WorldWideScience

Sample records for cesium 133 target

  1. Uptake and translocation of cesium-133 in napiergrass (Pennisetum purpureum Schum.) under hydroponic conditions.

    Science.gov (United States)

    Kang, Dong Jin; Seo, Young-Jin; Saito, Tsukasa; Suzuki, Hiroyuki; Ishii, Yasuyuki

    2012-08-01

    The present study reports the potential remediation of cesium (Cs) using napiergrass, which produces the largest biomass among the herbaceous plants in hydroponic culture containing stable Cs (Cs-133) at concentrations of 50, 150, 300, 1000, and 3,000 μM using cesium chloride (CsCl), with 0 μM Cs as a control concentration. Plant height was significantly decreased in higher Cs-treated conditions (300, 1000, and 3000 μM Cs) at 7 weeks after treatment (WAT), but tiller numbers tended to increase compared with the control plant. No significant difference was observed in the aboveground dry matter weight in all Cs treatments throughout the study period. Cs content in the roots, leaf blades, and leaf sheaths clearly increased with increasing Cs concentration in the solutions. Cs content in the aboveground parts (leaf blades and leaf sheaths) was consistently higher than in the roots at concentration of 3,000 μM. Total Cs contents in the aboveground parts were 6305 and 26,365 mg kg(-1) at 7WAT in 1000- and 3000-μM Cs treatments, respectively. Mean values of transfer factors (TFs) in the aboveground parts were 50 μM=0.78, 150 μM=1.02, 300 μM=0.86, 1,000 μM=0.68, and 3,000 μM=0.94, respectively at 7WAT. Due to its high Cs content and high TF in the aboveground parts, napiergrass may be a candidate plant with high potential for phytoremediation of Cs from Cs-137-contaminated soil.

  2. Effects of pocket gopher burrowing on cesium-133 distribution on engineered test plots

    International Nuclear Information System (INIS)

    Very low levels of radionuclides exist on soil surfaces. Biological factors including vegetation and animal burrowing can influence the fate of these surface contaminants. Animal burrowing introduces variability in radionuclide migration that confounds estimation of nuclide migration pathways, risk assessment, and assessment of waste burial performance. A field study on the surface and subsurface erosional transport of surface-applied 133Cs as affected by pocket gopher (Thomomys bottae) burrowing was conducted on simulated waste landfill caps at the Los Alamos National Laboratory in north central New Mexico. Surface loss of Cs, adhered to five soil particle size ranges, was measured several times over an 18-mo period while simulated rainfalls were in progress. Gophers reduced Cs surface loss by significant amounts, 43%. Cesium surface loss on plots with only gophers was 0.8 kg totalled for the study period. This compared with 1.4 kg for control plots, 0.5 kg for vegetated plots, and 0.2 kg for plots with both gophers and vegetation. The change in Cs surface loss over time was significant (P -1). Vegetation-bearing plots bad significant more total subsurface Cs (μ = 1.7 g kg-1) than plots without vegetation (μ = 0.8 g kg-1). An average of 97% of the subsurface Cs in plots with vegetation was located in the upper 15 cm of soil (SDR1 + SDR2) compared with 67% for plots without vegetation. Vegetation moderated the influence of gopher activity on the transport of Cs to soil subsurface, and stabilized subsurface Cs by concentrating it in the rhizosphere. Gopher activity may have caused Cs transport to depths below that sampled, 30 cm. The results provide distribution coefficients for models of contaminant migration where animal burrowing occurs. 35 refs., 2 figs., 3 tabs

  3. CD133, Selectively Targeting the Root of Cancer

    Directory of Open Access Journals (Sweden)

    Jörg U. Schmohl

    2016-05-01

    Full Text Available Cancer stem cells (CSC are capable of promoting tumor initiation and self-renewal, two important hallmarks of carcinoma formation. This population comprises a small percentage of the tumor mass and is highly resistant to chemotherapy, causing the most difficult problem in the field of cancer research, drug refractory relapse. Many CSC markers have been reported. One of the most promising and perhaps least ubiquitous is CD133, a membrane-bound pentaspan glycoprotein that is frequently expressed on CSC. There is evidence that directly targeting CD133 with biological drugs might be the most effective way to eliminate CSC. We have investigated two entirely unrelated, but highly effective approaches for selectively targeting CD133. The first involves using a special anti-CD133 single chain variable fragment (scFv to deliver a catalytic toxin. The second utilizes this same scFv to deliver components of the immune system. In this review, we discuss the development and current status of these CD133 associated biological agents. Together, they show exceptional promise by specific and efficient CSC elimination.

  4. Control of the 133 cesium cold collisions, search for a variation of the fine structure constant using a dual rubidium-cesium atomic fountain; Controle des collisions froides du cesium {sup 133}Cs: tests de la variation de la constante de structure fine a l'aide d'une fontaine atomique double rubidium-cesium

    Energy Technology Data Exchange (ETDEWEB)

    Marion, H

    2005-03-15

    We developed a method of measurement of the frequency shift due to the collisions between cold atoms. This is the main systematic limitation for the accuracy of the Cs{sup 133} based fountains ({approx} 10{sup -15} in relative frequency). Consequently, we can measure this effect near 0.5% This opens prospects for improvements of the fountains performances in term of accuracy until 10{sup -16}. The fountain has also obtained a stability about 10{sup -14} at 1 s. We discovered for the first time, at very low magnetic field (5 {+-} 1 mG), Feshbach resonances. We also took a new absolute measurement of the hyperfine transition of the Rb{sup 87}, which is the most precise ever carried out and is used now as definition for the secondary standard. By comparing this value with those measured the previous years, we could carry out a test of the stability of the fine structure constant on the level of 10{sup -15} /yr. We led local comparisons between atomic fountains and the other fountains of the laboratory. Most stable it is unrolled with a combined stability of 5.10{sup -14} at 1 s. The behavior of the difference of the two clocks goes like white frequency noise up to 3.10{sup -16}. The assessment of the dual fountain accuracy budget has been evaluated at 7.10{sup -16} for the cesium part and 8.10{sup -16} for the rubidium part. We contributed to the realization of the scale of International Atomic Time, by series of calibrations of hydrogen masers. An atomic comparison of fountain by satellite links was tested between our laboratory and our German counterpart. This measurement has determined the good agreement between the two clocks. (author)

  5. MicroRNA-133a Inhibits Osteosarcoma Cells Proliferation and Invasion via Targeting IGF-1R

    Directory of Open Access Journals (Sweden)

    Guangnan Chen

    2016-02-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs are a class of small noncoding RNAs that regulate gene expression by repressing translation or cleaving RNA transcripts in a sequence-specific manner. Downregulated microRNAs and their roles in cancer development have attracted much attention. A growing body of evidence showed that microRNA-133a (miR-133a has inhibitory effects on cell proliferation, migration, invasion, and metastasis of osteosarcoma. Methods: MiR-133a expression in human osteosarcoma cell lines and human normal osteoblastic cell line hFOB was investigated by real-time PCR (RT-PCR. The role of miR-133a in human osteosarcoma growth and invasion was assessed in cell lines in vitro and in vivo. Then, luciferase reporter assay validated IGF-1R as a downstream and functional target of miR-133a, and functional studies revealed that the anti-tumor effect of miR-133a was probably due to targeting and repressing of IGF-1R expression. Results: MiR-133a was lower expressed in human osteosarcoma cell lines than human normal osteoblastic cell line hFOB and its effect on inhibiting proliferation, invasion and metastasis is mediated by its direct interaction with the IGF-1R. Furthermore, the tumour-suppressive function of miR-133a probably contributed to inhibiting the activation AKT and ERK signaling pathway. Conclusion: MiR-133a suppresses osteosarcoma progression and metastasis by targeting IGF-1R in human osteosarcoma cells, providing a novel candidate prognostic factor and a potential anti-metastasis therapeutic target in osteosarcoma.

  6. Transtarget residue products of 47MeV/u 12C ions on 133Cs targets

    Institute of Scientific and Technical Information of China (English)

    LiZong-Wei; YangWei-Fan; 等

    1997-01-01

    The yield of transtarget produced in the reaction of 47MeV/u 12C bombardment on cesium compound targets are measured by means of nuclear chemical method and the offline γ spectrum technique.The measurement results show that reaction cross-sections of transtarget products are considerable.The isotope distribution peak position(mass number) of barium element is 129.7±0.2 and the distribution width parameter is 2.76±0.25,At the same time,the yields of products with up to five charge numbers larger than target nucleus have been obtained.

  7. Neurotensin-induced miR-133α expression regulates neurotensin receptor 1 recycling through its downstream target aftiphilin.

    Science.gov (United States)

    Law, Ivy Ka Man; Jensen, Dane; Bunnett, Nigel W; Pothoulakis, Charalabos

    2016-01-01

    Neurotensin (NT) triggers signaling in human colonic epithelial cells by activating the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). Activated NTR1 traffics from the plasma membrane to early endosomes, and then recycles. Although sustained NT/NTR1 signaling requires efficient NTR1 recycling, little is known about the regulation of NTR1 recycling. We recently showed that NT/NTR1 signaling increases expression of miR-133α. Herein, we studied the mechanism of NT-regulated miR-133α expression and examined the role of miR-133α in intracellular NTR1 trafficking in human NCM460 colonocytes. We found that NT-induced miR-133α upregulation involves the negative transcription regulator, zinc finger E-box binding homeobox 1. Silencing of miR-133α or overexpression of aftiphilin (AFTPH), a binding target of miR-133α, attenuated NTR1 trafficking to plasma membrane in human colonocytes, without affecting NTR1 internalization. We localized AFTPH to early endosomes and the trans-Golgi network (TGN) in unstimulated human colonic epithelial cells. AFTPH overexpression reduced NTR1 localization in early endosomes and increased expression of proteins related to endosomes and the TGN trafficking pathway. AFTPH overexpression and de-acidification of intracellular vesicles increased NTR1 expression. Our results suggest a novel mechanism of GPCR trafficking in human colonic epithelial cells by which a microRNA, miR-133α regulates NTR1 trafficking through its downstream target AFTPH. PMID:26902265

  8. MiR-133b ameliorates axon degeneration induced by MPP(+) via targeting RhoA.

    Science.gov (United States)

    Niu, M; Xu, R; Wang, J; Hou, B; Xie, A

    2016-06-14

    Increasing evidence suggests that microRNAs (miRs) play a significant role in the pathogenesis of Parkinson's disease (PD). MiR-133b, which is significantly decreased in the PD midbrain, has recently been shown to promote neurite outgrowth and enhance neural functional recovery. However, the role of miR-133b in PD has not been clearly established. Here, using a well-established PD model culture based on the neurotoxin 1-methyl-4-phenyl-pyridinium (MPP(+)), we demonstrated that miR-133b could promote axon outgrowth in dopaminergic neurons (DNs) and ameliorated MPP(+)-induced axon degeneration. Additional experiments suggested that the mechanisms of this miR-133b-mediated effect might rely on RhoA inhibition. We demonstrated that RhoA, an inhibitor of axonal growth, was increased in DNs under MPP(+) treatment, and this increase could be attenuated by miR-133b overexpression. Moreover, we demonstrated that the induced expression of miR-133b could inhibit α-synuclein, which is critically involved in the pathological process of PD. Furthermore, we found that overexpression of miR-133b abrogated the MPP(+)-induced decrease in the Bcl-2/Bax ratio and upregulated phosphorylated Akt (p-Akt), which is a pro-survival kinase. Together these findings reveal novel roles for miR-133b in the pathogenesis of PD and provide new therapeutic avenues for the treatment of the disease. PMID:27012608

  9. MicroRNA-133 Controls Brown Adipose Determination in Skeletal Muscle Satellite Cells by Targeting Prdm16

    DEFF Research Database (Denmark)

    Yin, Hang; Pasut, Alessandra; Soleimani, Vahab D;

    2013-01-01

    Brown adipose tissue (BAT) is an energy-dispensing thermogenic tissue that plays an important role in balancing energy metabolism. Lineage-tracing experiments indicate that brown adipocytes are derived from myogenic progenitors during embryonic development. However, adult skeletal muscle stem cells...... (satellite cells) have long been considered uniformly determined toward the myogenic lineage. Here, we report that adult satellite cells give rise to brown adipocytes and that microRNA-133 regulates the choice between myogenic and brown adipose determination by targeting the 3'UTR of Prdm16. Antagonism...... of microRNA-133 during muscle regeneration increases uncoupled respiration, glucose uptake, and thermogenesis in local treated muscle and augments whole-body energy expenditure, improves glucose tolerance, and impedes the development of diet-induced obesity. Finally, we demonstrate that miR-133 levels...

  10. Targeting cancer stem cells with an 131I-labeled anti-AC133 monoclonal antibody in human colorectal cancer xenografts

    International Nuclear Information System (INIS)

    Introduction: Cancer stem cells (CSCs) are a subpopulation within a tumor, which possesses the characteristics of self-renewal, differentiation, tumorigenicity, and drug resistance. The aim of this study was to target the colorectal CSC marker CD133 with an131I-labeled specific monoclonal antibody (AC133 mAb) in a nude mouse xenograft model. Methods: Colorectal adenocarcinoma cells (LoVo cell line) were separated into CD133(+) and CD133(−) cells by magnetic activated cell sorting. CD133(+), CD133(−), and unsorted LoVo cells were cultured and then implanted subcutaneously into the lower limbs of nude mice (n = 5). AC133 mAb was labeled with 131I by the iodogen method. Results: The radiolabeled compound, 131I-AC133 mAb, showed high stability, specificity, and immunoactivity in vitro. Obvious accumulation of 131I-AC133 mAb was seen in nude mice bearing xenografts of CD133(+) and unsorted LoVo cells, but no uptake was found in mice bearing CD133(−) xenografts or specifically blocked xenografts. Biodistribution analysis showed that the tumor uptake of 131I-AC133 mAb was 6.97 ± 1.40, 1.35 ± 0.48, 6.12 ± 1.91, and 1.61 ± 0.44% ID/g (n = 4) at day 7 after injection of 131I-AC133 mAb in CD133(+), CD133(−), unsorted LoVo cell and specifically blocked xenografts, respectively. The results of immunofluorescence, autoradiography, and western blotting further verified the specific binding of 131I-AC133 mAb to CD133(+) tumors. Conclusions: This study demonstrates the possibility of targeting CSCs with a radiolabeled AC133 mAb in colorectal cancer xenografts based on in vitro, ex vivo, and in vivo experiments. Our findings suggest a new method for imaging CSCs non-invasively

  11. Ursolic Acid Inhibits the Proliferation of Gastric Cancer Cells by Targeting miR-133a.

    Science.gov (United States)

    Xiang, Fenfen; Pan, Chunying; Kong, Qianqian; Wu, Rong; Jiang, Jiemin; Zhan, Yueping; Xu, Jian; Gu, Xingang; Kang, Xiangdong

    2014-01-01

    Ursolic acid (UA), a potential chemotherapeutic agent, has the properties of inhibition of the growth of many human cancer cell lines. Whether UA can inhibit the growth and metastasis of human gastric cancer cells remains unknown. In this study, it was found that UA inhibited the growth and metastasis of human gastric cancer cells in vitro. Our results showed the increase of the percent of apoptotic cells and G1 phase, the inhibition of cell migrations well as the decrease of the expression of Bax, caspase 3 and Bcl-2 in BGC-823 cells after the treatment with UA. Real-time quantitative PCR analysis showed that UA treatment upregulated the level of miR-133a in BGC-823 cells. Overexpression of miR-133a increased the G1 phase of cell cycle and decreased Akt1 expression in BGC-823 cells. These outcomes might be secondary to the increased expression of miR-133a after the treatment with UA. PMID:26629938

  12. Ultrasound-targeted microbubble destruction-mediated downregulation of CD133 inhibits epithelial-mesenchymal transition, stemness and migratory ability of liver cancer stem cells.

    Science.gov (United States)

    Liu, Yan-Min; Li, Xuan-Fei; Liu, Hao; Wu, Xiao-Ling

    2015-12-01

    Hepatocellular carcinoma (HCC) is an aggressive disease with a poor outcome due to the high incidence of metastasis. Cancer stem cells (CSCs) have been identified to be responsible for tumor progression and may be generated by epithelial-mesenchymal transition (EMT) characteristics. CD133 is a specific surface marker for liver cancer stem cells (LCSCs), which is also considered as an important functional factor for tumorigenesis and overall survival in HCC. Ultrasound-targeted microbubble destruction (UTMD) has recently been used as a novel, safe and effective gene transfection technology. The aim of the present study was to elucidate the regulatory mechanism of CD133 and EMT in LCSCs and whether the UTMD-based shRNA delivery system facilitated gene delivery in LCSCs. In the present study, CD133+ cells were isolated from the SMMC-7721 HCC cell line and then transfected with shCD133 mediated by UTMD and liposomes, respectively. Compared to the liposomes group, the UTMD group resulted in significantly improved transfection efficiency. The downregulation of CD133 reversed the EMT program, attenuated self-renewal, proliferation and migration of CD133+ LCSCs and suppressed the growth of CSC tumor xenografts. Additionally, the downregulation of CD133 led to downregulation of the nuclear factor-κB (NF-κB) pathway. The present study demonstrated that CD133 plays a critical role in the regulation of the EMT process, tumor-initiating properties and migratory ability of LCSCs. The UTMD technique targeted for CD133 downregulation may be examined as a potential therapeutic strategy for HCC.

  13. miRNA-133 augments coelomocyte phagocytosis in bacteria-challenged Apostichopus japonicus via targeting the TLR component of IRAK-1 in vitro and in vivo

    OpenAIRE

    Meng Lu; Peng-Juan Zhang; Cheng-Hua Li; Zhi-Meng Lv; Wei-Wei Zhang; Chun-Hua Jin

    2015-01-01

    In this study, we explored the potential roles of miRNA-133 in regulating TLR pathways in the sea cucumber Apostichopus japonicus. Target screening of RNA-Seq data successfully identified interleukin-1 receptor-associated kinase (AjIRAK−1) as a putative target of miR-133. This result was further validated by negative expression profiles in Vibrio splendidus-challenged coelomocytes and lipopolysaccharide (LPS)-exposed cell cultures. HEK-293T cells transfected with a dual-luciferase reporter fu...

  14. miRNA-133 augments coelomocyte phagocytosis in bacteria-challenged Apostichopus japonicus via targeting the TLR component of IRAK-1 in vitro and in vivo.

    Science.gov (United States)

    Lu, Meng; Zhang, Peng-Juan; Li, Cheng-Hua; Lv, Zhi-Meng; Zhang, Wei-Wei; Jin, Chun-Hua

    2015-01-01

    In this study, we explored the potential roles of miRNA-133 in regulating TLR pathways in the sea cucumber Apostichopus japonicus. Target screening of RNA-Seq data successfully identified interleukin-1 receptor-associated kinase (AjIRAK-1) as a putative target of miR-133. This result was further validated by negative expression profiles in Vibrio splendidus-challenged coelomocytes and lipopolysaccharide (LPS)-exposed cell cultures. HEK-293T cells transfected with a dual-luciferase reporter fused to the 3'UTR of wild-type or mutant AjIRAK-1 exhibited a 52.9% reduction in luciferase activity (p < 0.01) compared to controls. Co-infection with a miR-133 mimics or a specific siRNA targeting AjIRAK-1 significantly repressed the mRNA and protein expression levels of AjIRAK-1 and its downstream molecules, such as AjTRAF6 and Ajp105, in primary coelomocytes. In contrast, a miR-133 inhibitor significantly increased the expression of these TLR pathway members. The injection of miR-133 agomir or AjIRAK-1 siRNA into sea cucumbers not only decreased the expression of AjIRAK-1 and its downstream molecules but also significantly increased V. splendidus coelomocyte phagocytosis. All of the present data provide direct evidence that miR-133 is involved in TLR cascade modulation through AjIRAK-1 targeting to promote V. splendidus coelomocyte phagocytosis in these non-model invertebrates. PMID:26223836

  15. Silencing BMI1 eliminates tumor formation of pediatric glioma CD133+ cells not by affecting known targets but by down-regulating a novel set of core genes.

    Science.gov (United States)

    Baxter, Patricia A; Lin, Qi; Mao, Hua; Kogiso, Mari; Zhao, Xiumei; Liu, Zhigang; Huang, Yulun; Voicu, Horatiu; Gurusiddappa, Sivashankarappa; Su, Jack M; Adesina, Adekunle M; Perlaky, Laszlo; Dauser, Robert C; Leung, Hon-chiu Eastwood; Muraszko, Karin M; Heth, Jason A; Fan, Xing; Lau, Ching C; Man, Tsz-Kwong; Chintagumpala, Murali; Li, Xiao-Nan

    2014-01-01

    Clinical outcome of children with malignant glioma remains dismal. Here, we examined the role of over-expressed BMI1, a regulator of stem cell self-renewal, in sustaining tumor formation in pediatric glioma stem cells. Our investigation revealed BMI1 over-expression in 29 of 54 (53.7%) pediatric gliomas, 8 of 8 (100%) patient derived orthotopic xenograft (PDOX) mouse models, and in both CD133+ and CD133- glioma cells. We demonstrated that lentiviral-shRNA mediated silencing of suppressed cell proliferation in vitro in cells derived from 3 independent PDOX models and eliminated tumor-forming capacity of CD133+ and CD133- cells derived from 2 PDOX models in mouse brains. Gene expression profiling showed that most of the molecular targets of BMI1 ablation in CD133+ cells were different from that in CD133- cells. Importantly, we found that silencing BMI1 in CD133+ cells derived from 3 PDOX models did not affect most of the known genes previously associated with the activated BMI1, but modulated a novel set of core genes, including RPS6KA2, ALDH3A2, FMFB, DTL, API5, EIF4G2, KIF5c, LOC650152, C20ORF121, LOC203547, LOC653308, and LOC642489, to mediate the elimination of tumor formation. In summary, we identified the over-expressed BMI1 as a promising therapeutic target for glioma stem cells, and suggest that the signaling pathways associated with activated BMI1 in promoting tumor growth may be different from those induced by silencing BMI1 in blocking tumor formation. These findings highlighted the importance of careful re-analysis of the affected genes following the inhibition of abnormally activated oncogenic pathways to identify determinants that can potentially predict therapeutic efficacy.

  16. Identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer.

    Science.gov (United States)

    Liu, Yanfang; Zhang, Xin; Zhang, Yujing; Hu, Zunqi; Yang, Dejun; Wang, Changming; Guo, Meng; Cai, Qingping

    2015-12-01

    Gastric cancer (GC) is the fourth most frequent malignant disease and the second leading cause of cancer mortality worldwide, but the molecular mechanisms underlying this clinically heterogeneous disease are complex and remain far from completely understood. Accumulating evidence suggests that abnormal microRNA (miRNA) expression is involved in tumorigenesis. However, their accurate expression pattern, function, and mechanism in GC remain unclear. Here, a heatmap analysis of the miRNomes was performed across TCGA datasets and the expression of miR-133 family was found to be consistently downregulated in GC. This result was confirmed in two GC cell lines and 20 pairs of primary GC tissues, and further study demonstrated that the downregulation of miR-133 was mainly mediated by histone modification within its promoter region. Importantly, restoration of miR-133b/a-3p expression could suppress GC cell proliferation and promote cell apoptosis by targeting anti-apoptotic molecules Mcl-1 and Bcl-xL. Consistent with in vitro results, reintroducing of miR-133b/a-3p expression significantly delayed tumor formation and reduced tumor size of GC cells in xenograft nude mice. And the inverse relationship between miR-133b/a-3p and its targets was verified in xenograft mice. Taken together, our findings suggest that miR-133b/a-3p acts as a tumor suppressor in GC by directly targeting Mcl-1 and Bcl-xL. Revealing novel mechanism for oncogene inhibition by miRNA-mediated pathways offers new avenues for GC treatment.

  17. miR-150-5p and miR-133a suppress glioma cell proliferation and migration through targeting membrane-type-1 matrix metalloproteinase.

    Science.gov (United States)

    Sakr, Moustafa; Takino, Takahisa; Sabit, Hemragul; Nakada, Mitsutoshi; Li, Zichen; Sato, Hiroshi

    2016-08-10

    Gliomas are the most frequent primary tumors of the brain, and there is no successful treatment for highly malignant gliomas. MicroRNAs (miRNAs) are involved in a variety of biological processes. Recent studies showed that miR-150-5p and miR-133a are downregulated in various human malignancies, and one of target mRNAs was shown to be membrane-type 1 matrix metalloproteinase (MT1-MMP) mRNA. However, their detailed role in the processes of cancer remains to be determined. Here we found that miR-150-5p and miR-133a expression was significantly downregulated in glioma tissues compared with normal tissues, and that MT1-MMP expression was inversely upregulated in glioma tissues. Knockdown of MT1-MMP by specific siRNAs in U87 and U251 glioma cells induced suppression of cell proliferation and invasion/migration. Transfection of miR-150-5p or miR-133a mimics into glioma cell lines reduced MT1-MMP expression and MMP-2 activation by these cells, and cell proliferation and invasion/migration were also suppressed by it. Co-transfection of specific inhibitor oligo DNA for miR-150-5p or miR-133a abrogated miR-150-5p or miR-133a mimic's actions, respectively. These results suggest that miR-150-5p and miR-133a may suppress malignancy of gliomas by targeting MT1-MMP, and could be used as an anti-metastatic therapy for glioma patients. PMID:27154818

  18. MicroRNA-133b targets glutathione S-transferase π expression to increase ovarian cancer cell sensitivity to chemotherapy drugs

    Directory of Open Access Journals (Sweden)

    Chen S

    2015-09-01

    Full Text Available Shuo Chen,1 Jin-Wen Jiao,2 Kai-Xuan Sun,1 Zhi-Hong Zong,3 Yang Zhao1 1Department of Gynecology, The First Affiliated Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Gynecology, The Affiliated Hospital of Medical College, Qingdao University, Qingdao, People’s Republic of China; 3Department of Biochemistry and Molecular Biology, College of Basic Medicine, China Medical University, Shenyang, People’s Republic of China Background: Accumulating studies reveal that aberrant microRNA (miRNA expression can affect the development of chemotherapy drug resistance by modulating the expression of relevant target proteins. The aim of this study was to investigate the role of miR-133b in the development of drug resistance in ovarian cancer cells. Methods: We examined the levels of miR-133b expression in ovarian carcinoma tissues and the human ovarian carcinoma cell lines (A2780, A2780/DDP and A2780/Taxol, respectively. We determined the cell viability of these cell lines treated with cisplatin or paclitaxel in the presence or absence of miR-133b or anti-miR-133b transfection using the MTT assay. Reverse transcription polymerase chain reaction and Western blotting were used to assess the mRNA and protein expression levels of two drug-resistance-related genes: glutathione S-transferase (GST-π and multidrug resistance protein 1 (MDR1. The dual-luciferase reporter assay was used to detect the promoter activity of GST-π in the presence and absence of miR-133b. Results: The expression of miR-133b was significantly lower in primary resistant ovarian carcinomas than in the chemotherapy-sensitive carcinomas (P<0.05, and the same results were found in primary resistant ovarian cell lines (A2780/Taxol and A2780/DDP compared to the chemotherapy-sensitive cell line (A2780; P<0.05. Following miR-133b transfection, four cell lines showed increased sensitivity to paclitaxel and cisplatin, while anti-miR-133b transfection

  19. Cesium-137

    International Nuclear Information System (INIS)

    This sheet belongs to a collection which relates to the use of radionuclides essentially in unsealed sources. Its goal is to gather on a single document the most relevant information as well as the best prevention practices to be implemented. These sheets are made for the persons in charge of radiation protection: users, radioprotection-skill persons, labor physicians. Each sheet treats of: 1 - the radio-physical and biological properties; 2 - the main uses; 3 - the dosimetric parameters; 4 - the measurement; 5 - the protection means; 6 - the areas delimitation and monitoring; 7 - the personnel classification, training and monitoring; 8 - the effluents and wastes; 9 - the authorization and declaration administrative procedures; 10 - the transport; and 11 - the right conduct to adopt in case of incident or accident. This sheet deals specifically with Cesium-137

  20. MiR-34a targeting of Notch ligand delta-like 1 impairs CD15+/CD133+ tumor-propagating cells and supports neural differentiation in medulloblastoma.

    Directory of Open Access Journals (Sweden)

    Pasqualino de Antonellis

    Full Text Available BACKGROUND: Through negative regulation of gene expression, microRNAs (miRNAs can function as oncosuppressors in cancers, and can themselves show altered expression in various tumor types. Here, we have investigated medulloblastoma tumors (MBs, which arise from an early impairment of developmental processes in the cerebellum, where Notch signaling is involved in many of the cell-fate-determining stages. Notch regulates a subset of MB cells that have stem-cell-like properties and can promote tumor growth. On the basis of this evidence, we hypothesized that miRNAs targeting the Notch pathway can regulate these phenomena, and can be used in anti-cancer therapies. METHODOLOGY/PRINCIPAL FINDINGS: In a screening of potential targets within Notch signaling, miR-34a was seen to be a regulator of the Notch pathway through its targeting of Notch ligand Delta-like 1 (Dll1. Down-regulation of Dll1 expression by miR-34a negatively regulates cell proliferation, and induces apoptosis and neural differentiation in MB cells. Using an inducible tetracycline on-off model of miR-34a expression, we show that in Daoy MB cells, Dll1 is the first target that is regulated in MB, as compared to the other targets analyzed here: Cyclin D1, cMyc and CDK4. MiR-34a expression negatively affects CD133(+/CD15(+ tumor-propagating cells, then we assay through reverse-phase proteomic arrays, Akt and Stat3 signaling hypo-phosphorylation. Adenoviruses carrying the precursor miR-34a induce neurogenesis of tumor spheres derived from a genetic animal model of MB (Patch1(+/- p53(-/-, thus providing further evidence that the miR-34a/Dll1 axis controls both autonomous and non autonomous signaling of Notch. In vivo, miR-34a overexpression carried by adenoviruses reduces tumor burden in cerebellum xenografts of athymic mice, thus demonstrating an anti-tumorigenic role of miR-34a in vivo. CONCLUSIONS/SIGNIFICANCE: Despite advances in our understanding of the pathogenesis of MB, one-third of

  1. MiR-133a regarded as a potential biomarker for benzene toxicity through targeting Caspase-9 to inhibit apoptosis induced by benzene metabolite (1,4-Benzoquinone).

    Science.gov (United States)

    Chen, Yujiao; Sun, Pengling; Bai, Wenlin; Gao, Ai

    2016-11-15

    Benzene is an environmental and industrial chemical which is widely utilized in various applications. Our previous study showed that miR-133a expression was down-regulated in chronic benzene poisoning workers, but the mechanism of miR-133a in benzene-induced hematotoxicity remains unclear. In this population-based study, benzene-exposed group recruited workers whose concentration of air benzene was 3.50±1.60mg/m(3), and control workers who were exposed to 0.06±0.01mg/m(3) air benzene. By comparison, Caspase-9 and Caspase-3 was up-regulated while miR-133a expression decreased in benzene-exposed workers. Pearson correlation analysis showed that miR-133a was reversely correlated with pro-apoptotic gene Caspase-9 in population-based study. Moreover, multiple linear regressions indicated that miR-133a was positively associated with blood cells count. To explore the underlying mechanism of miR-133a in benzene-induced hematotoxicity, AO/EB staining and TEM ultrastructural analysis were conducted to verify the activation of apoptosis in Human Leukemic U937 Cells induced by benzene metabolites (1,4-Benzoquinone, 1,4-BQ), while the mechanism of miR-133a in 1,4-BQ-induced apoptosis was performed using lentivirus vectors transfection. The results demonstrated that 1,4-BQ evidently induced mitochondria-mediated apoptosis and increased pro-apoptotic genes (Caspase-9 and Caspase-3) expression in a dose-dependent manner. The mechanistic study showed 1,4-BQ decreased miR-133a expression and miR-133a over-expression attenuated 1, 4-BQ-caused upregulation of Caspase-9, Caspase-3 and apoptosis. In conclusion, our research suggested that benzene induced hematotoxicity by decreasing miR-133a and caspase-dependent apoptosis which might contribute to the underlying mechanism of miR-133a in benzene-induced hematotoxicity.

  2. Decorporation of cesium-137

    International Nuclear Information System (INIS)

    Cesium radio-isotopes, especially cesium-137 (137Cs) are among the radionuclides of main importance produced by a fission reaction in reactor or a nuclear weapon explosion. In the environment, 137Cs is a major contaminant which can cause severe β, γirradiations and contaminations. 137Cs is distributed widely and relatively uniformly throughout the body with the highest concentration in skeletal muscles. A treatment becomes difficult afterwards. The purposes of this report are Firstly to compare the Prussian blue verses cobalt and potassium ferrocyanide (D.I. blue) efficiency for the 137Cs decorporation and secondly to assess a chronological treatment with D.I. blue. (author)

  3. Cesium reservoir and interconnective components

    International Nuclear Information System (INIS)

    The program objective is to demonstrate the technology readiness of a TFE (thermionic fuel element) suitable for use as the basic element in a thermionic reactor with electric power output in the 0.5 to 5.0 MW range. A thermionic converter must be supplied with cesium vapor for two reasons. Cesium atoms adsorbed on the surface of the emitter cause a reduction of the emitter work function to permit high current densities without excessive heating of the emitter. The second purpose of the cesium vapor is to provide space-charge neutralization in the emitter-collector gap so that the high current densities may flow across the gap unattenuated. The function of the cesium reservoir is to provide a source of cesium atoms, and to provide a reserve in the event that cesium is lost from the plasma by any mechanism. This can be done with a liquid cesium metal reservoir in which case it is heated to the desired temperature with auxiliary heaters. In a TFE, however, it is desirable to have the reservoir passively heated by the nuclear fuel. In this case, the reservoir must operate at a temperature intermediate between the emitter and the collector, ruling out the use of liquid reservoirs. Integral reservoirs contained within the TFE will produce cesium vapor pressures in the desired range at typical electrode temperatures. The reservoir material that appears to be the best able to meet requirements is graphite. Cesium intercalates easily into graphite, and the cesium pressure is insensitive to loading for a given intercalation stage. The goals of the cesium reservoir test program were to verify the performance of Cs-graphite reservoirs in the temperature-pressure range of interest to TFE operation, and to test the operation of these reservoirs after exposure to a fast neutron fluence corresponding to seven year mission lifetime. In addition, other materials were evaluated for possible use in the integral reservoir

  4. Cesium-137 in biosphere

    International Nuclear Information System (INIS)

    The behaviour of cesium-137 in environment is reviewed. Problems on 137Cs migration in environment, on metabolism andbiological effects are considered. Data on nuclide accumulation in various plants, ways of their entering the man's organism are presented. It is marked that the rate of 137Cs metabolism in the man's organism depends considerably on age, sex, temperature of environment, conditions for activity, water and mineral metabolism and some other factors. It is shown that the annual effective equivalent dose per capita will increase to 2000 yr. up to 1 μSv, that constitutes 0.05% of the average value of irradiation by a natural source

  5. Construction and identification of replication-competent adenovirus expressing siRNA targeting CD133 gene regulated by survivin promoter and its inhibition of liver cancer cell growth%survivin 启动子调控肿瘤干细胞标记 CD133基因 siRNA增殖型溶瘤腺病毒的构建及对肝癌细胞生长的抑制作用

    Institute of Scientific and Technical Information of China (English)

    牛坚; 王月; 刘斌; 王人颢; 朱志军; 申海莲

    2016-01-01

    目的:构建 survivin 启动子调控的靶向 CD133基因的 siRNA 增殖型溶瘤腺病毒,研究其对肝癌细胞生长的影响。方法RT-PCR 法扩增 survivin 启动子,测序鉴定,双酶切连接,获得 pH-XC2-survivin。酶切 pH-XC2-survivin、pZD55-CD133-siRNA 获得 survivin 启动子表达框的亚克隆和CD133-siRNA 基因表达框的亚克隆,连接获得 survivin 启动子调控的 siRNA 增殖型溶瘤腺病毒表达载体质粒 pT-ZD55-CD133-siRNA。增殖型溶瘤腺病毒 survivin-T-ZD55-CD133-siRNA 经 PCR 和测序鉴定。 qRT-PCR 法检测 CD133表达, Western blot 法检测 E1A,CCK-8法检测细胞生长,流式细胞术检测细胞凋亡。结果成功构建增殖型溶瘤腺病毒 sur-vivin-T-ZD55-CD133-siRNA。 qRT-PCR 法检测 CD133 mRNA明显下降, Western blot 证实 survivin-T-ZD55-CD133-siRNA在肿瘤细胞中表达 E1A 能抑制肝癌细胞 CD133表达及生长。结论构建的增殖型溶瘤腺病毒可有效降低肝癌细胞CD133的表达,用于肝癌基因治疗的进一步研究。%Objective To construct a replication-competent adenovirus expressing siRNA targeting CD133 gene regulated by survivin promoter and investigate its inhibitory effect on Hep 3B cells.Methods The fragment of the survivin promoter was amplified by PCR and inserted into pH -XC2 to reconstruct a recombinant plasmid pH -XC2-survivin.Complete digestion pH-XC2-survivin and pZD55-CD133-siRNA, combinational joining the subclones, then getting replication-competent adenovirus expressing short interference RNA targeting CD 133 gene regulated by survivin promoter, replication-competent adenovirus was constructed .The recombined adenoviruses ( T-ZD55-CD133-siRNA) were verified by PCR and sequencing .The effect of T-ZD55-CD133-siRNA on CD133 expression in Hep3B cells was detected by qRT-PCR.The expression of E1A was detected by Western blot.The antitumor po-tential of replication

  6. Fiber laser system for cesium and rubidium atom interferometry

    CERN Document Server

    Diboune, Clément; Bidel, Yannick; Cadoret, Malo; Bresson, Alexandre

    2016-01-01

    We present an innovative fiber laser system for both cesium and rubidium manipulation. The architecture is based on frequency conversion of two lasers at 1560 nm and 1878 nm. By taking advantage of existing fiber components at these wavelengths, we demonstrate an all fiber laser system delivering 350 mW at 780 nm for rubidium and 210 mW at 852 nm for cesium. This result highlights the promising nature of such laser system especially for Cs manipulation for which no fiber laser system has been reported. It offers new perspectives for the development of atomic instruments dedicated to onboard applications and opens the way to a new generation of atom interferometers involving three atomic species $^{85}$Rb, $^{87}$Rb and $^{133}$Cs for which we propose an original laser architecture.

  7. Cesium diffusion in graphite

    Energy Technology Data Exchange (ETDEWEB)

    Evans, R.B. III; Davis, W. Jr.; Sutton, A.L. Jr.

    1980-05-01

    Experiments on diffusion of /sup 137/Cs in five types of graphite were performed. The document provides a completion of the report that was started and includes a presentation of all of the diffusion data, previously unpublished. Except for data on mass transfer of /sup 137/Cs in the Hawker-Siddeley graphite, analyses of experimental results were initiated but not completed. The mass transfer process of cesium in HS-1-1 graphite at 600 to 1000/sup 0/C in a helium atmosphere is essentially pure diffusion wherein values of (E/epsilon) and ..delta..E of the equation D/epsilon = (D/epsilon)/sub 0/ exp (-..delta..E/RT) are about 4 x 10/sup -2/ cm/sup 2//s and 30 kcal/mole, respectively.

  8. Control of AC133/CD133 and impact on human hematopoietic progenitor cells through nucleolin.

    Science.gov (United States)

    Bhatia, S; Reister, S; Mahotka, C; Meisel, R; Borkhardt, A; Grinstein, E

    2015-11-01

    AC133 is a prominent surface marker of CD34+ and CD34- hematopoietic stem/progenitor cell (HSPC) subsets. AC133+ HSPCs contain high progenitor cell activity and are capable of hematopoietic reconstitution. Furthermore, AC133 is used for prospective isolation of tumor-initiating cells in several hematological malignancies. Nucleolin is a multifunctional factor of growing and cancer cells, which is aberrantly active in certain hematological neoplasms, and serves as a candidate molecular target for cancer therapy. Nucleolin is involved in gene transcription and RNA metabolism and is prevalently expressed in HSPCs, as opposed to differentiated hematopoietic tissue. The present study dissects nucleolin-mediated activation of surface AC133 and its cognate gene CD133, via specific interaction of nucleolin with the tissue-dependent CD133 promoter P1, as a mechanism that crucially contributes to AC133 expression in CD34+ HSPCs. In mobilized peripheral blood (MPB)-derived HSPCs, nucleolin elevates colony-forming unit (CFU) frequencies and enriches granulocyte-macrophage CFUs. Furthermore, nucleolin amplifies long-term culture-initiating cells and also promotes long-term, cytokine-dependent maintenance of hematopoietic progenitor cells. Active β-catenin, active Akt and Bcl-2 levels in MPB-derived HSPCs are nucleolin-dependent, and effects of nucleolin on these cells partially rely on β-catenin activity. The study provides new insights into molecular network relevant to stem/progenitor cells in normal and malignant hematopoiesis. PMID:26183533

  9. Comparison of organic and inorganic ion exchange materials for removal of cesium and strontium from tank waste

    Energy Technology Data Exchange (ETDEWEB)

    Brown, G. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    This work is part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. Pacific Northwest National Laboratory (PNNL) staff are investigating novel ion exchangers for use in nuclear waste remediation (groundwater, high-level waste (HLW), and low-level waste (LLW)). Waste components targeted for remediation include cesium, strontium, and technetium.

  10. Chemoresistance of CD133+ cancer stem cells in laryngeal carcinoma

    Institute of Scientific and Technical Information of China (English)

    YANG Jing-pu; LIU Yan; ZHONG Wei; YU Dan; WEN Lian-ji; JIN Chun-shun

    2011-01-01

    Background Mounting evidence suggests that tumors are histologically heterogeneous and are maintained by a small population of tumor cells termed cancer stem cells. CD133 has been identified as a candidate marker of cancer stem cells in laryngeal carcinoma. This study aimed to analyze the chemoresistance of CD133+ cancer stem cells.Methods The response of Hep-2 cells to different chemotherapeutic agents was investigated and the expression of CD133 was studied. Fluorescence-activated cell sorting analysis was used to identify CD133,and the CD133+ subset of cells was separated and analyzed in colony formation assays,cell invasion assays,chemotherapy resistance studies,and analyzed for the expression of the drug resistance gene ABCG2.Results About 1%-2% of Hep-2 cells were CD133+ cells,and the CD133+ proportion was enriched by chemotherapy.CD133+ cancer stem cells exhibited higher potential for clonogenicity and invasion,and were more resistant to chemotherapy. This resistance was correlated with higher expression of ABCG2.Conclusions This study suggested that CD133+ cancer stem cells are more resistant to chemotherapy. The expression of ABCG2 could be partially responsible for this. Targeting this small population of CD133+ cancer stem cells could be a strategy to develop more effective treatments for laryngeal carcinoma.

  11. Cesium transport data for HTGR systems

    International Nuclear Information System (INIS)

    Cesium transport data on the release of cesium from HTGR fuel elements are reviewed and discussed. The data available through 1976 are treated. Equations, parameters, and associated variances describing the data are presented. The equations and parameters are in forms suitable for use in computer codes used to calculate the release of metallic fission products from HTGR fuel elements into the primary circuit. The data cover the following processes: (1) diffusion of cesium in fuel kernels and pyrocarbon, (2) sorption of cesium on fuel rod matrix material and on graphite, and (3) migration of cesium in graphite. The data are being confirmed and extended through work in progress

  12. Cesium Ion Exchange Using Tank 241-AN-104 Supernate

    International Nuclear Information System (INIS)

    The River Protection Project is to design and build a high level nuclear waste treatment facility. The waste treatment plant is to process millions of gallons of radioactive waste stored in tanks at the Hanford Site. The high level nuclear waste treatment process includes various unit operations, such as ultrafiltration, precipitation, evaporation, ion exchange, and vitrification. Ion exchange is identified as the optimal treatment method for removal of cesium-137 and Tc-99 from the waste. Extensive ion exchange testing was performed using small-scale columns with actual waste samples. The objectives of this study were to: demonstrate SuperLig 644 ion exchange performance and process steps for the removal of cesium from actual AN-104 tank waste; pretreat actual AN-104 tank waste to reduce the concentration of cesium-137 in the waste below LAW vitrification limit; produce and characterize cesium eluate solutions for use in eluate evaporation tests. The experiments consisted of batch contact and small-scale column tests. The batch contact tests measured sorption partition coefficients Kds. The Kds were used to predict the effective resin capacity. The small-scale column tests, which closely mimic plant conditions, generated loading and elution profile data used to determine whether removal targets and design requirements were met

  13. Decorporation of cesium-137; Decorporation du cesium-137

    Energy Technology Data Exchange (ETDEWEB)

    Le Fleche, Ph.; Destombe, C.; Grasseau, A.; Mathieu, J.; Chancerelle, Y.; Mestries, J.C. [GMR, Direction des Recherches, Etudes et Techniques, 94 - Arcueil (France)

    1997-12-31

    Cesium radio-isotopes, especially cesium-137 ({sup 137}Cs) are among the radionuclides of main importance produced by a fission reaction in reactor or a nuclear weapon explosion. In the environment, {sup 137}Cs is a major contaminant which can cause severe {beta}, {gamma}irradiations and contaminations. {sup 137}Cs is distributed widely and relatively uniformly throughout the body with the highest concentration in skeletal muscles. A treatment becomes difficult afterwards. The purposes of this report are Firstly to compare the Prussian blue verses cobalt and potassium ferrocyanide (D.I. blue) efficiency for the {sup 137}Cs decorporation and secondly to assess a chronological treatment with D.I. blue. (author)

  14. Extraction of radioactive cesium from tea leaves

    International Nuclear Information System (INIS)

    Radioactive contamination of foodstuffs attributed to the Fukushima Daiichi nuclear disaster has become a social problem. This study investigated the extraction of radioactive cesium from the contaminated leaves to the tea. The green tea was brewed twice reusing the same leaves to study the difference in extraction of cesium between the first and second brew. Moreover, the extraction of cesium was studied in correlation to brewing time. The concentration of radioactive cesium was determined with gamma spectrometry, and the concentration of caffeine was determined with absorption spectrometry. About 40% of cesium was extracted from leaves in the first brew, and about 80% was extracted in the second brew. The extraction of cesium increased over time, and it reached about 80% after 10 minutes brew. The ratio of radioactive cesium to caffeine decreased linearly over time. This study revealed that the extraction of cesium was higher for the second brew, and a rapid increase in extraction was seen as the tea was brewed for 6 minutes and more. Therefore, the first brew of green tea, which was brewed within 5 minutes, contained the least extraction of radioactive cesium from the contaminated leaves. (author)

  15. Strong expression of CD133 is associated with increased cholangiocarcinoma progression

    Institute of Scientific and Technical Information of China (English)

    Kawin Leelawat; Taweesak Thongtawee; Siriluck Narong; Somboon Subwongcharoen; Sa-ad Treepongkaruna

    2011-01-01

    AIM: To determine the role of CD133 in cholangiocar-cinoma progression.METHODS: CD133 protein expression was evaluated by immunohistochemistry in 34 cholangiocarcinoma specimens. In addition, proliferation, chemoresistance and invasive properties of CD133-enriched (CD133+) and CD133-depleted (CD133-) RMCCA1 cholangiocarci-noma cells were studied and compared.RESULTS: Strong CD133 expression was observed in 67.6% (23/34) of the cholangiocarcinoma specimens. Strong expression of CD133 was significantly associat-ed with nodal metastasis (P = 0.009) and positive sur-gical margin status (P = 0.011). In the in vitro study, both the CD133+ and CD133- cells had similar prolifera-tion abilities and resistance to chemotherapeutic drugs. However, the CD133+ cells had a higher invasive ability compared with CD133- cells.CONCLUSION: CD133+ cells play an important role in the invasiveness of cholangiocarcinoma. Targeting of the CD133+ cells may be a useful approach to improve treatment against cholangiocarcinoma.

  16. Activity of cesium-134 and cesium-137 in game and mushrooms in Poland

    International Nuclear Information System (INIS)

    The activity of cesium-134 and cesium-137 was measured in mushrooms and game in 1986-1991. The samples were collected all over Poland and most of the measurements were carried out for export purposes. The results indicate that the activity ratio of cesium-137 to cesium-134 in some samples is not comparable to that with fallout after the Chernobyl accident. The analysis of some samples of mushrooms from 1985 showed that the activity of cesium-137 was higher compared to any other foodstuff. The level of contamination varied greatly throughout Poland

  17. LNA aptamer based multi-modal, Fe3O4-saturated lactoferrin (Fe3O4-bLf) nanocarriers for triple positive (EpCAM, CD133, CD44) colon tumor targeting and NIR, MRI and CT imaging.

    Science.gov (United States)

    Roy, Kislay; Kanwar, Rupinder K; Kanwar, Jagat R

    2015-12-01

    This is the first ever attempt to combine anti-cancer therapeutic effects of emerging anticancer biodrug bovine lactoferrin (bLf), and multimodal imaging efficacy of Fe3O4 nanoparticles (NPs) together, as a saturated Fe3O4-bLf. For cancer stem cell specific uptake of nanocapsules/nanocarriers (NCs), Fe3O4-bLf was encapsulated in alginate enclosed chitosan coated calcium phosphate (AEC-CP) NCs targeted (Tar) with locked nucleic acid (LNA) modified aptamers against epithelial cell adhesion molecule (EpCAM) and nucleolin markers. The nanoformulation was fed orally to mice injected with triple positive (EpCAM, CD133, CD44) sorted colon cancer stem cells in the xenograft cancer stem cell mice model. The complete regression of tumor was observed in 70% of mice fed on non-targeted (NT) NCs, with 30% mice showing tumor recurrence after 30 days, while only 10% mice fed with Tar NCs showed tumor recurrence indicating a significantly higher survival rate. From tumor tissue analyses of 35 apoptotic markers, 55 angiogenesis markers, 40 cytokines, 15 stem cell markers and gene expression studies of important signaling molecules, it was revealed that the anti-cancer mechanism of Fe3O4-bLf was intervened through TRAIL, Fas, Fas-associated protein with death domain (FADD) mediated phosphorylation of p53, to induce activation of second mitochondria-derived activator of caspases (SMAC)/DIABLO (inhibiting survivin) and mitochondrial depolarization leading to release of cytochrome C. Induction of apoptosis was observed by inhibition of the Akt pathway and activation of cytokines released from monocytes/macrophages and dendritic cells (interleukin (IL) 27, keratinocyte chemoattractant (KC)). On the other hand, the recurrence of tumor in AEC-CP-Fe3O4-bLf NCs fed mice mainly occurred due to activation of alternative pathways such as mitogen-activated protein kinases (MAPK)/extracellular signal-regulated kinases (ERK) and Wnt signaling leading to an increase in expression of survivin

  18. Surface tension of liquid dilute solutions of lead-cesium and bismuth-cesium systems

    International Nuclear Information System (INIS)

    Method of the maximal pressure in a drop was used to measure the surface tension of 15 liquid dilute solutions of lead-cesium system in 0-0.214 at% concentration range and of 12 diluted solutions of bismuth-cesium system in 0-0.160 at.% cesium range from solidification temperature up to 500 dec C. It was found that cesium was characterized as surfactant in lead and bismuth melts. It was established that the temperature coefficient of surface tension changes sufficiently in maximally diluted solutions of alkali metals in bismuth and lead melts. Effect of sodium, potassium, rubidum and cesium on the value of surface tension of lead and bismuth was systematized. Growth of activity in sodium, potassium, rubidium and cesium series was noted

  19. Sorption of cesium on Latvian clays

    International Nuclear Information System (INIS)

    Cesium is like potassium - good solubility and mobile in a ground, easily assimilate in organism expressly brawn woof. It is a problem if pollutant is a radioactive 137Cs. We made experiments to sorption a 2M CsF solution on some Latvian clays which mainly contain hydro micas (cesium content after good elute of clays are in table). We establish, that clay treated with 25 % sulfuric acid adsorb cesium two times more that waste clay. Hereto unstuck elute Cs from clays. (author)

  20. An isotope dilution-precipitation process for removing radioactive cesium from wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Harold, E-mail: rogers22@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA, 94550 (United States); Bowers, John; Gates-Anderson, Dianne [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA, 94550 (United States)

    2012-12-15

    Highlights: Black-Right-Pointing-Pointer Developed an isotope dilution-precipitation treatment process for Cs-137 contaminated water. Black-Right-Pointing-Pointer Waste seeded with non-radioactive Cs-133 prior to precipitation with sodium tetraphenylborate. Black-Right-Pointing-Pointer Final Cs-137 concentrations below DOE discharge limit of 3.0 Multiplication-Sign 10{sup -6} {mu}Ci/mL can be achieved. Black-Right-Pointing-Pointer Synthetic wastewater, and industrial low level radioactive proof of principle studies completed. - Abstract: A novel isotope dilution-precipitation method has been developed to remove cesium-137 from radioactive wastewater. The process involves adding stable cesium chloride to wastewater in order to raise the total cesium concentration, which then allows both the stable and radioactive cesium ions to be precipitated together using sodium tetraphenylborate. This process was investigated utilizing laboratory solutions to determine stable cesium dose rates, mixing times, effects of pH, and filtration requirements. Once optimized, the process was then tested on synthetic wastewater and aqueous low-level waste. Experiments showed the reaction to be very quick and stable in the pH range tested, 2.5-11.5. The wastewater may need to be filtered using a 0.45-{mu}m filter, though ferric sulfate has been shown to promote coagulation and settling, thereby eliminating the necessity for filtration. This investigation showed that this isotope dilution-precipitation process can remove Cs-37 levels below the U.S. Department of Energy's (DOE) Derived Concentration Standard (DCS) of 3.0 Multiplication-Sign 10{sup -6} {mu}Ci/mL using a single dosage, potentially allowing the wastewater to be discharged directly to sanitary sewers.

  1. CD133/prominin-1-mediated autophagy and glucose uptake beneficial for hepatoma cell survival.

    Directory of Open Access Journals (Sweden)

    Haiyang Chen

    Full Text Available CD133/Prominin-1 is a pentaspan transmembrane protein that has been frequently used as a biomarker for cancer stem cells, although its biological function is unclear. The aim of our study was to explore the intrinsic functions of CD133 membrane protein in hepatoma cells during autophagy, apoptosis, tumorigenesis and cell survival through expression or downregulation of CD133. In this study, CD133 was found to be dynamically released from plasma membrane into cytoplasm in both of complete medium(CM and low glucose medium (LGM, and LGM promoted this translocation. Expression of CD133 enhanced autophagic activity in LGM, while silencing CD133 attenuated this activity in HCC LM3 and Huh-7 cells, suggesting that CD133 is associated with autophagy. Immunofluorescence and time-lapsed confocal techniques confirmed that CD133 was associated with autophagy marker, microtubule-associated protein light chain3 (LC3 and lysosome marker during the glucose starvation. We further found that Huh-7 cells with stable expression of shCD133 (Huh-7sh133 impaired the ability of cell proliferation and formation of xenograft tumors in the NOD/SCID mice. Although loss of CD133 did not affect the rates of glucose uptake in Huh-7con and Huh-7sh133 cells under the CM, Huh-7sh133 cells obviously died fast than Huh-7con cells in the LGM and decreased the rate of glucose uptake and ATP production. Furthermore, targeting CD133 by CD133mAb resulted in cell death in HepG2 cells, especially in the LGM, via inhibition of autophagic activity and increase of apoptosis. The results demonstrated that CD133 is involved in cell survival through regulation of autophagy and glucose uptake, which may be necessary for cancer stem cells to survive in tumor microenvironment.

  2. Cesium and strontium ion specific exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Yates, S.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with AlliedSignal, Inc. (Des Plaines, Illinois) to develop inorganic ion exchangers that are selective for strontium and cesium from alkaline high-level waste and groundwater streams.

  3. Sorption of Cesium on Latvia clays

    International Nuclear Information System (INIS)

    Cesium is like potassium - good solubility and mobile in a ground, easy assimilates in organism expressly brawn woof. It is a problem if pollutant is radioactive 137Cs. We made experiments to sorption a 2M CsF solution on some Latvian clays which mainly contain hydro micas. We establish that clay treated with 25% sulfuric acid absorb cesium two times more that waste clay. Hereto unstuck elute Cs from clays

  4. Non-invasive in vivo imaging of tumor-associated CD133/prominin.

    Directory of Open Access Journals (Sweden)

    Chizuko Tsurumi

    Full Text Available BACKGROUND: Cancer stem cells are thought to play a pivotal role in tumor maintenance, metastasis, tumor therapy resistance and relapse. Hence, the development of methods for non-invasive in vivo detection of cancer stem cells is of great importance. METHODOLOGY/PRINCIPAL FINDINGS: Here, we describe successful in vivo detection of CD133/prominin, a cancer stem cell surface marker for a variety of tumor entities. The CD133-specific monoclonal antibody AC133.1 was used for quantitative fluorescence-based optical imaging of mouse xenograft models based on isogenic pairs of CD133 positive and negative cell lines. A first set consisted of wild-type U251 glioblastoma cells, which do not express CD133, and lentivirally transduced CD133-overexpressing U251 cells. A second set made use of HCT116 colon carcinoma cells, which uniformly express CD133 at levels comparable to primary glioblastoma stem cells, and a CD133-negative HCT116 derivative. Not surprisingly, visualization and quantification of CD133 in overexpressing U251 xenografts was successful; more importantly, however, significant differences were also found in matched HCT116 xenograft pairs, despite the lower CD133 expression levels. The binding of i.v.-injected AC133.1 antibodies to CD133 positive, but not negative, tumor cells isolated from xenografts was confirmed by flow cytometry. CONCLUSIONS/SIGNIFICANCE: Taken together, our results show that non-invasive antibody-based in vivo imaging of tumor-associated CD133 is feasible and that CD133 antibody-based tumor targeting is efficient. This should facilitate developing clinically applicable cancer stem cell imaging methods and CD133 antibody-based therapeutics.

  5. Removal of cesium from wastewater: A cesium-specific ion exchange resin

    International Nuclear Information System (INIS)

    Researchers at the Savannah River Laboratory (SRL) have applied for a patent for an ion exchange resin that will remove cesium from water. Radioactive cesium-137 is a fission product of nuclear reactor operations. Cesium may enter the water of spent fuel holding basins through defects in fuel cladding. Control of cesium in these basins is desirable to keep personnel exposure to a minimum. Cesium is also present in the waste from reprocessing of defense nuclear reactor fuel. Research has been underway at SRL for over a decade to improve management of high-level reprocessing waste. The current technology separates the waste into soluble and insoluble components. Radioactive constituents are removed from the soluble component stream and combined with the insoluble components, which are then converted to a glass for long-term storage. Cesium is the most radioactive constituent of the soluble components stream. The SRL resin is a resorcinol-formaldehyde condensation polymer highly specific for cesium and is about 10 times more effective in removal of cesium than other ion exchange resins evaluated for use in processing defense nuclear waste. Tests have been run at SRL using both simulated and actual waste streams

  6. The biological difference between CD13+CD133+ and CD13¬CD133¬liver cancer cells and its clinical significance

    Directory of Open Access Journals (Sweden)

    Shi-long JIN

    2013-09-01

    Full Text Available Objective To compare the biological difference between CD13+CD133+ and CD13-CD133- hepatocellular carcinoma (HCC cells in HuH7 cell line and its clinical significance. Methods The status of proliferation, phase of the cell cycle, tumor formation in vivo, differentiation, and their chemoresistance to 5-FU and pirarubicin of CD13+CD133+ and CD13-CD133-HCC cells were studied to analyze the clinical implication of CD13+CD133+HCC cell subset. Results The proliferation rate of CD13+CD133+HCC cells was significantly higher than that of CD13-CD133-HCC cells. The cell-cycle phase study showed that 78.45% of the CD13+CD133+HCC cells were in the G0/G1 phase, 2.19% in G2/M phase, and 19.36% in S phase, while 62.18% CD13-CD133-HCC cells were in the G0/G1 phase, 11.88% in G2/M phase, and 25.95% in S phase. Limiting dilution analysis of HuH7 cells revealed that 1×103 CD13+CD133+ cells could form the tumor, while 1×105 CD13-CD133- cells did. CD13+CD133+ cells showed chemoresistance to 5-FU and pirarubicin, while other three subsets succumbed to the drugs. Conclusion CD13+CD133+ cancer cells in HuH7 showed the characteristics of cancer stem cells (CSCs, which might contribute to the relapse and metastasis of liver cancer, and they may be the main target for chemotherapy in human liver cancer.

  7. Preferential removal and immobilization of stable and radioactive cesium in contaminated fly ash with nanometallic Ca/CaO methanol suspension

    International Nuclear Information System (INIS)

    Graphical abstract: Schematic representation of possible mechanisms determining the Cs extraction and immobilization in fly ash during water, methanol or n-MCaS extraction. - Highlights: • nMCaS suspension for cesium extraction and immobilization in fly ash was developed. • Enhanced cesium immobilization was done by nanometallic Ca/CaO methanol suspension. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • nMCaS unique and a highly potential amendment for the remediation of Cs. - Abstract: In this work, the capability of nanometallic Ca/CaO methanol suspension in removing and/or immobilizing stable (133Cs) and radioactive cesium species (134Cs and 137Cs) in contaminated fly ash was investigated. After a first methanol and second water washing yielded only 45% of 133Cs removal. While, after a first methanol washing, the second solvent with nanometallic Ca/CaO methanol suspension yielded simultaneous enhanced removal and immobilization about 99% of 133Cs. SEM-EDS analysis revealed that the mass percent of detectable 133Cs on the fly ash surface recorded a 100% decrease. When real radioactive cesium contaminated fly ash (containing an initial 14,040 Bq kg−1134Cs and 137Cs cumulated concentration) obtained from burning wastes from Fukushima were reduced to 3583 Bq kg−1 after treatment with nanometallic Ca/CaO methanol suspension. Elution test conducted on the treated fly ash gave 100 Bq L−1 total 134Cs and 137Cs concentrations in eluted solution. Furthermore, both ash content and eluted solution concentrations of 134Cs and 137Cs were much lower than the Japanese Ministry of the Environment regulatory limit of 8000 Bq kg−1 and 150 Bq L−1 respectively. The results of this study suggest that the nanometallic Ca/CaO methanol suspension is a highly potential amendment for the remediation of radioactive cesium-contaminated fly ash

  8. Radioactive cesium in Finnish mushrooms

    International Nuclear Information System (INIS)

    Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137Cs detected in the mushrooms mainly originates from the 137Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137Cs concentrations of mushrooms, the 137Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus cornucopioides often

  9. Plasma etching of cesium iodide

    International Nuclear Information System (INIS)

    Thick films of cesium iodide (CsI) are often used to convert x-ray images into visible light. Spreading of the visible light within CsI, however, reduces the resolution of the resulting image. Anisotropic etching of the CsI film into an array of micropixels can improve the image resolution by confining light within each pixel. The etching process uses a high-density inductively coupled plasma to pattern CsI samples held by a heated, rf-biased chuck. Fluorine-containing gases such as CF4 are found to enhance the etch rate by an order of magnitude compared to Ar+ sputtering alone. Without inert-gas ion bombardment, however, the CF4 etch becomes self-limited within a few microns of depth due to the blanket deposition of a passivation layer. Using CF4+Ar continuously removes this layer from the lateral surfaces, but the formation of a thick passivation layer on the unbombarded sidewalls of etched features is observed by scanning electron microscopy. At a substrate temperature of 220 deg. C, the minimum ion-bombardment energy for etching is Ei∼50 eV, and the rate depends on Ei1/2 above 65 eV. In dilute mixtures of CF4 and Ar, the etch rate is proportional to the gas-phase density of atomic fluorine. Above 50% CF4, however, the rate decreases, indicating the onset of net surface polymer deposition. These observations suggest that anisotropy is obtained through the ion-enhanced inhibitor etching mechanism. Etching exhibits an Arrhenius-type behavior in which the etch rate increases from ∼40 nm/min at 40 deg. C to 380 nm/min at 330 deg. C. The temperature dependence corresponds to an activation energy of 0.13±0.01 eV. This activation energy is consistent with the electronic sputtering mechanism for alkali halides

  10. Experiments and simulations for the dynamics of cesium in negative hydrogen ion sources for ITER N-NBI

    Energy Technology Data Exchange (ETDEWEB)

    Gutser, Raphael

    2010-07-21

    The injection of fast neutral particles (NBI) into a fusion plasma is an important method for plasma heating and current drive. A source for negative deuterium ions delivering an 1 MeV beam that is accelerated to a specific energy and neutralized by a gas target is required for the ITER-NBI. Cesium seeding is required to extract high negative ion current densities from these sources. The optimization of the cesium homogeneity and control are major objectives to achieve the source requirements imposed by ITER. Within the scope of this thesis, the Monte Carlo based numerical transport simulation CsFlow3D was developed, which is the first computer model that is capable of simulating the flux and the accumulation of cesium on the surfaces of negative-ion sources. Basic studies that support the code development were performed at a dedicated experiment at the University of Augsburg. Input parameters of the ad- and desorption of cesium at ion source relevant conditions were taken from systematic measurements with a quartz micro balance, while the injection rate of the cesium oven at the ion source was determined by surface ionization detection. This experimental setup was used for further investigations of the work function of cesium-coated samples during plasma exposure. (orig.)

  11. Experiments and simulations for the dynamics of cesium in negative hydrogen ion sources for ITER N-NBI

    International Nuclear Information System (INIS)

    The injection of fast neutral particles (NBI) into a fusion plasma is an important method for plasma heating and current drive. A source for negative deuterium ions delivering an 1 MeV beam that is accelerated to a specific energy and neutralized by a gas target is required for the ITER-NBI. Cesium seeding is required to extract high negative ion current densities from these sources. The optimization of the cesium homogeneity and control are major objectives to achieve the source requirements imposed by ITER. Within the scope of this thesis, the Monte Carlo based numerical transport simulation CsFlow3D was developed, which is the first computer model that is capable of simulating the flux and the accumulation of cesium on the surfaces of negative-ion sources. Basic studies that support the code development were performed at a dedicated experiment at the University of Augsburg. Input parameters of the ad- and desorption of cesium at ion source relevant conditions were taken from systematic measurements with a quartz micro balance, while the injection rate of the cesium oven at the ion source was determined by surface ionization detection. This experimental setup was used for further investigations of the work function of cesium-coated samples during plasma exposure. (orig.)

  12. Chemoresistance of CD133{sup +} colon cancer may be related with increased survivin expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Cho, Mee-Yon, E-mail: meeyon@yonsei.ac.kr [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Institute of Genomic Cohort, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of)

    2015-07-31

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133{sup +} colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133{sup −} cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133{sup +} and siRNA-induced CD133{sup −} cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133{sup +} cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133{sup +} cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133{sup +} cells at 96 h after siRNA transfection. From this study, we conclude that CD133{sup +} cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133{sup +} colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133{sup +} cells and siRNA-induced CD133{sup −} cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133{sup +} colon cancer cells.

  13. Characterization of CD133+ hepatocellular carcinoma cells as cancer stem/progenitor cells

    International Nuclear Information System (INIS)

    The CD133 antigen, identified as a hematopoietic stem cell marker, appears in various human embryonic epithelia including the neural tube, gut, and kidney. We herein investigated whether CD133+ cells isolated from human hepatocellular carcinoma cell lines possess cancer stem/progenitor cell-like properties. Among the three cell lines studied, the CD133 antigen was found to be expressed only on the surface of Huh-7 cells. CD133+ cells from Huh-7 performed a higher in vitro proliferative potential and lower mRNA expressions of mature hepatocyte markers, glutamine synthetase and cytochrome P450 3A4, than CD133- population of Huh-7 cells. When either CD133+ or CD133- cells were subcutaneously injected into SCID mice, CD133+ cells formed tumors, whereas CD133- cells induced either a very small number of tumors or none at all. Taken together, the identification of CD133+ cells could thus be a potentially powerful tool to investigate the tumorigenic process in the hepatoma system and to also develop effective therapies targeted against hepatocellular carcinoma

  14. Perlite for permanent confinement of cesium

    Science.gov (United States)

    Balencie, J.; Burger, D.; Rehspringer, J.-L.; Estournès, C.; Vilminot, S.; Richard-Plouet, M.; Boos, A.

    2006-06-01

    We present the potential use of expanded perlite, a metastable amorphous hydrated aluminium silicate, as a permanent medium for the long-term confinement of cesium. The method requires simply a loading by mixing an aqueous cesium nitrate solution and expanded perlite at 300 K followed by densification by sintering. The formation of pollucite, CsAlSi2O6, a naturally occurring mineral phase, upon careful heat treatment is demonstrated by X-ray diffraction. Leaching tests on the resulting glass-ceramics reveal a very low Cs departure of 0.5 mg m-2 d-1.

  15. Crystalline silicotitanates for cesium/strontium removal

    Energy Technology Data Exchange (ETDEWEB)

    Brown, N.; Miller, J.; Sherman, J.

    1996-10-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST) has been developed that exhibits very high selectivity for cesium and strontium in the highly alkaline radioactive wastes at the Hanford Site and other DOE sites. Tests have also shown that CSTs have high selectivity for cesium in acidic and neutral solutions. The ESP is supporting an effort at Sandia National Laboratories and Texas A & M University to further develop and characterize the important chemical and physical properties that will determine the applicability of CST to radioactive waste treatment at Hanford and other DOE facilities.

  16. Microbial accumulation of uranium, radium, and cesium

    International Nuclear Information System (INIS)

    Diverse microbial species varied considerably in their ability to accumulate uranium, cesium, and radium. Mechanistic differences in uranium uptake by Saccharomyces cerevisiae and Pseudomonas aeruginosa were indicated. S. serevisiae exhibited a slow (hours) surface accumulation of uranium which was subject to environmental factors, while P. aeruginosa accumulated uranium rapidly (minutes) as dense intracellular deposits and did not appear to be affected by environmental parameters. Metabolism was not required for uranium uptake by either organism. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several species tested

  17. Longitudinal Wobbling in $^{133}$La

    CERN Document Server

    Biswas, S; Garg, U; Bhat, G H; Frauendorf, S; Li, W; Sheikh, J A; Sethi, J; Saha, S; Singh, Purnima; Choudhury, D; Matta, J T; Ayangeakaa, A D; Dar, W >; Singh, V; Sihotra, S

    2016-01-01

    Excited states of $^{133}$La have been investigated to search for the wobbling excitation mode in the low-spin regime. Wobbling bands with $n_\\omega$ = 0 and 1 are identified along with the interconnecting $\\Delta I$ = 1, $E2$ transitions, which are regarded as fingerprints of the wobbling motion. An increase in wobbling frequency %of the $n_\\omega$ = 1 band with spin implies longitudinal wobbling for $^{133}$La, in contrast with the case of transverse wobbling observed in $^{135}$Pr. This is the first observation of a longitudinal wobbling band in nuclei. The experimental observations are accounted for by calculations using the quasiparticle triaxial rotor with harmonic frozen approximation and the triaxial projected shell model approaches, which attribute the appearance of longitudinal wobbling to the early alignment of an h$_{11/2}$ neutron pair.

  18. 7 CFR 29.133 - Identification number.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Identification number. 29.133 Section 29.133... REGULATIONS TOBACCO INSPECTION Regulations Miscellaneous § 29.133 Identification number. The Director may require the use of official identification numbers in connection with tobacco certificated or...

  19. 14 CFR 65.133 - Seal.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Seal. 65.133 Section 65.133 Aeronautics and...: AIRMEN OTHER THAN FLIGHT CREWMEMBERS Parachute Riggers § 65.133 Seal. Each certificated parachute rigger must have a seal with an identifying mark prescribed by the Administrator, and a seal press....

  20. 33 CFR 117.133 - Ouachita River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Ouachita River. 117.133 Section 117.133 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Arkansas § 117.133 Ouachita River. The draw of the...

  1. 22 CFR 133.670 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... Acquisition Regulation for procurement contracts (48 CFR part 9, subpart 9.4) and the common rule, Government... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Suspension. 133.670 Section 133.670 Foreign... ASSISTANCE) Definitions § 133.670 Suspension. Suspension means an action taken by a Federal agency...

  2. 22 CFR 133.655 - Individual.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Individual. 133.655 Section 133.655 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.655 Individual. Individual means a natural person....

  3. 47 CFR 24.133 - Emission limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Emission limits. 24.133 Section 24.133... SERVICES Narrowband PCS § 24.133 Emission limits. (a) The power of any emission shall be attenuated below... the lesser attenuation. (b) The measurements of emission power can be expressed in peak or...

  4. 14 CFR 125.133 - Fuel valves.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Fuel valves. 125.133 Section 125.133....133 Fuel valves. Each fuel valve must— (a) Comply with § 125.155; (b) Have positive stops or suitable... operation or from accelerated flight conditions are not transmitted to the lines connected to the valve....

  5. 10 CFR 71.133 - Corrective action.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Corrective action. 71.133 Section 71.133 Energy NUCLEAR....133 Corrective action. The licensee, certificate holder, and applicant for a CoC shall establish... determined and corrective action taken to preclude repetition. The identification of the...

  6. 46 CFR 133.105 - Survival craft.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Survival craft. 133.105 Section 133.105 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS LIFESAVING SYSTEMS Requirements for All OSVs § 133.105 Survival craft. (a) Each survival craft must be approved and equipped...

  7. 7 CFR 930.133 - Compensation rate.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Compensation rate. 930.133 Section 930.133 Agriculture... Regulations § 930.133 Compensation rate. A compensation rate of $250 per meeting shall be paid to the public member and to the alternate public member when attending Board meetings. Such compensation is a...

  8. 49 CFR 383.133 - Testing methods.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Testing methods. 383.133 Section 383.133... STANDARDS; REQUIREMENTS AND PENALTIES Tests § 383.133 Testing methods. (a) All tests shall be constructed in... must be at least as stringent as the Federal standards. (c) States shall determine specific methods...

  9. Removal of Radioactive Cesium Using Prussian Blue Magnetic Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sung-Chan Jang

    2014-11-01

    Full Text Available Radioactive cesium (137Cs has inevitably become a human concern due to exposure from nuclear power plants and nuclear accident releases. Many efforts have been focused on removing cesium and the remediation of the contaminated environment. In this study, we elucidated the ability of Prussian blue-coated magnetic nanoparticles to eliminate cesium from radioactive contaminated waste. Thus, the obtained Prussian blue-coated magnetic nanoparticles were then characterized and examined for their physical and radioactive cesium adsorption properties. This Prussian blue-coated magnetic nanoparticle-based cesium magnetic sorbent can offer great potential for use in in situ remediation.

  10. Cesium vapor thermionic converter anomalies arising from negative ion emission

    Science.gov (United States)

    Rasor, Ned S.

    2016-08-01

    Compelling experimental evidence is given that a longstanding limit encountered on cesium vapor thermionic energy converter performance improvement and other anomalies arise from thermionic emission of cesium negative ions. It is shown that the energy that characterizes thermionic emission of cesium negative ions is 1.38 eV and, understandably, is not the electron affinity 0.47 eV determined for the photodetachment threshold of the cesium negative ion. The experimental evidence includes measurements of collector work functions and volt-ampere characteristics in quasi-vacuum cesium vapor thermionic diodes, along with reinterpretation of the classic Taylor-Langmuir S-curve data on electron emission in cesium vapor. The quantitative effects of negative ion emission on performance in the ignited, unignited, and quasi-vacuum modes of cesium vapor thermionic converter operation are estimated.

  11. Anomalous wetting of helium on cesium

    International Nuclear Information System (INIS)

    The authors report studies of the anomalous wetting of a cesium substrate by a liquid helium film by means of the technique of third sound. A hysteretic pre-wetting transition is observed as a function of the amount of helium in the experimental cell. 10 refs., 2 figs

  12. Cesium and Strontium Separation Technologies Literature Review

    Energy Technology Data Exchange (ETDEWEB)

    T. A. Todd; T. A. Todd; J. D. Law; R. S. Herbst

    2004-03-01

    Integral to the Advanced Fuel Cycle Initiative (AFCI) Program’s proposed closed nuclear fuel cycle, the fission products cesium and strontium in the dissolved spent nuclear fuel stream are to be separated and managed separately. A comprehensive literature survey is presented to identify cesium and strontium separation technologies that have the highest potential and to focus research and development efforts on these technologies. Removal of these high-heat-emitting fission products reduces the radiation fields in subsequent fuel cycle reprocessing streams and provides a significant short-term (100 yr) heat source reduction in the repository. This, along with separation of actinides, may provide a substantial future improvement in the amount of fuel that could be stored in a geologic repository. The survey and review of the candidate cesium and strontium separation technologies are presented herein. Because the AFCI program intends to manage cesium and strontium together, technologies that simultaneously separate both elements are of the greatest interest, relative to technologies that separate only one of the two elements.

  13. miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages.

    Science.gov (United States)

    Peng, Xiao-Ping; Huang, Lei; Liu, Zhi-Hong

    2016-08-01

    lipid metabolism is the major causes of atherosclerosis. There is increasing evidence that miR-133a plays an important role in atherosclerosis. However, the regulatory mechanism of miR-133a in macrophages is still unclear. Several lines of evidence indicate that loss of TR4 leads to reduce lipid accumulation in liver and adipose tissues, etc, and lesional macrophages-derived TR4 can greatly increase the foam cell formation through increasing the CD36-mediated the uptake of ox-LDL. Interestingly, computational analysis suggests that TR4 may be a target gene of miR-133a. Here, we examined whether miR-133a regulates TR4 expression in ox-LDL-induced mouse RAW 264.7 macrophages, thereby affecting lipid accumulation. Using ox-LDL-treatment RAW 264.7 macrophages transfected with miR-133a mimics or inhibitors, we have showed that miR-133a can directly regulate the expression of TR4 in RAW 264.7 cells, thereby attenuates CD36-medide lipid accumulation. Furthermore, our studies suggest an additional explanation for the regulatory mechanism of miR-133a regulation to its functional target, TR4 in RAW 264.7 macrophages. Thus, our findings suggest that miR-133a may regulate lipid accumulation in ox-LDL-stimulated RAW 264.7 macrophages via TR4-CD36 pathway.

  14. Rac1+ cells distributed in accordance with CD 133+ cells in glioblastomas and the elevated invasiveness of CD 133+ glioma cells with higher Rac1 activity

    Institute of Scientific and Technical Information of China (English)

    ZHANG Bin; SUN Jian; YU Sheng-ping; CHEN Cong; LIU Bin; LIU Zhi-feng; REN Bing-cheng; MING Hao-lang; YANG Xue-jun

    2012-01-01

    the basement membrane of the vessels and myelinated nerve fibers.Rac1 expression was high and diffused in the central parts of the GBMs,and the Rac1+ cells were distributed basically in accordance with CD133+ cells both in the central and peripheral parts of GBMs.In double-labeling immunofluorescence,Rac1 was expressed in (83.14±4.23)% of CD133+ cells,and CD133 and Rac1 co-expressed cells were located around the vessels in GBMs.Significantly higher amounts of Rac1-GTP were expressed in the CD133+ cells (0.378+0.007),compared to CD133-cells (0.195±0.004) (t=27.81; P <0.05).CD133+ cells had stronger ability to migrate (74.34±2.40 vs.38.72±2.60,t=42.71,P <0.005) and invade (52.00±2.28 vs.31.26±1.82,t=30.76,P <0.005),compared to their counterpart CD133-cells in transwell cell migration/invasion assay.Conclusions These data suggest that CD133+ GBM cells highly express Rac1 and have greater potential to migrate and invade through activated Rac1-GTP.The accordance of distribution between Rac1+ cells and CD133+ cells in GBMs implies that Rac1 might be an inhibited target to prevent invasion and migration and to avoid malignant glioma recurrence.

  15. Strategic Design and Optimization of Inorganic Sorbents For Cesium, Strontium and Actinides

    Energy Technology Data Exchange (ETDEWEB)

    Hobbs, D.; Nyman, M.; Clearfield, A.; Maginn, E.

    2006-06-01

    The basic science goal in this project identifies structure/affinity relationships for selected radionuclides and existing sorbents. The task will apply this knowledge to the design and synthesis of new sorbents that will exhibit increased affinity for cesium, strontium and actinide separations. The target problem focuses on the treatment of high-level nuclear wastes. The general approach can likewise be applied to nonradioactive separations.

  16. Dicty_cDB: SLA133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA133 (Link to dictyBase) - - - Contig-U16455-1 SLA133Z (Link... to Original site) - - SLA133Z 728 - - - - Show SLA133 Library SL (Link to library) Clone ID SLA133 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-B/SLA133Q.Seq.d/ Representative seq. ID SLA13...3Z (Link to Original site) Representative DNA sequence >SLA133 (SLA133Q) /CSM/SL/SLA1-B/SLA133Q.Seq.d/ XXXXX...AAATAATATTTCTTAATAAATAGC ATTTTATAATAATTTTAA sequence update 1998. 4.11 Translated Amino Acid sequence ---rph

  17. Lanthanide doped strontium-barium cesium halide scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Bizarri, Gregory; Bourret-Courchesne, Edith; Derenzo, Stephen E.; Borade, Ramesh B.; Gundiah, Gautam; Yan, Zewu; Hanrahan, Stephen M.; Chaudhry, Anurag; Canning, Andrew

    2015-06-09

    The present invention provides for a composition comprising an inorganic scintillator comprising an optionally lanthanide-doped strontium-barium, optionally cesium, halide, useful for detecting nuclear material.

  18. Surface interactions of cesium and boric acid with stainless steel

    International Nuclear Information System (INIS)

    In this report, the effects of cesium hydroxide and boric acid on oxidized stainless steel surfaces at high temperatures and near one atmosphere of pressure are investigated. This is the first experimental investigation of this chemical system. The experimental investigations were performed using a mass spectrometer and a mass electrobalance. Surfaces from the different experiments were examined using a scanning electron microscope to identify the presence of deposited species, and electron spectroscopy for chemical analysis to identify the species deposited on the surface. A better understanding of the equilibrium thermodynamics, the kinetics of the steam-accelerated volatilizations, and the release kinetics are gained by these experiments. The release rate is characterized by bulk vaporization/gas-phase mass transfer data. The analysis couples vaporization, deposition, and desorption of the compounds formed by cesium hydroxide and boric acid under conditions similar to what is expected during certain nuclear reactor accidents. This study shows that cesium deposits on an oxidized stainless steel surface at temperatures between 1000 and 1200 Kelvin. Cesium also deposits on stainless steel surfaces coated with boric oxide in the same temperature ranges. The mechanism for cesium deposition onto the oxide layer was found to involve the chemical reaction between cesium and chromate. Some revaporization in the cesium hydroxide-boric acid system was observed. It has been found that under the conditions given, boric acid will react with cesium hydroxide to form cesium metaborate. A model is proposed for this chemical reaction

  19. Distribution and retention of cesium in Swedish boreal forest ecosystems

    International Nuclear Information System (INIS)

    The retention and distribution of cesium in forest environments are being studied at three locations in Sweden. The main part of the cesium found in the soil was recovered in horizons rich in organic matter. The cesium was retained in the soil organic matter in a more or less extractable form. As different soil types have a different distribution pattern of organic matter the distribution of cesium will depend on the forest soil type. The clay content in Swedish forest soils is in general low which will mitigate the retention of cesium in the soil mineral horizons. The cesium present in the tree was considered to be an effect of assimilation by the tissues in the canopy as well as by the roots. The redistribution of cesium within the trees was extensive which was considered to be an effect of a high mobility of cesium in the close system of a forest environment. The cesium will remain in the forest environment for a considerable time but can be removed by forest practice, by leaching out of the soil profile or by the radioactive decay. (au)

  20. CXCL3 contributes to CD133+ CSCs maintenance and forms a positive feedback regulation loop with CD133 in HCC via Erk1/2 phosphorylation

    Science.gov (United States)

    Zhang, Lin; Zhang, Lixing; Li, Hong; Ge, Chao; Zhao, Fangyu; Tian, Hua; Chen, Taoyang; Jiang, Guoping; Xie, Haiyang; Cui, Ying; Yao, Ming; Li, Jinjun

    2016-01-01

    Although the chemotactic cytokine CXCL3 is thought to play an important role in tumor initiation and invasion, little is known about its function in hepatocellular carcinoma (HCC). In our previous study, we found that Ikaros inhibited CD133 expression via the MAPK pathway in HCC. Here, we showed that Ikaros may indirectly down-regulate CXCL3 expression in HCC cells, which leads to better outcomes in patients with CD133+ cancer stem cell (CSC) populations. CD133 overexpression induced CXCL3 expression, and silencing of CD133 down-regulated CXCL3 in HCC cells. Knockdown of CXCL3 inhibited CD133+ HCC CSCs’ self-renewal and tumorigenesis. The serum CXCL3 level was higher in HCC patients’ samples than that in healthy individual. HCC patients with higher CXCL3 expression displayed a poor prognosis, and a high level of CXCL3 was significantly associated with vascular invasion and tumor capsule formation. Exogenous CXCL3 induced Erk1/2 and ETS1 phosphorylation and promoted CD133 expression, indicating a positive feedback loop between CXCL3 and CD133 gene expression in HCC cells via Erk1/2 activation. Together, our findings indicated that CXCL3 might be a potent therapeutic target for HCC. PMID:27255419

  1. Sorption of cesium in intact rock

    Energy Technology Data Exchange (ETDEWEB)

    Puukko, E. [Univ. of Helsinki, Dept. of Chemistry (Finland)

    2014-04-15

    The mass distribution coefficient K{sub d} is used in performance assessment (PA) to describe sorption of a radionuclide on rock. The R{sub d} is determined using crushed rock which causes uncertainty in converting the R{sub d} values to K{sub d} values for intact rock. This work describes a method to determine the equilibrium of sorption on intact rock. The rock types of the planned Olkiluoto waste disposal site were T-series mica gneiss (T-MGN), T-series tonalite granodiorite granite gneiss (T-TGG), P-series tonalite granodiorite granite gneiss (P-TGG) and pegmatitic granite (PGR). These rocks contain different amount of biotite which is the main sorbing mineral. The sorption of cesium on intact rock slices was studied by applying an electrical field to speed up migration of cesium into the rock. Cesium is in the solution as a noncomplex cation Cs{sup +} and it is sorbed by ion exchange. The tracer used in the experiments was {sup 134}Cs. The experimental sorption on the intact rock is compared with values calculated using the in house cation exchange sorption model (HYRL model) in PHREEQC program. The observed sorption on T-MGN and T-TGG rocks was close to the calculated values. Two PGR samples were from a depth of 70 m and three samples were from a depth of 150 m. Cesium sorbed more than predicted on the two 70 m PGR samples. The sorption of Cs on the three 150 m PGR samples was small which was consistent with the calculations. The pegmatitic granite PGR has the smallest content of biotite of the four rock types. In the case of P-TGG rock the observed values of sorption were only half of the calculated values. Two kind of slices were cut from P-TGG drill core. The slices were against and to the direction of the foliation of the biotite rims. The sorption of cesium on P-TGG rock was same in both cases. The results indicated that there was no effect of the directions of the electric field and the foliation of biotite in the P-TGG rock. (orig.)

  2. Expression of CD133 in acute leukemia.

    Science.gov (United States)

    Tolba, Fetnat M; Foda, Mona E; Kamal, Howyda M; Elshabrawy, Deena A

    2013-06-01

    There have been conflicting results regarding a correlation between CD133 expression and disease outcome. To assess CD133 expression in patients with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) and to evaluate its correlation with the different clinical and laboratory data as well as its relation to disease outcome, the present study included 60 newly diagnosed acute leukemic patients; 30 ALL patients with a male to female ratio of 1.5:1 and their ages ranged from 9 months to 48 years, and 30 AML patients with a male to female ratio of 1:1 and their ages ranged from 17 to 66 years. Flow cytometric assessment of CD133 expression was performed on blast cells. In ALL, no correlations were elicited between CD133 expression and some monoclonal antibodies, but in AML group, there was a significant positive correlation between CD133 and HLA-DR, CD3, CD7 and TDT, CD13 and CD34. In ALL group, patients with negative CD133 expression achieved complete remission more than patients with positive CD133 expression. In AML group, there was no statistically significant association found between positive CD133 expression and treatment outcome. The Kaplan-Meier curve illustrated a high significant negative correlation between CD133 expression and the overall survival of the AML patients. CD133 expression is an independent prognostic factor in acute leukemia, especially ALL patients and its expression could characterize a group of acute leukemic patients with higher resistance to standard chemotherapy and relapse. CD133 expression was highly associated with poor prognosis in acute leukemic patients. PMID:23532815

  3. miR-133a Enhances the Protective Capacity of Cardiac Progenitors Cells after Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Alberto Izarra

    2014-12-01

    Full Text Available miR-133a and miR-1 are known as muscle-specific microRNAs that are involved in cardiac development and pathophysiology. We have shown that both miR-1 and miR-133a are early and progressively upregulated during in vitro cardiac differentiation of adult cardiac progenitor cells (CPCs, but only miR-133a expression was enhanced under in vitro oxidative stress. miR-1 was demonstrated to favor differentiation of CPCs, whereas miR-133a overexpression protected CPCs against cell death, targeting, among others, the proapoptotic genes Bim and Bmf. miR-133a-CPCs clearly improved cardiac function in a rat myocardial infarction model by reducing fibrosis and hypertrophy and increasing vascularization and cardiomyocyte proliferation. The beneficial effects of miR-133a-CPCs seem to correlate with the upregulated expression of several relevant paracrine factors and the plausible cooperative secretion of miR-133a via exosomal transport. Finally, an in vitro heart muscle model confirmed the antiapoptotic effects of miR-133a-CPCs, favoring the structuration and contractile functionality of the artificial tissue.

  4. 3-Bromopyruvate inhibits cell proliferation and induces apoptosis in CD133+ population in human glioma.

    Science.gov (United States)

    Xu, Dong-Qiang; Tan, Xiao-Yu; Zhang, Bao-Wei; Wu, Tao; Liu, Ping; Sun, Shao-Jun; Cao, Yin-Guang

    2016-03-01

    The study was aimed to investigate the role of 3-bromopyruvate in inhibition of CD133+ U87 human glioma cell population growth. The results demonstrated that 3-bromopyruvate inhibited the viability of both CD133+ and parental cells derived from U87 human glioma cell line. However, the 3-bromopyruvate-induced inhibition in viability was more prominent in CD133+ cells at 10 μM concentration after 48 h. Treatment of CD133+ cells with 3-bromopyruvate caused reduction in cell population and cell size, membrane bubbling, and degradation of cell membranes. Hoechst 33258 staining showed condensation of chromatin material and fragmentation of DNA in treated CD133+ cells after 48 h. 3-Bromopyruvate inhibited the migration rate of CD133+ cells significantly compared to the parental cells. Flow cytometry revealed that exposure of CD133+ cells to 3-bromopyruvate increased the cell population in S phase from 24.5 to 37.9 % with increase in time from 12 to 48 h. In addition, 3-bromopyruvate significantly enhanced the expression of Bax and cleaved caspase 3 in CD133+ cells compared to the parental cells. Therefore, 3-bromopyruvate is a potent chemotherapeutic agent for the treatment of glioma by targeting stem cells selectively. PMID:26453119

  5. DEVELOPMENT OF PROTOTYPE TITANATE ION EXCHANGE LOADED MEMBRANES FOR STRONTIUM, CESIUM AND ACTINIDE DECONTAMINATION FROM AQUEOUS MEDIA

    Energy Technology Data Exchange (ETDEWEB)

    Oji, L; Keisha Martin, K; David Hobbs, D

    2008-05-30

    We have successfully incorporated high surface area particles of titanate ion exchange materials (monosodium titanate and crystalline silicotitanate) with acceptable particle size distribution into porous and inert support membrane fibrils consisting of polytetrafluoroethylene (Teflon{reg_sign}), polyethylene and cellulose materials. The resulting membrane sheets, under laboratory conditions, were used to evaluate the removal of surrogate radioactive materials for cesium-137 and strontium-90 from high caustic nuclear waste simulants. These membrane supports met the nominal requirement for nonchemical interaction with the embedded ion exchange materials and were porous enough to allow sufficient liquid flow. Some of this 47-mm size stamped out prototype titanium impregnated ion exchange membrane discs was found to remove more than 96% of dissolved cesium-133 and strontium-88 from a caustic nuclear waste salt simulants. Since in traditional ion exchange based column technology monosodium titanate (MST) is known to have great affinity for the sorbing of other actinides like plutonium, neptunium and even uranium, we expect that the MST-based membranes developed here, although not directly evaluated for uptake of these three actinides because of costs associated with working with actinides which do not have 'true' experimental surrogates, would also show significant affinity for these actinides in aqueous media. It was also observed that crystalline silicotitanate impregnated polytetrafluoroethylene or polyethylene membranes became less selective and sorbed both cesium and strontium from the caustic aqueous salt simulants.

  6. 21 CFR 133.118 - Colby cheese.

    Science.gov (United States)

    2010-04-01

    ...: (1) The word “milk” means cow's milk, which may be adjusted by separating part of the fat therefrom... Products § 133.118 Colby cheese. (a) Colby cheese is the food prepared from milk and other ingredients... the methods prescribed in § 133.5 (a), (b), and (d). If the milk used is not pasteurized, the...

  7. 22 CFR 133.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 133.650 Section 133.650 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  8. 4 CFR 28.133 - Stay proceedings.

    Science.gov (United States)

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false Stay proceedings. 28.133 Section 28.133 Accounts... request shall be in writing and shall specify the nature of the action to be stayed and the basis for the... alleged prohibited personnel practice as specified by the Board's General Counsel; (2) Assess the...

  9. 21 CFR 133.141 - Gorgonzola cheese.

    Science.gov (United States)

    2010-04-01

    ... storage, the surface of the cheese may be scraped to remove surface growth of undesirable microorganisms... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Gorgonzola cheese. 133.141 Section 133.141 Food... HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese...

  10. 21 CFR 133.106 - Blue cheese.

    Science.gov (United States)

    2010-04-01

    ... undesirable microorganisms. Antimycotics may be applied to the surface of the whole cheese. One or more of the... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Blue cheese. 133.106 Section 133.106 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and...

  11. 12 CFR 13.3 - Business conduct.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Business conduct. 13.3 Section 13.3 Banks and....3 Business conduct. A bank that is a government securities broker or dealer shall observe high standards of commercial honor and just and equitable principles of trade in the conduct of its business as...

  12. 38 CFR 13.3 - State legislation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false State legislation. 13.3... ADMINISTRATION, FIDUCIARY ACTIVITIES § 13.3 State legislation. Field facility Directors are authorized to... local and State bar associations, to the end that deficiencies of the State laws relating to...

  13. 40 CFR 133.102 - Secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Secondary treatment. 133.102 Section... TREATMENT REGULATION § 133.102 Secondary treatment. The following paragraphs describe the minimum level of effluent quality attainable by secondary treatment in terms of the parameters—BOD5, SS and pH....

  14. Selective Lentiviral Gene Delivery to CD133-Expressing Human Glioblastoma Stem Cells

    OpenAIRE

    N Sumru Bayin; Aram S Modrek; August Dietrich; Jonathan Lebowitz; Tobias Abel; Hae-Ri Song; Markus Schober; David Zagzag; Christian J Buchholz; Chao, Moses V; Placantonakis, Dimitris G.

    2014-01-01

    Glioblastoma multiforme (GBM) is a deadly primary brain malignancy. Glioblastoma stem cells (GSC), which have the ability to self-renew and differentiate into tumor lineages, are believed to cause tumor recurrence due to their resistance to current therapies. A subset of GSCs is marked by cell surface expression of CD133, a glycosylated pentaspan transmembrane protein. The study of CD133-expressing GSCs has been limited by the relative paucity of genetic tools that specifically target them. H...

  15. Distillation device supplies cesium vapor at constant pressure

    Science.gov (United States)

    Basiulis, A.; Shefsiek, P. K.

    1968-01-01

    Distillation apparatus in the form of a U tube supplies small amounts of pure cesium vapor at constant pressure to a thermionic converter. The upstream leg of the U tube is connected to a vacuum pump to withdraw noncondensable impurities, the bottom portion serves as a reservoir for the liquid cesium.

  16. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma

    Directory of Open Access Journals (Sweden)

    Lu Lizhi

    2006-12-01

    Full Text Available Abstract Background Recently, a small population of cancer stem cells in adult and pediatric brain tumors has been identified. Some evidence has suggested that CD133 is a marker for a subset of leukemia and glioblastoma cancer stem cells. Especially, CD133 positive cells isolated from human glioblastoma may initiate tumors and represent novel targets for therapeutics. The gene expression and the drug resistance property of CD133 positive cancer stem cells, however, are still unknown. Results In this study, by FACS analysis we determined the percentage of CD133 positive cells in three primary cultured cell lines established from glioblastoma patients 10.2%, 69.7% and 27.5%, respectively. We also determined the average mRNA levels of markers associated with neural precursors. For example, CD90, CD44, CXCR4, Nestin, Msi1 and MELK mRNA on CD133 positive cells increased to 15.6, 5.7, 337.8, 21.4, 84 and 1351 times, respectively, compared to autologous CD133 negative cells derived from cell line No. 66. Additionally, CD133 positive cells express higher levels of BCRP1 and MGMT mRNA, as well as higher mRNA levels of genes that inhibit apoptosis. Furthermore, CD133 positive cells were significantly resistant to chemotherapeutic agents including temozolomide, carboplatin, paclitaxel (Taxol and etoposide (VP16 compared to autologous CD133 negative cells. Finally, CD133 expression was significantly higher in recurrent GBM tissue obtained from five patients as compared to their respective newly diagnosed tumors. Conclusion Our study for the first time provided evidence that CD133 positive cancer stem cells display strong capability on tumor's resistance to chemotherapy. This resistance is probably contributed by the CD133 positive cell with higher expression of on BCRP1 and MGMT, as well as the anti-apoptosis protein and inhibitors of apoptosis protein families. Future treatment should target this small population of CD133 positive cancer stem cells in

  17. Extraction of radioactive cesium from ash of flammable radioactive material

    International Nuclear Information System (INIS)

    Huge amount of radioactive materials was released by the hydrogen explosion at Fukushima Daiichi Nuclear Power Plant due to the Great East Japan Earthquake on March 11, 2011. Suppression of the volume of radioactive materials stored by decontamination works is strongly required since the preparation of storage places is not easy. We are developing the technology for separation and concentration of radioactive cesium using nano-particle, Prussian blue, as a cesium adsorption material which has a high efficiency and good selectivity. We propose a method in which radioactive cesium is extracted from the ash of flammable materials into the water and the Prussian blue nano-particles are added to the water to collect cesium. The volume of radioactive wastes contaminated by cesium is expected to be cut down with these processes. (J.P.N.)

  18. A combined cesium-strontium extraction/recovery process

    International Nuclear Information System (INIS)

    A new solvent extraction process for the simultaneous extraction of cesium and strontium from acidic nitrate media is described. This process uses a solvent formulation comprised of 0.05 M di-t-butylcyclohexano-18-crown-6 (DtBuCH18C6), 0.1 M Crown 100' (a proprietary, cesium-selective derivative of dibenzo-18-crown-6), 1.2 M tributyl phosphate (TBP), and 5% (v/v) lauryl nitrile in an isoparaffinic hydrocarbon diluent. Distribution ratios for cesium and strontium from 4 M nitric acid are 4.13 and 3.46, respectively. A benchtop batch countercurrent extraction experiment indicates that >98% of the cesium and strontium initially present in the feed solution can be removed in only four extraction stages. Through proper choice of extraction and strip conditions, extracted cesium and strontium can be recovered either together or individually

  19. Plutonium and Cesium Colloid Mediated Transport

    Science.gov (United States)

    Boukhalfa, H.; Dittrich, T.; Reimus, P. W.; Ware, D.; Erdmann, B.; Wasserman, N. L.; Abdel-Fattah, A. I.

    2013-12-01

    Plutonium and cesium have been released to the environment at many different locations worldwide and are present in spent fuel at significant levels. Accurate understanding of the mechanisms that control their fate and transport in the environment is important for the management of contaminated sites, for forensic applications, and for the development of robust repositories for the disposal of spent nuclear fuel and nuclear waste. Plutonium, which can be present in the environment in multiple oxidations states and various chemical forms including amorphous oxy(hydr)oxide phases, adsorbs/adheres very strongly to geological materials and is usually immobile in all its chemical forms. However, when associated with natural colloids, it has the potential to migrate significant distances from its point of release. Like plutonium, cesium is not very mobile and tends to remain adhered to geological materials near its release point, although its transport can be enhanced by natural colloids. However, the reactivity of plutonium and cesium are very different, so their colloid-mediated transport might be significantly different in subsurface environments. In this study, we performed controlled experiments in two identically-prepared columns; one dedicated to Pu and natural colloid transport experiments, and the other to Cs and colloid experiments. Multiple flow-through experiments were conducted in each column, with the effluent solutions being collected and re-injected into the same column two times to examine the persistence and scaling behavior of the natural colloids, Pu and Cs. The data show that that a significant fraction of colloids were retained in the first elution through each column, but the eluted colloids collected from the first run transported almost conservatively in subsequent runs. Plutonium transport tracked natural colloids in the first run but deviated from the transport of natural colloids in the second and third runs. Cesium transport tracked natural

  20. Adsorption of cesium on cement mortar from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Volchek, Konstantin, E-mail: konstantin.volchek@ec.gc.ca [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Miah, Muhammed Yusuf [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Department of Applied Chemistry and Chemical Technology, Noakhali Science and Technology University (Bangladesh); Kuang, Wenxing; DeMaleki, Zack [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Tezel, F. Handan [Department of Chemical and Biological Engineering, University of Ottawa, 161 Louis-Pasteur, Ottawa, Ontario, Canada K1N 6N5 (Canada)

    2011-10-30

    Highlights: {yields} The adsorption of cesium on cement mortar was investigated in a range of temperatures and cesium concentrations. {yields} The pseudo-second order kinetic model produced a good fit with the experimental kinetic data. {yields} Equilibrium test results correlated well with the Freundlich isotherm adsorption model. {yields} The interaction between cesium ions and cement mortar was dominated by chemical adsorption. - Abstract: The adsorption of cesium on cement mortar from aqueous solutions was studied in series of bench-scale tests. The effects of cesium concentration, temperature and contact time on process kinetics and equilibrium were evaluated. Experiments were carried out in a range of initial cesium concentrations from 0.0103 to 10.88 mg L{sup -1} and temperatures from 278 to 313 K using coupons of cement mortar immersed in the solutions. Non-radioactive cesium chloride was used as a surrogate of the radioactive {sup 137}Cs. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectroscopy. Depending on the initial cesium concentration, its equilibrium concentration in solution ranged from 0.0069 to 8.837 mg L{sup -1} while the respective surface concentration on coupons varied from 0.0395 to 22.34 {mu}g cm{sup -2}. Equilibrium test results correlated well with the Freundlich isotherm model for the entire test duration. Test results revealed that an increase in temperature resulted in an increase in adsorption rate and a decrease in equilibrium cesium surface concentration. Among several kinetic models considered, the pseudo-second order reaction model was found to be the best to describe the kinetic test results in the studied range of concentrations. The adsorption activation energy determined from Arrhenius equation was found to be approximately 55.9 kJ mol{sup -1} suggesting that chemisorption was the prevalent mechanism of interaction between cesium ions and cement mortar.

  1. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM133Q.Seq.d/ Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  2. Dicty_cDB: CHS133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS133 (Link to dictyBase) - - - - CHS133P (Link to Original site) CHS133F 704 CHS1...33Z 773 CHS133P 1457 - - Show CHS133 Library CH (Link to library) Clone ID CHS133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHS1...-B/CHS133Q.Seq.d/ Representative seq. ID CHS133P (Link to... Original site) Representative DNA sequence >CHS133 (CHS133Q) /CSM/CH/CHS1-B/CHS133Q.Seq.d/ ATTTTTAAATATATAT

  3. Single-Particle States in $^{133}$Sn

    CERN Document Server

    Huck, A

    2002-01-01

    % IS338 \\\\ \\\\ It is suggested to investigate the $\\beta^- $-decay of $^{133}$In and $^{134}$In in order to determine the single-particle states in $^{133}$Sn, which are so far unknown and needed for the shell-model description of the region close to $^{132}$Sn. Large hyper-pure Ge-detectors will be used for the $\\gamma$-ray spectroscopy. In the experiments with $^{134}$In, delayed neutrons in coincidence with $\\gamma$-rays from excited states in $^{133}$Sn provide the opportunity for a very selective detection of the states in question.

  4. Sympathetic cooling in a rubidium cesium mixture: Production of ultracold cesium atoms

    International Nuclear Information System (INIS)

    This thesis presents experiments for the production of ultracold rubidium cesium mixture in a magnetic trap. The long-termed aim of the experiment is the study of the interaction of few cesium atoms with a Bose-Einstein condensate of rubidium atoms. Especially by controlled variation of the cesium atom number the transition in the description of the interaction by concepts of the one-particle physics to the description by concepts of the many-particle physics shall be studied. The rubidium atoms are trapped in a magneto-optical trap (MOT) and from there reloaded into a magnetic trap. In this the rubidium atoms are stored in the state vertical stroke f=2,mf=2 right angle of the electronic ground state and evaporatively cooled by means of microwave-induced transitions into the state vertical stroke f=1,mf=1] (microwave cooling). The cesium atoms are also trppaed in a MOT and into the same magnetic trap reloaded, in which they are stored in the state vertical stroke f=4,mf=4 right angle of the electronic ground state together with rubidium. Because of the different hyperfine splitting only rubidium is evaporatively cooled, while cesium is cooled jointly sympathetically - i.e. by theramal contact via elastic collisions with rubidium atoms. The first two chapters contain a description of interatomic interactions in ultracold gases as well as a short summary of theoretical concepts in the description of Bose-Einstein condensates. The chapters 3 and 4 contain a short presentation of the methods applied in the experiment for the production of ultracold gases as well as the experimental arrangement; especially in the framework of this thesis a new coil system has been designed, which offers in view of future experiments additionally optical access for an optical trap. Additionally the fourth chapter contains an extensive description of the experimental cycle, which is applied in order to store rubidium and cesium atoms together into the magnetic trap. The last chapter

  5. Intense non-relativistic cesium ion beam

    International Nuclear Information System (INIS)

    The Heavy Ion Fusion group at Lawrence Berkeley Laboratory has constructed the One Ampere Cesium Injector as a proof of principle source to supply an induction linac with a high charge density and high brightness ion beam. This is studied here. An electron beam probe was developed as the major diagnostic tool for characterizing ion beam space charge. Electron beam probe data inversion is accomplished with the EBEAM code and a parametrically adjusted model radial charge distribution. The longitudinal charge distribution was not derived, although it is possible to do so. The radial charge distribution that is derived reveals an unexpected halo of trapped electrons surrounding the ion beam. A charge fluid theory of the effect of finite electron temperature on the focusing of neutralized ion beams (Nucl. Fus. 21, 529 (1981)) is applied to the problem of the Cesium beam final focus at the end of the injector. It is shown that the theory's predictions and assumptions are consistent with the experimental data, and that it accounts for the observed ion beam radius of approx. 5 cm, and the electron halo, including the determination of an electron Debye length of approx. 10 cm

  6. Microbial uptake of uranium, cesium, and radium

    International Nuclear Information System (INIS)

    The ability of diverse microbial species to concentrate uranium, cesium, and radium was examined. Saccharomyces cerevisiae, Pseudomonas aeruginosa, and a mixed culture of denitrifying bacteria accumulated uranium to 10 to 15% of the dry cell weight. Only a fraction of the cells in a given population had visible uranium deposits in electron micrographs. While metabolism was not required for uranium uptake, mechanistic differences in the metal uptake process were indicated. Uranium accumulated slowly (hours) on the surface of S. cerevisiae and was subject to environmental factors (i.e., temperature, pH, interfering cations and anions). In contrast, P. aeruginosa and the mixed culture of denitrifying bacteria accumulated uranium rapidly (minutes) as dense, apparently random, intracellular deposits. This very rapid accumulation has prevented us from determining whether the uptake rate during the transient between the initial and equilibrium distribution of uranium is affected by environmental conditions. However, the final equilibrium distributions are not affected by those conditions which affect uptake by S. cerevisiae. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several microbial species tested. The potential utility of microorganisms for the removal and concentration of these metals from nuclear processing wastes and several bioreactor designs for contacting microorganisms with contaminated waste streams will be discussed

  7. Biosorption behavior and mechanism of cesium-137 on Rhodosporidium fluviale strain UA2 isolated from cesium solution

    International Nuclear Information System (INIS)

    In order to identify a more efficient biosorbent for 137Cs, we have investigated the biosorption behavior and mechanism of 137Cs on Rhodosporidium fluviale (R. fluviale) strain UA2, one of the dominant species of a fungal group isolated from a stable cesium solution. We observed that the biosorption of 137Cs on R. fluviale strain UA2 was a fast and pH-dependent process in the solution composed of R. fluviale strain UA2 (5 g/L) and cesium (1 mg/L). While a Langmuir isotherm equation indicated that the biosorption of 137Cs was a monolayer adsorption, the biosorption behavior implied that R. fluviale strain UA2 adsorbed cesium ions by electrostatic attraction. The TEM analysis revealed that cesium ions were absorbed into the cytoplasm of R. fluviale strain UA2 across the cell membrane, not merely fixed on the cell surface, which implied that a mechanism of metal uptake contributed largely to the cesium biosorption process. Moreover, PIXE and EPBS analyses showed that ion-exchange was another biosorption mechanism for the cell biosorption of 137Cs, in which the decreased potassium ions were replaced by cesium ions. All the above results implied that the biosorption of 137Cs on R. fluviale strain UA2 involved a two-step process. The first step is passive biosorption that cesium ions are adsorbed to cells surface by electrostatic attraction; after that, the second step is active biosorption that cesium ions penetrate the cell membrane and accumulate in the cytoplasm. - Highlights: • Microorganisms isolated from a cesium solution are considered as a biosorbent to remove cesium ions. • The biosorption equilibrium is fitted well to a Langmuir model with a correlation coefficient of 0.9997. • First attempt to explore biosorption mechanisms using PIXE and EPBS. • Living and dead microorganisms have different biosorption mechanisms. • The biosorption of 137Cs involved a two-step process: passive and active

  8. REL 133 UOP Course Tutorial/TutorialRank

    OpenAIRE

    jhon

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 6 Times, Rating: A+   REL 133 Week 1 Individual Assignment Elements of Religious Traditions Paper (UOP Course) REL 133 Week 1 DQ 1 (UOP Course) REL 133 Week 1 DQ 2 (UOP Course) REL 133 Week 1 DQ 3 (UOP Course) REL 133 Week 1 DQ 4 (UOP Course) REL 133 Week 2 Individual Assignment Four Yogic Paths and Jainism Worksheet (UOP Course) REL 133 Week 2 DQ 1 (UOP Course) REL 133 W...

  9. 49 CFR 37.133 - Subscription service.

    Science.gov (United States)

    2010-10-01

    ... DISABILITIES (ADA) Paratransit as a Complement to Fixed Route Service § 37.133 Subscription service. (a) This... paratransit system, subject to the limitations in this section. (b) Subscription service may not absorb...

  10. 14 CFR 1264.133 - Evidence.

    Science.gov (United States)

    2010-01-01

    ... PENALTIES ACT OF 1986 § 1264.133 Evidence. (a) The presiding officer shall determine the admissibility of... outweighed by the danger of unfair prejudice, confusion of the issues, or by considerations of undue delay...

  11. Adsorption of cesium on cement mortar from aqueous solutions.

    Science.gov (United States)

    Volchek, Konstantin; Miah, Muhammed Yusuf; Kuang, Wenxing; DeMaleki, Zack; Tezel, F Handan

    2011-10-30

    The adsorption of cesium on cement mortar from aqueous solutions was studied in series of bench-scale tests. The effects of cesium concentration, temperature and contact time on process kinetics and equilibrium were evaluated. Experiments were carried out in a range of initial cesium concentrations from 0.0103 to 10.88 mg L(-1) and temperatures from 278 to 313 K using coupons of cement mortar immersed in the solutions. Non-radioactive cesium chloride was used as a surrogate of the radioactive (137)Cs. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectroscopy. Depending on the initial cesium concentration, its equilibrium concentration in solution ranged from 0.0069 to 8.837 mg L(-1) while the respective surface concentration on coupons varied from 0.0395 to 22.34 μg cm(-2). Equilibrium test results correlated well with the Freundlich isotherm model for the entire test duration. Test results revealed that an increase in temperature resulted in an increase in adsorption rate and a decrease in equilibrium cesium surface concentration. Among several kinetic models considered, the pseudo-second order reaction model was found to be the best to describe the kinetic test results in the studied range of concentrations. The adsorption activation energy determined from Arrhenius equation was found to be approximately 55.9 kJ mol(-1) suggesting that chemisorption was the prevalent mechanism of interaction between cesium ions and cement mortar.

  12. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juntao; Mao, Zhangfan; Huang, Jie; Xie, Songping; Liu, Tianshu; Mao, Zhifu, E-mail: 48151660@qq.com

    2014-02-21

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G{sub 2}/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were

  13. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    International Nuclear Information System (INIS)

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G2/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were enhanced

  14. Dicty_cDB: CHR133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR133 (Link to dictyBase) - - - Contig-U11110-1 | Contig-U13144-1 CHR...133P (Link to Original site) CHR133F 616 CHR133Z 142 CHR133P 738 - - Show CHR133 Library CH (Link to library) Clone ID CHR...10-1 | Contig-U13144-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR...133Q.Seq.d/ Representative seq. ID CHR133P (Link to Original site) Representative DNA sequence >CHR133 (CHR...133Q) /CSM/CH/CHR1-B/CHR133Q.Seq.d/ TTTGTACCAGCATTCAAGGTAATTCCTTATTGGGGTACACAACAACAACGTACTACCATT

  15. Dicty_cDB: SSC133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSC133 (Link to dictyBase) - G02091 DDB0220658 Contig-U12246-1 SSC...133E (Link to Original site) - - - - - - SSC133E 474 Show SSC133 Library SS (Link to library) Clone ID SSC...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSC1-B/SSC133Q.Seq.d/ ...Representative seq. ID SSC133E (Link to Original site) Representative DNA sequence >SSC133 (SSC133Q) /CSM/SS/SSC1-B/SSC...30 (SSI330Q) /CSM/SS/SSI3-B/SSI330Q.Seq.d/ 620 e-177 SSC133 (SSC133Q) /CSM/SS/SSC1-B/SSC133Q.Seq.d/ 620 e-17

  16. Synthesis and peculiarities of the cesium zeolite crystal structure (cesite)

    International Nuclear Information System (INIS)

    An attempt is made to synthesize cesium zeolite by introduction of amorphous seed crystals which correspond by composition with cesium-containing zeolite into the aluminosilicate gel, since this method can produce zeolite with a crystal structure it would not adopt under the usual conditions. It is seen that during crystablization upon introduction of a seed crystal the cesium content in zeolite decreases. A more complete structural elucidation of zeolite obtained by the suggested method was carried out by x0ray and IR spectral analyses. The data of x-ray analysis showed that the structures of synthesized zeolite and binary octagonal pores are similar

  17. Pollution of drug-technical materials by cesium-137

    International Nuclear Information System (INIS)

    Drug-technical raw materials are medicinal plants (flowers, folium, grasses, mushrooms, roots, fruits, berry, kidney, cortex), used in pharmacy. To limit receipt cesium-137 in people body in 1993 in the Republic of Belarus were created 'Temporary permission levels of the cesium-137 radionuclides contents in drug-technical raw materials' were created (TPL-1993). The permission levels of cesium-137 are following: for drug-technical raw material (flowers, folium, grass, mushrooms, roots and other plants parts) - 1850 Bq/kg, for dried up fruits and berries - 2590 Bq/kg. (Author)

  18. Management of cesium loaded AMP- Part I preparation of 137Cesium concentrate and cementation of secondary wastes

    International Nuclear Information System (INIS)

    Separation of 137cesium from High Level Waste can be achieved by use of composite-AMP, an engineered form of Ammonium Molybdo-Phosphate(AMP). Direct vitrification of cesium loaded composite AMP in borosilicate glass matrix leads to separation of water soluble molybdate phase. A proposed process describes two different routes of selective separation of molybdates and phosphate to obtain solutions of cesium concentrates. Elution of 137Cesium from composite-AMP by decomposing it under flow conditions using saturated barium hydroxide was investigated. This method leaves molybdate and phosphate embedded in the column but only 70% of total cesium loaded on column could be eluted. Alternatively composite-AMP was dissolved in sodium hydroxide and precipitation of barium molybdate-phosphate from the resultant solution, using barium nitrate was investigated by batch methods. The precipitation technique gave over 99.9% of 137Cesium activity in solutions, free of molybdates and phosphates, which is ideally suited for immobilization in borosilicate glass matrix. Detailed studies were carried out to immobilize secondary waste of 137Cesium contaminated barium molybdate-phosphate precipitates in the slag cement matrix using vermiculite and bentonite as admixtures. The cumulative fraction of 137Cs leached from the cement matrix blocks was 0.05 in 140 days while the 137Cs leach rate was 0.001 gm/cm2/d. (author)

  19. CD133/Src axis mediates tumor initiating property and epithelial-mesenchymal transition of head and neck cancer.

    Directory of Open Access Journals (Sweden)

    Yu-Syuan Chen

    Full Text Available BACKGROUND: Head and Neck squamous cell carcinoma (HNSCC is a human lethal cancer with clinical, pathological, phenotypical and biological heterogeneity. Caner initiating cells (CICs, which are responsible for tumor growth and coupled with gain of epithelial-mesenchymal transition (EMT, have been identified. Previously, we enriched a subpopulation of head and neck cancer initiating cells (HN-CICs with up-regulation of CD133 and enhancement of EMT. Others demonstrate that Src kinase interacts with and phosphorylates the cytoplasmic domain of CD133. However, the physiological function of CD133/Src signaling in HNSCCs has not been uncovered. METHODOLOGY/PRINCIPAL FINDING: Herein, we determined the critical role of CD133/Src axis modulating stemness, EMT and tumorigenicity of HNSCC and HN-CICs. Initially, down-regulation of CD133 significantly reduced the self-renewal ability and expression of stemness genes, and promoted the differentiation and apoptotic capability of HN-CICs. Additionally, knockdown of CD133 in HN-CICs also lessened both in vitro malignant properties including cell migration/cell invasiveness/anchorage independent growth, and in vivo tumor growth by nude mice xenotransplantation assay. In opposite, overexpression of CD133 enhanced the stemness properties and tumorigenic ability of HNSCCs. Lastly, up-regulation of CD133 increased phosphorylation of Src coupled with EMT transformation in HNSCCs, on the contrary, silence of CD133 or treatment of Src inhibitor inversely abrogated above phenotypic effects, which were induced by CD133 up-regulation in HNSCCs or HN-CICs. CONCLUSION/SIGNIFICANCE: Our results suggested that CD133/Src signaling is a regulatory switch to gain of EMT and of stemness properties in HNSCC. Finally, CD133/Src axis might be a potential therapeutic target for HNSCC by eliminating HN-CICs.

  20. Pm-miR-133 hosting in one potential lncRNA regulates RhoA expression in pearl oyster Pinctada martensii.

    Science.gov (United States)

    Zheng, Zhe; Huang, RongLian; Tian, RongRong; Jiao, Yu; Du, Xiaodong

    2016-10-15

    Long non-coding RNAs (LncRNAs) are abundant in the genome of higher forms of eukaryotes and implicated in regulating the diversity of biological processes partly because they host microRNAs (miRNAs), which are repressors of target gene expression. In vertebrates, miR-133 regulates the differentiation and proliferation of cardiac and skeletal muscles. Pinctada martensii miR-133 (pm-miR-133) was identified in our previous research through Solexa deep sequencing. In the present study, the precise sequence of mature pm-miR-133 was validated through miR-RACE. Stem loop qRT-PCR analysis demonstrated that mature pm-miR-133 was constitutively expressed in the adductor muscle, gonad, hepatopancreas, mantle, foot, and gill of P. martensii. Among these tissues, the adductor muscle exhibited the highest pm-miR-133 expression. Target analysis indicated that pm-RhoA was the potential regulatory target of pm-miR-133. Bioinformatics analyses revealed that a potential LncRNA (designated as Lnc133) with a mature pm-miR-133 could generate a hairpin structure that was highly homologous to that of Lottia gigantea. Lnc133 was also highly expressed in the adductor muscle, gill, hepatopancreas, and gonad. Phylogenetic analysis further showed that the miR-133s derived from chordate and achordate were separated into two classes. Therefore, Lnc133 hosting pm-miR-133 could be involved in regulating the cell proliferation of adductor muscles by targeting pm-RhoA.

  1. Structure of double hafnium and cesium sulfate

    International Nuclear Information System (INIS)

    The structure of a compound whose formula according to the structural investigation is Cssub(2+x)Hf(SOsub(4))sub(2+x)(HSOsub(4))sub(2-x)x3Hsub(2)O (x approximately 0.7) (a=10.220, b=12.004, c=15.767 A, space group Pcmn) is determined by diffractometric data (2840 reflections, anisotropic refinement, R=0.087). It is build of complex unions [Hf(SO4)4H2O]4-, Cs+ cations and water molecules. Eight O atoms surrounding Hf atom (dodecahedron Hf-O 2.10-2.22 A) belong to four sulphate groups and water molecule. Three sulphate groups are bidentate-cyclic, and one group - monodentate relative to Hf. The structure has a cesium deficit in particular positions

  2. Biosorption of uranium, radium, and cesium

    International Nuclear Information System (INIS)

    Some fundamental aspects of the biosorption of metals by microbial cells were investigated. These studies were carried out in conjunction with efforts to develop a process to utilize microbial cells as biosorbents for the removal of radionuclides from waste streams generated by the nuclear fuel cycle. It was felt that an understanding of the mechanism(s) of metal uptake would potentially enable the enhancement of the metal uptake phenomenon through environmental or genetic manipulation of the microorganisms. Also presented are the results of a preliminary investigation of the applicability of microorganisms for the removal of 137cesium and 226radium from existing waste solutions. The studies were directed primarily at a characterization of uranium uptake by the yeast, Saccharomyces cerevisiae, and the bacterium, Pseudomonas aeruginosa

  3. Atmospheric transmission for cesium DPAL using TDLAS

    Science.gov (United States)

    Rice, Christopher A.; Perram, Glen P.

    2012-03-01

    The cesium (Cs) Diode Pumped Alkali Laser (DPAL) operates near 894 nm, in the vicinity of atmospheric water vapor absorption lines. An open-path Tunable Diode Laser Absorption (TDLAS) system composed of narrow band (~300 kHz) diode laser fiber coupled to a 12" Ritchey-Chrétien transmit telescope has been used to study the atmospheric transmission characteristics of Cs DPALs over extended paths. The ruggedized system has been field deployed and tested for propagation distances of greater than 1 km. By scanning the diode laser across many free spectral ranges, many rotational absorption features are observed. Absolute laser frequency is monitored with a High Finesse wavemeter to an accuracy of less than 10 MHz. Phase sensitive detection is employed with an absorbance of less than 1% observable under field conditions.

  4. 21 CFR 133.175 - Pasteurized cheese spread.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized cheese spread. 133.175 Section 133.175... Cheese and Related Products § 133.175 Pasteurized cheese spread. Pasteurized cheese spread is the food... statement of ingredients, prescribed for pasteurized process cheese spread by § 133.179, except that...

  5. Sorption of cesium and strontium by arid region desert soil

    International Nuclear Information System (INIS)

    Adsorption and ion exchange in soil systems are the principal mechanisms that retard the migration of nuclear waste to the biosphere. Cesium and strontium are two elements with radioactive isotopes (Cs137 and Sr90) that are commonly disposed of as nuclear waste. The sorption and ion exchange properties of nonradioactive cesium and strontium were studied in this investigation. The soil used in this study was collected at an experimental infiltration site on Frenchman Flat, a closed drainage basin on the Nevada Test Site. This soil is mostly nonsaline-alkali sandy loam and loamy sand with a cation exchange capacity ranging from 13 to 30 me/100g. The clay fraction of the soil contains illite, montmorillonite, and clinoptilolite. Ion exchange studies have shown that this soil sorbs cesium preferentially relative to strontium, and that charge for charge, the exchange-phase cations released from exchange sites exceed the cesium and strontium sorbed by the soil. 38 references, 22 figures

  6. Sorption of cesium on Olkiluoto mica gneiss, granodiorite and granite

    Energy Technology Data Exchange (ETDEWEB)

    Huitti, T.; Hakanen, M. [Univ. of Helsinki (Finland). Lab. of Radiochemistry; Lindberg, A. [Geological Survey of Finland, Espoo (Finland)

    1998-09-01

    Cesium was selected as a model to study the sorption in bedrock occurring by ion exchange mechanism. The aim of the study was to supplement the existing data on sorption occurring by ion exchange mechanism in bedrock of the candidate sites for spent fuel disposal at Olkiluoto. The sorption of cesium was studied on crushed mica gneiss, tonalite (granodiorite) and granite in artificial groundwaters. Fresh water was represented by Allard water, pH 8 and pH 7, and saline water by Ol-So water, pH 7 and pH 9. In addition, a Na-Ca-Cl brine water and its 1:10 dilution were used as simulants. Cesium concentrations were between 10{sup -8} and 10{sup -3} mol/l. The distribution coefficients of the sorption, R{sub d} and R{sub a} values were determined by batch method. Isotherms were partly non-linear with slopes 0.7 - 1.0 depending on rock and water. At the end of the sorption experiment, the water was analysed for cations exchanged for cesium. The sorption of cesium was also studied as a function of ionic strength. The ionic strength increased in the order Allard < 0l-Br 1:10 < 0l-So < 0l-Br. The sorption of cesium was lower at higher ionic strength and higher Cs concentration. The mineral composition of rocks was determined by thin section analysis, and the sorption distribution ratios on thin sections in the different waters were determined by batch technique. The minerals, that sorbed most cesium were determined by autoradiography. These were biotite, muscovite and chlorite. Cordierite in mica gneiss also sorbed cesium very effectively. (orig.) 12 refs.

  7. Adsorption Behaviour of Liquid 4He on Cesium Substrates

    OpenAIRE

    Iov, Valentin

    2004-01-01

    The aim of this thesis is to investigate the wetting properties of 4He on cesium substrates using optical and electrical methods. Due to the fact that the cesium substrates are deposited at low temperatures onto a thin silver underlayer, it is necessary firstly to study and understand the adsorption of helium on silver. The work presented here is structured as follows: some of the fundamental concepts on the theory of physisorbed films, such as van der Waals interaction, adsorption isotherms ...

  8. Seasonal variation of cesium 134 and cesium 137 in semidomestic reindeer in Norway after the Chernobyl accident

    Directory of Open Access Journals (Sweden)

    I.M. H. Eikelmann

    1990-09-01

    Full Text Available The Chernobyl accident had a great impact on the semidomestic reindeer husbandry in central Norway. Seasonal differences in habitat and diet resulted in large variations in observed radiocesium concentrations in reindeer after the Chernobyl accident. In three areas with high values of cesium-134 and cesium-137 in lichens, the main feed for reindeer in winter, reindeer were sampled every second month to monitor the seasonal variation and the decrease rate of the radioactivity. The results are based on measurements of cesium-134 and cesium-137 content in meat and blood and by whole-body monitoring of live animals. In 1987 the increase of radiocesium content in reindeer in Vågå were 4x from August to January. The mean reductions in radiocesium content from the winter 1986/87 to the winter 1987/88 were 32%, 50% and 43% in the areas of Vågå, Østre-Namdal and Lom respectively.

  9. Steady State Sputtering Yields and Surface Compositions of Depleted Uranium and Uranium Carbide bombarded by 30 keV Gallium or 16 keV Cesium Ions

    International Nuclear Information System (INIS)

    Depleted uranium that included carbide inclusions was sputtered with 30keV gallium ions or 16kev cesium ions to depths much greater than the ions’ range, i.e. using steady state sputtering. The recession of both the uranium’s and uranium carbide’s surfaces and the ion corresponding fluences were used to determine the steady state target sputtering yields of both uranium and uranium carbide, i.e. 6.3 atoms of uranium and 2.4 units of uranium carbide eroded per gallium ion, and 9.9 uranium atoms and 3.65 units of uranium carbide eroded by cesium ions. The steady state surface composition resulting from the simultaneous gallium or cesium implantation and sputter-erosion of uranium and uranium carbide were calculated to be U86Ga14, (UC)70Ga30 and U81Cs9, (UC)79Cs21, respectively.

  10. 21 CFR 133.183 - Romano cheese.

    Science.gov (United States)

    2010-04-01

    ... Products § 133.183 Romano cheese. (a) Romano cheese is the food prepared from cow's milk or sheep's milk or... purposes of this section, the word “milk” means cow's milk or goat's milk or sheep's milk or mixtures of... of cow's milk) by adding one or more of the following: Cream, skim milk, concentrated skim......

  11. 5 CFR 1201.133 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Judicial review. 1201.133 Section 1201... review. An employee, former employee, or applicant for employment who is adversely affected by a final... review of the decision in the United States Court of Appeals for the Federal Circuit. 5 U.S.C....

  12. 7 CFR 1150.133 - Nominations.

    Science.gov (United States)

    2010-01-01

    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order National Dairy Promotion and Research Board § 1150.133 Nominations. Nominations for members of the..., the Secretary shall announce at least 120 days in advance when a Board member's term is expiring...

  13. Cerebral blood flow tomography with xenon-133

    DEFF Research Database (Denmark)

    Lassen, N A

    1985-01-01

    Cerebral blood flow (CBF) can be measured tomographically by inhalation of Xenon-133. The calculation is based on taking a sequence of tomograms during the wash-in and wash-out phase of the tracer. Due to the dynamic nature of the process, a highly sensitive and fast moving single photon emission...

  14. 27 CFR 9.133 - Rutherford.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Rutherford. 9.133 Section... Rutherford. (a) Name. The name of the viticultural area described in this section is “Rutherford.” (b) Approved maps. The appropriate maps for determining the boundary of the Rutherford viticultural area...

  15. 40 CFR 141.133 - Compliance requirements.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Disinfectant Residuals, Disinfection Byproducts, and Disinfection Byproduct Precursors § 141.133 Compliance requirements. (a) General requirements. (1) Where... chlorine or chloramine, the system is out of compliance at the end of that quarter. (b)...

  16. Cesium and strontium in Black Sea macroalgae

    International Nuclear Information System (INIS)

    The trace level of metals and particularly radioactive ones should be monitored to evaluate the transfer along the trophic chain, assess the risk for biota and can be used for global changes assessment. Plants respond rapidly to all changes in the ecosystem conditions and are widely used as indicators and predictors for changes in hydrology and geology. In this work we represent our successful development and applications of a methodology for monitoring of stable and radioactive strontium and cesium in marine biota (Black Sea algae's). In case of radioactive release they are of high interest. We use ED-XRF, gamma spectrometers and LSC instrumentation and only 0.25 g sample. Obtained results are compared with those of other authors in same regions. The novelty is the connection between the radioactive isotopes and their stable elements in algae in time and space scale. All our samples were collected from Bulgarian Black Sea coast. - Highlights: • An extraction chromatography method for radiochemical separation of Sr and Cs. • Assessment of Sr and Cs accumulation capacity of six Black Sea macroalgae species. • Connection between the isotopes and their stable elements content in algae. • Assessment of Sr and Cs content in ecosystems along the Bulgarian coast

  17. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO4] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils

    International Nuclear Information System (INIS)

    Graphical abstract: A possible pathway for immobilization with the nano-Fe/Ca/CaO/[PO4] treatment (a) 133Cs is adsorbed onto the soil particles, (b) Cs encapsulation through the formation of immobile salts, and (c) solid (small/finer or larger/aggregate) soil fraction separation. - Highlights: • Nano-Fe/Ca/CaO/[PO4] composite for Cs immobilization in soil was developed. • Enhanced cesium separation and immobilization was done in dry condition. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • Nano-Fe/Ca/CaO/[PO4] a highly potential amendment for the remediation of Cs. - Abstract: This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable (133Cs) and radioactive cesium species (134Cs and 137Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO4], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant 133Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO4], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped 134Cs and 137Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that 134Cs and 137Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO4] treated soil were characterized using SEM–EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil included Ca/PO4 associated crystalline complexes. These results suggest that simple grinding

  18. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO{sub 4}] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Mallampati, Srinivasa Reddy, E-mail: srireddys@ulsan.ac.kr [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of); Mitoma, Yoshiharu, E-mail: mitomay@pu-hiroshima.ac.jp [Department of Environmental Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka-Cho Shobara City, Hiroshima 727-0023 (Japan); Okuda, Tetsuji [Environmental Research and Management Center, Hiroshima University, 1-5-3 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8513 (Japan); Simion, Cristian [Politehnica University of Bucharest, Department of Organic Chemistry, Bucharest 060042 (Romania); Lee, Byeong Kyu [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of)

    2015-10-30

    Graphical abstract: A possible pathway for immobilization with the nano-Fe/Ca/CaO/[PO{sub 4}] treatment (a) {sup 133}Cs is adsorbed onto the soil particles, (b) Cs encapsulation through the formation of immobile salts, and (c) solid (small/finer or larger/aggregate) soil fraction separation. - Highlights: • Nano-Fe/Ca/CaO/[PO{sub 4}] composite for Cs immobilization in soil was developed. • Enhanced cesium separation and immobilization was done in dry condition. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • Nano-Fe/Ca/CaO/[PO{sub 4}] a highly potential amendment for the remediation of Cs. - Abstract: This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable ({sup 133}Cs) and radioactive cesium species ({sup 134}Cs and {sup 137}Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO{sub 4}], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant {sup 133}Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO{sub 4}], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped {sup 134}Cs and {sup 137}Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that {sup 134}Cs and {sup 137}Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO{sub 4}] treated soil were characterized using SEM–EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil

  19. Viscosity and crystallization mechanism of cesium loaded iron phosphate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, Kitheri, E-mail: joskit@igcar.gov.in [Chemistry Group, IGCAR, Kalpakkam 603 102 (India); Kutty, K.V. Govindan [Chemistry Group, IGCAR, Kalpakkam 603 102 (India); Goswami, M.C. [National Metallurgical Laboratory, Jamshedpur 831 007 (India); Rao, P.R. Vasudeva [Chemistry Group, IGCAR, Kalpakkam 603 102 (India)

    2014-07-01

    Highlights: • Melt viscosity of cesium loaded iron phosphate glasses is measured and reported for the first time. • Viscosity – temperature followed Arrhenius model. • Activation energy of viscous flow is strongly correlated to glass transition temperature of the glasses. • Process of crystallization of cesium loaded glass by approximation-free kinetic method to understand the mechanism. • Cesium loaded IPG and IPG shows bulk crystallization mechanism. - Abstract: This paper describes the melt viscosity behaviour and the crystallization mechanism of a series of iron phosphate glasses. High temperature viscosity measurements were carried out on pristine iron phosphate glass and a series of cesium loaded iron phosphate glasses in order to understand the effect of addition of Cs{sub 2}O on viscosity of iron phosphate glasses. Activation energy of viscous flow was estimated from the experimental data by applying Arrhenius model of viscosity–temperature relationship. Activation energy of viscous flow is observed to be strongly correlated to glass transition temperature of these glasses. Fragility of iron phosphate and cesium loaded iron phosphate glass systems were also evaluated in region of high temperature. Crystallization of these glasses was studied using thermal analysis techniques. Temperature integral approximation free method was utilized to evaluate the kinetic parameters such as activation energy of crystallization (E{sub c}) and Avrami exponent (n). The value of Avrami exponent ‘n’ obtained showed that the glasses under present study crystallize via bulk crystallization mechanism, i.e., nucleation and three dimensional growth.

  20. Cesium corrosion process in Fe–Cr steel

    International Nuclear Information System (INIS)

    A cesium corrosion out-pile test was performed to Fe–Cr steel in a simulated fuel pin environment. In order to specify the corrosion products, the corroded area was analyzed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). A cesium corrosion process in Fe–Cr steel was successfully developed proceeding from both experimental results and thermochemical consideration. The corroded area was mainly formed by Fe layer and Fe depleted oxidized layer. The Fe depleted oxidized layer was formed by Cr0.5Fe0.5 and Cr2O3. The presumed main corrosion reactions were 2Cr+2/3 O2→Cr2O3(ΔG650°C=-894.1kJ/mol) and Cr23C6+46Cs+46O2→23Cs2CrO4+6C(ΔG650°C=-25018.1kJ/mol). Factors of these reactions are chromium, carbon, oxygen and cesium. Therefore, cesium corrosion progression must be dependent on the chromium content, carbon content in the steel, the supply rate of oxygen and temperature which correlated with the diffusion rate of cesium and oxygen into the specimen

  1. Viscosity and crystallization mechanism of cesium loaded iron phosphate glasses

    International Nuclear Information System (INIS)

    Highlights: • Melt viscosity of cesium loaded iron phosphate glasses is measured and reported for the first time. • Viscosity – temperature followed Arrhenius model. • Activation energy of viscous flow is strongly correlated to glass transition temperature of the glasses. • Process of crystallization of cesium loaded glass by approximation-free kinetic method to understand the mechanism. • Cesium loaded IPG and IPG shows bulk crystallization mechanism. - Abstract: This paper describes the melt viscosity behaviour and the crystallization mechanism of a series of iron phosphate glasses. High temperature viscosity measurements were carried out on pristine iron phosphate glass and a series of cesium loaded iron phosphate glasses in order to understand the effect of addition of Cs2O on viscosity of iron phosphate glasses. Activation energy of viscous flow was estimated from the experimental data by applying Arrhenius model of viscosity–temperature relationship. Activation energy of viscous flow is observed to be strongly correlated to glass transition temperature of these glasses. Fragility of iron phosphate and cesium loaded iron phosphate glass systems were also evaluated in region of high temperature. Crystallization of these glasses was studied using thermal analysis techniques. Temperature integral approximation free method was utilized to evaluate the kinetic parameters such as activation energy of crystallization (Ec) and Avrami exponent (n). The value of Avrami exponent ‘n’ obtained showed that the glasses under present study crystallize via bulk crystallization mechanism, i.e., nucleation and three dimensional growth

  2. The diffusion of cesium, strontium, and europium in silicon carbide

    Science.gov (United States)

    Dwaraknath, S. S.; Was, G. S.

    2016-08-01

    A novel multi-layer diffusion couple was used to isolate the diffusion of strontium, europium and cesium in SiC without introducing radiation damage to SiC and at concentrations below the solubility limit for the fission products in SiC. Diffusion occurred by both bulk and grain boundary pathways for all three fission products between 900∘ C and 1 ,300∘ C. Cesium was the fastest diffuser below 1 ,100∘ C and the slowest above this temperature. Strontium and europium diffusion tracked very closely as a function of temperature for both bulk and grain boundary diffusion. Migration energies ranged from 1.0 eV to 5.7 eV for bulk diffusion and between 2.2 eV and 4.7 eV for grain boundary diffusion. These constitute the first measurements of diffusion of cesium, europium, and strontium in silicon carbide, and the magnitude of the cesium diffusion coefficient supports the premise that high quality TRISO fuel should have minimal cesium release.

  3. In situ7Li and 133Cs nuclear magnetic resonance investigations on the role of Cs+ additive in lithium-metal deposition process

    Science.gov (United States)

    Hu, Jian Zhi; Zhao, Zhenchao; Hu, Mary Y.; Feng, Ju; Deng, Xuchu; Chen, Xilin; Xu, Wu; Liu, Jun; Zhang, Ji-Guang

    2016-02-01

    Cesium ion (Cs+) has been reported to be an effective electrolyte additive to suppress Li dendrite growth which prevents the application of lithium (Li) metal as an anode for rechargeable Li batteries. In this work, we investigated the effect of Cs+ additive on Li depositions using quantitative in situ7Li and 133Cs nuclear magnetic resonance (NMR) with planar symmetric Li cells. It's found that the addition of Cs+ can significantly enhance both the formation of well aligned Li nanorods and reversibility of the Li electrode. In situ133Cs NMR directly confirms that Cs+ migrates to Li electrode to form a positively charged electrostatic shield during the charging process. Much more electrochemical "active" Li was found in Li films deposited with Cs+ additive, while more electrochemical "dead" and thicker Li rods were identified in Li films deposited without Cs+. Combining the in situ and the previous ex-situ results, a Li deposition model has been proposed to explain these observations.

  4. Dissociative excitation of cesium atom upon e-CsOH collisions

    International Nuclear Information System (INIS)

    The process of dissociative excitation of cesium atom in collisions with mono-kinetic molecules of cesium hydroxide is studied. It is established that behaviour of dissociative excitations the cesium atom in spectral series corresponds of to the grade dependence of cross sections on the main quantum number of the upper level. The values of constants, characterizing the behaviour of cross sections in the eight spectral series of the cesium atom are determined

  5. Increased plasma levels of microparticles expressing CD39 and CD133 in acute liver injury

    DEFF Research Database (Denmark)

    Schmelzle, Moritz; Splith, Katrin; Wiuff Andersen, Lars;

    2013-01-01

    BACKGROUND: We have previously demonstrated that CD133 and CD39 are expressed by hematopoietic stem cells (HSC), which are mobilized after liver injury and target sites of injury, limit vascular inflammation, and boost hepatic regeneration. Plasma microparticles (MP) expressing CD39 can block...... endothelial activation. Here, we tested whether CD133 MP might be shed in a CD39-dependent manner in a model of liver injury and could potentially serve as biomarkers of liver failure in the clinic. METHODS: Wild-type and Cd39-null mice were subjected to acetaminophen-induced liver injury. Mice were...

  6. Intercomparision of Standardized Radioactive Solution of 133Ba

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>133Ba is a very important nuclide in the field of radiation, for example applied to efficienency calibration of the γ spectromenter. To ensure the accurate and reliable of measurement results of 133Ba, to

  7. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of [sup 137]Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of [sup 137]Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope [sup 137]Cs releases have resulted in a negligible risk to the environment and the population it supports.

  8. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of {sup 137}Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of {sup 137}Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope {sup 137}Cs releases have resulted in a negligible risk to the environment and the population it supports.

  9. Rapid selection and proliferation of CD133+ cells from cancer cell lines: chemotherapeutic implications.

    Directory of Open Access Journals (Sweden)

    Sarah E Kelly

    Full Text Available Cancer stem cells (CSCs are considered a subset of the bulk tumor responsible for initiating and maintaining the disease. Several surface cellular markers have been recently used to identify CSCs. Among those is CD133, which is expressed by hematopoietic progenitor cells as well as embryonic stem cells and various cancers. We have recently isolated and cultured CD133 positive [CD133+] cells from various cancer cell lines using a NASA developed Hydrodynamic Focusing Bioreactor (HFB (Celdyne, Houston, TX. For comparison, another bioreactor, the rotary cell culture system (RCCS manufactured by Synthecon (Houston, TX was used. Both the HFB and the RCCS bioreactors simulate aspects of hypogravity. In our study, the HFB increased CD133+ cell growth from various cell lines compared to the RCCS vessel and to normal gravity control. We observed a +15-fold proliferation of the CD133+ cellular fraction with cancer cells that were cultured for 7-days at optimized conditions. The RCCS vessel instead yielded a (-4.8-fold decrease in the CD133+cellular fraction respect to the HFB after 7-days of culture. Interestingly, we also found that the hypogravity environment of the HFB greatly sensitized the CD133+ cancer cells, which are normally resistant to chemo treatment, to become susceptible to various chemotherapeutic agents, paving the way to less toxic and more effective chemotherapeutic treatment in patients. To be able to test the efficacy of cytotoxic agents in vitro prior to their use in clinical setting on cancer cells as well as on cancer stem cells may pave the way to more effective chemotherapeutic strategies in patients. This could be an important advancement in the therapeutic options of oncologic patients, allowing for more targeted and personalized chemotherapy regimens as well as for higher response rates.

  10. Controllable evaporation of cesium from a dispenser oven

    Science.gov (United States)

    Fantz, U.; Friedl, R.; Fröschle, M.

    2012-12-01

    This instrument allows controlled evaporation of the alkali metal cesium over a wide range of evaporation rates. The oven has three unique features. The first is an alkali metal reservoir that uses a dispenser as a cesium source. The heating current of the dispenser controls the evaporation rate allowing generation of an adjustable and stable flow of pure cesium. The second is a blocking valve, which is fully metallic as is the body of the oven. This construction both reduces contamination of the dispenser and enables the oven to be operated up to 300 °C, with only small temperature variations (metal at a cold spot is significantly hindered. The last feature is an integral surface ionization detector for measuring and controlling the evaporation rate. The dispenser oven can be easily transferred to the other alkali-metals.

  11. Dating of mine waste in lacustrine sediments using cesium-137

    Science.gov (United States)

    Rember, W. C.; Erdman, T. W.; Hoffmann, M. L.; Chamberlain, V. E.; Sprenke, K. F.

    1993-11-01

    For over a century Medicine Lake in northern Idaho has received heavy-metal-laden tailings from the Coeur d'Alene mining district. Establishing the depositional chronology of the lake bottom sediments provides information on the source and rate of deposition of the tailings. Cesium-137, an isotope produced in the atmosphere by nuclear bomb tests, was virtually absent in the environment prior to 1951, but reached its apex in 1964. Our analysis of cesium-137 in the sediments of Medicine Lake revealed that 14 cm of fine-grained tailings were deposited in the lake from 1951 to 1964 and tailing deposition downstream was greatly reduced by the installation of tailings dams in the district in 1968. Cesium-137 analysis is accomplished by a fairly simple gamma-ray counting technique and should be a valuable tool for analyzing sedimentation in any lacustrine environment that was active during the 1950s and 1960s.

  12. Cesium 137 in oils and plants from Guatemala

    International Nuclear Information System (INIS)

    Since 1990 the project of radioactive and environmental contamination started in Guatemala. Studies about the radioactive contamination levels are made within the framework of this project. Cesium-137 has been an interest radionuclide, because it is a fission product released to the environment by the use of nuclear weapons and nuclear power plants accidents. The sampling consisted in collection of soil and grass in 20 provinces of Guatemala, one point by province, and it was made in 1990. The cesium-137 concentration in the samples, was determined by gamma spectrometry, using an hyper pure germanium detector. The results show the presence of radioactive contamination in soil and grass due to cesium-137, at levels that might be considered as normal. The levels found are not harmful for human health, and its importance is the fact that can be used as reference levels for the environmental radioactivity monitoring in Guatemala

  13. Study of radiatively sustained cesium plasmas for solar energy conversion

    Science.gov (United States)

    Palmer, A. J.; Dunning, G. J.

    1980-01-01

    The results of a study aimed at developing a high temperature solar electric converter are reported. The converter concept is based on the use of an alkali plasma to serve as both an efficient high temperature collector of solar radiation as well as the working fluid for a high temperature working cycle. The working cycle is a simple magnetohydrodynamic (MHD) Rankine cycle employing a solid electrode Faraday MHD channel. Research milestones include the construction of a theoretical model for coupling sunlight in a cesium plasma and the experimental demonstration of cesium plasma heating with a solar simulator in excellent agreement with the theory. Analysis of a solar MHD working cycle in which excimer laser power rather than electric power is extracted is also presented. The analysis predicts a positive gain coefficient on the cesium-xenon excimer laser transition.

  14. 21 CFR 133.186 - Sap sago cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  15. Deletion 22q13.3 syndrome

    OpenAIRE

    Phelan Mary C

    2008-01-01

    Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndr...

  16. 27 CFR 40.133 - Amount of individual bond.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Amount of individual bond. 40.133 Section 40.133 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU..., AND PROCESSED TOBACCO Bonds and Extensions of Coverage of Bonds § 40.133 Amount of individual...

  17. 21 CFR 133.124 - Cold-pack cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cold-pack cheese food. 133.124 Section 133.124 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Cheese and Related Products § 133.124 Cold-pack cheese food. (a)(1) Cold-pack cheese food is the...

  18. 46 CFR 133.130 - Stowage of survival craft.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Stowage of survival craft. 133.130 Section 133.130... SYSTEMS Requirements for All OSVs § 133.130 Stowage of survival craft. (a) General. Each survival craft must be stowed as follows: (1) Each survival craft must be as close to the accommodation and...

  19. 19 CFR 133.21 - Articles bearing counterfeit trademarks.

    Science.gov (United States)

    2010-04-01

    ...: “The sample described as and provided pursuant to 19 CFR 133.21(d) was (damaged/destroyed/lost) during... 19 Customs Duties 1 2010-04-01 2010-04-01 false Articles bearing counterfeit trademarks. 133.21... Recorded Trademarks or Recorded Trade Names § 133.21 Articles bearing counterfeit trademarks....

  20. 23 CFR 1.33 - Conflicts of interest.

    Science.gov (United States)

    2010-04-01

    ... § 1.33 Conflicts of interest. No official or employee of a State or any other governmental... 23 Highways 1 2010-04-01 2010-04-01 false Conflicts of interest. 1.33 Section 1.33 Highways... project shall have, directly or indirectly, any financial or other personal interest in any such...

  1. 22 CFR 133.635 - Drug-free workplace.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Drug-free workplace. 133.635 Section 133.635 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.635 Drug-free workplace. Drug-free workplace means a site for...

  2. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Directory of Open Access Journals (Sweden)

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  3. Small cluster ions from source of negative ions by cesium sputtering

    CERN Document Server

    Wang, X M; Shao, L; Liu, J R; Chu, W K

    2002-01-01

    We investigated the delivery of small cluster ions using a source of negative ions by cesium sputtering (SNICS). The negative cluster ions of B sub n , C sub n , Si sub n , Co sub n , Cu sub n , Ge sub n , Au sub n , GeB sub n and SiB sub n have been extracted by SNICS. Adequate beam current of some small clusters was obtained by changing several parameters for cluster ion yield. After a comprehensive study of the operation parameters, such as target material selection, target geometry, sputtering voltage and current, the small cluster ion current can be increased by several orders of magnitude, with little change on the monomer ion yield.

  4. Structural analysis of alkali cations in mixed alkali silicate glasses by 23Na and 133Cs MAS NMR

    Directory of Open Access Journals (Sweden)

    T. Minami

    2014-12-01

    Full Text Available We report the structural analysis of Na+ and Cs+ in sodium cesium silicate glasses by using 23Na and 133Cs magic-angle spinning nuclear magnetic resonance (MAS NMR spectroscopy. In the NMR spectra of cesium silicate crystals, the peak position shifted to higher magnetic field for structures with larger Cs+ coordination numbers and to lower magnetic field for smaller Cs+ coordination numbers. The MAS NMR spectra of xNa2O-yCs2O-2SiO2 (x = 0, 0.2, 0.33, 0.5, 0.66, 0.8, 1.0; x + y = 1 glass reveal that the average coordination number of both the alkali cations decreases with increasing Cs+/(Na+ + Cs+ ratio. In addition, the coordination number of Na+ in xNa2O-yCs2O-2SiO2 glass is smaller than that of Cs+. This difference between the average coordination numbers of the alkali cations is considered to be one structural reason of the mixed alkali effect.

  5. Sorption of cesium in young till soils

    Energy Technology Data Exchange (ETDEWEB)

    Lusa, Merja; Lempinen, Janne; Ahola, Hanna; Soederlund, Mervi; Lehto, Jukka [Helsinki Univ. (Finland). Laboratory of Radiochemistry; Lahdenperae, Anne-Maj [Saanio and Riekkola Oy, Consulting Engineers, Helsinki (Finland); Ikonen, Ari T.K. [Posiva Oy, Eurajoki (Finland)

    2014-10-01

    Soil samples from three forest soil pits were examined down to a depth of approximately three metres using 1 M ammonium acetate extraction and microwave-assisted extraction with concentrated nitric acid (HNO{sub 3}), to study the binding of cesium (Cs) at Olkiluoto Island, southern Finland. Ammonium acetate was used to extract the readily exchangeable Cs fractions roughly representing the Cs fraction in soil which is available for plants. Microwave-assisted HNO{sub 3} extraction dissolves various minerals, e.g. carbonates, most sulphides, arsenides, selenides, phosphates, molybdates, sulphates, iron (Fe) and manganese (Mn) oxides and some silicates (olivine, biotite, zeolite), and reflects the total Cs concentrations. Cs was mostly found in the strongly bound fraction obtained through HNO{sub 3} extraction. The average Cs concentrations found in this fraction were 3.53 ± 0.30 mg/kg (d.w.), 3.06 ± 1.86 mg/kg (d.w.) and 1.83 ± 0.42 mg/kg (d.w.) in the three soil pits, respectively. The average exchangeable Cs found in the ammonium acetate extraction in all three sampling pits was 0.015 ± 0.008 mg/kg (d.w.). In addition, Cs concentrations in the soil solution were determined and in situ distribution coefficients (K{sub d}) for Cs were calculated. Furthermore, the in situ K{sub d} data was compared with the Cs K{sub d} data obtained using the model batch experiments. The in situ K{sub d} values were observed to fairly well follow the trend of batch sorption data with respect to soil depth, but on average the batch distribution coefficients were almost an order of magnitude higher than the in situ K{sub d} data. In situ Cs sorption data could be satisfactory fitted with the Langmuir sorption isotherm, but the Freundlich isotherm failed to fit the data. Finally, distribution coefficients were calculated by an ion exchange approach using soil solution data, the cation exchange capacity (CEC) as well as Cs to sodium (Na) and Cs to potassium (K) ion exchange selectivity

  6. Production of negative D- ions by double charge exchange using cesium

    International Nuclear Information System (INIS)

    The first experimental results on the source of D- negative ions developed at SIG confirm a certain number of essential points: (1) the use of a positive ion source obtained by a resonance electronic cyclotron permits the production of D+ ion beams with a very small gas output, therefore it has a very good gas efficiency; (2) the supersonic cesium target obtained after the release of a high temperature cesium vapor functions perfectly with the desired characteristics; (3) the conversion efficiency measured in D- ions is close to those which were deduced from experimental cross sections; and (4) the mean density of D- ion currents is on the order of 10 mA/cm2 at 1 keV. They could be 15 at 25 mA/cm2 at 300 eV. This presupposes that we modify the extraction optic for the D+ ions to extract 60 at 70 mA/cm2 of D+ at 300 eV with a maximum electric field of 30 DV/cm and a greater perveance of the optic

  7. Cesium-137 Levels Detected in Otters from Austria

    Directory of Open Access Journals (Sweden)

    Gutleb A.C.

    1991-02-01

    Full Text Available Pollution seems to be one of the most important causes for the decline of the European otter (Lutra lutra. The accident in the Chernobyl nuclear power plant added another aspect to environmental pollution. Few data on cesium-137 contents in otters are available, so levels were measured in 3 otters from Austria. All levels found were very low.

  8. Membrane-based separation technologies for cesium, strontium, and technetium

    Energy Technology Data Exchange (ETDEWEB)

    Kafka, T.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with 3M, St. Paul, Minnesota, working in cooperation with IBC Advanced Technologies, American Fork, Utah.

  9. Discovery of Cesium, Lanthanum, Praseodymium and Promethium Isotopes

    OpenAIRE

    May, E.; Thoennessen, M

    2011-01-01

    Currently, forty-one cesium, thirty-five lanthanum, thirty-two praseodymium, and thirty-one promethium, isotopes have been observed and the discovery of these isotopes is discussed here. For each isotope a brief synopsis of the first refereed publication, including the production and identification method, is presented.

  10. Strontium-90 and cesium-137 in fresh water

    International Nuclear Information System (INIS)

    Japan Chemical Analysis Center has analysed the strontium-90 and Cesium-137 contents in fresh water from 7 prefectures in Japan by the commission of Science and Technology Agency of Japanese Government. The method described in ''Radioactivity Survey Data in Japan No. 43 (NIRS-RSD-43, 1977) was applied to the analysis of these two radionuclides in samples. (author)

  11. CD133+ cells contribute to radioresistance via altered regulation of DNA repair genes in human lung cancer cells

    International Nuclear Information System (INIS)

    Background: Radioresistance in human tumors has been linked in part to a subset of cells termed cancer stem cells (CSCs). The prominin 1 (CD133) cell surface protein is proposed to be a marker enriching for CSCs. We explore the importance of DNA repair in contributing to radioresistance in CD133+ lung cancer cells. Materials and methods: A549 and H1299 lung cancer cell lines were used. Sorted CD133+ cells were exposed to either single 4 Gy or 8 Gy doses and clonogenic survival measured. ϒ-H2AX immunofluorescence and quantitative real time PCR was performed on sorted CD133+ cells both in the absence of IR and after two single 4 Gy doses. Lentiviral shRNA was used to silence repair genes. Results: A549 but not H1299 cells expand their CD133+ population after single 4 Gy exposure, and isolated A549 CD133+ cells demonstrate IR resistance. This resistance corresponded with enhanced repair of DNA double strand breaks (DSBs) and upregulated expression of DSB repair genes in A549 cells. Prior IR exposure of two single 4 Gy doses resulted in acquired DNA repair upregulation and improved repair proficiency in both A549 and H1299. Finally Exo1 and Rad51 silencing in A549 cells abrogated the CD133+ IR expansion phenotype and induced IR sensitivity in sorted CD133+ cells. Conclusions: CD133 identifies a population of cells within specific tumor types containing altered expression of DNA repair genes that are inducible upon exposure to chemotherapy. This altered gene expression contributes to enhanced DSB resolution and the radioresistance phenotype of these cells. We also identify DNA repair genes which may serve as promising therapeutic targets to confer radiosensitivity to CSCs

  12. MicroRNA-133a suppresses multiple oncogenic membrane receptors and cell invasion in non-small cell lung carcinoma.

    Directory of Open Access Journals (Sweden)

    Lu-Kai Wang

    Full Text Available Non-small cell lung cancers (NSCLCs cause high mortality worldwide, and the cancer progression can be activated by several genetic events causing receptor dysregulation, including mutation or amplification. MicroRNAs are a group of small non-coding RNA molecules that function in gene silencing and have emerged as the fine-tuning regulators during cancer progression. MiR-133a is known as a key regulator in skeletal and cardiac myogenesis, and it acts as a tumor suppressor in various cancers. This study demonstrates that miR-133a expression negatively correlates with cell invasiveness in both transformed normal bronchial epithelial cells and lung cancer cell lines. The oncogenic receptors in lung cancer cells, including insulin-like growth factor 1 receptor (IGF-1R, TGF-beta receptor type-1 (TGFBR1, and epidermal growth factor receptor (EGFR, are direct targets of miR-133a. MiR-133a can inhibit cell invasiveness and cell growth through suppressing the expressions of IGF-1R, TGFBR1 and EGFR, which then influences the downstream signaling in lung cancer cell lines. The cell invasive ability is suppressed in IGF-1R- and TGFBR1-repressed cells and this phenomenon is mediated through AKT signaling in highly invasive cell lines. In addition, by using the in vivo animal model, we find that ectopically-expressing miR-133a dramatically suppresses the metastatic ability of lung cancer cells. Accordingly, patients with NSCLCs who have higher expression levels of miR-133a have longer survival rates compared with those who have lower miR-133a expression levels. In summary, we identified the tumor suppressor role of miR-133a in lung cancer outcome prognosis, and we demonstrated that it targets several membrane receptors, which generally produce an activating signaling network during the progression of lung cancer.

  13. Some aspects of cesium deposition in Transilvania (Romania)

    International Nuclear Information System (INIS)

    Following the accident of the Chernobyl atomic electric power station, a great quantity of radionuclides (∼100MCi) escaped from the reactor. It was estimated that 13% of the inventory activity of cesium representing 1.5-2 MCi left the reactor. The radioactive deposits were very nonuniform for the same distance and in the same direction from Chernobyl nuclear center having a close dependence upon direction and speed of wind and pluviometric conditions. The rains, especially the storms, spectacularly increased the radioactive fallout. Although, for the first two-three days, subsequent to accident, the meteorological conditions were favorable for Romania, after April 29/30, because of the changing in the wind direction on SW (initial it was N and NW) the countries were on this direction - Romania, Bulgaria, Greece, former Yugoslavia - began to be intensely contaminated with radioactive fallout. In Romania, the radioactive cloud passing coincided with abundant rains, especially on the direction mentioned above. On this direction, the cesium deposits are of 8-2 times larger than other Romanian regions. The torrential rain which fell on May 1st 1986, in the western side of Cluj Napoca town caused an intense contamination especially with short-life isotopes as Te, I, Ba, La, Mo. Medium and long-life isotopes as Ru, Zr, Cs, Sr were present in large quantities in this area.too. For the total contribution the value obtained was 1130 kBq/m2, much larger than the average in Romania. This work presents data about cesium content of pollen samples gathered daily between 1-30 May 1986; cesium deposits in five areas and some measurements in connection with cesium mitigation in soils

  14. Radiological protection and calibration of an activity meter with cesium and barium sources in a nuclear medicine center; Proteccion radiologica y calibracion de un activimetro con fuentes de cesio y bario en un centro de medicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Morales L, M.E. [IPEN INEN Centro de Medicina Nuclear, Av. Aviacion 3799, Lima 34 (Peru)

    2005-07-01

    Presently work is shown the results when gauging a team Deluxe Isotope (Caliper 11) with some sources of Cesium 137 and Barium 133, in a Center of Medicine Nuclear that operates from the anus 1983 in a modern building inside the one Institute of Illnesses Neoplasia (Inn). This Center was equipped initially with teams donated by the International Organism of Atomic Energy (Oa) with those that it develops assistance, educational works and of investigation, giving services to patient of the Inn and other public and private medical centers. (Author)

  15. Distribution and retention of cesium and strontium in Swedish boreal forest ecosystems

    International Nuclear Information System (INIS)

    The retention and distribution of cesium, and to some extent strontium, in forest environments are being studied at three sites in Sweden. The main part of the cesium found in the soil was recovered in horizons rich in organic matter. The cesium was retained in the soil organic matter in a more or less extractable form. As different soil types have a different distribution pattern of organic matter, the distribution of cesium will depend on the forest soil type. The clay content in Swedish forest soils is, in general, low which will mitigate the retention of cesium in the soil mineral horizons. The cesium and strontium present in the trees was considered to be an effect of assimilation by the tissues in the canopy as well as by the roots. The redistribution of cesium within the trees was extensive which was considered to be the effect of a high mobility of cesium in the trees. The recovery of strontium-90 in pines, in relation to the deposition rate was higher compared to the relative recovery of cesium-137, 30 years after deposition. The cesium and strontium will remain in the forest environment for a considerable time but can be reduced by forest practice, by leaching out of the soil profile or by radioactive decay

  16. CD133在肺癌中的研究与进展%Research and advance of CD133 in lung cancer

    Institute of Scientific and Technical Information of China (English)

    于会娜; 莫碧文

    2011-01-01

    Lung carcinoma is one of the most common cause of cancer-related death in the world,and is also one of the most common malignant tumors in China. It is difficult to cure because of its high-grade malignancy and rapid progress. Cancer stem cells (CSC) is a small part of tumor cells with self-renewal, unlimited proliferation and multi-differentiation capacity in tumor tissue. While CSC has small proportion in the tumor tissue, it is closely related with tumor origin, development and metastasis, and thus considered as a potential target to eradicate tumors. CD133 is a transmembrane glycoprotein found in human hematopoietic stem cells, which is thought as a surface marker of several stem cells. CD133+ cells are associated with tumor metastasis and tumor microvessels formation. Tumor relapse could be detected by quantitative CD133 mRNA expression. CD133 is also the biomarker of CSC of lung cancer. So this paper reviews CD133 and the related research in lung cancer.%肺癌是世界范围内死亡率最高的恶性肿瘤之一,也是我国常见的恶性肿瘤之一,恶性程度高,发展迅速,治疗困难,总体疗效不理想。肿瘤干细胞是肿瘤组织中一小部分具有自我更新、无限增殖和多向分化能力的肿瘤细胞,它在肿瘤组织中所占比例虽然很少,却与肿瘤起源、发展与转移关系密切,因此肿瘤干细胞被看作是一个根除癌症的潜在目标。CD133是在人类造血干细胞中发现的一种跨膜糖蛋白,并认为是多种干细胞的表面标志之一,并且CD133+细胞与肿瘤的转移、肿瘤的血管生成都有关系。另外研究者报道,可通过检测CD133 mRNA水平预测肿瘤的复发,并且认为可以作为某些肿瘤的预后指标。因此,有人认为CD133可能是肺癌干细胞的肿瘤标记物。本文就CD133在肺癌中的研究加以综述。

  17. Evaluation of in vivo antitumor effects of low-frequency ultrasound-mediated miRNA-133a microbubble delivery in breast cancer.

    Science.gov (United States)

    Ji, Yanlei; Han, Zhen; Shao, Limei; Zhao, Yuehuan

    2016-09-01

    MicroRNAs (miRNAs), as a novel class of small noncoding RNAs, have been identified as important transcriptional and posttranscriptional inhibitors of gene expression. Ultrasound-targeted microbubble destruction (UTMD) is a noninvasive method for microRNA delivery. We aimed to investigate the effect of UTMD of miR-133a on breast cancer treatment. It has been reported that miRNA-133a is involved in various cancers. miR-133a was lowly expressed in breast cancer tissues and breast cancer cell lines MCF-7 and MDA-MB-231. The miR-133a expression was significantly upregulated under exogenous miRNA-133a treatment in MCF-7 and MDA-MB-231 cells analyzed by qRT-PCR. Exogenous miR-133a promoted the cell proliferation as determined by diphenyl tetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine (EdU) staining. Epidermal growth factor receptor (EGFR) expression and Akt phosphorylation were significantly suppressed after miR-133a transfection by western blot detection. We prepared the miR-133a-microbubble and injected it into breast cancer xenografts. The miR-133a-microbubble injection prolonged miR-133a circulatory time by detecting the amount of miRNA-133a in the plasma. No significant toxicity was observed on alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels at liver and albumin, blood urea nitrogen, or creatine kinase levels at kidney after miR-133a-microbubble injection. The tumor size of miR-133a-microbubble-injected mice was smaller than that of the control group. Furthermore, the delivery efficiency of miR-133a with low frequency was higher than that with common frequency. miR-133a suppressed cell proliferation by suppressing the expression of EGFR and the phosphorylation of Akt. UTMD of miR-133a inhibited the tumor growth and improved the survival rate in breast cancer mice. Our study provides new evidence that UTMD of miRNA is a promising platform for breast cancer therapy. PMID:27465833

  18. Estimation of Physical Properties of AN-107 Cesium and Technetium Eluate Blend

    Energy Technology Data Exchange (ETDEWEB)

    Choi, A.S.

    2001-06-12

    The objective of this study, as defined in the associated test specifications and task technical and quality assurance plan, was to estimate all the physical properties that are required to design the storage and transport facilities for the concentrated cesium and technetium eluates. Specifically, the scope of this study included: (1) modeling of the aqueous electrolyte chemistry of Tank 241-AN-107 Cs and Tc eluate evaporators, (2) process modeling of semi-batch and continuous evaporation operations, (3) determination of the operating vacuum and target endpoint of each evaporator, (4) calculation of the physical properties of the concentrated Cs and Tc eluate blend, and (5) development of the empirical correlations for the physical properties thus estimated.

  19. Modulation by cocaine of dopamine receptors through miRNA-133b in zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    Katherine Barreto-Valer

    Full Text Available The use of cocaine during pregnancy can affect the mother and indirectly might alter the development of the embryo/foetus. Accordingly, in the present work our aim was to study in vivo (in zebrafish embryos the effects of cocaine on the expression of dopamine receptors and on miR-133b. These embryos were exposed to cocaine hydrochloride (HCl at 5 hours post-fertilization (hpf and were then collected at 8, 16, 24, 48 and 72 hpf to study the expression of dopamine receptors, drd1, drd2a, drd2b and drd3, by quantitative real time PCR (qPCR and in situ hybridization (ISH, only at 24 hpf. Our results indicate that cocaine alters the expression of the genes studied, depending on the stage of the developing embryo and the type of dopamine receptor. We found that cocaine reduced the expression of miR-133b at 24 and 48 hpf in the central nervous system (CNS and at the periphery by qPCR and also that the spatial distribution of miR-133b was mainly seen in somites, a finding that suggests the involvement of miR-133b in the development of the skeletal muscle. In contrast, at the level of the CNS miR-133b had a weak and moderate expression at 24 and 48 hpf. We also analysed the interaction of miR-133b with the Pitx3 and Pitx3 target genes drd2a and drd2b, tyrosine hydroxylase (th and dopamine transporter (dat by microinjection of the Pitx3-3'UTR sequence. Microinjection of Pitx3-3'UTR affected the expression of pitx3, drd2a, drd2b, th and dat. In conclusion, in the present work we describe a possible mechanism to account for cocaine activity by controlling miR-133b transcription in zebrafish. Via miR-133b cocaine would modulate the expression of pitx3 and subsequently of dopamine receptors, dat and th. These results indicate that miRNAs can play an important role during embryogenesis and in drug addiction.

  20. Measurement of parity violation in the 6S-7S transition of cesium using stimulated emission; Mesure de la violation de la parite sur la transition 6S-7S du cesium par emission stimulee dans une vapeur atomique

    Energy Technology Data Exchange (ETDEWEB)

    Lintz, M

    2005-11-15

    This document describes the design and implementation of a pump-probe polarimetry experiment in a cesium vapor, aiming at a 1% precision measurement of atomic parity violation (APV) induced by Z{sup 0} boson exchange. The experimental scheme, relying on induced emission by a probe laser, allows a detection efficiency close to unity, and the left-right asymmetry to be measured is amplified during the propagation of the probe beam in the excited vapour. The interest of the result presented here is to cross-check the unique previous result by an experiment with a completely different design, and hence with completely different systematics, that also allows measurements on long-lived isotopes especially {sup 135}Cs (nuclear spin 7/2 like {sup 133}Cs, half-life 3 million years). We have demonstrated improvements in polarimetry techniques (rejection of instrumental errors, implementation of a polarization magnifier), especially in pulsed polarimetry (doubly-differential, balanced-mode polarization analysis). But most importantly, the expected pump-probe chiral optical gain has been observed in a Cs vapor. The precision on the {theta}{sup pv} measurement has been improved to 2.6%, and the achieved signal/noise ratio allows measurements at the 1% precision level. The achieved precision on lm E{sub 1}{sup pv} is 2 x 10{sup -13} ea{sub 0}, 15 times better than the measurements obtained with the lead and thallium atoms. Our result is in agreement with the more precise Boulder result. The required amount of cesium is small enough to allow a measurement with {sup 135}Cs provided one takes reasonable radioprotection measures. (author)

  1. Cesium-137, a drama recounted; Cesio-137, um drama recontado

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Suzane de Alencar

    2013-01-15

    The radiological accident with Cesium-137, which started on Goiania in 1987, did not stop with the end of radiological contamination and continues in a judicial, scientific and narrative process of identification and recognition of new victims. The drama occupies a central place on the dynamics of radiological event, as it extends its limits, inflects its intensity and updates the event. As a narrative of the event, the ethnography incorporates and brings up to date the drama as an analysis landmark and the description of the theme as it is absorbed by a dramatic process. Cesium-137, a drama recounted is a textual experimentation based on real events and characters picked out from statements reported in various narratives about the radiological accident. (author)

  2. Trapping and cooling cesium atoms in a speckle field

    International Nuclear Information System (INIS)

    We present the results of two experiments where cold cesium atoms are trapped in a speckle field. In the first experiment, a YAG laser creates the speckle pattern and induces a far-detuned dipole potential which is a nearly-conservative potential. Localization of atoms near the intensity maxima of the speckle field is observed. In a second experiment we use two counterpropagating laser beams tuned close to a resonance line of cesium and in the lin perpendicular to lin configuration, one of them being modulated by a holographic diffuser that creates the speckle field. Three-dimensional cooling is observed. Variations of the temperature and of the spatial diffusion coefficient with the size of a speckle grain are presented. (orig.)

  3. Kelvin Probe Studies of Cesium Telluride Photocathode for AWA Photoinjector

    CERN Document Server

    Wisniewski, Eric; Yusof, Zikri; Spentzouris, Linda; Terry, Jeff; Harkay, Katherine

    2012-01-01

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (~50 nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating.

  4. Cesium exchange reaction on natural and modified clinoptilolite zeolites

    International Nuclear Information System (INIS)

    Cesium cation exchange reaction with K, Na, Ca and Mg ions on natural and modified clinoptilolite has been studied. Batch cation-exchange experiments were performed by placing 0.5 g of clinoptilolite into 10 ml or 20 ml of 1 x 10-3M CsCl solution for differing times. Two type deposits of clinoptilolite zeolites from, Nizny Hrabovec (NH), Slovakia and Metaxades (MX), Greece were used for ion-exchange study. The distribution coefficient (Kd) and sorption capacity (Γ) were evaluated. For the determination of K, Na, Ca and Mg isotachophoresis method, the most common cations in exchange reaction was used. Cesium sorption was studied using 137Cs tracer and measured by γ-spectrometry. (author)

  5. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    International Nuclear Information System (INIS)

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations. The process, described by a three-level model with the Λ scheme, shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms. The |Fg = 3> → |Fe = 4> resonance pumping can result in the ground state |Fg = 4, mF = 4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg = 4. To enhance the anisotropy in the ground state, we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg = 4> → |Fe = 3> transition, in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field. (atomic and molecular physics)

  6. Studies on the Separation of Cesium From Fission Products

    Institute of Scientific and Technical Information of China (English)

    QIANLi-juan; ZHANGSheng-dong; GUOJing-ru; CUIAn-zhi; YANGLei; WUWang-suo

    2003-01-01

    135Cs is a long-life fission product. When measuring its thermal cross section, we must separate radiochemical purity cesium from fission products. Except for decontaminating radio- nuclides, others which can be activated must be avoided to come into solution. So ion exchanger is used. Inorganic ion exchangers have received increased attention because of their high resistance to radiation and their very efficient separation of alkali metal ions.

  7. Optimized production of a cesium Bose-Einstein condensate

    OpenAIRE

    Kraemer, Tobias; Herbig, Jens; Mark, Michael; Weber, Tino; Chin, Cheng; Naegerl, Hanns-Christoph; Grimm, Rudolf

    2004-01-01

    We report on the optimized production of a Bose-Einstein condensate of cesium atoms using an optical trapping approach. Based on an improved trap loading and evaporation scheme we obtain more than $10^5$ atoms in the condensed phase. To test the tunability of the interaction in the condensate we study the expansion of the condensate as a function of scattering length. We further excite strong oscillations of the trapped condensate by rapidly varying the interaction strength.

  8. Radioactive cesium. Dynamics and transport in forestal food-webs

    International Nuclear Information System (INIS)

    This report summarises results from a radioecological study during 1994-1995 concerning turnover, redistribution and loss of radioactive Cesium (134 and 137) in boreal forest ecosystems, as well as uptake and transfer in important food-chains over moose, vole and vegetation. The basis for this report are 9 publications published 1994-95. These reports are presented in summary form. 9 refs, 17 figs

  9. Electrically switched cesium ion exchange. FY 1997 annual report

    International Nuclear Information System (INIS)

    This paper describes the Electrically Switched Ion Exchange (ESIX) separation technology being developed as an alternative to ion exchange for removing radionuclides from high-level waste. Progress in FY 1997 for specific applications of ESIX is also outlined. The ESIX technology, which combines ion exchange and electrochemistry, is geared toward producing electroactive films that are highly selective, regenerable, and long lasting. During the process, ion uptake and elution can be controlled directly by modulating the potential of an ion exchange film that has been electrochemically deposited onto a high surface area electrode. This method adds little sodium to the waste stream and minimizes the secondary wastes associated with traditional ion exchange techniques. Development of the ESIX process is well underway for cesium removal using ferrocyanides as the electroactive films. Films having selectivity for perrhenate (a pertechnetate surrogate) over nitrate also have been deposited and tested. Based on the ferrocyanide film capacity, stability, rate of uptake, and selectivity shown during performance testing, it appears possible to retain a consistent rate of removal and elute cesium into the same elution solution over several load/unload cycles. In batch experiments, metal hexacyanoferrate films showed high selectivities for cesium in concentrated sodium solutions. Cesium uptake was unaffected by Na/Cs molar ratios of up to 2 x 104 , and reached equilibrium within 18 hours. During engineering design tests using 60 pores per inch, high surface area nickel electrodes, nickel ferrocyanide films displayed continued durability. losing less than 20% of their capacity after 1500 load/unload cycles. Bench-scale flow system studies showed no change in capacity or performance of the ESIX films at a flow rate up to 13 BV/h, the maximum flow rate tested, and breakthrough curves further supported once-through waste processing. 9 refs., 24 figs

  10. Corrections to our results for optical nanofiber traps in Cesium

    CERN Document Server

    Ding, D; Choi, K S; Kimble, H J

    2012-01-01

    Several errors in Refs. [1, 2] are corrected related to the optical trapping potentials for a state-insensitive, compensated nanofiber trap for the D2 transition of atomic Cesium. Section I corrects our basic formalism in Ref. [1] for calculating dipole-force potentials. Section II corrects erroneous values for a partial lifetime and a transition wavelength in Ref. [1]. Sections III and IV present corrected figures for various trapping configurations considered in Refs. [1] and [2], respectively.

  11. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  12. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  13. Adiponectin Upregulates MiR-133a in Cardiac Hypertrophy through AMPK Activation and Reduced ERK1/2 Phosphorylation.

    Directory of Open Access Journals (Sweden)

    Ying Li

    Full Text Available Adiponectin and miR-133a are key regulators in cardiac hypertrophy. However, whether APN has a potential effect on miR-133a remains unclear. In this study, we aimed to investigate whether APN could regulate miR-133a expression in Angiotensin II (Ang II induced cardiac hypertrophy in vivo and in vitro. Lentiviral-mediated adiponectin treatment attenuated cardiac hypertrophy induced by Ang II infusion in male wistar rats as determined by reduced cell surface area and mRNA levels of atrial natriuretic peptide (ANF and brain natriuretic peptide (BNP, also the reduced left ventricular end-diastolic posterior wall thickness (LVPWd and end-diastolic interventricular septal thickness (IVSd. Meanwhile, APN elevated miR-133a level which was downregulated by Ang II. To further investigate the underlying molecular mechanisms, we treated neonatal rat ventricular myocytes (NRVMs with recombinant rat APN before Ang II stimulation. Pretreating cells with recombinant APN promoted AMP-activated protein kinase (AMPK phosphorylation and inhibited ERK activation. By using the inhibitor of AMPK or a lentiviral vector expressing AMPK short hairpin RNA (shRNA cancelled the positive effect of APN on miR-133a. The ERK inhibitor PD98059 reversed the downregulation of miR-133a induced by Ang II. These results indicated that the AMPK activation and ERK inhibition were responsible for the positive effect of APN on miR-133a. Furthermore, adiponectin receptor 1 (AdipoR1 mRNA expression was inhibited by Ang II stimulation. The positive effects of APN on AMPK activation and miR-133a, and the inhibitory effect on ERK phosphorylation were inhibited in NRVMs transfected with lentiviral AdipoR1shRNA. In addition, APN depressed the elevated expression of connective tissue growth factor (CTGF, a direct target of miR-133a, through the AMPK pathway. Taken together, our data indicated that APN reversed miR-133a levels through AMPK activation, reduced ERK1/2 phosphorylation in

  14. MODELING RESULTS FROM CESIUM ION EXCHANGE PROCESSING WITH SPHERICAL RESINS

    Energy Technology Data Exchange (ETDEWEB)

    Nash, C.; Hang, T.; Aleman, S.

    2011-01-03

    Ion exchange modeling was conducted at the Savannah River National Laboratory to compare the performance of two organic resins in support of Small Column Ion Exchange (SCIX). In-tank ion exchange (IX) columns are being considered for cesium removal at Hanford and the Savannah River Site (SRS). The spherical forms of resorcinol formaldehyde ion exchange resin (sRF) as well as a hypothetical spherical SuperLig{reg_sign} 644 (SL644) are evaluated for decontamination of dissolved saltcake wastes (supernates). Both SuperLig{reg_sign} and resorcinol formaldehyde resin beds can exhibit hydraulic problems in their granular (nonspherical) forms. SRS waste is generally lower in potassium and organic components than Hanford waste. Using VERSE-LC Version 7.8 along with the cesium Freundlich/Langmuir isotherms to simulate the waste decontamination in ion exchange columns, spherical SL644 was found to reduce column cycling by 50% for high-potassium supernates, but sRF performed equally well for the lowest-potassium feeds. Reduced cycling results in reduction of nitric acid (resin elution) and sodium addition (resin regeneration), therefore, significantly reducing life-cycle operational costs. These findings motivate the development of a spherical form of SL644. This work demonstrates the versatility of the ion exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. The value of a resin with increased selectivity for cesium over potassium can be assessed for further development.

  15. Cesium Toxicity Alters MicroRNA Processing and AGO1 Expressions in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Il Lae Jung

    Full Text Available MicroRNAs (miRNAs are short RNA fragments that play important roles in controlled gene silencing, thus regulating many biological processes in plants. Recent studies have indicated that plants modulate miRNAs to sustain their survival in response to a variety of environmental stimuli, such as biotic stresses, cold, drought, nutritional starvation, and toxic heavy metals. Cesium and radio-cesium contaminations have arisen as serious problems that both impede plant growth and enter the food chain through contaminated plants. Many studies have been performed to define plant responses against cesium intoxication. However, the complete profile of miRNAs in plants during cesium intoxication has not been established. Here we show the differential expression of the miRNAs that are mostly down-regulated during cesium intoxication. Furthermore, we found that cesium toxicity disrupts both the processing of pri-miRNAs and AGONOUTE 1 (AGO1-mediated gene silencing. AGO 1 seems to be especially destabilized by cesium toxicity, possibly through a proteolytic regulatory pathway. Our study presents a comprehensive profile of cesium-responsive miRNAs, which is distinct from that of potassium, and suggests two possible mechanisms underlying the cesium toxicity on miRNA metabolism.

  16. Laboratory plant for the separation of cesium from waste solutions of the PUREX process

    International Nuclear Information System (INIS)

    A laboratory plant for the separation of cesium from a fission product waste solution of the fuel reprocessing is described. The plant consists of two stages. In the first stage cesium is adsorbed on ammonium molybdatophosphate (AMP). Then the adsorbent is dissolved. From the solution cesium is adsorbed on a cationic ion exchanger in the second stage. Then AMP can be reproduced from this solution. For the elution of cesium in the second stage a NH4NO3 solution (3 m) is used. Flow sheet, construction and the control device of the plant are described and the results of tests with a model solution are given. (author)

  17. Structure of cesium loaded iron phosphate glasses: An infrared and Raman spectroscopy study

    International Nuclear Information System (INIS)

    The structure of cesium loaded iron phosphate glasses (IPG) was investigated using infrared and Raman spectroscopy. The spectra of the cesium doped samples revealed a structural modification of the parent glass owing to the incorporation of cesium. The structural changes could be correlated with the variation observed in the glass transition temperature of these glasses. Increased Cs-mediated cationic cross linking appears to be the reason for the initial rise in glass transition temperature up to 21 mol% Cs2O in IPG; while, breakdown of the phosphate network with increasing cesium content, brings down the glass transition temperature.

  18. Mobility of cesium through the Callovo-Oxfordian claystones under partially saturated conditions

    International Nuclear Information System (INIS)

    The diffusion of cesium was studied in an unsaturated core of Callovo-Oxfordian claystone, which is a potential host rock for retrievable disposal of high-level radioactive wastes. In-diffusion laboratory experiments were performed on rock samples with water saturation degrees ranging from 81% to 100%. The analysis of both cesium concentration monitoring in the source reservoir and postmortem cesium rock concentration profile of the samples was carried out using a chemical-transport code where the sorption of cesium was described by a multi-site ion-exchange model. The results showed that cesium exhibited a clear trend related to the saturation degree of the sample. The more dehydrated the rock sample, the slower the decrease of cesium concentration, and the thinner the penetration depth of cesium was. The effective diffusion coefficient (De) for cesium decreased from 18.5 *10-11 m2 s-1 at full-saturation to 0.3 * 10-11 m2 s-1 for the more dehydrated sample. This decrease is almost 1 order of magnitude higher than that for tritiated water (HTO), although a similar behavior could have been expected, since cesium is known to diffuse in the same parts of the pore space as HTO in fully saturated claystones. (authors)

  19. Cesium transport in Four Mile Creek of the Savannah River Plant

    International Nuclear Information System (INIS)

    The behavior of a large radioactive cesium release to a Savannah River Plant (SRP) stream was examined using a stable cesium release to Four Mile Creek. Measurements following the release show that most of the cesium released was transported downstream; however, sorption and desorption decreased the maximum concentration and increased the travel time and duration, relative to a dye tracer, at sampling stations downstream. The study was made possible by the development of an analytical technique using ammonium molybdophosphate and neutron activation that permitted the measurement of stable cesium concentrations as low as 0.2 μg/L

  20. Preparation of Modified Kaolin Filler with Cesium and Its Application in Security Paper

    OpenAIRE

    Houssni El-Saied; Samya El-Sherbiny; Omnia Ali; Wafaa El-Saied; Said Rohyem

    2013-01-01

    In this study, cesium was added intentionally during paper manufacture for protecting the papers against forgery and counterfeiting by sorbing cesium ions (Cs+) on kaolin, used as special filler in papermaking. The sorption of cesium from aqueous solution by kaolin was studied as a function of pH, shaking time, cesium initial concentration, and mass of kaolin using batch technique. The results showed that a solution containing 10 mg/L Cs+ and 250 mg of kaolin at pH 6 can be used to modify the...

  1. 21 CFR 133.147 - Grated American cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133.147 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  2. 14 CFR 133.41 - Flight characteristics requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Flight characteristics requirements. 133.41... EXTERNAL-LOAD OPERATIONS Airworthiness Requirements § 133.41 Flight characteristics requirements. (a) The applicant must demonstrate to the Administrator, by performing the operational flight checks prescribed...

  3. 19 CFR 133.37 - Renewal of copyright recordation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Renewal of copyright recordation. 133.37 Section... OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.37 Renewal of copyright recordation. (a) Term of renewal. If a recorded copyright has a term which exceeds the original...

  4. 19 CFR 133.32 - Application to record copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Application to record copyright. 133.32 Section... OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.32 Application to record copyright. An application to record a copyright to secure customs protection against...

  5. 21 CFR 133.137 - Washed curd cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd cheese for manufacturing. 133.137... Standardized Cheese and Related Products § 133.137 Washed curd cheese for manufacturing. Washed curd cheese for manufacturing conforms to the definition and standard of identity prescribed for washed curd cheese by §...

  6. 21 CFR 133.189 - Skim milk cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Skim milk cheese for manufacturing. 133.189... Standardized Cheese and Related Products § 133.189 Skim milk cheese for manufacturing. (a) Skim milk cheese for manufacturing is the food prepared from skim milk and other ingredients specified in this section, by...

  7. 21 CFR 133.145 - Granular cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular cheese for manufacturing. 133.145 Section... Standardized Cheese and Related Products § 133.145 Granular cheese for manufacturing. Granular cheese for manufacturing conforms to the definition and standard of identity prescribed for granular cheese by §...

  8. 21 CFR 133.114 - Cheddar cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cheddar cheese for manufacturing. 133.114 Section... Standardized Cheese and Related Products § 133.114 Cheddar cheese for manufacturing. Cheddar cheese for manufacturing conforms to the definition and standard of identity prescribed for cheddar cheese by §...

  9. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by §...

  10. 21 CFR 133.109 - Brick cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Brick cheese for manufacturing. 133.109 Section... Standardized Cheese and Related Products § 133.109 Brick cheese for manufacturing. Brick cheese for manufacturing conforms to the definition and standard of identity for brick cheese prescribed by §...

  11. 21 CFR 133.119 - Colby cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Colby cheese for manufacturing. 133.119 Section... Standardized Cheese and Related Products § 133.119 Colby cheese for manufacturing. Colby cheese for manufacturing conforms to the definition and standard of identity prescribed for colby cheese by §...

  12. Promoter hypomethylation regulates CD133 expression in human gliomas

    Institute of Scientific and Technical Information of China (English)

    Kouichi Tabu; Ken Sasai; Taichi Kimura; Lei Wang; Eiko Aoyanagi; Shinji Kohsaka; Mishie Tanino; Hiroshi Nishihara; Shinya Tanaka

    2008-01-01

    Brain tumor-initiating cells (BTICs) have been enriched using antibodies against the cell surface protein CD133;however,the biological relevance and the regulatory mechanism of CD133 expression in human gliomas are not yet understood.In this study,we initially demonstrated that CD133 was overexpressed in high-grade human glioblastomas where CD133-positive cells were focally observed as a micro-cluster.In addition,CD133 transcripts with exon 1A,1B,or 1C were predominantly expressed in glioblastomas.To elucidate the mechanism regulating this aberrant expression of CD133,three proximal promoters (P1,P2,and P3) containing a CpG island were isolated.In U251MG and T98Gglioblastoma cells,the P1 region flanking exon 1A exhibited the highest activity among the three promoters,and this activity was significantly inactivated by in vitro methylation.After treatment with the demethylating agent 5-azacytidine and/or the histone deacetylase inhibitor valproic acid,the expression level of CD133 mRNA was significantly restored in glioma cells.Importantly,hypomethylation of CpG sites within the P1,P2,and P3 regions was observed by bisulfite sequencing in human glioblastoma tissues with abundant CD133 mRNA.Taken together,our results indicate that DNA hypomethylation is an important determinant of CD133 expression in glioblastomas,and this epigenetic event may be associated with the development of BTICs expressing CD133.

  13. Next Generation Solvent (NGS): Development for Caustic-Side Solvent Extraction of Cesium

    International Nuclear Information System (INIS)

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Interlaboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  14. Next Generation Solvent Development for Caustic-Side Solvent Extraction of Cesium

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Birdwell, Joseph F. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Bonnesen, Peter V. [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States); Bruffey, Stephanie [Oak Ridge National Laboratory (ORNL), Oak Ridge, TN (United States)

    2014-03-01

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Inter laboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  15. Next Generation Solvent (NGS): Development for Caustic-Side Solvent Extraction of Cesium

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Birdwell, Jr, Joseph F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bonnesen, Peter V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bruffey, Stephanie H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Duncan, Nathan C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ensor, Dale [Tennessee Technological Univ., Cookeville, TN (United States); Hill, Talon G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lee, Denise L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rajbanshi, Arbin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Roach, Benjamin D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Szczygiel, Patricia L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sloop, Jr., Frederick V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Stoner, Erica L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Neil J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-03-01

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Interlaboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  16. Internal radiotherapy with copper-64-diacetyl-bis (N4-methylthiosemicarbazone) reduces CD133+ highly tumorigenic cells and metastatic ability of mouse colon carcinoma

    International Nuclear Information System (INIS)

    Introduction: 64Cu-diacetyl-bis (N4-methylthiosemicarbazone) (64Cu-ATSM) is an imaging agent for positron emission tomography (PET) that targets hypoxic tumors. 64Cu-ATSM is also reported to be a potential agent for internal radiotherapy. In a mouse colon carcinoma (Colon-26) model, we have shown that 64Cu-ATSM preferentially localizes in intratumoral regions with a high density of CD133+ cells, which show characteristics of cancer stem cells or cancer stem cell-like cells (collectively referred here as CSCs). In this study, we evaluated the therapeutic effect of 64Cu-ATSM in relation to CD133 expression using this model. Methods: Systemic administration of 37 MBq 64Cu-ATSM or saline was conducted twice within a 1-week interval to mice bearing 1-week-old Colon-26 tumors (days 0-7). At day 19, tumor size measurement, flow cytometry analysis and experimental lung metastatic assay were performed. The therapeutic effect of 64Cu-ATSM on sorted CD133+ and CD133- Colon-26 cells was also examined in vitro. Results: In vivo studies showed that 64Cu-ATSM treatment inhibited tumor growth. The percentage of CD133+ cells and metastatic ability in 64Cu-ATSM treated tumors was decreased compared with that in control animals. In vitro studies demonstrated that 64Cu-ATSM accumulated in cells under hypoxic conditions and incorporation of 64Cu-ATSM under hypoxia caused cell death in both CD133+ and CD133- cells in a similar extent. Conclusions: 64Cu-ATSM administration reduced tumor volume as well as the percentage of CD133+ cells and the metastatic ability of Colon-26 tumors. Together with our data, it is suggested that 64Cu-ATSM accumulates in regions high in CD133+ highly tumorigenic cells and kills such regions by radiation, resulting in a decrease of the percentage of CD133+ cells.

  17. Tumour-initiating cells vs. cancer 'stem' cells and CD133: What's in the name?

    International Nuclear Information System (INIS)

    Recent evidence suggests that a subset of cells within a tumour have 'stem-like' characteristics. These tumour-initiating cells, distinct from non-malignant stem cells, show low proliferative rates, high self-renewing capacity, propensity to differentiate into actively proliferating tumour cells, resistance to chemotherapy or radiation, and they are often characterised by elevated expression of the stem cell surface marker CD133. Understanding the molecular biology of the CD133+ cancer cells is now essential for developing more effective cancer treatments. These may include drugs targeting organelles, such as mitochondria or lysosomes, using highly efficient and selective inducers of apoptosis. Alternatively, agents or treatment regimens that enhance sensitivity of these therapy-resistant 'tumour stem cells' to the current or emerging anti-tumour drugs would be of interest as well

  18. Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis.

    Directory of Open Access Journals (Sweden)

    Mian-Bo Huang

    Full Text Available BACKGROUND: The insulin-like growth factor (IGF signaling pathway has long been established as playing critical roles in skeletal muscle development. However, the underlying regulatory mechanism is poorly understood. Recently, a large family of small RNAs, named microRNAs (miRNAs, has been identified as key regulators for many developmental processes. Because miRNAs participate in the regulation of various signaling pathways, we hypothesized that miRNAs may be involved in the regulation of IGF signaling in skeletal myogenesis. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we determined that the cell-surface receptor IGF-1R is directly regulated by a muscle-specific miRNA, microRNA-133 (miR-133. A conserved and functional binding site for miR-133 was identified in the 3'untranslated region (3'UTR of IGF-1R. During differentiation of C2C12 myoblasts, IGF-1R protein, but not messenger RNA (mRNA expression, was gradually reduced, concurrent with the upregulation of miR-133. Overexpression of miR-133 in C2C12 cells significantly suppressed IGF-1R expression at the posttranscriptional level. We also demonstrated that both overexpression of miR-133 and knockdown of IGF-1R downregulated the phosphorylation of Akt, the central mediator of the PI3K/Akt signaling pathway. Furthermore, upregulation of miR-133 during C2C12 differentiation was significantly accelerated by the addition of IGF-1. Mechanistically, we found that the expression of myogenin, a myogenic transcription factor reported to transactivate miR-133, was increased by IGF-1 stimulation. CONCLUSION/SIGNIFICANCE: Our results elucidate a negative feedback circuit in which IGF-1-stimulated miR-133 in turn represses IGF-1R expression to modulate the IGF-1R signaling pathway during skeletal myogenesis. These findings also suggest that miR-133 may be a potential therapeutic target in muscle diseases.

  19. Exposure mode study to xenon-133 in a reactor building

    International Nuclear Information System (INIS)

    The work described in this thesis focuses on the external and internal dose assessment to xenon-133. During the nuclear reactor operation, fission products and radioactive inert gases, as 133Xe, are generated and might be responsible for the exposure of workers in case of clad defect. Particle Monte Carlo transport code is adapted in radioprotection to quantify dosimetric quantities. The study of exposure to xenon-133 is conducted by using Monte-Carlo simulations based on GEANT4, an anthropomorphic phantom, a realistic geometry of the reactor building, and compartmental models. The external exposure inside a reactor building is conducted with a realistic and conservative exposure scenario. The effective dose rate and the eye lens equivalent dose rate are determined by Monte-Carlo simulations. Due to the particular emission spectrum of xenon-133, the equivalent dose rate to the lens of eyes is discussed in the light of expected new eye dose limits. The internal exposure occurs while xenon-133 is inhaled. The lungs are firstly exposed by inhalation, and their equivalent dose rate is obtained by Monte-Carlo simulations. A biokinetic model is used to evaluate the internal exposure to xenon-133. This thesis gives us a better understanding to the dosimetric quantities related to external and internal exposure to xenon-133. Moreover the impacts of the dosimetric changes are studied on the current and future dosimetric limits. The dosimetric quantities are lower than the current and future dosimetric limits. (author)

  20. Common molecular pathways involved in human CD133+/CD34+ progenitor cell expansion and cancer

    Directory of Open Access Journals (Sweden)

    Vêncio Ricardo Z

    2007-06-01

    Full Text Available Abstract Background Uncovering the molecular mechanism underlying expansion of hematopoietic stem and progenitor cells is critical to extend current therapeutic applications and to understand how its deregulation relates to leukemia. The characterization of genes commonly relevant to stem/progenitor cell expansion and tumor development should facilitate the identification of novel therapeutic targets in cancer. Methods CD34+/CD133+ progenitor cells were purified from human umbilical cord blood and expanded in vitro. Correlated molecular changes were analyzed by gene expression profiling using microarrays covering up to 55,000 transcripts. Genes regulated during progenitor cell expansion were identified and functionally classified. Aberrant expression of such genes in cancer was indicated by in silico SAGE. Differential expression of selected genes was assessed by real-time PCR in hematopoietic cells from chronic myeloid leukemia patients and healthy individuals. Results Several genes and signaling pathways not previously associated with ex vivo expansion of CD133+/CD34+ cells were identified, most of which associated with cancer. Regulation of MEK/ERK and Hedgehog signaling genes in addition to numerous proto-oncogenes was detected during conditions of enhanced progenitor cell expansion. Quantitative real-time PCR analysis confirmed down-regulation of several newly described cancer-associated genes in CD133+/CD34+ cells, including DOCK4 and SPARCL1 tumor suppressors, and parallel results were verified when comparing their expression in cells from chronic myeloid leukemia patients Conclusion Our findings reveal potential molecular targets for oncogenic transformation in CD133+/CD34+ cells and strengthen the link between deregulation of stem/progenitor cell expansion and the malignant process.

  1. Examination of post operative split lung function using quantitative xenon 133 (133Xe) inhalation scan

    International Nuclear Information System (INIS)

    133Xe inhalation scan and ordinary lung function testing were performed three times in 34 patients undergoing pulmonary resection: before surgery, and one and six months postoperatively. Forced vital capacity (FVC) and forced expiratory volume in the first second (FEV1.0) were used as spirometric parameters. From the 133Xe inhalation scan, a split lung capacity (right to left, upper, middle and lower) and T1/2 (time required for half of the inhalation of 133Xe gas to be expired) were calculated by computer and used as indices of split lung capacity and ventilation, respectively. The predicted postoperative lung functions were calculated using preoperative spirometric respiratory function and 133Xe inhalation data according to the formula reported by Ali and associates. At sixth postoperative month, both predicted FVC (r=0.895, p1.0 (r=0.897, p<0.001) correlated highly with those actually observed. These results appear to be very useful for preoperative evaluation of operative indications and the choice of surgical method. The ratios of observed to predicted lung capacity in the post operative state were examined by splitting the right and left lung and the means±S.D.(%) were 80.5±9.7% on the operated side and 119.2±11.7% on the opposite side one month after surgery. Six months after surgery, the corresponding figures were 111.0±5.6% and 96.7±16.4%. The post operative T1/2 values on the operated sides were about 2.4 times the preoperative values at one month after surgery but returned to the preoperative values by the six postoperative month. From these results, it can be said that respiratory functions after pulmonary resection are maintained primarily by compensatory lung function of opposite and operated sides at one and six months, respectively. These results also provide valuable information on postoperative respiratory care for patients who have undergone lung resection. (author)

  2. Cesium-137 inventories in undisturbed areas in different regions of Brazil

    International Nuclear Information System (INIS)

    Cesium-137 is an anthropogenic radionuclide introduced in the environment in the early of 1960s to the end of 1970s. The Cesium-137 has very used to assess soil redistribution in the landscape because this is very tight in the fine soil particles and its movement in the landscape is due to soil redistribution. To use Cesium-137 to assess soil redistribution is need to known the Cesium-137 inventory in an area that not has experimented soil erosion neither soil deposition. So, this work present Cesium-137 inventories in undisturbed areas in different regions of Brazil, from South to Northeast of Brazil. The inventories in these areas represent the variational deposition of Cesium-137 in the whole national territory of Brazil. The inventories of Cesium-137 varied from 200 ± 15 Bq.m-2 for South region to 15 ± 2 Bq.m-2 for Northeast region. Moreover, was verified that the Cesium- 137 inventories depend on latitude and altitude of the area. (author)

  3. Peculiarities of presence of cesium-137 in soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    The granulometric composition of soil and the distribution of cesium-137 by soil fractions at the Azgir test site was determined. The characterization of cesium-137 presence in the layer of the thickness of 1 cm of the surface soil was gave. (author)

  4. Velocity Distribution of Effective Atoms in a Small Optically Pumped Cesium Beam Frequency Standard

    Institute of Scientific and Technical Information of China (English)

    CHEN Jingbiao; WANG Fengzhi; YANG Donghai; WANG YiQiu

    2001-01-01

    In this paper, the velocity distribution of effective atoms in a small optically pumped cesium beam frequency standard has been achieved from the Fourier transforms of the experimentally recorded Ramsey patterns. The result fits well with the theoretical calculation. The second order Doppler shift correction of the small cesium atomic clock is obtained from the velocity distribution of effective atoms.

  5. Vacuum squeezed light for atomic memories at the D2 cesium line

    CERN Document Server

    Burks, Sidney; Giacobino, Elisabeth; Laurat, Julien; Ortalo, Jérémie; Jia, Xiaojun; Villa, Fabrizio; Chuimmo, Antonino

    2008-01-01

    We report the experimental generation of squeezed light at 852 nm, locked on the Cesium D2 line. 50% of noise reduction down to 50 kHz has been obtained with a doubly resonant optical parametric oscillator operating below threshold, using a periodically-polled KTP crystal. This light is directly utilizable with Cesium atomic ensembles for quantum networking applications

  6. Ionizing mechanisms in a cesium plasma irradiated with a ruby laser

    Science.gov (United States)

    Shimada, K.; Robinson, L. B.

    1975-01-01

    A cesium filled diode--laser plasmadynamic converter was built to investigate the feasibility of converting laser energy to electrical energy at large power levels. Experiments were performed with a pulsed ruby laser to determine the quantity of electrons and cesium ions generated per pulse of laser beam and to determine the output voltage. A current density as high as 200 amp/sq cm from a spot of approximately 1 sq mm area and an open circuit voltage as high as 1.5 volts were recorded. A qualitative theory was developed to explain these results. In the operation of the device, the laser beam evaporates some of the cesium and ionizes the cesium gas. A dense cesium plasma is formed to absorb further the laser energy. Results suggest that the simultaneous absorption of two ruby laser photons by the cesium atoms plays an important role in the initial ionization of cesium. Inverse bremsstrahlung absorption appears to be the dominant mechanism in subsequent processes. Recombinations of electrons and cesium ions appear to compete favorably with the simultaneous absorption of two photons.

  7. Sorption of iodine, chlorine, technetium and cesium in soil

    International Nuclear Information System (INIS)

    The safety assessment of final disposal of spent nuclear fuel will include an estimate for the behavior of waste nuclides in the biosphere. As a part of this estimate also the sorption of radioactive iodine, chlorine, technetium and cesium in soil is to be considered. The chemistry and the sorption of these radionuclides in soils are described in this literature survey. Behavior of I-129, Cl-36 and Tc-99 in the environment is of great interest because of their long half-lives and relatively high mobilities. The importance of Cs-135 arises from its high content in spent nuclear fuel and long physical half-life, even though it is considered relatively immobile in soil. Factors affecting the migration and sorption of radionuclides in soils can be divided into elemental and soil specific parameters. The most important elemental factor is the speciation of the element, which is influenced by the soil redox potential, pH and complex forming ligands. Soil micro-organisms can either serve as sorbents for radionuclides or affect their speciation by altering the prevailing soil redox conditions. Soil organic matter content and mineral properties have a marked influence on the retention of radionuclides. The sorption of anionic radionuclides such as I-, Cl- and TcO4 - is pronounced in the presence of organic matter. Clay minerals are known to bound cesium effectively. The effect of speciation of radioactive iodine, chlorine, technetium and cesium in soil is considered in this study, as well as the effect of soil micro-organisms, organic matter and mineral properties. (orig.)

  8. Cesium-137 inventory of the undisturbed soil areas in the Londrina Region, Parana, Brazil

    International Nuclear Information System (INIS)

    Cesium-137 is an artificial radionuclide introduced in the environment through the radioactive fallout of the superficial tests of nuclear weapons. The cesium-137 deposition occurred to middles of the 1980-decade and, due to the Chernobyl accident, great part of Europe had a additional fallout of cesium-137. The contaminations of this accident do not have reached Southern Hemisphere. Cesium-137 is an alkaline metal, high electropositive, that in contact with the soil is strongly adsorbed to the clay in the FES (Frayed Edge Sites) and RES (Regular Edge Sites) positions, and it movement by chemical processes in the soil is insignificant. Because of this, cesium-137 became a good soil marker, and its movement is related to the soil movement particles, so that the cesium-137 have been used in the study of the soil redistribution processes, as a tool of quantifying the rates of soil losses and gain. To use this methodology, it is necessary the knowledge of the reference inventory of cesium-137, that is given as function of the total concentration of cesium-137 deposited in an area by the radioactive fallout. If a sampling point presents less cesium-137 than the reference inventory, this point is considered a point with soil loss; otherwise, the point is considered a point with soil deposition. To evaluate the cesium-137 inventory in the Londrina region, four areas of the undisturbed soil were sampling in grid of 3x3, with a distance of 9 meters among the points. Of these four sampling areas, three areas were of native forest (labeled Mata1, Mata2 and Mata UEL), and one was a pasture area. Cesium-137 inventory was 223 ± 41 Bq m-2, 240 ± 65 Bq m-2 and 305 ± 36 Bq m-2 for Mata UEL, Mata1 and Mata2, respectively, and of 211 ± 28 Bq m-2 for the native pasture. Considering the deviation in each value, it is not possible to conclude that there are differences among the values of cesium-137 inventory, so that the average reference inventory of cesium-137 for the Londrina

  9. Usefulness of 3-D dynamic pulmonary xenon-133 SPECT for thoracoscopic lung volume reduction surgery in patients with pulmonary emphysema

    International Nuclear Information System (INIS)

    Six patients with pulmonary emphysema scheduled to undergo thoracoscopic lung volume reduction surgery (TLVRS) were evaluated by three-dimensional (3-D) dynamic pulmonary xenon-133 SPECT. Serial 30-second dynamic SPECT data for equilibrium and washout (for 5 min) were acquired using a continuous repetitive rotating acquisition mode with a triple-detector SPECT system. SPECT data were reconstructed to 3-D images with a color, surface-rendering technique, and a 3-D fusion image of the 3-min washout image over the equilibrium image was obtained. Regional ventilation was visually assessed on the fusion 3-D images and quantified by xenon-133 half-washout time (T1/2) and mean transit time (MTT). The 3-D fusion image localized and lateralized the worst diseased sites with xenon-133 retention. Xenon-133 retention, T1/2 and MTT were reduced on these images in five patients with improved pulmonary function tests following TLVRS. However, xenon-133 retention was greater in one with asynchronous diaphragm movement after TLVRS. This modality will assist TLVRS in determining the lung-resection target and in evaluating the treatment effect. (author)

  10. Rational Design of Cesium-Selective Ionophores and Chemosensors: Dihydrocalix[4]arene Crown-6 Ethers

    Energy Technology Data Exchange (ETDEWEB)

    Sachleben, Richard A.; Bryan, Jeffrey C.; Brown, Gilbert M.; Engle, Nancy L.; Haverlock, Tamara J.; Hay, Benjamin P.; Urvoas, Agathe; Moyer, Bruce A.

    2003-12-15

    Molecular mechanics calculations performed on calix[4]arene crown-6 ethers predict that the 1,3-dihydro derivatives will exhibit greater complementarity for potassium and cesium ions than the parent 1,3-dialkoxy calix crowns. The X-ray crystal structures of 1,3-alt bis-octyloxycalix[4]arene benzocrown-6 ether, dihydrocalix[4]arene benzocrown-6 ether, and the cesium nitrate complex of dihydrocalix[4]arene benzocrown-6 ether were determined. The cesium complex structure corresponds closely to the structure predicted by molecular mechanics. The dihydrocalix[4]arene crown-6 ethers exhibit enhanced cesium selectivity in the extraction of alkali metal salts and provide a platform for a highly sensitive and selective cesium chemosensor.

  11. [Variation in amount of radioactive cesium before and after cooking dry shiitake and beef].

    Science.gov (United States)

    Nabeshi, Hiromi; Tsutsumi, Tomoaki; Hachisuka, Akiko; Matsuda, Rieko

    2013-01-01

    We investigated the change of radioactive cesium content in food due to cooking in order to estimate the internal radiation exposure due to from radioactive materials in food. Our results revealed that soaking dry shiitake in water decreased the radioactive cesium content by about 50%, compared with that present in uncooked shiitake. Radioactive cesium in beef was decreased by about 10%, 12%, 60-65% and 80% by grilling, frying, boiling and stewing, respectively, compared to uncooked beef. For cooked beef, the decrease in the ratio of radioactive cesium was significantly different among the types of cooking. The decrease ratio of radioactive cesium in boiled and stewed beef was 8 times higher than that in grilled and fried beef.

  12. Sensitive Detection of Cold Cesium Molecules by Radiative Feshbach Spectroscopy

    OpenAIRE

    Chin, Cheng; Kerman, Andrew J.; Vuletić, Vladan; Chu, Steven

    2002-01-01

    We observe the dynamic formation of $Cs_2$ molecules near Feshbach resonances in a cold sample of atomic cesium using an external probe beam. This method is 300 times more sensitive than previous atomic collision rate methods, and allows us to detect more than 20 weakly-coupled molecular states, with collisional formation cross sections as small as $\\sigma =3\\times 10^{-16}$cm$^2$. We propose a model to describe the atom-molecule coupling, and estimate that more than $2 \\times 10^5$ $Cs_2$ mo...

  13. Characterizing optical dipole trap via fluorescence of trapped cesium atoms

    Institute of Scientific and Technical Information of China (English)

    LIU; Tao; GENG; Tao; YAN; Shubin; LI; Gang; ZHANG; Jing; WANG; Junmin; PENG; Kunchi; ZHANG; Tiancai

    2006-01-01

    Optical dipole trap (ODT) is becoming an important tool of manipulating neutral atoms. In this paper ODT is realized with a far-off resonant laser beam strongly focused in the magneto-optical trap (MOT) of cesium atoms. The light shift is measured by simply monitoring the fluorescence of the atoms in the magneto-optical trap and the optical dipole trap simultaneously. The advantages of our experimental scheme are discussed, and the effect of the beam waist and power on the potential of dipole trap as well as heating rate is analyzed.

  14. Cesium fallout in Norway after the Chernobyl accident

    International Nuclear Information System (INIS)

    Results of country-wide measurements of 137Cs and 134 Cs in soil samples in Norway after the Chernobyl accident are reported. The results clearly demonstrates that municipalities in the central part of southern Norway, Troendelag and the southern part of Nordland, have been rather heavily contaminated. The total fallout of 137Cs and 134Cs from the Chernobyl accident in Norway is estimated to 2300 TBq and 1200 TBq, respectively. This is approximately 6% of the cesium activity released from the reactor

  15. Review of xenon-133 production and related problems

    International Nuclear Information System (INIS)

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs

  16. 19 CFR 133.42 - Infringing copies or phonorecords.

    Science.gov (United States)

    2010-04-01

    ... pursuant to 19 CFR 133.42(e) was (damaged/destroyed/lost) during examination, testing, or other use.” (f... trafficking in counterfeit labels for phonorecords or copies of motion pictures or other audiovisual works...

  17. 40 CFR 133.105 - Treatment equivalent to secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... except as provided for in § 133.103, or paragraphs (d), (e) or (f) of this section. (a) BOD 5. (1) The 30...) of this section. Where concurrent BOD effluent data are available, they must be submitted with...

  18. Automated analysis of Xe-133 pulmonary ventilation (AAPV) in children

    Science.gov (United States)

    Cao, Xinhua; Treves, S. Ted

    2011-03-01

    In this study, an automated analysis of pulmonary ventilation (AAPV) was developed to visualize the ventilation in pediatric lungs using dynamic Xe-133 scintigraphy. AAPV is a software algorithm that converts a dynamic series of Xe- 133 images into four functional images: equilibrium, washout halftime, residual, and clearance rate by analyzing pixelbased activity. Compared to conventional methods of calculating global or regional ventilation parameters, AAPV provides a visual representation of pulmonary ventilation functions.

  19. A mechanical valve assembly for xenon 133 gas delivery systems

    International Nuclear Information System (INIS)

    Some gas delivery systems used in pulmonary ventilation scanning are unable to satisfactorily supply 133Xe gas to bed-ridden patients. A mechanical gas valve assembly to control the flow of gas in such systems was constructed. A commercially produced 133Xe gas delivery system when fitted with the new assembly was able to ventilate almost all patients whereas previously this could be achieved with approximately only 50% of patients

  20. Morphological and electrical properties of zirconium vanadate doped with cesium

    Directory of Open Access Journals (Sweden)

    Marwa F. Elkady

    2014-09-01

    Full Text Available Cesium doped zirconium vanadate ZrV2O7 with different Cs dopant content (Cs/Zr varied from 0 to 0.5 in weight ratio were fabricated by hydrothermal technique at 120 °C for 60 min. The synthesized materials are thermally treated using microwave technique. The structural and morphological properties of the synthesized materials and thermally treated samples were investigated using XRD and SEM respectively. It was evident that all synthesized specimens have cubic phase structural without any extra phase but after heat treatment Orthorhombic phase appear with doped samples. However, the morphological structure of the doped synthesized materials has transferred from nanoparticles into rods aspect with heat treatment for the different dopant ratio. Moreover, the electrical properties of both the synthesized and thermally treated materials are studied by AC impedance measurements. The results indicated that the ionic conductivity of Cs-doped ZrV2O7 materials decreased by increasing the dopant ratio while that thermally treated samples the ionic conductivity increase by increasing the dopant ratio. Finally, the concentration of cesium dopants is found to play crucial role in tuning the morphology and electrical properties of nanostructures.

  1. Transportable cesium irradiator (TPCI): Final safety analysis report: Revision 1

    International Nuclear Information System (INIS)

    This Final Safety Analysis Report describes the Transportable Cesium Irradiator (TPCI) and assesses the hazards associated with its operation. The TPCI consists of a mobile, lead-shielded, irradiation unit with support equipment mounted within an enclosed trailer. The irradiation unit has two basic compartments; a source chamber sized to mate with the transportation cask which houses the source capsules, and an irradiation chamber formed as a large shielded cylinder (drum) with a window. The irradiation chamber is mounted on a large diameter support bearing. As this chamber is rotated its window moves from the product access door, where produce is inserted or extracted, to a position in line with a similar window in the source chamber. When the windows are aligned the produce is irradiated, while the back wall of the irradiation chamber shields the product access door. The TPCI is designed to be transported throughout the continental United States. The transportation cask containing the cesium source capsules is transported separately from the irradiation unit and is installed when the TPCI unit has been readied for operation at a particular site. The transportation cask is a separate unit and is documented in a separate FSAR

  2. Kelvin probe studies of cesium telluride photocathode for AWA photoinjector

    Energy Technology Data Exchange (ETDEWEB)

    Wisniewski, Eric E., E-mail: ewisniew@anl.gov [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Velazquez, Daniel [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Yusof, Zikri, E-mail: zyusof@hawk.iit.edu [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Spentzouris, Linda; Terry, Jeff [Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Sarkar, Tapash J. [Rice University, 6100 Main, Houston, TX 77005 (United States); Harkay, Katherine [Accelerator Science Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States)

    2013-05-21

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (≈50nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating. -- Highlights: ► The correlation between Quantum Efficiency (QE) and work function. ► How QE and work function evolve together. ► Rejuvenation of the photocathode via heating and the effect on work function. ► The effects on the work function due to exposure to UV light.

  3. Structure and bonding in crystalline cesium uranyl tetrachloride under pressure.

    Science.gov (United States)

    Osman, Hussien H; Pertierra, Pilar; Salvadó, Miguel A; Izquierdo-Ruiz, F; Recio, J M

    2016-07-21

    A thorough investigation of pressure effects on the structural properties of crystalline cesium uranyl chloride was performed by means of first-principles calculations within the density functional theory framework. Total energies, equilibrium geometries and vibrational frequencies were computed at selected pressures up to 50 GPa. Zero pressure results present good agreement with available experimental and theoretical data. Our calculated equation of state parameters reveal that Cs2UO2Cl4 is a high compressible material, similar to other ionic compounds with cesium cations, and displays a structural anisotropic behavior guided by the uranyl moiety. An unexpected variation of the U-O bond length, dUO, is detected as pressure is applied. It leads to a dUO-stretching frequency relationship that cannot be described by the traditional Badger's rule. Interestingly enough, it can be explained in terms of a change in the main factor controlling dUO. At low pressure, the charge transferred to the uranyl cation induces an increase of the bond length and a red shift of the stretching frequencies, whereas it is the mechanical effect of the applied pressure above 10 GPa that is the dominant factor that leads to a shortening of dUO and a blue shift of the stretching frequencies. PMID:27340008

  4. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    Institute of Scientific and Technical Information of China (English)

    Zhang Jun-Hai; Zeng Xian-Jin; Li Qing-Meng; Huang Qiang; Sun Wei-Min

    2013-01-01

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations.The process,described by a three-level model with the A scheme,shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms.The |Fg =3> → |Fe-4> resonance pumping can result in the ground state |Fg =4,mF =4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg =4.To enhance the anisotropy in the ground state,we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg =4> → |Fe =3>transition,in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field.

  5. Structure and bonding in crystalline cesium uranyl tetrachloride under pressure.

    Science.gov (United States)

    Osman, Hussien H; Pertierra, Pilar; Salvadó, Miguel A; Izquierdo-Ruiz, F; Recio, J M

    2016-07-21

    A thorough investigation of pressure effects on the structural properties of crystalline cesium uranyl chloride was performed by means of first-principles calculations within the density functional theory framework. Total energies, equilibrium geometries and vibrational frequencies were computed at selected pressures up to 50 GPa. Zero pressure results present good agreement with available experimental and theoretical data. Our calculated equation of state parameters reveal that Cs2UO2Cl4 is a high compressible material, similar to other ionic compounds with cesium cations, and displays a structural anisotropic behavior guided by the uranyl moiety. An unexpected variation of the U-O bond length, dUO, is detected as pressure is applied. It leads to a dUO-stretching frequency relationship that cannot be described by the traditional Badger's rule. Interestingly enough, it can be explained in terms of a change in the main factor controlling dUO. At low pressure, the charge transferred to the uranyl cation induces an increase of the bond length and a red shift of the stretching frequencies, whereas it is the mechanical effect of the applied pressure above 10 GPa that is the dominant factor that leads to a shortening of dUO and a blue shift of the stretching frequencies.

  6. A study of strontium and cesium sorption on granite

    International Nuclear Information System (INIS)

    The diffusion and sorption of cesium and strontium in crushed granite particles is discussed. Sorption experiments have been performed with one granite from Finnsjoen outside Forsmark on the east coast of Sweden and one granite from the Stripa mine in central Sweden. Granite samples have been crushed and screened, and six different particle size fractions from 0.10-0.12 mm to 4-5 mm of each rock have been used in the experiments. The initial concentrations of inactive cesium and strontium were 10-15 ppm. The experimental data indicate that the amount of sorption is dependent not only on the mass of granite particles, but also to some extent on the size of the particles. An attempt has been made to distinguish between sorption on external surfaces and inner surfaces. The amount of external surface adsorption was found to vary from 15-40 % of the total adsorption capacity for the particle size fraction 0.10-0.12 mm to a few percent or less for the largest particles used. (Auth.)

  7. Diffusion of strontium, technetium, iodine and cesium in granitic rock

    International Nuclear Information System (INIS)

    The migration of strontium, technetium, iodine and cesium in granitic rock has been studied. Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at trace levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the diffusion into the rock were studied by an autoradiographic technique. The cationic strontium and cesium have apparent diffusivities of 10-13 - 10-14 m2/s. The migration is confined to microfissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with high capacity minerals (e.g. biotite). The anionic iodine and technetium have apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. (orig.)

  8. Studies on cesium sorption in hydrous zirconium and titanium oxides

    International Nuclear Information System (INIS)

    Significant quantities of 137Cs (T1/2 = 30.1 y) and 90Sr (T1/2 = 28.5 y) are produced as fission products in nuclear reactors. These long-lived gamma-emitting radionuclides, regarded as a waste few decades ago, are being termed now as valuables owing to the upsurge in the utilization of these radioisotopes in the area of medicine, food irradiation, and sewage treatment technologies in recent years. For long-term waste management it is necessary to minimize the volume and toxicity of the waste. Selective recovery and utilization of these radionuclides from the waste is the concept of growing interest to many researchers. Inorganic sorbents are proven candidates for the separation and recovery of cesium and strontium from aqueous waste streams. They are chemically durable and stable against ionizing radiation. In addition, these materials can be converted into unleachable ceramic form for final disposal. Hydrous metal oxides belong to a particular class of inorganic ion exchangers extensively investigated for various applications in nuclear waste treatment. The present study deals with the preparation of hydrous zirconium and titanium oxide and the studies aimed at separation of cesium from aqueous wastes

  9. Expression of CD133 in various premalignant and proliferative lesions

    Directory of Open Access Journals (Sweden)

    Rahmi Amtha

    2015-06-01

    Full Text Available Background: In Jakarta, oral squamous cell carcinoma (OSCC usually detected in late stage with very low survival rate ofabout 1.1 years. OSCC may be preceded by premalignant lesion, so that early detection of the lesion may decrease the mortality rate due to oral malignancy. CD133 is a hematopoietic stem cell that play role in tissue regeneration, inflammation and tumor. Upregulated of CD133 was reported on tumor progression. Purpose: The aim of study is to determine circulating CD133 expression on premalignant (PML and proliferative (PL lesion. Method: Observational research was carried out on patients who seek treatment of PML and PL at Oral Medicine clinic. CD133 was taken from peripheral blood serum, examined using PCR. Data was analyzed by Chi square test. Result: 15 subjects (each of five subjects for PML, PL and control consist of 40% male and 60% female. Age group of above 41 years old was most affected PML and PL (66.7%. Tongue is common site for oral lesion (40%. There is a significant different of circulating CD133 rate among all groups lesion (p=0.039. Conclusion: CD133 express differently in premalignant and proliferative lesions.

  10. Characterization of colon cancer cells: a functional approach characterizing CD133 as a potential stem cell marker

    International Nuclear Information System (INIS)

    Isolation and characterization of tumourigenic colon cancer initiating cells may help to develop novel diagnostic and therapeutic procedures. We characterized a panel of fourteen human colon carcinoma cell lines and their corresponding xenografts for the surface expression of potential stem cell markers CD133, CD24, CD44, CDCP1 and CXCR4. In five cell lines and nine xenografts, mRNA expression of these markers was determined. Tumour growth behaviour of CD133+, CD133- and unsorted SW620 cells was evaluated in vivo. All five putative stem cell markers showed distinct expression patterns in the tumours examined. Two patient-derived cell lines highly expressed CD133 (> 85% of positive cells) and three other cell lines had an expression level of about 50% whereas in long-term culture based models CD133 expression ranged only from 0 to 20%. In 8/14 cell lines, more than 80% of the cells were positive for CD24 and 11/14 were over 70% positive for CD44. 10/14 cell lines expressed CDCP1 on ≥ 83% of cells. CXCR4 expression was determined solely on 94 L and SW480. Analyses of the corresponding xenografts revealed a significant reduction of cell numbers expressing the investigated surface markers and showed single cell fractions expressing up to three markers simultaneously. Statistical analysis revealed that the CXCR4 mRNA level correlates negatively with the protein expression of CD133, CD44, CD24 and CDCP1 in cell lines and xenografts. A lower differentiation grade of donor material correlated with a higher CDCP1 mRNA expression level in the respective tumour model. In vivo growth behaviour studies of SW620 revealed significantly higher take rates and shorter doubling times in the tumour growth of CD133 positive subclones in comparison to the unsorted cell line or CD133 negative subclones. Our data revealed correlations in the expression of surface markers CD44 and CD24 as well as CD44 and CDCP1 and strongly suggest that CD133 is a stem cell marker within our colon

  11. Review of xenon-133 production and related problems; Estudio bibliografico de la produccion de xenon-133 y problemas afines

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Ropero, M.

    1980-07-01

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs.

  12. Brain uptake of a non-radioactive pseudo-carrier and its effect on the biodistribution of [18 F]AV-133 in mouse brain

    International Nuclear Information System (INIS)

    Introduction: 9-[18 F]Fluoropropyl-(+)-dihydrotetrabenazine ([18 F]AV-133) is a new PET imaging agent targeting vesicular monoamine transporter type II (VMAT2). To shorten the preparation of [18 F]AV-133 and to make it more widely available, a simple and rapid purification method using solid-phase extraction (SPE) instead of high-pressure liquid chromatography (HPLC) was developed. The SPE method produced doses containing the non-radioactive pseudo-carrier 9-hydroxypropyl-(+)-dihydrotetrabenazine (AV-149). The objectives of this study were to evaluate the brain uptake of AV-149 by UPLC-MS/MS and its effect on the biodistribution of [18 F]AV-133 in the brains of mice. Methods: The mice were injected with a bolus including [18 F]AV-133 and different doses of AV-149. Brain tissue and blood samples were harvested. The effect of different amounts of AV-149 on [18 F]AV-133 was evaluated by quantifying the brain distribution of radiolabelled tracer [18 F]AV-133. The concentrations of AV-149 in the brain and plasma were analyzed using a UPLC-MS/MS method. Results: The concentrations of AV-149 in the brain and plasma exhibited a good linear relationship with the doses. The receptor occupancy curve was fit, and the calculated ED50 value was 8.165 mg/kg. The brain biodistribution and regional selectivity of [18 F]AV-133 had no obvious differences at AV-149 doses lower than 0.1 mg/kg. With increasing doses of AV-149, the brain biodistribution of [18 F]AV-133 changed significantly. Conclusion: The results are important to further support that the improved radiolabelling procedure of [18 F]AV-133 using an SPE method may be suitable for routine clinical application

  13. Enhanced invasion in vitro and the distribution patterns in vivo of CD133+ glioma stem cells

    Institute of Scientific and Technical Information of China (English)

    YU Sheng-ping; YANG Xue-jun; ZHANG Bin; MING Hao-lang; CHEN Cong; REN Bing-cheng; LIU Zhi-feng; LIU Bin

    2011-01-01

    Background Recent studies have suggested that cancer stem cells cause tumor recurrence based on their resistance to radiotherapy and chemotherapy.Although the highly invasive nature of glioblastoma cells is also implicated in the failure of current therapies,it is not clear whether cancer stem cells are involved in invasiveness.This study aimed to assess invasive ability of glioma stem cells (GSCs) derived from C6 glioma cell line and the distribution patterns of GSCs in Sprague-Dawley (SD) rat brain tumor.Methods Serum-free medium culture and magnetic isolation were used to gain purely CD133+ GSCs.The invasive stem cell markers and luxol fast blue staining for white matter tracts were performed to show the distribution patterns of GSCs in brain tumor of rats and the relationship among GSCs,vessels,and white matter tracts.The results of matrigel invasion assay were estimated using the Student's t test and the analysis of Western blotting was performed using the one-way analysis of variance (ANOVA) test.Results CD133+GSCs(number:85.3±4.1)were significantly more invasive in vitro than matched CD133- cells(number:25.9±3.1) (t=14.5,P <0.005).GSCs invaded into the brain diffusely and located in perivascular niche of tumor-brain interface or resided within perivascular niche next to white fiber tracts.The polarity of glioma cells containing GSCs was parallel to the white matter tracts.Conclusions Our data suggest that CD133+ GSCs exhibit more aggressive invasion in vitro and GSCs in vivo probably disseminate along the long axis of blood vessels and transit through the white matter tracts.The therapies targeting GSCs invasion combined with traditional glioblastoma multiforme therapeutic paradigms might be a new approach for avoiding malignant glioma recurrence.

  14. Equilibrium, kinetic and thermodynamic study of cesium adsorption onto nanocrystalline mordenite from high-salt solution.

    Science.gov (United States)

    Lee, Keun-Young; Park, Minsung; Kim, Jimin; Oh, Maengkyo; Lee, Eil-Hee; Kim, Kwang-Wook; Chung, Dong-Yong; Moon, Jei-Kwon

    2016-05-01

    In this study, the equilibrium, kinetics and thermodynamics of cesium adsorption by nanocrystalline mordenite were investigated under cesium contamination with high-salt solution, simulating the case of an operation and decommissioning of nuclear facilities or an accident during the processes. The adsorption rate constants were determined using a pseudo second-order kinetic model. The kinetic results strongly demonstrated that the cesium adsorption rate of nano mordenite is extremely fast, even in a high-salt solution, and much faster than that of micro mordenite. In the equilibrium study, the Langmuir isotherm model fit the cesium adsorption data of nano mordenite better than the Freundlich model, which suggests that cesium adsorption onto nano mordenite is a monolayer homogeneous adsorption process. The obtained thermodynamic parameters indicated that the adsorption involved a very stable chemical reaction. In particular, the combination of rapid particle dispersion and rapid cesium adsorption of the nano mordenite in the solution resulted in a rapid and effective process for cesium removal without stirring, which may offer great advantages for low energy consumption and simple operation. PMID:26683820

  15. Preliminary Evaluation of Cesium Distribution for Wet Sieving Process Planned for Soil Decontamination in Japan - 13104

    Energy Technology Data Exchange (ETDEWEB)

    Enokida, Y.; Tanada, Y.; Hirabayashi, D. [Graduate School of Engineering, 1 Furo-cho Nagoya-shi, Aichi-ken, 4648603 (Japan); Sawada, K. [EcoTopia Science Institute, Nagoya University, 1 Furo-cho Nagoya-shi, Aichi-ken, 4648603 (Japan)

    2013-07-01

    For the purpose of decontaminating radioactive cesium from a huge amount of soil, which has been estimated to be 1.2x10{sup 8} m{sup 3} by excavating to a 5-cm depth from the surface of Fukushima Prefecture where a severe nuclear accident occurred at TEPCO's power generating site and has emitted a significant amount of radioactive materials, mainly radioactive cesium, a wet sieving process was selected as one of effective methods available in Japan. Some private companies have demonstrated this process for soil treatment in the Fukushima area by testing at their plants. The results were very promising, and a full-fledged application is expected to follow. In the present study, we spiked several aqueous samples containing soil collected from an industrial wet sieving plant located near our university for the recycling of construction wastes with non-radioactive cesium hydroxide. The present study provides scientific data concerning the effectiveness in volume reduction of the contaminated soil by a wet sieving process as well as the cesium distribution between the liquid phase and clay minerals for each sub-process of the full-scale one, but a simulating plant equipped with a process of coagulating sedimentation and operational safety fundamentals for the plant. Especially for the latter aspect, the study showed that clay minerals of submicron size strongly bind a high content of cesium, which was only slightly removed by coagulation with natural sedimentation (1 G) nor centrifugal sedimentation (3,700 G) and some of the cesium may be transferred to the effluent or recycled water. By applying ultracentrifugation (257,000 G), most of submicron clay minerals containing cesium was removed, and the cesium amount which might be transferred to the effluent or recycled water, could be reduced to less than 2.3 % of the original design by the addition of a cesium barrier consisting of ultracentrifugation or a hollow fiber membrane. (authors)

  16. Hydrogen and Cesium Monitor for H- Magnetron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Cheng-Yang [Fermilab; Bollinger, Dan [Fermilab; Schupbach, Brian [Fermilab; Seiya, Kiyomi [Fermilab

    2014-07-01

    The relative concentration of cesium to hydrogen in the plasma of a H- magnetron source is an important parameter for reliable operations. If there is too much cesium, the surfaces of the source become contaminated with it and sparking occurs. If there is too little cesium then the plasma cannot be sustained. In order to monitor these two elements, a spectrometer has been built and installed on a test and operating source that looks at the plasma. It is hypothesized that the concentration of each element in the plasma is proportional to the intensity of their spectral lines.

  17. Effect of Rare Earth Elements on Exchange Performances of Cesium Ion-Sieve

    Institute of Scientific and Technical Information of China (English)

    张惠源; 王榕树; 林灿生; 张先业

    2003-01-01

    The exchange performances and the distribution coefficient of Cesium Ion-Sieve (Cs-IS) for cesium and for some rare earth elements were compared. In particular, the effects of neodymium on the cesium ion exchange and the Cs+ selectivity variation on Cs-IS owing to introduction of rare earth elements into HLLW were studied. Though rare earth elements exhibit a small influence on the distribution coefficient for Cs+, they impair Cs-exchange capacity of Cs-IS to some extent. This interruption on the selectivity to Cs+ can be significantly eliminated provided an appropriate ratio of liquid to solid V:m is used.

  18. High voltage holding in the negative ion sources with cesium deposition

    Energy Technology Data Exchange (ETDEWEB)

    Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)

    2016-02-15

    High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.

  19. Specific interaction of cesium with the surface of calcium silicate hydrates

    International Nuclear Information System (INIS)

    The sorption of cesium at the calcium silicate hydrates (CSH) surface was investigated, both through sorption isotherm data and by solid-state NMR experiments. The sorption ability of CSH towards cesium is favored for low solid Ca/Si molar ratios, in agreement with the negative surface charge they develop then. A significant proportion of these sorbed cesium cations remains tightly bound to the surface sites forming, in dehydrated CSH, inner-sphere complexes, which can not be removed by alcohol washing. Chloride seems to present a lower affinity for CSH, even for high Ca/Si molar ratios, where the surface charge becomes positive. (orig.)

  20. First-principles study of cesium adsorption to weathered micaceous clay minerals

    Science.gov (United States)

    Okumura, Masahiko; Nakamura, Hiroki; Machida, Masahiko

    2014-05-01

    A large amount of radioactive nuclides was produced into environment due to the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident. Residents near FDNPP were suffering from radioactive cesium and then evacuated, because which has long half-life and is retained by surface soil for long time. The Japanese government has been decontaminating the cesium by removing the surface soil in order to return them to their home. This decontamination method is very effective, but which produces huge amount of waste soil. This becomes another big problem in Fukushima, because it is not easy to find large storage sites. Then effective and economical methods to reduce the volume of the waste soil are needed. However, it has not been invented yet. One of the reasons is lack of knowledge about microscopic process of adsorption/desorption of cesium to/from soil. It is known that weathered micaceous clay minerals play crucial role on adsorption and retention of cesium. They are expected to have special sorption sites, called frayed edge sites (FESs), which adsorb cesium selectively and irreversibly. Properties of FES have been intensely investigated by experiments. But microscopic details of the adsorption process on FES are still unclear. Because direct observation of the process with current experimental techniques is quite difficult. We investigated the adsorption of cesium to FES in muscovite, which is a typical micaceous clay mineral, via first-principles calculations (density functional theory). We made a minimal model of FES and evaluate the energy difference before and after cesium adsorption to FES. This is the first numerical modeling of FES. It was shown that FES does adsorb cesium if the weathering of muscovite has been weathered. In addition, we revealed the mechanism of cesium adsorption to FES, which is competition between ion radius of cesium and the degree of weathering. I plan to discuss volume reduction of the waste soil based on our result. Reference M. Okumura

  1. Test procedures and instructions for single shell tank saltcake cesium removal with crystalline silicotitanate

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, J.B.

    1997-01-07

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Single Shell Tank Saltcake from tanks 24 t -BY- I 10, 24 1 -U- 108, 24 1 -U- 109, 24 1 -A- I 0 1, and 24 t - S-102, in a bench-scale column. The cesium sorbent to be tested is crystalline siticotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-024, Hanford Single Shell Tank Saltcake Cesium Removal Test Plan.

  2. A New Pumping-Probing Scheme for the Optically Pumped Cesium Beam Frequency Standard

    Institute of Scientific and Technical Information of China (English)

    陈景标; 朱程锦; 王凤芝; 杨东海

    2001-01-01

    A new pumping-probing scheme for the optically pumped cesium beam frequency standard has been experimentally tested in our laboratory. The stability of the optically pumped cesium beam frequency standard was measured by comparing its 10 MHz output with an HP5071A commercial cesium atomic clock. The result shows that the frequency stability for the 1 s and 30000s sample times are 1.2 × 10-11 and 3.7 × 10-13, respectively. It was proved that the new pumping scheme works well.

  3. Investigation of adsorption and wetting of 3He on cesium and cesiated glass

    International Nuclear Information System (INIS)

    Experiments have been carried out to investigate the binding of 3He on cesium substrates, using optical pumping to spin-polarize the atoms. The behavior of 3He on the walls at low temperature can be analyzed through the evolution of the nuclear magnetization of the sample. Preliminary results are presented, including: (1) adsorption studies of gaseous 3He on cesiated glass; (2) magnetic relaxation time of polarized liquid 3He on cesium and cesiated glass; (3) evidence for wetting of liquid 3He on cesium. 8 refs., 2 figs

  4. a Biokinetic Model for CESIUM-137 in the Fetus

    Science.gov (United States)

    Jones, Karen Lynn

    1995-01-01

    Previously, there was no method to determine the dose to the embryo, fetus, fetal organs or placenta from radionuclides within the embryo, fetus, or placenta. In the past, the dose to the fetus was assumed to be equivalent to the dose to the uterus. Watson estimated specific absorbed fractions from various maternal organs to the uterine contents which included the fetus, placenta, and amniotic fluid and Sikov estimated the absorbed dose to the embryo/fetus after assuming 1 uCi of radioactivity was made available to the maternal blood.^{1,2} However, this method did not allow for the calculation of a dose to individual fetal organs or the placenta. The radiation dose to the embryo or fetus from Cs-137 in the fetus and placenta due to a chronic ingestion by the mother was determined. The fraction of Cs-137 in the maternal plasma crossing the placenta to the fetal plasma was estimated. The absorbed dose from Cs-137 in each modelled fetal organ was estimated. Since there has been more research regarding potassium in the human body, and particularly in the pregnant woman, a biokinetic model for potassium was developed first and used as a basis and confirmation of the cesium model. Available pertinent information in physiology, embryology, biokinetics, and radiation dosimetry was utilized. Due to the rapid growth of the fetus and placenta, the pregnancy was divided into four gestational periods. The numerous physiological changes that occurred during pregnancy were considered and an appropriate biokinetic model was developed for each of the gestational periods. The amount of cesium in the placenta, embryo, and fetus was estimated for each period. The dose to the fetus from cesium deposited in the embryo or fetus and in the placenta was determined for each period using Medical Internal Radiation Dosimetry (MIRD) methodology. An uncertainty analysis was also performed to account for the variability of the parameters in the biokinetic model based on the experimental data

  5. Factors affecting the sorption of cesium in a nutrient-poor boreal bog

    International Nuclear Information System (INIS)

    135Cs is among the most important radionuclides in the long-term safety assessments of spent nuclear fuel, due to its long half-life of 2.3 My and large inventory in spent nuclear fuel. Batch sorption experiments were conducted to evaluate the sorption behavior of radiocesium (134Cs) in the surface moss, peat, gyttja, and clay layers of 7-m-deep profiles taken from a nutrient-poor boreal bog. The batch distribution coefficient (Kd) values of radiocesium increased as a function of sampling depth. The highest Kd values, with a geometric mean of 3200 L/kg dry weight (DW), were observed in the bottom clay layer and the lowest in the 0.5–1.0 m peat layer (50 L/kg DW). The maximum sorption in all studied layers was observed at a pH between 7 and 9.5. The in situ Kd values of 133Cs in surface Sphagnum moss, peat and gyttja samples were one order of magnitude higher than the Kd values obtained using the batch method. The highest in situ Kd values (9040 L/kg DW) were recorded for the surface moss layer. The sterilization of fresh surface moss, peat, gyttja and clay samples decreased the sorption of radiocesium by 38%, although the difference was not statistically significant. However, bacteria belonging to the genera Pseudomonas, Paenibacillus, Rhodococcus and Burkholderia isolated from the bog were found to remove radiocesium from the solution under laboratory conditions. The highest biosorption was observed for Paenibacillus sp. V0-1-LW and Pseudomonas sp. PS-0-L isolates. When isolated bacteria were added to sterilized bog samples, the removal of radiocesium from the solution increased by an average of 50% compared to the removal recorded for pure sterilized peat. Our results demonstrate that the sorption of radiocesium in the bog environment is dependent on pH and the type of the bog layer and that common environmental bacteria prevailing in the bog can remove cesium from the solution phase. - Highlights: • pH and the type of the bog layer affect the sorption

  6. Factors affecting the sorption of cesium in a nutrient-poor boreal bog.

    Science.gov (United States)

    Lusa, M; Bomberg, M; Virtanen, S; Lempinen, J; Aromaa, H; Knuutinen, J; Lehto, J

    2015-09-01

    (135)Cs is among the most important radionuclides in the long-term safety assessments of spent nuclear fuel, due to its long half-life of 2.3 My and large inventory in spent nuclear fuel. Batch sorption experiments were conducted to evaluate the sorption behavior of radiocesium ((134)Cs) in the surface moss, peat, gyttja, and clay layers of 7-m-deep profiles taken from a nutrient-poor boreal bog. The batch distribution coefficient (Kd) values of radiocesium increased as a function of sampling depth. The highest Kd values, with a geometric mean of 3200 L/kg dry weight (DW), were observed in the bottom clay layer and the lowest in the 0.5-1.0 m peat layer (50 L/kg DW). The maximum sorption in all studied layers was observed at a pH between 7 and 9.5. The in situ Kd values of (133)Cs in surface Sphagnum moss, peat and gyttja samples were one order of magnitude higher than the Kd values obtained using the batch method. The highest in situ Kd values (9040 L/kg DW) were recorded for the surface moss layer. The sterilization of fresh surface moss, peat, gyttja and clay samples decreased the sorption of radiocesium by 38%, although the difference was not statistically significant. However, bacteria belonging to the genera Pseudomonas, Paenibacillus, Rhodococcus and Burkholderia isolated from the bog were found to remove radiocesium from the solution under laboratory conditions. The highest biosorption was observed for Paenibacillus sp. V0-1-LW and Pseudomonas sp. PS-0-L isolates. When isolated bacteria were added to sterilized bog samples, the removal of radiocesium from the solution increased by an average of 50% compared to the removal recorded for pure sterilized peat. Our results demonstrate that the sorption of radiocesium in the bog environment is dependent on pH and the type of the bog layer and that common environmental bacteria prevailing in the bog can remove cesium from the solution phase. PMID:26010098

  7. Diffusion of water, cesium and neptunium in pores of rocks

    International Nuclear Information System (INIS)

    Teollisuuden Voima Oy (TVO) is investigating the feasibility to dispose of spent nuclear fuel within Finland. The present plan calls for the repository to be located in crystalline rock at a depth of several hundred meters. The safety assessment of the repository includes calculations of migration of waste nuclides. The flow of waste elements in groundwater will be retarded through sorption interaction with minerals and through diffusion into rock. Diffusion is the only mechanism retarding the migration of non-sorbing species and, it is expected to be the dominating retardation mechanism of many of the sorbing elements. In the investigation the simultaneous diffusion of tritiated water (HTO), cesium and neptunium in rocks of TVO investigation sites at Kivetty, Olkiluoto and Romuvaara were studied. (11 refs., 33 figs., 9 tabs.)

  8. Cesium-137 accident lessons in Goiania, Goias State, Brazil

    International Nuclear Information System (INIS)

    This document relates the experience obtained by several professionals which had an important role in the cesium-137 accident occurred in Goiania, Goias State, Brazil in September, 1987. It's divided into chapters, according to the action area - medical, nursing, social assistance, odontological and psychological. At first, some notions of radioprotection are explained, followed by the accident history and by the doctors and nurses action during the emergency phase and the medical, odontological, social and psychological assistance to the victims. The social assistance report shows some statistical data about the economic, occupational and social conditions of the accident victims. It is shown some information about the health institutions and the sanitary care in the ionizing radiation and about the occupational radiological protection in Goiania

  9. Coherence Properties of Nanofiber-Trapped Cesium Atoms

    Science.gov (United States)

    Reitz, D.; Sayrin, C.; Mitsch, R.; Schneeweiss, P.; Rauschenbeutel, A.

    2013-06-01

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized ˜200nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time of T2*=0.6ms and an irreversible dephasing time of T2'=3.7ms. By modeling the signals, we find that, for our experimental parameters, T2* and T2' are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  10. Norbadione A: synthetic approach and cesium complexation studies

    International Nuclear Information System (INIS)

    This work was dedicated to the study of the synthesis and complexation studies of norbadione A: a pigment originating from a mushroom. A synthetic approach, based on a double Suzuki-Miyaura coupling, was developed. This strategy was applied with high yields to the synthesis of various norbadione A analogues, as well as to the synthesis of simple pulvinic acids. Access to functionalized precursors of the molecule was also studied and the final coupling remains to be done. Besides, a speciation study based on electro-spray ionization mass spectrometry was conducted with norbadione A and one of the analogues. This study allowed the assessment of the cesium complexation abilities of each molecule. Structural data was also obtained and complexation constants were calculated. Finally, norbadione A and various synthetic products have been tested via high-throughput screening methods and strong antioxidant properties were observed. Other biological results are also reported. (author)

  11. Vector Cesium Magnetometer for the nEDM Experiment

    International Nuclear Information System (INIS)

    Full text: We use optical pumping combined with magnetic resonance in a Cesium vapor cell in order to measure the magnetic field. A Vector Cs Magnetometer uses multiple laser beams to follow the dynamics of the spin in 3D. The 3D signal is used to extract the Larmor frequency of the spins, and to extract the direction of the magnetic field through the path of the spins. The magnetometer was successfully tested in a proof of principle experiment. Its measured performance is ∼50 pT/Hz1/2 for the directions perpendicular to the magnetic field, and ∼500 fT/Hz1/2 for the direction parallel to the magnetic field. (author)

  12. Coherence properties of nanofiber-trapped cesium atoms

    CERN Document Server

    Reitz, D; Mitsch, R; Schneeweiss, P; Rauschenbeutel, A

    2013-01-01

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized 200 nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time $T_2^\\ast=0.6$ ms and an irreversible dephasing time $T_2^\\prime=3.7$ ms. By theoretically modelling the signals, we find that, for our experimental parameters, $T_2^\\ast$ and $T_2^\\prime$ are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  13. Quantitative analysis of cesium in synthetic lithium molten salts

    International Nuclear Information System (INIS)

    An analytical technique for fission products in lithium molten salts of spent PWR (Pressurized Water Reactor) fuels has been studied for the establishment of optimum chemical engineering process and the evaluation of process material balance in developing Direct Oxide Reduction Process with lithium metal. As part of the basic research, synthetic dissolver solutions of lithium chloride containing trace amounts of fission product elements (La, Ce, Pr, Nd, Sm, Eu, Gd, Y, Cs, Ru, Rh, Pd, Mo, Zr, Cd, Ba, Sr, Te and Se) was prepared and used in establishing the selective separation technique of cesium from lithium chloride matrix using cation exchange chromatography. Its recovery was measured by flame atomic absorption spectrometry and the reliability of this technique was evaluate

  14. Elastic scattering of sodium and cesium atoms at ultracold temperatures

    Institute of Scientific and Technical Information of China (English)

    Zhang Ji-Cai; Wang Ke-Dong; Liu Yu-Fang; Sun Jin-Feng

    2011-01-01

    The elastic scattering properties in a mixture of sodium and cesium atoms are investigated at cold and ultracold temperatures. Based on the accurate interatomic potential for the NaCs mixture,the interspecies s-wave scattering lengths,the effective ranges and the p-wave scattering lengths are calculated by the quantal method and the semiclassical method,respectively. The s-wave scattering lengths are 512.7ao for the singlet state and 33.4ao for the triplet state. In addition,the spin-change and elastic cross sections are also calculated,and the g-wave shape resonance is found in the total elastic cross sections.

  15. Vitrification of cesium-contaminated organic ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Sargent, T.N. Jr. [Clemson Univ., SC (United States)

    1994-08-01

    Vitrification has been declared by the Environmental Protection Agency (USEPA) as the Best Demonstrated Available Technology (BDAT) for the permanent disposal of high-level radioactive waste. Savannah River Site currently uses a sodium tetraphenylborate (NaTPB) precipitation process to remove Cs-137 from a wastewater solution created from the processing of nuclear fuel. This process has several disadvantages such as the formation of a benzene waste stream. It has been proposed to replace the precipitation process with an ion exchange process using a new resorcinol-formaldehyde resin developed by Savannah River Technical Center (SRTC). Preliminary tests, however, showed that problems such as crust formation and a reduced final glass wasteform exist when the resin is placed in the melter environment. The newly developed stirred melter could be capable of overcoming these problems. This research explored the operational feasibility of using the stirred tank melter to vitrify an organic ion exchange resin. Preliminary tests included crucible studies to determine the reducing potential of the resin and the extent of oxygen consuming reactions and oxygen transfer tests to approximate the extent of oxygen transfer into the molten glass using an impeller and a combination of the impeller and an external oxygen transfer system. These preliminary studies were used as a basis for the final test which was using the stirred tank melter to vitrify nonradioactive cesium loaded organic ion exchange resin. Results from this test included a cesium mass balance, a characterization of the semi-volatile organic compounds present in the off gas as products of incomplete combustion (PIC), a qualitative analysis of other volatile metals, and observations relating to the effect the resin had on the final redox state of the glass.

  16. Candlestick oven with a silica wick provides an intense collimated cesium atomic beam

    Science.gov (United States)

    Pailloux, A.; Alpettaz, T.; Lizon, E.

    2007-02-01

    This article shows that readily available glass and silica fibers and braids are suitable capillary structure for recirculating ovens, such as candlestick ovens, becoming then an alternative wick material to conventional metal based capillary structures. In order to study wettability and capillarity of metallic liquid cesium on borosilicate and silica microstructures, samples were selected, prepared, and tested experimentally. The contact angle of cesium on silica glass was roughly measured: θ =35°±10°. A commercially available silica braid was then introduced inside a candlestick oven to transfer the metallic liquid cesium from the cold reservoir to the hot emission point of the candlestick. A collimated cesium atomic beam of intensity of 2×1016at./ssr was obtained, stable and reproducible. Furthermore, this modified oven is easy to handle daily.

  17. Preparation, structure and application of a new ecomaterials cesium ion-sieve

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A new ecomaterials cesium ion-sieve (Cs-IS), which has high selectivity to cesium and excellent acid resistance, is prepared with zirconyl molybdopyrophosphate as its matrix by specific chemical sieve-making means. Cs-IS has large exchange capacity ( 1.83mmol@g-1) and high distribution coefficient (4.09 x 104 mL@ L-1) in the medium of 3 mol@ L- 1 HNO3. In the static exchange with strongly acidic high-level radioactive liquid waste (HLLW) (3 mol@ L-1 HNO3), Cs-IS exhibits high exchange rate for cesium (above 96.53 % ) and large separation factor (greater than 958.41). These indicate the possible use of Cs-IS in cesium-137 selective removal and recovery from highly saline acidic HLLW system.

  18. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium.

    Science.gov (United States)

    Hu, Baiyang; Fugetsu, Bunshi; Yu, Hongwen; Abe, Yoshiteru

    2012-05-30

    We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent. PMID:22464752

  19. Synthesis of novel calix[4]crown telomers and selective extraction of cesium ions

    Institute of Scientific and Technical Information of China (English)

    Hai Bing Li; Yuan Yin Chen; De Jun Xiong; Jun Yan Zhan; Cui Ping Han

    2007-01-01

    p-tert-Butylcalix[4]diazacrown-4 telomer, which contains hard and soft ion binding sites, was synthesized. It exhibited high selectivity toward cesium ions. The binding sites may complex alkali metal ions selectively.

  20. Biological effects of cesium-137 injected in beagle dogs of different ages

    Energy Technology Data Exchange (ETDEWEB)

    Nikula, K.J.; Muggenburg, B.A.; Griffith, W.C. [and others

    1995-12-01

    The toxicity of cesium-137 ({sup 137}Cs) in the Beagle dog was investigated at the Argonne National Laboratory (ANL) as part of a program to evaluate the biological effects of internally deposited radionuclides. The toxicity and health effects of {sup 137}Cs are important to understand because {sup 137}Cs is produced in large amounts in light-water nuclear reactors. Large quantities of cesium radioisotopes have entered the human food chain as a result of atmospheric nuclear weapons test, and additional cesium radioisotopes were released during the Chernobyl accident. Although the final analyses are not complete, three findings are significant: older dogs dies significantly earlier than juvenile and young adult dogs; greater occurrence of sarcomas in the cesium-137 injected dogs; the major nonneoplastic effect in dogs surviving beyond 52 d appears to be testicular atrophy.

  1. Total deposition of cesium-137 measured in Finland during the exercise `RESUME 95` in August 1995

    Energy Technology Data Exchange (ETDEWEB)

    Geer, L.E. De; Vintersved, I.; Arntsing, R. [National Defence Research Establisment, Nuclear Detection Group, Stockholm (Sweden)

    1997-12-31

    In the exercise called `RESUME 95` the Nuclear Detection Group from the National Defence Research Establishment in Stockholm participated with field gamma ray measurements combined with soil sampling and profile measurements. The results are presented in this report for the measurements of cesium-137. We considered the measurements of cesium-137 at the airfield the most important part of the in-situ exercise. Data was of course collected also for cesium-134 and natural radionuclides but time has not permitted a full analysis of these radionuclides. The methodology would, however, be the same as applied for cesium-137. Less attention was paid for area II and due to limited personnel resources the search exercise was not fully carried out. (au).

  2. Assessment of food calcium radioprotection effectiveness against cesium-137, added alone and with iodine-131

    International Nuclear Information System (INIS)

    New fish product with addition of food calcium had radioprotective properties, resulted in decreased cesium-137 content in organs and tissues of animals by 40-60% and lesser changes in differential blood count and biochemical indexes of blood serum

  3. Cold cesium molecules produced directly in a magneto-optical trap

    Institute of Scientific and Technical Information of China (English)

    Zhang Hong-Shan; Ji Zhong-Hua; Yuan Jin-Peng; Zhao Yan-Ting; Ma Jie; Wang Li-Rong; Xiao Lian-Tuan; Jia Suo-Tang

    2011-01-01

    We report on the observation of ultracold ground electric-state cesium molecules produced directly in a magnetooptical trap with a good signal-to-noise ratio.These molecules arise from the photoassociation of magneto-optical trap lasers and they are detected by resonantly enhanced multiphoton ionization technology.The production rate of ultracold cesium molecules is up to 4× 104 s-1.We measure the characteristic time of the ground electric-state cesium molecules generated in the experiment and investigate the Cs2+ molecular ion intensity as a function of the trapping laser intensity and the ionization pulse laser energy.We conclude that the production of cold cesium molecules may be enhanced by using appropriate experimental parameters,which is useful for future experiments involving the production and trapping of ultracold ground electric-state molecules.

  4. Cs2 ‘diffuse bands’ emission from superheated cesium vapor

    Science.gov (United States)

    Pichler, G.; Makdisi, Y.; Kokaj, J.; Thomas, N.; Mathew, J.; Beuc, R.

    2016-07-01

    Thermal emission from superheated cesium vapor was studied to very high temperatures from 700 °C to 1000 °C. This was performed in the vapor condition only and with no liquid cesium present in the all-sapphire cell. We observed a number of atomic and molecular spectral features simultaneously in emission and absorption, especially peculiar thermal emission of cesium dimer diffuse bands (2 3Πg → a 3∑u + transitions) around 710 nm coexisting with absorption bands around first resonance lines at 852 and 894 nm. We performed appropriate calculations of the diffuse band emission profiles and compared them with measured profiles. We also performed absorption measurements and compared observed diffuse band profiles with calculated ones. Possible applications of the observed phenomena will be discussed in terms of the solar energy conversion using dense cesium vapor.

  5. Fission of Multiply Charged Cesium and Potassium Clusters in Helium Droplets - Approaching the Rayleigh Limit

    CERN Document Server

    Renzler, Michael; Daxner, Matthias; Kranabetter, Lorenz; Kuhn, Martin; Scheier, Paul; Echt, Olof

    2016-01-01

    Electron ionization of helium droplets doped with cesium or potassium results in doubly and, for cesium, triply charged cluster ions. The smallest observable doubly charged clusters are $Cs_{9}^{2+}$ and $K_{11}^{2+}$; they are a factor two smaller than reported previously. The size of potassium dications approaches the Rayleigh limit nRay for which the fission barrier is calculated to vanish, i.e. their fissilities are close to 1. Cesium dications are even smaller than nRay, implying that their fissilities have been significantly overestimated. Triply charged cesium clusters as small as $Cs_{19}^{3+}$ are observed; they are a factor 2.6 smaller than previously reported. Mechanisms that may be responsible for enhanced formation of clusters with high fissilities are discussed.

  6. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.

    Science.gov (United States)

    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P

    2010-05-01

    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  7. Fabrication and performance of fl y ash granule filter for trapping gaseous cesium

    Directory of Open Access Journals (Sweden)

    Park Jang Jin

    2015-09-01

    Full Text Available Although a disk-type fly ash filter has shown a good performance in trapping gaseous cesium, it has difficulty in charging filters into a filter container and discharging waste filters containing radioactive cesium from a container by remote action. To solve the difficulty of the disk-type fly ash filter, five types of granule filters, including a ball type, tube type, and sponge-structure type have been made. Among them, the best filter type was chosen through simple crucible tests. The five types of granule filters packed into containers were loaded into five alumina crucibles of 50 cc. Five grams of CsNO3 was used as a gaseous cesium source. They were then placed in a muffle furnace and heated to 900°C and maintained for 2 hours. After the experiment, the weights of the cesium trapped filters were measured. Among the five types of granule filters, the sponge-structure type granule filter was the best, which has the highest trapping capacity of cesium. Its capacity is 0.42 g-Cs/g-filter. The chosen sponge-structure type granule filters and disk-type filters have been tested using a two-zone tube furnace. Cs volatilization and Cs trapping zones were maintained at 900 and 1000°C, respectively. Sixteen grams of CsNO3 was used as a gaseous cesium source. The cesium trapping profile of the sponge-structure type granule filters was almost similar to that of the disk-type fly ash filters. For both cases, cesium was successfully trapped within the third filter.

  8. Patient derived cell culture and isolation of CD133⁺ putative cancer stem cells from melanoma.

    Science.gov (United States)

    Welte, Yvonne; Davies, Cathrin; Schäfer, Reinhold; Regenbrecht, Christian R A

    2013-01-01

    Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression. Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin. Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133(+) CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133(+) CSCs and CD133(-) bulk, which can be cultivated and functionally analyzed thereafter. PMID:23525090

  9. Enhanced electronic injection in organic light-emitting diodes by incorporating silver nanoclusters and cesium carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying-Chung; Gao, Chia-Yuan [Department of Electrical Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan (China); Chen, Kan-Lin [Department of Electronic Engineering, Fortune Institute of Technology, Kaohsiung, Taiwan (China); Sze, Po-Wen [Department of Electro-Optical Science and Engineering, Kao Yuan University, Kaohsiung, Taiwan (China); Huang, Chien-Jung, E-mail: chien@nuk.edu.tw [Department of Applied Physics, National University of Kaohsiung, Kaohsiung, Taiwan (China)

    2015-10-01

    Highlights: • The localized electric field around SNCs is enhanced. • When the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained. • The structure for efficient electron injection is critical to characteristics of the device. - Abstract: The influence of the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure (CSC-EIS) on the performance of organic light-emitting diodes is investigated in this study. The silver nanoclusters (SNCs) are introduced between the electron-injection layers by means of thermal evaporation. When the CSC-EIS replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained because the electron-injection barrier between the cathode and the electron-transport layer is remarkably reduced from 1.2 to 0 eV. In addition, surface plasmon resonance effect will cause the enhanced localized electric field around the SNCs, resulting that electron-injection ability is further enhanced from the cathode to the emitting layer.

  10. Measurement of cesium emissions during the vitrification of simulated high level radioactive waste

    International Nuclear Information System (INIS)

    In the Defense Waste Processing Facility at the Savannah River Site, it is desired to eliminate a startup test that would involve adding small amounts of radioactive cesium-137 to simulated high-level waste. In order to eliminate this test, a reliable method for measuring non-radioactive cesium in the offgas system from the glass melter is required. From a pilot scale melter system, offgas particulate samples were taken on filter paper media and analyzed by Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). The ICPMS method proved to be sufficiently sensitive to measure cesium quantities as low as 0.135 μg, with the sensitivity being limited by the background cesium present in the filter paper. Typical particulate loadings ranged from 800 μg of cesium. This sensitivity allowed determination of cesium decontamination factors for four of the five major components of the offgas system. The decontamination factors measured experimentally compared favorably with the process design basis values

  11. Modeling Ion-Exchange Processing With Spherical Resins For Cesium Removal

    Energy Technology Data Exchange (ETDEWEB)

    Hang, T.; Nash, C. A.; Aleman, S. E.

    2012-09-19

    The spherical Resorcinol-Formaldehyde and hypothetical spherical SuperLig(r) 644 ion-exchange resins are evaluated for cesium removal from radioactive waste solutions. Modeling results show that spherical SuperLig(r) 644 reduces column cycling by 50% for high-potassium solutions. Spherical Resorcinol Formaldehyde performs equally well for the lowest-potassium wastes. Less cycling reduces nitric acid usage during resin elution and sodium addition during resin regeneration, therefore, significantly decreasing life-cycle operational costs. A model assessment of the mechanism behind ''cesium bleed'' is also conducted. When a resin bed is eluted, a relatively small amount of cesium remains within resin particles. Cesium can bleed into otherwise decontaminated product in the next loading cycle. The bleed mechanism is shown to be fully isotherm-controlled vs. mass transfer controlled. Knowledge of residual post-elution cesium level and resin isotherm can be utilized to predict rate of cesium bleed in a mostly non-loaded column. Overall, this work demonstrates the versatility of the ion-exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. This evaluation justifies further development of a spherical form of the SL644 resin.

  12. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    International Nuclear Information System (INIS)

    Highlights: ► Prussian blue was sealed in cavities of diatomite using carbon nanotubes. ► The caged Prussian blue after being permanently immobilized in polyurethane spongy showed a 167 mg/g capability for absorbing cesium. ► Cesium elimination was accomplished by simply adding the Prussian-blue based spongiform adsorbent to radioactive water. - Abstract: We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  13. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Baiyang [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Fugetsu, Bunshi, E-mail: hu@ees.hokudai.ac.jp [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Yu, Hongwen [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Abe, Yoshiteru [Kyoei Engineering Corporation, Niigata 959-1961 (Japan)

    2012-05-30

    Highlights: Black-Right-Pointing-Pointer Prussian blue was sealed in cavities of diatomite using carbon nanotubes. Black-Right-Pointing-Pointer The caged Prussian blue after being permanently immobilized in polyurethane spongy showed a 167 mg/g capability for absorbing cesium. Black-Right-Pointing-Pointer Cesium elimination was accomplished by simply adding the Prussian-blue based spongiform adsorbent to radioactive water. - Abstract: We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  14. The effects of K+ growth conditions on the accumulation of cesium by the bacterium Thermus sp. TibetanG6

    Institute of Scientific and Technical Information of China (English)

    WANG; Hailei; KONG; Fanjing; ZHENG; Mianping

    2006-01-01

    The accumulation of cesium by the bacterium Thermus sp. TibetanG6 was examined under different K+ growth conditions. The effects of external pH and Na+ on the accumulation of cesium were also studied, and the mechanism involved was discussed. K+ regimes played an important role in the accumulation of cesium by the strain TibetanG6. The quantity of cesium accumulated (24 h) was much higher in K+-deficient regime than that in K+-sufficient regime. The pH and Na+ had different effects on the accumulation of cesium in the two K+ regimes. IR spectra analyses indicated that the biosorption is a process of homeostasis with cesium initially accumulated on the cell wall.

  15. Monitoring of radionuclides in the environment. Part. 4. Factors influencing depth profiles of radioactive cesium in soils

    International Nuclear Information System (INIS)

    In order to evaluate the vertical migration behavior of radioactive cesium, which contaminated by the Fukushima Dai-ichi NPP accident, the distribution of radioactive cesium in different type of soils, e.g., bare ground, grass land, conifer forest floor were measured on October 2011, 2012, 2013, in Abiko, Chiba, Japan. Even three years after the deposition, most of radioactive cesium were deposited in the depths of within 5 cm at anywhere in this area. Depth profiles of radioactive cesium in soil was significantly correlated with organic matter content in soils (r=0.82; p<0.0001), whereas the factors such as potassium ion and ammonium ion in soil, stable cesium content, and clay mineral content were not correlated clearly. This indicates that the vertical migration rate of radioactive cesium is very slow and it would be influenced by organic matter in soil, not just clay. (author)

  16. Preliminary application of dynamic pulmonary xenon-133 single-photon emission tomography in the evaluation of patients with pulmonary emphysema for thoracoscopic lung volume reduction surgery

    Energy Technology Data Exchange (ETDEWEB)

    Suga, Kazuyoshi; Nishigauchi, Kazuya; Matsunaga, Naofumi; Matsumoto, Tsuneo; Kume, Norihiko [Univ. School of Medicine, Yamaguchi (Japan). Dept. of Radiol.; Sugi, Kazuro; Esato, Kensuke [First Department of Surgery, Yamaguchi University School of Medicine, Ube, Yamaguchi (Japan)

    1998-04-01

    Dynamic pulmonary xenon-133 single-photon emission tomography (SPET) with three-dimensional (3D) displays was preliminarily applied to select resection targets for thoracoscopic lung volume reduction surgery (LVRS) and to assess regional ventilatory changes following surgery. Dynamic SPET was performed using a triple-detector SPET system in 14 patients with pulmonary emphysema before and after LVRS. After reconstructing colour-illuminated, surface-rendered 3D images of equilibrium (EQ) and 3-min washout (WO{sub 3}), a single 3D fusion display was created from these two different time-course image sets, in which the 3D WO{sub 3} image indicating {sup 133}Xe retention was visible through the overlying 3D EQ image delineating lung contours. Volumetric extent of retention on this display was quantified by a {sup 133}Xe retention index, defined as the ratio (%) of total pixel numbers of segmented 3-min WO data to those of EQ data. {sup 133}Xe SPET and appropriately thresholded 3D displays efficiently localized a total of 36 retention sites; 19 (52.7%) of these sites were not localized by CT because they were within the widely or homogeneously spreading non-bullous emphysematous lung tissues. The 3D displays enhanced the perception of anatomical configurations and the extent of {sup 133}Xe retention compared with multislice tomograms. Postoperatively, 3D fusion display visualized the details of regional changes in retention, and changes in the retention index on the 3D display with a standardized threshold correlated well with changes in {sup 133}Xe clearance time (T{sub 1/2}) and %FEV{sub 1} (r = 0.881 and 0.856, respectively; P<0.0001). This preliminary study indicates that {sup 133}Xe SPET and appropriately thresholded, topographic 3D displays are of potential use in selecting resection targets for LVRS, and in evaluating the treatment effects on regional ventilation. (orig.) With 4 figs., 1 tab., 32 refs.

  17. Preliminary application of dynamic pulmonary xenon-133 single-photon emission tomography in the evaluation of patients with pulmonary emphysema for thoracoscopic lung volume reduction surgery

    International Nuclear Information System (INIS)

    Dynamic pulmonary xenon-133 single-photon emission tomography (SPET) with three-dimensional (3D) displays was preliminarily applied to select resection targets for thoracoscopic lung volume reduction surgery (LVRS) and to assess regional ventilatory changes following surgery. Dynamic SPET was performed using a triple-detector SPET system in 14 patients with pulmonary emphysema before and after LVRS. After reconstructing colour-illuminated, surface-rendered 3D images of equilibrium (EQ) and 3-min washout (WO3), a single 3D fusion display was created from these two different time-course image sets, in which the 3D WO3 image indicating 133Xe retention was visible through the overlying 3D EQ image delineating lung contours. Volumetric extent of retention on this display was quantified by a 133Xe retention index, defined as the ratio (%) of total pixel numbers of segmented 3-min WO data to those of EQ data. 133Xe SPET and appropriately thresholded 3D displays efficiently localized a total of 36 retention sites; 19 (52.7%) of these sites were not localized by CT because they were within the widely or homogeneously spreading non-bullous emphysematous lung tissues. The 3D displays enhanced the perception of anatomical configurations and the extent of 133Xe retention compared with multislice tomograms. Postoperatively, 3D fusion display visualized the details of regional changes in retention, and changes in the retention index on the 3D display with a standardized threshold correlated well with changes in 133Xe clearance time (T1/2) and %FEV1 (r = 0.881 and 0.856, respectively; P133Xe SPET and appropriately thresholded, topographic 3D displays are of potential use in selecting resection targets for LVRS, and in evaluating the treatment effects on regional ventilation. (orig.)

  18. 21 CFR 133.155 - Mozzarella cheese and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... safe and suitable ingredients may be used: (1) Dairy ingredients. Cow's milk, nonfat milk, or cream, as defined in § 133.3, or the corresponding products of water buffalo origin, except that cow's milk products... buffalo milk, the name of the food is accompanied by the phrase “made with water buffalo milk”. (d)...

  19. 40 CFR 164.133 - Emergency waiver of hearing.

    Science.gov (United States)

    2010-07-01

    ... Section 164.133 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS RULES OF PRACTICE GOVERNING HEARINGS, UNDER THE FEDERAL INSECTICIDE, FUNGICIDE, AND RODENTICIDE ACT... he determines: (1) That the application presents a situation involving need to use the pesticide...

  20. 27 CFR 31.133 - Change in management.

    Science.gov (United States)

    2010-04-01

    ... controlling the management policies or buying or selling practices of the business pertaining to alcohol... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Change in management. 31... § 31.133 Change in management. A change in management that involves no change in ownership of...

  1. Dicty_cDB: VFJ133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fqpmvlekk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFJ133 (VFJ1...A Score E Sequences producing significant alignments: (bits) Value N ( BJ432622 ) Dictyostelium discoideum c... significant alignments: (bits) Value AB292732_1( AB292732 |pid:none) Dictyosteli

  2. 49 CFR 237.133 - Supervision of repairs and modifications.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Supervision of repairs and modifications. 237.133... Supervision of repairs and modifications. Each repair or modification pursuant to this part shall be performed under the immediate supervision of a railroad bridge supervisor as defined in § 237.55 of this part...

  3. 21 CFR 133.171 - Pasteurized process pimento cheese.

    Science.gov (United States)

    2010-04-01

    ... process cheese with fruits, vegetables, or meats, and is subject to the requirement for label statement of..., washed curd cheese, colby cheese, and granular cheese, respectively. (d) The only fruit, vegetable, or... Section 133.171 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...

  4. 50 CFR 600.133 - Scientific and Statistical Committee (SSC).

    Science.gov (United States)

    2010-10-01

    ... Fishery Management Councils § 600.133 Scientific and Statistical Committee (SSC). (a) Each Council shall...) Each SSC shall provide its Council ongoing scientific advice for fishery management decisions... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Scientific and Statistical Committee...

  5. 41 CFR 105-53.133 - Information Security Oversight Office.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Security... FUNCTIONS Central Offices § 105-53.133 Information Security Oversight Office. (a) Creation and authority. The Information Security Oversight Office (ISOO), headed by the Director of ISOO, who is appointed...

  6. 16 CFR 1500.133 - Extremely flammable contact adhesives; labeling.

    Science.gov (United States)

    2010-01-01

    ... regulation (sec. 16 CFR part 1302), paragraphs (a), (b), (c) and (d) of this section are revoked as to the... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Extremely flammable contact adhesives... REGULATIONS § 1500.133 Extremely flammable contact adhesives; labeling. (a) Extremely flammable...

  7. 40 CFR 35.133 - Programs eligible for inclusion.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Programs eligible for inclusion. 35.133... Programs eligible for inclusion. (a) Eligible programs. Except as provided in paragraph (b) of this section, the environmental programs eligible, in accordance with appropriation acts, for inclusion in...

  8. {sup 133}Xenon study in various pulmonary diseases

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Q.C.; Mori, Yutaka; Uchiyama, Masayuki; Kawakami, Kenji [Jikei Univ., Tokyo (Japan). School of Medicine; Tominaga, Shigeru

    1997-08-01

    An aim of this study is to evaluate the role of {sup 133}Xe examination for patients with various pulmonary diseases (diffuse pan bronchiolitis and bronchiectasis end so on were included) whose pulmonary function was within normal limits. Subjects consist of 21 cases (9 cases of chronic bronchitis, 3 cases of lower respiratory infectious disease were contained; 5 of bronchiectasis, 1 case of lower respiratory infectious disease were contained; 3 of diffuse pan bronchiolitis; 1 case of pulmonary emphysema; 2 cases of sequestration of the lung; 1 case of bacterial pneumonia). These patients were treated by Levofloxacin (200-300 mg/day) from 2-6 months and Ofloxacin (300 mg/day) from 3-6 months. Ventilation scintigraphy was performed with {sup 133}Xe before and after therapy. Chest X-P, CT imaging, pulmonary function test and blood gas analysis were examined at the same period. All cases showed abnormal regions of ventilation before therapy, although results of pulmonary function test and blood gas analysis were within normal ranges. Abnormal areas of ventilation were improved by therapy in all cases, but most of the patients still showed abnormal retention of {sup 133}Xe. This finding suggests that it is necessary to continue the treatment. As conclusion, {sup 133}Xe is useful to evaluate an indication of treatment for various pulmonary diseases. (author)

  9. 40 CFR 180.133 - Lindane; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Lindane; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.133 Lindane; tolerances for residues. (a) General. Tolerances are established for residues of the...

  10. Behavior of cesium in municipal solid waste incineration.

    Science.gov (United States)

    Oshita, Kazuyuki; Aoki, Hiroshi; Fukutani, Satoshi; Shiota, Kenji; Fujimori, Takashi; Takaoka, Masaki

    2015-05-01

    As a result of the Fukushima Daiichi Nuclear Power Plant accident on March 11, 2011 in Japan radioactive nuclides, primarily (134)Cs and (137)Cs were released, contaminating municipal solid waste and sewage sludge in the area. Although stabilizing the waste and reducing its volume is an important issue differing from Chernobyl nuclear power plant accident, secondary emission of radioactive nuclides as a result of any intermediate remediation process is of concern. Unfortunately, there is little research on the behavior of radioactive nuclides during waste treatment. This study focuses on waste incineration in an effort to clarify the behavior of radioactive nuclides, specifically, refuse-derived fuel (RDF) with added (133)Cs (stable nuclide) or (134)Cs (radioactive nuclide) was incinerated in laboratory- and pilot-scale experiments. Next, thermogravimetric (TG) and differential thermal analysis (DTA) of stable Cs compounds, as well as an X-ray absorption fine structure (XAFS) analysis of Cs concentrated in the ashes were performed to validate the behavior and chemical forms of Cs during the combustion. Our results showed that at higher temperatures and at larger equivalence ratios, (133)Cs was distributed to the bottom ash at lower concentration, and the influence of the equivalence ratio was more significant at lower temperatures. (134)Cs behaved in a similar fashion as (133)Cs. We found through TG-DTA and XAFS analysis that a portion of Cs in RDF vaporizes and is transferred to fly ash where it exists as CsCl in the MSW incinerator. We conclude that Cs-contaminated municipal solid wastes could be incinerated at high temperatures resulting in a small amount of fly ash with a high concentration of radioactive Cs, and a bottom ash with low concentrations. PMID:25697082

  11. Behavior of cesium in municipal solid waste incineration

    International Nuclear Information System (INIS)

    As a result of the Fukushima Daiichi Nuclear Power Plant accident on March 11, 2011 in Japan radioactive nuclides, primarily 134Cs and 137Cs were released, contaminating municipal solid waste and sewage sludge in the area. Although stabilizing the waste and reducing its volume is an important issue differing from Chernobyl nuclear power plant accident, secondary emission of radioactive nuclides as a result of any intermediate remediation process is of concern. Unfortunately, there is little research on the behavior of radioactive nuclides during waste treatment. This study focuses on waste incineration in an effort to clarify the behavior of radioactive nuclides, specifically, refuse-derived fuel (RDF) with added 133Cs (stable nuclide) or 134Cs (radioactive nuclide) was incinerated in laboratory- and pilot-scale experiments. Next, thermogravimetric (TG) and differential thermal analysis (DTA) of stable Cs compounds, as well as an X-ray absorption fine structure (XAFS) analysis of Cs concentrated in the ashes were performed to validate the behavior and chemical forms of Cs during the combustion. Our results showed that at higher temperatures and at larger equivalence ratios, 133Cs was distributed to the bottom ash at lower concentration, and the influence of the equivalence ratio was more significant at lower temperatures. 134Cs behaved in a similar fashion as 133Cs. We found through TG–DTA and XAFS analysis that a portion of Cs in RDF vaporizes and is transferred to fly ash where it exists as CsCl in the MSW incinerator. We conclude that Cs-contaminated municipal solid wastes could be incinerated at high temperatures resulting in a small amount of fly ash with a high concentration of radioactive Cs, and a bottom ash with low concentrations. - Highlights: • Behaviors of Cs on the incineration of the model waste were investigated. • More Cs was moved to fly ash with increasing of equivalence ratio and temperature. • Chemical forms of Cs in the fly ash were

  12. Engineered Materials for Cesium and Strontium Storage Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Sean M. McDeavitt

    2010-04-14

    Closing the nuclear fuel cycle requires reprocessing spent fuel to recover the long-lived components that still have useful energy content while immobilizing the remnant waste fission products in stable forms. At the genesis of this project, next generation spent fuel reprocessing methods were being developed as part of the U.S. Department of Energy's Advanced Fuel Cycle Initiative. One of these processes was focused on solvent extraction schemes to isolate cesium (Cs) and strontium (Sr) from spent nuclear fuel. Isolating these isotopes for short-term decay storage eases the design requirements for long-term repository disposal; a significant amount of the radiation and decay heat in fission product waste comes from Cs-137 and Sr-90. For the purposes of this project, the Fission Product Extraction (FPEX) process is being considered to be the baseline extraction method. The objective of this project was to evaluate the nature and behavior of candidate materials for cesium and strontium immobilization; this will include assessments with minor additions of yttrium, barium, and rubidium in these materials. More specifically, the proposed research achieved the following objectives (as stated in the original proposal): (1) Synthesize simulated storage ceramics for Cs and Sr using an existing labscale steam reformer at Purdue University. The simulated storage materials will include aluminosilicates, zirconates and other stable ceramics with the potential for high Cs and Sr loading. (2) Characterize the immobilization performance, phase structure, thermal properties and stability of the simulated storage ceramics. The ceramic products will be stable oxide powders and will be characterized to quantify their leach resistance, phase structure, and thermophysical properties. The research progressed in two stages. First, a steam reforming process was used to generate candidate Cs/Sr storage materials for characterization. This portion of the research was carried out at

  13. Engineered Materials for Cesium and Strontium Storage. Final Technical Report

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle requires reprocessing spent fuel to recover the long-lived components that still have useful energy content while immobilizing the remnant waste fission products in stable forms. At the genesis of this project, next generation spent fuel reprocessing methods were being developed as part of the U.S. Department of Energy's Advanced Fuel Cycle Initiative. One of these processes was focused on solvent extraction schemes to isolate cesium (Cs) and strontium (Sr) from spent nuclear fuel. Isolating these isotopes for short-term decay storage eases the design requirements for long-term repository disposal; a significant amount of the radiation and decay heat in fission product waste comes from Cs-137 and Sr-90. For the purposes of this project, the Fission Product Extraction (FPEX) process is being considered to be the baseline extraction method. The objective of this project was to evaluate the nature and behavior of candidate materials for cesium and strontium immobilization; this will include assessments with minor additions of yttrium, barium, and rubidium in these materials. More specifically, the proposed research achieved the following objectives (as stated in the original proposal): (1) Synthesize simulated storage ceramics for Cs and Sr using an existing labscale steam reformer at Purdue University. The simulated storage materials will include aluminosilicates, zirconates and other stable ceramics with the potential for high Cs and Sr loading. (2) Characterize the immobilization performance, phase structure, thermal properties and stability of the simulated storage ceramics. The ceramic products will be stable oxide powders and will be characterized to quantify their leach resistance, phase structure, and thermophysical properties. The research progressed in two stages. First, a steam reforming process was used to generate candidate Cs/Sr storage materials for characterization. This portion of the research was carried out at Purdue

  14. Radiological protection and routinary controls of an activimeter with a cesium and barium sources in an nuclear medicine center; Proteccion radiologica y controles rutinarios de un activimetro con fuentes de cesio y bario en un centro de medicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Morales L, M.E. [IPEN INEN, Centro de Medicina Nuclear, Av. Aviacion 3799, Lima 34 (Peru)]. e-mail: toyoco3000@hotmail.com

    2006-07-01

    In the present work the results when carrying out the routine controls in a Deluxe Isotope (Calibrator II) equipment, with some sources of Cesium 137 and Barium 133, in a Nuclear Medicine Center that operates from the year 1983 in a modern one construction inside the Institute of Neoplastic Illnesses (INEN) are shown. Taking in account the Radiological Protection measures to verify if the equipment responds to the personnel's demands in the measurements of activities of the diverse radionuclides that are used in different types of exams that are carried out in this Nuclear Medicine Center are the objectives of this work. This Center was equipped initially with donated equipment by the International Atomic Energy Agency (IAEA) with those that it develops assistance, educational works and of research, giving services to patients of the INEN and other public and private medical centers. (Author)

  15. Biology and clinical implications of CD133+ liver cancer stem cells

    International Nuclear Information System (INIS)

    Hepatocellular carcinoma (HCC) is the most common primary malignant tumor of the liver, accounting for 80%–90% of all liver cancers. The disease ranks as the fifth most common cancer worldwide and is the third leading cause of all cancer-associated deaths. Although advances in HCC detection and treatment have increased the likelihood of a cure at early stages of the disease, HCC remains largely incurable because of late presentation and tumor recurrence. Only 25% of HCC patients are deemed suitable for curative treatment, with the overall survival at just a few months for inoperable patients. Apart from surgical resection, loco-regional ablation and liver transplantation, current treatment protocols include conventional cytotoxic chemotherapy. But due to the highly resistant nature of the disease, the efficacy of the latter regimen is limited. The recent emergence of the cancer stem cell (CSC) concept lends insight into the explanation of why treatment with chemotherapy often may seem to be initially successful but results in not only a failure to eradicate the tumor but also possibly tumor relapse. Commonly used anti-cancer drugs in HCC work by targeting the rapidly proliferating and differentiated liver cancer cells that constitute the bulk of the tumor. However, a subset of CSCs exists within the tumor, which are more resistant and are able to survive and maintain residence after treatment, thus, growing and self-renewing to generate the development and spread of recurrent tumors in HCC. In the past few years, compelling evidence has emerged in support of the hierarchic CSC model for solid tumors, including HCC. And in particular, CD133 has drawn significant attention as a critical liver CSC marker. Understanding the characteristics and function of CD133+ liver CSCs has also shed light on HCC management and treatment, including the implications for prognosis, prediction and treatment resistance. In this review, a detailed summary of the recent progress in CD

  16. Preparation and characterization of cesium-137 aluminosilicate pellets for radioactive source applications

    International Nuclear Information System (INIS)

    Twenty-seven fully loaded 137Cs aluminosilicate pellets were fabricated in a hot cell by the vacuum hot pressing of a cesium carbonate/montmorillonite clay mixture at 15000C and 570 psig. Four pellets were selected for characterization studies which included calorimetric measurements, metallography, scanning electron microscope and electron backscattering (SEM-BSE), electron microprobe, x-ray diffraction, and cesium ion leachability measurements. Each test pellet contained 437 to 450 curies of 137Cs as determined by calorimetric measurements. Metallographic examinations revealed a two-phase system: a primary, granular, gray matrix phase containing large and small pores and small pore agglomerations, and a secondary fused phase interspersed throughout the gray matrix. SEM-BSE analyses showed that cesium and silicon were uniformly distributed throughout both phases of the pellet. This indicated that the cesium-silicon-clay reaction went to completion. Aluminum homogeneity was unconfirmed due to the high background noise associated with the inherent radioactivity of the test specimens. X-ray diffraction analyses of both radioactive and non-radioactive aluminosilicate pellets confirmed the crystal lattice structure to be pollucite. Cesium ion quasistatic leachability measurements determined the leach rates of fully loaded 137Cs sectioned pollucite pellets to date to be 4.61 to 34.4 x 10-10 kg m-2s-1, while static leach tests performed on unsectioned fully loaded pellets showed the leach rates of the cesium ion to date to be 2.25 to 3.41 x 10-12 kg m-2s-1. The cesium ion diffusion coefficients through the pollucite pellet were calculated using Fick's first and second laws of diffusion. The diffusion coefficients calculated for three tracer level 137Cs aluminosilicate pellets were 1.29 x 10-16m2s-1, 6.88 x 10-17m2s-1, and 1.35 x 10-17m2s-1, respectively

  17. CD133 does not enrich for the stem cell activity in vivo in adult mouse prostates

    Directory of Open Access Journals (Sweden)

    Xing Wei

    2016-05-01

    Full Text Available CD133 is widely used as a marker for stem/progenitor cells in many organ systems. Previous studies using in vitro stem cell assays have suggested that the CD133-expressing prostate basal cells may serve as the putative prostate stem cells. However, the precise localization of the CD133-expressing cells and their contributions to adult murine prostate homeostasis in vivo remain undetermined. We show that loss of function of CD133 does not impair murine prostate morphogenesis, homeostasis and regeneration, implying a dispensable role for CD133 in prostate stem cell function. Using a CD133-CreERT2 model in conjunction with a fluorescent report line, we show that CD133 is not only expressed in a fraction of prostate basal cells, but also in some luminal cells and stromal cells. CD133+ basal cells possess higher in vitro sphere-forming activities than CD133− basal cells. However, the in vivo lineage tracing study reveals that the two cell populations possess the same regenerative capacity and contribute equally to the maintenance of the basal cell lineage. Similarly, CD133+ and CD133− luminal cells are functionally equivalent in maintaining the luminal cell lineage. Collectively, our study demonstrates that CD133 does not enrich for the stem cell activity in vivo in adult murine prostate. This study does not contradict previous reports showing CD133+ cells as prostate stem cells in vitro. Instead, it highlights a substantial impact of biological contexts on cellular behaviors.

  18. The crystal structures of potassium and cesium trivanadates

    Science.gov (United States)

    Evans, H.T.; Block, S.

    1966-01-01

    Potassium and cesium trivanadates are monoclinic and isomorphous, space group P21/m, with the following dimensions (Z = 2): KV3O8, a = 7.640 A, b = 8.380 A, c = 4.979 A, ??= 96?? 57???; CsV3O8, a = 8.176 A, b = 8.519 A, c = 4.988 A, ?? = 95?? 32???. The crystal structure of KV3O8 has been determined from hk0, 0kl, and h0l Weissenberg data with an R factor of 0.15. The structure of CsV3O8 has been refined with 1273 hkl Weissenberg data to an R factor of 0.089. The structures consist of corrugated sheets based on a linkage of distorted VO6, octahedra. Two of the vanadium atoms lie in double, square-pyramid groups V2O8, which are linked through opposite basal corners into chains along the b axis. The chains are joined laterally along the c axis into sheets by the third vanadium atom in VO groups, also forming part of a square-pyramid coordination. Various aspects of these structures are compared with other known oxovanadate structures.

  19. ATLAS tile calorimeter cesium calibration control and analysis software

    International Nuclear Information System (INIS)

    An online control system to calibrate and monitor ATLAS Barrel hadronic calorimeter (TileCal) with a movable radioactive source, driven by liquid flow, is described. To read out and control the system an online software has been developed, using ATLAS TDAQ components like DVS (Diagnostic and Verification System) to verify the hardware before running, IS (Information Server) for data and status exchange between networked computers, and other components like DDC (DCS to DAQ Connection), to connect to PVSS-based slow control systems of Tile Calorimeter, high voltage and low voltage. A system of scripting facilities, based on Python language, is used to handle all the calibration and monitoring processes from hardware perspective to final data storage, including various abnormal situations. A QT based graphical user interface to display the status of the calibration system during the cesium source scan is described. The software for analysis of the detector response, using online data, is discussed. Performance of the system and first experience from the ATLAS pit are presented

  20. Cesium sorption and desorption behavior of clay minerals

    International Nuclear Information System (INIS)

    Cesium sorption and desorption of clay minerals (montmorillonite, beidellite, nontronite, weathered biotite, rectorite and illite) were investigated by consecutive sorption-desorption (CSD) experiments. In batch sorption experiment, two solutions with different Cs concentration 10-3 and 10-7 mol/L) were used. In batch desorption experiments, Cs sorbed samples in sorption experiments were treated 5 times with 1 mol/L ammonium acetate solution. In the case of CSD experiments using 10-3 mol/L Cs solution, the exchangeable cations (Na, Ca, and K) in the clay samples affected to the sorption ratio of Cs, and this effect depended on the type of clay mineral. The desorption ratios of untreated, Na-exchanged and Ca-exchanged weathered biotite ranged from 23 to 33%, while that of other samples was over 80%. In the case of CSD experiments using 10-7 mol/L Cs solution, the sorption ratio of montmorillonite was smaller than that of the other clay samples. In desorption experiments, more than 10-9 mol sorbed Cs remained in 1.0 g of the sample after 5 extraction times. These results indicate that all examined clay samples are able to strongly adsorb Cs with a capacity of more than 10-9 mol/g. (author)

  1. Broadband Vibrational Cooling of Cold Cesium Molecules: Theory and Experiments

    Institute of Scientific and Technical Information of China (English)

    D. Sofikitis; A. Fioretti; S. Weber; M. Viteau; A. Chotia; R. Horchani; M. Allegrini; B. Chatel; D. Comparat; P. Pillet

    2009-01-01

    The use of a broadband, frequency shaped femtosecond laser on translationally cold cesium molecules has recently demonstrated to be a very efficient method of cooling also the vibrational degree of freedom. A sample of cold molecules, initially distributed over several vibrational levels, has thus been transfered into a single selected vibrational level of the singlet X1∑g ground electronic state. Our method is based on repeated optical pumping by laser light with a spectrum broad enough to excite all populated vibrational levels but limited in its frequency bandwidth with a spatial light modulator. In such a way we are able to eliminate transitions from the selected level, in which molecules accumulate. In this paper we briefly report the main experimental results and then address, in a detailed way by computer simulations, the perspectives for a "complete" cooling of the molecules, including also the rotational degree of freedom. Since the pumping process strongly depends on the rclative shape of the ground and excited potential curves, ro-vibrational cooling through different excited states is theoretically compared.

  2. Evaluation of a cesium adsorbent grafted with ammonium 12-molybdophosphate

    Science.gov (United States)

    Shibata, Takuya; Seko, Noriaki; Amada, Haruyo; Kasai, Noboru; Saiki, Seiichi; Hoshina, Hiroyuki; Ueki, Yuji

    2016-02-01

    A fibrous cesium (Cs) adsorbent was developed using radiation-induced graft polymerization with a cross-linked structure containing a highly stable adsorption ligand. The ligand, ammonium 12-molybdophosphate (AMP), was successfully introduced onto the fibrous polyethylene trunk material. The resulting Cs adsorbent contained 36% nonwoven fabric polyethylene (NFPE), 1% AMP, 2% triallyl isocyanurate (TAIC) and 61% glycidyl methacrylate (GMA). The adsorbent's Cs adsorption capacity was evaluated using batch and column tests. It was determined that the adsorbent could be used in a wide pH range. The amount of desorbed molybdenum, which can be used as an estimate for AMP stability on the Cs adsorbent, was minimized at the standard drinking water pH range of 5.8-8.6. Based from the inspection on the adherence of these results to the requirements set forth by the Food Sanitation Act by a third party organization, it can be concluded that the developed Cs adsorbent can be safely utilized for drinking water.

  3. Ion exchange performance of commercial crystalline silicotitanates for cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Braun, R.; Dangieri, T.J.; Fennelly, D.J. [and others

    1996-03-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST), invented by researchers at Sandia National Laboratories and Texas A&M University, has been commercialized in a joint Sandia-UOP effort. The original developmental materials exhibited high selectivity for the ion exchange of cesium, strontium, and several other radionuclides from highly alkaline solutions containing molar concentrations of Na{sup +}. The materials also showed excellent chemical and radiation stability. Together, the high selectivity and stability of the CSTs made them excellent candidates for treatment of solutions such as the Hanford tank supernates and other DOE radwastes. Sandia National Laboratories and UOP have teamed under a Cooperative Research and Development Agreement (CRADA) to develop CSTs in the powdered form and in an engineered form suitable for column ion exchange use. A continuous-flow, column ion exchange process is expected to be used to remove Cs and other radionuclides from the Hanford supernatant. The powder material invented by the Sandia and Texas A&M team consists of submicron-size particles. It is not designed for column ion exchange but may be used in other applications.

  4. Hanford Isotope Project strategic business analysis Cesium-137 (Cs-137)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    The purpose of this business analysis is to address the beneficial reuse of Cesium 137 (Cs-137) in order to utilize a valuable national asset and possibly save millions of tax dollars. Food irradiation is the front runner application along with other uses. This business analysis supports the objectives of the Department of Energy National Isotope Strategy distributed in August 1994 which describes the DOE plans for the production and distribution of isotope products and services. As part of the Department`s mission as stated in that document. ``The Department of Energy will also continue to produce and distribute other radioisotopes and enriched stable isotopes for medical diagnostics and therapeutics, industrial, agricultural, and other useful applications on a businesslike basis. This is consistent with the goals and objectives of the National Performance Review. The Department will endeavor to look at opportunities for private sector to co-fund or invest in new ventures. Also, the Department will seek to divest from ventures that can more profitably or reliably be operated by the private sector.``

  5. Hanford Isotope Project strategic business analysis Cesium-137 (Cs-137)

    International Nuclear Information System (INIS)

    The purpose of this business analysis is to address the beneficial reuse of Cesium 137 (Cs-137) in order to utilize a valuable national asset and possibly save millions of tax dollars. Food irradiation is the front runner application along with other uses. This business analysis supports the objectives of the Department of Energy National Isotope Strategy distributed in August 1994 which describes the DOE plans for the production and distribution of isotope products and services. As part of the Department's mission as stated in that document. ''The Department of Energy will also continue to produce and distribute other radioisotopes and enriched stable isotopes for medical diagnostics and therapeutics, industrial, agricultural, and other useful applications on a businesslike basis. This is consistent with the goals and objectives of the National Performance Review. The Department will endeavor to look at opportunities for private sector to co-fund or invest in new ventures. Also, the Department will seek to divest from ventures that can more profitably or reliably be operated by the private sector.''

  6. Differential number of CD34+, CD133+ and CD34+/CD133+ cells in peripheral blood of patients with congestive heart failure

    Directory of Open Access Journals (Sweden)

    Fritzenwanger M

    2009-03-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC which are characterised by the simulateous expression of CD34, CD133 and vascular endothelial growth receptor 2 (VEGF 2 are involved in the pathophysiology of congestive heart failure (CHF and their number and function is reduced in CHF. But so far our knowledge about the number of circulating hematopoietic stem/progenitor cells (CPC expressing the early hematopoietic marker CD133 and CD34 in CHF is spares and therefore we determined their number and correlated them with New York Heart Association (NYHA functional class. Methods CD34 and CD133 surface expression was quantified by flow cytometry in the peripheral venous blood of 41 healthy adults and 101 patients with various degrees of CHF. Results CD34+, CD133+ and CD34+/CD133+ cells correlated inversely with age. Both the number of CD34+ and of CD34+/CD133+ cells inversely correlated with NYHA functional class. The number of CD133+ cells was not affected by NYHA class. Furthermore the number of CD133+ cells did not differ between control and CHF patients. Conclusion In CHF the release of CD34+, CD133+ and CD34+/CD133+ cells from the bone marrow seems to be regulated differently. Modulating the releasing process in CHF may be a tool in CHF treatment.

  7. Internal radiotherapy with copper-64-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) reduces CD133{sup +} highly tumorigenic cells and metastatic ability of mouse colon carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Yoshii, Yukie [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Furukawa, Takako [Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan); Kiyono, Yasushi [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Watanabe, Ryo [Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Mori, Tetsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Yoshii, Hiroshi [Faculty of Medical Sciences, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Asai, Tatsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Okazawa, Hidehiko [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Welch, Michael J. [Mallinckrodt Institute of Radiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Fujibayashi, Yasuhisa, E-mail: yfuji@nirs.go.j [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan)

    2011-02-15

    Introduction: {sup 64}Cu-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) ({sup 64}Cu-ATSM) is an imaging agent for positron emission tomography (PET) that targets hypoxic tumors. {sup 64}Cu-ATSM is also reported to be a potential agent for internal radiotherapy. In a mouse colon carcinoma (Colon-26) model, we have shown that {sup 64}Cu-ATSM preferentially localizes in intratumoral regions with a high density of CD133{sup +} cells, which show characteristics of cancer stem cells or cancer stem cell-like cells (collectively referred here as CSCs). In this study, we evaluated the therapeutic effect of {sup 64}Cu-ATSM in relation to CD133 expression using this model. Methods: Systemic administration of 37 MBq {sup 64}Cu-ATSM or saline was conducted twice within a 1-week interval to mice bearing 1-week-old Colon-26 tumors (days 0-7). At day 19, tumor size measurement, flow cytometry analysis and experimental lung metastatic assay were performed. The therapeutic effect of {sup 64}Cu-ATSM on sorted CD133{sup +} and CD133{sup -} Colon-26 cells was also examined in vitro. Results: In vivo studies showed that {sup 64}Cu-ATSM treatment inhibited tumor growth. The percentage of CD133{sup +} cells and metastatic ability in {sup 64}Cu-ATSM treated tumors was decreased compared with that in control animals. In vitro studies demonstrated that {sup 64}Cu-ATSM accumulated in cells under hypoxic conditions and incorporation of {sup 64}Cu-ATSM under hypoxia caused cell death in both CD133{sup +} and CD133{sup -} cells in a similar extent. Conclusions: {sup 64}Cu-ATSM administration reduced tumor volume as well as the percentage of CD133{sup +} cells and the metastatic ability of Colon-26 tumors. Together with our data, it is suggested that {sup 64}Cu-ATSM accumulates in regions high in CD133{sup +} highly tumorigenic cells and kills such regions by radiation, resulting in a decrease of the percentage of CD133{sup +} cells.

  8. Quantum dots affect expression of CD133 surface antigen in melanoma cells

    Directory of Open Access Journals (Sweden)

    Steponkiene S

    2011-10-01

    Full Text Available Simona Steponkiene1-3, Simona Kavaliauskiene1, Rasa Purviniene4, Ricardas Rotomskis3,5, Petras Juzenas11Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Radiumhospital, Oslo, Norway; 2Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania; 3Biomedical Physics Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 4Immunology Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 5Biophotonics Laboratory, Laser Research Center, Vilnius University, Vilnius, LithuaniaBackground: In novel treatment approaches, therapeutics should be designed to target cancer stem cells (CSCs. Quantum dots (QDs are a promising new tool in fighting against cancer. However, little is known about accumulation and cytotoxicity of QDs in CSCs.Methods: Accumulation and cytotoxicity of CdTe-MPA (mercaptopropionic acid QDs in CSCs were assessed using flow cytometry and fluorescence-activated cell sorting techniques as well as a colorimetric cell viability assay.Results: We investigated the expression of two cell surface-associated glycoproteins, CD44 and CD133, in four different cancer cell lines (glioblastoma, melanoma, pancreatic, and prostate adenocarcinoma. Only the melanoma cells were positive to both markers of CD44 and CD133, whereas the other cells were only CD44-positive. The QDs accumulated to a similar extent in all subpopulations of the melanoma cells. The phenotypical response after QD treatment was compared with the response after ionizing radiation treatment. The percentage of the CD44high-CD133high subpopulation decreased from 72% to 55%–58% for both treatments. The stem-like subpopulation CD44highCD133low/- increased from 26%–28% in the untreated melanoma cells to 36%–40% for both treatments.Conclusion: Treatment of melanoma cells with QDs results in an increase of stem-like cell subpopulations. The changes in phenotype distribution of the melanoma cells after

  9. Misinterpretation on the risk of radioactive cesium contained in the disaster wastes

    International Nuclear Information System (INIS)

    Osaka Prefectural Government accepted the disaster wastes contained radioactive cesium after investigation them during one year. I explained the process and discussed about the risk management by people and the self-government body. The environmental pollution by radioactive cesium and Act on Special Measures concerning the Handling of Pollution by Radioactive Materials, the progress of treatment of debris, the concentration of radioactive cesium in debris, the acceptance conditions of debris contained small amount of radioactive cesium, evaluation of effects of radioactive materials in debris on the environment, and citizen's opinion of Osaka prefecture are described. The important investigation area of radioactive contamination on the basis of Act on Special Measures concerning the Handling of Pollution by Radioactive Materials, total amount of waste from Fukushima nuclear accident and debris in Miyagi, Iwate and Fukushima prefecture, the concentration of radioactive cesium in debris in Rikuzentakata and Miyako city as of September, 2011, and cumulative number of citizen's opinion to Osaka are illustrated. (S.Y.)

  10. Local mat-forming cyanobacteria effectively facilitate decontamination of radioactive cesium in rice fields

    International Nuclear Information System (INIS)

    The most effective and widespread method to decontaminate radioactive cesium from the Fukushima Daiichi Nuclear Power Plant Disaster was peeling topsoil. But the method had problems, such as large amounts of discarded soil and large-scale work. In nature, cyanobacteria formed biomats on the ground surface and facilitated peeling topsoil when the biomats dried. The cyanobacteria-facilitating peeling decontamination method utilized these cyanobacterial properties. Cyanobacteria are located all over Japan and 'local' cyanobacteria could be used for decontamination without introducing new species. Utilizing cyanobacteria could decrease the amount of discarded soil to about 30% and downsize the execution-scale to individual locations. Cyanobacterial biomats were easily cultivated, especially in rice fields, by maintaining wet conditions and exposure to 100 - 83% solar radiation. Shading by a thin net was helpful in maintaining an environment suitable for cyanobacteria. Nowadays, to prevent uptake of radioactive cesium into rice, K+ is usually added to fertilizer in rice fields. The K+ fertilization in rice fields might also enhance cyanobacterial capture of radioactive cesium, because high concentrations of K+ enhanced cyanobacterial uptake of Cs+. Cyanobacteria could also mitigate the risk of radioactive cesium moving away from a decontaminating rice field. Therefore, the cyanobacteria-facilitating peeling decontamination method was proposed as an easy and safe 'D.I.Y.' method for both farmers and the environment. Besides, plowing rice fields with water before peeling improved the efficiency of this method, because plowing increased the radioactive cesium concentration in the topsoil. (author)

  11. Development program for magnetically assisted chemical separation: Evaluation of cesium removal from Hanford tank supernatant

    International Nuclear Information System (INIS)

    Magnetic particles (MAG*SEPSM) coated with various absorbents were evaluated for the separation and recovery of low concentrations of cesium from nuclear waste solutions. The MAG*SEPSM particles were coated with (1) clinoptilolite, (2) transylvanian volcanic tuff, (3) resorcinol formaldehyde, and (4) crystalline silico-titanate, and then were contacted with a Hanford supernatant simulant. Particles coated with the crystalline silico-titanate were identified by Bradtec as having the highest capacity for cesium removal under the conditions tested (variation of pH, ionic strength, cesium concentration, and absorbent/solution ratio). The MAG*SEPSM particles coated with resorcinol formaldehyde had high distribution ratios values and could also be used to remove cesium from Hanford supernant simulant. Gamma irradiation studies were performed on the MAG*SEPSM particles with a gamma dose equivalent to 100 cycles of use. This irradiation decreased the loading capacity and distribution ratios for the particles by greater than 75%. The particles demonstrated high sensitivity to radiolytic damage due to the degradation of the polymeric regions. These results were supported by optical microscopy measurements. Overall, use of magnetic particles for cesium separation under nuclear waste conditions was found to be marginally effective

  12. Efficiency of fly ash belite cement and zeolite matrices for immobilizing cesium.

    Science.gov (United States)

    Goñi, S; Guerrero, A; Lorenzo, M P

    2006-10-11

    The efficiency of innovative matrices for immobilizing cesium is presented in this work. The matrix formulation included the use of fly ash belite cement (FABC-2-W) and gismondine-type Na-P1 zeolite, both of which are synthesized from fly ash of coal combustion. The efficiency for immobilizing cesium is evaluated from the leaching test ANSI/ANS 16.1-1986 at the temperature of 40 degrees C, from which the apparent diffusion coefficient of cesium is obtained. Matrices with 100% of FABC-2-W are used as a reference. The integrity of matrices is evaluated by porosity and pore-size distribution from mercury intrusion porosimetry, X-ray diffraction and nitrogen adsorption analyses. Both matrices can be classified as good solidify systems for cesium, specially the FABC-2-W/zeolite matrix in which the replacement of 50% of belite cement by the gismondine-type Na-P1 zeolite caused a decrease of two orders of magnitude of cesium mean Effective Diffusion Coefficient (D(e)) (2.8e-09 cm(2)/s versus 2.2e-07 cm(2)/s, for FABC-2-W/zeolite and FABC-2-W matrices, respectively). PMID:16759800

  13. Preparation of Modified Kaolin Filler with Cesium and Its Application in Security Paper

    Directory of Open Access Journals (Sweden)

    Houssni El-Saied

    2013-01-01

    Full Text Available In this study, cesium was added intentionally during paper manufacture for protecting the papers against forgery and counterfeiting by sorbing cesium ions (Cs+ on kaolin, used as special filler in papermaking. The sorption of cesium from aqueous solution by kaolin was studied as a function of pH, shaking time, cesium initial concentration, and mass of kaolin using batch technique. The results showed that a solution containing 10 mg/L Cs+ and 250 mg of kaolin at pH 6 can be used to modify the kaolin. Paper handsheets were prepared containing various percentages of the modified kaolin. The mechanical and optical properties of paper handsheets were studied. The prepared paper handsheets were irradiated by gamma irradiation using different doses. Fourier transform infrared (FTIR spectroscopy was used to study the effect of kaolin modification by cesium and gamma irradiation on paper handsheets properties. The results indicated that modified kaolin enhanced the mechanical and optical properties of paper handsheets. Electron spin resonance (ESR spectroscopy and laser-induced breakdown spectroscopy (LIBS were also used. They provided rapid, sensitive and nondestructive techniques in differentiating between different questioned documents. This study presents a new concept in manufacturing security papers and anticounterfeiting applications.

  14. Study of the elastic scattering differential cross sections of a proton beam by a cesium target

    International Nuclear Information System (INIS)

    The elastic differential cross section of H+ on Cs is studied experimentally and theoretically. The experimental device is described, after which the differential cross-section values obtained as a function of the laboratory angle are given for four incident energies: 13.4 eV, 15.1 eV, 17.7 eV and 24.2 eV. By means of an interaction potential of the quasi-molecule H+Cs the differential cross sections are calculated for the same incident energies; this calculation uses the semi-classical method of stationary phases which shows clearly the limits of conventional description and the changes introduced by quantum effects. Very good agreement is obtained between theoretical and experimental results, which shows that elastic scattering is very little perturbed by inelastic channels in this energy range. The estimated inelastic cross section at 24 eV is about 1.9 10-15cm2, corresponding to 1.6% of the scattering process

  15. Molecular analysis of ex-vivo CD133+ GBM cells revealed a common invasive and angiogenic profile but different proliferative signatures among high grade gliomas

    Directory of Open Access Journals (Sweden)

    Garcia Juan L

    2010-08-01

    Full Text Available Abstract Background Gliomas are the most common type of primary brain tumours, and in this group glioblastomas (GBMs are the higher-grade gliomas with fast progression and unfortunate prognosis. Two major aspects of glioma biology that contributes to its awful prognosis are the formation of new blood vessels through the process of angiogenesis and the invasion of glioma cells. Despite of advances, two-year survival for GBM patients with optimal therapy is less than 30%. Even in those patients with low-grade gliomas, that imply a moderately good prognosis, treatment is almost never curative. Recent studies have demonstrated the existence of a small fraction of glioma cells with characteristics of neural stem cells which are able to grow in vitro forming neurospheres and that can be isolated in vivo using surface markers such as CD133. The aim of this study was to define the molecular signature of GBM cells expressing CD133 in comparison with non expressing CD133 cells. This molecular classification could lead to the finding of new potential therapeutic targets for the rationale treatment of high grade GBM. Methods Eight fresh, primary and non cultured GBMs were used in order to study the gene expression signatures from its CD133 positive and negative populations isolated by FACS-sorting. Dataset was generated with Affymetrix U133 Plus 2 arrays and analysed using the software of the Affymetrix Expression Console. In addition, genomic analysis of these tumours was carried out by CGH arrays, FISH studies and MLPA; Results Gene expression analysis of CD133+ vs. CD133- cell population from each tumour showed that CD133+ cells presented common characteristics in all glioblastoma samples (up-regulation of genes involved in angiogenesis, permeability and down-regulation of genes implicated in cell assembly, neural cell organization and neurological disorders. Furthermore, unsupervised clustering of gene expression led us to distinguish between two groups

  16. Surface expression of CXCR4 on circulating CD133+ progenitor cells is associated with plaque instability in subjects with carotid artery stenosis

    Directory of Open Access Journals (Sweden)

    Sadikovic Suwad

    2009-12-01

    Full Text Available Abstract Background Circulating progenitor cells (PCs are considered to contribute to the remodeling of atherosclerotic plaques. Their surface receptor CXCR4 plays an important role in the recruitment of PCs to their target. This study compares the mobilization of PCs and their functional characteristics in asymptomatic subjects with stable and with unstable carotid plaques. This could provide insight into plaque remodeling and help to develop biomarkers for plaque stability. Methods In 31 subjects with asymptomatic carotid artery stenosis we analyzed the number of CD133+ PCs, VEGFR2+CD34+ PCs and the surface expression of CXCR4 on CD133+ PCs by flow cytometry. Subjects underwent bilateral carotid MRI in a 1.5-T scanner in order to allow the categorization of plaques, following the modified criteria of the American Heart Association. Results The number of CD133+ PCs and VEGFR2+CD34+ PCs showed no significant difference between subjects with stable and unstable carotid plaques. The expression of CXCR4 on CD133+ PCs was higher in subjects with unstable plaques than in subjects with stable plaques (p = 0.009. Conclusions This study demonstrates an association between functional characteristics of circulating CD133+ PCs and plaque stability in subjects with asymptomatic carotid artery stenosis. The higher expression of CXCR4 on CD133+ PCs suggests a difference in the recruitment of PCs to the injured tissue in subjects with unstable plaques and subjects with stable plaques. As surface expression of CXCR4 on CD133+ PCs differs in subjects with unstable and with stable plaques, CXCR4 is a promising candidate for a serological biomarker for plaque stability.

  17. Cesium-137 in soil texture fractions and its impact on Cesium-137 soil-to-plant transfer

    International Nuclear Information System (INIS)

    Field studies at two sites contaminated by the Chernobyl fallout showed 137Cesium (Cs) soil-to-plant transfer factors in wheat, rye and potato. Transfer values ranged from 0.0017 (potato tuber) to 0.07 (wheat straw). Generally transfer coefficients in cereal grains and potato tubers were significantly below the values of the shoots. A comparison of the two sites led to the conclusion that for all plants investigated 137Cs transfer factors were higher in Lower Austria (Calcic Chernozem) than in Upper Austria (Eutric Cambisol). The specific activities of the texture fractions of the two soil types increased from sand to silt and clay. In the Calcic Chernozem the ratio of the 137Cs activity in the silt fraction to the total activity in the soil was considerably higher than in the Eutric Cambisol. At the same time extractability of 137Cs from the silt fraction of the latter soil was clearly lower. Both results mainly were attributed to the differences between the soils according to the organic matter content of the silt fractions, the Calcic Chernozem being seven times higher. Therefore, the differences in the 137Cs-soil-to-plant transfer can be attributed partly to these soil characteristics. (authors)

  18. Prognostic role of CD133 expression in colorectal cancer: a meta-analysis

    OpenAIRE

    Wang Ke; Xu Jianjun; Zhang Junshu; Huang Jian

    2012-01-01

    Abstract Background CD133 has been identified as a putative cancer stem cell marker in colorectal cancer (CRC). However, the clinical and prognostic significance of CD133 in CRC remains controversial. Methods Publications were identified which assessed the clinical or prognostic significance of CD133 in CRC up to October 2012. A meta-analysis was performed to clarify the association between CD133 expression and clinical outcomes. Results A total of 12 studies met the inclusion criteria, and c...

  19. 27 CFR 478.133 - Records of transactions in semiautomatic assault weapons.

    Science.gov (United States)

    2010-04-01

    ... semiautomatic assault weapons. 478.133 Section 478.133 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... AMMUNITION Records § 478.133 Records of transactions in semiautomatic assault weapons. The evidence specified in § 478.40(c), relating to transactions in semiautomatic assault weapons, shall be retained in...

  20. 41 CFR 301-10.133 - What is a U.S. flag air carrier?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false What is a U.S. flag air carrier? 301-10.133 Section 301-10.133 Public Contracts and Property Management Federal Travel Regulation... Carrier Transportation Use of United States Flag Air Carriers § 301-10.133 What is a U.S. flag air...

  1. 46 CFR 108.133 - Hull superstructure, structural bulkheads, decks, and deckhouses.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hull superstructure, structural bulkheads, decks, and deckhouses. 108.133 Section 108.133 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.133 Hull...

  2. Sympathetic cooling in a rubidium cesium mixture: Production of ultracold cesium atoms; Sympathetisches Kuehlen in einer Rubidium-Caesium-Mischung: Erzeugung ultrakalter Caesiumatome

    Energy Technology Data Exchange (ETDEWEB)

    Haas, M.

    2007-07-01

    This thesis presents experiments for the production of ultracold rubidium cesium mixture in a magnetic trap. The long-termed aim of the experiment is the study of the interaction of few cesium atoms with a Bose-Einstein condensate of rubidium atoms. Especially by controlled variation of the cesium atom number the transition in the description of the interaction by concepts of the one-particle physics to the description by concepts of the many-particle physics shall be studied. The rubidium atoms are trapped in a magneto-optical trap (MOT) and from there reloaded into a magnetic trap. In this the rubidium atoms are stored in the state vertical stroke f=2,m{sub f}=2 right angle of the electronic ground state and evaporatively cooled by means of microwave-induced transitions into the state vertical stroke f=1,m{sub f}=1] (microwave cooling). The cesium atoms are also trppaed in a MOT and into the same magnetic trap reloaded, in which they are stored in the state vertical stroke f=4,m{sub f}=4 right angle of the electronic ground state together with rubidium. Because of the different hyperfine splitting only rubidium is evaporatively cooled, while cesium is cooled jointly sympathetically - i.e. by theramal contact via elastic collisions with rubidium atoms. The first two chapters contain a description of interatomic interactions in ultracold gases as well as a short summary of theoretical concepts in the description of Bose-Einstein condensates. The chapters 3 and 4 contain a short presentation of the methods applied in the experiment for the production of ultracold gases as well as the experimental arrangement; especially in the framework of this thesis a new coil system has been designed, which offers in view of future experiments additionally optical access for an optical trap. Additionally the fourth chapter contains an extensive description of the experimental cycle, which is applied in order to store rubidium and cesium atoms together into the magnetic trap. The

  3. An Integrated Hydrologic Modeling Approach to Cesium-137 Transport in Forested Fukushima Watersheds

    Science.gov (United States)

    Siirila-Woodburn, E. R.; Steefel, C. I.; Williams, K. H.; Birkholzer, J. T.

    2015-12-01

    The 2011 Fukushima Daiichi Nuclear Power Plant (FDNPP) accident in Japan resulted in a significant dissemination of cesium-137 (Cs-137) over a wide area west of the plant, including the contamination of many watersheds and the subsequent evacuation of many communities. Today approximately 90% of on-land Cs-137 fallout following the accident resides in the upper 5 cm of forest soils. While this can be partially attributed to the forested composition of the prefecture (70%), there is also difficulty in cleanup efforts in these regions due to a lack of understanding and predictive capability of radioisotopes transport at the catchment to watershed scale. Subsequently, there is an uncertain, but likely long-term impact on local communities with implications for the use of nuclear energy use worldwide. Due to the complex nature of forest eco-hydrology, sophisticated modeling tools to accurately predict Cs-137 fluxes across different spatial and temporal scales are required. High fidelity, high resolution numerical modeling techniques in conjunction with parallel high performance computing is required to accurately determine transport and feedbacks in these complex systems. To better understand the fundamental transport of Cs-137, a watershed near the FDNPP is modeled with an integrated hydrologic model that includes variably saturated groundwater and overland flow in addition to atmospheric and vegetative processes via a coupled land surface model. Of specific interest is the impact of land cover type on hydrologic flow in the area, which will likely play an important role in erosion patterns and the consequent transport of Cs-137 strongly sorbed to surface soils. Risk management practices (for example, passive remediation versus active remediation such as targeted logging) for two principal tree types (evergreen and deciduous) are informed given the simulated responses to flow patterns assuming different quantities and spatial distribution patterns of each tree type.

  4. Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer.

    Science.gov (United States)

    Sansone, Pasquale; Ceccarelli, Claudio; Berishaj, Marjan; Chang, Qing; Rajasekhar, Vinagolu K; Perna, Fabiana; Bowman, Robert L; Vidone, Michele; Daly, Laura; Nnoli, Jennifer; Santini, Donatella; Taffurelli, Mario; Shih, Natalie N C; Feldman, Michael; Mao, Jun J; Colameco, Christopher; Chen, Jinbo; DeMichele, Angela; Fabbri, Nicola; Healey, John H; Cricca, Monica; Gasparre, Giuseppe; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline

    2016-02-09

    The mechanisms of metastatic progression from hormonal therapy (HT) are largely unknown in luminal breast cancer. Here we demonstrate the enrichment of CD133(hi)/ER(lo) cancer cells in clinical specimens following neoadjuvant endocrine therapy and in HT refractory metastatic disease. We develop experimental models of metastatic luminal breast cancer and demonstrate that HT can promote the generation of HT-resistant, self-renewing CD133(hi)/ER(lo)/IL6(hi) cancer stem cells (CSCs). HT initially abrogates oxidative phosphorylation (OXPHOS) generating self-renewal-deficient cancer cells, CD133(hi)/ER(lo)/OXPHOS(lo). These cells exit metabolic dormancy via an IL6-driven feed-forward ER(lo)-IL6(hi)-Notch(hi) loop, activating OXPHOS, in the absence of ER activity. The inhibition of IL6R/IL6-Notch pathways switches the self-renewal of CD133(hi) CSCs, from an IL6/Notch-dependent one to an ER-dependent one, through the re-expression of ER. Thus, HT induces an OXPHOS metabolic editing of luminal breast cancers, paradoxically establishing HT-driven self-renewal of dormant CD133(hi)/ER(lo) cells mediating metastatic progression, which is sensitive to dual targeted therapy.

  5. MiR-133a Is Functionally Involved in Doxorubicin-Resistance in Breast Cancer Cells MCF-7 via Its Regulation of the Expression of Uncoupling Protein 2.

    Directory of Open Access Journals (Sweden)

    Yuan Yuan

    Full Text Available The development of novel targeted therapies holds promise for conquering chemotherapy resistance, which is one of the major hurdles in current breast cancer treatment. Previous studies indicate that mitochondria uncoupling protein 2 (UCP-2 is involved in the development of chemotherapy resistance in colon cancer and lung cancer cells. In the present study we found that lower level of miR133a is accompanied by increased expression of UCP-2 in Doxorubicin-resistant breast cancer cell cline MCF-7/Dox as compared with its parental cell line MCF-7. We postulated that miR133a might play a functional role in the development of Doxorubicin-resistant in breast cancer cells. In this study we showed that: 1 exogenous expression of miR133a in MCF-7/Dox cells can sensitize their reaction to the treatment of Doxorubicin, which is coincided with reduced expression of UCP-2; 2 knockdown of UCP-2 in MCF-7/Dox cells can also sensitize their reaction to the treatment of Doxorubicin; 3 intratumoral delivering of miR133a can restore Doxorubicin treatment response in Doxorubicin-resistant xenografts in vivo, which is concomitant with the decreased expression of UCP-2. These findings provided direct evidences that the miR133a/UCP-2 axis might play an essential role in the development of Doxorubicin-resistance in breast cancer cells, suggesting that the miR133a/UCP-2 signaling cohort could be served as a novel therapeutic target for the treatment of chemotherapy resistant in breast cancer.

  6. Behavior of ruthenium, cesium and antimony during simulated HLLW vitrification

    International Nuclear Information System (INIS)

    The behavior of ruthenium, cesium, and antimony during the vitrification of simulated high-level radioactive liquid wastes (HLLW) in a liquid fed melter was studied on a laboratory scale and on a semi-pilot scale. In the laboratory melter of a 2.5 kg capacity, a series of tests with the simulate traced with 103Ru, 134Cs and 124Sb, has shown that the Ru and Cs losses to the melter effluent are generally higher than 10% whereas the antimony losses remain lower than 0.4%. A wet purification system comprising in series, a dust scrubber, a condenser, an ejector venturi and an NOx washing column retains most of the activity present in the off-gas so that the release fractions for Ru at the absolute filter inlet ranges between 5.10-3 to 5.10-5% of the Ru fed, for Cs the corresponding release fraction ranges between 3.10-3 to 10-4% and for Sb the release fraction ranges between 1.7 10-4 to 1.7 10-5%. The same experiments were performed at a throughput of 1 to 2 1 h-1 of simulated solution in the semi-pilot scale unit RUFUS. The RUFUS unit comprises a glass melter with a 50 kg molten glass capacity and the wet purification train comprises in series a dust scrubber, a condenser, an ejector venturi and an NOx washing column. The tracer tests were restricted to 103Ru and 134Cs since the laboratory tests had shown that the antimony losses were very low. The results of the tests are presented

  7. Cesium and Strontium Specific Exchangers for Nuclear Waste Effluent Remediation

    International Nuclear Information System (INIS)

    During the past 50 years, nuclear defense activities have produced large quantities of nuclear waste that now require safe and permanent disposal. The general procedure to be implemented involves the removal of cesium and strontium from the waste solutions for disposal in permanently vitrified media. This requires highly selective sorbents or ion exchangers. Further, at the high radiation doses present in the solution, organic exchangers or sequestrants are likely to decompose over time. Inorganic ion exchangers are resistant to radiation damage and can exhibit remarkably high selectivities. We have synthesized three families of tunnel-type ion exchangers. The crystal structures of these compounds as well as their protonated phases, coupled with ion exchange titrations, were determined and this information was used to develop an understanding of their ion exchange behavior. The ion exchange selectivities of these phases could be regulated by isomorphous replacement of the framework metals by larger or smaller radius metals. In the realm of layered compounds, we prepared alumina, silica, and zirconia pillared clays and sodium micas. The pillared clays yielded very high Kd values for Cs+ and were very effective in removing Cs+ from groundwaters. The sodium micas also had a high affinity for Cs+ but an even greater attraction for S42+. They also possess the property of trapping these ions permanently as the layers slowly decrease their interlayer distance as loading occurs. Sodium nonatitanate exhibited extremely high Kd values for Sr2+ in alkaline tank wastes and should be considered for removal of Sr2+ in such cases. For tank wastes containing complexing agents, we have found that adding Ca2+ to the solution releases the complexed Sr2+ which may then be removed with the CST exchanger

  8. Immobilisation and solidification of cesium on 11 A calcium silicate hydroxy hydrate column

    International Nuclear Information System (INIS)

    Calcium silicate hydrate closely resembling silicate mineral 11 A tobermorite has been synthesised by hydrothermal treatment of lime and silica at 175 degC. The synthetic mineral exhibits selectivity for Cs+ in the presence of strong solutions of alkali and alkaline earth cations, viz, Na+, K+, Mg2+, Ca2+, Sr2+, etc. The Al-substituted form of this mineral effectively separates cesium ion when used as an exchanger in column of size 35x5 mm (hxr). It is possible to remove 98.65±0.5%Cs+ from a mixed solution of cesium and sodium (0.0001N Cs+ + 0.5N Na+). Column separation of cesium from simulated intermediate level waste solution shows that from the first run ∼ 76% Cs+ can be immobilised on a small column, 18x10mm (hxr), having 2.0 g of exchanger. (author)

  9. Studies of cesium and strontium migration in unconsolidated Canadian geological materials

    International Nuclear Information System (INIS)

    Distribution coefficients (Ksub(d)) were measured for cesium and strontium in 16 samples of Canadian unconsolidated geological materials. The samples were collected to cover a wide range of grain size, clay-mineral composition, cation exchange capacity and carbonate mineral content. Distribution coefficients ranged between 102 and 2.0 x 104 ml/g for cesium and between 2.5 and 102 ml/g for strontium, indicating that most unconsolidated geological materials have a substantial ability to retard the migration of cesium, while strontium could generally be expected to be somewhat more mobile. The measured K values were not significantly correlated with the measured soil properties, but appeared to be significantly affected by the background concentration of stable isotopes of the respective radionuclides

  10. The effects of using Cesium-137 teletherapy sources as a radiological weapon (dirty bomb)

    CERN Document Server

    Liolios, Theodore

    2009-01-01

    While radioactive sources used in medical diagnosis do not pose a great security risk due to their low level of radioactivity, therapeutic sources are extremely radioactive and can presumably be used as a radiological weapon. Cobalt-60 and Cesium-137 sources are the most common ones used in radiotherapy with over 10,000 of such sources currently in use worldwide, especially in the developing world, which cannot afford modern accelerators. The present study uses computer simulations to investigate the effects of using Cesium-137 sources from teletherapy devices as a radiological weapon. Assuming a worst-case terrorist attack scenario, we estimate the ensuing cancer mortality, land contamination, evacuation area, as well as the relevant evacuation, decontamination, and health costs in the framework of the linear risk model. The results indicate that an attack with a Cesium-137 dirty bomb in a large metropolitan city (especially one that would involve several teletherapy sources) although would not cause any sta...

  11. Phosphate ceramic solidification and stabilization of cesium-containing crystalline silicotitanate resins.

    Energy Technology Data Exchange (ETDEWEB)

    Langton, C. A.

    1999-05-11

    This paper reports on the fabrication and testing of magnesium potassium phosphate (MKP)-bonded cesium-loaded crystalline silicotitanate (CST) resins. Typical waste loading of CST resins in the final waste forms was 50 wt.%. Physical and chemical characterization of the MKP materials has shown them to be physically, chemically, and mineralogically stable. Long-term durability studies (using the AN 16.1 standard test) showed a leachability index of {approx}18 for cesium in the phosphate matrix when exposed to deionized water under ambient and elevated temperatures. Leaching of cesium was somewhat higher than in glass waste forms as per PCT and MCC-1 tests. MKP-based final waste forms showed no significant weight changes after exposure to aqueous media for {approx}90 days, indicating the highly insoluble nature of the phosphate matrix. In addition, durability of the CST-MKP waste forms was further established by freeze-thaw cycling tests.

  12. Determining Reactor Flux from Xenon-136 and Cesium-135 in Spent Fuel

    CERN Document Server

    Hayes, A C

    2012-01-01

    The ability to infer the reactor flux from spent fuel or seized fissile material would enhance the tools of nuclear forensics and nuclear nonproliferation significantly. We show that reactor flux can be inferred from the ratios of xenon-136 to xenon-134 and cesium-135 to cesium-137. If the average flux of a reactor is known, the flux inferred from measurements of spent fuel could help determine whether that spent fuel was loaded as a blanket or close to the mid-plane of the reactor. The cesium ratio also provides information on reactor shutdowns during the irradiation of fuel, which could prove valuable for identifying the reactor in question through comparisons with satellite reactor heat monitoring data. We derive analytic expressions for these correlations and compare them to experimental data and to detailed reactor burn simulations. The enrichment of the original uranium fuel affects the correlations by up to 3 percent, but only at high flux.

  13. Reduction of cesium levels in the diet through management of food

    International Nuclear Information System (INIS)

    Several processes influence the radionuclide concentration of food products during processing: dilution, losses, concentration. Boiling of leaf vegetables yields a decontamination effect of up to 80% in the case of radioiodine. Peeling of potato tubers results in a reduction of the cesium concentration of 30%. The cesium and strontium concentration of flour is a factor of two lower as compared to the corresponding cereal grain due to the milling process. Significant discrimination occurs during the milk processing. The skimmed milk is significantly richer in cesium, iodine and especially in strontium than the cream. It follows that butter is depleted in its radionuclide contents as compared to other milk produce. Strontium is concentrated in the casein. Pressurized cooking in combination with salting or a treatment with acetic acid results in an Cs-activity loss of beef, veal and lamb meat of 50 to 90%. (Author) 3 figs., 7 tabs., 13 refs

  14. Continuous Separation of Cesium Based on NiHCF/PTCF Electrode by Electrochemically Switched Ion Exchange

    Institute of Scientific and Technical Information of China (English)

    孙斌; 郝晓刚; 王忠德; 张忠林; 刘世斌; 官国清

    2012-01-01

    Nickel hexacyanoferrate (NiHCF) film was synthesized on porous three-dimensional carbon felt (PTCF) substrate by repetitious batch chemical depositions, and the NiHCF/PTCF electrode was used as electrochemically switched ion exchange (ESIX) electrode in a packed bed for continuous separation for cesium ions. The morphologies of the prepared electrodes were characterized by scanning electron microscopy and the effects of solution concentration on the ion-exchange capacity of the electrodes were investigated by cyclic voltammetry technique. Cycling stability and long-term storage stability of NiHCF/PTCF electrodes were also studied. The NiHCF/PTCF electrodes with excellent ion-exchange ability were used to assemble a diaphragm-isolated ESIX reactor for cesium separation. Continuous separation of cesium and regeneration of NiHCF/PTCF electrode based on the diaphragm-isolated reactor were performed in a laboratory-scale two-electrode system.

  15. Small-Column Cesium Ion Exchange Elution Testing of Spherical Resorcinol-Formaldehyde

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Garrett N.; Russell, Renee L.; Peterson, Reid A.

    2011-10-21

    This report summarizes the work performed to evaluate multiple, cesium loading, and elution cycles for small columns containing SRF resin using a simple, high-level waste (HLW) simulant. Cesium ion exchange loading and elution curves were generated for a nominal 5 M Na, 2.4E-05 M Cs, 0.115 M Al loading solution traced with 134Cs followed by elution with variable HNO3 (0.02, 0.07, 0.15, 0.23, and 0.28 M) containing variable CsNO3 (5.0E-09, 5.0E-08, and 5.0E-07 M) and traced with 137Cs. The ion exchange system consisted of a pump, tubing, process solutions, and a single, small ({approx}15.7 mL) bed of SRF resin with a water-jacketed column for temperature-control. The columns were loaded with approximately 250 bed volumes (BVs) of feed solution at 45 C and at 1.5 to 12 BV per hour (0.15 to 1.2 cm/min). The columns were then eluted with 29+ BVs of HNO3 processed at 25 C and at 1.4 BV/h. The two independent tracers allowed analysis of the on-column cesium interaction between the loading and elution solutions. The objective of these tests was to improve the correlation between the spent resin cesium content and cesium leached out of the resin in subsequent loading cycles (cesium leakage) to help establish acid strength and purity requirements.

  16. Cesium removal from high-pH, high-salt wastwater using crystalline silicotitanate sorbent

    Energy Technology Data Exchange (ETDEWEB)

    Walker, J.F. Jr.; Taylor, P.A.; Lee, D.D.

    1997-11-01

    Treatment and disposal options for Department of Energy (DOE) underground storage tank waste at Hanford, Savannah River, and Oak Ridge National Laboratory (ORNL) are limited by high gamma radiation fields that are produced by high concentrations of cesium in the waste. Treatment methods are needed to remove the cesium from the liquid waste and thus concentrate the cesium into high-activity, remote-handled waste forms. The treated liquids could then be processed and disposed of by more cost-effective means with less radiation exposure to workers. A full-scale demonstration of one cesium removal technology is currently being conducted at ORNL. This demonstration utilizes a modular, mobile ion-exchange system and existing facilities for the off-gas system, secondary containment, and utilities. The ion-exchange material, crystalline silicotitanate (CST), was chosen on the basis of its effectiveness in laboratory tests. The CST, which was developed through a Cooperative Research and Development Agreement between DOE and private industry, has several advantages over current organic ion-exchange technologies. These advantages include (1) the ability to remove cesium in the presence of high concentrations of potassium, (2) a high affinity for cesium in both alkaline and acidic conditions, (3) physical stability over wide alkaline and acidic ranges, and (4) the elimination of large volumes of secondary waste required for regeneration of organic ion exchangers. Approximately 100,000 L of wastewater will be processed during the demonstration. The wastewater being processed has a high salt content, about 4 M NaNO{sub 3}, and a pH of 12 to 13. This paper discusses the results of the full-scale demonstration and compares these results with data from the laboratory tests.

  17. Separation of cesium from simulated active waste using zinc hexacyanoferrate supported composite

    International Nuclear Information System (INIS)

    Potassium zinc hexacyanoferrate (KZnHCF) was prepared and supported on polyacrylonitrile (PAN) binding polymer. This composite was characterized and used to study the elimination of cesium from acidic radioactive waste containing Sr(II), Eu(II), Am(II), Zr(IV), Hf(IV) and Nb(V) using batch and column techniques. The sorption capacity of this composite for cesium was found to be 1.14 meq/g for column technique. The effect of presence of NH4SCN, NaNo3 and other complexing agents in the aqueous solutions was studied

  18. A preliminary deposit model for lithium-cesium-tantalum (LCT) pegmatites

    Science.gov (United States)

    Bradley, Dwight; McCauley, Andrew

    2013-01-01

    This report is part of an effort by the U.S. Geological Survey to update existing mineral deposit models and to develop new ones. We emphasize practical aspects of pegmatite geology that might directly or indirectly help in exploration for lithium-cesium-tantalum (LCT) pegmatites, or for assessing regions for pegmatite-related mineral resource potential. These deposits are an important link in the world’s supply chain of rare and strategic elements, accounting for about one-third of world lithium production, most of the tantalum, and all of the cesium.

  19. Heat Transfer During Evaporation of Cesium From Graphite Surface in an Argon Environment

    Directory of Open Access Journals (Sweden)

    Bespala Evgeny

    2016-01-01

    Full Text Available The article focuses on discussion of problem of graphite radioactive waste formation and accumulation. It is shown that irradiated nuclear graphite being inalienable part of uranium-graphite reactor may contain fission and activation products. Much attention is given to the process of formation of radioactive cesium on the graphite element surface. It is described a process of plasma decontamination of irradiated graphite in inert argon atmosphere. Quasi-one mathematical model is offered, it describes heat transfer process in graphite-cesium-argon system. Article shows results of calculation of temperature field inside the unit cell. Authors determined the factors which influence on temperature change.

  20. Synthesis of novel calixcrown derivatives with selective complexation towards cesium ions

    Institute of Scientific and Technical Information of China (English)

    Lu Zhang; Juan Du; Li Hua Yuan; Dong Zhang; Gui Ping Dan; Yuan You Yang; Wen Feng

    2011-01-01

    A series of novel calix [4]arenecrown-6 derivatives with an alkenyl loop of various sizes 5-8 were synthesized via intramolecular ring closing olefin metathesis and characterized by 1H NMR, 13C NMR and ESI-HRMS. Their complexation property towards cesium ion was studied by 'H NMR technique. Two-phase extraction of alkali metal ions using UV-vis spectroscopy revealed remarkably different extractabilities. These results indicate that the complexation capacities towards cesium ions can be tuned and controlled through cooperative regulation of the strain of the loop and conformational change of calixcrown skelton.

  1. Measurement of Ionization Threshold of Ultracold Cesium Rydberg Atoms in Static Electric Field

    Institute of Scientific and Technical Information of China (English)

    FENG Zhi-Gang; ZHANG Lin-Jie; ZHAO Jian-Ming; LI Chang-Yong; LI An-Ling; JIA Suo-Tang

    2008-01-01

    We investigate the field ionization spectra of ultracold cesium Rydberg atoms in dc electric field. The ionization thresholds of different electric fields are measured and shift of the ionization threshold relative to field-free ionization threshold is accurately described by (6.06±0.14) F1/2, which is in good agreement with the classical saddle-point model for field ionization. We obtain the field-free ionization threshold of cesium (6P,3/2) as 19674.89士2.99cm-1 by fitting experimental data.

  2. A direct frequency comb for two-photon transition spectroscopy in a cesium vapor

    Institute of Scientific and Technical Information of China (English)

    Zhang Yi-Chi; Wu Ji-Zhou; Li Yu-Qing; Jin Li; Ma Jie; Wang Li-Rong; Zhao Yan-Ting; Xiao Lian-Tuan; Jia Suo-Tang

    2012-01-01

    A phase-stabilized femtosecond frequency comb is used to measure high-resolution spectra of two-photon transition 62S1/2-62P1/2,3/2-82S1/2 in a cesium vapor.The broadband laser output from a femtosecond frequency comb is split into counter-propagating parts,shaped in an original way,and focused into a room-temperature cesium vapor.We obtain high-resolution two-photon spectroscopy by scanning the repetition rate of femtosecond frequency comb,and through absolute frequency measurements.

  3. Recent progress in optically-pumped cesium beam clock at Peking University

    Science.gov (United States)

    Liu, C.; Zhou, S.; Wan, J.; Wang, S.; Wang, Y.

    2016-06-01

    A compact, long-life, and low-drift cesium beam clock is investigated at Peking University, where the atoms are magnetic-state selected and optically detected. Stability close to that of the best commercial cesium clocks has been achieved from 10 to 105 s. As previously shown, the short-term stability is determined by atomic shot noise or laser frequency noise. The stabilizations of microwave power and C-field improve the long-term stability, with the help of a digital servo system based on field-programmable gate array.

  4. Separation of cesium from rad waste solutions with hexacyanoferrate(II) resins of copper and cobalt

    International Nuclear Information System (INIS)

    The separation of radiocesium from low and intermediate level waste solutions by ion exchange with potassium cobalt hexacyanoferrate(II) and potassium copper-cobalt hexacyanoferrate(II) loaded resins was studied. The distribution coefficient(Kd) of cesium as a function of sodium ion concentration was determined. High batch capacity of these resins with regards to cesium make them ideal sorbents that can be used in once through mode in the treatment of rad waste solutions. (author). 3 refs., 1 fig., 1 tab

  5. Concentration Ratios for Cesium and Strontium in Produce Near Los Alamos

    Energy Technology Data Exchange (ETDEWEB)

    S. Salazar, M.McNaughton, P.R. Fresquez

    2006-03-01

    The ratios of the concentrations of radionuclides in produce (fruits, vegetables, and grains) to the concentrations in the soil have been measured for cesium and strontium at locations near Los Alamos. The Soil, Foodstuffs, and Biota Team of the Meteorology and Air Quality Group of the Los Alamos National Laboratory (LANL) obtained the data at locations within a radius of 50 miles of LANL. The concentration ratios are in good agreement with previous measurements: 0.01 to 0.06 for cesium-137 and 0.1 to 0.5 for strontium-90 (wet-weight basis).

  6. Computational study of organo-cesium complexes and the possibility of lanthanide/actinide ions substitution

    Science.gov (United States)

    Rabanal-León, Walter A.; Martinez-Ariza, Guillermo; Roberts, Sue A.; Hulme, Christopher; Arratia-Pérez, Ramiro

    2015-11-01

    Relativistic DFT calculations suggest that two organo-cesium complexes studied herein afford large HOMO-LUMO gaps of around 2.4 eV with the PBE xc-functional, which accounts for their stability. Energy decomposition studies suggest these two complexes are largely ionic with about 20% covalency. However, when the Cs+ ions are substituted by the isoelectronic La3+ and Th4+, their predicted ionicity decreases significantly. The significant increase in covalence indicates that employing Ugi reaction cascades that afford tetramic acid-based organo-cesium complexes may be extended to La3+ and Th4+ organometallics.

  7. Evaluation of cancer stem cell markers CD133, CD44, CD24: association with AKT isoforms and radiation resistance in colon cancer cells.

    Directory of Open Access Journals (Sweden)

    Sara Häggblad Sahlberg

    Full Text Available The cell surface proteins CD133, CD24 and CD44 are putative markers for cancer stem cell populations in colon cancer, associated with aggressive cancer types and poor prognosis. It is important to understand how these markers may predict treatment outcomes, determined by factors such as radioresistance. The scope of this study was to assess the connection between EGFR, CD133, CD24, and CD44 (including isoforms expression levels and radiation sensitivity, and furthermore analyze the influence of AKT isoforms on the expression patterns of these markers, to better understand the underlying molecular mechanisms in the cell. Three colon cancer cell-lines were used, HT-29, DLD-1, and HCT116, together with DLD-1 isogenic AKT knock-out cell-lines. All three cell-lines (HT-29, HCT116 and DLD-1 expressed varying amounts of CD133, CD24 and CD44 and the top ten percent of CD133 and CD44 expressing cells (CD133high/CD44high were more resistant to gamma radiation than the ten percent with lowest expression (CD133low/CD44low. The AKT expression was lower in the fraction of cells with low CD133/CD44. Depletion of AKT1 or AKT2 using knock out cells showed for the first time that CD133 expression was associated with AKT1 but not AKT2, whereas the CD44 expression was influenced by the presence of either AKT1 or AKT2. There were several genes in the cell adhesion pathway which had significantly higher expression in the AKT2 KO cell-line compared to the AKT1 KO cell-line; however important genes in the epithelial to mesenchymal transition pathway (CDH1, VIM, TWIST1, SNAI1, SNAI2, ZEB1, ZEB2, FN1, FOXC2 and CDH2 did not differ. Our results demonstrate that CD133high/CD44high expressing colon cancer cells are associated with AKT and increased radiation resistance, and that different AKT isoforms have varying effects on the expression of cancer stem cell markers, which is an important consideration when targeting AKT in a clinical setting.

  8. X-ray imaging performance of structured cesium iodide scintillators.

    Science.gov (United States)

    Zhao, Wei; Ristic, Goran; Rowlands, J A

    2004-09-01

    Columnar structured cesium iodide (CsI) scintillators doped with Thallium (Tl) have been used extensively for indirect x-ray imaging detectors. The purpose of this paper is to develop a methodology for systematic investigation of the inherent imaging performance of CsI as a function of thickness and design type. The results will facilitate the optimization of CsI layer design for different x-ray imaging applications, and allow validation of physical models developed for the light channeling process in columnar CsI layers. CsI samples of different types and thicknesses were obtained from the same manufacturer. They were optimized either for light output (HL) or image resolution (HR), and the thickness ranged between 150 and 600 microns. During experimental measurements, the CsI samples were placed in direct contact with a high resolution CMOS optical sensor with a pixel pitch of 48 microns. The modulation transfer function (MTF), noise power spectrum (NPS), and detective quantum efficiency (DQE) of the detector with different CsI configurations were measured experimentally. The aperture function of the CMOS sensor was determined separately in order to estimate the MTF of CsI alone. We also measured the pulse height distribution of the light output from both the HL and HR CsI at different x-ray energies, from which the x-ray quantum efficiency, Swank factor and x-ray conversion gain were determined. Our results showed that the MTF at 5 cycles/mm for the HR type was 50% higher than for the HL. However, the HR layer produces approximately 36% less light output. The Swank factor below K-edge was 0.91 and 0.93 for the HR and HL types, respectively, thus their DQE(0) were essentially identical. The presampling MTF decreased as a function of thickness L. The universal MTF, i.e., MTF plotted as a function of the product of spatial frequency f and CsI thickness L, increased as a function of L. This indicates that the light channeling process in CsI improved the MTF of

  9. Study of regional lung function with xenon 133

    International Nuclear Information System (INIS)

    Exploration of regional lung function includes study of the closed circuit perfusion and ventilation respectively by injection and inhalation of xenon 133. The radiation is measured across the chest using 4 fixed scintillation counters, placed opposite the subject's back, 2 per lung field. Theoretical regional values using 15 normal young subjects are determined. Three cases justified the practical interest of this method. The percentage of variation for the parameters studied was about 10%. The method proved very useful for the clinician to whom it provides a numerical assessment of regional ventilation and perfusion

  10. Regional study of ventilation with inhaled xenon 133 in children

    International Nuclear Information System (INIS)

    A regional exploration of pulmonary ventilation in a population of 104 infants and children by a study of distribution and washout of xenon 133 inhaled with rebreathing is carried out. The results are expressed by photographs (gamma-camera) and time-activity curves. The indications for regional exploration were oriented by the existence on the straight X-ray film of a localised ventilation disorder (a hyperlucent area or an opacity). This study permitted physiopathological analysis and guided endobronchial examinations. The functional results obtained, complete and explain other methods of exploration of lung function by spirography, ventilatory mechanics, transthoracic electrical measurements and study of lung perfusion with technetium 99m

  11. A 15q13.3 microdeletion segregating with autism

    OpenAIRE

    Pagnamenta, Alistair T.; Wing, Kirsty; Akha, Elham Sadighi; Knight, Samantha JL; Bölte, Sven; Schmötzer, Gabriele; Duketis, Eftichia; Poustka, Fritz; Klauck, Sabine M; Poustka, Annemarie; Ragoussis, Jiannis; Bailey, Anthony J; Monaco, Anthony P

    2008-01-01

    Autism and mental retardation (MR) show high rates of comorbidity and potentially share genetic risk factors. In this study, a rare ∼2 Mb microdeletion involving chromosome band 15q13.3 was detected in a multiplex autism family. This genomic loss lies between distal break points of the Prader–Willi/Angelman syndrome locus and was first described in association with MR and epilepsy. Together with recent studies that have also implicated this genomic imbalance in schizophrenia, our data indicat...

  12. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica;

    2013-01-01

    duplications that include both the YWHAE and LIS1 genes. These patients had a relatively distinct facial phenotype and frequent structural brain abnormalities involving the corpus callosum, cerebellar vermis, and cranial base. Autism spectrum disorders were seen in a third of duplication probands, most......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...

  13. 133Xe labelling of acrylate for catheter embolisation

    International Nuclear Information System (INIS)

    A method for radio-nucleide labelling of histo-acryl/lipiodol with 133Xe gas is described. The method consists of disolving the gas in lipiodol under sterile conditions. After embolisation and angiography, the localisation of the embolising material can be determined by means of a scintillation camera. The labelling method was used in 15 patients. In all patients the position of the embolising material, as demonstrated by scintigraphy, corresponded with the radiological findings. It was not possible to demonstrate escape of the material by scintigraphy. (orig.)

  14. Effects of radionuclides (uranium et cesium 137) on the metabolism of vitamin D in rat

    International Nuclear Information System (INIS)

    Uranium and Cesium 137 (137Cs) are both radionuclides found in the environment as a result of their accidental dispersion and/or natural presence. Consequently, some human populations are exposed to these radioelements mainly through chronic ingestion. Chemical and/or radiological toxicity of uranium and 137Cs has been reported in kidney, liver and brain that play key-roles in vitamin D metabolism. Beside, alterations of both bone and phospho-calcium homeostasis have been reported after an acute or chronic contamination with uranium or 137Cs. However, vitamin D, the major regulator of mineral homeostasis has never been studied up to now. The aim of this work was to investigate in vivo the effects of depleted (DU) or enriched uranium (EU) and of 137Cs on vitamin D3 biosynthetic pathway in liver, kidney and brain. An experimental animal model was used for the first time to demonstrate that chronic exposure with environmental doses of 137Cs and uranium could decrease the vitamin D active form level (1,25(OH)2D3) and lead to molecular modifications of cytochromes P450 (CYPs) enzymes involved in this metabolism and associated nuclear receptors. We demonstrated that both UA and UE contamination affected VDR (vitamin D receptor) and RXRa (retinoid X receptor alpha) expression, and consequently could modulate the expression of vitamin D target genes involved in calcium homeostasis in kidney. These results suggest that these effects could be due to the chemical toxicity of uranium. On the contrary, the main molecular targets of 137Cs are CYPs involved in Vitamin D3 biosynthesis (CYP2R1, CYP27B1) in liver and brain. In this adult rat model such perturbations were not associated with a dys-regulation of mineral homeostasis. Conversely, chronic exposure with 137Cs during postnatal development induce alterations of vitamin D metabolism associated with modifications of bone and phospho-calcium homeostasis, suggesting a greater susceptibility of the growing organism to 137Cs

  15. Physical barrier effect of geopolymeric waste form on diffusivity of cesium and strontium.

    Science.gov (United States)

    Jang, J G; Park, S M; Lee, H K

    2016-11-15

    The present study investigates the physical barrier effect of geopolymeric waste form on leaching behavior of cesium and strontium. Fly ash-based geopolymers and slag-blended geopolymers were used as solidification agents. The leaching behavior of cesium and strontium from geopolymers was evaluated in accordance with ANSI/ANS-16.1. The diffusivity of cesium and strontium in a fly ash-based geopolymer was lower than that in Portland cement by a factor of 10(3) and 10(4), respectively, showing significantly improved immobilization performance. The leaching resistance of fly ash-based geopolymer was relatively constant regardless of the type of fly ash. The diffusivity of water-soluble cesium and strontium ions were highly correlated with the critical pore diameter of the binder. The critical pore diameter of the fly ash-based geopolymer was remarkably smaller than those of Portland cement and slag-blended geopolymer; consequently, its ability physically to retard the diffusion of nuclides (physical barrier effect) was superior.

  16. Immobilisation of radio cesium loaded ammonium molybdo phosphate in glass matrices

    International Nuclear Information System (INIS)

    Long half life and easy availability from high level wastes make 137Cesium most economical radiation source. High level liquid waste processing for 137 Cesium removal has become easier due to development of Cesium specific granulated ammonium molybdophosphate (AMP) composite. In such applications, resulting spent composite AMP itself represents high active solid waste and immobilization of these materials in cement may not be acceptable. Studies on immobilization of 137Cs loaded AMP were taken up in order to achieve twin goals of increasing safety and minimizing processing costs of the final matrix. Studies indicated that phosphate modified sodium borosilicate SPNM glasses prepared under usual oxidizing conditions are not suitable for immobilization of 137Cs loaded on AMP .Phosphate glasses containing Na2O, P2O5, B2O3, Fe2O3, Al2O3 and SiO2 as major constituents are capable of incorporating 6 to 8 % AMP. The Normalized Leach rates of these glasses for sodium, cesium, boron and silica are 10-4 to 10-6 gm/cm2/day which are comparable to or better than those reported for NBS glasses incorporating HLW. Homogeneity of the final matrix was confirmed by x-ray diffraction analysis. Further studies on characterization of these glasses would establish their acceptability. (author)

  17. Removal of cesium ions from waste solution using sericite incorporated into nickel hexacyanoferrate

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Choong; Cha, Ju-Hyun [Gangneung-Wonju National University, Wonju (Korea, Republic of)

    2015-11-15

    To increase adsorption capacity and selectivity for cesium ions from waste solution, sericite was chemically modified by means of nickel hexacyanoferrate (NiHCF) with a high selectivity trap agent for cesium. Scanning electron microscopy (SEM) and energy dispersive X-ray (EDX) spectroscopy were used for the characteristic analysis of surface onto the NiHCF-sericite. The adsorption capacity of cesium ions for the NiHCF-sericite increased about 2.5 times, as compared with natural sericite at initial pH 5.0 of waste solution. Adsorption equilibrium was investigated by Langmuir and Freundlich isotherm model, respectively. Maximum adsorption capacity was estimated as 16.583mg/g, and the Langmuir isotherm fits the adsorption data better than Freundlich model. The adsorption process was determined as an exothermic reaction and all adsorption was completed in 30 min. In addition, the adsorption capacity of cesium ions was not greatly affected by ionic strength (-0.1M NaCl concentration) and other metals in mixed waste solution.

  18. Assessment of commercially available ion exchange materials for cesium removal from highly alkaline wastes

    Energy Technology Data Exchange (ETDEWEB)

    Brooks, K.P.; Kim, A.Y.; Kurath, D.E.

    1996-04-01

    Approximately 61 million gallons of nuclear waste generated in plutonium production, radionuclide removal campaigns, and research and development activities is stored on the Department of Energy`s Hanford Site, near Richland, Washington. Although the pretreatment process and disposal requirements are still being defined, most pretreatment scenarios include removal of cesium from the aqueous streams. In many cases, after cesium is removed, the dissolved salt cakes and supernates can be disposed of as LLW. Ion exchange has been a leading candidate for this separation. Ion exchange systems have the advantage of simplicity of equipment and operation and provide many theoretical stages in a small space. The organic ion exchange material Duolite{trademark} CS-100 has been selected as the baseline exchanger for conceptual design of the Initial Pretreatment Module (IPM). Use of CS-100 was chosen because it is considered a conservative, technologically feasible approach. During FY 96, final resin down-selection will occur for IPM Title 1 design. Alternate ion exchange materials for cesium exchange will be considered at that time. The purpose of this report is to conduct a search for commercially available ion exchange materials which could potentially replace CS-100. This report will provide where possible a comparison of these resin in their ability to remove low concentrations of cesium from highly alkaline solutions. Materials which show promise can be studied further, while less encouraging resins can be eliminated from consideration.

  19. Transfer of radioactive cesium from soil to rape plants, rape blossoms and rape honey

    International Nuclear Information System (INIS)

    Due to the test of atomic weapons and the accident in the nuclear power plant at Chernobyl, the vegetation in Germany has been exposed to cesium contamination in the soil. It was to be expected that activity would migrate from soil to plants and to food products. In this work, the transfer of radioactive cesium from soil to rape plants (Brassica napus var. oleifera), rape blossoms and further to rape honey was investigated. By measuring the gamma activity of cesium using germanium detectors with measuring capacity up to 30 h per sample (limit of detection about 0.14 Bq/kg to 0.19 Bq/kg), we determined a mean transfer factor fcs = 0,116 ± 0,080 for the system soil-rape plant, fcs = 0.065 + 0.075 for the system soil-rape blossom and F!S = 0.098 + 0.044 for the system soil-rape honey (plants and honey wet mass, soil dry mass) (Table IV). Additionally, for the transfer of cesium from rape plants to rape honey, a factor of fcs = 2.04 ± 7.23 (both wet mass) was determined. Due to some environmental circumstances, which can hardly ever be taken into account, the results obtained sometimes differ considerably. Nevertheless, the mean transfer factors are within the range of values found in literature (Table V)

  20. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  1. Strontium-90 and cesium-137 in sea fish (from Jun. 1982 to Dec. 1982)

    International Nuclear Information System (INIS)

    Strontium-90 and cesium-137 in sea fish (from Jun. to Dec. 1982) were determined. Fish was collected from 22 sampling locations. Only the edible part was used in case of larger sized fish, and the whole part was used in case of smaller ones. The results are sown in a table. (Namekawa, K.)

  2. Strontium-90 and cesium-137 in sea fish (from Nov. 1982 to Jun. 1983)

    International Nuclear Information System (INIS)

    Strontium-90 and cesium-137 in sea fish (from Nov. 1982 to Jun. 1983) were determined. Fishes were collected from eight sampling locations. Only the edible part was used in case of larger sized fish, and the whole part was used in case of smaller ones. The results are shown in a table. (J.P.N.)

  3. Strontium-90 and cesium-137 in sea fish (from Oct. 1981 to Jun. 1982)

    International Nuclear Information System (INIS)

    Strontium-90 and cesium-137 in sea fishes (from Oct. 1981 to Jun. 1982) were determined. Fish was collected from eight sampling locations. Only the edible part was used in case of larger sized fish, and the whole part was used in case of smaller ones. The results are shown in a table. (Namekawa, K.)

  4. Leachability of cobalt and cesium from natural and chemically treated zeolites

    International Nuclear Information System (INIS)

    The determination of leachability of radioisotopes of cesium and cobalt from preloaded zeolites in distilled water, base solution and acid solution has been studied. For the experiment, we used natural and chemically treated zeolites. The zeolites before leaching were calcined at different temperatures. (author). 8 refs., 5 figs., 2 tabs

  5. Nanophotonic hybridization of narrow atomic cesium resonances and photonic stop gaps of opaline nanostructures

    NARCIS (Netherlands)

    Harding, P.J.; Pinkse, P.W.H.; Mosk, A.P.; Vos, W.L.

    2015-01-01

    We study a hybrid system consisting of a narrow-band atomic optical resonance and the long-range periodic order of an opaline photonic nanostructure. To this end, we have infiltrated atomic cesium vapor in a thin silica opal photonic crystal. With increasing temperature, the frequencies of the opal'

  6. Electromagnetically-induced transparency in a multi-V-type system in cesium atomic vapour

    Institute of Scientific and Technical Information of China (English)

    赵建明; 尹王保; 汪丽蓉; 肖连团; 贾锁堂

    2002-01-01

    Electromagnetically-induced transparency is observed in a three-level multi-V-type system in cesium vapour atroom temperature. The absorption property is measured and the hyperfine structures of atomic states can be determined.The results of the experiment agree with the theoretical analysis.

  7. Dual cesium and rubidium atomic fountain with a 10-16 level accuracy and applications

    International Nuclear Information System (INIS)

    Atomic fountains are the most accomplished development of the atomic clocks based on the cesium atom whose hyperfine resonance defines the SI second since 1967. Today these systems are among those which realize the second with the best accuracy. We present the last developments of the cold cesium and rubidium atom dual fountain experiment at LNE-SYRTE. This unique dual setup would allow to obtain an outstanding resolution in fundamental physics tests based on atomic transition frequency comparisons. In order to enable operation with both atomic species simultaneously, we designed, tested and implemented on the fountain new collimators which combine the laser lights corresponding to each atom. By comparing our rubidium fountain to another cesium fountain over a decade, we performed a test of the stability of the fine structure constant at the level of 5 * 10-16 per year. We carried on the work on the clock accuracy and we focused on the phase gradients effects in the interrogation cavity and on the microwave leakage. The fountain accuracy has been evaluated to 4 * 10-16 for the cesium clock and to 5 * 10-16 for the refurbished rubidium clock. As a powerful instrument of metrology, our fountain was implicated in many clock comparisons and contributed many times to calibrate the International Atomic Time. Furthermore, we used the fountain to perform a new test of Lorentz local invariance. (author)

  8. Separation of cesium-137 from uranium fission products via a NeoflonR column supporting tetraphenylboron

    International Nuclear Information System (INIS)

    Cesium is a member of the Group I alkali metals, very reactive earth metals that react vigorously with both air and water. The chemistry of cesium is much like the chemistry of neighboring elements on the periodic table, potassium and rubidium. This close relation creates many problems in plant-life exposed to cesium because it is so easily confused for potassium, an essential nutrient to plants. Radioactive 134Cs and 137Cs are also chemically akin to potassium and stable cesium. Uptake of these radioactive isotopes from groundwater by plant-life destroys the plant-life and can potentially expose humans to the radioactive affects of 134Cs and 137Cs. Much experimental work has been focused on the separation of 137Cs from uranium fission products. In previous experimental work performed a column consisting of Kel-F supporting tetraphenylboron (TPB) was utilized to separate 137Cs from uranium fission products. It is of interest at this time to attempt the separation of 134Cs from 0.01M EDTA using the same method and Neoflon in the place of Kel-F as the inert support. The results of this experiment give a separation efficiency of 88% and show a linear relationship between the column bed length and the separation efficiency obtained. (author)

  9. Cesium Sorption from Concentrated Acidic Tank Wastes Using Ammonium Molybdophosphate-polyacrylonitrile Composite Sorbents

    Energy Technology Data Exchange (ETDEWEB)

    Todd, Terry Allen; Mann, Nicholas Robert; Tranter, Troy Joseph; Sebesta, F.; John, J.; Motl, A.,

    2002-10-01

    Ammonium molybdophosphate-polyacrylonitrile (AMP-PAN) composite sorbents have been evaluated for the removal of cesium from Idaho National Engineering and Environmental Laboratory (INEEL) concentrated acidic tank waste. Batch contacts were performed to qualitatively evaluate the effects of increased nitric acid, sodium and potassium. An equilibrium isotherm was generated with simulated concentrated tank waste solutions and fit to the Langmuir equation. Additional batch contact experiments were performed to determine if mercury, plutonium and americium would sorb onto AMP-PAN. Dynamic sorption was evaluated in column tests employing 1.5 cm3 columns operating at 5, 10 and 20 bed volumes of flow per hour. Results indicate, as expected, that dynamic cesium sorption capacity is reduced as the flowrate is increased. Calculated dynamic capacities for cesium were 22.5, 19.8 and 19.6 mg Cs/g sorbent, for 5, 10 and 20 bed volume per hour flows, respectively. The thermal stability of loaded AMP-PAN was evaluated by performing thermogrovimetric analysis (TGA) on samples of AMP, PAN (polymer), and AMP-PAN. Results indicate that AMP-PAN is stable to 400 °C, with less than a 10% loss of weight, which is at least partially due to loss of water of hydration. The evaluation of AMP-PAN indicates that it will effectively remove cesium from concentrated acidic tank waste solutions.

  10. Sorption behavior of cesium from aqueous solution on magnetic hexacyanoferrate materials

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Hengxuan; Zhao, Xuan, E-mail: zhxinet@tsinghua.edu.cn; Wei, Jiying; Li, Fuzhi

    2014-08-15

    Highlights: • A novel pathway of synthesizing magnetic hexacyanoferrate material was developed. • The synthesized material can offer a high capacity for sorption of cesium. • The material can offer a fast removal of cesium in kinetic performance. • The fine M-PTH particle can be easily separated from wastewater for recirculation. - Abstract: The rapid development of the nuclear power plant in China leads to increasing attention to the treatment of low-level radioactive wastewater (LLRW). One of possibilities is the application of inorganic adsorbent like potassium titanium hexacyanoferrate (PTH), which can exhibit the effective adsorption of cesium. In this paper, the PTH material was optimized by means of being loaded on magnetite substrate. The synthesized material (magnetic PTH, M-PTH), with a particle size of less than 100 nm, can offer a high capacity and favorable kinetic performance, however, without difficulties of separation from the LLRW due to its magnetic characterizations. The batch experiments demonstrate that cesium sorption isotherm of M-PTH coincide well with Langmuir model. The calculated capacity amounts to 0.517 mmol/g, approximately 1.5 times the capacity of zeolite materials. The sorption process follows the pseudo-second-order sorption model. In the initial phase the rate-controlling step is intraparticle diffusion. With the Cs accumulation on the particle surface, external diffusion performs an important role together with intraparticle diffusion.

  11. Z' indication from new APV data in Cesium and searches at linear colliders

    OpenAIRE

    Casalbuoni, R.; De Curtis, S.; Dominici, D.; Gatto, R.; Riemann, S.

    2000-01-01

    New data on parity violation in atomic cesium can be explained by a new neutral vector boson almost unmixed with Z, with a mass in the TeV range and sizeable couplings to the fermions. The properties of such additional Z' can be investigated at future linear colliders.

  12. Cobalt-60 and cesium-137 for the sterilization of food. Radiation treatment of food

    International Nuclear Information System (INIS)

    The brief article discusses the reasons justifying in the eyes of the authors the irradiation of food with ionizing readiation, the irradiation technique applied using cobalt-60 and cesium-137 as a radiation source, and the possible secondary effects of the method. (VHE)

  13. High-temperature cesium capture using activated kaolinite in the presence of chlorine and volatile heavy metals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hee Chul; Kim, Jeoung Guk; Yoo, Jae Hyung; Kim, Joon Hyung [KAERI, Taejon (Korea, Republic of); Yoon, Jong Sung [Chungnam National Univ., Taejon (Korea, Republic of)

    2002-05-01

    This study investigated the use of porous activated kaolin particles in the size range of 300- 400 {mu}m as high-temperature sorbents for cesium capture in the presence of chlorine and/or in the presence of cadmium and lead. Packed bed sorption tests by passing CsCl-carrying flue gas through the packed bed of activated porous kaolin particles were first performed at the temperature range of 973-1173 K and a CsCl partial pressure range of 7.4-11.1 Pa. The observed structural change of the sorbent mineral at the stage of sorption revealed the characteristics of an irreversible chemical reaction as a major cesium capturing mechanism. In the fully saturated kaolin sorbent, Cs{sub 2}O{center_dot}Al{sub 2}O{sub 3}{center_dot}SiO{sub 2} is present as a sorption reaction product, together with much smaller amount of water-soluble cesium species. The increase in sorbent bed temperature resulted in an increase in the rate of sorption, but it had no effect on maximum cesium uptake. In the presence of other condensable gas-phase metal chlorides such as cadmium and lead, cesium was preferentially adsorbed onto tested activated kaolinite, but a half of cesium appeared to be physically-sorbed cesium species, CsCl.

  14. Foliar uptake of cesium, iodine and strontium and their transfer to the edible parts of beans, potatoes and radishes

    Science.gov (United States)

    Oestling, O.; Kopp, P.; Burkart, W.

    Considerable fractions of radionuclide solutions deposited on the surface of the leaves may be transferred to the edible parts of plants. In radishes we observed a transfer of more than 40% of the applied cesium radioisotope within a few days. A rather similar uptake was found for beans and potatoes when harvested a month after application of radioactivity. As much as 60% of the applied cesium-isotope remained in (or on) the potato leaves even 8 days after application. The major part could however be washed off the leaves a few hours after application. When radishes were showered with water within 7 h after the application of activity the uptake was greatly reduced. No competitive effect of potassium chloride for the foliar uptake of cesium was found. A 10 -2 M colloidal suspension of Prussian Blue, a chelating agent for monovalent alkali metals such as potassium, cesium, or other monovalent cations, applied as droplets to the leaves one day prior to application of active cesium was found to strongly inhibit the transfer of cesium to the radish. The transfer of iodine and strontium to the edible parts was found to be negligible (or slower) as compared to cesium. In most cases no detectable amounts of these two nuclides were transfered to the edible parts of the radish after 2-5 weeks.

  15. Distinct roles for miR-1 and miR-133a in the proliferation and differentiation of rhabdomyosarcoma cells.

    Science.gov (United States)

    Rao, Prakash K; Missiaglia, Edoardo; Shields, Lauren; Hyde, Greg; Yuan, Bingbing; Shepherd, Christopher J; Shipley, Janet; Lodish, Harvey F

    2010-09-01

    Rhabdomyosarcoma is the most common soft tissue sarcoma in the pediatric population. As this tumor has an undifferentiated myogenic phenotype, agents that promote differentiation hold particular promise as part of a novel therapeutic approach to combat this type of cancer. In this report, we focus on the contribution of two microRNAs (miRNAs) in rhabdomyosarcomas. Levels of miR-1 and miR-133a are drastically reduced in representative cell lines from each major rhabdomyosarcoma subtype (embryonal and alveolar). Introduction of miR-1 and miR-133a into an embryonal rhabdomyosarcoma-derived cell line is cytostatic, thereby suggesting a tumor suppressor-like role for these myogenic miRNAs. Transcriptional profiling of cells after miR-1 and miR-133a expression reveals that miR-1 (but not miR-133a) exerts a strong promyogenic influence on these poorly differentiated tumor cells. We identify mRNAs that are down-regulated by these miRNAs and propose roles for miR-1 and miR-133a in repressing isoforms of genes that are normally not expressed in muscle. Finally, we show that mRNA targets of miR-1 and miR-133a are up-regulated in rhabdomyosarcomas, suggesting a causative role for these miRNAs in the development of rhabdomyosarcomas. More important, these results point to the promise of enhancing rhabdomyosarcoma therapy using miRNAs as agents that mediate cytostasis and promote muscle differentiation.

  16. Ion exchange kinetics of cesium for various reaction designs using crystalline silicotitanate, UOP IONSIV IE-911

    Science.gov (United States)

    Kim, Sung Hyun

    Through collaborative efforts at Texas A&M University and Sandia National Laboratories, a crystalline silicotitanate (CST), which shows extremely high selectivity for radioactive cesium removal in highly concentrated sodium solutions, was synthesized. The effect of hydrogen peroxide on a CST under cesium ion exchange conditions has been investigated. The experimental results with hydrogen peroxide showed that the distribution coefficient of cesium decreased and the tetragonal phase, the major component of CST, slowly dissolved at hydrogen peroxide concentrations greater than 1 M. A simple and novel experimental apparatus for a single-layer ion exchange column was developed to generate experimental data for estimation of the intraparticle effective diffusivity. A mathematical model is presented for estimation of effective diffusivities for a single-layer column of CST granules. The intraparticle effective diffusivity for Cs was estimated as a parameter in the analytical solution. By using the least square method, the effective diffusivities of 1.56 +/- 0.14 x 10-11 m2/s and 0.68 +/- 0.09 x 10-11 m2/s, respectively, were obtained. The difference in the two values was due to the different viscosities of the solutions. A good fit of the experimental data was obtained which supports the use of the homogeneous model for this system. A counter-current ion exchange (CCIX) process was designed to treat nuclear waste at the Savannah River Site. A numerical method based on the orthogonal collocation method was used to simulate the concentration profile of cesium in the CCIX loaded with CST granules. To maximize cesium loading onto the CST and minimize the volume of CST, two design cases of a moving bed, where the fresh CST is pulsed into the column at certain periods or at certain concentration of cesium, were investigated. Simulation results showed that cesium removal behavior in the pilot-scale test of CCIX experiment, where the column length is 22 ft and the CST is pulsed

  17. Preparation and characterization of cesium-137 aluminosilicate pellets for radioactive source applications

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, F.J.; Tompkins, J.A.; Haff, K.W.; Case, F.N.

    1981-07-01

    Twenty-seven fully loaded /sup 137/Cs aluminosilicate pellets were fabricated in a hot cell by the vacuum hot pressing of a cesium carbonate/montmorillonite clay mixture at 1500/sup 0/C and 570 psig. Four pellets were selected for characterization studies which included calorimetric measurements, metallography, scanning electron microscope and electron backscattering (SEM-BSE), electron microprobe, x-ray diffraction, and cesium ion leachability measurements. Each test pellet contained 437 to 450 curies of /sup 137/Cs as determined by calorimetric measurements. Metallographic examinations revealed a two-phase system: a primary, granular, gray matrix phase containing large and small pores and small pore agglomerations, and a secondary fused phase interspersed throughout the gray matrix. SEM-BSE analyses showed that cesium and silicon were uniformly distributed throughout both phases of the pellet. This indicated that the cesium-silicon-clay reaction went to completion. Aluminum homogeneity was unconfirmed due to the high background noise associated with the inherent radioactivity of the test specimens. X-ray diffraction analyses of both radioactive and non-radioactive aluminosilicate pellets confirmed the crystal lattice structure to be pollucite. Cesium ion quasistatic leachability measurements determined the leach rates of fully loaded /sup 137/Cs sectioned pollucite pellets to date to be 4.61 to 34.4 x 10/sup -10/ kg m/sup -2/s/sup -1/, while static leach tests performed on unsectioned fully loaded pellets showed the leach rates of the cesium ion to date to be 2.25 to 3.41 x 10/sup -12/ kg m/sup -2/s/sup -1/. The cesium ion diffusion coefficients through the pollucite pellet were calculated using Fick's first and second laws of diffusion. The diffusion coefficients calculated for three tracer level /sup 137/Cs aluminosilicate pellets were 1.29 x 10/sup -16/m/sup 2/s/sup -1/, 6.88 x 10/sup -17/m/sup 2/s/sup -1/, and 1.35 x 10/sup -17/m/sup 2/s/sup -1

  18. Biosorption of cesium by native and chemically modified biomass of marine algae: introduce the new biosorbents for biotechnology applications

    Energy Technology Data Exchange (ETDEWEB)

    Jalali-Rad, R. [Department of Biotechnology, Nuclear Research Center, Atomic Energy Organization of Iran, Tehran (Iran, Islamic Republic of)]. E-mail: rjalali@aeoi.org.ir; Ghafourian, H. [Department of Biotechnology, Nuclear Research Center, Atomic Energy Organization of Iran, Tehran (Iran, Islamic Republic of); Asef, Y. [Department of Biotechnology, Nuclear Research Center, Atomic Energy Organization of Iran, Tehran (Iran, Islamic Republic of); Dalir, S.T. [Department of Biotechnology, Nuclear Research Center, Atomic Energy Organization of Iran, Tehran (Iran, Islamic Republic of); Sahafipour, M.H. [Department of Biotechnology, Nuclear Research Center, Atomic Energy Organization of Iran, Tehran (Iran, Islamic Republic of); Gharanjik, B.M. [Offshore Fisheries Research Center, Chabahar (Iran, Islamic Republic of)

    2004-12-10

    Biosorption batch experiments were conducted to determine the cesium binding ability of native biomass and chemically modified biosorbents derived from marine algae, namely ferrocyanide algal sorbents type 1 and type 2 (FASs1 and FASs2). The applicability of the Langmuir and Freundlich isotherms for representation of the experimental data was investigated. The cesium sorption performances of the various types of sorbents were compared using the maximum capacities (q{sub max} values) obtained from fitting the Langmuir isotherm to the values calculated from the sorption experiments, which FASs type 1 and type 2 showed better sorption performances for cesium. FASs1 and FASs2 derived from formaldehyde and glutaraldehyde crosslinked Padina australis exhibited lower sorption capacities than those prepared from the non-crosslinked one. Most of the cesium ions were bound to FASs1, derived from Sargassum glaucescens and P. australis, in <2 min and equilibrium reached within the first 30 min of contact. Biosorption of cesium by FASs1 derived from P. australis and Cystoseria indica was constantly occurred at a wide range of pH, between 1 and 10, and the highest removal took place at pH 4. The presence of sodium and potassium at 0.5 and 1 mM did not inhibit cesium biosorption by algae biomass. The maximum cesium uptake was acquired using the large particles of FAS2 originated from S. glaucescens (2-4 mm). Desorption of cesium from the metal-laden FASs1 (from P. australis, S. glaucescens and Dictyota indica) was completely achieved applying 0.5 and 1 M NaOH and KOH, although the cesium sorption capacity of the biosorbents (from C. indica and S. glaucescens) decreased by 46-51% after 9 sorption-desorption cycles.

  19. Performance modeling of an integral, self-regulating cesium reservoir for the ATI-TFE

    International Nuclear Information System (INIS)

    This work covers the performance modeling of an integral metal-matrix cesium-graphite reservoir for operation in the Advanced Thermionic Initiative-Thermionic Fuel Element (ATI-TFE) converter configuration. The objectives of this task were to incorporate an intercalated cesium-graphite reservoir for the 3C24Cs→2C36Cs+Cs(g) two phase equilibrium reaction into the emitter lead region of the ATI-TFE. A semi two-dimensional, cylindrical TFE computer model was used to obtain thermal and electrical converter output characteristics for various reservoir locations. The results of this study are distributions for the interelectrode voltage, output current density, and output power density as a function of axial position along the TFE emitter. This analysis was accomplished by identifying an optimum cesium pressure for three representative pins in the ATI ''driverless'' reactor core and determining the corresponding position of the graphite reservoir in the ATI-TFE lead region. The position for placement of the graphite reservoir was determined by performing a first-order heat transfer analysis of the TFE lead region to determine its temperature distribution. The results of this analysis indicate that for the graphite reservoirs investigated the 3C24Cs→2C36Cs+Cs(g) equilibrium reaction reservoir is ideal for placement in the TFE emitter lead region. This reservoir can be directly coupled to the emitter, through conduction, to provide the desired cesium pressure for optimum performance. The cesium pressure corresponding to the optimum converter output performance was found to be 2.18 torr for the ATI core least power TFE, 2.92 torr for the average power TFE, and 4.93 torr for the maximum power TFE

  20. Synthesis of Iron-ferrocyanide functionalized magnetic nanocluster for the removal of cesium

    International Nuclear Information System (INIS)

    In the present study, magnetite nanocluster was synthesized by hydrothermal method, and coated with iron ferrocyanide for the adsorption of cesium in an aqueous solution through simple addition of iron ferrocyanide in acid condition. We describe the morphology, structure, and physical property of these nanoparticles. In addition, their ability to eliminate cesium from water was also evaluated. In this study, we fabricated Iron ferrocyanide immobilized magnetite nanocluster (IFC-MNC) using hydrothermal methods. The CIFC-MNC exhibited easy separation ability from water by an external magnet, and showed a high removal efficiency of cesium in aqueous solutions. Therefore, the IFC-MNC demonstrated good potential for the treatment of water contaminated with radioactive cesium. gnetic nanoadsorbents composed of a magnetic particles core and functional shell, which adsorb the contaminants, has attracted significant attention in environmental remediation owing to their high surface area and unique superparamagnetism. The nuclear accident at the Fukushima Daiichi nuclear power station in 2011 released a huge quantity of radioactive contaminants into the environment. Among these, cesium Cs-137 is the most problematic contaminant due to its long half-life (30.2 years), and high-energy gamma ray (γ-ray) emissions. Among various adsorbents to treat Cs-137 contaminated water, metal ferrocyanides were widely applied to remove the Cs-137 in water. For better separation of metal ferrocyanide from water, recently, our group reported the fabrication of copper ferrocyanide-functionalized magnetic nanoparticles (Cu-FC-EDA-MNPs) using alkoxysilanes, having ethylenediamine (EDA) group, modified Fe3O4 nanoparticles (EDA-MNPs) for the fast and easy magnetic separation of metal ferrocyanide. However, the fabrication method was multistep procedure. Thus, a more simplified fabrication procedure is still desired

  1. Synthesis of Iron-ferrocyanide functionalized magnetic nanocluster for the removal of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hee-Man; Jang, Sung-Chan; Lee, Kune Woo; Seo, Bum-Kyoung; Moon, Jei Kwon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-10-15

    In the present study, magnetite nanocluster was synthesized by hydrothermal method, and coated with iron ferrocyanide for the adsorption of cesium in an aqueous solution through simple addition of iron ferrocyanide in acid condition. We describe the morphology, structure, and physical property of these nanoparticles. In addition, their ability to eliminate cesium from water was also evaluated. In this study, we fabricated Iron ferrocyanide immobilized magnetite nanocluster (IFC-MNC) using hydrothermal methods. The CIFC-MNC exhibited easy separation ability from water by an external magnet, and showed a high removal efficiency of cesium in aqueous solutions. Therefore, the IFC-MNC demonstrated good potential for the treatment of water contaminated with radioactive cesium. gnetic nanoadsorbents composed of a magnetic particles core and functional shell, which adsorb the contaminants, has attracted significant attention in environmental remediation owing to their high surface area and unique superparamagnetism. The nuclear accident at the Fukushima Daiichi nuclear power station in 2011 released a huge quantity of radioactive contaminants into the environment. Among these, cesium Cs-137 is the most problematic contaminant due to its long half-life (30.2 years), and high-energy gamma ray (γ-ray) emissions. Among various adsorbents to treat Cs-137 contaminated water, metal ferrocyanides were widely applied to remove the Cs-137 in water. For better separation of metal ferrocyanide from water, recently, our group reported the fabrication of copper ferrocyanide-functionalized magnetic nanoparticles (Cu-FC-EDA-MNPs) using alkoxysilanes, having ethylenediamine (EDA) group, modified Fe{sub 3}O{sub 4} nanoparticles (EDA-MNPs) for the fast and easy magnetic separation of metal ferrocyanide. However, the fabrication method was multistep procedure. Thus, a more simplified fabrication procedure is still desired.

  2. Biology and clinical implications of CD133{sup +} liver cancer stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Stephanie, E-mail: stefma@hku.hk [Department of Clinical Oncology, State Key Laboratory for Liver Research, LKS Faculty of Medicine, The University of Hong Kong (Hong Kong)

    2013-01-15

    Hepatocellular carcinoma (HCC) is the most common primary malignant tumor of the liver, accounting for 80%–90% of all liver cancers. The disease ranks as the fifth most common cancer worldwide and is the third leading cause of all cancer-associated deaths. Although advances in HCC detection and treatment have increased the likelihood of a cure at early stages of the disease, HCC remains largely incurable because of late presentation and tumor recurrence. Only 25% of HCC patients are deemed suitable for curative treatment, with the overall survival at just a few months for inoperable patients. Apart from surgical resection, loco-regional ablation and liver transplantation, current treatment protocols include conventional cytotoxic chemotherapy. But due to the highly resistant nature of the disease, the efficacy of the latter regimen is limited. The recent emergence of the cancer stem cell (CSC) concept lends insight into the explanation of why treatment with chemotherapy often may seem to be initially successful but results in not only a failure to eradicate the tumor but also possibly tumor relapse. Commonly used anti-cancer drugs in HCC work by targeting the rapidly proliferating and differentiated liver cancer cells that constitute the bulk of the tumor. However, a subset of CSCs exists within the tumor, which are more resistant and are able to survive and maintain residence after treatment, thus, growing and self-renewing to generate the development and spread of recurrent tumors in HCC. In the past few years, compelling evidence has emerged in support of the hierarchic CSC model for solid tumors, including HCC. And in particular, CD133 has drawn significant attention as a critical liver CSC marker. Understanding the characteristics and function of CD133{sup +} liver CSCs has also shed light on HCC management and treatment, including the implications for prognosis, prediction and treatment resistance. In this review, a detailed summary of the recent progress

  3. Preparation and use of polymeric materials containing hydrophobic anions and plasticizers for separation of cesium and strontium

    International Nuclear Information System (INIS)

    Preparation and use is described for polymeric materials containing hydrophobic anions and plasticizers for extraction of cesium and strontium. The use of polymeric materials containing plasticizers which are solvents for hydrophobic anions such as derivatives of cobalt dicarbollide or tetraphenylborate which are capable of extracting cesium and strontium ions from aqueous solutions in contact with the polymeric materials, is described. The polymeric material may also include a synergistic agent for a given ion like polyethylene glycol or a crown ether, for removal of radioactive isotopes of cesium and strontium from solutions of diverse composition and, in particular, for solutions containing large excess of sodium nitrate

  4. Measurement of regional hepatic blood flow and scintigraphic imaging of portal circulation with /sup 133/Xe

    Energy Technology Data Exchange (ETDEWEB)

    Kroiss, A. (Krankenanstalt der Stadt Wien Rudolfstiftung (Austria) 1. Medizinische Abt.)

    1980-01-01

    Regional hepatic blood flow has been determined by 4 methods with the aid of /sup 133/Xe washout technique: 1. scintisplenoportography (direct application of /sup 133/Xe into the spleen by means of a thin needle); 2. arterial method (/sup 133/Xe is injected into the A. hepatica by means of a catheter); 3. retrograde-venous method (/sup 133/Xe administered by an occluding hepatic vein catheter); 4. percutaneous intrahepatic method (/sup 133/Xe administered directly into the parenchyma by means of a Chiba needle). It was possible to demonstrate that hepatic blood flow values established with the aid of /sup 133/Xe are independent of the form of application (scintisplenoportography, arterial method, retrograde-venous method).

  5. STAT3 is a key transcriptional regulator of cancer stem cell marker CD133 in HCC

    Science.gov (United States)

    Ghoshal, Sarani; Fuchs, Bryan C.

    2016-01-01

    Cancer stem cell (CSC) marker CD133 was found to be upregulated in many cancers including hepatocellular carcinoma (HCC). However, the molecular mechanism of CD133 regulation in the liver tumor microenvironment has remained elusive. In this study Won and colleagues report that interleukin-6 (IL-6) mediated signal transducer and activator of transcription factor 3 (STAT3) signaling and hypoxia enhance the expression of CD133 and promote the progression of HCC. PMID:27275460

  6. Molecular properties of CD133+ glioblastoma stem cells derived from treatment-refractory recurrent brain tumors

    OpenAIRE

    Liu, Qinghai; Nguyen, David H.; DONG, QINGHUA; Shitaku, Peter; Chung, Kenneth; Liu, On Ying; Jonathan L Tso; Liu, Jason Y; Konkankit, Veerauo; Cloughesy, Timothy F.; Mischel, Paul S; Lane, Timothy F.; Liau, Linda M.; Stanley F Nelson; Tso, Cho-Lea

    2009-01-01

    Glioblastoma multiforme (GBM) remains refractory to conventional therapy. CD133+ GBM cells have been recently isolated and characterized as chemo-/radio-resistant tumor-initiating cells and are hypothesized to be responsible for post-treatment recurrence. In order to explore the molecular properties of tumorigenic CD133+ GBM cells that resist treatment, we isolated CD133+ GBM cells from tumors that are recurrent and have previously received chemo-/radio-therapy. We found that the purified CD1...

  7. Clinicopathological significance of CD133 in lung cancer: A meta-analysis

    OpenAIRE

    Yaoxi TAN; Chen, Bo; Xu, Wei; Zhao, Weihong; Wu, Jianqing

    2013-01-01

    CD133 is one of the most commonly used markers of lung cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical value and significance of CD133 in lung cancer remains controversial. Due to the limited size of the individual studies, the association between CD133 and the clinicopathological characteristics of lung cancer had not been fully elucidated. A meta-analysis based on published studies was performed with the aim of ev...

  8. 29 CFR 780.133 - Farmers' cooperative as a “farmer.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Farmers' cooperative as a âfarmer.â 780.133 Section 780.133... General Scope of Agriculture Practices Performed âby A Farmerâ § 780.133 Farmers' cooperative as a “farmer.” (a) The phrase “by a farmer” covers practices performed either by the farmer himself or by the...

  9. A 133-xenon inhalation system for cerebral blood-flow measurements in ventilated premature babies

    International Nuclear Information System (INIS)

    We constructed a Xenon-133 inhalation and trapping system in order to measure cerebral blood flow of ventilated premature babies by means of the noninvasive 133Xe clearance method. The completely lead-shielded inhalation device is a closed system driven by the baby's own respirator and can thus be safely used at the patients bedside in the intensive care unit. Reproducible proximal airway concentrations of 133Xe (with or without leaks around the endotracheal tube) were obtained by in vitro simulation. (orig.)

  10. MicroRNA Profiling during Craniofacial Development: Potential Roles for Mir23b and Mir133b

    Science.gov (United States)

    Ding, Hai-Lei; Hooper, Joan E.; Batzel, Peter; Eames, B. Frank; Postlethwait, John H.; Artinger, Kristin B.; Clouthier, David E.

    2016-01-01

    Defects in mid-facial development, including cleft lip/palate, account for a large number of human birth defects annually. In many cases, aberrant gene expression results in either a reduction in the number of neural crest cells (NCCs) that reach the frontonasal region and form much of the facial skeleton or subsequent failure of NCC patterning and differentiation into bone and cartilage. While loss of gene expression is often associated with developmental defects, aberrant upregulation of expression can also be detrimental. microRNAs (miRNAs) are a class of non-coding RNAs that normally repress gene expression by binding to recognition sequences located in the 3′ UTR of target mRNAs. miRNAs play important roles in many developmental systems, including midfacial development. Here, we take advantage of high throughput RNA sequencing (RNA-seq) from different tissues of the developing mouse midface to interrogate the miRs that are expressed in the midface and select a subset for further expression analysis. Among those examined, we focused on four that showed the highest expression level in in situ hybridization analysis. Mir23b and Mir24.1 are specifically expressed in the developing mouse frontonasal region, in addition to areas in the perichondrium, tongue musculature and cranial ganglia. Mir23b is also expressed in the palatal shelves and in anterior epithelium of the palate. In contrast, Mir133b and Mir128.2 are mainly expressed in head and trunk musculature. Expression analysis of mir23b and mir133b in zebrafish suggests that mir23b is expressed in the pharyngeal arch, otic vesicle, and trunk muscle while mir133b is similarly expressed in head and trunk muscle. Functional analysis by overexpression of mir23b in zebrafish leads to broadening of the ethmoid plate and aberrant cartilage structures in the viscerocranium, while overexpression of mir133b causes a reduction in ethmoid plate size and a significant midfacial cleft. These data illustrate that miRs are

  11. MicroRNA Profiling During Craniofacial Development: Potential Roles for Mir23b and Mir133b

    Directory of Open Access Journals (Sweden)

    Hai-Lei Ding

    2016-07-01

    Full Text Available Defects in mid-facial development, including cleft lip/palate, account for a large number of human birth defects annually. In many cases, aberrant gene expression results in either a reduction in the number of neural crest cells (NCCs that reach the frontonasal region and form much of the facial skeleton or subsequent failure of NCC patterning and differentiation into bone and cartilage. While loss of gene expression is often associated with developmental defects, aberrant upregulation of expression can also be detrimental. microRNAs (miRNAs are a class of non-coding RNAs that normally repress gene expression by binding to recognition sequences located in the 3’ UTR of target mRNAs. miRNAs play important roles in many developmental systems, including midfacial development. Here, we take advantage of high throughput RNA sequencing (RNA-seq from different tissues of the developing mouse midface to interrogate the miRs that are expressed in the midface and select a subset for further expression analysis. Among those examined, we focused on four that showed the highest expression level in situ hybridization analysis. Mir23b and Mir24.1 are specifically expressed in the developing mouse frontonasal region, in addition to areas in the perichondrium, tongue musculature and cranial ganglia. Mir23b is also expressed in the palatal shelves and in anterior epithelium of the palate. In contrast, Mir133b and Mir128.2 are mainly expressed in head and trunk musculature. Expression analysis of mir23b and mir133b in zebrafish suggests that mir23b is expressed in the pharyngeal arch, otic vesicle and trunk muscle while mir133b is similarly expressed in head and trunk muscle. Functional analysis by overexpression of mir23b in zebrafish leads to broadening of the ethmoid plate and aberrant cartilage structures in the viscerocranium, while overexpression of mir133b causes a reduction in ethmoid plate size and a significant cleft. These data illustrate that mi

  12. CD133 promotes gallbladder carcinoma cell migration through activating Akt phosphorylation

    Science.gov (United States)

    Zhen, Jiaojiao; Ai, Zhilong

    2016-01-01

    Gallbladder carcinoma (GBC) is the fifth most common malignancy of gastrointestinal tract. The prognosis of gallbladder carcinoma is extremely terrible partially due to metastasis. However, the mechanisms underlying gallbladder carcinoma metastasis remain largely unknown. CD133 is a widely used cancer stem cell marker including in gallbladder carcinoma. Here, we found that CD133 was highly expressed in gallbladder carcinoma as compared to normal tissues. CD133 was located in the invasive areas in gallbladder carcinoma. Down-regulation expression of CD133 inhibited migration and invasion of gallbladder carcinoma cell without obviously reducing cell proliferation. Mechanism analysis revealed that down-regulation expression of CD133 inhibited Akt phosphorylation and increased PTEN protein level. The inhibitory effect of CD133 down-regulation on gallbladder carcinoma cell migration could be rescued by Akt activation. Consistent with this, addition of Akt inhibitor Wortmannin markedly inhibited the migration ability of CD133-overexpressing cells. Thus, down-regulation of CD133 inhibits migration of gallbladder carcinoma cells through reducing Akt phosphorylation. These findings explore the fundamental biological aspect of CD133 in gallbladder carcinoma progression, providing insights into gallbladder carcinoma cell migration. PMID:26910892

  13. Clinicopathological significance of CD133 in lung cancer: A meta-analysis.

    Science.gov (United States)

    Tan, Yaoxi; Chen, Bo; Xu, Wei; Zhao, Weihong; Wu, Jianqing

    2014-01-01

    CD133 is one of the most commonly used markers of lung cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical value and significance of CD133 in lung cancer remains controversial. Due to the limited size of the individual studies, the association between CD133 and the clinicopathological characteristics of lung cancer had not been fully elucidated. A meta-analysis based on published studies was performed with the aim of evaluating the effect of CD133 on the clinicopathological characteristics of lung cancer and to investigate the role of CSCs in the prognosis of lung cancer. A total of 15 eligible studies were included in this meta-analysis and our results indicated that a positive CD133 expression was significantly associated with poor differentiation and lymph node metastasis, although it was not associated with tumor stage or histological type. Therefore, CD133 may be considered as a prognostic maker of lung cancer. Further clinical studies, with larger patient samples, unified methods and cut-off levels to detect CD133 expression, classified by tumor stage, therapeutic schedule, follow-up time and survival events, are required to determine the role of CD133 in clinical application and the association between CD133 and the prognosis of lung cancer. PMID:24649317

  14. CD133 Immunohistochemisty in Glioblastoma – Identification of Tumor Stem Cells or a Matter of Coincidence?

    DEFF Research Database (Denmark)

    Hermansen, Simon Kjær; Christensen, Karina Garnier; Jensen, Stine Skov;

    + niches in glioblastomas, often in close relation to blood vessels, using all four antibody clones. The distribution of identified niches did, however, rarely correspond among each antibody clone. Staining of glioblastoma single and niche cells was predominantly cytoplasmatic, although membranous staining...... was also observed in niches. Quantitative stereology revealed vast dissimilarities regarding fractions of CD133+ niches and single cells among the CD133 antibody clones. Generally, the fraction of CD133 positivity identified by clone W6B3C1 was significantly higher than CD133 fractions identified by...

  15. Analysis of 133 patients with severe blunt liver injury

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To investigate the treatment and causes of death aboutsevere blunt liver injury.Methods: The data of 133 patients with severe blunt liver injury (Grade Ⅲ to Grade Ⅴ) were analyzed retrospectively. All the patients except 2 underwent operations. Different types of surgical procedures were adopted according to the severity of liver injury.Results: Operations were the major method to treat hepatic injury. The total mortality rate was 21.0% in this study. The mortality rates of Grade Ⅲ, Grade Ⅳ and Grade Ⅴ of liver injuries were 11.3%, 24.4% and 69.2%, respectively.Conclusions: Packing treatment plays an important role in the treatment of hepatic injury. The mortality rate is related closely to the severity of hepatic injury, multiple trauma, shock and disturbance of blood coagulation.

  16. Contribution to scintigraphic study of pulmonary ventilation using 133Xe

    International Nuclear Information System (INIS)

    A technique of regional lung function study, using 133Xe, is described (instrumentation, procedure, results). A gamma-camera is used for this investigation, its main advantages are as follows. The picture is smaller than the one produced by a scanner, but is obtained more quickly. The gamma-camera equipped with a data processing unit is able to visualize areas of interest and to provide quantitative informations. Two parameters are studied. The first one is Xenon washout speed expressed in (ml/mn/cm3) which gives an exact value of pulmonary ventilation. The latter is retention. This parameter is of interest because retention is more easy to evaluate than washout speed, and is able to quantify what is suggested by scintigraphic pictures. The technique has proven to be valuable in differentiating chronic bronchitis from post-bronchitic emphysema

  17. Removal of cesium using coconut fiber in raw and modified forms for the treatment of radioactive liquid wastes

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Nella N.M. de; Nobre, Vanessa B.; Potiens Junior, Ademar J.; Sakata, Solange K., E-mail: sksakata@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Di Vitta, Patricia B. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Quimica

    2013-07-01

    Sorption is one of the most studied methods to reduce the volume of radioactive waste streams. Cesium-137 is a radioisotope formed by the fission of uranium and it can cause health problems due to its easy assimilation by cells. The aim of this study is to evaluate the potential of coconut fiber in removing cesium from radioactive liquid wastes; this process can help in disposing radioactive waste. The experiments were performed in batch and the particle size of the fiber ranged between 0.30 mm and 0.50 mm. The fiber was treated with hydrogen peroxide in alkaline medium. The following parameters were analyzed: contact time, pH and concentration of cesium ions in aqueous solution. After the experiments the samples were filtered and cesium remaining in solution was quantified by inductively coupled plasma optical emission spectrometry. (author)

  18. Frequency doubling with periodically poled KTiOPO4 at the fundamental wave of cesium D2 transition

    Institute of Scientific and Technical Information of China (English)

    Xiaoling Song; Zhigang Li; Pengfei Zhang; Gang Li; Yuchi Zhang; Junmin Wang; Tiancai Zhang

    2007-01-01

    @@ We report the continuous wave (CW) second harmonic generation (SHG) with a periodically poled KTiOPO4 (PPKTP) pumped by a diode laser at 852.356 nm, which is exactly resonant on the cesium D2 transition.

  19. Application of a composite sorbent based om natural and synthetic zeolites for cesium ion elimination from water solutions

    International Nuclear Information System (INIS)

    The study has been carried out to determine the effect of variations in the content of natural and synthetic zeolites, being the components of the composite sorbent, on the cesium sorption from the water solution

  20. Spin-dependent asymmetry functions in the elastic and inelastic electron-cesium scattering at intermediate energies

    International Nuclear Information System (INIS)

    In this thesis the measurements of the relative differential cross section, the exchange asymmetry, the spin-orbit asymmetry, and the interference asymmetry for the electron scattering on cesium atoms from 4 to 18 eV is described. (HSI)

  1. Evaluation of calix-crown ionophores for selective separation of radio-cesium from acidic nuclear waste solution

    Energy Technology Data Exchange (ETDEWEB)

    Mohapatra, P.K. [Radiochemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Ansari, S.A. [Radiochemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Sarkar, A. [Radiochemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Bhattacharyya, A. [Radiochemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Manchanda, V.K. [Radiochemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)]. E-mail: vkm@magnum.barc.ernet.in

    2006-07-07

    Extraction of Cs-137 from nitric acid was carried out using nitrobenzene solutions of calix-crowns such as calix[4]arene-bis(crown-6) (CC-A), calix[4]arene-bis(benzo crown-6) (CC-B) and calix[4]arene-bis(napthocrown-6) (CC-C). CC-C was found to be superior extractant for Cs(I) as compared to the other two calix-crown ligands used in the present study. The effect of diluent on the extraction of Cs(I) indicated the trend: nitrobenzene > dichloroethane > chloroform > decanol >> carbon tetrachloride {approx} n-hexane {approx} toluene. Subsequently, the studies were carried out with nitrobenzene solutions of the calix-crown ligands (mainly CC-C) on the effects of (a) aqueous phase acidity (b) ligand concentration, and (c) cesium concentration on Cs extraction from nitric acid media. Conditions for quantitative extraction and stripping were optimized and the extracted species conformed to {l_brace}[CsL]{sup +}.[NO{sub 3}]{sup -}.nH{sub 2}O{r_brace}. Selectivity studies were carried out using an irradiated natural U target involving tracer amount of fission products activities. Extraction of Cs(I) from a synthetic high level waste solution was also carried out. The promising results obtained in the present studies indicate possible use of the calix-crown ligand for Cs(I) recovery from the acidic high level waste.

  2. Cesium-137 in ash from combustion of biofuels. Application of regulations from the Swedish Radiation Safety Authority; Cesium-137 i aska fraan foerbraenning av biobraenslen. Tillaempning av Straalsaekerhetsmyndighetens regler

    Energy Technology Data Exchange (ETDEWEB)

    Sjoeblom, Rolf (Tekedo AB, Nykoeping (SE))

    2009-03-19

    The Swedish Radiation Safety Authority, SSM, has issued an ordinance on ash contaminated with Cesium-137. It implies amongst other things that ash containing 0,5 - 10 kBq/kg Cesium-137 (so-called contaminated ash) can be used for geotechnical purposes provided that the content in a near-by well does not exceed 1 Bq/litre and that the increase in a near-by fish producing recipient does not exceed 0,1 Bq/litre. The initial plan with the presently reported work was to provide a compilation of how the ordinance for Cesium-137 can be applied in practical work. It became evident, however, in the course of the work that issues related to the co-variation between potassium and Cesium needed further investigation. As a result, the present report comprises also a compilation of this extended information search. Cesium-137 is present in ash as a result of the accident in a nuclear power reactor in Chernobyl in 1986 during which material having a very small grain size was spread to a high altitude. A few days later, Cesium-137 was deposited during rains over large parts of Sweden. This activity penetrated to a depth of one or a few decimetres during the course of the subsequent few days and weeks, after which it was partially taken up by plants and spread in the ecosystem. Section 2 has the character of a handbook. It provides basic information on radiation, and also about the ordinance and other material from the SSI. Section 3 comprises compilations of relevant international status of knowledge. This regards how potassium and Cesium behave in soil and ash, and also how spreading of Cesium can be modelled. Cesium behaves similarly to Potassium but with the difference that Cesium is bonded much more strongly to mineral soil and ash. Potassium and Cesium appears in soil in four different forms: dissolved in the pore water, exchangeable, non-exchangeable and as bonded to minerals. The amount dissolved in the pore water is the smallest and that bonded to minerals is the largest

  3. The promotional effects of cesium promoter on higher alcohol synthesis from syngas over cesium-promoted Cu/ZnO/Al2O3 catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Jie; Cai, Qiuxia; Wan, Yan; Wan, Shaolong; Wang, Li; Lin, Jingdong; Mei, Donghai; Wang, Yong

    2016-09-02

    In this study, the promotional effects of cesium promoter on higher alcohol (C2+OH) synthesis from syngas over Cs-Cu/ZnO/Al2O3 catalysts were investigated using a combined experimental and theoretical density functional theory (DFT) calculation method. In the presence of cesium, the C2+OH productivity increases from 77.1 g•kgcat-1•h-1 to 157.3 g•kgcat-1•h-1 at 583 K due to the enhancement of the initial C–C bond formation. Detailed analysis of chain growth probabilities (CGPs) confirms that initial C–C bond formation is the rate-determining step in the temperature range of 543-583 K. Addition of cesium promoter significantly increases the productivities of 2-methyl-1-propanol, while the CGPs values (C3* to 2-methyl-C3*) is almost unaffected. With the assistance of cesium promoter, the CGPs of the initial C–C bond formation step (C1* to C2*) could be increased from 0.13 to 0.25 at 583 K. DFT calculations indicate that the initial C–C bond formation is mainly contributed by the HCO+HCO coupling reaction over the ZnCu(211) model surface. In the presence of the Cs2O, the stabilities of key reaction intermediates such as HCO and H2CO are enhanced which facilitates both HCO+HCO and HCO+H2CO coupling reaction steps with lower activation barriers over the Cs2O-ZnCu(211) surface. The promotional effects of cesium on the C2+OH productivity are also benefited from the competitive CH+HCO coupling reaction over CH hydrogenation that leads to lower alkane formation. In addition, Bader charge analysis suggests that the presence of cesium ions would facilitate the nucleophilic reaction between HCO and H2CO for initial C–C bond formation. This work was supported by the National Natural Science Foundation of China (No. 91545114 and No. 91545203). We appreciate the joint PhD scholarship support from the China Scholarship Council. The authors would also like to thank the support from Collaborative Innovation Center of Chemistry for Energy Materials (2011-iChEM). DM

  4. Identification by Mass Spectrometry and Immune Response Analysis of Guinea Pig Cytomegalovirus (GPCMV Pentameric Complex Proteins GP129, 131 and 133

    Directory of Open Access Journals (Sweden)

    Josephine S. Gnanandarajah

    2014-02-01

    Full Text Available Development of a vaccine against congenital infection with human cytomegalovirus (HCMV is a major public health priority. A potential vaccine target receiving considerable recent attention is the pentameric complex (PC of HCMV proteins consisting of gL, gH, UL128, UL130, and UL131, since some antibodies against these target proteins are capable of potently neutralizing virus at epithelial and endothelial cell surfaces. Recently, homologous proteins have been described for guinea pig cytomegalovirus (GPCMV, consisting of gH, gL, and the GPCMV proteins GP129, GP131, and GP133. To investigate these proteins as potential vaccine targets, expression of GP129-GP133 transcripts was confirmed by reverse-transcriptase PCR. Mass spectrometry combined with western blot assays demonstrated the presence of GP129, GP131, and GP133 proteins in virus particles. Recombinant proteins corresponding to these PC proteins were generated in baculovirus, and as GST fusion proteins. Recombinant proteins were noted to be immunoreactive with convalescent sera from infected animals, suggesting that these proteins are recognized in the humoral immune response to GPCMV infection. These analyses support the study of PC-based recombinant vaccines in the GPCMV congenital infection model.

  5. FY06 ANNUAL REPORT FOR ENVIRONMENTAL MANAGEMENT SCIENCE PROGRAM PROJECT #95061STRATEGIC DESIGN AND OPTIMIZATION OF INORGANIC SORBENTSFOR CESIUM, STRONTIUM AND ACTINIDES

    Energy Technology Data Exchange (ETDEWEB)

    Hobbs, D

    2006-08-10

    The basic science goal in this project identifies structure/affinity relationships for selected radionuclides and existing sorbents. The task will apply this knowledge to the design and synthesis of new sorbents that will exhibit increased affinity for cesium, strontium and actinide separations. The target problem focuses on the treatment of high-level nuclear wastes. The general approach can likewise be applied to nonradioactive separations. During the fifth year of the project our studies focused along the following paths: (1) determination of Cs{sup +} ion exchange mechanism in sodium titanium silicates with sitinikite topology and the influence of crystallinity on ion exchange, (2) synthesis and characterization of novel peroxo-titanate materials for strontium and actinide separations, and (3) further refinements in computational models for the CST and polyoxoniobate materials.

  6. Sugar-metal ion interactions: the complicated coordination structures of cesium ion with D-ribose and myo-inositol.

    Science.gov (United States)

    Hu, Haijian; Xue, Junhui; Wen, Xiaodong; Li, Weihong; Zhang, Chao; Yang, Limin; Xu, Yizhuang; Zhao, Guozhong; Bu, Xiaoxia; Liu, Kexin; Chen, Jia'er; Wu, Jinguang

    2013-11-18

    The novel cesium chloride-D-ribose complex (CsCl·C5H10O5; Cs-R) and cesium chloride-myo-inositol complex (CsCl·C6H12O6; Cs-I) have been synthesized and characterized using X-ray diffraction and FTIR, FIR, THz, and Raman spectroscopy. Cs(+) is eight-coordinated to three chloride ions, O1 and O2 from one D-ribose molecule, O1 from another D-ribose molecule, and O4 and O5 from the third D-ribose molecule in Cs-R. For one D-ribose molecule, the oxygen atom O1 in the ring is coordinated to two cesium ions as an oxygen bridge, O2 is cocoordinated with O1 to one of the two cesium ions, and O4 and O5 are coordinated to the third cesium ion, respectively. O3 does not coordinate to metal ions and only takes part in forming hydrogen bonds. One chloride ion is connected to three cesium ions. Thus, a complicated structure of Cs-D-ribose forms. For Cs-I, Cs(+) is 10-coordinated to three chloride ions, O1 and O2 from one myo-inositol molecule, O3 and O4 from another myo-inositol molecule, O5 and O6 from the third myo-inositol molecule, and O6 from the fourth myo-inositol molecule. One metal ion is connected to four ligands, and one myo-inositol is coordinated to four Cs(+) ions, which is also a complicated coordination structure. Crystal structure results, FTIR, FIR, THz, and Raman spectra provide detailed information on the structure and coordination of hydroxyl groups to metal ions in the cesium chloride-D-ribose and cesium chloride-myo-inositol complexes.

  7. 基因OCT4、CD133在非小细胞肺癌组织中的表达及临床意义%Expression and significance of OCT4 , CD133 in non-small cell lung cancer

    Institute of Scientific and Technical Information of China (English)

    倪静怡; 杨磊; 朱兴华; 茅国新

    2012-01-01

    . The expressions of them were positively correlated (P = 0. 0218) . Conclusion OCT4 and CD133 probably play an important role in the process of transformation of the normal cell to malignant cells. To detect the expression of OCT4 and CD133 may help in the early diagnosis of the lung cancer, and may provide the theory basis of confirmation or differentiation of tumor stem cells markers and target therapy of cancer stem cells.

  8. Dicty_cDB: SHI133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 044130 |CR044130.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering ...clone MHPP186g09. 50 0.068 1 CR023465 |CR023465.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engine...Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHPP47e19. 50... 0.068 1 CR034434 |CR034434.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engine...ion targeting and chromosome engineering clone MHPP142o16. 50 0.068 1 BX990136 |B

  9. Next Generation Extractants for Cesium Separation from High-Level Waste: From Fundamental Concepts to Site Implementation

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A; Bazelaire, Eve; Bonnesen, Peter V; Custelcean, Radu; Delmau, Laetitia H; Ditto, Mary E; Engle, Nancy L; Gorbunova, Maryna G; Haverlock, Tamara J; Levitskaia, Taiana G; Bartsch, Richard A; Surowiec, Malgorzata A; Zhou, Hui

    2005-07-06

    This project unites expertise at Oak Ridge National Laboratory (ORNL) and Texas Tech University (TTU, Prof. Richard A. Bartsch) to answer fundamental questions addressing the problem of cesium removal from high-level tank waste. Efforts focus on novel solvent-extraction systems containing calixcrown extractants designed for enhanced cesium binding and release. Exciting results are being obtained in three areas: (1) a new lipophilic cesium extractant with a high solubility in the solvent; (2) new proton-ionizable calixcrowns that both strongly extract cesium and "switch off" when protonated; and (3) an improved solvent system that may be stripped with more than 100-fold greater efficiency. Scientific questions primarily concern how to more effectively reverse extraction, focusing on the use of amino groups and proton-ionizable groups to enable pH-switching. Synthesis is being performed at ORNL (amino calixcrowns) and TTU (proton-ionizable calixcrowns). At ORNL, the extraction behavior is being surveyed to assess the effectiveness of candidate solvent systems, and systematic distribution measurements are under way to obtain a thermodynamic understanding of partitioning and complexation equilibria. Crystal structures obtained at ORNL are revealing the structural details of cesium binding. The overall objective is a significant advance in the predictability and efficiency of cesium extraction from high-level waste in support of potential implementation at U. S. Department of Energy (USDOE) sites.

  10. Next Generation Extractants for Cesium Separation from High-Level Waste: From Fundamental Concepts to Site Implementation

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A.; Bazelaire, Eve; Bonnesen, Peter V.; Custelcean, Radu; Delmau, Laetitia H.; Ditto, Mary E.; Engle, Nancy L.; Gorbunova, Maryna G.; Haverlock, Tamara J.; Levitskaia, Tatiana G.; Bartsch, Richard A.; Surowiec, Malgorzata A.; Zhou, Hui

    2005-07-06

    This project unites expertise at Oak Ridge National Laboratory (ORNL) and Texas Tech University (TTU, Prof. Richard A. Bartsch) to answer fundamental questions addressing the problem of cesium removal from high-level tank waste. Efforts focus on novel solvent-extraction systems containing calixcrown extractants designed for enhanced cesium binding and release. Exciting results are being obtained in three areas: (1) a new lipophilic cesium extractant with a high solubility in the solvent; (2) new proton-ionizable calixcrowns that both strongly extract cesium and ''switch off'' when protonated; and (3) an improved solvent system that may be stripped with more than 100-fold greater efficiency. Scientific questions primarily concern how to more effectively reverse extraction, focusing on the use of amino groups and proton-ionizable groups to enable pH-switching. Synthesis is being performed at ORNL (amino calixcrowns) and TTU (proton-ionizable calixcrowns). At ORNL, the extraction behavior is being surveyed to assess the effectiveness of candidate solvent systems, and systematic distribution measurements are under way to obtain a thermodynamic understanding of partitioning and complexation equilibria. Crystal structures obtained at ORNL are revealing the structural details of cesium binding. The overall objective is a significant advance in the predictability and efficiency of cesium extraction from high-level waste in support of potential implementation at U. S. Department of Energy (USDOE) sites.

  11. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Chien-Chih [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Liu, Ren-Shyan [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, National PET/Cyclotron Center, Taipei (China); National Yang-Ming University, Department of Biomedical Imaging and Radiological Sciences, Taipei (China); Yang, An-Hang [Taipei Veterans General Hospital, Department of Pathology and Laboratory Medicine, Taipei (China); National Yang-Ming University, Department of Pathology, School of Medicine, Taipei (China); Liu, Ching-Sheng [National Yang-Ming University Medical School, Department of Nuclear Medicine, School of Medicine, Taipei (China); Chi, Chin-Wen [National Yang-Ming University, Institute of Pharmacology, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China); Tseng, Ling-Ming [National Yang Ming University, Institute of Clinical Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Tsai, Yi-Fan [Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Ho, Jennifer H. [Taipei Medical University, Graduate Institute of Clinical Medicine, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Department of Ophthalmology, Taipei (China); Taipei Medical University-Wan Fang Medical Center, Center for Stem Cell Research, Taipei (China); Lee, Chen-Hsen [NRPGM, Molecular and Genetic Imaging Core, Taipei (China); National Yang-Ming University, School of Medicine, Taipei (China); Taipei Veterans General Hospital, Department of Surgery, Taipei (China); Lee, Oscar K. [Taipei Veterans General Hospital, Department of Orthopedics, Taipei (China); National Yang-Ming University, Stem Cell Research Center, Taipei (China); Taipei Veterans General Hospital, Department of Medical Research and Education, Taipei (China)

    2013-01-15

    {sup 131}I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133{sup +} cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133{sup +} cells and higher radioresistance. After {gamma}-irradiation of the cells, the CD133{sup +} population was enriched due to the higher apoptotic rate of CD133{sup -} cells. In vivo {sup 131}I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133{sup +} cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133{sup +} cells. (orig.)

  12. CD133-expressing thyroid cancer cells are undifferentiated, radioresistant and survive radioiodide therapy

    International Nuclear Information System (INIS)

    131I therapy is regularly used following surgery as a part of thyroid cancer management. Despite an overall relatively good prognosis, recurrent or metastatic thyroid cancer is not rare. CD133-expressing cells have been shown to mark thyroid cancer stem cells that possess the characteristics of stem cells and have the ability to initiate tumours. However, no studies have addressed the influence of CD133-expressing cells on radioiodide therapy of the thyroid cancer. The aim of this study was to investigate whether CD133+ cells contribute to the radioresistance of thyroid cancer and thus potentiate future recurrence and metastasis. Thyroid cancer cell lines were analysed for CD133 expression, radiosensitivity and gene expression. The anaplastic thyroid cancer cell line ARO showed a higher percentage of CD133+ cells and higher radioresistance. After γ-irradiation of the cells, the CD133+ population was enriched due to the higher apoptotic rate of CD133- cells. In vivo 131I treatment of ARO tumour resulted in an elevated expression of CD133, Oct4, Nanog, Lin28 and Glut1 genes. After isolation, CD133+ cells exhibited higher radioresistance and higher expression of Oct4, Nanog, Sox2, Lin28 and Glut1 in the cell line or primarily cultured papillary thyroid cancer cells, and lower expression of various thyroid-specific genes, namely NIS, Tg, TPO, TSHR, TTF1 and Pax8. This study demonstrates the existence of CD133-expressing thyroid cancer cells which show a higher radioresistance and are in an undifferentiated status. These cells possess a greater potential to survive radiotherapy and may contribute to the recurrence of thyroid cancer. A future therapeutic approach for radioresistant thyroid cancer may focus on the selective eradication of CD133+ cells. (orig.)

  13. The beta strength function structure in \\beta + decay of lutecium, thulium and cesium isotopes

    CERN Document Server

    Alkhazov, G D; Naumov, Yu V; Orlov, S Yu; Vitman, V D

    1981-01-01

    The spectra of total gamma -absorption in the decays of some lutetium, thulium and cesium isotopes have been measured. The probabilities for level population in the decay of the isotopes have been determined. The deduced beta strength functions reveal pronounced structure. Calculations of the strength functions using the Saxon-Woods potential and the residual Gamow-Teller interaction are presented. It is shown that in beta /sup +/ decay of light thulium and cesium isotopes the strength function comprises more than 70% of the Gamow-Teller excitations with mu /sub tau /=+1. This result is the first direct observation of the Gamov-Teller resonance in beta /sup +/ decay of nuclei with T/sub z/>0. (21 refs).

  14. Light storage via coherent population oscillation in a thermal cesium vapor

    CERN Document Server

    de Almeida, A J F; Maynard, M -A; Laupretre, T; Bretenaker, F; Felinto, D; Goldfarb, F; Tabosa, J W R

    2014-01-01

    We report on the storage of light via the phenomenon of Coherent Population Oscillation (CPO) in an atomic cesium vapor at room temperature. In the experiment the optical information of a probe field is stored in the CPO of two ground states of a Lambda three-level system formed by the Zeeman sublevels of the hyperfine transition F = 3 - F' = 2 of cesium D2 line. We show directly that this CPO based memory is very insensitive to stray magnetic field inhomogeneities and presents a lifetime which is mainly limited only by atomic motion. A theoretical simulation of the measured spectra was also developed and is in very good agreement with the experiment.

  15. Leaching Study in Immobilization of Cesium and Cobalt Radionuclides In Fly Ash- Zeolite Cement

    International Nuclear Information System (INIS)

    Fly ash-zeolite cement was synthesized from industrial by-product fly ash obtained from the thermal electric power station. The synthesis process is based on the hydrothermal-calcination-route of the fly ash. The microstructure of fly ash-zeolite cement was characterized by X-ray diffraction, FT infrared spectroscopy and surface area (F-N2). The efficiency of innovative matrices for immobilizing cesium and cobalt radionuclides is presented in this work. The aim of the present study is to investigate the possibility of solidifying 137Cs and 60Co radionuclides in synthetic fly ash zeolite cement. Leaching behavior of the radionuclides have been studied. The leachability index measured indicated that fly ash zeolite cement matrix can be utilized as an efficient material for immobilizing cesium and cobalt radionuclides than portland cement.

  16. Static and dynamic experiments for the retention of cesium in nitrate containing, nitric acid solutions

    International Nuclear Information System (INIS)

    The separation of cesium from medium active waste (MAW) of the Purex-Process by chromatographic methods is demonstrated using the inorganic ion exchanger ammoniummolybdatophosphate (AMP-1). Other inorganic exchangers like ammoniumhexacyanocobaltousferrate (NCFC), zirkoniumphosphate (ZPH) and antimonypentoxid (HAP) have shown for different pH-values a reasonable retention for cesium (NCFC (pH 12) : 35 g Cs/kgNCFC, ZPH(pH 7) : 100 g Cs/kgZPH and HAP (pH 2) : 55 g Cs/kgHAP). But with a high salt loading (300 g/l NaNO3) a loss of capacities occurs which does not allow the use of these exchangers, whereas AMP-1 is useful from a pH of 9 to conc. HNO3 with this high salt loadings with a capacity of 60 g Cs/kg AMP-1. (orig.)

  17. Kelvin probe studies of cesium telluride photocathode for the AWA photoinjector

    Energy Technology Data Exchange (ETDEWEB)

    Velazquez, D.; Wisniewski, E. E.; Yusof, Z.; Harkay, K.; Spentzouris, L.; Terry, J. [Physics Department at Illinois Institute of Technology, Chicago, IL 60616 and High Energy Physics Division at Argonne National Laboratory, Lemont, IL 60439 (United States); High Energy Physics Division at Argonne National Laboratory, Lemont, IL 60439 (United States); Accelerator Science Division at Argonne National Laboratory, Lemont, IL 60439 (United States); Physics Department at Illinois Institute of Technology, Chicago, IL 60616 (United States)

    2012-12-21

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (> 1%), is robust in a photoinjector, and long lifetime. This photocathode is fabricated in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch ({approx}50 nC) in a long bunch train. We present some results from a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV light exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating.

  18. Strontium-90 and cesium-137 in soil from May 1984 to July 1984

    International Nuclear Information System (INIS)

    Strontium-90 and cesium-137 in soil measured throughout Japan from May to July 1984 are given in pCi/kg and mCi/km2. Sampling points are total of 8 from Kawabe-gun (Akita) to Ibasuki-gun (Kagoshima). Collection and pretreatment of samples, preparation of samples for analysis, separation of strontium-90 and cesium-137, determination of stable strontium, calcium and potassium, and counting are described. Soil was collected from the location in the spacious and flat area without past disturbance on the surface. Soil was taken from two layers of different depths, 0 aproximately 5 cm and 5 approximately 20 cm. After the radiochemical separation, the mounted precipitates were counted for activity using low background beta counters normally for 60 minutes. (Mori, K.)

  19. Characterization of cesium uptake mediated by a potassium transport system of bacteria in a soil conditioner

    International Nuclear Information System (INIS)

    We found that bacteria in a commercial soil conditioner sold in Ishinomaki, Miyagi, exhibited concentrative and saturable cesium ion (Cs+) uptake in the natural range of pH and temperature. The concentration of intracellular Cs+ could be condensed at least a few times higher compared with the outside medium of the cells. This uptake appeared to be mediated by a K+ transport system, since Cs+ uptake was dose-dependently inhibited by potassium ion (K+). Eadie-Hofstee plot analysis indicated that the Cs+ uptake involved a single saturable process. The maximum uptake amount (Jmax) was the same in the presence and absence of K+, suggesting that Cs+ and K+ uptakes were competitive with respect to each other. These bacteria might be useful for bioremediation of cesium-contaminated soil. (author)

  20. Low Level Gamma Spectroscopy Measurements of Radium and Cesium in Lucerne (Medicago Sativa)

    Science.gov (United States)

    Fokapić, S.; Bikit, I.; Mrđa, D.; Vesković, M.; Slivka, J.; Mihaljev, Ž.; Ćupić, Ž.

    2007-04-01

    Nineteen years after Chernobyl nuclear accident, activity concentration of 137Cs still could be detected in food and soil samples in Central and Eastern Europe. In this paper radiation levels of radium and cesium in Lucerne will be presented. It is a perennial plant with a deep root system and it is widely grown throughout the world as forage for cattle. The samples of Lucerne were taken from twelve different locations in Vojvodina in the summer period July-September 2004. The samples were specially dried on the air and after that ground, powdered and mineralized by method of dry burning on the temperature of 450°C. Gamma spectrometry measurements of the ash were performed by means of actively shielded germanium detector with maximal background reduction. For cesium 137Cs 10 mBq/kg order of magnitude detection limits were achieved.

  1. Determination of modelling parameter in the fluctuation and migration of Cesium in soils

    International Nuclear Information System (INIS)

    Cesium radionuclide is one of fission products with high level activity and long life, of about 30 years, therefore it is used as an indicator of a fission product released from a nuclear reactor or a radioactive waste storage. The migration process of cesium in soil is influent by physical and chemical properties of soil and environment in which the sorption process occurred. The data of the physical and chemical properties and the radionuclide retardation in such area are needed for the study of mathematical models of radionuclide migration. The experiment has been performed in laboratory by using soils with particle sizes of -4 - 4.48x10-2 cm/second; the longitudinal dispersivity 0.030 - 0.241 cm; the coefficient of longitudinal dispersion was 4.96x10-5 - 7.69x10-3 cm2/second and retardation factor was 2.30 - 3.39

  2. Chemical treatment of aqueous radioactive Cesium-137 waste using Ferri Chloride

    International Nuclear Information System (INIS)

    Ferric Chloride 6H2O was used for treatment of liquid radioactive wastes containing Cesium-137. Various concentration of ferric chloride 6H2O have been added into the waste at different pH and speed of stirrer. The treatment was based on the coagulans-flocculation and coprecipitation mechanisms. The best result of this experiment was achieved by adding 300 ppm of Ferric chloride 6 H2O into liquid waste on following condition the rate Stirrer was 250 rpm. At this condition, it was found that the separation efficiency and the decontamination factor were 83.32 % and 5.99. The activity of decreasing of aqueous radioactive Cesium-137 waste was 2.10 x 10-4 Ci/l to 3.50 x 10-5 Ci/l

  3. Spectroscopic approach for an electron EDM measurement using neutral cesium atoms

    Science.gov (United States)

    Zhu, Kunyan; Solmeyer, Neal; Weiss, David S.

    2012-06-01

    Observation of a permanent electric dipole moment of the electron (eEDM) would imply CP violating effects not contained in the Standard Model. We describe the state preparation and spectroscopy that will be used to measure the eEDM. Cesium atoms are guided into a measurement chamber, where they are laser-cooled and trapped in a pair of parallel one-dimensional optical lattices. The lattices thread three specially coated glass electric field plates. The measurement chamber is surrounded by a four layer magnetic shield inside of which eight magnetic field coils control the bias and gradient magnetic fields. A series of microwave and low frequency magnetic field pulses transfer the atoms into a superposition state that is sensitive to the eEDM signal. A measurement of the eEDM using neutral cesium atoms can obtain an ultimate shot noise limit of 3x10-30 e-cm.

  4. Adsorption of uranium, cesium and strontium onto coconut shell activated carbon

    International Nuclear Information System (INIS)

    The adsorption of uranium (VI), cesium and strontium ions from aqueous solutions onto a commercial activated carbon obtained by physical activation of coconut shell has been studied in batch systems. In particular the adsorption of uranium, studied as a function of contact time and metal ion concentration, followed pseudo-first-order kinetics. Equilibrium adsorption data were fitted by Langmuir and Freundlich isotherm models and the maximum adsorption capacity of the activated carbon resulted to be 55.32 mg/g. The study showed that the considered activated carbon could be successfully used for uranium adsorption from aqueous solutions. Feasibility of cesium and strontium adsorption onto the same activated carbon has been also investigated. Results showed that no affinities with both of these ions exist. (author)

  5. Stark spectra of Rydberg states in atomic cesium in the vicinity of n=18

    Institute of Scientific and Technical Information of China (English)

    Dong Hui-Jie; Wang Ting; Li Chang-Yong; Zhao Jian-Ming; Zhang Lin-Jie

    2013-01-01

    The Stark structures in a cesium atom around n =18 are numerically calculated.The results show that the components of 20D states with a small azimuthal quantum number |m| shift upward a lot,and those with a large |m| shift downward a little within 1100 V/cm.All components of P states shift downward.Experimental work has been performed in ultracold atomic cesium.Atoms initially in 6P3/2 state are excited to high-n Rydberg states by a polarization light perpendicular to the field,and Stark spectra with 丨m丨=1/2,3/2,5/2 are simultaneously observed with a large linewidth for the first time.The observed spectra are analyzed in detail.The relative transition probability is calculated.The experimental results are in good agreement with our numerical computation.

  6. Mössbauer study on the gamma radiolysis of anhydrous cesium tris (oxalato) ferrate(III)

    Science.gov (United States)

    Ladriere, J.; Senterre, V.; Apers, D.

    1992-04-01

    The final product of the gamma radiolysis of anhydrous cesium tris(oxalato) ferrate(III) has been identified by Mössbauer spectroscopy as Cs2Fe(ox)2. The radiolytic decomposition proceeds as a first-order process due to the original compound depletion and to the radiolytic stability of the ferrous compound. Lamb-Mössbauer factors measurements indicate that the recoilless fractions of the iron species are practically unaffected by the radiolysis.

  7. Spatial variability and the fate of cesium in coastal sediments near Fukushima, Japan

    Directory of Open Access Journals (Sweden)

    E. Black

    2014-05-01

    Full Text Available Quantifying the amount of cesium incorporated into marine sediments as a result of the Fukushima Dai-ichi Nuclear Power Plant (FDNPP accident has proven challenging due to the limited multi-core sampling from within the 30 km zone around the facility, the inherent spatial heterogeneities in ocean sediments, and the potential for inventory fluctuations due to physical, biological, and chemical processes. Using 210Pb, 234Th, 137Cs, and 134Cs profiles from 20 sediment cores, coastal sediment inventories were reevaluated. A minimum 137Cs sediment inventory of 100 ± 50 TBq was found for an area of 55 000 km2 using cores from this study and a total of 130 ± 60 TBq using an additional 181 samples. These inventories represent less than 1% of the estimated 15–30 PBq of cesium released during the FDNPP disaster and constitute ~ 90% of the total coastal inventory of 137Cs remaining in 2012. The time needed for surface sediment activities (0 to 3 cm at the 20 locations to reduce by 50% via bioturbation was estimated to range from 0.4 to 26 years, indicating a much greater persistence of cesium in the sediments relative to coastal water activities. However, due to the observed variability in mixing rates, grain size, and inventories, additional cores are needed to further improve estimates and capture the full extent of cesium penetration into the shallow coastal sediments, which was deeper than 14 cm for all cores retrieved from water depths less than 150 m.

  8. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    OpenAIRE

    Hu, Baiyang; Fugetsu, Bunshi; Yu, Hongwen; Abe, Yoshiteru

    2012-01-01

    We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/P...

  9. The effects of different factors at the cesium 137 accumulation by tree plants

    International Nuclear Information System (INIS)

    It was shown that cesium 137 accumulation by tree plants depended from numerous factors that had to be take into account by utilisation of forest production and conducting of forestry in the whole. It is necessary to elaborate a new classification of contaminated forests which could take into account not only radionuclide density of soils but existence of different tree species and their growth conditions

  10. Evaporative cooling of cesium atoms in the gravito-optical surface trap

    CERN Document Server

    Hammes, M; Grimm, R

    2000-01-01

    We report on cooling of an atomic cesium gas closely above an evanescent-wave. Our first evaporation experiments show a temperature reduction from 10muK down to 300nK along with a gain in phase-space density of almost two orders of magnitude. In a series of measurements of heating and spin depolarization an incoherent background of resonant photons in the evanescent-wave diode laser light was found to be the limiting factor at this stage.

  11. Quantized atomic motion in 1D cesium molasses with magnetic field

    International Nuclear Information System (INIS)

    We report the observation of quantized energy levels for the motion of cesium atoms in optical molasses consisting two counterpropagating σ+ beams and a small transverse magnetic field. The observation of overtones proves the existence of at least four bound states in each optical potential well. The absorption spectrum is dramatically modified when an additional longitudinal magnetic field is applied. In particular, a population inversion between quantized levels is observed. (orig.)

  12. Development of an Advanced Polymeric Composite (ALIX) for separation of cesium from nuclear waste

    International Nuclear Information System (INIS)

    137Cs is one of the major isotopes present in high level radioactive waste (HLW). Its presence makes nuclear waste handling difficult. A new composite (ALIX) containing Ammonium molybdophosphate and a derivative of Bisphenol was developed for column operations to selectively remove cesium from acidic high level nuclear waste. The composite is stable in nitric acid, radiation field and exhibits fast kinetics for uptake. The properties of the composite are attributed to molecular structure of the polymer and morphology of the composite. (author)

  13. Prussian blue as an antidote for radioactive thallium and cesium poisoning

    Directory of Open Access Journals (Sweden)

    Altagracia-Martinez M

    2012-06-01

    Full Text Available Marina Altagracia-Martínez, Jaime Kravzov-Jinich, Juan Manuel Martínez-Núñez, Camilo Ríos-Castañeda, Francisco López-NaranjoDepartments of Biological Systems and Health Care, Biological and Health Sciences Division, Universidad Autónoma Metropolitana-Xochimilco, Mexico DF, MexicoBackground: Following the attacks on the US on September 11, 2001, potentially millions of people might experience contamination from radioactive metals. However, before the specter of such accidents arose, Prussian blue was known only as an investigational agent for accidental thallium and cesium poisoning. The purpose of this review is to update the state of the art concerning use of Prussian blue as an effective and safe drug against possible bioterrorism attacks and to disseminate medical information in order to contribute to the production of Prussian blue as a biodefense drug.Methods: We compiled articles from a systematic review conducted from January 1, 1960 to March 30, 2011. The electronic databases consulted were Medline, PubMed, the Cochrane Library, and Scopus.Results: Prussian blue is effective and safe for use against radioactive intoxications involving cesium-137 and thallium. The US Food and Drug Administration has approved Prussian blue as a drug, but there is only one manufacturer providing Prussian blue to the US. Based on the evidence, Prussian blue is effective for use against radioactive intoxications involving cesium-137 and thallium, but additional clinical research on and production of Prussian blue are needed.Keywords: Prussian blue, radioactive cesium, thallium, intoxication, biodefense drug

  14. Laser-pumped cesium magnetometers for high-resolution medical and fundamental research

    OpenAIRE

    Groeger, Stephan; Bison, Georg; Knowles, Paul E.; Wynands, Robert; Weis, Antoine

    2007-01-01

    Laser-pumped cesium magnetometers allow highly sensitive magnetometry at room temperature. We report on applications of that technique in biomagnetic diagnostics and in a neutron electric dipole moment (nEDM) experiment. In the biomagnetic application the magnetic field from the beating human heart is detected using a gradiometer, which reaches an intrinsic sensitivity of 80 fT/Hz1/2. The device can record time-resolved magnetic field maps above the human body surface with a spatial resolutio...

  15. Cesium under pressure: First-principles calculation of the bcc-to-fcc phase transition

    Science.gov (United States)

    Carlesi, S.; Franchini, A.; Bortolani, V.; Martinelli, S.

    1999-05-01

    In this paper we present the ab initio calculation of the structural properties of cesium under pressure. The calculation of the total energy is done in the local-density approximation of density-functional theory, using a nonlocal pseudopotential including the nonlinear core corrections proposed by Louie et al. The calculation of the pressure-volume diagram for both bcc and fcc structures allows us to prove that the transition from bcc to fcc structure is a first-order transition.

  16. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  17. 21 CFR 133.136 - Washed curd and soaked curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd and soaked curd cheese. 133.136... Standardized Cheese and Related Products § 133.136 Washed curd and soaked curd cheese. (a) Description. (1) Washed curd, soaked curd cheese is the food prepared by the procedure set forth in paragraph (a)(3)...

  18. Regional ventilation studies with Kr-81m and Xe-133: a comparative analysis

    International Nuclear Information System (INIS)

    Krypton-81m and Xe-133 ventilation scintigrams, and particulate perfusion scintigrams with Tc-99m, were obtained on the same day in 41 patients. Of 14 studies demonstrating pulmonary embolism, Kr-81m complemented the perfusion study better than Xe-133 in seven and was judged essential for that diagnosis in two. Xenon-133 was better in none. On the other hand, in 29 studies with obstructive or parenchymal lung disease, Kr-81m was essential for the diagnosis in only one of seven cases in which it was judged superior to Xe-133, whereas Xe-133 was essential in six of nine studies in which it was judged superior. Ventilation scintigraphy with Kr-81m offers important advantages over Xe-133 in the diagnosis of embolic lung disease due to its improved spatial resolution and capacity to provide superimposable ventilation and perfusion images in multiple projections, so that defects can be accurately matched. Obstructive pulmonary disease may be more easily diagnosed with Xe-133 ventilation images, because areas of gaseous retention, not visible with Kr-81m, can be seen on Xe-133 washout images

  19. 19 CFR 133.36 - Change in name of owner of recorded copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Change in name of owner of recorded copyright. 133...; DEPARTMENT OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.36 Change in name of owner of recorded copyright. If there is a change in the name of the owner of a...

  20. 19 CFR 133.35 - Change of ownership of recorded copyright.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Change of ownership of recorded copyright. 133.35...; DEPARTMENT OF THE TREASURY TRADEMARKS, TRADE NAMES, AND COPYRIGHTS Recordation of Copyrights § 133.35 Change of ownership of recorded copyright. (a) Application. If the ownership of a recorded copyright...

  1. CD133 identifies perivascular niches in grade II-IV astrocytomas

    DEFF Research Database (Denmark)

    Christensen, Karina; Schrøder, Henrik; Kristensen, Bjarne

    2008-01-01

    expression of CD133 in paraffin sections was analysed using morphometry. In all grades, CD133 was expressed on tumour and endothelial cells. Tumour cells were found in perivascular niches, as dispersed single cells and in pseudopalisade formations around necrosis. There was no correlation between the mean...

  2. 42 CFR 422.133 - Return to home skilled nursing facility.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Return to home skilled nursing facility. 422.133....133 Return to home skilled nursing facility. (a) General rule. MA plans must provide coverage of posthospital extended care services to Medicare enrollees through a home skilled nursing facility if...

  3. Compensation for geometric changes during monitoring of 133Xe washout from subcutaneous adipose tissue

    DEFF Research Database (Denmark)

    Bülow, J; Madsen, J

    1975-01-01

    A method is described for automatic compensation of changes in geometry during monitoring of 133Xe-washout curves from subcutaneous depots. A 99mTc source is placed on the skin over the 133Xe depot, and both isotopes are counted simultaneously. Variations in the 99mTc activity (corrected for radi...

  4. 21 CFR 133.170 - Pasteurized process cheese with fruits, vegetables, or meats.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese with fruits, vegetables, or meats. 133.170 Section 133.170 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH... dried vegetable; any properly prepared cooked or canned meat. (3) When the added fruits, vegetables,...

  5. 21 CFR 133.168 - Pasteurized blended cheese with fruits, vegetables, or meats.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized blended cheese with fruits, vegetables, or meats. 133.168 Section 133.168 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH... vegetable; any properly prepared cooked or canned meat. (3) When the added fruits, vegetables, or...

  6. 21 CFR 133.161 - Muenster and munster cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster...

  7. Photoemission from Graphene on Copper and Cesium Antimonide: Theory and Experiment

    Science.gov (United States)

    Finkenstadt, Daniel; Jensen, Kevin L.; Lambrakos, Samuel G.; Shabaev, Andrew; Moody, Nathan A.

    The work function is calculated using DFT for a substrate of flat copper on which a single layer of graphene is deposited. These calculations show a reduced work function, compared to bare copper, when graphene is deposited on a cathode. Based on our DFT-calculated results, a simple model using the transfer matrix approach gives the transmission probability near and above the barrier maximum. An important element of our model is the DFT-calculated, macroscopically-averaged electrostatic potential. Using this potential, graphene behaves as a resonant well for electrons transmitted between the substrate and vacuum regions. Another system to be discussed is graphene atop cesium antimonide, which has very low work function making it technologically useful, in particular for the development of an x-ray free electron laser. On cesium antimonide, we examine whether graphene may allow for the retention of an underlying cesium layer that is often damaged in high-field applications. A discussion of these results in light of recent experimental characterization at LANL will be given. Funding and support provide by ONR and DOE.

  8. Uptake and transport of radioactive cesium and strontium into grapevines after leaf contamination

    Science.gov (United States)

    Zehnder, H. J.; Kopp, P.; Eikenberg, J.; Feller, U.; Oertli, J. J.

    1995-07-01

    From 1989 to 1993 the foliar uptake of radioactive strontium (Sr-85) and cesium (Cs-134) by selected leaves of grapevine plants and the subsequent redistribution within the plants was examined under controlled conditions in a greenhouse. The radionuclides were applied as chlorides. These plants were grown in large pots containing a mixture of local soil and peat. Plant and soil samples were analyzed throughout the growing season and also during the following vegetation period. Only traces of the applied radiostrontium were taken up by the leaves. This element was essentially not redistributed within the plants. In contrast, radiocesium was easily taken up through the leaf surface, transported to other plant parts and to some extent released from the roots into the soil. Cesium reaching the soil may interact with clay particles causing a very reduced availability for plants. Therefore the soil may act as a long-term sink for radiocesium. On the other hand, grape berries represent transient sinks. The cesium levels in the berries decreased again in a late phase of maturation, but the mechanisms causing this loss are not yet identified. During the second vegetation period, only a very minor proportion of the radiocesium taken up previously by the plants was present in the above ground parts.

  9. Strontium-90 and cesium-137 in soil from May to July 1983

    International Nuclear Information System (INIS)

    The measured values in soil of strontium-90 and cesium-137 at a total of 4 locations throughout Japan from May to July, 1983 are given in pCi/kg and mCi/km2 in the tables. The method of measurement is also described: collection and pretreatment of samples, preparation of the samples for analysis, separation of strontium-90 and cesium-137, determination of stable strontium, calcium and potassium, and counting. Soil was collected from the location in the spacious and flat area without any past disturbance. Soil was taken from two layers having different depths: 0--5 cm and 5--20 cm. The sample solution was neutralized with sodium hydroxide. After sodium carbonate was added, the precipitate of strontium and calcium carbonates was separated. The supernatant solution was retained for cesium-137 determination. After the radiochemical separation, the mounted precipitates were counted for activity using a low background beta counter normally for 60 min. The maximum values were 690 pCi/kg for Sr-90 and 1300 pCi/kg for Cs-137, which were obtained from the samples in the 5-to-20 cm depth, in June 1983, at Akita-ken,Japan. (Mori, K.)

  10. Enhanced capacity and stability for the separation of cesium in electrically switched ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Tawfic, A.F.; Dickson, S.E.; Kim, Y. [McMaster University, Hamilton, ON (Canada); Mekky, W. [AMEC NSS, Power and Process America, Toronto (Canada)

    2015-03-15

    Electrically switched ion exchange (ESIX) can be used to separate ionic contaminants from industrial wastewater, including that generated by the nuclear industry. The ESIX method involves sequential application of reduction and oxidation potentials to an ion exchange film to induce the respective loading and unloading of cesium. This technology is superior to conventional methods (e.g electrodialysis reversal or reverse osmosis) as it requires very little energy for ionic separation. In previous studies, ESIX films have demonstrated relatively low ion exchange capacities and limited film stabilities over repeated potential applications. In this study, the methodology for the deposition of electro-active films (nickel hexacyanoferrate) on nickel electrodes was modified to improve the ion exchange capacity for cesium removal using ESIX. Cyclic voltammetry was used to investigate the ion exchange capacity and stability. Scanning electron microscopy (SEM) was used to characterize the modified film surfaces. Additionally, the films were examined for the separation of cesium ions. This modified film preparation technique enhanced the ion exchange capacity and improves the film stability compared to previous methods for the deposition of ESIX films. (authors)

  11. Kinetic and equilibrium studies of cesium adsorption on ceiling tiles from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Miah, Muhammed Yusuf [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Department of Applied Chemistry and Chemical Technology, Noakhali Science and Technology University (Bangladesh); Volchek, Konstantin, E-mail: Konstantin.Volchek@ec.gc.ca [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Kuang, Wenxing [SAIC Canada, 335 River Road, Ottawa, Ontario, K1A 0H3 (Canada); Tezel, F. Handan [Department of Chemical and Biological Engineering, University of Ottawa, 161 Louis-Pasteur, Ottawa, Ontario, K1N 6N5 (Canada)

    2010-11-15

    A series of experiments were performed to quantify the adsorption of cesium on ceiling tiles as a representative of urban construction materials. Adsorption was carried out from solutions to mimic wet environmental conditions. Non-radioactive cesium chloride was used as a surrogate of the radioactive {sup 137}Cs. The experiments were performed in the range of initial cesium concentrations of 0.114-23.9 mg L{sup -1} at room temperature (21 deg. C) around three weeks. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectrometry (ICP-MS). The quantity of adsorbed Cs was calculated by mass balance as a function of time. Two kinetic and three equilibrium models were employed to interpret the test results. Determination of kinetic parameters for adsorption was carried out using the first-order reaction model and the intra-particle diffusion model. Adsorption equilibrium was studied using Langmuir, Freundlich and three-parameter Langmuir-Freundlich adsorption isotherm models. A satisfactory correlation between the experimental and the predicted values was observed.

  12. Derivation of cesium-137 residual radioactive material guidelines for the Peek Street site, Schenectady, New York

    Energy Technology Data Exchange (ETDEWEB)

    Jones, L.; Nimmagadda, M.; Yu, C.

    1992-01-01

    Residual radioactive material guidelines for cesium-137 were derived for the Peek rk. The derivation was based on the requirement that the Street site in Schenectady, New York. The derivation was based on the requirement that the 50-year committed effective dose equivalent to a hypothetical individual who lives or works in the immediate vicinity of the Peek Street site should not exceed a dose of 100 mrem/yr following remedial action. The US Department of Energy (DOE) residual radioactive material guideline computer code, RESRAD was used in this evaluation. Three potential scenarios were considered for the site on the assumption that for a period of 1,000 years following remedial action, the site wig be utilized without radiological restrictions. The scenarios vary with regard to use of the site, time spent at the site, and sources of food consumed. Results indicate that the basic dose limit of 100 mrem/yr will not be exceeded for cesium-137 within 1,000 years, provided that the soil concentration of cesium-137 at the Peek Street site does not exceed the following levels: 98 pCi/g for Scenario A (industrial worker: the expected scenario), 240 pCi/g for Scenario B (recreationist: a plausible scenario), and 34 pCi/g for Scenario C (resident farmer ingesting food produced in the decontaminated area: a plausible scenario).

  13. Cesium and strontium tolerant Arthrobacter sp. strain KMSZP6 isolated from a pristine uranium ore deposit.

    Science.gov (United States)

    Swer, Pynskhem Bok; Joshi, Santa Ram; Acharya, Celin

    2016-12-01

    Arthrobacter sp. KMSZP6 isolated from a pristine uranium ore deposit at Domiasiat located in North-East India exhibited noteworthy tolerance for cesium (Cs) and strontium (Sr). The strain displayed a high minimum inhibitory concentration (MIC) of 400 mM for CsCl and for SrCl2. Flow cytometric analysis employing membrane integrity indicators like propidium iodide (PI) and thiazole orange (TO) indicated a greater sensitivity of Arthrobacter cells to cesium than to strontium. On being challenged with 75 mM of Cs, the cells sequestered 9612 mg Cs g(-1) dry weight of cells in 12 h. On being challenged with 75 mM of Sr, the cells sequestered 9989 mg Sr g(-1) dry weight of cells in 18 h. Heat killed cells exhibited limited Cs and Sr binding as compared to live cells highlighting the importance of cell viability for optimal binding. The association of the metals with Arthrobacter sp. KMSZP6 was further substantiated by Field Emission-Scanning Electron Microscopy (FE-SEM) coupled with Energy dispersive X-ray (EDX) spectroscopy. This organism tolerated up to 1 kGy (60)Co-gamma rays without loss of survival. The present report highlights the superior tolerance and binding capacity of the KMSZP6 strain for cesium and strontium over other earlier reported strains and reveals its potential for bioremediation of nuclear waste. PMID:27620733

  14. Study on magnetic separation for decontamination of cesium contaminated soil by using superconducting magnet

    International Nuclear Information System (INIS)

    Highlights: • The method for the soil decontamination by the superconducting magnet is proposed. • Magnetic separation of clay minerals was performed by HGMS. • Soil separation ratio was evaluated by quantitative analysis using XRD. • It is expected that HGMS can be applied to the actual soil decontamination. - Abstract: The accident of Fukushima Daiichi nuclear power plant caused the diffusion of radioactive cesium over the wide area. We examined the possibility of applying magnetic separation method using the superconducting magnet, which can process a large amount of the soil in high speed, to the soil decontamination and volume reduction of the radioactive cesium contaminated soil. Clay minerals are classified as 2:1 and 1:1 types by the difference of their layer structures, and these types of minerals are respectively paramagnetic and diamagnetic including some exception. It is known that most of the radioactive cesium is strongly adsorbed on the clay, especially on 2:1 type clay minerals. It is expected that the method which can separate only 2:1 type clay minerals selectively from the mixture clay minerals can enormously contribute to the volume reduction of the contaminated soil. In this study, the components in the clay before and after separation were evaluated to estimate the magnetic separation efficiency by using X-ray diffraction. From the results, the decontamination efficiency and the volume reduction ratio were estimated in order to examine the appropriate separation conditions for the practical decontamination of the soil

  15. ION EXCHANGE MODELING FOR REMOVAL OF CESIUM FROM HANFORD WASTE USING SUPERLIG 644 RESIN

    Energy Technology Data Exchange (ETDEWEB)

    Hamm, L

    2004-05-01

    The expected performance of a proposed ion exchange column using SuperLig{reg_sign} 644 resin for the removal of cesium from Hanford high level radioactive alkaline waste is discussed. This report represents a final report on the ability and knowledge with regard to modeling the Cesium-SuperLig{reg_sign} 644 resin ion exchange system. Only the loading phase of the cycle process is addressed within this report. Pertinent bench-scale column tests and batch equilibrium experiments are addressed. The methodology employed and sensitivity analyses are also included (i.e., existing methodology employed is referenced to prior developmental efforts while updated methodology is discussed). Pilot-scale testing is not assessed since no pilot-scale testing was available at the time of this report. Column performance predictions are made considering three selected feed compositions under nominal operating conditions. The sensitivity analyses provided help to identify key parameters that aid in resin procurement acceptance criteria. The methodology and application presented within this report reflect the expected behavior of SuperLig{reg_sign} 644 resin manufactured at the production-scale (i.e, 250 gallon batch size level). The primary objective of this work was, through modeling and verification based on experimental assessments, to predict the cesium removal performance of SuperLig{reg_sign} 644 resin for application in the RPP pretreatment facility.

  16. Derivation of cesium-137 residual radioactive material guidelines for the Peek Street site, Schenectady, New York

    International Nuclear Information System (INIS)

    Residual radioactive material guidelines for cesium-137 were derived for the Peek rk. The derivation was based on the requirement that the Street site in Schenectady, New York. The derivation was based on the requirement that the 50-year committed effective dose equivalent to a hypothetical individual who lives or works in the immediate vicinity of the Peek Street site should not exceed a dose of 100 mrem/yr following remedial action. The US Department of Energy (DOE) residual radioactive material guideline computer code, RESRAD was used in this evaluation. Three potential scenarios were considered for the site on the assumption that for a period of 1,000 years following remedial action, the site wig be utilized without radiological restrictions. The scenarios vary with regard to use of the site, time spent at the site, and sources of food consumed. Results indicate that the basic dose limit of 100 mrem/yr will not be exceeded for cesium-137 within 1,000 years, provided that the soil concentration of cesium-137 at the Peek Street site does not exceed the following levels: 98 pCi/g for Scenario A (industrial worker: the expected scenario), 240 pCi/g for Scenario B (recreationist: a plausible scenario), and 34 pCi/g for Scenario C (resident farmer ingesting food produced in the decontaminated area: a plausible scenario)

  17. Study on magnetic separation for decontamination of cesium contaminated soil by using superconducting magnet

    Energy Technology Data Exchange (ETDEWEB)

    Igarashi, Susumu, E-mail: igarashi@qb.see.eng.osaka-u.ac.jp; Nomura, Naoki; Mishima, Fumihito; Akiyama, Yoko, E-mail: yoko-ak@see.eng.osaka-u.ac.jp

    2014-09-15

    Highlights: • The method for the soil decontamination by the superconducting magnet is proposed. • Magnetic separation of clay minerals was performed by HGMS. • Soil separation ratio was evaluated by quantitative analysis using XRD. • It is expected that HGMS can be applied to the actual soil decontamination. - Abstract: The accident of Fukushima Daiichi nuclear power plant caused the diffusion of radioactive cesium over the wide area. We examined the possibility of applying magnetic separation method using the superconducting magnet, which can process a large amount of the soil in high speed, to the soil decontamination and volume reduction of the radioactive cesium contaminated soil. Clay minerals are classified as 2:1 and 1:1 types by the difference of their layer structures, and these types of minerals are respectively paramagnetic and diamagnetic including some exception. It is known that most of the radioactive cesium is strongly adsorbed on the clay, especially on 2:1 type clay minerals. It is expected that the method which can separate only 2:1 type clay minerals selectively from the mixture clay minerals can enormously contribute to the volume reduction of the contaminated soil. In this study, the components in the clay before and after separation were evaluated to estimate the magnetic separation efficiency by using X-ray diffraction. From the results, the decontamination efficiency and the volume reduction ratio were estimated in order to examine the appropriate separation conditions for the practical decontamination of the soil.

  18. DFB-ridge laser diodes at 894 nm for Cesium atomic clocks

    Science.gov (United States)

    von Bandel, N.; Garcia, M.; Lecomte, M.; Larrue, A.; Robert, Y.; Vinet, E.; Driss, O.; Parrilaud, O.; Krakowski, M.; Gruet, F.; Matthey, R.; Mileti, G.

    2016-02-01

    Time and frequency applications are in need of high accuracy and high stability clocks. Optically pumped compact industrial Cesium atomic clocks are a promising approach that could satisfy these demands. However, the stability of these clocks relies, among others, on the performances of the laser diodes that are used. This issue has led the III-V Lab to commit to the European Euripides-LAMA project that aims to provide competitive compact optical Cesium clocks for ground applications. This work will provide key experience for further space technology qualification. III-V Lab is in charge of the design, fabrication and reliability of Distributed-Feedback diodes (DFB) at 894 nm (D1 line of Cesium) and 852 nm (D2 line). LTF-Unine is in charge of their spectral characterisation. The use of D1 line for pumping will provide simplified clock architecture compared to the D2 line pumping thanks to simpler atomic transitions and a larger spectral separation between lines in the 894 nm case. Also, D1 line pumping overcomes the issue of unpumped "idle states" that occur with D2 line. The modules should provide narrow linewidth (= 10 Hz and 109 Hz2/Hz @ f >= 10 Hz.

  19. ION EXCHANGE MODELING FOR REMOVAL OF CESIUM FROM HANFORD WASTE USING SUPERLIG 644 RESIN

    International Nuclear Information System (INIS)

    The expected performance of a proposed ion exchange column using SuperLig(regsign) 644 resin for the removal of cesium from Hanford high level radioactive alkaline waste is discussed. This report represents a final report on the ability and knowledge with regard to modeling the Cesium-SuperLig(regsign) 644 resin ion exchange system. Only the loading phase of the cycle process is addressed within this report. Pertinent bench-scale column tests and batch equilibrium experiments are addressed. The methodology employed and sensitivity analyses are also included (i.e., existing methodology employed is referenced to prior developmental efforts while updated methodology is discussed). Pilot-scale testing is not assessed since no pilot-scale testing was available at the time of this report. Column performance predictions are made considering three selected feed compositions under nominal operating conditions. The sensitivity analyses provided help to identify key parameters that aid in resin procurement acceptance criteria. The methodology and application presented within this report reflect the expected behavior of SuperLig(regsign) 644 resin manufactured at the production-scale (i.e, 250 gallon batch size level). The primary objective of this work was, through modeling and verification based on experimental assessments, to predict the cesium removal performance of SuperLig(regsign) 644 resin for application in the RPP pretreatment facility

  20. Stationary point of the radiometric control of cesium contamination of agricultural animals

    International Nuclear Information System (INIS)

    Stationary point of the radiometric control of cesium contamination of an agricultural animals. Is intended for vital measurements of the contents of radiocesium in muscular tissue of a cattle. Can be used on cattle-breeding farms, providing points, in meat factories and personal facilities. As a base means for accommodation of the control point the motor-car is used. Design of the car allows to automate operations on deployment of the control point on a place and translation of one to a transport mode. Limits of measured specific activity of cesium contamination of a cattle is up 5*10-9 to 5*10-6 Ci/kg. The basic error on the bottom limit of measurement at confidence coefficient 0,95 is no more than 30%. Measurement time for the bottom limit of determined specific activity is no more than 30 s. There is automatic measurement mode. Type of a power is 220 V, 50 Hz. Range of working temperatures is up -15 to +35 centigrade. Relative humidity is no more than 98% at 25 centigrade. External gamma background is till 0.035 mR/h. Time of installation and dismantle of stationary control point is no more than 1,5 hours. The direct radiometric control in divo allows to fulfil and to use biotechnological process of removing of cesium isotopes from body of animals for decrease of levels of radioactive contamination

  1. Crown bridged thiacalix[4]arenes as cesium-selective ionophores in solvent polymeric membrane electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Bereczki, Robert [Technical Analytical Research Group of the Hungarian Academy of Sciences, Department of General and Analytical Chemistry, Budapest University of Technology and Economics, Szt. Gellert ter 4, H-1111 Budapest (Hungary); Csokai, Viktor [Department of Organic Chemical Technology, Budapest University of Technology and Economics, Muegyetem rkp.3, H-1111 Budapest (Hungary); Gruen, Alajos [Department of Organic Chemical Technology, Budapest University of Technology and Economics, Muegyetem rkp.3, H-1111 Budapest (Hungary); Bitter, Istvan [Department of Organic Chemical Technology, Budapest University of Technology and Economics, Muegyetem rkp.3, H-1111 Budapest (Hungary); Toth, Klara [Technical Analytical Research Group of the Hungarian Academy of Sciences, Department of General and Analytical Chemistry, Budapest University of Technology and Economics, Szt. Gellert ter 4, H-1111 Budapest (Hungary)]. E-mail: ktoth@mail.bme.hu

    2006-05-31

    Novel 1,3-alternate thiacalix[4]mono- and biscrown-6 ethers were studied as ionophores in poly(vinyl chloride) membrane electrodes. Their selectivity behavior was characterized with respect to large number of cations, including potential interferents in environmental samples, and the membrane composition was optimized for cesium ion response. Among the ionophores, 1,3-alternate thiacalix[4]mono(crown-6) ether showed, especially high selectivity for cesium over other alkali-metal ions. Transition and heavy metal ions did not interfere seriously with the electrode response, which indicates that the bridging sulfur atoms do not take part in the ion recognition process. The potentiometric cesium responses of all electrodes involved in this study were found close to Nernstian and the detection limits were lower than 10{sup -7} M. The Cs{sup +}/Na{sup +} selectivity of the different ionophore-based sensors and the solvent extraction ability of the ligands were interpreted based on the respective constants of complex formation.

  2. Temperature and number evolution of cold cesium atoms inside a wall-coated glass cell

    Institute of Scientific and Technical Information of China (English)

    黄家强; 张建伟; 王时光; 王力军

    2015-01-01

    We report an experimental study on the temperature and number evolution of cold cesium atoms diffusively cooled inside a wall-coated glass cell by measuring the absorption profile of the 62S1/2 (F=4)→62P3/2(F0=5) transition line with a weak probe laser in the evolution process. We found that the temperature of the cold atoms first gradually decreases from 16 mK to 9 mK, and then rapidly increases. The number of cold atoms first declines slowly from 2.1 × 109 to 3.7 × 108 and then falls drastically. A theoretical model for the number evolution is built and includes the instantaneous temperature of the cold atoms and a fraction p, which represents the part of cold cesium atoms elastically reflected by the coated cell wall. The theory is overall in good agreement with the experimental result, and a nonzero value is obtained for the fraction p, which indicates that the cold cesium atoms are not all heated to the ambient temperature by a single collision with the coated cell wall. These results can provide helpful insight for precision measurements based on diffuse laser cooling.

  3. Small-Scale Ion Exchange Removal of Cesium and Technetium from Hanford Tank 241-AN-103

    Energy Technology Data Exchange (ETDEWEB)

    Hassan, N.M.

    2000-07-27

    The pretreatment process for BNFL, Inc.'s Hanford River Protection Project is to provide decontaminated low activity waste and concentrated eluate streams for vitrification into low activity and high level waste glass, respectively. The pretreatment includes sludge washing, filtration, precipitation, and ion exchange processes to remove entrained solids, cesium, transuranics, technetium, and strontium. The ion exchange removal of cesium (Cs) and technetium (Tc) ions is accomplished by using SuperLig 644, and 639 resins from IBC Advanced Technologies, American Fork, Utah. The resins were shown to selectively remove cesium and technetium (as pertechnetate), from alkaline salt solutions. The efficiency of ion exchange column loading and elution is a complex function involving feed compositions, equilibrium and kinetic behavior of ion exchange resins, diffusion, and the ionic strength and pH of the aqueous solution. A previous experimental program completed at the Savannah River Technology Center demonstrated the conceptualized flow sheet parameters with a similar Hanford tank sample (241-AW-101). Those experiments included determination of Cs and Tc batch distribution coefficients by SuperLig 644 and 639 resins and demonstration of small-scale column breakthrough and elution. The experimental findings were used in support of preliminary design bases and pretreatment flow sheet development by BNFL, Inc.

  4. Determination of collisional ionization rate and ionization yield from excited levels of cesium in a flame

    International Nuclear Information System (INIS)

    A method is proposed for determining the rate constants of collisional ionization and the ionization yield from excited levels of cesium atoms in a flame, using experimental curves of optical saturation and laser-stimulated ionization of excited atoms. It is shown that deviations of the shape of the saturation curves from ideal shape are due to the time dependence of the trailing edge of the exciting laser pulse. The ionization yield of cesium in an acetylene--air flame during its one-step excitation to the 6p2p1/2 level was 0.95%, rising to 50% for two-step excitation to the 8d2D3/2 level. The corresponding values of the rate constants of collisional ionization were 3.2x105 and 3.3x107 sec-1. From the known value of the ionization yield in the two-step excitation scheme, estimates of the atomization coefficient of cesium in the flame were made. The proposed method can be used for other elements in different flames

  5. Temperature and number evolution of cold cesium atoms inside a glass cell

    CERN Document Server

    Huang, J Q; Wang, S G; Wang, Z B; Wang, L J

    2015-01-01

    We report an experimental study on the temperature and number evolution of the cold cesium atoms diffusively cooled inside a wall-coated glass cell by measuring the absorption profile of the 62S1/2 (F=4)-62P3/2 (F'=5) transition line with a weak probe laser in the evolution process. We found that the temperature of the cold atoms first gradually decreases from 16 mK to 9 mK, and then rapidly increases. A theoretical model of the number evolution is built, which includes the temperature of the cold atoms and the fraction p of the cold cesium atoms elastically reflected by the cell wall. The theoretical model is consistent with the experimental result very well, and the fraction p is obtained to be (0.58 +/- 0.03), which reveals that the cold cesium atoms are not all heated to the ambient temperature by a single collision with the cell wall.

  6. Fire Safety Tests for Cesium-Loaded Spherical Resorcinol Formaldehyde Resin: Data Summary Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Sang; Schweiger, Michael J.; Peterson, Reid A.

    2012-09-01

    A draft safety evaluation of the scenario for spherical resorcinol formaldehyde (SRF) resin fire inside the ion exchange column was performed by the Hanford Tank Waste Treatment and Immobilization Plant (WTP) Fire Safety organization. The result of this draft evaluation suggested a potential change of the fire safety classification for the Cesium Ion Exchange Process System (CXP) emergency elution vessels, equipment, and piping. To resolve this question, the fire properties of the SRF resin were measured by Southwest Research Institute (SwRI) through a subcontract managed by Pacific Northwest National Laboratory (PNNL). The results of initial fire safety tests on the SRF resin were documented in a previous report (WTP-RPT-218). The present report summarizes the results of additional tests performed by SwRI on the cesium-loaded SRF resin. The efforts by PNNL were limited to summarizing the test results provided by SwRI into one consolidated data report. The as-received SwRI report is attached to this report in the Appendix A. Where applicable, the precision and bias of each test method, as given by each American Society for Testing and Materials (ASTM) standard procedure, are included and compared with the SwRI test results of the cesium-loaded SRF resin.

  7. Optically pumped semiconductor lasers: Conception and characterization of a single mode source for Cesium atoms manipulation

    International Nuclear Information System (INIS)

    Lasers currently used in atomic clocks or inertial sensors are suffering from a lack of power, narrow linewidth or compactness for future spatial missions. Optically pumped semiconductor lasers, which combine the approach of classical solid state lasers and the engineering of semiconductor laser, are considered here as a candidate to a metrological laser source dedicated to the manipulation of Cesium atoms in these instruments. These lasers have demonstrated high power laser emission in a circular single transverse mode, as well as single longitudinal mode emission, favoured by the semiconductor structure and the external cavity design. We study the definition and the characterization of a proper semiconductor structure for the cooling and the detection of Cesium atoms at 852 nm. A compact and robust prototype tunable on the Cesium D2 hyperfine structure is built. The laser frequency is locked to an atomic transition thanks to a saturated absorption setup. The emission spectral properties are investigated, with a particular attention to the laser frequency noise and the laser linewidth. Finally, we describe and model the thermal properties of the semiconductor structure, which enables the simulation of the laser power characteristic. The experimental parameters are optimised to obtain the maximum output power with our structure. Thanks to our analysis, we propose several ways to overcome these limitations, by reducing the structure heating. (authors)

  8. Cesium removal demonstration utilizing crystalline silicotitanate sorbent for processing Melton Valley Storage Tank supernate: Final report

    Energy Technology Data Exchange (ETDEWEB)

    Walker, J.F. Jr.; Taylor, P.A.; Cummins, R.L. [and others

    1998-03-01

    This report provides details of the Cesium Removal Demonstration (CsRD), which was conducted at Oak Ridge National Laboratory (ORNL) on radioactive waste from the Melton Valley Storage Tanks. The CsRD was the first large-scale use of state-of-the-art sorbents being developed by private industry for the selective removal of cesium and other radionuclides from liquid wastes stored across the DOE complex. The crystalline silicotitanate sorbent used in the demonstration was chosen because of its effectiveness in laboratory tests using bench-scale columns. The demonstration showed that the cesium could be removed from the supernate and concentrated on a small-volume, solid waste form that would meet the waste acceptance criteria for the Nevada Test Site. During this project, the CsRD system processed > 115,000 L (30,000 gal) of radioactive supernate with minimal operational problems. Sluicing, drying, and remote transportation of the sorbent, which could not be done on a bench scale, were successfully demonstrated. The system was then decontaminated to the extent that it could be contact maintained with the use of localized shielding only. By utilizing a modular, transportable design and placement within existing facilities, the system can be transferred to different sites for reuse. The initial unit has now been removed from the process building and is presently being reinstalled for use in baseline operations at ORNL.

  9. Fabrication of stimuli-sensitive hydrogel for the removal of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hee-Man; Bong, Sang Bum; Park, Chan Woo; Lee, Kune Woo; Seo, Bum-Kyoung; Moon, Jei Kwon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-05-15

    The nuclear accident at the Fukushima Daiichi nuclear power station in 2011 released a huge quantity of radioactive contaminants into the environment.1 Among these, cesium Cs-137 is the most problematic contaminant due to its long half-life (30.2 years), and high-energy gamma ray (γ-ray) emissions. 2 Various surface including road, roof, house, building were contaminated with Cs-137. These coating materials have some problems and limitation such as toxic component, and lack of reusability of materials related to the cost. Thus, a more cost-effective and environmental friendly coating materials is still desired. 3 In the present study, the stimuli-sensitive hydrogel were fabricated for the removal of radioactive Cs from solid surface. We describe the morphology, structure, and physical property of these stimuli sensitive hydrogel. In addition, their ability to eliminate cesium was also evaluated. The smart hydrogel coating materials showed an excellent morphology change from the liquid to film by addition of Ca ion. Therefore, the stimuli-sensitive hydrogel demonstrated good potential for the treatment of contaminated surface for the removal of radioactive cesium.

  10. The effect of organic amendment on mobility of cesium in tropical soils - The effect of organic amendment on sorption mechanisms for cesium and cobalt in tropical soils

    Energy Technology Data Exchange (ETDEWEB)

    Wasserman, M.A.V.; Santos-Oliveira, R. [Instituto de Engenharia nuclear/CNEN. Rua Helio de Almeida, 75. Cidade Universitaria - Ilha do Fundao, Rio de Janeiro, RJ. CEP 21941-906 (Brazil); Garcia, R.J.L.; Ferreira, A.C.M.; Rochedo, E.R.R.; Sobrinho, G.A.N. [Instituto de Radioprotecao e Dosimetria/CNEN. Av. Salvador Allende s /no. Rio de Janeiro, RJ. CEP: 22780-160 (Brazil); Perez, D.V. [Centro Nacional de Pesquisa de Solos/EMBRAPA. R. Jardim Botanico, 1024.Rio de Janeiro, RJ, CEP: 22460-000 (Brazil); Wasserman, J.C. [dUFF Network of Environment and Sustainable Development (REMADS-UFF), University Federal Fluminense, Niteroi, RJ (Brazil)

    2014-07-01

    This work aimed to investigate the mechanisms involved in the sorption of {sup 137}Cs and {sup 60}Co as a function of the physico-chemical properties of some types of Brazilian soils and the changes on the behavior of these radionuclides due to changes in soil properties promoted by organic amendment. The experimental study was conducted in a controlled area, where pots containing different types of soils (Ferralsol, Nitisol and Histosol) and different doses of organic amendment (no amendment; 2 kg.m{sup -2} and 4 kg.m{sup -2}) were spiked with {sup 137}Cs and {sup 60}Co. The organic amendment used in this experiment was obtained in the Unit of Compost of the Organic Material of Pinheiral (RJ, Brazil), where the compost is made up from the leaves swept from the streets of the Pinheiral city. The mobility of these radionuclides in the soil was assessed through sequential chemical extraction and desorption studies as a function of pH. The bioavailability was evaluated through the effective absorption of radionuclide by root crops (Raphanus sativus, L). This study evidenced that the organic amendment plays an important role in the desorption processes of cobalt and cesium, reducing desorption of both nuclides beneath higher organic amendment dose. This behavior was observed in acid conditions as well in alkaline. However extreme acid conditions may mobilize both radionuclides, although cobalt mobility was shown to be more sensitive to low pH than cesium. (authors)

  11. The effect of organic amendment on mobility of cesium in tropical soils - The effect of organic amendment on sorption mechanisms for cesium and cobalt in tropical soils

    International Nuclear Information System (INIS)

    This work aimed to investigate the mechanisms involved in the sorption of 137Cs and 60Co as a function of the physico-chemical properties of some types of Brazilian soils and the changes on the behavior of these radionuclides due to changes in soil properties promoted by organic amendment. The experimental study was conducted in a controlled area, where pots containing different types of soils (Ferralsol, Nitisol and Histosol) and different doses of organic amendment (no amendment; 2 kg.m-2 and 4 kg.m-2) were spiked with 137Cs and 60Co. The organic amendment used in this experiment was obtained in the Unit of Compost of the Organic Material of Pinheiral (RJ, Brazil), where the compost is made up from the leaves swept from the streets of the Pinheiral city. The mobility of these radionuclides in the soil was assessed through sequential chemical extraction and desorption studies as a function of pH. The bioavailability was evaluated through the effective absorption of radionuclide by root crops (Raphanus sativus, L). This study evidenced that the organic amendment plays an important role in the desorption processes of cobalt and cesium, reducing desorption of both nuclides beneath higher organic amendment dose. This behavior was observed in acid conditions as well in alkaline. However extreme acid conditions may mobilize both radionuclides, although cobalt mobility was shown to be more sensitive to low pH than cesium. (authors)

  12. The Effect of Pressure and Organic Constituents on the Cesium Ion Exchange Performance of IONSIV IE-911

    International Nuclear Information System (INIS)

    This study examined cesium (137Cs) ion exchange of crystalline silicotitanate (CST) in simulated waste solution. In particular, the study focused on the effect of CST pretreatment on the kinetics and extent of cesium adsorption. The test used IONSIV IE-911 (UOP LLC, Molecular Sieves Division, Des Plaines, IL), the engineered form of CST. Pretreatment steps examined include: soaking CST in 2M NaOH solution for three days, exposing CST to 50% relative humidity for one week, flowing organic-containing (saturated) salt solution through a CST packed bed (at 5 cm/min. superficial velocity), or drying CST in air at 100 C for three days. Some tests occurred under 50 and 25 psig of argon. The following conclusions summarize the results. Pretreatment of IE-911 in organic-containing (e.g., tri-n-butyl phosphate, dibutylphosphate, butanol, paraffin and Dow Corning H-10 defoamer) simulated waste or simulated waste yielded a 83% slower rate of cesium adsorption and 56% lower cesium capacity after one week. Pretreatment of IE-911 in 2M caustic solution for 48 hours yielded a slower approach to equilibrium cesium distribution in batch contact tests--7.7 mL/(g*h) during the first 48 hours and 2.4 ml/(g*h) thereafter. Carboxylates and adsorbed carbonates inside the pores likely affect the cesium transport by either increasing the path-length or reducing mass transfer rate. Heating IE-911 as received from the vendor at 100 C for 24 hours significantly degraded its cesium removal performance by a 40.7% reduction in capacity and 43% reduction in sorption rate over one week of testing. Testing determined nearly identical distribution coefficients Kd between lot numbersign 9990-9681-0004 and 9990-9881-0005 (i.e., difference of only 5.6%). Tests measuring water insertion rates into IE-911 show that hydration of the IE-911 does not appear to limit the rate of cesium sorption. Increasing the atmospheric pressure from 0 to 50 psig had no effect on cesium sorption. Note that lower apparent

  13. Immiscibility in a Quantum Degenerate Mixture of $^{87}$Rb and $^{133}$Cs

    CERN Document Server

    McCarron, D J; Jenkin, D L; Köppinger, M P; Cornish, S L

    2011-01-01

    We report a new method for the production of Bose-Einstein condensates of $^{133}$Cs and demonstrate the formation of a quantum degenerate mixture of $^{87}$Rb and $^{133}$Cs. The approach exploits efficient sympathetic cooling of $^{133}$Cs via $^{87}$Rb in a magnetic quadrupole trap prior to further evaporative cooling in a levitated optical trap. Sacrificing all the $^{87}$Rb during the cooling, we create single species $^{133}$Cs condensates of up to $6\\times10^{4}$ atoms. Tailoring the evaporation to retain some $^{87}$Rb, we simultaneously create condensates of $^{87}$Rb and $^{133}$Cs in the same trapping potential, each containing up to $2\\times10^{4}$ atoms. We observe a striking phase separation of the two species revealing the mixture to be immiscible due to strong repulsive interspecies interactions.

  14. Implications of liver activity associated with 133Xe ventilation lung scans

    International Nuclear Information System (INIS)

    A series of 35 xenon-133 (133Xe) ventilation studies yielded nine cases demonstrating accumulation of activity in the liver. Maximum intrahepatic deposition of radioxenon occurred during the washout phase of the study. In addition to those clinical instances which make this phenomenon possible, i.e., obesity, alcoholic-induced liver steatosis and diabetes mellitus, we found that hyperlipidemia and coronary artery disease also favor xenon-133 localization into the hepatic parenchyma. It is concluded that the lipid avidity of 133Xe facilitates its liver accumulation hyperlipidemic patients and in patients with coronary artery disease, and that this action may be explored to further understand deranged metabolic pathways in the liver of these patients. Hepatic accumulation of 133Xe during ventilation studies must be considered when assessing regional ventilation/perfusion relationships

  15. Complementary single photon emission computed tomography of the brain: Xe-133 and iodoamphetamine

    International Nuclear Information System (INIS)

    Xe-133 and I-123 iodoamphetamin (IMP) emission computed tomography studies of 32 patients with neurologic (n = 7) or psychiatric (n = 25) diagnoses were used to determine whether the modalities yield complementary diagnostic information. The images, interpreted by two observers, differed in 15 (47%) cases. In schizophrenic patients, 11(61%) abnormalities were identified by Xe-133 imaging and 15(83%) by IMP. The abnormalities involved principally the frontal lobes and were identified in eight (73%) cases by Xe-133 imaging and in ten (67%) cases by IMP. In all four patients with arteriovenous malformations the imaging results were abnormal: Xe-133 showed increased flow while IMP revealed localized decreased activity in one patient. Imaging patterns for seizures, depression and psychoses also differed. Thus, Xe-133 and IMP appear complementary in their portrayal of brain function

  16. LOSS OF HETEROZYGOSITY ON CHROMOSOME 17p13.3 IN OVARIAN CANCER AND CERVICAL CANCER

    Institute of Scientific and Technical Information of China (English)

    Zhang Guoling; Yang Huijian; Xu Kaili; Zhou Jin; Qin Ruidi; Lu Minghua

    1998-01-01

    Objective:To identify the loss of heterozygosity (LOH) on chromosome 17p13.3 in ovarian cancer and cervical cancer. Methods: The frequency of LOH on chromosome 17p13.3 in DNA samples from 24 ovarian cancers, 9 cervical cancers, and 13 non-malignant gynecological diseases were determined respectively, using Southern blot method with probe PYNZ.22. Results:LOH on 17p13.3 was found in 12 of 24 (50.0%) ovarian cancers (including a borderline mucinous cystadenoma), 4of 9 (44.4%) cervical carcinomas, and 1 of 13 (7.7%) nonmalignant gynecological diseases, which was cervical intraepithelial neoplasm HI (CIN Ⅲ) (P<0.01).Conclusion: These results show that LOH on 17p13.3 is associated with ovarian cancer and cervical cancer,suggesting that detection of LOH on 17p13.3 may be helpful to understand the molecular pathogenesis of ovarian cancer and cervical cancer.

  17. Prognostic role of CD133 expression in colorectal cancer: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Wang Ke

    2012-12-01

    Full Text Available Abstract Background CD133 has been identified as a putative cancer stem cell marker in colorectal cancer (CRC. However, the clinical and prognostic significance of CD133 in CRC remains controversial. Methods Publications were identified which assessed the clinical or prognostic significance of CD133 in CRC up to October 2012. A meta-analysis was performed to clarify the association between CD133 expression and clinical outcomes. Results A total of 12 studies met the inclusion criteria, and comprised 3652 cases. Analysis of these data showed that CD133 was not significantly associated with the depth of CRC invasion (odds ratio [OR] = 1.44, 95% confidence interval [CI]: 0.77–2.68, Z = 1.15, P = 0.252 or tumor differentiation (OR = 0.63, 95% CI: 0.28–1.46, Z = −1.06, P = 0.286. Also, there was no statistically significant association of CD133 with lymph node metastasis (OR = 1.16, 95% CI: 0.87–1.54, Z = 1.05, P = 0.315 or lymphatic invasion (OR = 1.08, 95% CI: 0.81–1.43, Z = 0.53, P = 0.594. However, in identified studies, overexpression of CD133 was highly correlated with reduced overall survival (relative risk [RR] = 2.14, 95% CI: 1.45–3.17, Z = 3.81, P = 0.0001. Conclusions CD133 may play an important role in the progression of CRC, and overexpression of CD133 is closely related with poorer patient survival. If these findings are confirmed by well-designed prospective studies, CD133 may be a useful maker for clinical applications.

  18. Specific recognition of arteriovenous malformations using xenon-133 RCBF technique

    International Nuclear Information System (INIS)

    With respect to the methodology of the atraumatic xenon-133 technique the problem whether or not the proposed and introduced arterial artifact (AA) truely represents radiation from intravascular volume and to what extent it affects regional cerebral blood flow (rCBF) calculation is unresolved. We performed rCBF measurements in 22 patients with angiomas to clarify this issue in those patients known to have pathologically enlarged intracranial vessels. P4 - the parameter suggested to represent the AA - as well as the conventional blood flow parameter for gray matter (F1) were compared to those of 50 volunteers using four criteria of abnormality: 1. Intrahemispheric distribution, 2. interhemispheric differences of homologous detector pairs, 3 differences of mean hemispheric values, 4. visual evaluation of CBF maps. 19 of the 22 patients with angioma fulfilled at least two of the four criteria of abnormality, in comparison to 1 of 50 volunteers. P 4's sensitivity for detecting angiomas proved to be higher (86%) than the perfusion parameters of gray matter. Focal increase of P4 proved to be highly specific for the presence of arteriovenous malformation (AVM, specifity 98%). A true arterial artifact exists in most instances in the presence of an AVM. Disregarding AA in the algorithm for calculation rCBF leads to an artificial overestimation of tissue flow in the region of the AVM

  19. STS-133/ET-137 Tanking Test Photogrammetry Assessment

    Science.gov (United States)

    Oliver, Stanley T.

    2012-01-01

    Following the launch scrub of Space Shuttle mission STS-133 on November 5, 2010, an anomalous condition of cracked and raised thermal protection system (TPS) foam was observed on the External Tank (ET). Subsequent dissection of the affected TPS region revealed cracks in the feet of two Intertank (IT) metallic stringers. An extensive investigation into the cause(s) and corrective action(s) for the cracked stringers was initiated, involving a wide array of material and structural tests and nondestructive evaluations, with the intent to culminate into the development of flight rational. One such structural test was the instrumented tanking test performed on December 17, 2010. The tanking test incorporated two three-dimensional optical displacement measurement systems to measure full-field outer surface displacements of the TPS surrounding the affected region that contained the stringer cracks. The results showed that the radial displacement and rotation of the liquid oxygen (LO2) tank flange changed significantly as the fluid level of the LO2 approached and passed the LO2 tank flange.

  20. Asteroid 2012 XE133, a transient companion to Venus

    CERN Document Server

    Marcos, C de la Fuente

    2013-01-01

    Apart from Mercury that has no known co-orbital companions, Venus remains as the inner planet that hosts the smallest number of known co-orbitals, 2: (322756) 2001 CK32 and 2002 VE68. Both objects have absolute magnitudes 18 < H < 21 and were identified as Venus co-orbitals in 2004. Here, we analyze the orbit of the recently discovered asteroid 2012 XE133 with H = 23.5 mag to conclude that it is a new Venus co-orbital currently following a transitional trajectory between Venus' Lagrangian points L5 and L3. The object could have been a 1:1 librator for several thousand years and it may leave the resonance with Venus within the next few hundred years, after a close encounter with the Earth. Our calculations show that its dynamical status as co-orbital, as well as that of the 2 previously known Venus co-orbitals, is controlled by the Earth-Moon system with Mercury playing a secondary role. The 3 temporary co-orbitals follow rather chaotic but similar trajectories with e-folding times of order of 100 yr. Ou...