investigate this process in different saturation regimes and demonstrate the possibility of generating intensity correlation and anti-correlation between the probe and conjugate beams. A simple theoretical model is developed that accounts qualitatively well to the observed results.

  18. Theoretical analysis of parity violation induced by neutral currents in atomic cesium

    Energy Technology Data Exchange (ETDEWEB)

    Bouchiat, C.; Piketty, C.A.; Pignon, D. (Ecole Normale Superieure, 75 - Paris (France). Lab. de Physique Theorique)

    1983-07-04

    In this paper we give a theoretical analysis of the parity violation phenomena in nS-n'S transitions in atomic cesium induced by the electron-nucleus neutral-current interaction. The actual observation of parity violation consists in the measurement of an interference between the p.v. electric dipole amplitude E/sub 1/sup(pv) with the electric amplitude induced by a static electric field. Our theoretical work must then include a calculation of the diagonal and non-diagonal polarizabilities of the states of atomic cesium. We have used a one-electron model proposed by Norcross which incorporates some many-body effects like the electric screening induced by the core polarization in a semi-empirical way. Our calculated values of the diagonal and non-diagonal polarizabilities of the nS states are in good agreement with the existing measurements; this confirms the already well-established success of the model in predicting the radiative transitions in cesium. We present theoretical arguments supported by detailed numerical computations showing that the one-particle matrix element of the parity-violating electron-nucleus interaction and the parity-violating electric dipole amplitude E/sub 1/sup(pv) itself weakly depend on the shape of the one-electron potential provided the binding energies of the valence states are reproduced accurately. Furthermore it turns out that because of a compensation mechanism, the parity-violating transition is induced by the radiation field outside the ion core region where the screening can be described simply in terms of the measurable cesium ion polarizability. Our results are then used to extract, from the Ecole Normale Superieure experiment, a value of the weak charge Qsub(w)= -57.1+-9.4 (r.m.s. statistical deviation) +-4.7 (systematic uncertainty). This number is to be compared with the prediction of the Weinberg-Salam model with electro-weak radiative corrections: Qsub(w)=-68.6+-3.0.

  19. Parity violation in atomic cesium and alternatives to the standard model of electroweak interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bouchiat, C.; Piketty, C.A. (Ecole Normale Superieure, 75 - Paris (France). Lab. de Physique Theorique)

    1983-08-18

    We study the implications of the recent observation of a parity violation in atomic cesium. After a discussion of the uncertainties associated with the atomic physics calculations we derive conservative bounds for the weak charge Qsub(W). These bounds are used to put constraints on alternatives to the standard electroweak model, involving an 'extra U(1)' gauge group. We analyze the possibility that the extra gauge boson might be very light and give, as a by-product, the typical range of momentum transfer explored in atomic parity violation experiments.

  20. A theoretical analysis of parity violation induced by neutral currents in atomic cesium

    Science.gov (United States)

    Bouchiat, C.; Piketty, C. A.; Pignon, D.

    1983-07-01

    In this paper we give a theoretical analysis of the parity violation phenomena in nS - n'S transitions in atomic cesium induced by the electron-nucleus neutral-current interaction. The actual observation of parity violation consists in the measurement of an interference between the p.v. electric dipole amplitude Elpv with the electric amplitude induced by a static electric field. Our theoretical work must then include a calculation of the diagonal and non-diagonal polarizabilities of the states of atomic cesium. We have used a one-electron model proposed by Norcross which incorporates some many-body effects like the electric screening induced by the core polarization in a semi-empirical way. Our calculated values of the diagonal and non-diagonal polarizabilities of the nS states are in good agreement with the existing measurements; this confirms the already well-established success of the model in predicting the radiative transitions in cesium. We present theoretical arguments supported by detailed numerical computations showing that the one-particle matrix element of the parity-violating electron-nucleus interaction and the parity-violating electric dipole amplitude Elpv itself weakly depend on the shape of the one-electron potential provided the binding energies of the valence states are reproduced accurately. Furthermore it turns out that because of a compensation mechanism, the parity-violating transition is induced by the radiation field outside the ion core region where the screening can be described simply in terms of the measurable cesium ion polarizability. Our results are then used to extract, from the Ecole Normale Supérieure experiment, a value of the weak charge Qw = -57.1 ± 9.4 (r.m.s. statistical deviation) ± 4.7 (systematic uncertainty). This number is to be compared with the prediction of the Weinberg-Salam model with electro-weak radiative corrections: Qw = -68.6 ± 3.0. A general discussion of the uncertainties of the atomic physics

  1. Universality of the three-body parameter for Efimov states in ultracold cesium.

    Science.gov (United States)

    Berninger, M; Zenesini, A; Huang, B; Harm, W; Nägerl, H-C; Ferlaino, F; Grimm, R; Julienne, P S; Hutson, J M

    2011-09-16

    We report on the observation of triatomic Efimov resonances in an ultracold gas of cesium atoms. Exploiting the wide tunability of interactions resulting from three broad Feshbach resonances in the same spin channel, we measure magnetic-field dependent three-body recombination loss. The positions of the loss resonances yield corresponding values for the three-body parameter, which in universal few-body physics is required to describe three-body phenomena and, in particular, to fix the spectrum of Efimov states. Our observations show a robust universal behavior with a three-body parameter that stays essentially constant.

  2. Digital Square-Wave Frequency Modulated Microwave Sources for a Miniature Optically Pumped Cesium Beam Clock

    Institute of Scientific and Technical Information of China (English)

    CHEN Jingbiao; ZHU Chengjin; LIU Ge; WANG Fengzhi; WANG Yiqiu; YANG Donghai

    2001-01-01

    Three different digital frequencymodulated microwave sources have been designed andapplied to our miniature optically pumped cesiumbeam clock.The main features and their influenceon clock accuracy have been experimentally tested.Itis proved that a digital square-wave frequency modu-lated microwave source using a microprocessor con-trolled direct-digital frequency synthesizer (DDFS)for our miniature optically pumped cesium beamclock works well,the frequency short term stability2 × 10 11/x r and the long term stability 3.5 x 10-13 forone day sample time have been obtained.

  3. Microcrystalline hexagonal tungsten bronze. 1. Basis of ion exchange selectivity for cesium and strontium.

    Science.gov (United States)

    Griffith, Christopher S; Luca, Vittorio; Hanna, John V; Pike, Kevin J; Smith, Mark E; Thorogood, Gordon S

    2009-07-06

    The structural basis of selectivity for cesium and strontium of microcrystalline hexagonal tungsten bronze (HTB) phase Na(x)WO(3+x/2).zH(2)O has been studied using X-ray and neutron diffraction techniques, 1D and 2D (23)Na magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy, and radiochemical ion exchange investigations. For the HTB system, this study has shown that scattering techniques alone provide an incomplete description of the disorder and rapid exchange of water (with tunnel cations) occurring in this system. However, 1D and 2D (23)Na MAS NMR has identified three sodium species within the HTB tunnels-species A, which is located at the center of the hexagonal window and is devoid of coordinated water, and species B and C, which are the di- and monohydrated variants, respectively, of species A. Although species B accords with the traditional crystallographic model of the HTB phase, this work is the first to propose and identify the anhydrous species A and monohydrate species C. The population (total) of species B and C decreases in comparison to that of species A with increasing exchange of either cesium or strontium; that is, species B and C appear more exchangeable than species A. Moreover, a significant proportion of tunnel water is redistributed by these cations. Multiple ion exchange investigations with radiotracers (137)Cs and (85)Sr have shown that for strontium there is a definite advantage in ensuring that any easily exchanged sodium is removed from the HTB tunnels prior to exchange. The decrease in selectivity (wrt cesium) is most probably due to the slightly smaller effective size of Sr(2+); namely, it is less of a good fit for the hexagonal window, ion exchange site. The selectivity of the HTB framework for cesium has been shown unequivocally to be defined by the structure of the hexagonal window, ion exchange site. Compromising the geometry of this window even in the slightest way by either (1) varying the cell volume through

  4. TMI-2 core debris-cesium release/settling test. Volume 3

    Energy Technology Data Exchange (ETDEWEB)

    Akers, D W; Johnson, D A

    1984-12-01

    Cesium release, turbidity and airborne potential tests were conducted on 50 grams of TMI-2 core debris materials. The tests were performed on the debris in two conditions: on the as-received core debris specimen, and after crushing the debris to alter the particle size distribution. The crushing was intended to simulate the breakup of TMI-2 core material that may occur during reactor defueling. These tests are intended to assist GPU Nuclear in predicting the effect of defueling on the reactor environment.

  5. Accumulation of uranium, cesium, and radium by microbial cells: bench-scale studies

    Energy Technology Data Exchange (ETDEWEB)

    Strandberg, G.W.; Shumate, S.E. II

    1982-07-01

    This report describes bench-scale studies on the utilization of microbial cells for the concentration and removal of uranium, radium, and cesium from nuclear processing waste streams. Included are studies aimed at elucidating the basic mechanism of uranium uptake, process development efforts for the use of a combined denitrification-uranium removal process to treat a specific nuclear processing waste stream, and a preliminary investigation of the applicability of microorganisms for the removal of /sup 137/Cs and /sup 226/Ra from existing waste solutions.

  6. CD133+细胞的干性鉴定及131I-CD133抗体对其体内外抑制作用%Identification of the stem property of CD133+ liver cancer cells and inhibition effect of 131I-labeled anti-CD133 mAb on them in vitro and vivo

    Institute of Scientific and Technical Information of China (English)

    段丽群; 侯妍利; 陈兴月; 唐敏; 康强强; 舒锦; 李少林

    2014-01-01

    目的:研究CD133+细胞的干性鉴定和131I-CD133抗体在体内外对人肝癌CD133+-HepG2干细胞的抑制作用.方法:氯胺T法制备并鉴定131I-CD133抗体;免疫磁珠(magnetic-activated cell sorting,MACS)分选CD133+-HepG2细胞;流式细胞仪(flow cytometry,FCM)检测分选前后CD133表达率;体外克隆形成实验、成球实验和体内成瘤实验验证其干细胞特性;将分选出的CD133+细胞分组为CD133抗体、131I、131I-CD133抗体和131I+CD133抗体4个组,MTT法检测不同处理后不同组中CD133+细胞生长抑制率;成功构建人肝癌CD133+-HepG2移植瘤模型;随机分4组,1次/2 d给予尾静脉用药,共14次.4周后,处死小鼠,比较肿瘤的体积、质量、计算抑瘤率;HE染色观察肿瘤组织病理学改变.结果:131I-CD133抗体标记率为89.34%,放化纯度为98.21%.流式显示分选前后CD133表达率分别为(1.78±0.54)%和(98.46±0.97)%.成球实验、克隆形成实验和裸鼠成瘤实验显现CD133+细胞相对于CD133-细胞更具有干细胞特性.131I-CD133抗体治疗组体外对细胞抑制率及体内抑瘤率明显高于其余各实验组,差异具有统计学意义(P<0.05).结论:131I-CD133抗体在体内外均能有效抑制人肝癌CD 133+-HepG2细胞的生长.

  7. IL-6 promotes growth and epithelial-mesenchymal transition of CD133+ cells of non-small cell lung cancer.

    Science.gov (United States)

    Lee, Soo Ok; Yang, Xiaodong; Duan, Shanzhou; Tsai, Ying; Strojny, Laura R; Keng, Peter; Chen, Yuhchyau

    2016-02-09

    We examined IL-6 effects on growth, epithelial-mesenchymal transition (EMT) process, and metastatic ability of CD133+ and CD133- cell subpopulations isolated from three non-small cell lung cancer (NSCLC) cell lines: A549, H157, and H1299. We developed IL-6 knocked-down and scramble (sc) control cells of A549 and H157 cell lines by lentiviral infection system, isolated CD133+ and CD133- sub-populations, and investigated the IL-6 role in self-renewal/growth of these cells. IL-6 showed either an inhibitory or lack of effect in modulating growth of CD133- cells depending on intracellular IL-6 levels, but there was higher self-renewal ability of IL-6 expressing CD133+ cells than IL-6 knocked down cells, confirming the promoter role of IL-6 in CD133+ cells growth. We then examined tumor growth of xenografts developed from CD133+ cells of A549IL-6si vs. A549sc cell lines. Consistently, there was retarded growth of tumors developed from A549IL-6si, CD133+ cells compared to tumors originating from A549sc, CD133+ cells. The effect of IL-6 in promoting CD133+ self-renewal was due to hedgehog (Hhg) and Erk signaling pathway activation and higher Bcl-2/Bcl-xL expression. We also investigated whether IL-6 regulates the EMT process of CD133- and CD133+ cells differently. Expression of the EMT/metastasis-associated molecules in IL-6 expressing cells was higher than in IL-6 knocked down cells. Together, we demonstrated dual roles of IL-6 in regulating growth of CD133- and CD133+ subpopulations of lung cancer cells and significant regulation of IL-6 on EMT/metastasis increase in CD133+ cells, not in CD133- cells.

  8. The Effect of Carbonate, Oxalate and Peroxide on the Cesium Loading of Ionsiv IE-910 and IE-911

    Energy Technology Data Exchange (ETDEWEB)

    Fondeur, F.F.

    2000-12-19

    The Savannah River Site (SRS) continues to examine three processes for the removal of radiocesium from high-level waste. One option involves the use of crystalline silicotitanate (CST) as a non-elutable ion exchange medium. The process uses CST in its engineered form - IONSIV IE-911 made by UOP, LLC. - in a column to contact the liquid waste. Cesium exchanges with sodium ions residing inside the CST particles. The design disposes of the cesium-loaded CST by vitrification within the Defense Waste Processing Facility.

  9. 喉癌Hep-2细胞CD44+CD133+生物学特性研究%Research on the biological characteristics of CD44+CD133+of human laryngeal carcinoma Hep-2 cells

    Institute of Scientific and Technical Information of China (English)

    孔令帅; 温树信; 高伟; 王珏; 付荣; 杨丽娟; 李飞; 杨雨燕

    2016-01-01

    Objective To isolate, culture and identify laryngeal cancer stem cells from laryngeal carcinoma Hep-2 cell line and observe its biological characteristics in vitro. Methods Isolated, cultured and indentified human laryngeal carcinoma Hep-2 cells by MACS to obtain CD44+CD133+,CD44+CD133-,CD44-CD133+,CD44-CD133-four subsets of stem cells and plot-ted, the growth curves of four kinds of cells. The positive rate was detected by flow cytometry. The transwell chamber invasion assay, cell adhesion experiment and cloneformation assay were performed to evaluate the invasive capability, adhesion ability and the cloneforming ability respectively. The drug resistance was detected by CCK8 method. Results The biological charac-teristics of the five kinds of cells in Hep-2, CD44+CD133+, CD44+CD133-, CD44-CD133+and CD44-CD133-were analyzed. The ability of proliferation, invasion, adhesion, clone formation and drug resistance of CD44+CD133+cell subsets were higher than those of other four. CD44+CD133+>CD44-CD133+>Hep2>CD44+CD133->CD44-CD133-. Conclusion MACS is an effective method for sorting CD44+CD133+ cells. CD44+CD133+ cell subsets have obvious characteristics of cancer stem cells , and may make some new exploration for the high expression markers of laryngeal cancer cells.%目的:分选培养和鉴定人喉癌Hep-2细胞珠,并研究其体外生物学特性。方法通过磁珠细胞分选(mag-netic bead cell sorting,MACS)方法,分选培养和鉴定CD44+CD133+喉癌干细胞,应用免疫磁珠分选技术分选CD44+CD133+、CD44+CD133-、CD44-CD133+、CD44-CD133-4种亚群,对4种细胞绘制生长曲线,应用流式细胞仪检测其阳性率,应用侵袭实验、黏附实验和克隆形成实验评价其侵袭能力、黏附能力和克隆形成能力,用CCK8法检测其耐药性。结果对Hep-2、CD44+CD133+亚群、CD44+CD133-亚群、CD44-CD133+亚群、CD44-CD133-亚群5种细胞进行生物学特性研究,CD44+CD133+细胞亚群的增殖、侵

  10. DNA variation in myoMIRs of the 1, 133, and 208 families in hypertrophic cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Ana I. Corao

    2011-08-01

    Full Text Available MicroRNAs (miRNAs are small RNAs that bind to mRNAs and regulate gene expression. MyoMirs are miRNAs implicated in cardiogenesis. Some MyoMirs have been found deregulated in hearts from patients with left ventricular hypertrophy (LVH. DNA variants at these miRNAs could contribute to the risk of developing hypertrophic cardiomyopathy (HCM. To test this hypothesis we used single strand conformation analysis and direct sequencing to search for DNA variants in the mir-208a, miR-208b, miR-133a-1, miR-133a-2, miR-133b, miR-1-1, and miR-1-2 genes in patients with HCM (n=245, LVH secondary to hypertension (n=120, and healthy controls (n=250. We found several nucleotide variants. Genotyping of patients and healthy controls showed significantly associations between a 133a-1 polymorphism and HCM and a 133b polymorphism and hypertensive- LVH. We concluded that rare variants in these mature miRNAs would be rarely found among HCM patients, but miR-133a-1 and 133b polymorphisms could contribute to the risk of developing cardiac hypertrophy.

  11. The CD133+ cell as advanced medicinal product for myocardial and limb ischemia.

    Science.gov (United States)

    Bongiovanni, Dario; Bassetti, Beatrice; Gambini, Elisa; Gaipa, Giuseppe; Frati, Giacomo; Achilli, Felice; Scacciatella, Paolo; Carbucicchio, Corrado; Pompilio, Giulio

    2014-10-15

    Ischemic diseases are the major cause of death and morbidity in Western countries. In the last decade, cell therapy has been suggested to be a promising treatment both in acute/chronic myocardial and peripheral ischemia. Different cell lineages have been tested, including endothelial progenitor cells. A subpopulation of bone marrow-derived immature ECPs, expressing the highly conserved stem cell glycoprotein antigen prominin-1 or CD133 marker, was shown to possess pro-angiogenic and antiapoptotic effects on ischemic tissues. The mechanisms implicated in CD133+ cells ability to contribute to neovascularization processes have been attributed to their ability to directly differentiate into newly forming vessels and to indirectly activate pro-angiogenic signaling by paracrine mechanisms. A large body of in vivo experimental evidences has demonstrated the potential of CD133+ cells to reverse ischemia. Moreover, several clinical trials have reported promising beneficial effects after infusion of autologous CD133+ into ischemic heart and limbs exploiting various delivery strategies. These trials have contributed to characterize the CD133+ manufacturing process as an advanced cell product (AMP). The aim of this review is to summarize available experimental and clinical data on CD133+ cells in the context of myocardial and peripheral ischemia, and to focus on the development of the CD133+ cell as an anti-ischemic AMP.

  12. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    Directory of Open Access Journals (Sweden)

    Nikola Arsic

    2015-04-01

    Full Text Available Cancer stem cells (CSC are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform.

  13. An alternatively spliced variant of CXCR3 mediates the metastasis of CD133+ liver cancer cells induced by CXCL9

    Science.gov (United States)

    Ding, Qiang; Xia, Yujia; Ding, Shuping; Lu, Panpan; Sun, Liang; Liu, Mei

    2016-01-01

    Metastasis of liver cancer is closely linked to tumor microenvironment, in which chemokines and their receptors act in an important role. The CXCR3, the receptor of chemokine CXCL9, belongs to a superfamily of rhodopsin-like seven transmembrane GPCRs and CXCR subfamily. In HCC tissues, CXCR3 was frequently upregulated and correlated with tumor size, tumor differentiation, portal invasion and metastasis. In the study, CXCR3-A isoform that was bound by CXCL9 was found to cause significant change of ERK1/2 phosphorylation level in the MAPK signaling pathway, consequently upregulating the MMP2 and MMP9 expression and promoting invasion and metastasis of CD133+ liver cancer cells. Also, CXCR3-A suppressed the adhesion ability of CD133+ liver cancer cells that stimulated by CXCL9 for 24h. These findings suggest that CXCR3 and its ligand CXCL9 could promote the metastasis of liver cancer cells and might be a potential target for the intervention of liver cancer metastasis. PMID:26883105

  14. Universal gates based on targeted phase shifts in a 3D neutral atom array

    Science.gov (United States)

    Kumar, Aishwarya; Wang, Yang; Wu, Tsung-Yao; Weiss, David

    2016-05-01

    We demonstrate a new approach to making targeted single qubit gates using Cesium atoms in a 5x5x5 3D neutral atom array. It combines targeted AC Zeeman phase shifts with global microwave pulses to produce arbitrary single qubit gates. Non-targeted atoms are left virtually untouched by the gates. We have addressed 48 sites, targeted individually, in a 40% full array. We have also performed Randomized Benchmarking to characterize the fidelity and crosstalk errors of this gate. These gates are highly insensitive to addressing beam imperfections and can be applied to other systems and geometries. Supported by NSF.

  15. The Brain Microenvironment Preferentially Enhances the Radioresistance of CD133+ Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Muhammad Jamal

    2012-02-01

    Full Text Available Brain tumor xenografts initiated from glioblastoma (GBM CD133+ tumor stem-like cells (TSCs are composed of TSC and non-TSC subpopulations, simulating the phenotypic heterogeneity of GBMs in situ. Given that the discrepancies between the radiosensitivity of GBM cells in vitro and the treatment response of patients suggest a role for the microenvironment in GBM radioresistance, we compared the response of TSCs and non-TSCs irradiated under in vitro and orthotopic conditions. As a measure of radioresponse determined at the individual cell level, γH2AX and 53BP1 foci were quantified in CD133+ cells and their differentiated (CD133- progeny. Under in vitro conditions, no difference was detected between CD133+ and CD133- cells in foci induction or dispersal after irradiation. However, irradiation of orthotopic xenografts initiated from TSCs resulted in the induction of fewer γH2AX and 53BP1 foci in CD133+ cells compared to their CD133- counterparts within the same tumor. Xenograft irradiation resulted in a tumor growth delay of approximately 7 days with a corresponding increase in the percentage of CD133+ cells at 7 days after radiation, which persisted to the onset of neurologic symptoms. These results suggest that, although the radioresponse of TSCs and non-TSCs does not differ under in vitro growth conditions, CD133+ cells are relatively radioresistant under intracerebral growth conditions. Whereas these findings are consistent with the suspected role for TSCs as a determinant of GBM radioresistance, these data also illustrate the dependence of the cellular radioresistance on the brain microenvironment.

  16. Dual-species Bose-Einstein condensate of Rb87 and Cs133

    Science.gov (United States)

    McCarron, D. J.; Cho, H. W.; Jenkin, D. L.; Köppinger, M. P.; Cornish, S. L.

    2011-07-01

    We report the formation of a dual-species Bose-Einstein condensate of Rb87 and Cs133 in the same trapping potential. Our method exploits the efficient sympathetic cooling of Cs133 via elastic collisions with Rb87, initially in a magnetic quadrupole trap and subsequently in a levitated optical trap. The two condensates each contain up to 2×104 atoms and exhibit a striking phase separation, revealing the mixture to be immiscible due to strong repulsive interspecies interactions. Sacrificing all the Rb87 during the cooling, we create single-species Cs133 condensates of up to 6×104 atoms.

  17. Metrological activity determination of {sup 133}Ba by sum-peak absolute method

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.L. da; Delgado, J.U.; Poledna, R.; Santos, A.; Veras, E.V. de; Rangel, J.; Trindade, O.L. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Almeida, M.C.M. de, E-mail: marcandida@yahoo.com.br, E-mail: candida@cnen.gov.br [Comissao Nacional de Energia Nuclear (CNEN), Rio de Janeiro, RJ (Brazil)

    2015-07-01

    The National Laboratory for Metrology of Ionizing Radiation provides gamma sources of radionuclide and standardized in activity with reduced uncertainties. Relative methods require standards to determine the sample activity while the absolute methods, as sum-peak, not. The activity is obtained directly with good accuracy and low uncertainties. {sup 133}Ba is used in research laboratories and on calibration of detectors for analysis in different work areas. Classical absolute methods do not calibrate {sup 133}Ba due to its complex decay scheme. The sum-peak method using gamma spectrometry with germanium detector standardizes {sup 133}Ba samples. Uncertainties lower than 1% to activity results were obtained.

  18. Metrological activity determination of 133Ba by sum-peak absolute method

    Science.gov (United States)

    da Silva, R. L.; de Almeida, M. C. M.; Delgado, J. U.; Poledna, R.; Santos, A.; de Veras, E. V.; Rangel, J.; Trindade, O. L.

    2016-07-01

    The National Laboratory for Metrology of Ionizing Radiation provides gamma sources of radionuclide and standardized in activity with reduced uncertainties. Relative methods require standards to determine the sample activity while the absolute methods, as sum-peak, not. The activity is obtained directly with good accuracy and low uncertainties. 133Ba is used in research laboratories and on calibration of detectors for analysis in different work areas. Classical absolute methods don't calibrate 133Ba due to its complex decay scheme. The sum-peak method using gamma spectrometry with germanium detector standardizes 133Ba samples. Uncertainties lower than 1% to activity results were obtained.

  19. Promoter hypermethylation and loss of CD133 gene expression in colorectal cancers

    Institute of Scientific and Technical Information of China (English)

    You-Kyung; Jeon; Sung-Hee; Kim; Seung-Ho; Choi; Kyung-Hee; Kim; Byong-Chul; Yoo; Ja-Lok; Ku; Jae-Gahb; Park

    2010-01-01

    AIM: To understand CD133 promoter hypermethyl-ation and expression in 32 colorectal cancer cell lines. METHODS: Nucleic acid was isolated from 32 colorectal cancer cell lines and CD133 expression levels were measured by reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR. Promoter methylation status of the CD133 gene was analyzed with a methylation-specific PCR after sodium-bisulfi te modification and by clonal sequencing analysis. The correlation between expression and promoter methy...

  20. Nanophotonic hybridization of narrow atomic cesium resonances and photonic stop gaps of opaline nanostructures

    CERN Document Server

    Harding, Philip J; Mosk, Allard P; Vos, Willem L

    2014-01-01

    We study a hybrid system consisting of a narrowband atomic optical resonance and the long-range periodic order of an opaline photonic nanostructure. To this end, we have infiltrated atomic cesium vapor in a thin silica opal photonic crystal. With increasing temperature, the frequencies of the opal's reflectivity peaks shift down by >20% due to chemical reduction of the silica. Simultaneously, the photonic bands and gaps shift relative to the fixed near-infrared cesium D1 transitions. As a result the narrow atomic resonances with high finesse (f/df=8E5) dramatically change shape from a usual dispersive shape at the blue edge of a stop gap, to an inverted dispersion lineshape at the red edge of a stop gap. The lineshape, amplitude, and off-resonance reflectivity are well modeled with a transfer-matrix model that includes the dispersion and absorption of Cs hyperfine transitions and the chemically-reduced opal. An ensemble of atoms in a photonic crystal is an intriguing hybrid system that features narrow defect-...

  1. Research on ultracold cesium molecule long-range states by high-resolution photoassociative spectroscopy

    Institute of Scientific and Technical Information of China (English)

    WANG LiRong; MA Jie; JI WeiBang; WANG GuiPing; XIAO LianTuan; JIA SuoTang

    2008-01-01

    In this paper, an ultra-high resolution photoassociation spectroscopy study on photoassociation of cesium atoms is reported. The cold cesium gas in the mag-neto-optical trap is illuminated by a photoassociation laser with red-tuning as large as 40 cm-1 below the 6S1/2 + 6P3/2 dissociation limit, and the photoassoclation to the excited state ultracold molecule is detected. High signal-to-noise ratio is obtained by using the lock-in detection of the fluorescence from the modulated cold Cs at-oms. The O-g, and O+u, long-range states which correspond to 6S1/2 + 6P3/2 diSsocia-tion limit are present in the photoassociation spectrum. The effective coefficients of leading long-range interactions and the corresponding vibrational quantum num-ber are obtained using LeRoy-Bernstein Law. It is found that photoassociation process creates rotating molecules and the high J value is a hint that higher partial waves participate in the PA process in the presence of trapping laser.

  2. Functionalized magnetic nanoparticles for the decontamination of water polluted with cesium

    Directory of Open Access Journals (Sweden)

    Ahmed S. Helal

    2016-05-01

    Full Text Available Magnetic nanoparticles are attracting considerable interest because of their potential applications in practically all fields of science and technology, including the removal of heavy metals from contaminated waters. It is, therefore, of great importance to adapt the surfaces of these nanoparticles according to the application. In this work advanced nanoparticles (NPs with well-tailored surface functionalities were synthesized using the polyol method. The efficiency of a chelating agent, succinyl-β-cyclodextrin (SBCD, was first investigated spectrophotometrically and by Isothermal Titration Calorimetry (ITC. SBCD was then grafted onto nanoparticles previously functionalized with 3-aminopropyl triethoxsilane (NP-APTES. The resulting NP-SBCD system was then incubated with a solution of cesium. After magnetic separation, the solid residue was removed from the supernatant and characterized by X-Ray Photoelectron spectrometry (XPS, X-Ray Fluorescence spectrometry (XRF and Superconducting QUantum Interference Device (SQUID magnetometry. These characterizations show the presence of cesium in the solid residue, which indicates Cs uptake by the NP-SBCD system. This nanohybrid system constitutes a promising model for heavy metal decontamination.

  3. Cesium removal from nuclear waste using a magnetical CuHCNPAN nano composite

    Science.gov (United States)

    Mobtaker, Hossein Ghasemi; Yousefi, Taher; Pakzad, Seyed Mohammadreza

    2016-12-01

    A nano-composite of copper hexacyanoferrate@polyacrylonitrile@magnetite (CuHCNPAN) was synthesized through chemical co-precipitation. The product were characterized using FT IR, XRD, SEM and TG techniques. The results of FTIR, XRD confirmed the composite formation. The SEM images showed that the particles are 20-60 nm in diameter. The composite showed high mechanical, chemical and thermal stability. The nano composite was used for removal of cesium ions from waste solutions. Effect of various parameters such as contact time, initial concentration, pH, competition ions and temperature were studied. After the metal ion adsorption process the magnetic separation of adsorbent from absorbents was carried out through external magnetic field. Maximum sorption capacity was about 260 mg/g. The kinetic studies showed that the equilibrium was achieved at 5 h and the experimental data fitted by the second order model. The adsorption isotherm was best modeled by Longmuir isotherm. The endothermic and spontaneous (and entropy increasing) nature of sorption process were approved by thermodynamic results. The results cleared which the synthesized CuHCNPAM composite is promising adsorbent for removal of cesium ions from nuclear waste.

  4. Effect of electrode materials on a negative ion production in a cesium seeded negative ion source

    Energy Technology Data Exchange (ETDEWEB)

    Shimizu, Takashi; Morishita, Takutoshi; Kashiwagi, Mieko; Hanada, Masaya; Iga, Takashi; Inoue, Takashi; Watanabe, Kazuhiro; Imai, Tsuyoshi [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment; Wada, Motoi [Doshisha Univ., Kyoto (Japan)

    2003-03-01

    Effects of plasma grid materials on the negative ion production efficiency in a cesium seeded ion source have been experimentally studied. Grid materials of Au, Ag, Cu, Ni, and Mo were examined. A 2.45 GHz microwave ion source was utilized in the experiment to avoid contamination of tungsten from filament cathode. Relations between the negative ion currents and work functions of the grid were measured for these materials. Influence of the contamination by tungsten on the grid was also investigated. If was clarified that the negative ion production efficiency was determined only by the work function of the grid. The efficiency did not depend on the material itself. The lowest work function of 1.42 eV was obtained for Au grid with Cs, and a high H{sup -} production efficiency of 20.7 mA/kW was measured. This efficiency is about 1.3 times larger than that of Cs/Mo and Cs/Cu. Further improvement of the production efficiency was observed by covering the plasma grid with tungsten and cesium simultaneously. Such co-deposition of W and Cs on the plasma grid produced the negative ion production efficiency of 1.7 times higher than that from the tungsten grid simply covered with Cs. (author)

  5. New Calix[4]arene dibenzocrown ethers for selective sensing of cesium ion in aqueous environment

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jong Seung; Kim, Jong Kuk [Konyang University, Nonsan (Korea, Republic of); Choi, Wang Kyu; Lee, Kune Woo; Oh, Won Jin [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1997-12-31

    1,3-dialkoxycalix[4]arene dibenzocrown ethers (6-9) were successfully synthesized in the fixed 1,3-alternate conformation with over 90% yields by the reaction of corresponding 1,3dialkoxycalix[4]arenes 2-5 with dibenzodimesylate 13 in acetonitrile as a solvent in the presence of cesium carbonate as a base. In view of cyclization yield, the use of dimesylate is found to be better than that of dibenzoditosylate. With an unusual AB pattern in {sup 1}H NMR spectrum for compound 9, it is suggested that conformational structure of 1,3-diallyloxycalix[4]arene dibenzocrown ether be less flexible than that of usual 1,3-alternate calixcrown ether, probably due to steric effects of two ally1 group. Complexation of the corresponding calix[4]arene 6-9 toward alkali metal ions using single flux method through bulk liquid membrane system was found to give a high cesium selectivity. 28 refs., 1 tab., 1 fig.

  6. Experimental approaches to assessing the impact of a cesium chloride radiological dispersal device

    Science.gov (United States)

    Lee, S.; Gibb, Snyder E.; Barzyk, J.; McGee, J.; Koenig, A.

    2008-01-01

    The US EPA, as a part of the Chemical, Biological, Radiological-Nuclear, and Explosives (CBRNE) Research and Technology Initiative (CRTI) project team, is currently working to assess the impacts of an urban radiological dispersion device (RDD) and to develop containment and decontamination strategies. Three efforts in this area are currently underway: development of a laboratory-scale cesium chloride deposition method to mimic a RDD; assessment of cesium (Cs) penetration depth and pathways in urban materials using two dimensional (2-D) mapping laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS); and experimental determination of distribution coefficients (kd) for Cs in water-building material systems. It is critical that, when performing laboratory-scale experiments to assess the fate of Cs from an RDD, the Cs particle deposition method mimics the RDD deposition. Once Cs particles are deposited onto urban surfaces, 2-D mapping of Cs concentrations using LA-ICP-MS is a critical tool for determining Cs transport pathways through these materials. Lastly, distribution coefficients are critical for understanding the transport of Cs in urban settings when direct measurements of its penetration depth are unavailable. An assessment of the newly developed deposition method along with preliminary results from the penetration experiments are presented in this paper.

  7. Functionalized magnetic nanoparticles for the decontamination of water polluted with cesium

    Science.gov (United States)

    Helal, Ahmed S.; Decorse, Philippe; Perruchot, Christian; Novak, Sophie; Lion, Claude; Ammar, Souad; El Hage Chahine, Jean-Michel; Hémadi, Miryana

    2016-05-01

    Magnetic nanoparticles are attracting considerable interest because of their potential applications in practically all fields of science and technology, including the removal of heavy metals from contaminated waters. It is, therefore, of great importance to adapt the surfaces of these nanoparticles according to the application. In this work advanced nanoparticles (NPs) with well-tailored surface functionalities were synthesized using the polyol method. The efficiency of a chelating agent, succinyl-β-cyclodextrin (SBCD), was first investigated spectrophotometrically and by Isothermal Titration Calorimetry (ITC). SBCD was then grafted onto nanoparticles previously functionalized with 3-aminopropyl triethoxsilane (NP-APTES). The resulting NP-SBCD system was then incubated with a solution of cesium. After magnetic separation, the solid residue was removed from the supernatant and characterized by X-Ray Photoelectron spectrometry (XPS), X-Ray Fluorescence spectrometry (XRF) and Superconducting QUantum Interference Device (SQUID) magnetometry. These characterizations show the presence of cesium in the solid residue, which indicates Cs uptake by the NP-SBCD system. This nanohybrid system constitutes a promising model for heavy metal decontamination.

  8. Phase noise analysis of voltage controlled oscillator used in cesium atomic clock

    Science.gov (United States)

    Zhi, Menghui; Tang, Liang; Qiao, Donghai

    2017-03-01

    Coherent population trapping (CPT) cesium frequency standard plays a significant role in precision guidance of missile and global positioning system (GPS). Low noise 4.596 GHz voltage controlled oscillator (VCO) is an indispensable part of microwave signal source in cesium frequency standard. Low-phase noise is also the most important and difficult performance indicator of VCO. Starting from phase noise analysis method proposed by Leeson, the formulas about the relationship between phase noise of output signal of oscillator feedback model and phase fluctuation spectrum of amplifier, phase noise of oscillator are derived in this paper. Finally, the asymptote model of microwave oscillator is proposed based on the formula derivation. The experiment shows that when the reverse bias voltage of variode is 1.8 V, the designed oscillation frequency of VCO is 4.596 GHz, the power is ‑1 dBm and the DC power consumption is 19.6 mW. The tendency of phase noise simulation curve and actual test curve conform to asymptote model. The phase noise in 1 and 10 kHz is, respectively, ‑60.86 and ‑86.58 dBc/Hz. The significance of the paper lies in determining the main factors influencing oscillator phase noise and providing guiding direction for the design of low-phase noise VCO.

  9. Contamination of terrestrial gastropods Helix aspersa maxima with {sup 137}Cs, {sup 85}Sr, {sup 133}Ba and {sup 123m}Te by direct and trophic pathways

    Energy Technology Data Exchange (ETDEWEB)

    Madoz-Escande, C.; Querrec, N.; Bonhomme, T.; Poncet-Bonnard, D. [CEA Cadarache (DEI/SECRE/LRE), Laboratory of Radioecology and Ecotoxicology, Institute for Radioprotection and Nuclear Safety, 13 - Saint-Paul-lez-Durance (France)

    2004-07-01

    Contaminations of terrestrial gastropod Helix aspersa Maxima by direct deposition or labelled food ingestion of {sup 137}Cs, {sup 85}Sr, {sup 133}Ba and {sup 123m}Te were carried out in laboratory conditions. This study was performed to compare the two pathways of contamination: direct and trophic in terms of individual mortality and, radionuclide uptake, depuration and tissular distribution. A first group of 30 snails (2-year old) was exposed to radioactive aerosols during a twenty-hour period. These aerosols were supposed to be representative of those produced during a nuclear accident occurring on a PWR. A second group of 40 snails (same ages) was submitted to twice-a-week ingestion of food during 10 days (flour at a feeding rate of about 0,2 g) contaminated by these same aerosols. During the 21 days observation period, comparison among the two groups and a reference group (not contaminated by radionuclides) was performed. No significant difference between the three groups was observed neither on the growth nor on the mortality. One day after the deposit, the cesium was the most bioavailable element, distributed homogeneously within the whole body (from 15 to 25% of total Cs respectively in shell and muscle). The strontium accumulated in the shell (about 70%). The barium was found in the muscle (20%) and the shell (65%). Tellurium was mainly present in the shell (70%) and in digestive gland (20%), Later, this element was mostly present in faeces. As regards the contamination by ingestion, it was mainly accumulated in digestive gland. (author)

  10. Incorporation of cesium into phosphates of apatitic and rhabdophane lattices. Application to the conditioning of separated radionuclides; Incorporation du cesium dans des phosphates de structure apatitique et rhabdophane. Application au conditionnement des radionucleides separes

    Energy Technology Data Exchange (ETDEWEB)

    Campayo, L

    2003-04-01

    Two phosphate-based materials were investigated for cesium immobilization after its partitioning from spent nuclear fuel: apatites and rhabdophanes. The incorporation of cesium into the apatitic lattice creates steric stresses. These stresses induce the formation of secondary phases which are rapidly leached. The effectiveness of the cesium immobilization in this material is not therefore validated. A second phosphate CsCaNd(PO{sub 4}){sub 2} was consistently found at the end of the leach test and its properties were further characterized. The structure of CsCaNd(PO{sub 4}){sub 2}, which is rhabdophane-like, is made of large channels which enable the incorporation of the largest alkaline cations. The synthesis involves two intermediates: the monazite, NdPO{sub 4}, and a soluble phosphate, CsCaPO{sub 4}. The study of a rhabdophane with 10 wt.% of cesium reveals satisfactory intrinsic properties: a thermal stability up to 1100 C and a leach rate of 10{sup -2} g/(m{sup 2}.d). The next step will be to improve the reaction yield. (author)

  11. Transporting dynamics of radioactive cesium in a forest ecosystem and its discharge processes

    Energy Technology Data Exchange (ETDEWEB)

    Iseda, Kohei; Ohte, Nobuhito; Tanoi, Keitaro; Endo, Izuki; Oda, Tomoki; Kato, Hiroyu [Graduate School of Agricultural and Life Sciences, University of Tokyo (Japan)

    2014-07-01

    A lot of radioactive substance including {sup 137}Cs, {sup 134}Cs fell out to Tohoku and Kanto region in particular Fukushima prefecture after the accident of Fukushima-daiichi nuclear power plant. Generally, cesium tends to attach to clay particle and organic matter. These clay particle and organic matter can potentially flow out from the forest through the river to the downstream not only as particulate matter but also dissolved matter. It is likely that behavior of cesium is similar to sediment locomotion. The objective of this study is to understand transporting dynamics of radioactive cesium inside and outside of the forest. We started investigations on transporting dynamics of cesium in the forest upper stream of Kami-Oguni river in Date city Fukushima prefecture located in about 50 km from the nuclear power plant since July 2012. We conducted river water sampling at 9 points along the river from the uppermost stream to the middle reaches during low flow condition once a month. We also sampled river water during storm event for 5 times in order to capture the change of {sup 137}Cs concentration in a flood stage. Samples were filtered and separated into particulate and dissolved matters using glass micro-fiber filters (GF/F). Samples were analyzed their {sup 137}Cs concentration by Germanium semiconductor detector at University of Tokyo. During low flow condition, {sup 137}Cs was detected only a very small amount both in particulate and dissolved matters. In contrast, during high flow condition, {sup 137}Cs was detected about 10-100 times higher than that of during low flow condition in particulate matter. We estimated discharge flux of {sup 137}Cs from the forest using the relations between water discharge and {sup 137}Cs concentration. It was 0.977 Bq/(m2 day ) (2012/8/31-2013/4/19). In the forest, we set 2 deciduous tree plots (Quercus serrata, Zelkova serrata and so on) and 1 evergreen confer plot (Cyptomeria japonica). Atmospheric depositions of {sup 137

  12. Preliminary Ion Exchange Modeling for Removal of Cesium from Hanford Waste Using SuperLig 644 Resin

    Energy Technology Data Exchange (ETDEWEB)

    Hamm, L.L.

    2000-08-23

    A proposed facility is being designed for the immobilization of Hanford high-level radioactive waste. One unit process in the facility is designed to remove radioactive cesium by ion-exchange from the strongly alkaline aqueous phase. A resin specifically designed with high selectivity of cesium under alkaline conditions is being investigated. The resin also is elutable under more acidic conditions. The proposed design of the facility consists of two sets of two packed columns placed in series (i.e., a lead column followed by a lag (guard) column configuration). During operation, upon reaching a specified cesium concentration criterion at the exit of the lag column, operation is switched to the second set of lead and lag columns. The cesium-loaded lead column is processed (i.e., washed and eluted) and switched to the lag position. the previous lag column is then placed in the lead position (without eluting) and the system is ready for use in the next cycle. For a well designed process, the loading and elution processes result in significant volume reductions in aqueous high-level waste.

  13. All-Vacuum-Deposited Stoichiometrically Balanced Inorganic Cesium Lead Halide Perovskite Solar Cells with Stabilized Efficiency Exceeding 11.

    Science.gov (United States)

    Chen, Chien-Yu; Lin, Hung-Yu; Chiang, Kai-Ming; Tsai, Wei-Lun; Huang, Yu-Ching; Tsao, Cheng-Si; Lin, Hao-Wu

    2017-03-01

    Vacuum-sublimed inorganic cesium lead halide perovskite thin films are prepared and integrated in all-vacuum-deposited solar cells. Special care is taken to determine the stoichiometric balance of the sublimation precursors, which has great influence on the device performance. The mixed halide devices exhibit exceptional stabilized power conversion efficiency (11.8%) and promising thermal and long-term stabilities.

  14. Removal efficiency of water purifier and adsorbent for iodine, cesium, strontium, barium and zirconium in drinking water.

    Science.gov (United States)

    Sato, Itaru; Kudo, Hiroaki; Tsuda, Shuji

    2011-01-01

    The severe incident of Fukushima Daiichi Nuclear Power Station has caused radioactive contamination of environment including drinking water. Radioactive iodine, cesium, strontium, barium and zirconium are hazardous fission products because of the high yield and/or relatively long half-life. In the present study, 4 pot-type water purifiers and several adsorbents were examined for the removal effects on these elements from drinking water. Iodide, iodate, cesium and barium were removed by all water purifiers with efficiencies about 85%, 40%, 75-90% and higher than 85%, respectively. These efficiencies lasted for 200 l, which is near the recommended limits for use of filter cartridges, without decay. Strontium was removed with initial efficiencies from 70% to 100%, but the efficiencies were slightly decreased by use. Zirconium was removed by two models, but hardly removed by the other models. Synthetic zeolite A4 efficiently removed cesium, strontium and barium, but had no effect on iodine and zirconium. Natural zeolite, mordenite, removed cesium with an efficiency as high as zeolite A4, but the removal efficiencies for strontium and barium were far less than those of zeolite A4. Activated carbon had little removal effects on these elements. In case of radioactive contamination of tap water, water purifiers may be available for convenient decontamination of drinking water in the home.

  15. Sugar-metal ion interactions: The coordination behavior of cesium ion with lactose, D-arabinose and L-arabinose

    Science.gov (United States)

    Jiang, Ye; Xue, Junhui; Wen, Xiaodong; Zhai, Yanjun; Yang, Limin; Xu, Yizhuang; Zhao, Guozhong; Kou, Kuan; Liu, Kexin; Chen, Jia'er; Wu, Jinguang

    2016-04-01

    The novel cesium chloride-lactose complex (CsCl·C12H22O10 (Cs-Lac), cesium chloride-D-arabinose and L-arabinose complexes (CsCl·C5H10O5, Cs-D-Ara and Cs-L-Ara) have been synthesized and characterized using X-ray diffraction, FTIR, FIR, THz and Raman spectroscopies. Cs+ is 9-coordinated to two chloride ions and seven hydroxyl groups from five lactose molecules in Cs-Lac. In the structures of CsCl-D-arabinose and CsCl-L-arabinose complexes, two kinds of Cs+ ions coexist in the structures. Cs1 is 10-coordinated with two chloride ions and eight hydroxyl groups from five arabinose molecule; Cs2 is 9-coordinated to three chloride ions and six hydroxyl groups from five arabinose molecules. Two coordination modes of arabinose coexist in the structures. α-D-arabinopyranose and α-L-arabinopyranose appear in the structures of Cs-D-Ara and Cs-L-Ara complexes. FTIR and Raman results indicate variations of hydrogen bonds and the conformation of the ligands after complexation. FIR and THz spectra also confirm the formation of Cs-complexes. Crystal structure, FTIR, FIR, THz and Raman spectra provide detailed information on the structure and coordination of hydroxyl groups to metal ions in the cesium chloride-lactose, cesium chloride-D- and L-arabinose complexes.

  16. Tracing cohesive sediment transportation at river mouths around Tokyo, Japan by Cesium originated from Fukushima Daiichi Power Plant

    Science.gov (United States)

    koibuchi, Y.

    2012-12-01

    Sediment transport at river mouths, which consists of suspended-load and bed-load, has not been fully understood, since bed-load transport of cohesive sand is difficult to observe. Especially, the impact of sediment transport on the total amount of fine-grained cohesive sediment has not been elucidated. Cesium-134 and cesium-137 were spread from the Fukushima Daiichi Nuclear Power Plant (FDNPP) after the earthquake of March 11 of 2011, and attached to the fine-grained sand on the land. The contaminated sand flowed into the river mouths through the rivers possibly due to the complex physical processes in estuarine areas. To evaluate the fine-grained sediment transport around Tokyo and Tokyo Bay, field observations were carried out utilizing radionuclide originated from FDNPP as an effective tracer. The cohesive sediment transport at three different river mouths around Tokyo was successfully quantified. The cohesive sediment transport deposited in the estuary was found to be greatly dependent on the land use, geometry, river discharge and salinity. In addition,the transport driven by the rainfall was minute, and its behavior was quite different from suspended solids. Although further field observations of radionuclide are necessary, it is clear that fine-grained sediment in the bay from rivers already settled on the river mouth by aggregation. The settled sand will not move even in rainfall events. Consequently, the transport of radionuclide to the Pacific Ocean may not occur.; Cesium distribution around Tokyo Bay ; Cesium Concentration in Edogawa river

  17. Documentation associated with the WESF preparation for receiving 25 cesium capsules from the Applied Radiant Energy Corporation (ARECO)

    Energy Technology Data Exchange (ETDEWEB)

    Pawlak, M.W.

    1996-10-21

    The purpose of this report is to compile all documentation associated with facility preparation of WESF to receive 25 cesium capsules from ARECO. The WESF validated it`s preparedness by completing a facility preparedness review using a performance indicator checklist.

  18. Bentonite-Clay Waste Form for the Immobilization of Cesium and Strontium from Fuel Processing Waste Streams

    Energy Technology Data Exchange (ETDEWEB)

    Kaminski, Michael D. [Argonne National Lab. (ANL), Argonne, IL (United States); Mertz, Carol J. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-01-01

    The physical properties of a surrogate waste form containing cesium, strontium, rubidium, and barium sintered into bentonite clay were evaluated for several simulant feed streams: chlorinated cobalt dicarbollide/polyethylene glycol (CCD-PEG) strip solution, nitrate salt, and chloride salt feeds. We sintered bentonite clay samples with a loading of 30 mass% of cesium, strontium, rubidium, and barium to a density of approximately 3 g/cm3. Sintering temperatures of up to 1000°C did not result in volatility of cesium. Instead, there was an increase in crystallinity of the waste form upon sintering to 1000ºC for chloride- and nitrate-salt loaded clays. The nitrate salt feed produced various cesium pollucite phases, while the chloride salt feed did not produce these familiar phases. In fact, many of the x-ray diffraction peaks could not be matched to known phases. Assemblages of silicates were formed that incorporated the Sr, Rb, and Ba ions. Gas evolution during sintering to 1000°C was significant (35% weight loss for the CCD-PEG waste-loaded clay), with significant water being evolved at approximately 600°C.

  19. 22 CFR 133.110 - Are any of my Federal assistance awards exempt from this part?

    Science.gov (United States)

    2010-04-01

    ... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Purpose and Coverage § 133.110 Are any... international obligations of the United States or the laws or regulations of a foreign government....

  20. Clinical value of CD133 and nestin in patients with glioma

    DEFF Research Database (Denmark)

    Dahlrot, Rikke H; Hansen, Steinbjørn; Jensen, Stine S

    2014-01-01

    133 and nestin separately and in combination using a novel quantitative approach in a well-characterized population-based cohort of glioma patients. The expression of CD133 and nestin was measured by systematic random sampling in stained paraffin sections from 239 glioma patients diagnosed between......-free survival (PFS) in multivariate analysis. High levels of co-localization were associated with poor PFS in patients with WHO grade II tumors, but not with OS. We conclude that CD133 was not an independent prognostic factor, but a high level of nestin was associated with poor PFS in patients with WHO grade II...... 2005 and 2009. We found that the expression of CD133 did not correlate with WHO grade, and there was no association with overall survival (OS). The level of nestin correlated positively with WHO grade. In patients with WHO grade II tumors, a high level of nestin was associated with short progression...

  1. Cesium-137 as a tracer of soil turbation: example of the taiga landscapes of the Western Siberia, Russia

    Energy Technology Data Exchange (ETDEWEB)

    Usacheva, Anna A.; Semenkov, Ivan N. [The Organization of Russian Academy of Sciences Institute of geology of ore deposits, petrography, mineralogy and geochemistry Russian Academy of Sciences, 119017, Moscow (Russian Federation)

    2014-07-01

    Cesium-137 is artificial radionuclide with 30.17 years half-life. However, this element can be found anywhere due to global atmospheric fallout. Its background storage is detected in landscapes: water, bottom sediments, plants and soils. Almost no one has studied the concentration of {sup 137}Cs in the landscapes of the North, because of its negligible storage. Cesium-137 is slightly mobile in the soils of the North. The cryogenic and other material movement is a typical feature of soils of the North. However, the dating of the soil turbations less than 100 years of age, using existing methods, is possible via long-term stationary observations. To determine the age of soil turbations quicker, one can use slightly mobile artificial radionuclides with medium or long half-life. Cesium-137 satisfies all the criteria. The aim of the work is to estimate suitable of cesium-137 as geo-tracer of soil turbation. According to our evaluation, the activity of the buried layers is less than 10 Bq*kg{sup -1} at the current {sup 137}Cs contamination of surface organic horizons (60-90 Bq*kg{sup -1}). A research has been conducted to study distribution of cesium-137 in the north and middle taiga landscapes of Western Siberia (Russia). Field research was carried out in 2012 in two study areas. The first study area 'Purpe' is located in the middle part of the Pur river basin, near Gubkinsky town (Yamalo-Nenets Autonomous Okrug). The second study area 'Noyabrsk' is located in the Ob and the Pur river watersheds, near Noyabrsk-city (Yamalo-Nenets Autonomous Okrug). Moss-grass-underwood layer (n=13) contains 22±20% of {sup 137}Cs total storage in the landscapes of oligo-trophic bogs with cryohistosols and pine forests on cryopodzols. The main reservoir of cesium-137 is soils (n=24) that accumulate 78±20% of its total landscape storage. The upper 10-cm soil layer contains 90% of {sup 137}Cs soil storage. Cesium-137 activity declines from shrubs and polytric layers

  2. Expression of the "stem cell marker" CD133 in pancreas and pancreatic ductal adenocarcinomas

    Directory of Open Access Journals (Sweden)

    Sakariassen Per

    2008-02-01

    Full Text Available Abstract Background It has been suggested that a small population of cells with unique self-renewal properties and malignant potential exists in solid tumors. Such "cancer stem cells" have been isolated by flow cytometry, followed by xenograft studies of their tumor-initiating properties. A frequently used sorting marker in these experiments is the cell surface protein CD133 (prominin-1. The aim of this work was to examine the distribution of CD133 in pancreatic exocrine cancer. Methods Fifty-one cases of pancreatic ductal adenocarcinomas were clinically and histopathologically evaluated, and immunohistochemically investigated for expression of CD133, cytokeratin 19 and chromogranin A. The results were interpreted on the background of CD133 expression in normal pancreas and other normal and malignant human tissues. Results CD133 positivity could not be related to a specific embryonic layer of organ origin and was seen mainly at the apical/endoluminal surface of non-squamous, glandular epithelia and of malignant cells in ductal arrangement. Cytoplasmic CD133 staining was observed in some non-epithelial malignancies. In the pancreas, we found CD133 expressed on the apical membrane of ductal cells. In a small subset of ductal cells and in cells in centroacinar position, we also observed expression in the cytoplasm. Pancreatic ductal adenocarcinomas showed a varying degree of apical cell surface CD133 expression, and cytoplasmic staining in a few tumor cells was noted. There was no correlation between the level of CD133 expression and patient survival. Conclusion Neither in the pancreas nor in the other investigated organs can CD133 membrane expression alone be a criterion for "stemness". However, there was an interesting difference in subcellular localization with a minor cell population in normal and malignant pancreatic tissue showing cytoplasmic expression. Moreover, since CD133 was expressed in shed ductal cells of pancreatic tumors and was

  3. CD133+ adult human retinal cells remain undifferentiated in Leukaemia Inhibitory Factor (LIF

    Directory of Open Access Journals (Sweden)

    Mayer Eric J

    2009-02-01

    Full Text Available Abstract Background CD133 is a cell surface marker of haematopoietic stem and progenitor cells. Leukaemia inhibitory factor (LIF, sustains proliferation and not differentiation of embryonic stem cells. We used CD133 to purify adult human retinal cells and aimed to determine what effect LIF had on these cultures and whether they still had the ability to generate neurospheres. Methods Retinal cell suspensions were derived from adult human post-mortem tissue with ethical approval. With magnetic automated cell sorting (MACS CD133+ retinal cells were enriched from post mortem adult human retina. CD133+ retinal cell phenotype was analysed by flow cytometry and cultured cells were observed for proliferative capacity, neuropshere generation and differentiation with or without LIF supplementation. Results We demonstrated purification (to 95% of CD133+ cells from adult human postmortem retina. Proliferating cells were identified through BrdU incorporation and expression of the proliferation markers Ki67 and Cyclin D1. CD133+ retinal cells differentiated whilst forming neurospheres containing appropriate lineage markers including glia, neurons and photoreceptors. LIF maintained CD133+ retinal cells in a proliferative and relatively undifferentiated state (Ki67, Cyclin D1 expression without significant neurosphere generation. Differentiation whilst forming neurospheres was re-established on LIF withdrawal. Conclusion These data support the evidence that CD133 expression characterises a population of cells within the resident adult human retina which have progenitor cell properties and that their turnover and differentiation is influenced by LIF. This may explain differences in retinal responses observed following disease or injury.

  4. Study on the Volatility of Cesium in Dry Ashing Pretreatment and Dissolution of Ash by Microwave Digestion System - 13331

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwang-Soon; Lee, Chang Heon; Ahn, Hong-Joo; Park, Yong Joon; Song, Kyuseok [Nuclear Chemistry Research Division, Korea Atomic Energy Research Institute, Daedeok-daero 989-111, Yuseong-gu, Daejeon, 305-353 (Korea, Republic of)

    2013-07-01

    Based on the regulation of the activity concentration of Cs-137, Co-58, Co-60, Fe-55, Ni-59, Ni-63, Sr-90, Nb-94, and Tc-99, and the total alpha from the radioactive waste acceptance criteria, the measurement of the activity concentration of these nuclides in low and intermediate levels of radioactive waste such as in paper, cotton, vinyl and plastic samples was investigated. A dry ashing method was applied to obtain a concentration effect of the samples. Owing to the temperature dependence of the volatility for cesium, the temperature of 300 to 650 deg. C was examined. It was found that 450 deg. C is the optimum dry ashing temperature. After dry ashing, the produced ash was dissolved with HNO{sub 3}, HCl, and HF by a high-performance microwave digestion system. The ash sample, for the most part, was completely dissolved with 10 mL of HNO{sub 3}, 4 mL of HCl, and 0.25 mL of HF by a high-performance microwave digestion system using a nova high temperature rotor at 250 deg. C for 90 min until reaching 0.2 g. To confirm the reliability of cesium loss after the performance of the dry ashing procedure, a cesium standard solution for AAS and a Cs-137 standard solution for gamma spectrometry were added to a paper towel or a planchet of stainless steel, respectively. Cesium was measured by AAS, ICP-MS, and gamma spectrometry. The volatility of cesium did not occur until 450 deg. C ashing. (authors)

  5. Sorption properties of cesium in soil%铯在土壤中的吸附性能研究

    Institute of Scientific and Technical Information of China (English)

    李爽; 倪师军; 张成江; 吴虹霁

    2009-01-01

    The sorption properties of cesium in the soil of a nuclear waste repository were investigated by column method. The effects of pH value, granularity of the soil, concentration of cesium solution on the sorption properties were also studied. The experiment results show that the equilibrium adsorptive quantity increases with the increasing of pH value and the initial concentration of cesium solution and decreases with the increasing of the grain size of the soil. This has no orderliness between equilibrium adsorptive quantity and pH value, the grain size of the soil. The most sorption rate of cesium in the soil of the primary election nuclear waste disposal is 65.9%, and the sorption properties are not well. So, people must use something which can adsorb cesium well as a barrier before the disposition.%用动态法测定了铯在某放射性废物处置预选场址土壤中的平衡吸附量,研究了水相pH值、土壤粒度及铯溶液浓度对土壤吸附铯的影响.pH值、溶液浓度越大,土壤平衡吸附量越大;土壤粒度越小,土壤平衡吸附量越大.用常用的吸附动力学方程对实验数据进行了拟合,并对吸附机理进行了探讨.实验结果表明,该放射性废物处置预选场址土壤对铯的最大吸附率为65.9%,吸附性能较差.

  6. IM-133N modulates cytokine secretion by RAW264.7 and THP-1 cells.

    Science.gov (United States)

    Varma, R Sandeep; Guruprasad, Kanive P; Satyamoorthy, Kapaettu; Kumar, L M Sharath; Babu, U Venkanna; Patki, S Pralhad

    2016-01-01

    An indigenous herbal extract IM-133N containing extracts of Prosopis glandulosa Torr and Symplocos racemosa Roxb were evaluated for potential immunomodulatory effects using RAW264.7 and THP-1 cells. The incubation of the cells for 24 h with IM-133N over a dose range 0-125 µg/ml did not cause cytotoxicity that exceeded 10%. The results indicated that non-cytotoxic doses of IM-133N effectively up-regulated iNOS, TNFα, IL-6, IL-10, IL-8 and IFNγ gene expression in both the RAW264.7 and THP-1 cells. The results also indicated IM-133N elicited dose-related increases in nitric oxide (NO) and tumor necrosis factor (TNF)-α production by RAW264.7 or THP-1 cells. These results demonstrated that IM-133N could stimulate NO and induced pro-inflammatory cytokine expression by monocytes/macrophages. As clinical studies have shown IM-133N to be an effective immunomodulator without any adverse effects, the results of the present study provide further support for the potential use of this agent as an immunostimulant or as an immunotherapy adjuvant.

  7. The determination of Fukushima-derived cesium-134 and cesium-137 in Japanese green tea samples and their distribution subsequent to simulated beverage preparation.

    Science.gov (United States)

    Cook, Matthew C; Stukel, Matthew J; Zhang, Weihua; Mercier, Jean-Francois; Cooke, Michael W

    2016-03-01

    Health Canada's Radiation Protection Bureau has identified trace quantities of (134)Cs and (137)Cs in commercially available green tea products of Japanese origin. Referenced to March 11, 2011, the activity ratio ((134)Cs/(137)Cs) has been determined to be 1:1, which supports an origin from the Fukushima Dai-ichi Nuclear Power Plant accident. The upper limits of typical tea beverage preparation conditions were applied to the most contaminated of these green tea samples to determine the proportion of radiocesium contamination that would be available for human consumption. The distribution of radiocesium among the components of the extraction experiments (water, residual tea solid, and filter media) was determined by both conventional and Compton-suppressed gamma spectroscopy. The latter aided tremendously in providing a more complete radiocesium distribution profile, particularly for the shorter-lived (134)Cs. Cesium extraction efficiencies of 64 ± 7% and 64 ± 5% were determined based on (134)Cs and (137)Cs, respectively. Annual, effective dose estimates from ingestion of (137)Cs and (134)Cs (1.8-3.7 μSv), arising from the consumption of tea beverages prepared from the most contaminated of these samples, are insignificant relative to both total (∼ 2.4 mSv) and ingested (∼ 0.28 mSv) annual effective doses received from naturally occurring radioactive sources. As such, there is no health concern arising from the consumption of green tea beverages contaminated with radiocesium at the levels encountered in this study.

  8. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133; Produccion de los radionucleidos de fision: Molibdeno-99, Yodo-131 y Xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Carrillo, D.

    1982-07-01

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs.

  9. Prognostic significance of stem cell marker CD133 determined by promoter methylation but not by immunohistochemical expression in malignant gliomas.

    Science.gov (United States)

    Wu, Xing; Wu, Fenlang; Xu, Dongwen; Zhang, Tao

    2016-04-01

    CD133 has played a pivotal role in the identification and isolation of brain tumor stem cells. The correlation between CD133 expression in tumor tissues with patients survival is still controversial. CD133 expression is determinated by methylation status of the promoter region 1-3. Aberrant methylation of CD133 was observed in glioblastoma. To date, a direct link between CD133 methylation and patient outcome has not been established.To address this question, we studied CD133 expression and promoter methylation in a series of 170 gliomas of various grade and histology, and investigated the correlation of CD133 expression and promoter methylation with patient outcome.We detected five CD133 promoter methylation patterns in 170 glioma samples: methylation only (M+, U-), unmethylation only (M-, U+), both methylation and unmethylation equally (M+, U+), high methylation and low unmethylation (M+, Ul), and low methylation and high unmethylation (Ml, U+). By multivariate survival analysis, we found CD133 promoter methylation status was significant (P promoter methylation status was observed (Kw = -0.165).CD133 promoter methylation status in glioma is closely correlated with patient survival, which suggest CD133 promoter methylaiton pattern is a promising tool for diagnostic purposes.

  10. Isolation and identification of CD133 + cells from human hepatocellular carcinoma cell lines Huh-7%人肝癌细胞系Huh-7中CD133+细胞的分离及鉴定

    Institute of Scientific and Technical Information of China (English)

    孙岚; 宋东颖; 刘岩磊; 刘岩; 张英鸽

    2013-01-01

    目的 通过表面标志分选法富集人肝癌Huh-7细胞中CD133+细胞,并初步鉴定其特性.方法 采用流式细胞分选技术从人肝癌细胞系Huh-7中分选出CD133+细胞,并进行干细胞比例分析;通过对CD133+细胞体外成球能力及增殖能力检测,考察CD133+细胞的自我更新能力;观察CD133+细胞在非肥胖性糖尿病/重度联合免疫缺陷小鼠(NOD/SCID)体内的成瘤情况.结果 分选获得的CD133+细胞经无血清培养后阳性比例达90%以上;CD133+细胞体外无血清培养3d即可成球且生长速度较CD133-细胞快;CD133+细胞在NOD/SCID小鼠体内21 d左右即可形成异种移植瘤.结论 CD133+表面标志物分选方法可以高纯度富集CD133+细胞,利用CD133抗体分选获得的CD133+细胞具有肿瘤干细胞样特性.%Objective To enrich CD133+ cells from human hepatocellular carcinoma cell lines Huh-7 cells through fluorescence activated cell sorting and identify their biological characteristics. Methods CD133 + cells were sorted by flow cytometry and the percentage of them in cultured Huh-7 cells was analyzed. The self-renewing and sphere-forming ability of CD133 + cell were observed by light microscope in vitro in comparison with CD133+ cells. Tumor-forming ability of CD133+ cells was observed by xenografts of them in NOD/SCID mice. Results Flow cytometry analysis indicated that the purity of CD133 + subset cells exceeded 90% , CD133 + subset cells were verified multipotent with the ability of forming tumor spheres within 3 culture days. And CD133 + subset cells were higher proliferative in vitro and had higher tumorigenitic ability in vivo than those of CD133+ subset cells in mice for 21 d. Conclusion CD133 + cells super marker sorting method can enrich CD133 + cells in high purity, and CD133 + cells sorted with CD133 antibody possess the characteristics of tumor stem cells.

  11. Solvent-Free Mechanosynthesis of Composition-Tunable Cesium Lead Halide Perovskite Quantum Dots.

    Science.gov (United States)

    Zhu, Zhi-Yuan; Yang, Qi-Qi; Gao, Lin-Feng; Zhang, Lei; Shi, An-Ye; Sun, Chun-Lin; Wang, Qiang; Zhang, Hao-Li

    2017-03-24

    A facile and green mechanosynthesis strategy free of solvent and high reaction temperature was developed to fabricate highly emissive cesium lead halide perovskite (CsPbX3) quantum dots (QDs). Their composition can be adjusted conveniently simply through mechanically milling/grinding stoichiometric combinations of raw reagents, thereby introducing a broad luminescence tunability of the product with adjustable wavelength, line width, and photoluminescence quantum yield. Desired CsPbX3 QDs "library" can thus be readily constructed in a way like assembling Lego building blocks. Hence, the method offered new avenues in the preparation of multicomponent cocrystals, adding one appealing apparatus to the tool box of perovskite-type QDs synthesis. Intriguingly, photoinduced dynamic study revealed the hole-transfer process of the as-prepared QDs toward electron donors, indicative of their potential in charge-transfer-based applications such as light-harvesting devices and photocatalysis.

  12. Numerical study of cesium effects on negative ion production in volume sources

    Energy Technology Data Exchange (ETDEWEB)

    Fukumasa, Osamu; Niitani, Eiji [Yamaguchi Univ., Ube (Japan). Faculty of Engineering

    1997-02-01

    Effects of cesium vapor injection of H{sup -} production in a tandem negative ion source are studied numerically as a function of plasma parameters. Model calculation is done by solving a set of particle balance equations in a steady-state hydrogen discharge plasmas. Here, the results which focus on gas pressure and electron temperature dependences of H{sup -} volume production are presented and discussed. With including H{sup -} surface production processes caused by both H atoms and positive hydrogen ions, enhancement of H{sup -} production and pressure dependence of H{sup -} production observed experimentally are well reproduced in the model. To enhance H{sup -} production, however, so-called electron cooling is not so effective if plasma parameters are initially optimized with the use of magnetic filter. (author)

  13. Characterizing passive coherent population trapping resonance in a cesium vapor cell filled with neon buffer gas

    Institute of Scientific and Technical Information of China (English)

    Liu Zhi; Wang Jie-Ying; Diao Wen-Ting; He Jun; Wang Jun-Min

    2013-01-01

    We present a pair of phase-locked lasers with a 9.2-GHz frequency difference through the injection locking of a master laser to the RF-modulation sideband of a slave diode laser.Using this laser system,a coherent population trapping (CPT)signal with a typical linewidth of ~ 182 Hz is obtained in a cesium vapor cell filled with 30 Torr (4 kPa) of neon as the buffer gas.We investigate the influence of the partial pressure of the neon buffer gas on the CPT linewidth,amplitude,and frequency shift.The results may offer some references for CPT atomic clocks and CPT atomic magnetometers.

  14. Cesium Isotherm Testing with Spherical Resorcinol-Formaldehyde Resin at High Sodium Concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Russell, Renee L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Fiskum, Sandra K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Smoot, Margaret R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Rinehart, Donald E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-04-01

    Washington River Protection Solutions (WRPS) is developing a Low-Activity Waste Pretreatment System (LAWPS) to provide low-activity waste (LAW) directly to the Hanford Tank Waste Treatment and Immobilization Plant (WTP) Low-Activity Waste Facility for immobilization. The pretreatment that will be conducted on tank waste supernate at the LAWPS facility entails filtration to remove entrained solids and cesium (Cs) ion exchange to remove Cs from the product sent to the WTP. Currently, spherical resorcinol-formaldehyde (sRF) resin (Microbeads AS, Skedsmokorset, Norway) is the Cs ion exchange resin of choice. Most work on Cs ion exchange efficacy in Hanford tank waste has been conducted at nominally 5 M sodium (Na). WRPS is examining the possibility of processing supernatant at high Na concentrations—up to 8 M Na—to maximize processing efficiency through the LAWPS. Minimal Cs ion exchange work has been conducted at 6 M and 8 M Na concentrations..

  15. Generation of ultraviolet radiation with wide angular tolerance in cesium lithium borate crystal

    Indian Academy of Sciences (India)

    Gopal C Bhar; Pathik Kumbhakar; Anil K Chaudhary

    2000-09-01

    Tangential phase-matching has been realised in cesium lithium borate (CLBO) crystal for the first time for the generation of fourth harmonic (266 nm) of Nd:YAG and third harmonic (226.7 nm) of a dye laser radiation by second harmonic generation and sum-frequency mixing with the angular tolerance as large as 22 mrad and 21 mrad respectively, over one of the interacting beams. An energy conversion efficiency of 15% for fourth harmonic generation is obtained with a 5.5 mm thick crystal and with the average pump powers only 170 and 70 mW. A set of Sellmeier dispersion equations for the CLBO crystal have also been formulated.

  16. Parity violation in atomic cesium and alternatives to the standard model of electroweak interactions

    Science.gov (United States)

    Bouchiat, C.; Piketty, C. A.

    1983-08-01

    We study the implications of the recent observation of a parity violation in atomic cesium. After a discussion of the uncertainties associated with the atomic physics calculations we derive conservative bounds for the weak charge QW. These bounds are used to put constraints on alternatives to the standard electroweak model, involving an ``extra U(1)'' gauge group. We analyze the possibility that the extra gauge boson might be very and give, as a by-product, the typical range of momentum transfer explored in atomic parity violation experiments. Laboratoire Propre du Centre National de la Recherche Scientifique associée à l'Ecole Normale Supérieure et à l'Université de Paris Sud.

  17. Tuning the Optical Properties of Cesium Lead Halide Perovskite Nanocrystals by Anion Exchange Reactions.

    Science.gov (United States)

    Akkerman, Quinten A; D'Innocenzo, Valerio; Accornero, Sara; Scarpellini, Alice; Petrozza, Annamaria; Prato, Mirko; Manna, Liberato

    2015-08-19

    We demonstrate that, via controlled anion exchange reactions using a range of different halide precursors, we can finely tune the chemical composition and the optical properties of presynthesized colloidal cesium lead halide perovskite nanocrystals (NCs), from green emitting CsPbBr3 to bright emitters in any other region of the visible spectrum, and back, by displacement of Cl(-) or I(-) ions and reinsertion of Br(-) ions. This approach gives access to perovskite semiconductor NCs with both structural and optical qualities comparable to those of directly synthesized NCs. We also show that anion exchange is a dynamic process that takes place in solution between NCs. Therefore, by mixing solutions containing perovskite NCs emitting in different spectral ranges (due to different halide compositions) their mutual fast exchange dynamics leads to homogenization in their composition, resulting in NCs emitting in a narrow spectral region that is intermediate between those of the parent nanoparticles.

  18. Strategic Design and Optimization of Inorganic Sorbents for Cesium, Strontium and Actinides

    Energy Technology Data Exchange (ETDEWEB)

    Edward J. Maginn

    2009-11-09

    The primary objective of the Notre Dame component of the project was computational in nature. The goal was to provide a design tool for the synthesis of optimized sorbents for the removal of cesium, strontium and actinides from nuclear waste solutions. Molecular modeling enables us to observe and better understand the molecular level interactions that govern the selectivity of specific radionuclides in a particular sorbent. The research focused on the development and validation of a suitable and transferable model for all the cations and ion exchangers of interest, nd then subsequent simulations which determined the siting and mobility of water and cations. Speciic accomplishments include: (1) improving existing intermolecular force fields to accurately model the sorbents of interest; (2) utilizing energy-minimizations and molecular dynamics simulations for structural prediction of CST and niobium-substituted CST materials; (3) determining Na+/water positions in polyoxoniobate materials using molecular dynamics simulations; and (4) developing Hybrid Monte Carlo methods for improved structural prediction.

  19. Sorption of cesium, radium, protactinium, uranium, neptunium and plutonium on rapakivi granite

    Energy Technology Data Exchange (ETDEWEB)

    Huitti, T.; Hakanen, M. [Helsinki Univ. (Finland). Lab. of Radiochemistry; Lindberg, A. [Geological Survey of Finland, Espoo (Finland)

    1996-12-01

    The aim of the study is to determine the sorption of cesium, radium, protactinium, uranium, neptunium and plutonium on rapakivi granite in the brackish groundwater of Haestholmen (site of the Loviisa-1, Loviisa-2 reactors). The studies were carried out under aerobic (Cs, Ra, Pa, U, Np, Pu) and anaerobic (Np, Pa, Pu, Tc) laboratory conditions. The cation exchange capasity was determined for the rock and the diffusion of tritiated water in the rocks of different degree of alteration. The sorption and diffusion properties of the rocks are briefly compared with those of host rocks at other sites under investigation by the Finnish company Posiva Oy for the final disposal of spent fuel. (29 refs.).

  20. Neutron powder diffraction and theory-aided structure refinement of rubidium and cesium ureate

    Energy Technology Data Exchange (ETDEWEB)

    Sterri, Kjersti B.; Deringer, Volker L.; Houben, Andreas; Jacobs, Philipp [RWTH Aachen Univ. (Germany). Inst. of Inorganic Chemistry; Kumar, Chogondahalli M.N. [Forschungszentrum Juelich GmbH, Juelich Centre for Neutron Science (JCNS), Outstation at SNS, Oak Ridge National Laboratory, Oak Ridge, TN (United States); Oak Ridge National Laboratory, TN (United States). Chemical and Engineering Materials Div.; Dronskowski, Richard [RWTH Aachen Univ. (Germany). Inst. of Inorganic Chemistry; RWTH Aachen Univ. (Germany). Juelich-Aachen Research Alliance (JARA-HPC)

    2016-08-01

    Urea (CN{sub 2}H{sub 4}O) is a fundamental biomolecule whose derivatives are abundant throughout chemistry. Among the latter, rubidium ureate (RbCN{sub 2}H{sub 3}O) and its cesium analog (CsCN{sub 2}H{sub 3}O) have been described only very recently and form the first structurally characterized salts of deprotonated urea. Here, we report on a neutron diffraction study on the aforementioned alkaline-metal ureates, which affords the positions for all hydrogen atoms (including full anisotropic displacement tensors) and thus allows us to gain fundamental insights into the hydrogen-bonding networks in the title compounds. The structure refinements of the experimental neutron data proceeded successfully using starting parameters from ab initio simulations of atomic positions and anisotropic displacement parameters. Such joint experimental-theoretical refinement procedures promise significant practical potential in cases where complex solids (organic, organometallic, framework materials) are studied by powder diffraction.

  1. Photoemission and optical constant measurements of Cesium Iodide thin film photocathode

    CERN Document Server

    Triloki,; Gupta, Nikita; Jammal, Nabeel F A; Singh, B K

    2014-01-01

    Performance of cesium iodide (CsI) as a reflective photocathode is presented. Absolute quantum efficiency (QE) measurement of 500 nm thick CsI film has been carried out in the wavelength range of 150 nm to 200 nm. Optical absorbance of 500 nm thick CsI film in the spectral range of 190 nm to 900 nm is analyzed and optical energy band gap is calculated using Tauc plot. To see the dispersive behavior of CsI film, refractive index has been determined by envelop plot of transmittance data, using Swanepoel method. Additional information on morphological and elemental composition results of CsI film, gained by atomic force microscopy (AFM) and X-ray photoelectron spectroscopy (XPS), respectively are also reported in present work.

  2. [Characteristics of mitochondria and myocardium ultrastructure of rats following chronic incorporation of cesium radionuclides 137 Cs].

    Science.gov (United States)

    Gritsuk, A I; Matiukhina, T G; Koval', A N; Sergeenko, S M; Svergun, V T; Verner, A I; Gritsuk, N A

    2002-01-01

    Ultrastructure, tissue respiration and oxidative phosphorilation were studies in the myocardium of animals after chronic natural irradiation by 137Cs in quantities that can in reality threaten population of radionuclide-polluted regions. Decline in the respiratory activity of the myocardium and ultrastructural disorders can be attributed to the effects of ions of radioactive Cs which is also a potassium antagonist. A hypothesis has been put forward according to which cesium blocks potassium channels in mitochondria and thus changes the volume and configuration of internal mitochondrial membranes, and impacts the respiratory processes. In the opinion of the authors, these changes characterize the mitochondrial phase of apoptosis which, in the event of chronic exposure to radionuclides, is a compensatory-adaptive mechanism eliminating the least immutable subpopulation of cardiomyocites.

  3. New data for Cesium from soil in Cluj-Napoca town after Cernobyl accident

    Directory of Open Access Journals (Sweden)

    Dan C. Niţă

    2011-08-01

    Full Text Available Cesium 137 deposits are due to serious nuclear disaster (such as Chernobyl and nuclearweapons tests. Due to the wide range of uses in environmental studies is important to know thatradionuclide concentrations in environment. Soil samples were measured, in which 137 Cs activitiesvaries between 4.3 and 114.3 Bq / kg. The highest concentrations were found in the top layers of thesoil. From the soil depth profiles it can be observed the 137 Cs migration. Horizontal and verticalmigration depends mainly on water runoff and the concentration of radionuclides, hydrological regimeand the type of soil. It is important to know the amount of radionuclides in the soil because there arealready developed models which describe the radionuclides migration in different environments. One ofthe most studied radionuclide Cs-137 is due to its abundance and relatively long half-life. If theconcentration of the radionuclides exceeds a certain value, it might be a threat to human health.

  4. Determination of the hyperfine coupling constant of cesium 7S1/2 state

    CERN Document Server

    Yang, Guang; Yang, Baodong; Wang, Junmin

    2016-01-01

    We report the hyperfine splitting (HFS) measurement of cesium (Cs) 7S1/2 state by optical-optical double-resonance spectroscopy in the 6S1/2-6P3/2-7S1/2 (852 nm + 1470 nm) ladder-type system. The HFS frequency calibration is performed by employing a phase-type waveguide electro-optic modulator together with a stable confocal Fabry-Perot cavity. From the measured HFS between F"= 3 and F"= 4 manifolds of Cs 7S1/2 state [HFS = 2183.273(37) MHz], we have determined the magnetic dipole hyperfine coupling constant [A = 545.818(09) MHz], which is in good agreement with the previous work but much more accurate.

  5. Selective removal of cesium and strontium using porous frameworks from high level nuclear waste.

    Science.gov (United States)

    Aguila, Briana; Banerjee, Debasis; Nie, Zimin; Shin, Yongsoon; Ma, Shengqian; Thallapally, Praveen K

    2016-05-01

    Efficient and cost-effective removal of radioactive (137)Cs and (90)Sr found in spent fuel is an important step for safe, long-term storage of nuclear waste. Solid-state materials such as resins and titanosilicate zeolites have been assessed for the removal of Cs and Sr from aqueous solutions, but there is room for improvement in terms of capacity and selectivity. Herein, we report the Cs(+) and Sr(2+) exchange potential of an ultra stable MOF, namely, MIL-101-SO3H, as a function of different contact times, concentrations, pH levels, and in the presence of competing ions. Our preliminary results suggest that MOFs with suitable ion exchange groups can be promising alternate materials for cesium and strontium removal.

  6. Cesium hafnium chloride: A high light yield, non-hygroscopic cubic crystal scintillator for gamma spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Burger, Arnold, E-mail: aburger@fisk.edu [Department of Life and Physical Sciences, Fisk University, Nashville, Tennessee 37208 (United States); Department of Physics and Astronomy, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rowe, Emmanuel; Groza, Michael; Morales Figueroa, Kristle [Department of Life and Physical Sciences, Fisk University, Nashville, Tennessee 37208 (United States); Cherepy, Nerine J.; Beck, Patrick R.; Hunter, Steven; Payne, Stephen A. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

    2015-10-05

    We report on the scintillation properties of Cs{sub 2}HfCl{sub 6} (cesium hafnium chloride or CHC) as an example of a little-known class of non-hygroscopic compounds having the generic cubic crystal structure of K{sub 2}PtCl{sub 6}. The crystals are easily growable from the melt using the Bridgman method with minimal precursor treatments or purification. CHC scintillation is centered at 400 nm, with a principal decay time of 4.37 μs and a light yield of up to 54 000 photons/MeV when measured using a silicon CCD photodetector. The light yield is the highest ever reported for an undoped crystal, and CHC also exhibits excellent light yield nonproportionality. These desirable properties allowed us to build and test CHC gamma-ray spectrometers providing energy resolution of 3.3% at 662 keV.

  7. Generation of a twin beam at the cesium line and telecom wavelength by cavity phase matching.

    Science.gov (United States)

    Liu, Y H; Xie, Z D; Ling, W; Lv, X J; Zhu, S N

    2011-08-15

    Cavity phase matching has been recently demonstrated as a phase-matching method for efficient nonlinear frequency conversion in a microcavity. Here we extend it to the Type I configuration using a sub-coherent-length optical parametric oscillator consisting of an MgO-doped lithium niobate crystal sheet. It generates a tunable single-longitudinal-mode twin beam, which covers the cesium D2 line of 852.1 nm and the extended band of optical communication. This microcavity is capable of peak output power of 58 kW with a maximum conversion efficiency of 18.5%. Broad applications in the areas of light-atom interaction, spectroscopy, optical telecommunication, and quantum optics can be expected.

  8. Cesium-iodide-based nanocrystal for the detection of ionizing radiation

    Science.gov (United States)

    Farzaneh, Azadeh; Abdi, Mohammad Reza; Saraee, Khadijeh Rezaee Ebrahim; Mostajaboddavati, Mojtaba; Quaranta, A.

    2016-05-01

    We report on the synthesis of cesium-iodide nanoparticles using sol-gel technique. The structural properties of CsI nanoparticles were characterized by X-ray diffraction and optical properties were followed by optical absorption and UV-vis fluorescence. Intense photoluminescence is also observed, with some spectral tuning possible with ripening time getting a range of emission photon wavelength approximately from 366 to 350 nm. The size effect on CsI luminescence leads to an increase in scintillation light yield, a redshift of the emission bands of the on_center and off_center self_trapped excitons (STEs) and an increase in the contribution of the off_center STEs to the net intrinsic emission yield. The energy transfer from the matrix to CsI nanoparticles is a key characteristic for scintillation detectors. So the scintillation spectra and decay curve to alpha particles of sample were monitored.

  9. Development of partitioning method. Adsorption of cesium with mordenite in acidic media

    Energy Technology Data Exchange (ETDEWEB)

    Donnet, L.; Morita, Yasuji; Yamagishi, Isao; Kubota, Masumitsu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-10-01

    Adsorption of cesium with mordenite from a acidic solution, typically from a 0.5 mol/L nitric acid solution, was studied to examine the possibility to design a new separation scheme for partitioning of high-level liquid waste. Batch adsorption experiments showed that three mordenites examined (natural mordenite and two synthetic mordenites Zeolon 900Na and 900H) have very close behavior with the parameters of adsorption kinetics, the saturation capacity by Langmuir equation, the distribution coefficient of Cs and adsorption of other elements. In the Cs adsorption with the natural mordenite at 0.5 mol/L nitric acid, distribution coefficient was 1150 ml/g and the saturation capacity was 0.64 mmol/g. In the adsorption of Cs on column using the natural mordenite, the flow rate of the Cs solution modified only the 5% breakthrough point and gave no influence on the total capacity of Cs. Column experiments with a mixed solution of Cs, Rb, Na, Ba, Sr, Cr, Ni, Ru, Rh and Pd showed that cesium was adsorbed very selectively. Only about 4% of rubidium in a molar ratio were retained in the column. The total quantity of Cs and Rb adsorbed was 0.51 mmol/g at 0.5 mol/L nitric acid. Elution of Cs (and Rb) with 4 mol/L nitric acid was performed against the column of the loaded natural mordenite. The adsorbed Cs and Rb were well eluted, and a good mass balance was obtained between the adsorbed quantity by breakthrough curves and the quantity found in the eluate. (author)

  10. ON THE RELATIONSHIP BETWEEN AMBIENT DOSE EQUIVALENT AND ABSORBED DOSE IN AIR IN THE CASE OF LARGE-SCALE CONTAMINATION OF THE ENVIRONMENT BY RADIOACTIVE CESIUM

    Directory of Open Access Journals (Sweden)

    V. P. Ramzaev

    2015-01-01

    Full Text Available One of the main aims of the study was an experimental determination of the conversion coefficient from ambient dose equivalent rate, Н*(10, to absorbed dose rate in air, D, in the case of radioactive contamination of the environment following the Chernobyl accident. More than 800 measurements of gamma-dose rates in air were performed at the typical locations (one-storey residential house, street, yard, kitchen-garden, ploughed field, undisturbed grassland, forest of rural settlements and their surroundings in the heavily contaminated areas of the Bryansk region, Russia in the period of 1996–2010. Five commercially available models of portable gamma-ray dosimeters were employed in the investigation. All tested dosimeters were included into the State register of approved measuring instruments of Russia. In all dosimeters, scintillation detectors are used as detection elements. A photon spectrometry technique is applied in the dosimeters to determine gamma dose rate in air. The dosimeters are calibrated in terms of exposure rate, X, absorbed dose rate in air, D, and ambient dose equivalent rate, Н*(10. A very good agreement was found between different dosimeters calibrated in the same units; the reading ratios were close to 1 and the correlation coefficients (Pearson’s or Spearman’s were higher than 0.99. The Н*(10/D ratio values were location-specific ranging from 1.23 Sv/Gy for undisturbed grasslands and forests to 1.47 Sv/Gy for wooden houses and asphalted streets. A statistically significant negative correlation (Spearman’s coefficient = -0.833; P<0.01; n=9 was found between the Н*(10/D ratio and the average energy of gamma-rays determined with a NaI(Tl-based gamma-ray monitor. For the whole area of a settlement and its surroundings, the average ratio of Н*(10 to D was calculated as 1.33 Sv/Gy. The overall conversion coefficient from ambient dose equivalent rate, Н*(10, to external effective dose rate, Ė, for adults was estimated

  11. Distribution of radioactive Cesium in trees and effect of decontamination of forest contaminated by the Fukushima nuclear accident

    Energy Technology Data Exchange (ETDEWEB)

    Iijima, K.; Funaki, H.; Tokizawa, T.; Nakayama, S. [Fukushima Environmental Safety Center, Headquarters of Fukushima Partnership Operations, Japan Atomic Energy Agency, Fukushima (Japan)

    2013-07-01

    In decontamination pilot projects conducted by Japan Atomic Energy Agency (JAEA), many different techniques were tested to determine their applicability to remediate areas evacuated after the Fukushima Daiichi nuclear accident following the Great Tohoku earthquake and tsunami of March 11, 2011. In addition to buildings, roads and farmland, the forest adjacent to living areas was one of the main decontamination targets. The projects evaluated the radioactive contamination of trees and the effectiveness of decontaminating a highly contaminated evergreen forest. This forest was located 1.3 km southwest of the Fukushima Daiichi Nuclear Power Plant and is dominated by Japanese cedar trees and fir trees. As the first step, three Japanese cedar trees and three fir trees were cut down and the distributions of radioactive cesium (Cs) were measured in each. The total concentrations of {sup 134}Cs and {sup 137}Cs in the leaves and branches were about 1 MBq/kg for both cedar and fir trees, and were appreciably higher than in the bark for cedar. The concentrations in the outer part of the trunks (under the bark) were lower, on the order of 10 kBq/kg, and those in the core of the trunks were lower than 1 kBq/kg for both kinds of trees. The observation that the Cs concentrations are higher in the outer part of trees, is compatible with the assumption that radio-Cs was mostly adsorbed on the surface of trees and partly penetrated into the trunks through the bark. Evolution of air dose rates in a 100 x 60 m pasture adjacent to the forest was monitored during decontamination of the forest and of the pasture itself. The dose rates in the pasture decreased drastically after stripping contaminated topsoil from the pasture and decreased slightly more after stripping contaminated topsoil of the forest floor and pruning the trees. Cutting down and removing 84 trees in the outermost area (10- m width) of the forest also slightly decreased these dose rates. After decontamination, the

  12. Small-angle neutron scattering study of the structure of mixed micellar solutions based on heptaethylene glycol monotetradecyl ether and cesium dodecyl sulfate

    Energy Technology Data Exchange (ETDEWEB)

    Rajewska, A., E-mail: aldonar@jinr.ru [Joint Institute for Nuclear Research (Russian Federation); Medrzycka, K.; Hallmann, E. [Gdansk University of Technology (Poland); Soloviov, D. V. [Joint Institute for Nuclear Research (Russian Federation)

    2016-01-15

    The micellization in mixed aqueous systems based on a nonionic surfactant, heptaethylene glycol monotetradecyl ether (C{sub 14}E{sub 7}), and an anionic surfactant, cesium dodecyl sulfate, has been investigated by small-angle neutron scattering. Preliminary data on the behavior of the C{sub 14}E{sub 7} aqueous solutions (with three concentrations, 0.17, 0.5, and 1%) mixed with a small amount of anionic surfactant, cesium dodecyl sulfate, are reported.

  13. Side population rather than CD133+ cells distinguishes enriched tumorigenicity in hTERT-immortalized primary prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Wolcott Karen

    2011-09-01

    Full Text Available Abstract Background Subpopulations of cancer cells with the capacity of generating solid tumors have been characterized. In various cancer types, including prostate cancer cells, a side population (SP and CD133-expressing cells have been proposed as containing a population cancer cells with stem-like ability. Therefore the aim of this work was to determine, in prostate cancer cell lines, the frequency and tumorigenic potential of SP and CD133+ cells. Results In vitro 2D colony-forming assay and sphere-forming assay, Flow cytometry analysis and magnetic cell sorting were utilized to sort CD133+, CD133- and Side population (SP cells. Our findings indicate that CD44 and integrin α-6 are uniformly expressed in the hTERT cell lines; however, CD133 is expressed only in a small population (in vitro and in vivo. Additionally, for the hTERT cells, SP rather than CD133 expression showed an 8-fold enhanced tumorigenic potential. The data suggest that SP cells, rather than those with CD133 marker, contain the rare population of CSC capable of producing prostate tumors. Conclusion Collectively, our data suggest that although CD133 is expressed only in a small population of hTERT-immortalized prostate cancer cells, it is not likely to be associated with stem cells, as CD133- and CD133+ cells exhibited similar tumorigenicity. However, SP isolated cells, appear to be enriched with tumorigenic stem-like cells capable of generating palpable tumors.

  14. Impact of short-term liquid storage on human CD133(+) stem cells.

    Science.gov (United States)

    Lux, Cornelia A; Mark, Peter; Klopsch, Christian; Laupheimer, Michael; Tu-Rapp, Hoang; Li, Wenzhong; Ma, Nan; Steinhoff, Gustav; David, Robert

    2015-01-01

    Stem cell transplantation is a viable strategy for regenerative medicine. However, it is inevitable to have cells undergo storage for several hours or days due to processing and transportation. Therefore, it is crucial to have rigidly controlled conditions ensuring the therapeutic benefit of isolated stem cells. In the present study, we investigated the impact of short-term storage on human CD133(+) cells. CD133(+) cells were isolated from human bone marrow and kept at standardized nonfreezing storage conditions for up to 72 h. Cell viability (apoptosis/necrosis) and expression of CD133 and CXCR4 were analyzed by flow cytometry. Metabolic activity was determined using an MTT assay; colony-forming ability, as well as endothelial-like differentiation, was further evaluated. A qRT-PCR array was employed to investigate the expression of stemness genes. CD133 and CXCR4 expressions were preserved at all time points. After 30 h, cell number and metabolic activity decreased, although no significant changes were detected in cell viability and proliferation as well as endothelial-like differentiation. Cell viability and proliferation decreased significantly only after 72 h of storage. Our results indicate that storage of isolated human CD133(+) bone marrow stem cells in liquid allows for high viability and functionality. However, storage time should be limited in order to avoid cell loss.

  15. DNA Damage in CD133-Positive Cells in Barrett’s Esophagus and Esophageal Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Raynoo Thanan

    2016-01-01

    Full Text Available Barrett’s esophagus (BE caused by gastroesophageal reflux is a major risk factor of Barrett’s esophageal adenocarcinoma (BEA, an inflammation-related cancer. Chronic inflammation and following tissue damage may activate progenitor cells under reactive oxygen/nitrogen species-rich environment. We previously reported the formation of oxidative/nitrative stress-mediated mutagenic DNA lesions, 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG and 8-nitroguanine, in columnar epithelial cells of BE tissues and cancer cells of BEA tissues. We investigated the mechanisms of BEA development in relation to oxidative/nitrative DNA damage and stem cell hypothesis. We examined 8-nitroguanine and 8-oxodG formation and the expression of stem cell marker (CD133 in biopsy specimens of patients with BE and BEA by immunohistochemical analysis in comparison with those of normal subjects. CD133 was detected at apical surface of columnar epithelial cells of BE and BEA tissues, and the cytoplasm and cell membrane of cancer cells in BEA tissues. DNA lesions and CD133 were colocalized in columnar epithelial cells and cancer cells. Their relative staining intensities in these tissues were significantly higher than those in normal subjects. Our results suggest that BE columnar epithelial cells with CD133 expression in apical surface undergo inflammation-mediated DNA damage, and mutated cells acquire the property of cancer stem cells with cytoplasmic CD133 expression.

  16. TP53 drives invasion through expression of its Δ133p53β variant

    Science.gov (United States)

    Gadea, Gilles; Arsic, Nikola; Fernandes, Kenneth; Diot, Alexandra; Joruiz, Sébastien M; Abdallah, Samer; Meuray, Valerie; Vinot, Stéphanie; Anguille, Christelle; Remenyi, Judit; Khoury, Marie P; Quinlan, Philip R; Purdie, Colin A; Jordan, Lee B; Fuller-Pace, Frances V; de Toledo, Marion; Cren, Maïlys; Thompson, Alastair M

    2016-01-01

    TP53 is conventionally thought to prevent cancer formation and progression to metastasis, while mutant TP53 has transforming activities. However, in the clinic, TP53 mutation status does not accurately predict cancer progression. Here we report, based on clinical analysis corroborated with experimental data, that the p53 isoform Δ133p53β promotes cancer cell invasion, regardless of TP53 mutation status. Δ133p53β increases risk of cancer recurrence and death in breast cancer patients. Furthermore Δ133p53β is critical to define invasiveness in a panel of breast and colon cell lines, expressing WT or mutant TP53. Endogenous mutant Δ133p53β depletion prevents invasiveness without affecting mutant full-length p53 protein expression. Mechanistically WT and mutant Δ133p53β induces EMT. Our findings provide explanations to 2 long-lasting and important clinical conundrums: how WT TP53 can promote cancer cell invasion and reciprocally why mutant TP53 gene does not systematically induce cancer progression. DOI: http://dx.doi.org/10.7554/eLife.14734.001 PMID:27630122

  17. Xenon-133 hepatic retention ratio: A useful index for fatty liver quantification

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, S.H.; Wu, L.C.; Wang, S.J.; Lin, H.C.; Liu, R.S.; Lee, S.D.; Wu, J.C. (Veterans General Hospital, Taipei (Taiwan))

    1989-10-01

    Xenon-133 hepatic retention ratio was developed for quantifying fatty liver. Data were acquired in frame mode in the hepatic region and both lung bases for 5 min after rebreathing 20 mCi of gaseous {sup 133}Xe and for another 5 min during washout. Static ({sup 99m}Tc)sulfur colloid liver imaging was performed with the patient in the identical position immediately after the ventilation study and data were stored for liver localization. A hepatic time-activity curve corrected for background activity was generated. The 133Xe retention ratio was derived by dividing the activity at 3.5 min after washout by the peak activity. The data of 16 controls and 20 patients with fatty liver were analyzed. The retention ratio (mean +/- s.d.) was greatly increased in patients with fatty infiltration (0.43 +/- 0.20 vs. 0.04 +/- 0.08 in controls, p less than 0.001). There was a strong positive correlation between the {sup 133}Xe retention ratios and percentage of fat on biopsy as assessed by the amount of the liver tissue occupied by fat globules on H E stained sections. The {sup 133}Xe hepatic retention ratio is a simple, accurate and clinically useful index of detecting, quantifying and managing fatty infiltration of the liver.

  18. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    Science.gov (United States)

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  19. Target Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  20. Metabolism of {sup 137}cesium, {sup 137}barium in the rat. Therapeutics of the contamination; Metabolisme du {sup 137}cesium, {sup 137}baryum chez le rat. Therapeutique de la contamination

    Energy Technology Data Exchange (ETDEWEB)

    Remy, J.; Philippon, A.; Lafuma, J.; Walter, C. [Commissariat a l' Energie Atomique, 92 - Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires. Departement de la Protection Sanitaire, Laboratoire de Radiopathologie

    1967-07-01

    The authors carry out research into the distribution kinetics, the metabolism and the excretion of {sup 137}Cs - {sup 137}Ba in the rat. They show that these phenomena are independent of the method of applying a single dose. The distribution tends to adopt in all cases a typical shape which remains the same depending on the body burden. Biological analysis of the state of the cesium in the biological media shows that it is transported in the free and ionised form. Considering the problem of the method of penetration of the cesium ion in the intracellular medium, and in particular by the in vivo and in vitro kinetic study of the plasma - red cell system, the authors make the assumption that an active transport of cesium occurs by the cell membrane. They thus arrive at an overall picture of the cesium distribution in the organism which is essentially characterized by a dynamic distribution equilibrium between two compartments: 99 per cent of the cesium accumulates in the intracellular pool, 1 per cent in the extracellular liquids. This latter compartment is open to the emunctories. Because, of the active transport by the cell membranes, the intracellular pool is filled rapidly but discharge is slow. This phenomenon is the limiting factor in the decrease of the body burden. From this representation, the authors deduce the reasons for the relative failure of the various therapeutic methods examined up till now by themselves or by other authors. The stimulation of the natural emunctories in the case of diuretics for example, can only improve the purification of the extracellular compartment. Now this latter contains only 1 per cent of the body burden and recharging is slow. Furthermore the methods designed to counteract or inhibit the active transport of cesium by the cell membrane are still at the present time incompatible with the survival of the cell. (authors) [French] Les auteurs etudient experimentalement la cinetique de distribution, le metabolisme et l