WorldWideScience

Sample records for cesium 133 target

  1. Uptake of cesium ions by human erythrocytes and perfused rat heart: a cesium-133 NMR study

    Energy Technology Data Exchange (ETDEWEB)

    Davis, D.G.; Murphy, E.; London, R.E.

    1988-05-17

    Cesium-133 NMR studies have been carried out on suspended human erythrocytes and on perfused rat hearts in media containing CsCl. The resulting spectra exhibit two sharp resonances, arising from intra-and extracellular Cs/sup +/, separated in chemical shift by 1.0-1.4 ppm. Thus, intra- and extracellular resonances are easily resolved without the addition of paramagnetic shift reagents required to resolve resonance of the other alkali metal ions. Spin-lattice relaxation times in all cases are monoexponential and significantly shorter (3-4 times) for the intracellular component. When corrections are made for the pulse repetition rate, the total intensity of the intracellular and extracellular Cs/sup +/ resonances in erythrocytes is conserve, implying total observability of the intracellular pool. The uptake of Cs/sup +/ by erythrocytes occurs at approximately one-third the reported rate for K/sup +/ and was reduced by a factor of 2 upon addition of ouabain to the sample. These results indicate that /sup 133/Cs NMR is a promising tool for studying the distribution and transport of cesium ions in biological systems and, in some cases such as uptake by cellular Na,K-ATPase, for analysis of K/sup +/ ion metabolism.

  2. Effects of pocket gopher burrowing on cesium-133 distribution on engineered test plots

    International Nuclear Information System (INIS)

    Very low levels of radionuclides exist on soil surfaces. Biological factors including vegetation and animal burrowing can influence the fate of these surface contaminants. Animal burrowing introduces variability in radionuclide migration that confounds estimation of nuclide migration pathways, risk assessment, and assessment of waste burial performance. A field study on the surface and subsurface erosional transport of surface-applied 133Cs as affected by pocket gopher (Thomomys bottae) burrowing was conducted on simulated waste landfill caps at the Los Alamos National Laboratory in north central New Mexico. Surface loss of Cs, adhered to five soil particle size ranges, was measured several times over an 18-mo period while simulated rainfalls were in progress. Gophers reduced Cs surface loss by significant amounts, 43%. Cesium surface loss on plots with only gophers was 0.8 kg totalled for the study period. This compared with 1.4 kg for control plots, 0.5 kg for vegetated plots, and 0.2 kg for plots with both gophers and vegetation. The change in Cs surface loss over time was significant (P -1). Vegetation-bearing plots bad significant more total subsurface Cs (μ = 1.7 g kg-1) than plots without vegetation (μ = 0.8 g kg-1). An average of 97% of the subsurface Cs in plots with vegetation was located in the upper 15 cm of soil (SDR1 + SDR2) compared with 67% for plots without vegetation. Vegetation moderated the influence of gopher activity on the transport of Cs to soil subsurface, and stabilized subsurface Cs by concentrating it in the rhizosphere. Gopher activity may have caused Cs transport to depths below that sampled, 30 cm. The results provide distribution coefficients for models of contaminant migration where animal burrowing occurs. 35 refs., 2 figs., 3 tabs

  3. CD133, Selectively Targeting the Root of Cancer

    Directory of Open Access Journals (Sweden)

    Jörg U. Schmohl

    2016-05-01

    Full Text Available Cancer stem cells (CSC are capable of promoting tumor initiation and self-renewal, two important hallmarks of carcinoma formation. This population comprises a small percentage of the tumor mass and is highly resistant to chemotherapy, causing the most difficult problem in the field of cancer research, drug refractory relapse. Many CSC markers have been reported. One of the most promising and perhaps least ubiquitous is CD133, a membrane-bound pentaspan glycoprotein that is frequently expressed on CSC. There is evidence that directly targeting CD133 with biological drugs might be the most effective way to eliminate CSC. We have investigated two entirely unrelated, but highly effective approaches for selectively targeting CD133. The first involves using a special anti-CD133 single chain variable fragment (scFv to deliver a catalytic toxin. The second utilizes this same scFv to deliver components of the immune system. In this review, we discuss the development and current status of these CD133 associated biological agents. Together, they show exceptional promise by specific and efficient CSC elimination.

  4. Control of the 133 cesium cold collisions, search for a variation of the fine structure constant using a dual rubidium-cesium atomic fountain; Controle des collisions froides du cesium {sup 133}Cs: tests de la variation de la constante de structure fine a l'aide d'une fontaine atomique double rubidium-cesium

    Energy Technology Data Exchange (ETDEWEB)

    Marion, H

    2005-03-15

    We developed a method of measurement of the frequency shift due to the collisions between cold atoms. This is the main systematic limitation for the accuracy of the Cs{sup 133} based fountains ({approx} 10{sup -15} in relative frequency). Consequently, we can measure this effect near 0.5% This opens prospects for improvements of the fountains performances in term of accuracy until 10{sup -16}. The fountain has also obtained a stability about 10{sup -14} at 1 s. We discovered for the first time, at very low magnetic field (5 {+-} 1 mG), Feshbach resonances. We also took a new absolute measurement of the hyperfine transition of the Rb{sup 87}, which is the most precise ever carried out and is used now as definition for the secondary standard. By comparing this value with those measured the previous years, we could carry out a test of the stability of the fine structure constant on the level of 10{sup -15} /yr. We led local comparisons between atomic fountains and the other fountains of the laboratory. Most stable it is unrolled with a combined stability of 5.10{sup -14} at 1 s. The behavior of the difference of the two clocks goes like white frequency noise up to 3.10{sup -16}. The assessment of the dual fountain accuracy budget has been evaluated at 7.10{sup -16} for the cesium part and 8.10{sup -16} for the rubidium part. We contributed to the realization of the scale of International Atomic Time, by series of calibrations of hydrogen masers. An atomic comparison of fountain by satellite links was tested between our laboratory and our German counterpart. This measurement has determined the good agreement between the two clocks. (author)

  5. MicroRNA-133a Inhibits Osteosarcoma Cells Proliferation and Invasion via Targeting IGF-1R

    Directory of Open Access Journals (Sweden)

    Guangnan Chen

    2016-02-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs are a class of small noncoding RNAs that regulate gene expression by repressing translation or cleaving RNA transcripts in a sequence-specific manner. Downregulated microRNAs and their roles in cancer development have attracted much attention. A growing body of evidence showed that microRNA-133a (miR-133a has inhibitory effects on cell proliferation, migration, invasion, and metastasis of osteosarcoma. Methods: MiR-133a expression in human osteosarcoma cell lines and human normal osteoblastic cell line hFOB was investigated by real-time PCR (RT-PCR. The role of miR-133a in human osteosarcoma growth and invasion was assessed in cell lines in vitro and in vivo. Then, luciferase reporter assay validated IGF-1R as a downstream and functional target of miR-133a, and functional studies revealed that the anti-tumor effect of miR-133a was probably due to targeting and repressing of IGF-1R expression. Results: MiR-133a was lower expressed in human osteosarcoma cell lines than human normal osteoblastic cell line hFOB and its effect on inhibiting proliferation, invasion and metastasis is mediated by its direct interaction with the IGF-1R. Furthermore, the tumour-suppressive function of miR-133a probably contributed to inhibiting the activation AKT and ERK signaling pathway. Conclusion: MiR-133a suppresses osteosarcoma progression and metastasis by targeting IGF-1R in human osteosarcoma cells, providing a novel candidate prognostic factor and a potential anti-metastasis therapeutic target in osteosarcoma.

  6. production of carrier -free 131 cesium from neutron irradiated barium targets

    International Nuclear Information System (INIS)

    this work describes the production of carrier-free radioactive 131 Cs from bulk amounts of Ba CO3 (1g each) as target material irradiated at ETRR-1, ETRR-2 and IRI research reactors. Cesium-131 was prepared according to the thermal neutron reaction 130Ba (n,γ ) 131 Ba (β- decay)131 Cs. Carrier-free 131Cs is separated from the irradiated barium target, by precipitation of Ba2+ cations with addition of SO42- anions in excess and filtration of the formed precipitate . quality control investigations including radionuclidic, radiochemical and chemical purity of 131 Cs product has proved its suitability for nuclear medicine use

  7. CD133-targeted gene transfer into long-term repopulating hematopoietic stem cells.

    Science.gov (United States)

    Brendel, Christian; Goebel, Benjamin; Daniela, Abriss; Brugman, Martijn; Kneissl, Sabrina; Schwäble, Joachim; Kaufmann, Kerstin B; Müller-Kuller, Uta; Kunkel, Hana; Chen-Wichmann, Linping; Abel, Tobias; Serve, Hubert; Bystrykh, Leonid; Buchholz, Christian J; Grez, Manuel

    2015-01-01

    Gene therapy for hematological disorders relies on the genetic modification of CD34(+) cells, a heterogeneous cell population containing about 0.01% long-term repopulating cells. Here, we show that the lentiviral vector CD133-LV, which uses a surface marker on human primitive hematopoietic stem cells (HSCs) as entry receptor, transfers genes preferentially into cells with high engraftment capability. Transduction of unstimulated CD34(+) cells with CD133-LV resulted in gene marking of cells with competitive proliferative advantage in vitro and in immunodeficient mice. The CD133-LV-transduced population contained significantly more cells with repopulating capacity than cells transduced with vesicular stomatitis virus (VSV)-LV, a lentiviral vector pseudotyped with the vesicular stomatitis virus G protein. Upon transfer of a barcode library, CD133-LV-transduced cells sustained gene marking in vivo for a prolonged period of time with a 6.7-fold higher recovery of barcodes compared to transduced control cells. Moreover, CD133-LV-transduced cells were capable of repopulating secondary recipients. Lastly, we show that this targeting strategy can be used for transfer of a therapeutic gene into CD34(+) cells obtained from patients suffering of X-linked chronic granulomatous disease. In conclusion, direct gene transfer into CD133(+) cells allows for sustained long-term engraftment of gene corrected cells. PMID:25189742

  8. Poly(lactic-co-glycolic acid nanoparticles conjugated with CD133 aptamers for targeted salinomycin delivery to CD133+ osteosarcoma cancer stem cells

    Directory of Open Access Journals (Sweden)

    Ni MZ

    2015-03-01

    Full Text Available Miaozhong Ni,1,* Min Xiong,1,* Xinchao Zhang,1,* Guoping Cai,1 Huaiwen Chen,2 Qingmin Zeng,1 Zuochong Yu1 1Department of Orthopedics, Jinshan Hospital, Fudan University, 2International Joint Cancer Institute, the Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Cancer stem cells (CSCs possess the characteristics associated with normal stem cells and are responsible for cancer initiation, recurrence, and metastasis. CD133 is regarded as a CSCs marker of osteosarcoma, which is the most common primary bone malignancy in childhood and adolescence. Salinomycin, a polyether ionophore antibiotic, has been shown to kill various CSCs, including osteosarcoma CSCs. However, salinomycin displayed poor aqueous solubility that hinders its clinical application. The objective of this study was to develop salinomycin-loaded nanoparticles to eliminate CD133+ osteosarcoma CSCs.Methods: The salinomycin-loaded PEGylated poly(lactic-co-glycolic acid nanoparticles (SAL-NP conjugated with CD133 aptamers (Ap-SAL-NP were developed by an emulsion/solvent evaporation method, and the targeting and cytotoxicity of Ap-SAL-NP to CD133+ osteosarcoma CSCs were evaluated.Results: The nanoparticles are of desired particle size (~150 nm, drug encapsulation efficiency (~50%, and drug release profile. After 48 hours treatment of the Saos-2 CD133+ osteosarcoma cells with drugs formulated in Ap-SAL-NP, SAL-NP, and salinomycin, the concentrations needed to kill 50% of the incubated cells were found to be 2.18, 10.72, and 5.07 µg/mL, respectively, suggesting that Ap-SAL-NP could be 4.92 or 2.33 fold more effective than SAL-NP or salinomycin, respectively. In contrast, Ap-SAL-NP was as effective as SAL-NP, and less effective than salinomycin in Saos-2 CD133- cells, suggesting that Ap-SAL-NP possess specific cytotoxicity toward Saos-2 CD133+ cells. Ap-SAL-NP showed the best therapeutic effect in Saos-2

  9. Transtarget residue products of 47MeV/u 12C ions on 133Cs targets

    Institute of Scientific and Technical Information of China (English)

    LiZong-Wei; YangWei-Fan; 等

    1997-01-01

    The yield of transtarget produced in the reaction of 47MeV/u 12C bombardment on cesium compound targets are measured by means of nuclear chemical method and the offline γ spectrum technique.The measurement results show that reaction cross-sections of transtarget products are considerable.The isotope distribution peak position(mass number) of barium element is 129.7±0.2 and the distribution width parameter is 2.76±0.25,At the same time,the yields of products with up to five charge numbers larger than target nucleus have been obtained.

  10. MicroRNA-133a functions as a tumor suppressor by targeting IGF-1R in hepatocellular carcinoma.

    Science.gov (United States)

    Zhang, Wei; Liu, Kai; Liu, Songyang; Ji, Bai; Wang, Yingchao; Liu, Yahui

    2015-12-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs and have critical roles in tumorigenesis and metastasis. A growing body of evidence showed that microRNA-133a (miR-133a) was downregulated and played tumor suppressor roles in gastric, colorectal, bladder, and lung cancer. However, the role and underlying molecular mechanism of miR-133a in hepatocellular carcinoma (HCC) remain unclear. In this study, we analyzed the expression of miR-133a in HCC tissues and HCC cell lines. We find that miR-133a was downregulated in HCC tissues and cell lines and that miR-133a expression negatively correlated with tumor differentiation (P cells significantly suppressed proliferation, colony formation, migration, and invasion, induced cell cycle arrest at G0/G1 stage and cell apoptosis in vitro, and decreased tumor size and weight in a nude mouse HepG2 xenograft model. Using bioinformatics method and dual luciferase assays identified insulin-like growth factor 1 receptor (IGF-1R) as a direct target of miR-133a in HCC cells. Furthermore, overexpression of miR-133a inhibited activation AKT and ERK signal pathway, which contributed to suppression of HCC cell growth. These findings suggest that miR-133a may act as a tumor suppressor and inhibited survival of HCC cells by targeting IGF-1R. PMID:26156803

  11. Neurotensin-induced miR-133α expression regulates neurotensin receptor 1 recycling through its downstream target aftiphilin.

    Science.gov (United States)

    Law, Ivy Ka Man; Jensen, Dane; Bunnett, Nigel W; Pothoulakis, Charalabos

    2016-01-01

    Neurotensin (NT) triggers signaling in human colonic epithelial cells by activating the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). Activated NTR1 traffics from the plasma membrane to early endosomes, and then recycles. Although sustained NT/NTR1 signaling requires efficient NTR1 recycling, little is known about the regulation of NTR1 recycling. We recently showed that NT/NTR1 signaling increases expression of miR-133α. Herein, we studied the mechanism of NT-regulated miR-133α expression and examined the role of miR-133α in intracellular NTR1 trafficking in human NCM460 colonocytes. We found that NT-induced miR-133α upregulation involves the negative transcription regulator, zinc finger E-box binding homeobox 1. Silencing of miR-133α or overexpression of aftiphilin (AFTPH), a binding target of miR-133α, attenuated NTR1 trafficking to plasma membrane in human colonocytes, without affecting NTR1 internalization. We localized AFTPH to early endosomes and the trans-Golgi network (TGN) in unstimulated human colonic epithelial cells. AFTPH overexpression reduced NTR1 localization in early endosomes and increased expression of proteins related to endosomes and the TGN trafficking pathway. AFTPH overexpression and de-acidification of intracellular vesicles increased NTR1 expression. Our results suggest a novel mechanism of GPCR trafficking in human colonic epithelial cells by which a microRNA, miR-133α regulates NTR1 trafficking through its downstream target AFTPH. PMID:26902265

  12. Neurotensin-induced miR-133α expression regulates neurotensin receptor 1 recycling through its downstream target aftiphilin

    Science.gov (United States)

    Law, Ivy Ka Man; Jensen, Dane; Bunnett, Nigel W.; Pothoulakis, Charalabos

    2016-01-01

    Neurotensin (NT) triggers signaling in human colonic epithelial cells by activating the G protein-coupled receptor, the neurotensin receptor 1 (NTR1). Activated NTR1 traffics from the plasma membrane to early endosomes, and then recycles. Although sustained NT/NTR1 signaling requires efficient NTR1 recycling, little is known about the regulation of NTR1 recycling. We recently showed that NT/NTR1 signaling increases expression of miR-133α. Herein, we studied the mechanism of NT-regulated miR-133α expression and examined the role of miR-133α in intracellular NTR1 trafficking in human NCM460 colonocytes. We found that NT-induced miR-133α upregulation involves the negative transcription regulator, zinc finger E-box binding homeobox 1. Silencing of miR-133α or overexpression of aftiphilin (AFTPH), a binding target of miR-133α, attenuated NTR1 trafficking to plasma membrane in human colonocytes, without affecting NTR1 internalization. We localized AFTPH to early endosomes and the trans-Golgi network (TGN) in unstimulated human colonic epithelial cells. AFTPH overexpression reduced NTR1 localization in early endosomes and increased expression of proteins related to endosomes and the TGN trafficking pathway. AFTPH overexpression and de-acidification of intracellular vesicles increased NTR1 expression. Our results suggest a novel mechanism of GPCR trafficking in human colonic epithelial cells by which a microRNA, miR-133α regulates NTR1 trafficking through its downstream target AFTPH. PMID:26902265

  13. MiR-133b ameliorates axon degeneration induced by MPP(+) via targeting RhoA.

    Science.gov (United States)

    Niu, M; Xu, R; Wang, J; Hou, B; Xie, A

    2016-06-14

    Increasing evidence suggests that microRNAs (miRs) play a significant role in the pathogenesis of Parkinson's disease (PD). MiR-133b, which is significantly decreased in the PD midbrain, has recently been shown to promote neurite outgrowth and enhance neural functional recovery. However, the role of miR-133b in PD has not been clearly established. Here, using a well-established PD model culture based on the neurotoxin 1-methyl-4-phenyl-pyridinium (MPP(+)), we demonstrated that miR-133b could promote axon outgrowth in dopaminergic neurons (DNs) and ameliorated MPP(+)-induced axon degeneration. Additional experiments suggested that the mechanisms of this miR-133b-mediated effect might rely on RhoA inhibition. We demonstrated that RhoA, an inhibitor of axonal growth, was increased in DNs under MPP(+) treatment, and this increase could be attenuated by miR-133b overexpression. Moreover, we demonstrated that the induced expression of miR-133b could inhibit α-synuclein, which is critically involved in the pathological process of PD. Furthermore, we found that overexpression of miR-133b abrogated the MPP(+)-induced decrease in the Bcl-2/Bax ratio and upregulated phosphorylated Akt (p-Akt), which is a pro-survival kinase. Together these findings reveal novel roles for miR-133b in the pathogenesis of PD and provide new therapeutic avenues for the treatment of the disease. PMID:27012608

  14. MicroRNA-133 Controls Brown Adipose Determination in Skeletal Muscle Satellite Cells by Targeting Prdm16

    DEFF Research Database (Denmark)

    Yin, Hang; Pasut, Alessandra; Soleimani, Vahab D;

    2013-01-01

    Brown adipose tissue (BAT) is an energy-dispensing thermogenic tissue that plays an important role in balancing energy metabolism. Lineage-tracing experiments indicate that brown adipocytes are derived from myogenic progenitors during embryonic development. However, adult skeletal muscle stem cells...... (satellite cells) have long been considered uniformly determined toward the myogenic lineage. Here, we report that adult satellite cells give rise to brown adipocytes and that microRNA-133 regulates the choice between myogenic and brown adipose determination by targeting the 3'UTR of Prdm16. Antagonism of...... downregulated in mice exposed to cold, resulting in de novo generation of satellite cell-derived brown adipocytes. Therefore, microRNA-133 represents an important therapeutic target for the treatment of obesity....

  15. Targeting cancer stem cells with an 131I-labeled anti-AC133 monoclonal antibody in human colorectal cancer xenografts

    International Nuclear Information System (INIS)

    Introduction: Cancer stem cells (CSCs) are a subpopulation within a tumor, which possesses the characteristics of self-renewal, differentiation, tumorigenicity, and drug resistance. The aim of this study was to target the colorectal CSC marker CD133 with an131I-labeled specific monoclonal antibody (AC133 mAb) in a nude mouse xenograft model. Methods: Colorectal adenocarcinoma cells (LoVo cell line) were separated into CD133(+) and CD133(−) cells by magnetic activated cell sorting. CD133(+), CD133(−), and unsorted LoVo cells were cultured and then implanted subcutaneously into the lower limbs of nude mice (n = 5). AC133 mAb was labeled with 131I by the iodogen method. Results: The radiolabeled compound, 131I-AC133 mAb, showed high stability, specificity, and immunoactivity in vitro. Obvious accumulation of 131I-AC133 mAb was seen in nude mice bearing xenografts of CD133(+) and unsorted LoVo cells, but no uptake was found in mice bearing CD133(−) xenografts or specifically blocked xenografts. Biodistribution analysis showed that the tumor uptake of 131I-AC133 mAb was 6.97 ± 1.40, 1.35 ± 0.48, 6.12 ± 1.91, and 1.61 ± 0.44% ID/g (n = 4) at day 7 after injection of 131I-AC133 mAb in CD133(+), CD133(−), unsorted LoVo cell and specifically blocked xenografts, respectively. The results of immunofluorescence, autoradiography, and western blotting further verified the specific binding of 131I-AC133 mAb to CD133(+) tumors. Conclusions: This study demonstrates the possibility of targeting CSCs with a radiolabeled AC133 mAb in colorectal cancer xenografts based on in vitro, ex vivo, and in vivo experiments. Our findings suggest a new method for imaging CSCs non-invasively

  16. Ursolic Acid Inhibits the Proliferation of Gastric Cancer Cells by Targeting miR-133a.

    Science.gov (United States)

    Xiang, Fenfen; Pan, Chunying; Kong, Qianqian; Wu, Rong; Jiang, Jiemin; Zhan, Yueping; Xu, Jian; Gu, Xingang; Kang, Xiangdong

    2014-01-01

    Ursolic acid (UA), a potential chemotherapeutic agent, has the properties of inhibition of the growth of many human cancer cell lines. Whether UA can inhibit the growth and metastasis of human gastric cancer cells remains unknown. In this study, it was found that UA inhibited the growth and metastasis of human gastric cancer cells in vitro. Our results showed the increase of the percent of apoptotic cells and G1 phase, the inhibition of cell migrations well as the decrease of the expression of Bax, caspase 3 and Bcl-2 in BGC-823 cells after the treatment with UA. Real-time quantitative PCR analysis showed that UA treatment upregulated the level of miR-133a in BGC-823 cells. Overexpression of miR-133a increased the G1 phase of cell cycle and decreased Akt1 expression in BGC-823 cells. These outcomes might be secondary to the increased expression of miR-133a after the treatment with UA. PMID:26629938

  17. miRNA-133 augments coelomocyte phagocytosis in bacteria-challenged Apostichopus japonicus via targeting the TLR component of IRAK-1 in vitro and in vivo

    OpenAIRE

    Meng Lu; Peng-Juan Zhang; Cheng-Hua Li; Zhi-Meng Lv; Wei-Wei Zhang; Chun-Hua Jin

    2015-01-01

    In this study, we explored the potential roles of miRNA-133 in regulating TLR pathways in the sea cucumber Apostichopus japonicus. Target screening of RNA-Seq data successfully identified interleukin-1 receptor-associated kinase (AjIRAK−1) as a putative target of miR-133. This result was further validated by negative expression profiles in Vibrio splendidus-challenged coelomocytes and lipopolysaccharide (LPS)-exposed cell cultures. HEK-293T cells transfected with a dual-luciferase reporter fu...

  18. Tumor suppressive microRNA-133a regulates novel targets: Moesin contributes to cancer cell proliferation and invasion in head and neck squamous cell carcinoma

    International Nuclear Information System (INIS)

    Highlights: ► Tumor suppressive microRNA-133a regulates moesin (MSN) expression in HNSCC. ► Silencing of MSN in HNSCC cells suppressed proliferation, migration and invasion. ► The expression level of MSN was significantly up-regulated in cancer tissues. -- Abstract: Recently, many studies suggest that microRNAs (miRNAs) contribute to the development, invasion and metastasis of various types of human cancers. Our recent study revealed that expression of microRNA-133a (miR-133a) was significantly reduced in head and neck squamous cell carcinoma (HNSCC) and that restoration of miR-133a inhibited cell proliferation, migration and invasion in HNSCC cell lines, suggesting that miR-133a function as a tumor suppressor. Genome-wide gene expression analysis of miR-133a transfectants and TargetScan database showed that moesin (MSN) was a promising candidate of miR-133a target gene. MSN is a member of the ERM (ezrin, radixin and moesin) protein family and ERM function as cross-linkers between plasma membrane and actin-based cytoskeleton. The functions of MSN in cancers are controversial in previous reports. In this study, we focused on MSN and investigated whether MSN was regulated by tumor suppressive miR-133a and contributed to HNSCC oncogenesis. Restoration of miR-133a in HNSCC cell lines (FaDu, HSC3, IMC-3 and SAS) suppressed the MSN expression both in mRNA and protein level. Silencing study of MSN in HNSCC cell lines demonstrated significant inhibitions of cell proliferation, migration and invasion activities in si-MSN transfectants. In clinical specimen with HNSCC, the expression level of MSN was significantly up-regulated in cancer tissues compared to adjacent non-cancerous tissues. These data suggest that MSN may function as oncogene and is regulated by tumor suppressive miR-133a. Our analysis data of novel tumor-suppressive miR-133a-mediated cancer pathways could provide new insights into the potential mechanisms of HNSCC oncogenesis.

  19. miRNA-133 augments coelomocyte phagocytosis in bacteria-challenged Apostichopus japonicus via targeting the TLR component of IRAK-1 in vitro and in vivo.

    Science.gov (United States)

    Lu, Meng; Zhang, Peng-Juan; Li, Cheng-Hua; Lv, Zhi-Meng; Zhang, Wei-Wei; Jin, Chun-Hua

    2015-01-01

    In this study, we explored the potential roles of miRNA-133 in regulating TLR pathways in the sea cucumber Apostichopus japonicus. Target screening of RNA-Seq data successfully identified interleukin-1 receptor-associated kinase (AjIRAK-1) as a putative target of miR-133. This result was further validated by negative expression profiles in Vibrio splendidus-challenged coelomocytes and lipopolysaccharide (LPS)-exposed cell cultures. HEK-293T cells transfected with a dual-luciferase reporter fused to the 3'UTR of wild-type or mutant AjIRAK-1 exhibited a 52.9% reduction in luciferase activity (p < 0.01) compared to controls. Co-infection with a miR-133 mimics or a specific siRNA targeting AjIRAK-1 significantly repressed the mRNA and protein expression levels of AjIRAK-1 and its downstream molecules, such as AjTRAF6 and Ajp105, in primary coelomocytes. In contrast, a miR-133 inhibitor significantly increased the expression of these TLR pathway members. The injection of miR-133 agomir or AjIRAK-1 siRNA into sea cucumbers not only decreased the expression of AjIRAK-1 and its downstream molecules but also significantly increased V. splendidus coelomocyte phagocytosis. All of the present data provide direct evidence that miR-133 is involved in TLR cascade modulation through AjIRAK-1 targeting to promote V. splendidus coelomocyte phagocytosis in these non-model invertebrates. PMID:26223836

  20. Application of Cesium isotopes in daily life

    International Nuclear Information System (INIS)

    In the world of science, the desire of the scientific community to discover new chemical elements is crucial for the development of new technologies in various fields of knowledge. And the main chemical element addressed by this article is Cesium, but specifically 133Cesium isotope and radioisotope 137Cesium, exemplifying their physical and chemical characteristics, and their applications. This article will also show how these isotopes have provided researchers a breakthrough in the field of radiological medicine and in time and frequency metrology. (author)

  1. miR-150-5p and miR-133a suppress glioma cell proliferation and migration through targeting membrane-type-1 matrix metalloproteinase.

    Science.gov (United States)

    Sakr, Moustafa; Takino, Takahisa; Sabit, Hemragul; Nakada, Mitsutoshi; Li, Zichen; Sato, Hiroshi

    2016-08-10

    Gliomas are the most frequent primary tumors of the brain, and there is no successful treatment for highly malignant gliomas. MicroRNAs (miRNAs) are involved in a variety of biological processes. Recent studies showed that miR-150-5p and miR-133a are downregulated in various human malignancies, and one of target mRNAs was shown to be membrane-type 1 matrix metalloproteinase (MT1-MMP) mRNA. However, their detailed role in the processes of cancer remains to be determined. Here we found that miR-150-5p and miR-133a expression was significantly downregulated in glioma tissues compared with normal tissues, and that MT1-MMP expression was inversely upregulated in glioma tissues. Knockdown of MT1-MMP by specific siRNAs in U87 and U251 glioma cells induced suppression of cell proliferation and invasion/migration. Transfection of miR-150-5p or miR-133a mimics into glioma cell lines reduced MT1-MMP expression and MMP-2 activation by these cells, and cell proliferation and invasion/migration were also suppressed by it. Co-transfection of specific inhibitor oligo DNA for miR-150-5p or miR-133a abrogated miR-150-5p or miR-133a mimic's actions, respectively. These results suggest that miR-150-5p and miR-133a may suppress malignancy of gliomas by targeting MT1-MMP, and could be used as an anti-metastatic therapy for glioma patients. PMID:27154818

  2. Cesium-137

    International Nuclear Information System (INIS)

    This sheet belongs to a collection which relates to the use of radionuclides essentially in unsealed sources. Its goal is to gather on a single document the most relevant information as well as the best prevention practices to be implemented. These sheets are made for the persons in charge of radiation protection: users, radioprotection-skill persons, labor physicians. Each sheet treats of: 1 - the radio-physical and biological properties; 2 - the main uses; 3 - the dosimetric parameters; 4 - the measurement; 5 - the protection means; 6 - the areas delimitation and monitoring; 7 - the personnel classification, training and monitoring; 8 - the effluents and wastes; 9 - the authorization and declaration administrative procedures; 10 - the transport; and 11 - the right conduct to adopt in case of incident or accident. This sheet deals specifically with Cesium-137

  3. MiR-34a targeting of Notch ligand delta-like 1 impairs CD15+/CD133+ tumor-propagating cells and supports neural differentiation in medulloblastoma.

    Directory of Open Access Journals (Sweden)

    Pasqualino de Antonellis

    Full Text Available BACKGROUND: Through negative regulation of gene expression, microRNAs (miRNAs can function as oncosuppressors in cancers, and can themselves show altered expression in various tumor types. Here, we have investigated medulloblastoma tumors (MBs, which arise from an early impairment of developmental processes in the cerebellum, where Notch signaling is involved in many of the cell-fate-determining stages. Notch regulates a subset of MB cells that have stem-cell-like properties and can promote tumor growth. On the basis of this evidence, we hypothesized that miRNAs targeting the Notch pathway can regulate these phenomena, and can be used in anti-cancer therapies. METHODOLOGY/PRINCIPAL FINDINGS: In a screening of potential targets within Notch signaling, miR-34a was seen to be a regulator of the Notch pathway through its targeting of Notch ligand Delta-like 1 (Dll1. Down-regulation of Dll1 expression by miR-34a negatively regulates cell proliferation, and induces apoptosis and neural differentiation in MB cells. Using an inducible tetracycline on-off model of miR-34a expression, we show that in Daoy MB cells, Dll1 is the first target that is regulated in MB, as compared to the other targets analyzed here: Cyclin D1, cMyc and CDK4. MiR-34a expression negatively affects CD133(+/CD15(+ tumor-propagating cells, then we assay through reverse-phase proteomic arrays, Akt and Stat3 signaling hypo-phosphorylation. Adenoviruses carrying the precursor miR-34a induce neurogenesis of tumor spheres derived from a genetic animal model of MB (Patch1(+/- p53(-/-, thus providing further evidence that the miR-34a/Dll1 axis controls both autonomous and non autonomous signaling of Notch. In vivo, miR-34a overexpression carried by adenoviruses reduces tumor burden in cerebellum xenografts of athymic mice, thus demonstrating an anti-tumorigenic role of miR-34a in vivo. CONCLUSIONS/SIGNIFICANCE: Despite advances in our understanding of the pathogenesis of MB, one-third of

  4. Cesium chemistry in irradiated fuel; cesium uranates

    International Nuclear Information System (INIS)

    The physico-chemical behaviour of fission products in nuclear fuel during and after irradiation has been studied extensively during the past decades. In spite of the large amount of chemical, crystallographic and thermodynamic data available, the knowledge on the very complicated UO2-fission product system is still far from complete. The paper discusses the multi variant character of uranium in cesium uranates, which has been assessed by a systematic X-ray Photoelectron Spectroscopy (XPS) study of a series of cesium uranates

  5. (64)Cu-ATSM therapy targets regions with activated DNA repair and enrichment of CD133(+) cells in an HT-29 tumor model: Sensitization with a nucleic acid antimetabolite.

    Science.gov (United States)

    Yoshii, Yukie; Furukawa, Takako; Matsumoto, Hiroki; Yoshimoto, Mitsuyoshi; Kiyono, Yasushi; Zhang, Ming-Rong; Fujibayashi, Yasuhisa; Saga, Tsuneo

    2016-06-28

    (64)Cu-diacetyl-bis (N(4)-methylthiosemicarbazone) ((64)Cu-ATSM) is a potential theranostic agent targeting the over-reduced state under hypoxia within tumors. Recent clinical Cu-ATSM positron emission tomography studies have revealed a correlation between uptake and poor prognosis; however, the reason is unclear. Here, using a human colon carcinoma HT-29 model, we demonstrated that the intratumoral (64)Cu-ATSM high-uptake regions exhibited malignant characteristics, such as upregulated DNA repair and elevated %CD133(+) cancer stem-like cells. Based on this evidence, we developed a strategy to enhance the efficacy of (64)Cu-ATSM internal radiotherapy (IRT) by inhibiting DNA repair with a nucleic acid (NA) antimetabolite. The results of the analyses showed upregulation of pathways related to DNA repair along with NA incorporation (bromodeoxyuridine uptake) and elevation of %CD133(+) cells in (64)Cu-ATSM high-uptake regions. In an in vivo(64)Cu-ATSM treatment study, co-administration of an NA antimetabolite and (64)Cu-ATSM synergistically inhibited tumor growth, with little toxicity, and effectively reduced %CD133(+) cells. (64)Cu-ATSM therapy targeted malignant tumor regions with activated DNA repair and high concentrations of CD133(+) cells in the HT-29 model. NA antimetabolite co-administration can be an effective approach to enhance the therapeutic effect of (64)Cu-ATSM IRT. PMID:26996296

  6. Application of Cesium isotopes in daily life; Aplicacoes dos isotopos do Cesio no cotidiano

    Energy Technology Data Exchange (ETDEWEB)

    Jordao, B.O.; Quaresma, D.S.; Carvalho, R.J., E-mail: bjordan@on.br, E-mail: dansq@on.br, E-mail: carvalho@on.br [Observatorio Nacional (ON/LPTF), Rio de Janeiro, RJ (Brazil). Lab. Nacional de Tempo e Frequencia; Peixoto, J.G.P., E-mail: guilherm@ird.gov.br [Instituto de Radioprotecao e Dosimetria, (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab. de Metrologia das Radiacoes Ionizantes

    2014-07-01

    In the world of science, the desire of the scientific community to discover new chemical elements is crucial for the development of new technologies in various fields of knowledge. And the main chemical element addressed by this article is Cesium, but specifically {sup 133}Cesium isotope and radioisotope {sup 137}Cesium, exemplifying their physical and chemical characteristics, and their applications. This article will also show how these isotopes have provided researchers a breakthrough in the field of radiological medicine and in time and frequency metrology. (author)

  7. Decorporation of cesium-137

    International Nuclear Information System (INIS)

    Cesium radio-isotopes, especially cesium-137 (137Cs) are among the radionuclides of main importance produced by a fission reaction in reactor or a nuclear weapon explosion. In the environment, 137Cs is a major contaminant which can cause severe β, γirradiations and contaminations. 137Cs is distributed widely and relatively uniformly throughout the body with the highest concentration in skeletal muscles. A treatment becomes difficult afterwards. The purposes of this report are Firstly to compare the Prussian blue verses cobalt and potassium ferrocyanide (D.I. blue) efficiency for the 137Cs decorporation and secondly to assess a chronological treatment with D.I. blue. (author)

  8. Analysis of radioactive cesium

    International Nuclear Information System (INIS)

    The procedure of analysis of cesium-137 in environmental samples is described. The standard measurement of cesium-137 is made by using a standard solution and a low background G-M counter system. Precipitation and dust are collected on a stainless steel pan. The collected samples are treated by evaporation and extraction or ion exchange and adsorption method. The sample is then quantitatively analyzed. The measurement of cesium-137 is made according to the standard of measurement. Samples collected from inland water and sea water are also treated by evaporation or ion exchange method. The measurements of cesium-137 are also made. This manual describes how to collect soil samples. The collected soil is dried and treated to make samples for activity measurement. Activity measurement is made according to the standard of measurement, then the data are analyzed. Samples are also collected from sediment of sea bottom or river bottom, agricultural products, milk, marine organisms, and daily foods. This manual describes on the methods to collect samples and the treatment to make samples for measurement. (Kato, T.)

  9. Cesium reservoir and interconnective components

    International Nuclear Information System (INIS)

    The program objective is to demonstrate the technology readiness of a TFE (thermionic fuel element) suitable for use as the basic element in a thermionic reactor with electric power output in the 0.5 to 5.0 MW range. A thermionic converter must be supplied with cesium vapor for two reasons. Cesium atoms adsorbed on the surface of the emitter cause a reduction of the emitter work function to permit high current densities without excessive heating of the emitter. The second purpose of the cesium vapor is to provide space-charge neutralization in the emitter-collector gap so that the high current densities may flow across the gap unattenuated. The function of the cesium reservoir is to provide a source of cesium atoms, and to provide a reserve in the event that cesium is lost from the plasma by any mechanism. This can be done with a liquid cesium metal reservoir in which case it is heated to the desired temperature with auxiliary heaters. In a TFE, however, it is desirable to have the reservoir passively heated by the nuclear fuel. In this case, the reservoir must operate at a temperature intermediate between the emitter and the collector, ruling out the use of liquid reservoirs. Integral reservoirs contained within the TFE will produce cesium vapor pressures in the desired range at typical electrode temperatures. The reservoir material that appears to be the best able to meet requirements is graphite. Cesium intercalates easily into graphite, and the cesium pressure is insensitive to loading for a given intercalation stage. The goals of the cesium reservoir test program were to verify the performance of Cs-graphite reservoirs in the temperature-pressure range of interest to TFE operation, and to test the operation of these reservoirs after exposure to a fast neutron fluence corresponding to seven year mission lifetime. In addition, other materials were evaluated for possible use in the integral reservoir

  10. possibilities of isotope separation of radioactive cesium by ion cyclotron resonance

    International Nuclear Information System (INIS)

    The transmutation of radioactive wastes is of high interest in order to reduce as much as possible the difficulties induced by their storage. In the case of radioactive cesium waste, cesium 137 which presents a short life time (30 years) is difficult to handle due to its high thermal load and and radiation level; cesium 135 is a long life time isotope with high mobility in storage glasses. As the processes of transmutation are different for cesium 135 and cesium 137 and as the neutron consumption is very high, it would be necessary to proceed to a preliminary isotope separation and it would not be worth to transmute the stable 133 isotope of cesium. Peculiar problems linked with cesium physico-chemical properties such as ionisation rat, vapour pressure, cooling of the components of the separation elements, especially the collector part, are discussed. It is shown that a high density plasma (1012 cm -3), with low ionic temperature (1 eV), good for isotope separation, can be achieved easily. It must be noticed that the cooling with water has to be avoided due to chemical reactions. After having defined the unitary separative element, different enrichment strategies and arrangements of the separative elements are proposed. An economic estimation with our code RICAN is given. (author)

  11. Cesium-137 in biosphere

    International Nuclear Information System (INIS)

    The behaviour of cesium-137 in environment is reviewed. Problems on 137Cs migration in environment, on metabolism andbiological effects are considered. Data on nuclide accumulation in various plants, ways of their entering the man's organism are presented. It is marked that the rate of 137Cs metabolism in the man's organism depends considerably on age, sex, temperature of environment, conditions for activity, water and mineral metabolism and some other factors. It is shown that the annual effective equivalent dose per capita will increase to 2000 yr. up to 1 μSv, that constitutes 0.05% of the average value of irradiation by a natural source

  12. Control of AC133/CD133 and impact on human hematopoietic progenitor cells through nucleolin.

    Science.gov (United States)

    Bhatia, S; Reister, S; Mahotka, C; Meisel, R; Borkhardt, A; Grinstein, E

    2015-11-01

    AC133 is a prominent surface marker of CD34+ and CD34- hematopoietic stem/progenitor cell (HSPC) subsets. AC133+ HSPCs contain high progenitor cell activity and are capable of hematopoietic reconstitution. Furthermore, AC133 is used for prospective isolation of tumor-initiating cells in several hematological malignancies. Nucleolin is a multifunctional factor of growing and cancer cells, which is aberrantly active in certain hematological neoplasms, and serves as a candidate molecular target for cancer therapy. Nucleolin is involved in gene transcription and RNA metabolism and is prevalently expressed in HSPCs, as opposed to differentiated hematopoietic tissue. The present study dissects nucleolin-mediated activation of surface AC133 and its cognate gene CD133, via specific interaction of nucleolin with the tissue-dependent CD133 promoter P1, as a mechanism that crucially contributes to AC133 expression in CD34+ HSPCs. In mobilized peripheral blood (MPB)-derived HSPCs, nucleolin elevates colony-forming unit (CFU) frequencies and enriches granulocyte-macrophage CFUs. Furthermore, nucleolin amplifies long-term culture-initiating cells and also promotes long-term, cytokine-dependent maintenance of hematopoietic progenitor cells. Active β-catenin, active Akt and Bcl-2 levels in MPB-derived HSPCs are nucleolin-dependent, and effects of nucleolin on these cells partially rely on β-catenin activity. The study provides new insights into molecular network relevant to stem/progenitor cells in normal and malignant hematopoiesis. PMID:26183533

  13. Cesium Concentration in MCU Solvent

    International Nuclear Information System (INIS)

    During Modular Caustic-Side Solvent Extraction (CSSX) Unit (MCU) operations, Cs-137 concentrations in product streams will vary depending on the location in the process and on the recent process conditions. Calculations of cesium concentrations under a variety of operating conditions reveal the following: (1) Under nominal operations with salt solution feed containing 1.1 Ci Cs-137 per gallon, the maximum Cs-137 concentration in the process will occur in the strip effluent (SE) and equal 15-16.5 Ci/gal. (2) Under these conditions, the majority of the solvent will contain 0.005 to 0.01 Ci/gal, with a limited portion of the solvent in the contactor stages containing ∼4 Ci/gal. (3) When operating conditions yield product near 0.1 Ci Cs-137/gal in the decontaminated salt solution (DSS), the SE cesium concentration will be the same or lower than in nominal operations, but majority of the stripped solvent will increase to ∼2-3 Ci/gal. (4) Deviations in strip and waste stream flow rates cause the largest variations in cesium content: (a) If strip flow rates deviate by -30% of nominal, the SE will contain ∼23 Ci/gal, although the cesium content of the solvent will increase to only 0.03 Ci/gal; (b) If strip flow rate deviates by -77% (i.e., 23% of nominal), the SE will contain 54 Ci/gal and solvent will contain 1.65 Ci/gal. At this point, the product DSS will just reach the limit of 0.1 Ci/gal, causing the DSS gamma monitors to alarm; and (c) Moderate (+10 to +30%) deviations in waste flow rate cause approximately proportional increases in the SE and solvent cesium concentrations. Recovery from a process failure due to poor cesium stripping can achieve any low cesium concentration required. Passing the solvent back through the contactors while recycling DSS product will produce a ∼70% reduction during one pass through the contactors (assuming the stripping D value is no worse than 0.36). If the solvent is returned to the solvent hold tank (containing additional

  14. Comparison of organic and inorganic ion exchange materials for removal of cesium and strontium from tank waste

    Energy Technology Data Exchange (ETDEWEB)

    Brown, G. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    This work is part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. Pacific Northwest National Laboratory (PNNL) staff are investigating novel ion exchangers for use in nuclear waste remediation (groundwater, high-level waste (HLW), and low-level waste (LLW)). Waste components targeted for remediation include cesium, strontium, and technetium.

  15. Cesium in the nutrient cycle

    International Nuclear Information System (INIS)

    Most radioactive cesium in forests is deposited in soil, from which it passes into berries and mushrooms, and further to game. The cesium contents of Finnish berries and mushrooms vary depending on the intensity of Chernobyl fallout. Northern Haeme, Pirkanmaa and parts of central Finland received the most fallout. Weather conditions and the environmental factors, and other circumstances during the growth period, also affect the contents. However, consumption of wild berries, mushrooms and game need not be restricted because of radioactivity anywhere in Finland

  16. Cesium contamination of heather honey

    International Nuclear Information System (INIS)

    In heather honey from Lueneburger Heide, FRG, relatively high values of cesium activity were found (up to about 650 Bq/kg). Activity values for heather honey, Calluna vulgaris plants and soil were measured. It is assumed that the origin of this activity is the direct Chernobyl fallout. There may also be a high transfer of cesium from the soil to the Calluna vulgaris plant, but in order to determine the transfer factor, fresh plants are needed, which have grown later than in spring 1986. (author) 21 refs.; 2 figs.; 2 tabs

  17. Cesium transport data for HTGR systems

    International Nuclear Information System (INIS)

    Cesium transport data on the release of cesium from HTGR fuel elements are reviewed and discussed. The data available through 1976 are treated. Equations, parameters, and associated variances describing the data are presented. The equations and parameters are in forms suitable for use in computer codes used to calculate the release of metallic fission products from HTGR fuel elements into the primary circuit. The data cover the following processes: (1) diffusion of cesium in fuel kernels and pyrocarbon, (2) sorption of cesium on fuel rod matrix material and on graphite, and (3) migration of cesium in graphite. The data are being confirmed and extended through work in progress

  18. LNA aptamer based multi-modal, Fe3O4-saturated lactoferrin (Fe3O4-bLf) nanocarriers for triple positive (EpCAM, CD133, CD44) colon tumor targeting and NIR, MRI and CT imaging.

    Science.gov (United States)

    Roy, Kislay; Kanwar, Rupinder K; Kanwar, Jagat R

    2015-12-01

    This is the first ever attempt to combine anti-cancer therapeutic effects of emerging anticancer biodrug bovine lactoferrin (bLf), and multimodal imaging efficacy of Fe3O4 nanoparticles (NPs) together, as a saturated Fe3O4-bLf. For cancer stem cell specific uptake of nanocapsules/nanocarriers (NCs), Fe3O4-bLf was encapsulated in alginate enclosed chitosan coated calcium phosphate (AEC-CP) NCs targeted (Tar) with locked nucleic acid (LNA) modified aptamers against epithelial cell adhesion molecule (EpCAM) and nucleolin markers. The nanoformulation was fed orally to mice injected with triple positive (EpCAM, CD133, CD44) sorted colon cancer stem cells in the xenograft cancer stem cell mice model. The complete regression of tumor was observed in 70% of mice fed on non-targeted (NT) NCs, with 30% mice showing tumor recurrence after 30 days, while only 10% mice fed with Tar NCs showed tumor recurrence indicating a significantly higher survival rate. From tumor tissue analyses of 35 apoptotic markers, 55 angiogenesis markers, 40 cytokines, 15 stem cell markers and gene expression studies of important signaling molecules, it was revealed that the anti-cancer mechanism of Fe3O4-bLf was intervened through TRAIL, Fas, Fas-associated protein with death domain (FADD) mediated phosphorylation of p53, to induce activation of second mitochondria-derived activator of caspases (SMAC)/DIABLO (inhibiting survivin) and mitochondrial depolarization leading to release of cytochrome C. Induction of apoptosis was observed by inhibition of the Akt pathway and activation of cytokines released from monocytes/macrophages and dendritic cells (interleukin (IL) 27, keratinocyte chemoattractant (KC)). On the other hand, the recurrence of tumor in AEC-CP-Fe3O4-bLf NCs fed mice mainly occurred due to activation of alternative pathways such as mitogen-activated protein kinases (MAPK)/extracellular signal-regulated kinases (ERK) and Wnt signaling leading to an increase in expression of survivin

  19. Cesium Ion Exchange Using Tank 241-AN-104 Supernate

    International Nuclear Information System (INIS)

    The River Protection Project is to design and build a high level nuclear waste treatment facility. The waste treatment plant is to process millions of gallons of radioactive waste stored in tanks at the Hanford Site. The high level nuclear waste treatment process includes various unit operations, such as ultrafiltration, precipitation, evaporation, ion exchange, and vitrification. Ion exchange is identified as the optimal treatment method for removal of cesium-137 and Tc-99 from the waste. Extensive ion exchange testing was performed using small-scale columns with actual waste samples. The objectives of this study were to: demonstrate SuperLig 644 ion exchange performance and process steps for the removal of cesium from actual AN-104 tank waste; pretreat actual AN-104 tank waste to reduce the concentration of cesium-137 in the waste below LAW vitrification limit; produce and characterize cesium eluate solutions for use in eluate evaporation tests. The experiments consisted of batch contact and small-scale column tests. The batch contact tests measured sorption partition coefficients Kds. The Kds were used to predict the effective resin capacity. The small-scale column tests, which closely mimic plant conditions, generated loading and elution profile data used to determine whether removal targets and design requirements were met

  20. Decorporation of cesium-137; Decorporation du cesium-137

    Energy Technology Data Exchange (ETDEWEB)

    Le Fleche, Ph.; Destombe, C.; Grasseau, A.; Mathieu, J.; Chancerelle, Y.; Mestries, J.C. [GMR, Direction des Recherches, Etudes et Techniques, 94 - Arcueil (France)

    1997-12-31

    Cesium radio-isotopes, especially cesium-137 ({sup 137}Cs) are among the radionuclides of main importance produced by a fission reaction in reactor or a nuclear weapon explosion. In the environment, {sup 137}Cs is a major contaminant which can cause severe {beta}, {gamma}irradiations and contaminations. {sup 137}Cs is distributed widely and relatively uniformly throughout the body with the highest concentration in skeletal muscles. A treatment becomes difficult afterwards. The purposes of this report are Firstly to compare the Prussian blue verses cobalt and potassium ferrocyanide (D.I. blue) efficiency for the {sup 137}Cs decorporation and secondly to assess a chronological treatment with D.I. blue. (author)

  1. Extraction of radioactive cesium from tea leaves

    International Nuclear Information System (INIS)

    Radioactive contamination of foodstuffs attributed to the Fukushima Daiichi nuclear disaster has become a social problem. This study investigated the extraction of radioactive cesium from the contaminated leaves to the tea. The green tea was brewed twice reusing the same leaves to study the difference in extraction of cesium between the first and second brew. Moreover, the extraction of cesium was studied in correlation to brewing time. The concentration of radioactive cesium was determined with gamma spectrometry, and the concentration of caffeine was determined with absorption spectrometry. About 40% of cesium was extracted from leaves in the first brew, and about 80% was extracted in the second brew. The extraction of cesium increased over time, and it reached about 80% after 10 minutes brew. The ratio of radioactive cesium to caffeine decreased linearly over time. This study revealed that the extraction of cesium was higher for the second brew, and a rapid increase in extraction was seen as the tea was brewed for 6 minutes and more. Therefore, the first brew of green tea, which was brewed within 5 minutes, contained the least extraction of radioactive cesium from the contaminated leaves. (author)

  2. Activity of cesium-134 and cesium-137 in game and mushrooms in Poland

    International Nuclear Information System (INIS)

    The activity of cesium-134 and cesium-137 was measured in mushrooms and game in 1986-1991. The samples were collected all over Poland and most of the measurements were carried out for export purposes. The results indicate that the activity ratio of cesium-137 to cesium-134 in some samples is not comparable to that with fallout after the Chernobyl accident. The analysis of some samples of mushrooms from 1985 showed that the activity of cesium-137 was higher compared to any other foodstuff. The level of contamination varied greatly throughout Poland

  3. The utility and limitations of glycosylated human CD133 epitopes in defining cancer stem cells

    Science.gov (United States)

    Bidlingmaier, Scott; Zhu, Xiaodong; Liu, Bin

    2008-01-01

    Human CD133 (human prominin-1), a five transmembrane domain glycoprotein, was originally identified as a cell surface antigen present on CD34+ hematopoietic stem cells. Although the biological function of CD133 is not well understood, antibodies to CD133 epitopes have been widely used to purify hematopoietic stem and progenitor cells. The cancer stem cell (CSC) hypothesis postulates that a rare population of tumor cells possessing increased capacities for self-renewal and tumor initiation is responsible for maintaining the growth of neoplastic tissue. The expression of the CD133 epitopes, AC133 and AC141, has been shown to define a subpopulation of brain tumor cells with significantly increased capacity for tumor initiation in xenograft models. Following the discovery of the AC133/AC141+ population of brain tumor stem cells, the AC133 and AC141 epitopes have been extensively used as markers for purifying CSCs in other solid tumors. There are, however, several issues associated with the use of the AC133 and AC141 CD133 epitopes as markers for CSCs. The antibodies routinely used for purification of AC133 and AC141-positive cells target poorly characterized glycosylated epitopes of uncertain specificity. Discordant expression of the AC133 and AC141 epitopes has been observed, and the epitopes can be absent despite the presence of CD133 protein. In addition, CD133 expression has recently been shown to be modulated by oxygen levels. These factors, in combination with the uncertain biological role of CD133, suggest that the use of CD133 expression as a marker for CSCs should be critically evaluated in each new experimental system and highlight the need for additional CSC surface markers that are directly involved in maintaining CSC properties. PMID:18535813

  4. The biological difference between CD13+CD133+ and CD13¬CD133¬liver cancer cells and its clinical significance

    Directory of Open Access Journals (Sweden)

    Shi-long JIN

    2013-09-01

    Full Text Available Objective To compare the biological difference between CD13+CD133+ and CD13-CD133- hepatocellular carcinoma (HCC cells in HuH7 cell line and its clinical significance. Methods The status of proliferation, phase of the cell cycle, tumor formation in vivo, differentiation, and their chemoresistance to 5-FU and pirarubicin of CD13+CD133+ and CD13-CD133-HCC cells were studied to analyze the clinical implication of CD13+CD133+HCC cell subset. Results The proliferation rate of CD13+CD133+HCC cells was significantly higher than that of CD13-CD133-HCC cells. The cell-cycle phase study showed that 78.45% of the CD13+CD133+HCC cells were in the G0/G1 phase, 2.19% in G2/M phase, and 19.36% in S phase, while 62.18% CD13-CD133-HCC cells were in the G0/G1 phase, 11.88% in G2/M phase, and 25.95% in S phase. Limiting dilution analysis of HuH7 cells revealed that 1×103 CD13+CD133+ cells could form the tumor, while 1×105 CD13-CD133- cells did. CD13+CD133+ cells showed chemoresistance to 5-FU and pirarubicin, while other three subsets succumbed to the drugs. Conclusion CD13+CD133+ cancer cells in HuH7 showed the characteristics of cancer stem cells (CSCs, which might contribute to the relapse and metastasis of liver cancer, and they may be the main target for chemotherapy in human liver cancer.

  5. PIXE analyses of cesium in rice grains

    Science.gov (United States)

    Sugai, Hiroyuki; Ishii, Keizo; Matsuyama, Shigeo; Terakawa, Atsuki; Kikuchi, Yohei; Takahashi, Hiroaki; Ishizaki, Azusa; Fujishiro, Fumito; Arai, Hirotsugu; Osada, Naoyuki; Karahashi, Masahiro; Nozawa, Yuichiro; Yamauchi, Shosei; Kikuchi, Kosuke; Koshio, Shigeki; Watanabe, Koji

    2014-01-01

    The Fukushima nuclear power plant accident released vast amounts of radioactive material into the environment. For instance, 134Cs and 137Cs have half-lives of about 2 and 30 years, respectively, and emit many harmful gamma rays. In 2012, rice with radioactivity >100 Bq/kg was occasionally reported in Fukushima prefecture. To determine where and how cesium accumulates in rice, we grew rice in soil containing stable cesium and investigated the distribution of cesium in rice using particle-induced X-ray emission (PIXE). This study found that cesium is accumulated in bran and germ at high concentrations, and white rice contains 40% of the cesium found in brown rice.

  6. Multiphoton ionization of atomic cesium

    International Nuclear Information System (INIS)

    We describe experimental studies of resonantly enhanced multiphoton ionization (MPI) of cesium atoms in the presence and absence of an external electric field. In the zero-field studies, photoelectron angular distributions for one- and two-photon resonantly enhanced MPI are compared with the theory of Tang and Lambropoulos. Deviations of experiment from theory are attributed to hyperfine coupling effects in the resonant intermediate state. The agreement between theory and experiment is excellent. In the absence of an external electric field, signal due to two-photon resonant three-photon ionization of cesium via np states is undetectable. Application of an electric field mixes nearby nd and ns levels, thereby inducing excitation and subsequent ionization. Signal due to two-photon excitation of ns levels in field-free experiments is weak due to their small photoionization cross section. An electric field mixes nearby np levels which again allows detectable photoionization signal. For both ns and np states the field induced MPI signal increases as the square of the electric field for a given principal quantum number and increases rapidly with n for a given field strength. Finally, we note that the classical two-photon field-ionization threshold is lower for the case in which the laser polarization and the electric field are parallel than it is when they are perpendicular. 22 references, 11 figures

  7. Example of cesium sorption database in natural minerals

    International Nuclear Information System (INIS)

    In the database of the National Institute for Materials Science (MatNavi), the adsorption data of cesium, strontium, and iodine have been published. Among these data, the authors picked up the data of cesium adsorption against natural ores, which were measured and compiled by the authors, graphically expressed them for clarifying the overall trends, and described each mineral’s adsorption characteristics and future challenges. The partition coefficients for the following minerals are compiled: bentonite, acid clay, montmorillonite, beidellite, vermiculite, illite, mordenite, zeolite, etc. Many of the recorded data in MatNavi are the data obtained in the systems without existence of a large amount of competing ions. On the other hand, in the accumulated water at the Fukushima Daiichi Nuclear Power Station, competing ions due to seawater are contained. In the immersion liquid of incineration fly ash and the immersion liquid of plants/vegetation, too, competing ions are considered to be contained. Accumulation of adsorption data under different solution conditions are considered important. In addition, the concentrations of radioactive cesium in decontamination target are lower values by 5-7 orders, compared with the lower limit of 0.01 ppm in the existing data. In face of experiments, the influence of adsorption to containers and filters cannot be neglected. (A.O.)

  8. Tungstate-based glass-ceramics for the immobilization of radio cesium

    Energy Technology Data Exchange (ETDEWEB)

    Drabarek, Elizabeth; McLeod, Terry I.; Hanna, John V.; Griffith, Christopher S. [Australian Nuclear Science and Technology Organisation, Institute of Materials Engineering, New Illawarra Road, PMB 1, Menai, Lucas Heights, NSW 2234 (Australia); Luca, Vittorio [Australian Nuclear Science and Technology Organisation, Institute of Materials Engineering, New Illawarra Road, PMB 1, Menai, Lucas Heights, NSW 2234 (Australia)], E-mail: vlu@ansto.gov.au

    2009-02-15

    The preparation of tungstate-containing glass-ceramic composites (GCC) for the potential immobilization of radio cesium has been considered. The GCC materials were prepared by blending two oxide precursor compositions in various proportions. These included a preformed Cs-containing hexagonal tungsten bronze (HTB) phase (Cs{sub 0.3}Ti{sub 0.2}W{sub 0.8}O{sub 3}, P6{sub 3}/mcm) and a blend of silica and other oxides. The use of the HTB phase was motivated on the assumption that a HTB-based adsorbent could be used to remove cesium directly from aqueous high level liquid waste feeds. In the absence of the HTB, glass-ceramics were relatively easily prepared from the Cs-containing glass-forming oxide blend. On melting the mixture a relative complex GCC phase assemblage formed. The principal components of this phase assemblage were determined using X-ray powder diffraction, {sup 133}Cs MAS-NMR, and cross-sectional SEM and included glass, various zeolites, scheelite (CaWO{sub 4}) and a range of other oxide phases and Cs-containing aluminosilicate. Importantly, under no circumstance was cesium partitioned into the glass phase irrespective of whether or not the composition included the preformed Cs-containing HTB compound. For compositions containing the HTB, cesium was partitioned into one of four major phases including zeolite; Cs-silica-tungstate bronze, pollucite (CsAlSi{sub 2}O{sub 6}), and an aluminosilicate with an Al/Si ratio close to one. The leach resistance of all materials was evaluated and related to the cesium distribution within the GCC phase assemblages. In general, the GCCs prepared from the HTB had superior durability compared with materials not containing tungsten. Indeed the compositions in many cases had leach resistances comparable to the best ceramics or glass materials.

  9. Tungstate-based glass-ceramics for the immobilization of radio cesium

    International Nuclear Information System (INIS)

    The preparation of tungstate-containing glass-ceramic composites (GCC) for the potential immobilization of radio cesium has been considered. The GCC materials were prepared by blending two oxide precursor compositions in various proportions. These included a preformed Cs-containing hexagonal tungsten bronze (HTB) phase (Cs0.3Ti0.2W0.8O3, P63/mcm) and a blend of silica and other oxides. The use of the HTB phase was motivated on the assumption that a HTB-based adsorbent could be used to remove cesium directly from aqueous high level liquid waste feeds. In the absence of the HTB, glass-ceramics were relatively easily prepared from the Cs-containing glass-forming oxide blend. On melting the mixture a relative complex GCC phase assemblage formed. The principal components of this phase assemblage were determined using X-ray powder diffraction, 133Cs MAS-NMR, and cross-sectional SEM and included glass, various zeolites, scheelite (CaWO4) and a range of other oxide phases and Cs-containing aluminosilicate. Importantly, under no circumstance was cesium partitioned into the glass phase irrespective of whether or not the composition included the preformed Cs-containing HTB compound. For compositions containing the HTB, cesium was partitioned into one of four major phases including zeolite; Cs-silica-tungstate bronze, pollucite (CsAlSi2O6), and an aluminosilicate with an Al/Si ratio close to one. The leach resistance of all materials was evaluated and related to the cesium distribution within the GCC phase assemblages. In general, the GCCs prepared from the HTB had superior durability compared with materials not containing tungsten. Indeed the compositions in many cases had leach resistances comparable to the best ceramics or glass materials

  10. An isotope dilution-precipitation process for removing radioactive cesium from wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Harold, E-mail: rogers22@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA, 94550 (United States); Bowers, John; Gates-Anderson, Dianne [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA, 94550 (United States)

    2012-12-15

    Highlights: Black-Right-Pointing-Pointer Developed an isotope dilution-precipitation treatment process for Cs-137 contaminated water. Black-Right-Pointing-Pointer Waste seeded with non-radioactive Cs-133 prior to precipitation with sodium tetraphenylborate. Black-Right-Pointing-Pointer Final Cs-137 concentrations below DOE discharge limit of 3.0 Multiplication-Sign 10{sup -6} {mu}Ci/mL can be achieved. Black-Right-Pointing-Pointer Synthetic wastewater, and industrial low level radioactive proof of principle studies completed. - Abstract: A novel isotope dilution-precipitation method has been developed to remove cesium-137 from radioactive wastewater. The process involves adding stable cesium chloride to wastewater in order to raise the total cesium concentration, which then allows both the stable and radioactive cesium ions to be precipitated together using sodium tetraphenylborate. This process was investigated utilizing laboratory solutions to determine stable cesium dose rates, mixing times, effects of pH, and filtration requirements. Once optimized, the process was then tested on synthetic wastewater and aqueous low-level waste. Experiments showed the reaction to be very quick and stable in the pH range tested, 2.5-11.5. The wastewater may need to be filtered using a 0.45-{mu}m filter, though ferric sulfate has been shown to promote coagulation and settling, thereby eliminating the necessity for filtration. This investigation showed that this isotope dilution-precipitation process can remove Cs-37 levels below the U.S. Department of Energy's (DOE) Derived Concentration Standard (DCS) of 3.0 Multiplication-Sign 10{sup -6} {mu}Ci/mL using a single dosage, potentially allowing the wastewater to be discharged directly to sanitary sewers.

  11. Surface tension of liquid dilute solutions of lead-cesium and bismuth-cesium systems

    International Nuclear Information System (INIS)

    Method of the maximal pressure in a drop was used to measure the surface tension of 15 liquid dilute solutions of lead-cesium system in 0-0.214 at% concentration range and of 12 diluted solutions of bismuth-cesium system in 0-0.160 at.% cesium range from solidification temperature up to 500 dec C. It was found that cesium was characterized as surfactant in lead and bismuth melts. It was established that the temperature coefficient of surface tension changes sufficiently in maximally diluted solutions of alkali metals in bismuth and lead melts. Effect of sodium, potassium, rubidum and cesium on the value of surface tension of lead and bismuth was systematized. Growth of activity in sodium, potassium, rubidium and cesium series was noted

  12. Chemoresistance of CD133{sup +} colon cancer may be related with increased survivin expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Cho, Mee-Yon, E-mail: meeyon@yonsei.ac.kr [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Institute of Genomic Cohort, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of)

    2015-07-31

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133{sup +} colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133{sup −} cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133{sup +} and siRNA-induced CD133{sup −} cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133{sup +} cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133{sup +} cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133{sup +} cells at 96 h after siRNA transfection. From this study, we conclude that CD133{sup +} cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133{sup +} colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133{sup +} cells and siRNA-induced CD133{sup −} cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133{sup +} colon cancer cells.

  13. Chemoresistance of CD133+ colon cancer may be related with increased survivin expression

    International Nuclear Information System (INIS)

    CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133+ colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133− cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133+ and siRNA-induced CD133− cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133+ cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133+ cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133+ cells at 96 h after siRNA transfection. From this study, we conclude that CD133+ cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133+ colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133+ cells and siRNA-induced CD133− cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133+ colon cancer cells

  14. Decontamination of radioactive cesium in soil

    International Nuclear Information System (INIS)

    Agricultural soil containing radioactive cesium was decontaminated using an extraction method involving aqueous potassium solutions. Results demonstrated that the potassium solution could extract radioactive cesium from soil artificially contaminated with 137Cs, although extraction rate decreased as time after contamination increased. However, visual examination of radioactivity distribution in soil samples significantly contaminated by the accident at the Fukushima Daiichi nuclear power plant showed that radioactive cesium also existed as insoluble particles. Therefore, reducing the volume of radioactive wastes generated from soil decontamination requires a physical decontamination method combined with chemical treatment. (author)

  15. Studies on cesium uptake by phenolic resins

    International Nuclear Information System (INIS)

    The selective removal of cesium by phenolic ion-exchange resins from highly salted alkaline radioactive solutions was studied. The resins were synthesized by alkaline polycondensation of phenol, resorcinol, catechol, and resorcinol-catechol mixture with formaldehyde and characterized for their moisture regain, ion-exchange (H+ → Na+) capacity, and distribution coefficient (KD) for cesium. The effects of open and sealed curing of the polymers on their properties were studied. The effect of Na+, NaOH, and Cs+ concentration on the uptake of cesium by resorcinol-formaldehyde resin was investigated, in particular. The chemical, thermal, and radiation stabilities of the polymers were also studied

  16. Sorption of cesium on Latvian clays

    International Nuclear Information System (INIS)

    Cesium is like potassium - good solubility and mobile in a ground, easily assimilate in organism expressly brawn woof. It is a problem if pollutant is a radioactive 137Cs. We made experiments to sorption a 2M CsF solution on some Latvian clays which mainly contain hydro micas (cesium content after good elute of clays are in table). We establish, that clay treated with 25 % sulfuric acid adsorb cesium two times more that waste clay. Hereto unstuck elute Cs from clays. (author)

  17. Characterization of CD133+ hepatocellular carcinoma cells as cancer stem/progenitor cells

    International Nuclear Information System (INIS)

    The CD133 antigen, identified as a hematopoietic stem cell marker, appears in various human embryonic epithelia including the neural tube, gut, and kidney. We herein investigated whether CD133+ cells isolated from human hepatocellular carcinoma cell lines possess cancer stem/progenitor cell-like properties. Among the three cell lines studied, the CD133 antigen was found to be expressed only on the surface of Huh-7 cells. CD133+ cells from Huh-7 performed a higher in vitro proliferative potential and lower mRNA expressions of mature hepatocyte markers, glutamine synthetase and cytochrome P450 3A4, than CD133- population of Huh-7 cells. When either CD133+ or CD133- cells were subcutaneously injected into SCID mice, CD133+ cells formed tumors, whereas CD133- cells induced either a very small number of tumors or none at all. Taken together, the identification of CD133+ cells could thus be a potentially powerful tool to investigate the tumorigenic process in the hepatoma system and to also develop effective therapies targeted against hepatocellular carcinoma

  18. Method for monitoring radioactive cesium concentration in water using cesium adsorption disk and GM survey meter

    International Nuclear Information System (INIS)

    A method for monitoring radioactive cesium concentration in water using a cesium adsorption disk and a GM survey meter has been developed to ascertain whether the water quality meets standards on radiological contaminants in water. In this method, both dissolved and suspended forms of radioactive cesium are collected on the cesium adsorption disk by means of filtration of a water sample. Beta count rate of the disk is converted into radioactivity using a conservative calibration factor obtained here. The present method was applied to monitoring of decontaminated water of an outdoor school swimming pool in Date City after Fukushima Daiichi Nuclear Power Plant accident. (author)

  19. Trapping characteristics for gaseous cesium generated from different cesium compounds by fly ash filter

    International Nuclear Information System (INIS)

    The purpose of this study is to evaluate the applicability of the fly ash ceramic foam filter to trap gaseous cesium generated during the OREOX and sintering processes of DUPIC green pellets. The trapping experiments of gaseous cesium generated from different cesium compounds using fly ash filters were carried out in a two-zone furnace under air and hydrogen (Ar/4% H2) conditions. XRD and SEM analyses were used to analyze reaction products of different cesium compounds with fly ash filters. To manufacture ceramic foam filters, fly ash with a Si/Al mole ratio of 2.1 and polyvinyl alcohol as binder were used. Reaction products formed by the trapping reaction of different cesium compounds with fly ash filters were investigated. The major reaction products of gaseous cesium generated from cesium silicate and CsI by fly ash filters indicated that pollucite (CsAlSi2O6) phase was formed under air and hydrogen conditions when the carrier gas velocity was 2 cm/sec. The minimum reaction temperature of fly ash filter with gaseous cesium was determined as about 600 deg. C. Finally, off-gas treatment system of sintering process in a hot cell of lMEF was explained as an application example of fly ash filter for trapping gaseous cesium. (author)

  20. Sintered wire cesium dispenser photocathode

    Energy Technology Data Exchange (ETDEWEB)

    Montgomery, Eric J; Ives, R. Lawrence; Falce, Louis R

    2014-03-04

    A photoelectric cathode has a work function lowering material such as cesium placed into an enclosure which couples a thermal energy from a heater to the work function lowering material. The enclosure directs the work function lowering material in vapor form through a low diffusion layer, through a free space layer, and through a uniform porosity layer, one side of which also forms a photoelectric cathode surface. The low diffusion layer may be formed from sintered powdered metal, such as tungsten, and the uniform porosity layer may be formed from wires which are sintered together to form pores between the wires which are continuous from the a back surface to a front surface which is also the photoelectric surface.

  1. Cesium and strontium ion specific exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Yates, S.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with AlliedSignal, Inc. (Des Plaines, Illinois) to develop inorganic ion exchangers that are selective for strontium and cesium from alkaline high-level waste and groundwater streams.

  2. Sorption of Cesium on Latvia clays

    International Nuclear Information System (INIS)

    Cesium is like potassium - good solubility and mobile in a ground, easy assimilates in organism expressly brawn woof. It is a problem if pollutant is radioactive 137Cs. We made experiments to sorption a 2M CsF solution on some Latvian clays which mainly contain hydro micas. We establish that clay treated with 25% sulfuric acid absorb cesium two times more that waste clay. Hereto unstuck elute Cs from clays

  3. Longitudinal Wobbling in $^{133}$La

    CERN Document Server

    Biswas, S; Garg, U; Bhat, G H; Frauendorf, S; Li, W; Sheikh, J A; Sethi, J; Saha, S; Singh, Purnima; Choudhury, D; Matta, J T; Ayangeakaa, A D; Dar, W >; Singh, V; Sihotra, S

    2016-01-01

    Excited states of $^{133}$La have been investigated to search for the wobbling excitation mode in the low-spin regime. Wobbling bands with $n_\\omega$ = 0 and 1 are identified along with the interconnecting $\\Delta I$ = 1, $E2$ transitions, which are regarded as fingerprints of the wobbling motion. An increase in wobbling frequency %of the $n_\\omega$ = 1 band with spin implies longitudinal wobbling for $^{133}$La, in contrast with the case of transverse wobbling observed in $^{135}$Pr. This is the first observation of a longitudinal wobbling band in nuclei. The experimental observations are accounted for by calculations using the quasiparticle triaxial rotor with harmonic frozen approximation and the triaxial projected shell model approaches, which attribute the appearance of longitudinal wobbling to the early alignment of an h$_{11/2}$ neutron pair.

  4. 10 CFR 501.133 - DOE evaluation.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false DOE evaluation. 501.133 Section 501.133 Energy DEPARTMENT... Interpretation § 501.133 DOE evaluation. (a)(1) The record shall consist of the request for an interpretation and... investigate and corroborate any statement in a request or related documents and may utilize in its...

  5. 7 CFR 29.133 - Identification number.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Identification number. 29.133 Section 29.133... REGULATIONS TOBACCO INSPECTION Regulations Miscellaneous § 29.133 Identification number. The Director may require the use of official identification numbers in connection with tobacco certificated or...

  6. 49 CFR 383.133 - Testing methods.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Testing methods. 383.133 Section 383.133... STANDARDS; REQUIREMENTS AND PENALTIES Tests § 383.133 Testing methods. (a) All tests shall be constructed in... must be at least as stringent as the Federal standards. (c) States shall determine specific methods...

  7. 14 CFR 133.21 - Personnel.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Personnel. 133.21 Section 133.21 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR CARRIERS... OPERATIONS Certification Rules § 133.21 Personnel. (a) The applicant must hold, or have available...

  8. 20 CFR 220.133 - Skill requirements.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Skill requirements. 220.133 Section 220.133... DISABILITY Vocational Considerations § 220.133 Skill requirements. (a) General. To evaluate skills and to... claimant does not gain work skills by doing unskilled jobs. For example, jobs are considered unskilled...

  9. 47 CFR 24.133 - Emission limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Emission limits. 24.133 Section 24.133... SERVICES Narrowband PCS § 24.133 Emission limits. (a) The power of any emission shall be attenuated below... the lesser attenuation. (b) The measurements of emission power can be expressed in peak or...

  10. 14 CFR 65.133 - Seal.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Seal. 65.133 Section 65.133 Aeronautics and...: AIRMEN OTHER THAN FLIGHT CREWMEMBERS Parachute Riggers § 65.133 Seal. Each certificated parachute rigger must have a seal with an identifying mark prescribed by the Administrator, and a seal press....

  11. 10 CFR 71.133 - Corrective action.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Corrective action. 71.133 Section 71.133 Energy NUCLEAR....133 Corrective action. The licensee, certificate holder, and applicant for a CoC shall establish... determined and corrective action taken to preclude repetition. The identification of the...

  12. 33 CFR 117.133 - Ouachita River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Ouachita River. 117.133 Section 117.133 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Arkansas § 117.133 Ouachita River. The draw of the...

  13. 14 CFR 1264.133 - Evidence.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Evidence. 1264.133 Section 1264.133... PENALTIES ACT OF 1986 § 1264.133 Evidence. (a) The presiding officer shall determine the admissibility of evidence. (b) Except as provided herein, the presiding officer shall not be bound by the Federal Rules...

  14. 21 CFR 133.142 - Gouda cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Gouda cheese. 133.142 Section 133.142 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.142 Gouda cheese. Gouda cheese conforms to the definition and standard of identity...

  15. 21 CFR 133.164 - Nuworld cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nuworld cheese. 133.164 Section 133.164 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.164 Nuworld cheese. (a) Description. (1) Nuworld cheese is the food prepared by...

  16. 21 CFR 133.128 - Cottage cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cottage cheese. 133.128 Section 133.128 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.128 Cottage cheese. (a) Cottage cheese is the soft uncured cheese prepared by mixing...

  17. 21 CFR 133.183 - Romano cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Romano cheese. 133.183 Section 133.183 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.183 Romano cheese. (a) Romano cheese is the food prepared from cow's milk or sheep's milk...

  18. 21 CFR 133.140 - Gammelost cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Gammelost cheese. 133.140 Section 133.140 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.140 Gammelost cheese. (a) Description. (1) Gammelost cheese is the food prepared from...

  19. Physical Property Modeling of Concentrated Cesium Eluate Solutions, Part I - Derivation of Models

    Energy Technology Data Exchange (ETDEWEB)

    Choi, A.S.; Pierce, R. A.; Edwards, T. B.; Calloway, T. B.

    2005-09-15

    Major analytes projected to be present in the Hanford Waste Treatment Plant cesium ion-exchange eluate solutions were identified from the available analytical data collected during radioactive bench-scale runs, and a test matrix of cesium eluate solutions was designed within the bounding concentrations of those analytes. A computer model simulating the semi-batch evaporation of cesium eluate solutions was run in conjunction with a multi-electrolyte aqueous system database to calculate the physical properties of each test matrix solution concentrated to the target endpoints of 80% and 100% saturation. The calculated physical properties were analyzed statistically and fitted into mathematical expressions for the bulk solubility, density, viscosity, heat capacity and volume reduction factor as a function of temperature and concentration of each major analyte in the eluate feed. The R{sup 2} of the resulting physical property models ranged from 0.89 to 0.99.

  20. Removal of cesium from wastewater: A cesium-specific ion exchange resin

    International Nuclear Information System (INIS)

    Researchers at the Savannah River Laboratory (SRL) have applied for a patent for an ion exchange resin that will remove cesium from water. Radioactive cesium-137 is a fission product of nuclear reactor operations. Cesium may enter the water of spent fuel holding basins through defects in fuel cladding. Control of cesium in these basins is desirable to keep personnel exposure to a minimum. Cesium is also present in the waste from reprocessing of defense nuclear reactor fuel. Research has been underway at SRL for over a decade to improve management of high-level reprocessing waste. The current technology separates the waste into soluble and insoluble components. Radioactive constituents are removed from the soluble component stream and combined with the insoluble components, which are then converted to a glass for long-term storage. Cesium is the most radioactive constituent of the soluble components stream. The SRL resin is a resorcinol-formaldehyde condensation polymer highly specific for cesium and is about 10 times more effective in removal of cesium than other ion exchange resins evaluated for use in processing defense nuclear waste. Tests have been run at SRL using both simulated and actual waste streams

  1. Preferential removal and immobilization of stable and radioactive cesium in contaminated fly ash with nanometallic Ca/CaO methanol suspension

    International Nuclear Information System (INIS)

    Graphical abstract: Schematic representation of possible mechanisms determining the Cs extraction and immobilization in fly ash during water, methanol or n-MCaS extraction. - Highlights: • nMCaS suspension for cesium extraction and immobilization in fly ash was developed. • Enhanced cesium immobilization was done by nanometallic Ca/CaO methanol suspension. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • nMCaS unique and a highly potential amendment for the remediation of Cs. - Abstract: In this work, the capability of nanometallic Ca/CaO methanol suspension in removing and/or immobilizing stable (133Cs) and radioactive cesium species (134Cs and 137Cs) in contaminated fly ash was investigated. After a first methanol and second water washing yielded only 45% of 133Cs removal. While, after a first methanol washing, the second solvent with nanometallic Ca/CaO methanol suspension yielded simultaneous enhanced removal and immobilization about 99% of 133Cs. SEM-EDS analysis revealed that the mass percent of detectable 133Cs on the fly ash surface recorded a 100% decrease. When real radioactive cesium contaminated fly ash (containing an initial 14,040 Bq kg−1134Cs and 137Cs cumulated concentration) obtained from burning wastes from Fukushima were reduced to 3583 Bq kg−1 after treatment with nanometallic Ca/CaO methanol suspension. Elution test conducted on the treated fly ash gave 100 Bq L−1 total 134Cs and 137Cs concentrations in eluted solution. Furthermore, both ash content and eluted solution concentrations of 134Cs and 137Cs were much lower than the Japanese Ministry of the Environment regulatory limit of 8000 Bq kg−1 and 150 Bq L−1 respectively. The results of this study suggest that the nanometallic Ca/CaO methanol suspension is a highly potential amendment for the remediation of radioactive cesium-contaminated fly ash

  2. Rac1+ cells distributed in accordance with CD 133+ cells in glioblastomas and the elevated invasiveness of CD 133+ glioma cells with higher Rac1 activity

    Institute of Scientific and Technical Information of China (English)

    ZHANG Bin; SUN Jian; YU Sheng-ping; CHEN Cong; LIU Bin; LIU Zhi-feng; REN Bing-cheng; MING Hao-lang; YANG Xue-jun

    2012-01-01

    the basement membrane of the vessels and myelinated nerve fibers.Rac1 expression was high and diffused in the central parts of the GBMs,and the Rac1+ cells were distributed basically in accordance with CD133+ cells both in the central and peripheral parts of GBMs.In double-labeling immunofluorescence,Rac1 was expressed in (83.14±4.23)% of CD133+ cells,and CD133 and Rac1 co-expressed cells were located around the vessels in GBMs.Significantly higher amounts of Rac1-GTP were expressed in the CD133+ cells (0.378+0.007),compared to CD133-cells (0.195±0.004) (t=27.81; P <0.05).CD133+ cells had stronger ability to migrate (74.34±2.40 vs.38.72±2.60,t=42.71,P <0.005) and invade (52.00±2.28 vs.31.26±1.82,t=30.76,P <0.005),compared to their counterpart CD133-cells in transwell cell migration/invasion assay.Conclusions These data suggest that CD133+ GBM cells highly express Rac1 and have greater potential to migrate and invade through activated Rac1-GTP.The accordance of distribution between Rac1+ cells and CD133+ cells in GBMs implies that Rac1 might be an inhibited target to prevent invasion and migration and to avoid malignant glioma recurrence.

  3. Experiments and simulations for the dynamics of cesium in negative hydrogen ion sources for ITER N-NBI

    International Nuclear Information System (INIS)

    The injection of fast neutral particles (NBI) into a fusion plasma is an important method for plasma heating and current drive. A source for negative deuterium ions delivering an 1 MeV beam that is accelerated to a specific energy and neutralized by a gas target is required for the ITER-NBI. Cesium seeding is required to extract high negative ion current densities from these sources. The optimization of the cesium homogeneity and control are major objectives to achieve the source requirements imposed by ITER. Within the scope of this thesis, the Monte Carlo based numerical transport simulation CsFlow3D was developed, which is the first computer model that is capable of simulating the flux and the accumulation of cesium on the surfaces of negative-ion sources. Basic studies that support the code development were performed at a dedicated experiment at the University of Augsburg. Input parameters of the ad- and desorption of cesium at ion source relevant conditions were taken from systematic measurements with a quartz micro balance, while the injection rate of the cesium oven at the ion source was determined by surface ionization detection. This experimental setup was used for further investigations of the work function of cesium-coated samples during plasma exposure. (orig.)

  4. Experiments and simulations for the dynamics of cesium in negative hydrogen ion sources for ITER N-NBI

    Energy Technology Data Exchange (ETDEWEB)

    Gutser, Raphael

    2010-07-21

    The injection of fast neutral particles (NBI) into a fusion plasma is an important method for plasma heating and current drive. A source for negative deuterium ions delivering an 1 MeV beam that is accelerated to a specific energy and neutralized by a gas target is required for the ITER-NBI. Cesium seeding is required to extract high negative ion current densities from these sources. The optimization of the cesium homogeneity and control are major objectives to achieve the source requirements imposed by ITER. Within the scope of this thesis, the Monte Carlo based numerical transport simulation CsFlow3D was developed, which is the first computer model that is capable of simulating the flux and the accumulation of cesium on the surfaces of negative-ion sources. Basic studies that support the code development were performed at a dedicated experiment at the University of Augsburg. Input parameters of the ad- and desorption of cesium at ion source relevant conditions were taken from systematic measurements with a quartz micro balance, while the injection rate of the cesium oven at the ion source was determined by surface ionization detection. This experimental setup was used for further investigations of the work function of cesium-coated samples during plasma exposure. (orig.)

  5. Radioactive cesium in Finnish mushrooms

    International Nuclear Information System (INIS)

    Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137Cs detected in the mushrooms mainly originates from the 137Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137Cs concentrations of mushrooms, the 137Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus cornucopioides often

  6. Plasma etching of cesium iodide

    International Nuclear Information System (INIS)

    Thick films of cesium iodide (CsI) are often used to convert x-ray images into visible light. Spreading of the visible light within CsI, however, reduces the resolution of the resulting image. Anisotropic etching of the CsI film into an array of micropixels can improve the image resolution by confining light within each pixel. The etching process uses a high-density inductively coupled plasma to pattern CsI samples held by a heated, rf-biased chuck. Fluorine-containing gases such as CF4 are found to enhance the etch rate by an order of magnitude compared to Ar+ sputtering alone. Without inert-gas ion bombardment, however, the CF4 etch becomes self-limited within a few microns of depth due to the blanket deposition of a passivation layer. Using CF4+Ar continuously removes this layer from the lateral surfaces, but the formation of a thick passivation layer on the unbombarded sidewalls of etched features is observed by scanning electron microscopy. At a substrate temperature of 220 deg. C, the minimum ion-bombardment energy for etching is Ei∼50 eV, and the rate depends on Ei1/2 above 65 eV. In dilute mixtures of CF4 and Ar, the etch rate is proportional to the gas-phase density of atomic fluorine. Above 50% CF4, however, the rate decreases, indicating the onset of net surface polymer deposition. These observations suggest that anisotropy is obtained through the ion-enhanced inhibitor etching mechanism. Etching exhibits an Arrhenius-type behavior in which the etch rate increases from ∼40 nm/min at 40 deg. C to 380 nm/min at 330 deg. C. The temperature dependence corresponds to an activation energy of 0.13±0.01 eV. This activation energy is consistent with the electronic sputtering mechanism for alkali halides

  7. Research on decontamination of cesium contaminated soil by electrokinetic process

    International Nuclear Information System (INIS)

    In this research, electrokinetic process was applied for the decontamination of cesium contaminated soil. As a result, about 4.0 times cesium removal was achieved by applying a DC electric field of 80 V/m to comparing zero electric field in treatment for 30 days. Therefore, the electrokinetic process has a possibility to decontamination of cesium contaminated soil. (author)

  8. Dicty_cDB: SLA133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA133 (Link to dictyBase) - - - Contig-U16455-1 SLA133Z (Link... to Original site) - - SLA133Z 728 - - - - Show SLA133 Library SL (Link to library) Clone ID SLA133 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-B/SLA133Q.Seq.d/ Representative seq. ID SLA13...3Z (Link to Original site) Representative DNA sequence >SLA133 (SLA133Q) /CSM/SL/SLA1-B/SLA133Q.Seq.d/ XXXXX...AAATAATATTTCTTAATAAATAGC ATTTTATAATAATTTTAA sequence update 1998. 4.11 Translated Amino Acid sequence ---rph

  9. Cesium ion uptake by moss (Hypnum cupressiforme)

    International Nuclear Information System (INIS)

    Lower land mosses uptake water and minerals from the atmosphere. They can collect metals polluting the air and radioactive fallout elements so they can be suitable for monitoring of these substances. Cesium ion uptake by Hypnum cupressiforme is studied by a radioactive tracer, 134Cs. The quantity of cesium ion in different celluar locations and the capacity of ion uptake is determined. The total capacity is found to be several times 10-3 mol g-1 and is therefore of the same order of magnitude as the cation exchange capacity of ion exchangers. The kinetics and reversibility of the process is studied as well. (orig.)

  10. Microbial accumulation of uranium, radium, and cesium

    International Nuclear Information System (INIS)

    Diverse microbial species varied considerably in their ability to accumulate uranium, cesium, and radium. Mechanistic differences in uranium uptake by Saccharomyces cerevisiae and Pseudomonas aeruginosa were indicated. S. serevisiae exhibited a slow (hours) surface accumulation of uranium which was subject to environmental factors, while P. aeruginosa accumulated uranium rapidly (minutes) as dense intracellular deposits and did not appear to be affected by environmental parameters. Metabolism was not required for uranium uptake by either organism. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several species tested

  11. Environmental transfer of radio-cesium

    International Nuclear Information System (INIS)

    A large amount of Cs 134 and 137 were emitted from the destroyed reactors of Fukushima Daiichi Nuclear Power Station and deposited on the soil surface of vast area including forests, fields, and residential areas. The present report explains mainly land transfer behaviors of cesium which deposited on the surface soils, absorbed into soil particles as time passed on and finally became difficult to move from the particles (aging effect). Depth-distribution of radio-cesium in rice paddy and grassland as well as the change over years is presented. Changes with the passage of time of Cs 137 concentrations in leaves of spinach, wormwood, and persimmon are also provided. (S. Ohno)

  12. Crystalline silicotitanates for cesium/strontium removal

    Energy Technology Data Exchange (ETDEWEB)

    Brown, N.; Miller, J.; Sherman, J.

    1996-10-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST) has been developed that exhibits very high selectivity for cesium and strontium in the highly alkaline radioactive wastes at the Hanford Site and other DOE sites. Tests have also shown that CSTs have high selectivity for cesium in acidic and neutral solutions. The ESP is supporting an effort at Sandia National Laboratories and Texas A & M University to further develop and characterize the important chemical and physical properties that will determine the applicability of CST to radioactive waste treatment at Hanford and other DOE facilities.

  13. 3-Bromopyruvate inhibits cell proliferation and induces apoptosis in CD133+ population in human glioma.

    Science.gov (United States)

    Xu, Dong-Qiang; Tan, Xiao-Yu; Zhang, Bao-Wei; Wu, Tao; Liu, Ping; Sun, Shao-Jun; Cao, Yin-Guang

    2016-03-01

    The study was aimed to investigate the role of 3-bromopyruvate in inhibition of CD133+ U87 human glioma cell population growth. The results demonstrated that 3-bromopyruvate inhibited the viability of both CD133+ and parental cells derived from U87 human glioma cell line. However, the 3-bromopyruvate-induced inhibition in viability was more prominent in CD133+ cells at 10 μM concentration after 48 h. Treatment of CD133+ cells with 3-bromopyruvate caused reduction in cell population and cell size, membrane bubbling, and degradation of cell membranes. Hoechst 33258 staining showed condensation of chromatin material and fragmentation of DNA in treated CD133+ cells after 48 h. 3-Bromopyruvate inhibited the migration rate of CD133+ cells significantly compared to the parental cells. Flow cytometry revealed that exposure of CD133+ cells to 3-bromopyruvate increased the cell population in S phase from 24.5 to 37.9 % with increase in time from 12 to 48 h. In addition, 3-bromopyruvate significantly enhanced the expression of Bax and cleaved caspase 3 in CD133+ cells compared to the parental cells. Therefore, 3-bromopyruvate is a potent chemotherapeutic agent for the treatment of glioma by targeting stem cells selectively. PMID:26453119

  14. miR-133a Enhances the Protective Capacity of Cardiac Progenitors Cells after Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Alberto Izarra

    2014-12-01

    Full Text Available miR-133a and miR-1 are known as muscle-specific microRNAs that are involved in cardiac development and pathophysiology. We have shown that both miR-1 and miR-133a are early and progressively upregulated during in vitro cardiac differentiation of adult cardiac progenitor cells (CPCs, but only miR-133a expression was enhanced under in vitro oxidative stress. miR-1 was demonstrated to favor differentiation of CPCs, whereas miR-133a overexpression protected CPCs against cell death, targeting, among others, the proapoptotic genes Bim and Bmf. miR-133a-CPCs clearly improved cardiac function in a rat myocardial infarction model by reducing fibrosis and hypertrophy and increasing vascularization and cardiomyocyte proliferation. The beneficial effects of miR-133a-CPCs seem to correlate with the upregulated expression of several relevant paracrine factors and the plausible cooperative secretion of miR-133a via exosomal transport. Finally, an in vitro heart muscle model confirmed the antiapoptotic effects of miR-133a-CPCs, favoring the structuration and contractile functionality of the artificial tissue.

  15. Expression of CD133 in acute leukemia.

    Science.gov (United States)

    Tolba, Fetnat M; Foda, Mona E; Kamal, Howyda M; Elshabrawy, Deena A

    2013-06-01

    There have been conflicting results regarding a correlation between CD133 expression and disease outcome. To assess CD133 expression in patients with acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) and to evaluate its correlation with the different clinical and laboratory data as well as its relation to disease outcome, the present study included 60 newly diagnosed acute leukemic patients; 30 ALL patients with a male to female ratio of 1.5:1 and their ages ranged from 9 months to 48 years, and 30 AML patients with a male to female ratio of 1:1 and their ages ranged from 17 to 66 years. Flow cytometric assessment of CD133 expression was performed on blast cells. In ALL, no correlations were elicited between CD133 expression and some monoclonal antibodies, but in AML group, there was a significant positive correlation between CD133 and HLA-DR, CD3, CD7 and TDT, CD13 and CD34. In ALL group, patients with negative CD133 expression achieved complete remission more than patients with positive CD133 expression. In AML group, there was no statistically significant association found between positive CD133 expression and treatment outcome. The Kaplan-Meier curve illustrated a high significant negative correlation between CD133 expression and the overall survival of the AML patients. CD133 expression is an independent prognostic factor in acute leukemia, especially ALL patients and its expression could characterize a group of acute leukemic patients with higher resistance to standard chemotherapy and relapse. CD133 expression was highly associated with poor prognosis in acute leukemic patients. PMID:23532815

  16. Cesium and Strontium Separation Technologies Literature Review

    Energy Technology Data Exchange (ETDEWEB)

    T. A. Todd; T. A. Todd; J. D. Law; R. S. Herbst

    2004-03-01

    Integral to the Advanced Fuel Cycle Initiative (AFCI) Program’s proposed closed nuclear fuel cycle, the fission products cesium and strontium in the dissolved spent nuclear fuel stream are to be separated and managed separately. A comprehensive literature survey is presented to identify cesium and strontium separation technologies that have the highest potential and to focus research and development efforts on these technologies. Removal of these high-heat-emitting fission products reduces the radiation fields in subsequent fuel cycle reprocessing streams and provides a significant short-term (100 yr) heat source reduction in the repository. This, along with separation of actinides, may provide a substantial future improvement in the amount of fuel that could be stored in a geologic repository. The survey and review of the candidate cesium and strontium separation technologies are presented herein. Because the AFCI program intends to manage cesium and strontium together, technologies that simultaneously separate both elements are of the greatest interest, relative to technologies that separate only one of the two elements.

  17. Scintillator handbook with emphasis on cesium iodide

    Science.gov (United States)

    Tidd, J. L.; Dabbs, J. R.; Levine, N.

    1973-01-01

    This report provides a background of reasonable depth and reference material on scintillators in general. Particular attention is paid to the cesium iodide scintillators as used in the High Energy Astronomy Observatory (HEAO) experiments. It is intended especially for use by persons such as laboratory test personnel who need to obtain a working knowledge of these materials and their characteristics in a short time.

  18. Anomalous wetting of helium on cesium

    International Nuclear Information System (INIS)

    The authors report studies of the anomalous wetting of a cesium substrate by a liquid helium film by means of the technique of third sound. A hysteretic pre-wetting transition is observed as a function of the amount of helium in the experimental cell. 10 refs., 2 figs

  19. 22 CFR 133.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 133.650 Section 133.650 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  20. 12 CFR 13.3 - Business conduct.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Business conduct. 13.3 Section 13.3 Banks and....3 Business conduct. A bank that is a government securities broker or dealer shall observe high standards of commercial honor and just and equitable principles of trade in the conduct of its business as...

  1. 40 CFR 133.102 - Secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Secondary treatment. 133.102 Section... TREATMENT REGULATION § 133.102 Secondary treatment. The following paragraphs describe the minimum level of effluent quality attainable by secondary treatment in terms of the parameters—BOD5, SS and pH....

  2. 38 CFR 13.3 - State legislation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false State legislation. 13.3... ADMINISTRATION, FIDUCIARY ACTIVITIES § 13.3 State legislation. Field facility Directors are authorized to... regarding any proposed legislation relating to fiduciary matters will be taken without the approval of...

  3. Selective Lentiviral Gene Delivery to CD133-Expressing Human Glioblastoma Stem Cells

    OpenAIRE

    N Sumru Bayin; Aram S Modrek; August Dietrich; Jonathan Lebowitz; Tobias Abel; Hae-Ri Song; Markus Schober; David Zagzag; Christian J Buchholz; Chao, Moses V; Placantonakis, Dimitris G.

    2014-01-01

    Glioblastoma multiforme (GBM) is a deadly primary brain malignancy. Glioblastoma stem cells (GSC), which have the ability to self-renew and differentiate into tumor lineages, are believed to cause tumor recurrence due to their resistance to current therapies. A subset of GSCs is marked by cell surface expression of CD133, a glycosylated pentaspan transmembrane protein. The study of CD133-expressing GSCs has been limited by the relative paucity of genetic tools that specifically target them. H...

  4. Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma

    Directory of Open Access Journals (Sweden)

    Lu Lizhi

    2006-12-01

    Full Text Available Abstract Background Recently, a small population of cancer stem cells in adult and pediatric brain tumors has been identified. Some evidence has suggested that CD133 is a marker for a subset of leukemia and glioblastoma cancer stem cells. Especially, CD133 positive cells isolated from human glioblastoma may initiate tumors and represent novel targets for therapeutics. The gene expression and the drug resistance property of CD133 positive cancer stem cells, however, are still unknown. Results In this study, by FACS analysis we determined the percentage of CD133 positive cells in three primary cultured cell lines established from glioblastoma patients 10.2%, 69.7% and 27.5%, respectively. We also determined the average mRNA levels of markers associated with neural precursors. For example, CD90, CD44, CXCR4, Nestin, Msi1 and MELK mRNA on CD133 positive cells increased to 15.6, 5.7, 337.8, 21.4, 84 and 1351 times, respectively, compared to autologous CD133 negative cells derived from cell line No. 66. Additionally, CD133 positive cells express higher levels of BCRP1 and MGMT mRNA, as well as higher mRNA levels of genes that inhibit apoptosis. Furthermore, CD133 positive cells were significantly resistant to chemotherapeutic agents including temozolomide, carboplatin, paclitaxel (Taxol and etoposide (VP16 compared to autologous CD133 negative cells. Finally, CD133 expression was significantly higher in recurrent GBM tissue obtained from five patients as compared to their respective newly diagnosed tumors. Conclusion Our study for the first time provided evidence that CD133 positive cancer stem cells display strong capability on tumor's resistance to chemotherapy. This resistance is probably contributed by the CD133 positive cell with higher expression of on BCRP1 and MGMT, as well as the anti-apoptosis protein and inhibitors of apoptosis protein families. Future treatment should target this small population of CD133 positive cancer stem cells in

  5. Composition and process for separating cesium ions from an acidic aqueous solution also containing other ions

    Science.gov (United States)

    Dietz, M.L.; Horwitz, E.P.; Bartsch, R.A.; Barrans, R.E. Jr.; Rausch, D.

    1999-03-30

    A crown ether cesium ion extractant is disclosed as is its synthesis. The crown ether cesium ion extractant is useful for the selective purification of cesium ions from aqueous acidic media, and more particularly useful for the isolation of radioactive cesium-137 from nuclear waste streams. Processes for isolating cesium ions from aqueous acidic media using the crown ether cesium extractant are disclosed as are processes for recycling the crown ether cesium extractant and processes for recovering cesium from a crown ether cesium extractant solution. 4 figs.

  6. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...1-B/AFM133Q.Seq.d/ Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  7. Strategic Design and Optimization of Inorganic Sorbents for Cesium, Strontium and Actinides

    International Nuclear Information System (INIS)

    The basic science goal in this project identifies structure/affinity relationships for selected radionuclides and existing sorbents. The task will apply this knowledge to the design and synthesis of new sorbents that will exhibit increased cesium, strontium and actinide removal. The target problem focuses on the treatment of high-level nuclear wastes. The general approach can likewise be applied to non-radioactive separations

  8. Single-Particle States in $^{133}$Sn

    CERN Document Server

    Huck, A

    2002-01-01

    % IS338 \\\\ \\\\ It is suggested to investigate the $\\beta^- $-decay of $^{133}$In and $^{134}$In in order to determine the single-particle states in $^{133}$Sn, which are so far unknown and needed for the shell-model description of the region close to $^{132}$Sn. Large hyper-pure Ge-detectors will be used for the $\\gamma$-ray spectroscopy. In the experiments with $^{134}$In, delayed neutrons in coincidence with $\\gamma$-rays from excited states in $^{133}$Sn provide the opportunity for a very selective detection of the states in question.

  9. Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle

    Directory of Open Access Journals (Sweden)

    Uney James B

    2011-06-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small RNA molecules that post-transcriptionally regulate gene expression and have been shown to play an important role during development. miR-1, miR-133a, miR-133b and miR-206 are expressed in muscle tissue and induced during muscle cell differentiation, a process that directs myoblasts to differentiate into mature myotubes, which are organized into myofibers. Although miR-1, miR-133a, miR-133b and miR-206 are well-studied in muscle, there is no information about their expression and function during human development. The purpose of this study was to determine the profile of these miRNAs in muscle cells isolated from different stages of human development. Results We examined the levels of miR-1, miR-133a, miR-133b and miR-206 during the development of human foetus. All four miRNA levels were found increased during late stages of human foetal muscle development. Increases in the expression levels of these miRNAs were proportional to the capacity of myoblasts to form myotubes. Changes in miRNA levels during human foetal development were accompanied by endogenous alterations in their known targets and also in their inducer, MyoD. Ectopic MyoD expression caused an induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, miR-133a, miR-133b and miR-206. Conclusions This study provides data about the profile of four miRNAs in human muscle cells isolated during different stages of foetal development. These results may shed light on the differentiation of muscle cells and regulation of muscle formation through miRNAs, during the development of human foetus.

  10. Strontium-90 and cesium-137 in milk

    International Nuclear Information System (INIS)

    The milk samples have been collected from 30 prefectures by prefectural public health laboratories and institutes (raw milk: 4 times per year for the report to WHO, and raw and city milk: 2 times per year), and analysed for strontium-90 and cesium-137 content at Japan Chemical Analysis Center. Collected samples were the raw milk and the city ones for the producing districts and the consuming ones, respectively. Three liters of fresh milk were carbonized in each prefectural public health laboratories and institutes, and then it was asked at Japan Chemical Analysis Center. The ask to which both some carriers and hydrochloric acid were added, was destroyed under heating. The nuclides was dissolved into hydrochloric acid and filtrated, after it was added with nitric acid and heated to dryness. The filtrate was radiochemically analysed for strontium-90 and cesium-137 using the method recommended by Science and Technology Agency. (author)

  11. Cesium stress and adaptation in pseudomonas fluorescens

    International Nuclear Information System (INIS)

    Industrialization and acid rain have led to a marked increment on the bioavailability of numerous metals. These metallic pollutants pose a serious threat to the ecosystem due to their ability to interact negatively with living organisms. Thus, considerable effort has been directed towards the development of environmentally-friendly technologies tailored to the management of metal wastes. As microbes are known to adapt to most environmental stresses, they constitute organisms of choice in the study of molecular adaptation processes. The adaptive features may be subsequently engineered for biotechnological applications. Cesium, a monovalent metal with chemical similarities to potassium but no know essential biological function has become a cause of environmental concern owing to its accidental release from the Chernobyl nuclear accident. This study examines the impact of cesium on the soil microbe Pseudomonas fluorescensts, and discusses the possibilities of its use in management of this nuclear waste. 15 refs., 3 figs

  12. Thermochemical evaluation and preparation of cesium uranates

    International Nuclear Information System (INIS)

    Two kinds of cesium uranates, Cs2UO4 and Cs2U2O7, which are predicted by thermochemical estimation to be formed in irradiated oxide fuels, were prepared from U3O8 and Cs2CO3 for measurements of the thermal expansions and thermal conductivities. In advance of the preparation, thermochemical calculations for the formation and decomposition of these cesium uranates were performed by Gibbs free energy minimizer. The preparation temperatures for Cs2UO4 and Cs2U2O7 were determined from the results of the thermochemical calculations. The prepared samples were analyzed by X-ray diffraction, which showed that the single phases of Cs2UO4 and Cs2U2O7 were formed. Thermogravimetry and differential thermal analysis were also performed on these samples, and the decomposition temperatures were evaluated. The experimental results were in good agreement with those of the thermochemical calculations. (author)

  13. Cesium legacy safety project management work plan

    International Nuclear Information System (INIS)

    This Management Work Plan (MWP) describes the process flow, quality assurance controls, and the Environment, Safety, and Health requirements of the Cesium Legacy Safety Project. This MWP provides an overview of the project goals and methods for repackaging the non-conforming Type W overpacks and packaging the CsCl powder and pellets. This MWP is not intended to apply to other activities associated with the CsCl Legacy Safety Program (i.e., clean out of South Cell)

  14. CD133 antigen expression in ovarian cancer

    International Nuclear Information System (INIS)

    Much attention has been recently focused on the role of cancer stem cells (CSCs) in the initiation and progression of solid malignancies. Since CSCs are able to proliferate and self-renew extensively, thus sustaining tumor growth, the identification of CSCs through their antigenic profile might have relevant clinical implications. In this context, CD133 antigen has proved to be a marker of tumor cells with stemness features in several human malignancies. The aim of the study was to investigate the clinical role of the immunohistochemically assessed expression of CD133 in a large single Institution series of ovarian cancer patients. The study included 160 cases admitted to the Gynecologic Oncology Unit, Catholic University of Campobasso and Rome. CD133 antigen was identified by the monoclonal mouse anti-CD133-1 antibody (clone CD133 Miltenyi biotec). In the overall series CD133 positive tumor cells were observed in 50/160 (31.2%) cases. A diffuse cytoplasmic pattern was identified in 30/50 (60.0%), while an apical cytoplasmic pattern was found in 20/50 (40.0%) of CD133 positive tumors. As of September 2008, the median follow up was 37 months (range: 2–112). During the follow up period, progression and death of disease were observed in 123 (76.9%), and 88 (55.0%) cases, respectively. There was no difference in TTP between cases with negative (median TTP = 23 months) versus positive CD133 expression (median TTP = 24 months) (p value = 0.3). Similar results were obtained for OS. When considering the TTP and OS curves according to the pattern of CD133 expression, a trend to a worse prognosis for cases with diffuse cytoplasmic versus the apical cytoplasmic pattern was documented, although the statistical significance was not reached. The immunohistochemical assessment of CD133 expression seems not to provide additional prognostic information in ovarian cancer patients. The role of the different pattern of CD133 immunoreaction deserves further investigation in a larger

  15. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juntao; Mao, Zhangfan; Huang, Jie; Xie, Songping; Liu, Tianshu; Mao, Zhifu, E-mail: 48151660@qq.com

    2014-02-21

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G{sub 2}/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were

  16. Blocking the NOTCH pathway can inhibit the growth of CD133-positive A549 cells and sensitize to chemotherapy

    International Nuclear Information System (INIS)

    Highlights: • Notch signaling pathway members are expressed lower levels in CD133+ cells. • CD133+ cells are not as sensitive as CD133− cells to chemotherapy. • GSI could inhibit the growth of both CD133+ and CD133− cells. • Blockade of Notch signaling pathway enhanced the effect of chemotherapy with CDDP. • DAPT/CDDP co-therapy caused G2/M arrest and elimination in CD133+ cells. - Abstract: Cancer stem cells (CSCs) are believed to play an important role in tumor growth and recurrence. These cells exhibit self-renewal and proliferation properties. CSCs also exhibit significant drug resistance compared with normal tumor cells. Finding new treatments that target CSCs could significantly enhance the effect of chemotherapy and improve patient survival. Notch signaling is known to regulate the development of the lungs by controlling the cell-fate determination of normal stem cells. In this study, we isolated CSCs from the human lung adenocarcinoma cell line A549. CD133 was used as a stem cell marker for fluorescence-activated cell sorting (FACS). We compared the expression of Notch signaling in both CD133+ and CD133− cells and blocked Notch signaling using the γ-secretase inhibitor DAPT (GSI-IX). The effect of combining GSI and cisplatin (CDDP) was also examined in these two types of cells. We observed that both CD133+ and CD133− cells proliferated at similar rates, but the cells exhibited distinctive differences in cell cycle progression. Few CD133+ cells were observed in the G2/M phase, and there were half as many cells in S phase compared with the CD133− cells. Furthermore, CD133+ cells exhibited significant resistance to chemotherapy when treated with CDDP. The expression of Notch signaling pathway members, such as Notch1, Notch2 and Hes1, was lower in CD133+ cells. GSI slightly inhibited the proliferation of both cell types and exhibited little effect on the cell cycle. The inhibitory effects of DPP on these two types of cells were enhanced

  17. Murine immunization by cesium-137 irradiation attenuated Schistosoma mansoni cercariae

    International Nuclear Information System (INIS)

    Cesium-137, becoming a more readily available ionizing gamma radiation source for laboratory use, was shown to effectively attenuate Schistosoma mansoni cercariae for vaccine production. In parallel comparison studies with the murine model, cesium-137 attenuated cercariae consistently afforded better protection than did the cobalt-60 prepared vaccine. Dose-response data indicated that the optimal total irradiation with cesium-137 was between 45 and 50 Krad

  18. Murine immunization by cesium-137 irradiation attenuated Schistosoma mansoni cercariae

    Energy Technology Data Exchange (ETDEWEB)

    Stek, M. Jr.; Minard, P.; Cruess, D.F.

    1984-06-01

    Cesium-137, becoming a more readily available ionizing gamma radiation source for laboratory use, was shown to effectively attenuate Schistosoma mansoni cercariae for vaccine production. In parallel comparison studies with the murine model, cesium-137 attenuated cercariae consistently afforded better protection than did the cobalt-60 prepared vaccine. Dose-response data indicated that the optimal total irradiation with cesium-137 was between 45 and 50 Krad.

  19. Sorption of cesium 137 by steel from sodium melt

    International Nuclear Information System (INIS)

    Sorption of cesium-137 radionuclide by Kh18N10T steel from sodium melt at different temperatures (150-450 deg C) has been studied. Equilibrium coefficients of cesium distribution between sodium and steel are determined, which depend on the conditions of sorption realization, such as cesium concentration in sodium melt, the content of oxygen admixture in sodium and the state of sorbing surface

  20. Cesium-137 as a radiation source

    International Nuclear Information System (INIS)

    The U.S. Department of Energy (DOE) Byproducts Utilization Program (BUP) seeks to develop and encourage widespread commercial use of defense byproducts that are produced by DOE. Cesium-l37 is one such byproduct that is radioactive and decays with emission of gamma rays. The beneficial use of this radiation to disinfect sewage sludge or disinfest food commodities is actively being pursued by the program. The radiation produced by cesium-l37(Cs-l37) is identical in form to that produced by cobalt-60(Co-60), an isotope that is widely used in commercial applications such as medical product sterilization. The choice of isotope to use depends on several factors ranging from inherent properties of the isotopes to availability and cost. The BUP, although centrally concerned with the beneficial use of Cs-l37, by investigating and assessing the feasibility of various uses hopes to define appropriate circumstances where cesium or cobalt might best be used to accomplish specific objectives. This paper discusses some of the factors that should be considered when evaluating potential uses for isotopic sources

  1. Removal of cesium from red deer meat

    International Nuclear Information System (INIS)

    The effect was studied of marinading on the reduction of cesium radionuclide activity in red deer meat contaminated by ingestion of feed containing 134Cs+137Cs from radioactive fallout following the Chernobyl accident. Two types of marinade were studied, viz., a vinegar infusion and a vinegar infusion with an addition of vegetables and spices. The meat was chopped to cubes of about 1.5 cm in size and the marinading process took place at temperatures of 5 and 11 degC. The drop of cesium content in the meat was determined by gamma spectrometry at given time intervals. The replacement of the marinade and the duration of the process were found to maximally affect efficiency. If the solution was not replaced, about 80% of cesium radionuclides were removed after seven hours of marinading. With one replacement of the infusion the drop in 134Cs+137Cs radioactivity amounted to up to 90% after seven hours of marinading. No effects were shown of vegetable additions to the vinegar infusion and of the change in temperature from 5 to 11 degC on the efficiency of the process. (author). 3 tabs., 6 refs

  2. Increased plasma levels of microparticles expressing CD39 and CD133 in acute liver injury

    DEFF Research Database (Denmark)

    Schmelzle, Moritz; Splith, Katrin; Wiuff Andersen, Lars;

    2013-01-01

    BACKGROUND: We have previously demonstrated that CD133 and CD39 are expressed by hematopoietic stem cells (HSC), which are mobilized after liver injury and target sites of injury, limit vascular inflammation, and boost hepatic regeneration. Plasma microparticles (MP) expressing CD39 can block...... endothelial activation. Here, we tested whether CD133 MP might be shed in a CD39-dependent manner in a model of liver injury and could potentially serve as biomarkers of liver failure in the clinic. METHODS: Wild-type and Cd39-null mice were subjected to acetaminophen-induced liver injury. Mice were...... sacrificed and plasma MP were isolated by ultracentrifugation. HSC and CD133 MP levels were analyzed by fluorescence-activated cell sorting. Patients were enrolled with acute (n=5) and acute on chronic (n=5) liver injury with matched controls (n=7). Blood was collected at admission and plasma CD133 and CD39...

  3. Surface interactions of cesium and boric acid with stainless steel

    International Nuclear Information System (INIS)

    In this report, the effects of cesium hydroxide and boric acid on oxidized stainless steel surfaces at high temperatures and near one atmosphere of pressure are investigated. This is the first experimental investigation of this chemical system. The experimental investigations were performed using a mass spectrometer and a mass electrobalance. Surfaces from the different experiments were examined using a scanning electron microscope to identify the presence of deposited species, and electron spectroscopy for chemical analysis to identify the species deposited on the surface. A better understanding of the equilibrium thermodynamics, the kinetics of the steam-accelerated volatilizations, and the release kinetics are gained by these experiments. The release rate is characterized by bulk vaporization/gas-phase mass transfer data. The analysis couples vaporization, deposition, and desorption of the compounds formed by cesium hydroxide and boric acid under conditions similar to what is expected during certain nuclear reactor accidents. This study shows that cesium deposits on an oxidized stainless steel surface at temperatures between 1000 and 1200 Kelvin. Cesium also deposits on stainless steel surfaces coated with boric oxide in the same temperature ranges. The mechanism for cesium deposition onto the oxide layer was found to involve the chemical reaction between cesium and chromate. Some revaporization in the cesium hydroxide-boric acid system was observed. It has been found that under the conditions given, boric acid will react with cesium hydroxide to form cesium metaborate. A model is proposed for this chemical reaction

  4. Distribution and retention of cesium in Swedish boreal forest ecosystems

    International Nuclear Information System (INIS)

    The retention and distribution of cesium in forest environments are being studied at three locations in Sweden. The main part of the cesium found in the soil was recovered in horizons rich in organic matter. The cesium was retained in the soil organic matter in a more or less extractable form. As different soil types have a different distribution pattern of organic matter the distribution of cesium will depend on the forest soil type. The clay content in Swedish forest soils is in general low which will mitigate the retention of cesium in the soil mineral horizons. The cesium present in the tree was considered to be an effect of assimilation by the tissues in the canopy as well as by the roots. The redistribution of cesium within the trees was extensive which was considered to be an effect of a high mobility of cesium in the close system of a forest environment. The cesium will remain in the forest environment for a considerable time but can be removed by forest practice, by leaching out of the soil profile or by the radioactive decay. (au)

  5. Lanthanide doped strontium-barium cesium halide scintillators

    Science.gov (United States)

    Bizarri, Gregory; Bourret-Courchesne, Edith; Derenzo, Stephen E.; Borade, Ramesh B.; Gundiah, Gautam; Yan, Zewu; Hanrahan, Stephen M.; Chaudhry, Anurag; Canning, Andrew

    2015-06-09

    The present invention provides for a composition comprising an inorganic scintillator comprising an optionally lanthanide-doped strontium-barium, optionally cesium, halide, useful for detecting nuclear material.

  6. Dicty_cDB: CHR133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR133 (Link to dictyBase) - - - Contig-U11110-1 | Contig-U13144-1 CHR...133P (Link to Original site) CHR133F 616 CHR133Z 142 CHR133P 738 - - Show CHR133 Library CH (Link to library) Clone ID CHR...10-1 | Contig-U13144-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR...133Q.Seq.d/ Representative seq. ID CHR133P (Link to Original site) Representative DNA sequence >CHR133 (CHR...133Q) /CSM/CH/CHR1-B/CHR133Q.Seq.d/ TTTGTACCAGCATTCAAGGTAATTCCTTATTGGGGTACACAACAACAACGTACTACCATT

  7. Sorption of cesium in intact rock

    Energy Technology Data Exchange (ETDEWEB)

    Puukko, E. [Univ. of Helsinki, Dept. of Chemistry (Finland)

    2014-04-15

    The mass distribution coefficient K{sub d} is used in performance assessment (PA) to describe sorption of a radionuclide on rock. The R{sub d} is determined using crushed rock which causes uncertainty in converting the R{sub d} values to K{sub d} values for intact rock. This work describes a method to determine the equilibrium of sorption on intact rock. The rock types of the planned Olkiluoto waste disposal site were T-series mica gneiss (T-MGN), T-series tonalite granodiorite granite gneiss (T-TGG), P-series tonalite granodiorite granite gneiss (P-TGG) and pegmatitic granite (PGR). These rocks contain different amount of biotite which is the main sorbing mineral. The sorption of cesium on intact rock slices was studied by applying an electrical field to speed up migration of cesium into the rock. Cesium is in the solution as a noncomplex cation Cs{sup +} and it is sorbed by ion exchange. The tracer used in the experiments was {sup 134}Cs. The experimental sorption on the intact rock is compared with values calculated using the in house cation exchange sorption model (HYRL model) in PHREEQC program. The observed sorption on T-MGN and T-TGG rocks was close to the calculated values. Two PGR samples were from a depth of 70 m and three samples were from a depth of 150 m. Cesium sorbed more than predicted on the two 70 m PGR samples. The sorption of Cs on the three 150 m PGR samples was small which was consistent with the calculations. The pegmatitic granite PGR has the smallest content of biotite of the four rock types. In the case of P-TGG rock the observed values of sorption were only half of the calculated values. Two kind of slices were cut from P-TGG drill core. The slices were against and to the direction of the foliation of the biotite rims. The sorption of cesium on P-TGG rock was same in both cases. The results indicated that there was no effect of the directions of the electric field and the foliation of biotite in the P-TGG rock. (orig.)

  8. Loss of miR-133a expression associated with poor survival of breast cancer and restoration of miR-133a expression inhibited breast cancer cell growth and invasion

    International Nuclear Information System (INIS)

    miRNAs, endogenous oligonucleotide RNAs, play an important role in mammary gland carcinogenesis and tumor progression. Detection of their expression and investigation of their functions could lead to discovery of novel biomarkers for breast cancer. In situ hybridization was used to detect miR-133a expression in formalin-fixed paraffin-embedded breast surgical specimens from 26 benign, 34 pericancerously normal and 90 cancerous tissues. qRT-PCR was performed to assess miR-133a levels in 6 breast cell lines and 10 benign and 18 cancerous fresh breast tissue specimens. Cell viability, migration, and invasion assays were used to determine the role of miR-133a in regulation of breast cancer cell growth, migration, and invasion, respectively. Luciferase assay was performed to assess miR-133a binding to FSCN1 gene. Expression of miR-133a was reduced from normal through benign to cancerous breast tissues. Expression of miR-133a was also low in breast cancer cell lines. The reduced miR-133a expression was associated with lymph nodes metastasis, high clinical stages, and shorter relapse-free survivals of patients with breast cancer. Furthermore, transfection of miR-133a oligonucleotides slightly inhibited growth but significantly decreased migration and invasion capacity of breast cancer cells, compared with negative controls, whereas knockdown of miR-133a expression induced breast cancer cell migration and invasion. In addition, we identified a putative miR-133a binding site in the 3'-untranslated region (UTR) of Fascin1 (FSCN1) gene using an online bioinformatical tool. We found that miR-133a transfection significantly reduced expression of FSCN1 mRNA and protein. The luciferase reporter assay confirmed that FSCN1 was the direct target gene of miR-133a. miR-133a expression was lost in breast cancer tissues, loss of which was associated with lymph nodes metastasis, high clinical stages and shorter relapse-free survivals of patients with breast cancer. Functionally, mi

  9. 21 CFR 133.175 - Pasteurized cheese spread.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized cheese spread. 133.175 Section 133.175... Cheese and Related Products § 133.175 Pasteurized cheese spread. Pasteurized cheese spread is the food... statement of ingredients, prescribed for pasteurized process cheese spread by § 133.179, except that...

  10. Distillation device supplies cesium vapor at constant pressure

    Science.gov (United States)

    Basiulis, A.; Shefsiek, P. K.

    1968-01-01

    Distillation apparatus in the form of a U tube supplies small amounts of pure cesium vapor at constant pressure to a thermionic converter. The upstream leg of the U tube is connected to a vacuum pump to withdraw noncondensable impurities, the bottom portion serves as a reservoir for the liquid cesium.

  11. Ion and electron thermoemission of cesium alumosilicates

    International Nuclear Information System (INIS)

    Relationships between and electron thermoemission of cesium aluminosilicate were studied. Measurements were made at 5.10-8-5.10-9 Tor and temperatures up to 1400 deg C. The effect of additions refractory metals Ti, Mo, Cu and Ir was studied. Ion thermoemission in the pulse regime was also studied. Conclusions are drawn that capacity depends upon additions. The temperature dependence of thermoionic emission current has two maxima and is characterized by instability in time. A conclusion is drawn that aluminosilicate thermionic cathodes can be reckoned as cathodes of a film type

  12. Cesium-137 in grass from Chernobyl fallout

    International Nuclear Information System (INIS)

    Grass ecosystem was monitored for 137Cs, a relatively long-lived radionuclide, for about 16 years since the Chernobyl reactor accident occurred on April 26, 1986. Cesium-137 in grass gramineae or poaceae the species, ranged from 122.9 Bq kg-1 (September 4, 1986) to 5.8 mBq kg-1 (October 16, 2001) that is a range of five orders of magnitude. It was observed that there was a trend of decreasing 137Cs with time reflecting a removal half-time of 40 months (3 1/3 years), which is the ecological half-life, T ec of 137Cs in grassland

  13. Plutonium and Cesium Colloid Mediated Transport

    Science.gov (United States)

    Boukhalfa, H.; Dittrich, T.; Reimus, P. W.; Ware, D.; Erdmann, B.; Wasserman, N. L.; Abdel-Fattah, A. I.

    2013-12-01

    Plutonium and cesium have been released to the environment at many different locations worldwide and are present in spent fuel at significant levels. Accurate understanding of the mechanisms that control their fate and transport in the environment is important for the management of contaminated sites, for forensic applications, and for the development of robust repositories for the disposal of spent nuclear fuel and nuclear waste. Plutonium, which can be present in the environment in multiple oxidations states and various chemical forms including amorphous oxy(hydr)oxide phases, adsorbs/adheres very strongly to geological materials and is usually immobile in all its chemical forms. However, when associated with natural colloids, it has the potential to migrate significant distances from its point of release. Like plutonium, cesium is not very mobile and tends to remain adhered to geological materials near its release point, although its transport can be enhanced by natural colloids. However, the reactivity of plutonium and cesium are very different, so their colloid-mediated transport might be significantly different in subsurface environments. In this study, we performed controlled experiments in two identically-prepared columns; one dedicated to Pu and natural colloid transport experiments, and the other to Cs and colloid experiments. Multiple flow-through experiments were conducted in each column, with the effluent solutions being collected and re-injected into the same column two times to examine the persistence and scaling behavior of the natural colloids, Pu and Cs. The data show that that a significant fraction of colloids were retained in the first elution through each column, but the eluted colloids collected from the first run transported almost conservatively in subsequent runs. Plutonium transport tracked natural colloids in the first run but deviated from the transport of natural colloids in the second and third runs. Cesium transport tracked natural

  14. Extraction of radioactive cesium from ash of flammable radioactive material

    International Nuclear Information System (INIS)

    Huge amount of radioactive materials was released by the hydrogen explosion at Fukushima Daiichi Nuclear Power Plant due to the Great East Japan Earthquake on March 11, 2011. Suppression of the volume of radioactive materials stored by decontamination works is strongly required since the preparation of storage places is not easy. We are developing the technology for separation and concentration of radioactive cesium using nano-particle, Prussian blue, as a cesium adsorption material which has a high efficiency and good selectivity. We propose a method in which radioactive cesium is extracted from the ash of flammable materials into the water and the Prussian blue nano-particles are added to the water to collect cesium. The volume of radioactive wastes contaminated by cesium is expected to be cut down with these processes. (J.P.N.)

  15. Evaluation of electrochemical ion exchange for cesium elution

    International Nuclear Information System (INIS)

    Electrochemical elution was investigated as an alternative method to acid elution for the desorption of cesium from loaded ion exchange resins. The approach was found to have several potential advantages over existing technologies, in particular, electrochemical elution eliminates the need for addition of chemicals to elute cesium from the ion exchange resin. Also, since, in the electrochemical elution process the eluting solution is not in direct contact with the ion exchange material, very small volumes of the eluting solution can be used in a complete recycle mode in order to minimize the total volume of the cesium elute. In addition, the cesium is eluted as an alkaline solution that does not require neutralization with caustic to meet the tank farm specifications. Other advantages include easy incorporation of the electrochemical elution process into the present cesium recovery schemes

  16. A combined cesium-strontium extraction/recovery process

    International Nuclear Information System (INIS)

    A new solvent extraction process for the simultaneous extraction of cesium and strontium from acidic nitrate media is described. This process uses a solvent formulation comprised of 0.05 M di-t-butylcyclohexano-18-crown-6 (DtBuCH18C6), 0.1 M Crown 100' (a proprietary, cesium-selective derivative of dibenzo-18-crown-6), 1.2 M tributyl phosphate (TBP), and 5% (v/v) lauryl nitrile in an isoparaffinic hydrocarbon diluent. Distribution ratios for cesium and strontium from 4 M nitric acid are 4.13 and 3.46, respectively. A benchtop batch countercurrent extraction experiment indicates that >98% of the cesium and strontium initially present in the feed solution can be removed in only four extraction stages. Through proper choice of extraction and strip conditions, extracted cesium and strontium can be recovered either together or individually

  17. Adsorption of cesium on cement mortar from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Volchek, Konstantin, E-mail: konstantin.volchek@ec.gc.ca [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Miah, Muhammed Yusuf [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Department of Applied Chemistry and Chemical Technology, Noakhali Science and Technology University (Bangladesh); Kuang, Wenxing; DeMaleki, Zack [Emergencies Science and Technology Section, Environment Canada, 335 River Road, Ottawa, Ontario, Canada K1A 0H3 (Canada); Tezel, F. Handan [Department of Chemical and Biological Engineering, University of Ottawa, 161 Louis-Pasteur, Ottawa, Ontario, Canada K1N 6N5 (Canada)

    2011-10-30

    Highlights: {yields} The adsorption of cesium on cement mortar was investigated in a range of temperatures and cesium concentrations. {yields} The pseudo-second order kinetic model produced a good fit with the experimental kinetic data. {yields} Equilibrium test results correlated well with the Freundlich isotherm adsorption model. {yields} The interaction between cesium ions and cement mortar was dominated by chemical adsorption. - Abstract: The adsorption of cesium on cement mortar from aqueous solutions was studied in series of bench-scale tests. The effects of cesium concentration, temperature and contact time on process kinetics and equilibrium were evaluated. Experiments were carried out in a range of initial cesium concentrations from 0.0103 to 10.88 mg L{sup -1} and temperatures from 278 to 313 K using coupons of cement mortar immersed in the solutions. Non-radioactive cesium chloride was used as a surrogate of the radioactive {sup 137}Cs. Solution samples were taken after set periods of time and analyzed by inductively coupled plasma mass spectroscopy. Depending on the initial cesium concentration, its equilibrium concentration in solution ranged from 0.0069 to 8.837 mg L{sup -1} while the respective surface concentration on coupons varied from 0.0395 to 22.34 {mu}g cm{sup -2}. Equilibrium test results correlated well with the Freundlich isotherm model for the entire test duration. Test results revealed that an increase in temperature resulted in an increase in adsorption rate and a decrease in equilibrium cesium surface concentration. Among several kinetic models considered, the pseudo-second order reaction model was found to be the best to describe the kinetic test results in the studied range of concentrations. The adsorption activation energy determined from Arrhenius equation was found to be approximately 55.9 kJ mol{sup -1} suggesting that chemisorption was the prevalent mechanism of interaction between cesium ions and cement mortar.

  18. Study of the complexation kinetics of Cs+ ion with dibenzo-30-crown-10 in some nonaqueous solvents by 133Cs NMR

    International Nuclear Information System (INIS)

    The exchange kinetics of the complexation of the cesium ion with dibenzo-30-crown-10 were studied in nitromethane, acetonitrile, propylene carbonate, and methanol solutions by cesium-133 NMR line-shape analysis. In the last three solvents, when the temperature is below -100C, the predominant mechanism for the exchange of the Cs+ ion between the solvated and complexed sites is the bimolecular process. In nitromethane solutions, at all temperatures studied, and in propylene carbonate and methanol solutions at -100C, the exchange process proceeds by the dissociation pathway. The activation parameters E/sub a/, ΔH*, ΔS*, and ΔG double dagger for the exchange have been determined. In systems where the exchange mechanism is bimolecular, the free energy barrier for the exchange process appears to be independent of the solvent

  19. High expression of miR-9 in CD133+ glioblastoma cells in chemoresistance to temozolomide

    Science.gov (United States)

    Munoz, Jessian L.; Rodriguez-Cruz, Vivian; Rameshwar, Pranela

    2016-01-01

    Glioblastoma Multiforme (GBM), a uniformly lethal stage IV astrocytoma, is currently treated with a combination of surgical and radiation therapy as well as Temozolomide (TMZ) chemotherapy. Resistance to TMZ is rapidly acquired by GBM cells and overcoming this resistance has been an area of signi?cant research. GBM 'cancer stem cells' (CSC) also known as 'cancer initiating cells' are often positively selected by CD133 expression and TMZ resistance. In this project, we selected GBM CSC from two cell lines based on CD133 expression. CD133+ and CD133− GBM cells showed comparable cell cycle status. The expression of genes within the Sonic Hedgehog Signaling pathway, PTCH1 (SHH receptor/basal signaling repressor) and Gli1 (effector transcription factor) were increased. The recent literature indicated a decreased in PTCH expression by miRNA and this was independent of SHH expression. We analyzed 5 potential PTCH-targeting miRNA and identi?ed an increase in miRNA-9-2. The CD133+ cells showed an increase in the Multiple Drug Resistance 1 gene (MDR1). Knockdown of Gli1 and MDR1 with siRNA enhanced TMZ induced cell death. Taken together, these studies show CD133+ GBM CSCs expressed greater levels of miR-9 and activation of the SHH/PTCH1/MDR1 axis. This axis has been shown to impart TMZ resistance. In the case of the CD133+ cells, the resistance is not acquires but seems to be inherent. Identi?cation of this pathway as well as the identi?cation of miR-9 may allow for the development of miRNA-targeted approach to Cancer Stem Cell therapy in GBM.

  20. Studies on release and deposition behaviour of cesium from contaminated sodium pools and cesium trap development for FBTR

    International Nuclear Information System (INIS)

    Investigations were carried out on the release and deposition behaviour of cesium from sodium pools in air-filled chamber in the temperature range of 673 to 873 K, using Cs-134 to simulate Cs-137. About 0.12 kg of sodium was loaded in a burn-pot together with 92.5 kBq of cesium. Experiments were carried out with 21% oxygen. Natural burning period of sodium and specific activity ratio between cesium and sodium showed a tendency to decrease and release fractions of both the species tended to increase with temperature. From the surface deposited aerosols it was observed that cesium has propensity to settle down closer to the point of release. A cesium trap has been developed for FBTR with RVC as getter material. Absorption kinetics and particle release behaviour studies pointed to its intended satisfactory performance in the plant. (author)

  1. Sympathetic cooling in a rubidium cesium mixture: Production of ultracold cesium atoms

    International Nuclear Information System (INIS)

    This thesis presents experiments for the production of ultracold rubidium cesium mixture in a magnetic trap. The long-termed aim of the experiment is the study of the interaction of few cesium atoms with a Bose-Einstein condensate of rubidium atoms. Especially by controlled variation of the cesium atom number the transition in the description of the interaction by concepts of the one-particle physics to the description by concepts of the many-particle physics shall be studied. The rubidium atoms are trapped in a magneto-optical trap (MOT) and from there reloaded into a magnetic trap. In this the rubidium atoms are stored in the state vertical stroke f=2,mf=2 right angle of the electronic ground state and evaporatively cooled by means of microwave-induced transitions into the state vertical stroke f=1,mf=1] (microwave cooling). The cesium atoms are also trppaed in a MOT and into the same magnetic trap reloaded, in which they are stored in the state vertical stroke f=4,mf=4 right angle of the electronic ground state together with rubidium. Because of the different hyperfine splitting only rubidium is evaporatively cooled, while cesium is cooled jointly sympathetically - i.e. by theramal contact via elastic collisions with rubidium atoms. The first two chapters contain a description of interatomic interactions in ultracold gases as well as a short summary of theoretical concepts in the description of Bose-Einstein condensates. The chapters 3 and 4 contain a short presentation of the methods applied in the experiment for the production of ultracold gases as well as the experimental arrangement; especially in the framework of this thesis a new coil system has been designed, which offers in view of future experiments additionally optical access for an optical trap. Additionally the fourth chapter contains an extensive description of the experimental cycle, which is applied in order to store rubidium and cesium atoms together into the magnetic trap. The last chapter

  2. Label-free quantitative proteomics of CD133-positive liver cancer stem cells

    Directory of Open Access Journals (Sweden)

    Tsai Sheng-Ta

    2012-11-01

    Full Text Available Abstract Background CD133-positive liver cancer stem cells, which are characterized by their resistance to conventional chemotherapy and their tumor initiation ability at limited dilutions, have been recognized as a critical target in liver cancer therapeutics. In the current work, we developed a label-free quantitative method to investigate the proteome of CD133-positive liver cancer stem cells for the purpose of identifying unique biomarkers that can be utilized for targeting liver cancer stem cells. Label-free quantitation was performed in combination with ID-based Elution time Alignment by Linear regression Quantitation (IDEAL-Q and MaxQuant. Results Initially, IDEAL-Q analysis revealed that 151 proteins were differentially expressed in the CD133-positive hepatoma cells when compared with CD133-negative cells. We then analyzed these 151 differentially expressed proteins by MaxQuant software and identified 10 significantly up-regulated proteins. The results were further validated by RT-PCR, western blot, flow cytometry or immunofluorescent staining which revealed that prominin-1, annexin A1, annexin A3, transgelin, creatine kinase B, vimentin, and EpCAM were indeed highly expressed in the CD133-positive hepatoma cells. Conclusions These findings confirmed that mass spectrometry-based label-free quantitative proteomics can be used to gain insights into liver cancer stem cells.

  3. Microbial uptake of uranium, cesium, and radium

    International Nuclear Information System (INIS)

    The ability of diverse microbial species to concentrate uranium, cesium, and radium was examined. Saccharomyces cerevisiae, Pseudomonas aeruginosa, and a mixed culture of denitrifying bacteria accumulated uranium to 10 to 15% of the dry cell weight. Only a fraction of the cells in a given population had visible uranium deposits in electron micrographs. While metabolism was not required for uranium uptake, mechanistic differences in the metal uptake process were indicated. Uranium accumulated slowly (hours) on the surface of S. cerevisiae and was subject to environmental factors (i.e., temperature, pH, interfering cations and anions). In contrast, P. aeruginosa and the mixed culture of denitrifying bacteria accumulated uranium rapidly (minutes) as dense, apparently random, intracellular deposits. This very rapid accumulation has prevented us from determining whether the uptake rate during the transient between the initial and equilibrium distribution of uranium is affected by environmental conditions. However, the final equilibrium distributions are not affected by those conditions which affect uptake by S. cerevisiae. Cesium and radium were concentrated to a considerably lesser extent than uranium by the several microbial species tested. The potential utility of microorganisms for the removal and concentration of these metals from nuclear processing wastes and several bioreactor designs for contacting microorganisms with contaminated waste streams will be discussed

  4. Intense non-relativistic cesium ion beam

    International Nuclear Information System (INIS)

    The Heavy Ion Fusion group at Lawrence Berkeley Laboratory has constructed the One Ampere Cesium Injector as a proof of principle source to supply an induction linac with a high charge density and high brightness ion beam. This is studied here. An electron beam probe was developed as the major diagnostic tool for characterizing ion beam space charge. Electron beam probe data inversion is accomplished with the EBEAM code and a parametrically adjusted model radial charge distribution. The longitudinal charge distribution was not derived, although it is possible to do so. The radial charge distribution that is derived reveals an unexpected halo of trapped electrons surrounding the ion beam. A charge fluid theory of the effect of finite electron temperature on the focusing of neutralized ion beams (Nucl. Fus. 21, 529 (1981)) is applied to the problem of the Cesium beam final focus at the end of the injector. It is shown that the theory's predictions and assumptions are consistent with the experimental data, and that it accounts for the observed ion beam radius of approx. 5 cm, and the electron halo, including the determination of an electron Debye length of approx. 10 cm

  5. Cesium separation Using Electrically Switched Ion Exchange

    International Nuclear Information System (INIS)

    Electrically Switched Ion Exchange (ESIX) is a separation technology being developed at Pacific Northwest National Laboratory as an alternative to conventional ion exchange for removing metal ions from wastewater. In ESIX, which combines ion exchange and electro-chemistry, ion uptake and elution can be controlled directly by modulating the potential of an ion exchange film that has been electrochemically deposited onto an electrode. This paper presents the results of experiments on high surface area electrodes and the development of a flow system for cesium ion separation. Bench-scale flow system studies showed no change in capacity or performance of the ESIX films at a flow rate up to 113 BV/h, the maxi-mum flow rate tested, and breakthrough curves supported once-through waste processing. A comparison of results for a stacked 5-electrode cell versus a single-electrode cell showed enhanced breakthrough performance. In the stacked configuration, break-through began at about 120 BV for a feed containing 0.2 ppm cesium at a flow rate of 13 BV/h. A case study for the KE Basin (a spent nuclear fuel storage basin) on the Hanford Site demonstrated that KE Basin wastewater could be processed continuously with minimal waste generation, reduced disposal costs, and lower capital expenditures

  6. Biosorption behavior and mechanism of cesium-137 on Rhodosporidium fluviale strain UA2 isolated from cesium solution

    International Nuclear Information System (INIS)

    In order to identify a more efficient biosorbent for 137Cs, we have investigated the biosorption behavior and mechanism of 137Cs on Rhodosporidium fluviale (R. fluviale) strain UA2, one of the dominant species of a fungal group isolated from a stable cesium solution. We observed that the biosorption of 137Cs on R. fluviale strain UA2 was a fast and pH-dependent process in the solution composed of R. fluviale strain UA2 (5 g/L) and cesium (1 mg/L). While a Langmuir isotherm equation indicated that the biosorption of 137Cs was a monolayer adsorption, the biosorption behavior implied that R. fluviale strain UA2 adsorbed cesium ions by electrostatic attraction. The TEM analysis revealed that cesium ions were absorbed into the cytoplasm of R. fluviale strain UA2 across the cell membrane, not merely fixed on the cell surface, which implied that a mechanism of metal uptake contributed largely to the cesium biosorption process. Moreover, PIXE and EPBS analyses showed that ion-exchange was another biosorption mechanism for the cell biosorption of 137Cs, in which the decreased potassium ions were replaced by cesium ions. All the above results implied that the biosorption of 137Cs on R. fluviale strain UA2 involved a two-step process. The first step is passive biosorption that cesium ions are adsorbed to cells surface by electrostatic attraction; after that, the second step is active biosorption that cesium ions penetrate the cell membrane and accumulate in the cytoplasm. - Highlights: • Microorganisms isolated from a cesium solution are considered as a biosorbent to remove cesium ions. • The biosorption equilibrium is fitted well to a Langmuir model with a correlation coefficient of 0.9997. • First attempt to explore biosorption mechanisms using PIXE and EPBS. • Living and dead microorganisms have different biosorption mechanisms. • The biosorption of 137Cs involved a two-step process: passive and active

  7. Spatial variability and Cesium-137 inventories in native forest

    International Nuclear Information System (INIS)

    With the nuclear fission discovery and development of nuclear weapons in 1940s, artificial radioisotopes were introduced in the environment. This contamination is due to worldwide fallout by superficial nuclear tests realized from early 1950s to late 1970s by USA, former URSS, UK, France and China. One of theses radioisotopes that have been very studied is cesium-137. Cesium-137 has a half-life of 30.2 years and its biological behavior is similar to the potassium. The behavior in soil matrix, depth distribution, spatial variability and inventories values of cesium-137 has been determinate for several regions of the world. In Brazil, some research groups have worked on this subject, but there are few works published about theses properties of cesium-137. The aim of this paper was study the depth distribution, spatial variability, and inventory of cesium-137 in native forest. Two native forests (Mata 1 and Mata UEL) were sampling in region of Londrina, PR. The results shows that there is a spatial variability of 40% for Mata 1 and 42% for Mata UEL. The depth distribution of cesium-137 for two forests presented a exponential form, characteristic to undisturbed soil. Cesium-137 inventory determinate for Mata 1 was 358 Bq m-2 and for Mata UEL was 320 Bq m-2. (author)

  8. Pollution of drug-technical materials by cesium-137

    International Nuclear Information System (INIS)

    Drug-technical raw materials are medicinal plants (flowers, folium, grasses, mushrooms, roots, fruits, berry, kidney, cortex), used in pharmacy. To limit receipt cesium-137 in people body in 1993 in the Republic of Belarus were created 'Temporary permission levels of the cesium-137 radionuclides contents in drug-technical raw materials' were created (TPL-1993). The permission levels of cesium-137 are following: for drug-technical raw material (flowers, folium, grass, mushrooms, roots and other plants parts) - 1850 Bq/kg, for dried up fruits and berries - 2590 Bq/kg. (Author)

  9. Synthesis and peculiarities of the cesium zeolite crystal structure (cesite)

    International Nuclear Information System (INIS)

    An attempt is made to synthesize cesium zeolite by introduction of amorphous seed crystals which correspond by composition with cesium-containing zeolite into the aluminosilicate gel, since this method can produce zeolite with a crystal structure it would not adopt under the usual conditions. It is seen that during crystablization upon introduction of a seed crystal the cesium content in zeolite decreases. A more complete structural elucidation of zeolite obtained by the suggested method was carried out by x0ray and IR spectral analyses. The data of x-ray analysis showed that the structures of synthesized zeolite and binary octagonal pores are similar

  10. Management of cesium loaded AMP- Part I preparation of 137Cesium concentrate and cementation of secondary wastes

    International Nuclear Information System (INIS)

    Separation of 137cesium from High Level Waste can be achieved by use of composite-AMP, an engineered form of Ammonium Molybdo-Phosphate(AMP). Direct vitrification of cesium loaded composite AMP in borosilicate glass matrix leads to separation of water soluble molybdate phase. A proposed process describes two different routes of selective separation of molybdates and phosphate to obtain solutions of cesium concentrates. Elution of 137Cesium from composite-AMP by decomposing it under flow conditions using saturated barium hydroxide was investigated. This method leaves molybdate and phosphate embedded in the column but only 70% of total cesium loaded on column could be eluted. Alternatively composite-AMP was dissolved in sodium hydroxide and precipitation of barium molybdate-phosphate from the resultant solution, using barium nitrate was investigated by batch methods. The precipitation technique gave over 99.9% of 137Cesium activity in solutions, free of molybdates and phosphates, which is ideally suited for immobilization in borosilicate glass matrix. Detailed studies were carried out to immobilize secondary waste of 137Cesium contaminated barium molybdate-phosphate precipitates in the slag cement matrix using vermiculite and bentonite as admixtures. The cumulative fraction of 137Cs leached from the cement matrix blocks was 0.05 in 140 days while the 137Cs leach rate was 0.001 gm/cm2/d. (author)

  11. Biosorption of uranium, radium, and cesium

    International Nuclear Information System (INIS)

    Some fundamental aspects of the biosorption of metals by microbial cells were investigated. These studies were carried out in conjunction with efforts to develop a process to utilize microbial cells as biosorbents for the removal of radionuclides from waste streams generated by the nuclear fuel cycle. It was felt that an understanding of the mechanism(s) of metal uptake would potentially enable the enhancement of the metal uptake phenomenon through environmental or genetic manipulation of the microorganisms. Also presented are the results of a preliminary investigation of the applicability of microorganisms for the removal of 137cesium and 226radium from existing waste solutions. The studies were directed primarily at a characterization of uranium uptake by the yeast, Saccharomyces cerevisiae, and the bacterium, Pseudomonas aeruginosa

  12. Structure of double hafnium and cesium sulfate

    International Nuclear Information System (INIS)

    The structure of a compound whose formula according to the structural investigation is Cssub(2+x)Hf(SOsub(4))sub(2+x)(HSOsub(4))sub(2-x)x3Hsub(2)O (x approximately 0.7) (a=10.220, b=12.004, c=15.767 A, space group Pcmn) is determined by diffractometric data (2840 reflections, anisotropic refinement, R=0.087). It is build of complex unions [Hf(SO4)4H2O]4-, Cs+ cations and water molecules. Eight O atoms surrounding Hf atom (dodecahedron Hf-O 2.10-2.22 A) belong to four sulphate groups and water molecule. Three sulphate groups are bidentate-cyclic, and one group - monodentate relative to Hf. The structure has a cesium deficit in particular positions

  13. Double manganese(III) cesium triphosphate

    International Nuclear Information System (INIS)

    Double triphosphates have been identified in research on interactions in the P2O5-M2O3-Cs2O-H2O system, where M(III) = Al, Ga, Cr, Fe, at 570-770K, which have the M(III)Cs2 - P3O10 composition; here we report the identification of a new phase made under analogous conditions in a system containing Mn(III) together with some of its physicochemical properties. The product was analyzed for phosphorus by a colorimetric method, for manganese by titration with EDTA, and for cesium by atomic absorption. The x-ray phase analysis was performed with a DRON-3.0 diffractometer. The IR spectra were recorded. Thermogravimetry indicates that the product is MnCs2P3O10·H2O

  14. Intercomparision of Standardized Radioactive Solution of 133Ba

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>133Ba is a very important nuclide in the field of radiation, for example applied to efficienency calibration of the γ spectromenter. To ensure the accurate and reliable of measurement results of 133Ba, to

  15. Low-work-function surfaces produced by cesium carbonate decomposition

    Science.gov (United States)

    Briere, T. R.; Sommer, A. H.

    1977-01-01

    Cesium carbonate (Cs2CO3) was heated to the decomposition temperature of approximately 600 C. The nonvolatile decomposition products were condensed on a nickel substrate while the carbon dioxide was removed by pumping. The deposited material is characterized by an effective work function of between 1.05 and 1.15 eV at 450 K and by photoemission in the visible and near-infrared region of the spectrum. It is suggested that the deposited material consists of Cs2O, possibly Cs2O2, and adsorbed cesium. Silver, evaporated from a heated silver bead, produced the typical photoemissive and thermionic properties of a silver-oxygen-cesium (S-1) photocathode. The material may be of interest for thermionic energy converters and for the formation of silver-oxygen-cesium photocathodes.

  16. Sorption of cesium and strontium by arid region desert soil

    International Nuclear Information System (INIS)

    Adsorption and ion exchange in soil systems are the principal mechanisms that retard the migration of nuclear waste to the biosphere. Cesium and strontium are two elements with radioactive isotopes (Cs137 and Sr90) that are commonly disposed of as nuclear waste. The sorption and ion exchange properties of nonradioactive cesium and strontium were studied in this investigation. The soil used in this study was collected at an experimental infiltration site on Frenchman Flat, a closed drainage basin on the Nevada Test Site. This soil is mostly nonsaline-alkali sandy loam and loamy sand with a cation exchange capacity ranging from 13 to 30 me/100g. The clay fraction of the soil contains illite, montmorillonite, and clinoptilolite. Ion exchange studies have shown that this soil sorbs cesium preferentially relative to strontium, and that charge for charge, the exchange-phase cations released from exchange sites exceed the cesium and strontium sorbed by the soil. 38 references, 22 figures

  17. Cesium iodide crystals fused to vacuum tube faceplates

    Science.gov (United States)

    Fleck, H. G.

    1964-01-01

    A cesium iodide crystal is fused to the lithium fluoride faceplate of a photon scintillator image tube. The conventional silver chloride solder is then used to attach the faceplate to the metal support.

  18. hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

    Directory of Open Access Journals (Sweden)

    Shunsuke Ohnishi

    Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

  19. 49 CFR 209.133 - Referral for prosecution.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Referral for prosecution. 209.133 Section 209.133... Penalties § 209.133 Referral for prosecution. If an inspector, including a certified state inspector under... case, and if it appears that assessment of a civil penalty would not be an adequate deterrent to...

  20. 19 CFR 133.21 - Articles bearing counterfeit trademarks.

    Science.gov (United States)

    2010-04-01

    ...: “The sample described as and provided pursuant to 19 CFR 133.21(d) was (damaged/destroyed/lost) during... 19 Customs Duties 1 2010-04-01 2010-04-01 false Articles bearing counterfeit trademarks. 133.21... Recorded Trademarks or Recorded Trade Names § 133.21 Articles bearing counterfeit trademarks....

  1. 7 CFR 1.133 - Institution of proceedings.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Institution of proceedings. 1.133 Section 1.133... Formal Adjudicatory Proceedings Instituted by the Secretary Under Various Statutes § 1.133 Institution of... the institution of a formal proceeding which may result in the withdrawal, suspension, or...

  2. 33 CFR 133.25 - Notification of Governor's designee.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Notification of Governor's designee. 133.25 Section 133.25 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... FUND; STATE ACCESS § 133.25 Notification of Governor's designee. (a) If the Governor of a...

  3. 21 CFR 133.124 - Cold-pack cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cold-pack cheese food. 133.124 Section 133.124 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... Cheese and Related Products § 133.124 Cold-pack cheese food. (a)(1) Cold-pack cheese food is the...

  4. 14 CFR 133.23 - Knowledge and skill.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Knowledge and skill. 133.23 Section 133.23... OPERATIONS Certification Rules § 133.23 Knowledge and skill. (a) Except as provided in paragraph (d) of this... the Administrator satisfactory knowledge and skill regarding rotorcraft external-load operations...

  5. 43 CFR 13.3 - Cooperation in selection of facilities.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Cooperation in selection of facilities. 13.3 Section 13.3 Public Lands: Interior Office of the Secretary of the Interior VENDING FACILITIES OPERATED BY BLIND PERSONS § 13.3 Cooperation in selection of facilities. Upon request from a...

  6. 23 CFR 1.33 - Conflicts of interest.

    Science.gov (United States)

    2010-04-01

    ... § 1.33 Conflicts of interest. No official or employee of a State or any other governmental... 23 Highways 1 2010-04-01 2010-04-01 false Conflicts of interest. 1.33 Section 1.33 Highways... project shall have, directly or indirectly, any financial or other personal interest in any such...

  7. 22 CFR 133.635 - Drug-free workplace.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Drug-free workplace. 133.635 Section 133.635 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 133.635 Drug-free workplace. Drug-free workplace means a site for...

  8. 40 CFR 133.105 - Treatment equivalent to secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Treatment equivalent to secondary treatment. 133.105 Section 133.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS SECONDARY TREATMENT REGULATION § 133.105 Treatment equivalent to secondary...

  9. 14 CFR 133.43 - Structures and design.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Structures and design. 133.43 Section 133.43 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED...-LOAD OPERATIONS Airworthiness Requirements § 133.43 Structures and design. (a) External-load...

  10. 21 CFR 133.186 - Sap sago cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by...

  11. 21 CFR 133.103 - Asiago medium cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Asiago medium cheese. 133.103 Section 133.103 Food... HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.103 Asiago medium cheese. Asiago medium cheese conforms to the definition...

  12. 21 CFR 133.104 - Asiago old cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Asiago old cheese. 133.104 Section 133.104 Food... HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.104 Asiago old cheese. Asiago old cheese conforms to the definition and standard...

  13. 21 CFR 133.116 - Low sodium cheddar cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Low sodium cheddar cheese. 133.116 Section 133.116... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.116 Low sodium cheddar cheese. Low sodium cheddar cheese is the...

  14. 21 CFR 133.154 - High-moisture jack cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false High-moisture jack cheese. 133.154 Section 133.154... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.154 High-moisture jack cheese. High-moisture jack cheese conforms...

  15. 21 CFR 133.167 - Pasteurized blended cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized blended cheese. 133.167 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.167 Pasteurized blended cheese. Pasteurized blended cheese conforms...

  16. 21 CFR 133.121 - Low sodium colby cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Low sodium colby cheese. 133.121 Section 133.121... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.121 Low sodium colby cheese. Low sodium colby cheese is the...

  17. 21 CFR 133.169 - Pasteurized process cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese. 133.169 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.169 Pasteurized process cheese. (a)(1) Pasteurized process cheese...

  18. Measurement of parity violation in the 6S-7S transition of cesium using stimulated emission

    International Nuclear Information System (INIS)

    This document describes the design and implementation of a pump-probe polarimetry experiment in a cesium vapor, aiming at a 1% precision measurement of atomic parity violation (APV) induced by Z0 boson exchange. The experimental scheme, relying on induced emission by a probe laser, allows a detection efficiency close to unity, and the left-right asymmetry to be measured is amplified during the propagation of the probe beam in the excited vapour. The interest of the result presented here is to cross-check the unique previous result by an experiment with a completely different design, and hence with completely different systematics, that also allows measurements on long-lived isotopes especially 135Cs (nuclear spin 7/2 like 133Cs, half-life 3 million years). We have demonstrated improvements in polarimetry techniques (rejection of instrumental errors, implementation of a polarization magnifier), especially in pulsed polarimetry (doubly-differential, balanced-mode polarization analysis). But most importantly, the expected pump-probe chiral optical gain has been observed in a Cs vapor. The precision on the θpv measurement has been improved to 2.6%, and the achieved signal/noise ratio allows measurements at the 1% precision level. The achieved precision on lm E1pv is 2 x 10-13 ea0, 15 times better than the measurements obtained with the lead and thallium atoms. Our result is in agreement with the more precise Boulder result. The required amount of cesium is small enough to allow a measurement with 135Cs provided one takes reasonable radioprotection measures. (author)

  19. Sleep Monitoring Experiment - Skylab Experiment M133

    Science.gov (United States)

    1970-01-01

    This 1970 photograph shows equipment for the Skylab's Sleep Monitoring Experiment (M133), a medical evaluation designed to objectively determine the amount and quality of crewmembers' inflight sleep. The experiment monitored and recorded electroencephalographic (EEG) and electrooculographic (EOG) activity during astronauts' sleep periods. One of the astronauts was selected for this experiment and wore a fitted cap during his sleep periods. The Marshall Space Flight Center had program management responsibility for the development of Skylab hardware and experiments.

  20. Deletion 22q13.3 syndrome

    OpenAIRE

    Phelan Mary C

    2008-01-01

    Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndr...

  1. Sorption of cesium on Olkiluoto mica gneiss, granodiorite and granite

    International Nuclear Information System (INIS)

    Cesium was selected as a model to study the sorption in bedrock occurring by ion exchange mechanism. The aim of the study was to supplement the existing data on sorption occurring by ion exchange mechanism in bedrock of the candidate sites for spent fuel disposal at Olkiluoto. The sorption of cesium was studied on crushed mica gneiss, tonalite (granodiorite) and granite in artificial groundwaters. Fresh water was represented by Allard water, pH 8 and pH 7, and saline water by Ol-So water, pH 7 and pH 9. In addition, a Na-Ca-Cl brine water and its 1:10 dilution were used as simulants. Cesium concentrations were between 10-8 and 10-3 mol/l. The distribution coefficients of the sorption, Rd and Ra values were determined by batch method. Isotherms were partly non-linear with slopes 0.7 - 1.0 depending on rock and water. At the end of the sorption experiment, the water was analysed for cations exchanged for cesium. The sorption of cesium was also studied as a function of ionic strength. The ionic strength increased in the order Allard < 0l-Br 1:10 < 0l-So < 0l-Br. The sorption of cesium was lower at higher ionic strength and higher Cs concentration. The mineral composition of rocks was determined by thin section analysis, and the sorption distribution ratios on thin sections in the different waters were determined by batch technique. The minerals, that sorbed most cesium were determined by autoradiography. These were biotite, muscovite and chlorite. Cordierite in mica gneiss also sorbed cesium very effectively. (orig.)

  2. Sorption of cesium on Olkiluoto mica gneiss, granodiorite and granite

    Energy Technology Data Exchange (ETDEWEB)

    Huitti, T.; Hakanen, M. [Univ. of Helsinki (Finland). Lab. of Radiochemistry; Lindberg, A. [Geological Survey of Finland, Espoo (Finland)

    1998-09-01

    Cesium was selected as a model to study the sorption in bedrock occurring by ion exchange mechanism. The aim of the study was to supplement the existing data on sorption occurring by ion exchange mechanism in bedrock of the candidate sites for spent fuel disposal at Olkiluoto. The sorption of cesium was studied on crushed mica gneiss, tonalite (granodiorite) and granite in artificial groundwaters. Fresh water was represented by Allard water, pH 8 and pH 7, and saline water by Ol-So water, pH 7 and pH 9. In addition, a Na-Ca-Cl brine water and its 1:10 dilution were used as simulants. Cesium concentrations were between 10{sup -8} and 10{sup -3} mol/l. The distribution coefficients of the sorption, R{sub d} and R{sub a} values were determined by batch method. Isotherms were partly non-linear with slopes 0.7 - 1.0 depending on rock and water. At the end of the sorption experiment, the water was analysed for cations exchanged for cesium. The sorption of cesium was also studied as a function of ionic strength. The ionic strength increased in the order Allard < 0l-Br 1:10 < 0l-So < 0l-Br. The sorption of cesium was lower at higher ionic strength and higher Cs concentration. The mineral composition of rocks was determined by thin section analysis, and the sorption distribution ratios on thin sections in the different waters were determined by batch technique. The minerals, that sorbed most cesium were determined by autoradiography. These were biotite, muscovite and chlorite. Cordierite in mica gneiss also sorbed cesium very effectively. (orig.) 12 refs.

  3. Cesium pre-implantation of embedded biological sections

    International Nuclear Information System (INIS)

    An ion implantation system which allows the implantation of a large surface of a specimen has been used to obtain an homogeneous enrichment with cesium of embedded biological tissues sections. In such a specimen, containing already oxygen at a high concentration, the addition of cesium allows both positive and negative secondary ions to be studied with the highest sensitivity, using the same primary ion source.

  4. Kelvin Probe Studies of Cesium Telluride Photocathode for AWA Photoinjector

    OpenAIRE

    Wisniewski, Eric; Velazquez, Daniel; Yusof, Zikri; Spentzouris, Linda; Terry, Jeff; Harkay, Katherine

    2012-01-01

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (~50 nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study incl...

  5. Adsorption Behaviour of Liquid 4He on Cesium Substrates

    OpenAIRE

    Iov, Valentin

    2004-01-01

    The aim of this thesis is to investigate the wetting properties of 4He on cesium substrates using optical and electrical methods. Due to the fact that the cesium substrates are deposited at low temperatures onto a thin silver underlayer, it is necessary firstly to study and understand the adsorption of helium on silver. The work presented here is structured as follows: some of the fundamental concepts on the theory of physisorbed films, such as van der Waals interaction, adsorption isotherms ...

  6. Study of strontium and cesium migration in fractured crystalline rock

    International Nuclear Information System (INIS)

    The purpose of this investigation has been to study the retardation and dilution of non-active strontium and cesium relative to a non-absorbing substance (iodide) in a well-defined fracture zone in the Finnsjoen field research area. The investigation was carried out in a previously tracer-tested fracture zone. The study has encompassed two separate test runs with prolonged injection of strontium and iodide and of cesium and iodide. The test have shown that: - Strontium is not retarded, but rather absorbed to about 40% at equilibrium. - At injection stop, 36.3% of the injected mass of strontium has been absorbed and there is no deabsorption. -Cesium is retarded a factor of 2-3 and absorbed to about 30% at equilibrium. - At injection stop, 39.4% of the injected mass of cesium has been absorbed. Cesium is deabsorbed after injection stop (400h) and after 1300 hours, only 22% of the injected mass of cesium is absorbed. (author)

  7. Seasonal variation of cesium 134 and cesium 137 in semidomestic reindeer in Norway after the Chernobyl accident

    Directory of Open Access Journals (Sweden)

    I.M. H. Eikelmann

    1990-09-01

    Full Text Available The Chernobyl accident had a great impact on the semidomestic reindeer husbandry in central Norway. Seasonal differences in habitat and diet resulted in large variations in observed radiocesium concentrations in reindeer after the Chernobyl accident. In three areas with high values of cesium-134 and cesium-137 in lichens, the main feed for reindeer in winter, reindeer were sampled every second month to monitor the seasonal variation and the decrease rate of the radioactivity. The results are based on measurements of cesium-134 and cesium-137 content in meat and blood and by whole-body monitoring of live animals. In 1987 the increase of radiocesium content in reindeer in Vågå were 4x from August to January. The mean reductions in radiocesium content from the winter 1986/87 to the winter 1987/88 were 32%, 50% and 43% in the areas of Vågå, Østre-Namdal and Lom respectively.

  8. Radiological protection and routinary controls of an activimeter with a cesium and barium sources in an nuclear medicine center

    International Nuclear Information System (INIS)

    In the present work the results when carrying out the routine controls in a Deluxe Isotope (Calibrator II) equipment, with some sources of Cesium 137 and Barium 133, in a Nuclear Medicine Center that operates from the year 1983 in a modern one construction inside the Institute of Neoplastic Illnesses (INEN) are shown. Taking in account the Radiological Protection measures to verify if the equipment responds to the personnel's demands in the measurements of activities of the diverse radionuclides that are used in different types of exams that are carried out in this Nuclear Medicine Center are the objectives of this work. This Center was equipped initially with donated equipment by the International Atomic Energy Agency (IAEA) with those that it develops assistance, educational works and of research, giving services to patients of the INEN and other public and private medical centers. (Author)

  9. Steady State Sputtering Yields and Surface Compositions of Depleted Uranium and Uranium Carbide bombarded by 30 keV Gallium or 16 keV Cesium Ions

    International Nuclear Information System (INIS)

    Depleted uranium that included carbide inclusions was sputtered with 30keV gallium ions or 16kev cesium ions to depths much greater than the ions’ range, i.e. using steady state sputtering. The recession of both the uranium’s and uranium carbide’s surfaces and the ion corresponding fluences were used to determine the steady state target sputtering yields of both uranium and uranium carbide, i.e. 6.3 atoms of uranium and 2.4 units of uranium carbide eroded per gallium ion, and 9.9 uranium atoms and 3.65 units of uranium carbide eroded by cesium ions. The steady state surface composition resulting from the simultaneous gallium or cesium implantation and sputter-erosion of uranium and uranium carbide were calculated to be U86Ga14, (UC)70Ga30 and U81Cs9, (UC)79Cs21, respectively.

  10. Steady State Sputtering Yields and Surface Compositions of Depleted Uranium and Uranium Carbide bombarded by 30 keV Gallium or 16 keV Cesium Ions.

    Energy Technology Data Exchange (ETDEWEB)

    Siekhaus, W. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Teslich, N. E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Weber, P. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-10-23

    Depleted uranium that included carbide inclusions was sputtered with 30-keV gallium ions or 16-kev cesium ions to depths much greater than the ions’ range, i.e. using steady-state sputtering. The recession of both the uranium’s and uranium carbide’s surfaces and the ion corresponding fluences were used to determine the steady-state target sputtering yields of both uranium and uranium carbide, i.e. 6.3 atoms of uranium and 2.4 units of uranium carbide eroded per gallium ion, and 9.9 uranium atoms and 3.65 units of uranium carbide eroded by cesium ions. The steady state surface composition resulting from the simultaneous gallium or cesium implantation and sputter-erosion of uranium and uranium carbide were calculated to be U₈₆Ga₁₄, (UC)₇₀Ga₃₀ and U₈₁Cs₉, (UC)₇₉Cs₂₁, respectively.

  11. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO{sub 4}] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils

    Energy Technology Data Exchange (ETDEWEB)

    Mallampati, Srinivasa Reddy, E-mail: srireddys@ulsan.ac.kr [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of); Mitoma, Yoshiharu, E-mail: mitomay@pu-hiroshima.ac.jp [Department of Environmental Sciences, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka-Cho Shobara City, Hiroshima 727-0023 (Japan); Okuda, Tetsuji [Environmental Research and Management Center, Hiroshima University, 1-5-3 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8513 (Japan); Simion, Cristian [Politehnica University of Bucharest, Department of Organic Chemistry, Bucharest 060042 (Romania); Lee, Byeong Kyu [Department of Civil and Environmental Engineering, University of Ulsan, Daehak-ro 93, Nam-gu, Ulsan 680-749 (Korea, Republic of)

    2015-10-30

    Graphical abstract: A possible pathway for immobilization with the nano-Fe/Ca/CaO/[PO{sub 4}] treatment (a) {sup 133}Cs is adsorbed onto the soil particles, (b) Cs encapsulation through the formation of immobile salts, and (c) solid (small/finer or larger/aggregate) soil fraction separation. - Highlights: • Nano-Fe/Ca/CaO/[PO{sub 4}] composite for Cs immobilization in soil was developed. • Enhanced cesium separation and immobilization was done in dry condition. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • Nano-Fe/Ca/CaO/[PO{sub 4}] a highly potential amendment for the remediation of Cs. - Abstract: This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable ({sup 133}Cs) and radioactive cesium species ({sup 134}Cs and {sup 137}Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO{sub 4}], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant {sup 133}Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO{sub 4}], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped {sup 134}Cs and {sup 137}Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that {sup 134}Cs and {sup 137}Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO{sub 4}] treated soil were characterized using SEM–EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil

  12. Solvent-free synthesis and application of nano-Fe/Ca/CaO/[PO4] composite for dual separation and immobilization of stable and radioactive cesium in contaminated soils

    International Nuclear Information System (INIS)

    Graphical abstract: A possible pathway for immobilization with the nano-Fe/Ca/CaO/[PO4] treatment (a) 133Cs is adsorbed onto the soil particles, (b) Cs encapsulation through the formation of immobile salts, and (c) solid (small/finer or larger/aggregate) soil fraction separation. - Highlights: • Nano-Fe/Ca/CaO/[PO4] composite for Cs immobilization in soil was developed. • Enhanced cesium separation and immobilization was done in dry condition. • By SEM analysis the amount of cesium detectable on soil particle surface decreases. • Leachable cesium concentrations reduced, lower than the standard regulatory limit. • Nano-Fe/Ca/CaO/[PO4] a highly potential amendment for the remediation of Cs. - Abstract: This study assessed the synthesis and application of nano-Fe/Ca/CaO-based composite material for use as a separation and immobilizing treatment of dry soil contaminated by stable (133Cs) and radioactive cesium species (134Cs and 137Cs). After grinding with nano-Fe/CaO, nano-Fe/Ca/CaO, and nano-Fe/Ca/CaO/[PO4], approximately 31, 25, and 22 wt% of magnetic fraction soil was separated. Their resultant 133Cs immobilization values were about 78, 81, and 100%, respectively. When real radioactive cesium contaminated soil obtained from Fukushima was treated with nano-Fe/Ca/CaO/[PO4], approximately 27.3 wt% of magnetic and 72.75% of non-magnetic soil fractions were separated. The highest amount of entrapped 134Cs and 137Cs was found in the lowest weight of the magnetically separated soil fraction (i.e., 80% in 27.3% of treated soil). Results show that 134Cs and 137Cs either in the magnetic or non-magnetic soil fractions was 100% immobilized. The morphology and mineral phases of the nano-Fe/Ca/CaO/[PO4] treated soil were characterized using SEM–EDS, EPMA, and XRD analysis. The EPMA and XRD patterns indicate that the main fraction of enclosed/bound materials on treated soil included Ca/PO4 associated crystalline complexes. These results suggest that simple grinding

  13. CD133+ cells contribute to radioresistance via altered regulation of DNA repair genes in human lung cancer cells

    International Nuclear Information System (INIS)

    Background: Radioresistance in human tumors has been linked in part to a subset of cells termed cancer stem cells (CSCs). The prominin 1 (CD133) cell surface protein is proposed to be a marker enriching for CSCs. We explore the importance of DNA repair in contributing to radioresistance in CD133+ lung cancer cells. Materials and methods: A549 and H1299 lung cancer cell lines were used. Sorted CD133+ cells were exposed to either single 4 Gy or 8 Gy doses and clonogenic survival measured. ϒ-H2AX immunofluorescence and quantitative real time PCR was performed on sorted CD133+ cells both in the absence of IR and after two single 4 Gy doses. Lentiviral shRNA was used to silence repair genes. Results: A549 but not H1299 cells expand their CD133+ population after single 4 Gy exposure, and isolated A549 CD133+ cells demonstrate IR resistance. This resistance corresponded with enhanced repair of DNA double strand breaks (DSBs) and upregulated expression of DSB repair genes in A549 cells. Prior IR exposure of two single 4 Gy doses resulted in acquired DNA repair upregulation and improved repair proficiency in both A549 and H1299. Finally Exo1 and Rad51 silencing in A549 cells abrogated the CD133+ IR expansion phenotype and induced IR sensitivity in sorted CD133+ cells. Conclusions: CD133 identifies a population of cells within specific tumor types containing altered expression of DNA repair genes that are inducible upon exposure to chemotherapy. This altered gene expression contributes to enhanced DSB resolution and the radioresistance phenotype of these cells. We also identify DNA repair genes which may serve as promising therapeutic targets to confer radiosensitivity to CSCs

  14. Enhanced radiosensitivity and radiation-induced apoptosis in glioma CD133-positive cells by knockdown of SirT1 expression

    International Nuclear Information System (INIS)

    CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133+) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133- cells. To evaluate the role of SirT1 in GBM-CD133+, we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133+. Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133+ to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in the inhibition of tumor growth in nude mice transplanted with GBM-CD133+. Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133+ mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.

  15. Dose mapping experiments of refurbished cesium irradiator

    International Nuclear Information System (INIS)

    Full text: Cesium irradiator is a technology demonstration facility for irradiation of food commodities to achieve various purposes like control of sprouting in onion and potato, insect disinfestations of cereals and pulses, quarantine treatment of fresh fruits and vegetables and shelf life extension of perishable foods. The facility was installed in 1968 and recently refurbished with the new control console. The current source strength (137Cs) of the irradiator is 44.3 kCi. The real success of irradiation of food commodities lies in the adequate delivery of radiation dose to achieve the particular purpose of irradiation. Therefore, evaluation of dose distribution pattern in the product trays of the irradiation facility is of paramount importance. Two sets of dose mapping experiments of the product trays of the facility were carried out to find out the dose distribution profile and dose uniformity ratio. Reference standard dosimeter Fricke was used for the experiment. The standardized ionic concentrations of Fricke dosimeter are Ferrous Ammonium Sulphate (FeSO4(NH4)2SO4 6H2O ) - 1 mM, Sodium Chloride (NaCl) - 1 mM, Sulphuric acid (H2SO4) - 400 mM. The Optical Density (O.D) evaluation was carried out using Spectrophotometry with wave length of 304 nm. The dosimetry tray was partitioned into two planes namely bottom plane and top plane using card-board sheets. Polypropylene vials containing Fricke solution were prepared and fixed on the planes. Each plane was containing nine numbers of dosimeters. The product thickness was around 9 cm. The temperatures of irradiation and measurements were 30 deg C and 28 deg C respectively. The first set of experiment was intended to find out the dose distribution profile throughout the irradiation chamber. The dose rate at Dmin position was observed as 3.69 Gy/min with a poor Dose Uniformity Ratio (DUR) of 6.5. In order to improve the dose rate and DUR the second set of the experiment was carried out with modified product geometry

  16. Improvement of cesium retention in uranium dioxide by additional phases

    International Nuclear Information System (INIS)

    The objective of this study is to improve the cesium retention in nuclear fuel. A bibliographic survey indicates that cesium is rapidly released from uranium dioxide in an accident condition. At temperatures higher than 1500 deg C or in oxidising conditions, our experiments show the difficulty of maintaining cesium inside simulated fuel. Two ternary systems are potentially interesting for the retention of cesium and to reduce the kinetics of release from the fuel: Cs2O-Al2O3-SiO2 et Cs2O-ZrO2-SO2. The compounds CsAISi2O6 and Cs2ZrSi6O15 were studied from 1200 deg C to 2000 deg C by thermogravimetric analysis. The volumetric diffusion coefficients of cesium in these structures, in solid state as well as in liquid one, were measured. A fuel was sintered with (Al2O3 + SiO2) or (ZrO2 + SiO2) and the intergranular phase was characterized. In the presence of (Al2O3 + SiO2), the sintering is realized at 1610 deg C in H2. It is a liquid phase sintering. On the other end, with (ZrO2 + SiO2), the sintering is a low temperature one in oxidising atmosphere. Finally, cesium containing simulated fuels were produced with these additives. According to the effective diffusion coefficients that were measured, the additives improved the retention of cesium. We have predicted the improvement that could be hoped for in a nuclear reactor, depending on the dispersion of the intergranular additives, the temperature and the degree of oxidation of the UO2+x. We wait for a factor of 2 for x=0 and more than 8 for x=0.05, up to 2000 deg C. (author). 148 refs., 122 figs., 34 tabs

  17. Cesium and strontium in Black Sea macroalgae

    International Nuclear Information System (INIS)

    The trace level of metals and particularly radioactive ones should be monitored to evaluate the transfer along the trophic chain, assess the risk for biota and can be used for global changes assessment. Plants respond rapidly to all changes in the ecosystem conditions and are widely used as indicators and predictors for changes in hydrology and geology. In this work we represent our successful development and applications of a methodology for monitoring of stable and radioactive strontium and cesium in marine biota (Black Sea algae's). In case of radioactive release they are of high interest. We use ED-XRF, gamma spectrometers and LSC instrumentation and only 0.25 g sample. Obtained results are compared with those of other authors in same regions. The novelty is the connection between the radioactive isotopes and their stable elements in algae in time and space scale. All our samples were collected from Bulgarian Black Sea coast. - Highlights: • An extraction chromatography method for radiochemical separation of Sr and Cs. • Assessment of Sr and Cs accumulation capacity of six Black Sea macroalgae species. • Connection between the isotopes and their stable elements content in algae. • Assessment of Sr and Cs content in ecosystems along the Bulgarian coast

  18. Cesium-137 levels detected in Georgia otters

    International Nuclear Information System (INIS)

    Beginning in the 1940's and continuing through the 50's and early 60's, nuclear devices were tested by aerial detonation in the United States and other countries around the world. Cesium-137 (137Cs) is one of the most important radionuclide by-products due to its abundance and slow decay (30-year half-life). The uptake of 137Cs in animal tissue is the result of its similarity to potassium. The somatic and genetic effects of 137Cs, along with its effect on reproductive cells, can pose great hazards to wildlife species. A reported buildup of 137Cs in white-tailed deer in the lower coastal plain of Georgia during the 1960's was followed by a gradual decline during the 1970's. Although numerous studies have involved terrestrial mammals of Georgia, few have involved aquatic mammals such as the river otter. With continued atmospheric testing by some foreign countries and the increased use of nuclear power as an energy source, there is a need for continued monitoring of radionuclides in wildlife to ascertain the quality of the environment. This study was initiated as part of an overall study of environmental pollutants in the river otter of Georgia and deals with analysis of the 137Cs accumulations in this species

  19. Cerebral blood flow tomography with xenon-133

    DEFF Research Database (Denmark)

    Lassen, N A

    1985-01-01

    Cerebral blood flow (CBF) can be measured tomographically by inhalation of Xenon-133. The calculation is based on taking a sequence of tomograms during the wash-in and wash-out phase of the tracer. Due to the dynamic nature of the process, a highly sensitive and fast moving single photon emission...... other tracers for CBF tomography using SPECT is summarized with emphasis on the 99mTc chelates that freely pass the intact blood-brain barrier. The highly sensitive brain-dedicated SPECT systems described are a prerequisite for achieving high resolution tomograms with such tracers....

  20. Lifetime measurement of states in 133Pr

    International Nuclear Information System (INIS)

    The aim of the present work was to study the shape polarising effect of high j orbitals. For the transitional nuclei in the mass 130 region, the valence protons tend to stabilise the nuclear shape close to prolate deformation while the valence neutrons favour oblate or triaxial shape. These effects are expected to reflect strongly on the collective properties of the nucleus with angular momentum. In the nucleus 133Pr, the odd proton occupies the low Ω, h11/2 orbital and is expected to polarise the nucleus to a prolate shape. Lifetime measurements of the states provide direct information about their collective properties

  1. Geochemical and grain-size distribution of radioactive and stable cesium in Fukushima soils: implications for their long-term behavior.

    Science.gov (United States)

    Saito, Takumi; Makino, Hisashi; Tanaka, Satoru

    2014-12-01

    Availability and mobility of radioactive cesium, (137)Cs, in soils are crucial for recovery from the accident in the Fukushima Dai-ichi Nuclear Power Plants. In this study we investigated the geochemical and grain-size distribution of (137)Cs in 11 soil samples collected in the eastern area of Fukushima Prefecture after the accident. Sequential extractions were performed to evaluate the distribution of (137)Cs having different geochemical interactions with soil components. The result was further compared with that of the stable cesium, (133)Cs, which had occurred in the soils before the accident. The distribution of (137)Cs in different grain-size fractions was also determined. Radioactive cesium was predominantly found in the extract obtained by strong-acid dissolution and the extraction residue and was more concentrated in silt and clay grains. X-ray diffraction analyses revealed that micaceous minerals as well as kaolin minerals were predominantly dissolved by the strong-acid treatment. Correlation between the fraction of (137)Cs and the content of micaceous minerals in different grain-size fractions of soil minerals suggests that micaceous minerals are responsible for the fixation of (137)Cs in the soils. The isotopic ratio of (137)Cs and (133)Cs in the extract by strong-acid dissolution was more than three times smaller than those in the extracts by water, ion exchange, and reductive dissolution. This indicates that the distribution of (137)Cs was not in the steady state in 2 y after the accident due to relatively slow fixation by the soil clay minerals. PMID:25128773

  2. Micro-PIXE evaluation of radioactive cesium transfer in contaminated soil samples

    International Nuclear Information System (INIS)

    Highlights: • There are radioactively contaminated soils having a radioactive cesium transfer of 0.01. • Micro-PIXE analysis has revealed an existence of phosphorus in a contaminated soil. • Radioactive cesium captured by phosphorus compound would be due to radioactive transfer. -- Abstract: Micro-PIXE analysis has been performed on two soil samples with high cesium activity concentrations. These soil samples were contaminated by fallout from the accident at Fukushima Daiichi Nuclear Power Plant. One exhibits a radioactive cesium transfer of ∼0.01, and the other shows a radioactive cesium transfer of less than 0.001, even though both samples have high cesium activity concentrations exceeding 10,000 Bq/kg. X-ray spectra and elemental images of the soil samples revealed the presence of chlorine, which can react with cesium to produce an inorganic soluble compound, and phosphorus-containing cesium-capturable organic compounds

  3. A fundamental study on cesium migration to sodium at low temperature

    International Nuclear Information System (INIS)

    Our experiment study aims to understand the behavior of cesium in severe accident of sodium cooled fast breeder reactor, especially cesium migration rate to sodium. In past study, exact migration rate of cesium to sodium has not been reported because of difficulty of the cesium-sodium interfacial area evaluations of gas bubble. In this study, we developed a pool-type experimental apparatus which can simplify the shape of interfacial area, and measured cesium migration rate in a low temperature range of 200degC to 300degC. The cesium migration rates obtained under the condition that the cesium mixed argon gas flow is the same temperature with sodium vary in the range of 10-3 - 10-1 mol/m2min and increase with increasing the system temperature. The difference of cesium migration rates between non-oxidized sodium surface and oxidized sodium surface is also clearly observed. (author)

  4. Viscosity and crystallization mechanism of cesium loaded iron phosphate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, Kitheri, E-mail: joskit@igcar.gov.in [Chemistry Group, IGCAR, Kalpakkam 603 102 (India); Kutty, K.V. Govindan [Chemistry Group, IGCAR, Kalpakkam 603 102 (India); Goswami, M.C. [National Metallurgical Laboratory, Jamshedpur 831 007 (India); Rao, P.R. Vasudeva [Chemistry Group, IGCAR, Kalpakkam 603 102 (India)

    2014-07-01

    Highlights: • Melt viscosity of cesium loaded iron phosphate glasses is measured and reported for the first time. • Viscosity – temperature followed Arrhenius model. • Activation energy of viscous flow is strongly correlated to glass transition temperature of the glasses. • Process of crystallization of cesium loaded glass by approximation-free kinetic method to understand the mechanism. • Cesium loaded IPG and IPG shows bulk crystallization mechanism. - Abstract: This paper describes the melt viscosity behaviour and the crystallization mechanism of a series of iron phosphate glasses. High temperature viscosity measurements were carried out on pristine iron phosphate glass and a series of cesium loaded iron phosphate glasses in order to understand the effect of addition of Cs{sub 2}O on viscosity of iron phosphate glasses. Activation energy of viscous flow was estimated from the experimental data by applying Arrhenius model of viscosity–temperature relationship. Activation energy of viscous flow is observed to be strongly correlated to glass transition temperature of these glasses. Fragility of iron phosphate and cesium loaded iron phosphate glass systems were also evaluated in region of high temperature. Crystallization of these glasses was studied using thermal analysis techniques. Temperature integral approximation free method was utilized to evaluate the kinetic parameters such as activation energy of crystallization (E{sub c}) and Avrami exponent (n). The value of Avrami exponent ‘n’ obtained showed that the glasses under present study crystallize via bulk crystallization mechanism, i.e., nucleation and three dimensional growth.

  5. Cesium corrosion process in Fe–Cr steel

    International Nuclear Information System (INIS)

    A cesium corrosion out-pile test was performed to Fe–Cr steel in a simulated fuel pin environment. In order to specify the corrosion products, the corroded area was analyzed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). A cesium corrosion process in Fe–Cr steel was successfully developed proceeding from both experimental results and thermochemical consideration. The corroded area was mainly formed by Fe layer and Fe depleted oxidized layer. The Fe depleted oxidized layer was formed by Cr0.5Fe0.5 and Cr2O3. The presumed main corrosion reactions were 2Cr+2/3 O2→Cr2O3(ΔG650°C=-894.1kJ/mol) and Cr23C6+46Cs+46O2→23Cs2CrO4+6C(ΔG650°C=-25018.1kJ/mol). Factors of these reactions are chromium, carbon, oxygen and cesium. Therefore, cesium corrosion progression must be dependent on the chromium content, carbon content in the steel, the supply rate of oxygen and temperature which correlated with the diffusion rate of cesium and oxygen into the specimen

  6. Viscosity and crystallization mechanism of cesium loaded iron phosphate glasses

    International Nuclear Information System (INIS)

    Highlights: • Melt viscosity of cesium loaded iron phosphate glasses is measured and reported for the first time. • Viscosity – temperature followed Arrhenius model. • Activation energy of viscous flow is strongly correlated to glass transition temperature of the glasses. • Process of crystallization of cesium loaded glass by approximation-free kinetic method to understand the mechanism. • Cesium loaded IPG and IPG shows bulk crystallization mechanism. - Abstract: This paper describes the melt viscosity behaviour and the crystallization mechanism of a series of iron phosphate glasses. High temperature viscosity measurements were carried out on pristine iron phosphate glass and a series of cesium loaded iron phosphate glasses in order to understand the effect of addition of Cs2O on viscosity of iron phosphate glasses. Activation energy of viscous flow was estimated from the experimental data by applying Arrhenius model of viscosity–temperature relationship. Activation energy of viscous flow is observed to be strongly correlated to glass transition temperature of these glasses. Fragility of iron phosphate and cesium loaded iron phosphate glass systems were also evaluated in region of high temperature. Crystallization of these glasses was studied using thermal analysis techniques. Temperature integral approximation free method was utilized to evaluate the kinetic parameters such as activation energy of crystallization (Ec) and Avrami exponent (n). The value of Avrami exponent ‘n’ obtained showed that the glasses under present study crystallize via bulk crystallization mechanism, i.e., nucleation and three dimensional growth

  7. The diffusion of cesium, strontium, and europium in silicon carbide

    Science.gov (United States)

    Dwaraknath, S. S.; Was, G. S.

    2016-08-01

    A novel multi-layer diffusion couple was used to isolate the diffusion of strontium, europium and cesium in SiC without introducing radiation damage to SiC and at concentrations below the solubility limit for the fission products in SiC. Diffusion occurred by both bulk and grain boundary pathways for all three fission products between 900∘ C and 1 ,300∘ C. Cesium was the fastest diffuser below 1 ,100∘ C and the slowest above this temperature. Strontium and europium diffusion tracked very closely as a function of temperature for both bulk and grain boundary diffusion. Migration energies ranged from 1.0 eV to 5.7 eV for bulk diffusion and between 2.2 eV and 4.7 eV for grain boundary diffusion. These constitute the first measurements of diffusion of cesium, europium, and strontium in silicon carbide, and the magnitude of the cesium diffusion coefficient supports the premise that high quality TRISO fuel should have minimal cesium release.

  8. CD133在肺癌中的研究与进展%Research and advance of CD133 in lung cancer

    Institute of Scientific and Technical Information of China (English)

    于会娜; 莫碧文

    2011-01-01

    Lung carcinoma is one of the most common cause of cancer-related death in the world,and is also one of the most common malignant tumors in China. It is difficult to cure because of its high-grade malignancy and rapid progress. Cancer stem cells (CSC) is a small part of tumor cells with self-renewal, unlimited proliferation and multi-differentiation capacity in tumor tissue. While CSC has small proportion in the tumor tissue, it is closely related with tumor origin, development and metastasis, and thus considered as a potential target to eradicate tumors. CD133 is a transmembrane glycoprotein found in human hematopoietic stem cells, which is thought as a surface marker of several stem cells. CD133+ cells are associated with tumor metastasis and tumor microvessels formation. Tumor relapse could be detected by quantitative CD133 mRNA expression. CD133 is also the biomarker of CSC of lung cancer. So this paper reviews CD133 and the related research in lung cancer.%肺癌是世界范围内死亡率最高的恶性肿瘤之一,也是我国常见的恶性肿瘤之一,恶性程度高,发展迅速,治疗困难,总体疗效不理想。肿瘤干细胞是肿瘤组织中一小部分具有自我更新、无限增殖和多向分化能力的肿瘤细胞,它在肿瘤组织中所占比例虽然很少,却与肿瘤起源、发展与转移关系密切,因此肿瘤干细胞被看作是一个根除癌症的潜在目标。CD133是在人类造血干细胞中发现的一种跨膜糖蛋白,并认为是多种干细胞的表面标志之一,并且CD133+细胞与肿瘤的转移、肿瘤的血管生成都有关系。另外研究者报道,可通过检测CD133 mRNA水平预测肿瘤的复发,并且认为可以作为某些肿瘤的预后指标。因此,有人认为CD133可能是肺癌干细胞的肿瘤标记物。本文就CD133在肺癌中的研究加以综述。

  9. Dissociative excitation of cesium atom upon e-CsOH collisions

    International Nuclear Information System (INIS)

    The process of dissociative excitation of cesium atom in collisions with mono-kinetic molecules of cesium hydroxide is studied. It is established that behaviour of dissociative excitations the cesium atom in spectral series corresponds of to the grade dependence of cross sections on the main quantum number of the upper level. The values of constants, characterizing the behaviour of cross sections in the eight spectral series of the cesium atom are determined

  10. Population of 133I from the beta decay of fission product 133Teg and the cluster-vibration model

    Science.gov (United States)

    Hicks, H. G.; Landrum, J. H.; Henry, E. A.; Meyer, R. A.; Brandt, S.; Paar, V.

    1983-05-01

    An automated rapid chemistry system has been used to isolate enriched sources of 12.4-min 133Teg from mixed fission products via the sequence 133Sb(β)133Teg. In addition, pure sources of 133Teg were obtained by using the reduction of TeVI to TeIV during the isomeric decay of 133Tem. Singles, Compton suppression singles, and γ-γ coincidence Ge(Li) spectra were used to identify approximately 210 γ rays from the decay of 133Teg. This information was used to establish 38 levels below 3000 keV in 133I. Cluster-vibration model calculations have been carried out for the Z=53 nucleus 133I. The calculated level structure and transition probabilities are found to be in good agreement with the experimental results. NUCLEAR STRUCTURE Cluster vibration model, energy levels, branching ratios. RADIOACTIVITY 133Teg (from Autobatch chemical isolation from fission); measured Eγ, Iγ, γ-γ coin, Compton suppression; 133I deduced levels J, π deduced β branch ft, HPGe and Ge(Li) detectors.

  11. Modulation by cocaine of dopamine receptors through miRNA-133b in zebrafish embryos.

    Directory of Open Access Journals (Sweden)

    Katherine Barreto-Valer

    Full Text Available The use of cocaine during pregnancy can affect the mother and indirectly might alter the development of the embryo/foetus. Accordingly, in the present work our aim was to study in vivo (in zebrafish embryos the effects of cocaine on the expression of dopamine receptors and on miR-133b. These embryos were exposed to cocaine hydrochloride (HCl at 5 hours post-fertilization (hpf and were then collected at 8, 16, 24, 48 and 72 hpf to study the expression of dopamine receptors, drd1, drd2a, drd2b and drd3, by quantitative real time PCR (qPCR and in situ hybridization (ISH, only at 24 hpf. Our results indicate that cocaine alters the expression of the genes studied, depending on the stage of the developing embryo and the type of dopamine receptor. We found that cocaine reduced the expression of miR-133b at 24 and 48 hpf in the central nervous system (CNS and at the periphery by qPCR and also that the spatial distribution of miR-133b was mainly seen in somites, a finding that suggests the involvement of miR-133b in the development of the skeletal muscle. In contrast, at the level of the CNS miR-133b had a weak and moderate expression at 24 and 48 hpf. We also analysed the interaction of miR-133b with the Pitx3 and Pitx3 target genes drd2a and drd2b, tyrosine hydroxylase (th and dopamine transporter (dat by microinjection of the Pitx3-3'UTR sequence. Microinjection of Pitx3-3'UTR affected the expression of pitx3, drd2a, drd2b, th and dat. In conclusion, in the present work we describe a possible mechanism to account for cocaine activity by controlling miR-133b transcription in zebrafish. Via miR-133b cocaine would modulate the expression of pitx3 and subsequently of dopamine receptors, dat and th. These results indicate that miRNAs can play an important role during embryogenesis and in drug addiction.

  12. Imaging and Selective Elimination of Glioblastoma Stem Cells with Theranostic Near-Infrared-Labeled CD133-Specific Antibodies

    Science.gov (United States)

    Jing, Hua; Weidensteiner, Claudia; Reichardt, Wilfried; Gaedicke, Simone; Zhu, Xuekai; Grosu, Anca-Ligia; Kobayashi, Hisataka; Niedermann, Gabriele

    2016-01-01

    Near-infrared photoimmunotherapy (NIR-PIT), which employs monoclonal antibody (mAb)-phototoxic phthalocyanine dye IR700 conjugates, permits the specific, image-guided and spatiotemporally controlled elimination of tumor cells. Here, we report the highly efficient NIR-PIT of human tumor xenografts initiated from patient-derived cancer stem cells (CSCs). Using glioblastoma stem cells (GBM-SCs) expressing the prototypic CSC marker AC133/CD133, we also demonstrate here for the first time that NIR-PIT is highly effective against brain tumors. The intravenously injected theranostic AC133 mAb conjugate enabled the non-invasive detection of orthotopic gliomas by NIR fluorescence imaging, and reached AC133+ GBM-SCs at the invasive tumor front. AC133-targeted NIR-PIT induced the rapid cell death of AC133+ GBM-SCs and thereby strong shrinkage of both subcutaneous and invasively growing brain tumors. A single round of NIR-PIT extended the overall survival of mice with established orthotopic gliomas by more than a factor of two, even though the harmless NIR light was applied through the intact skull. Humanised versions of this theranostic agent may facilitate intraoperative imaging and histopathological evaluation of tumor borders and enable the highly specific and efficient eradication of CSCs.

  13. Sorption of cesium and uranium to Feldspar

    International Nuclear Information System (INIS)

    Within safety assessment studies, for nuclear waste disposal in deep geologic formations, calculation for the migration of radionuclides through the geosphere are often carried out with models taking sorption into account. In the past 8 years the insight grew that other physico-chemical processes, besides sorption, could affect migration behaviour. While the currently used transport models were being improved taking either linear or non-linear sorption into account, the coupling of geochemical and transport models came into scope. In spite of these developments models which are still based on the sorption theory are frequently applied in studying migration behaviour of radionuclides. This is caused by the necessity of making preliminary pronouncements, while coupled models are still in stage of development and thermodynamic data are very limited available. Therefore one has to obtain insight in the reliability of the models based on the sorption theory. within the sorption database there is a lack of knowledge about mineralogy, composition of the fluid and the experimental conditions underlying the data. Therefore the Expert Group on geochemical Modelling supported by the Finnish proposal in order to obtain insight in the possible deviation of the sorption coefficients that can be estimated from experiments performed with standard samples, fluid composition and experimental conditions. Nine laboratories from OECD membership countries took part in this intercalibration study. In the framework of the Dutch safety assessment studies the Dutch National Institute of Public health and Environmental protection (RIVM) has decided to participate in this exercise. In this report the results are presented of sorption experiments for cesium and natural Uranium to Feldspar. (H.W.). 4 refs.; 1 fig.; 7 tabs

  14. Cesium in the Savannah River Site environment

    International Nuclear Information System (INIS)

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of 137Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of 137Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope 137Cs releases have resulted in a negligible risk to the environment and the population it supports

  15. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of {sup 137}Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of {sup 137}Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope {sup 137}Cs releases have resulted in a negligible risk to the environment and the population it supports.

  16. Cesium in the Savannah River Site environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Bauer, L.R.; Evans, A.G.; Geary, L.A.; Murphy, C.E. Jr.; Pinder, J.E.; Strom, R.N.

    1992-03-01

    Cesium in the Savannah River Site Environment is published as a part of the Radiological Assessment Program (RAP). It is the fourth in a series of eight documents on individual radioisotopes released to the environment as a result of Savannah River Site (SRS) operations. The earlier documents describe the environmental consequences of tritium, iodine, and uranium. Documents on plutonium, strontium, carbon, and technetium will be published in the future. These are dynamic documents and current plans call for revising and updating each one on a two-year schedule.Radiocesium exists in the environment as a result of above-ground nuclear weapons tests, the Chernobyl accident, the destruction of satellite Cosmos 954, small releases from reactors and reprocessing plants, and the operation of industrial, medical, and educational facilities. Radiocesium has been produced at SRS during the operation of five production reactors. Several hundred curies of [sup 137]Cs was released into streams in the late 50s and 60s from leaking fuel elements. Smaller quantities were released from the fuel reprocessing operations. About 1400 Ci of [sup 137]Cs was released to seepage basins where it was tightly bound by clay in the soil. A much smaller quantity, about four Ci. was released to the atmosphere. Radiocesium concentration and mechanisms for atmospheric, surface water, and groundwater have been extensively studied by Savannah River Technology Center (SRTC) and ecological mechanisms have been studied by Savannah River Ecology Laboratory (SREL). The overall radiological impact of SRS releases on the offsite maximum individual can be characterized by total doses of 033 mrem (atmospheric) and 60 mrem (liquid), compared with a dose of 12,960 mrem from non-SRS sources during the same period of time. Isotope [sup 137]Cs releases have resulted in a negligible risk to the environment and the population it supports.

  17. Spins and magnetic moments of rubidium and cesium nuclides far from stability

    International Nuclear Information System (INIS)

    Previous studies at ISOLDE have concerned spins and magnetic moments of neutron-deficient rubidium and cesium isotopes. Here, the main results obtained, and, in the case of cesium, new moment measurements are briefly discussed also the results from measurements on neutron-rich nuclides of rubidium and cesium. (orig./AH)

  18. Environmental application of cesium-137 irradiation technology: Sludges and foods

    Science.gov (United States)

    Sivinski, Jacek S.

    Several activities have been undertaken to investigate and implement the use of the military byproduct cesium-137 in ways which benefit mankind. Gamma radiation from cesium-137 has been shown to be effective in reducing pathogens in sewage sludge to levels where reuse of the material in public areas meets current regulatory criteria for protection of public health. Food irradiation at doses of 10 kGy or less have been found by international expert committees to be wholesome and safe for human consumption. Cesium-137 can be used as a means of enhancing particular properties of various food commodities by means of sterilization, insect disinfestation, delayed senescence and ripening, and sprout inhibition. This paper discusses the U.S. Department of Energy Beneficial Uses Program research and engineering history, as well as current activities and future plans, relating to both sewage sludge and food irradiation.

  19. Environmental application of cesium-137 irradiation technology: sludges and foods

    International Nuclear Information System (INIS)

    Several activities have been undertaken to investigate and implement the use of the military byproduct cesium-137 in ways which benefit mankind. Gamma radiation from cesium-137 has been shown to be effective in reducing pathogens in sewage sludge to levels where reuse of the material in public areas meets current regulatory criteria for protection of public health. Food irradiation at doses of 10 kGy or less have been found by international expert committees to be wholesome and safe for human consumption. Cesium-137 can be used as a means of enhancing particular properties of various food commodities by means of sterilization, insect disinfestation, delayed senescence and ripening, and sprout inhibition. This paper discusses the U.S. Department of Energy Beneficial Uses Program research and engineering history, as well as current activities and future plans, relating to both sewage sludge and food irradiation. (author)

  20. Dating of mine waste in lacustrine sediments using cesium-137

    Science.gov (United States)

    Rember, W. C.; Erdman, T. W.; Hoffmann, M. L.; Chamberlain, V. E.; Sprenke, K. F.

    1993-11-01

    For over a century Medicine Lake in northern Idaho has received heavy-metal-laden tailings from the Coeur d'Alene mining district. Establishing the depositional chronology of the lake bottom sediments provides information on the source and rate of deposition of the tailings. Cesium-137, an isotope produced in the atmosphere by nuclear bomb tests, was virtually absent in the environment prior to 1951, but reached its apex in 1964. Our analysis of cesium-137 in the sediments of Medicine Lake revealed that 14 cm of fine-grained tailings were deposited in the lake from 1951 to 1964 and tailing deposition downstream was greatly reduced by the installation of tailings dams in the district in 1968. Cesium-137 analysis is accomplished by a fairly simple gamma-ray counting technique and should be a valuable tool for analyzing sedimentation in any lacustrine environment that was active during the 1950s and 1960s.

  1. Cesium 137 in oils and plants from Guatemala

    International Nuclear Information System (INIS)

    Since 1990 the project of radioactive and environmental contamination started in Guatemala. Studies about the radioactive contamination levels are made within the framework of this project. Cesium-137 has been an interest radionuclide, because it is a fission product released to the environment by the use of nuclear weapons and nuclear power plants accidents. The sampling consisted in collection of soil and grass in 20 provinces of Guatemala, one point by province, and it was made in 1990. The cesium-137 concentration in the samples, was determined by gamma spectrometry, using an hyper pure germanium detector. The results show the presence of radioactive contamination in soil and grass due to cesium-137, at levels that might be considered as normal. The levels found are not harmful for human health, and its importance is the fact that can be used as reference levels for the environmental radioactivity monitoring in Guatemala

  2. Study of radiatively sustained cesium plasmas for solar energy conversion

    Science.gov (United States)

    Palmer, A. J.; Dunning, G. J.

    1980-01-01

    The results of a study aimed at developing a high temperature solar electric converter are reported. The converter concept is based on the use of an alkali plasma to serve as both an efficient high temperature collector of solar radiation as well as the working fluid for a high temperature working cycle. The working cycle is a simple magnetohydrodynamic (MHD) Rankine cycle employing a solid electrode Faraday MHD channel. Research milestones include the construction of a theoretical model for coupling sunlight in a cesium plasma and the experimental demonstration of cesium plasma heating with a solar simulator in excellent agreement with the theory. Analysis of a solar MHD working cycle in which excimer laser power rather than electric power is extracted is also presented. The analysis predicts a positive gain coefficient on the cesium-xenon excimer laser transition.

  3. On the compartmental modeling of cesium migration in soils

    International Nuclear Information System (INIS)

    The prediction of the migration of radionuclides in soil following deposition after a nuclear accident is important for both external dose and plant uptake prediction. In this paper, the validity conditions of compartment models for cesium migration in soils are investigated. A compartment model is derived from a diffusion-convection model. The model considers free and bound cesium compartments and is applied to measured profiles of 137Cs of undisturbed soil in Northern Greece. It is concluded that the rate of cesium transfer must vary linearly with depth and that from measured equilibrium profiles, the ratios of model parameters can be determined but not the parameters themselves. This model is applied to measured profiles of 137Cs in soil due to wet deposition following the Chernobyl accident

  4. Thallous and cesium halide materials for use in cryogenic applications

    International Nuclear Information System (INIS)

    Certain thallous and cesium halides, either used alone or in combination with other ceramic materials, are provided in cryogenic applications such as heat exchange material for the regenerator section of a closed-cycle cryogenic refrigeration section, as stabilizing coatings for superconducting wires, and as dielectric insulating materials. The thallous and cesium halides possess unusually large specific heats at low temperatures, have large thermal conductivities, are nonmagnetic, and are nonconductors of electricity. They can be formed into a variety of shapes such as spheres, bars, rods, or the like and can be coated or extruded onto substrates or wires. (author)

  5. Selective chemical binding enhances cesium tolerance in plants through inhibition of cesium uptake

    Science.gov (United States)

    Adams, Eri; Chaban, Vitaly; Khandelia, Himanshu; Shin, Ryoung

    2015-03-01

    High concentrations of cesium (Cs+) inhibit plant growth but the detailed mechanisms of Cs+ uptake, transport and response in plants are not well known. In order to identify small molecules with a capacity to enhance plant tolerance to Cs+, chemical library screening was performed using Arabidopsis. Of 10,000 chemicals tested, five compounds were confirmed as Cs+ tolerance enhancers. Further investigation and quantum mechanical modelling revealed that one of these compounds reduced Cs+ concentrations in plants and that the imidazole moiety of this compound bound specifically to Cs+. Analysis of the analogous compounds indicated that the structure of the identified compound is important for the effect to be conferred. Taken together, Cs+ tolerance enhancer isolated here renders plants tolerant to Cs+ by inhibiting Cs+ entry into roots via specific binding to the ion thus, for instance, providing a basis for phytostabilisation of radiocesium-contaminated farmland.

  6. Selective chemical binding enhances cesium tolerance in plants through inhibition of cesium uptake

    DEFF Research Database (Denmark)

    Adams, Eri; Chaban, Vitaly; Khandelia, Himanshu; Shin, Ryoung

    2015-01-01

    High concentrations of cesium (Cs(+)) inhibit plant growth but the detailed mechanisms of Cs(+) uptake, transport and response in plants are not well known. In order to identify small molecules with a capacity to enhance plant tolerance to Cs(+), chemical library screening was performed using...... Arabidopsis. Of 10,000 chemicals tested, five compounds were confirmed as Cs(+) tolerance enhancers. Further investigation and quantum mechanical modelling revealed that one of these compounds reduced Cs(+) concentrations in plants and that the imidazole moiety of this compound bound specifically to Cs......(+). Analysis of the analogous compounds indicated that the structure of the identified compound is important for the effect to be conferred. Taken together, Cs(+) tolerance enhancer isolated here renders plants tolerant to Cs(+) by inhibiting Cs(+) entry into roots via specific binding to the ion thus, for...

  7. Adiponectin Upregulates MiR-133a in Cardiac Hypertrophy through AMPK Activation and Reduced ERK1/2 Phosphorylation.

    Directory of Open Access Journals (Sweden)

    Ying Li

    Full Text Available Adiponectin and miR-133a are key regulators in cardiac hypertrophy. However, whether APN has a potential effect on miR-133a remains unclear. In this study, we aimed to investigate whether APN could regulate miR-133a expression in Angiotensin II (Ang II induced cardiac hypertrophy in vivo and in vitro. Lentiviral-mediated adiponectin treatment attenuated cardiac hypertrophy induced by Ang II infusion in male wistar rats as determined by reduced cell surface area and mRNA levels of atrial natriuretic peptide (ANF and brain natriuretic peptide (BNP, also the reduced left ventricular end-diastolic posterior wall thickness (LVPWd and end-diastolic interventricular septal thickness (IVSd. Meanwhile, APN elevated miR-133a level which was downregulated by Ang II. To further investigate the underlying molecular mechanisms, we treated neonatal rat ventricular myocytes (NRVMs with recombinant rat APN before Ang II stimulation. Pretreating cells with recombinant APN promoted AMP-activated protein kinase (AMPK phosphorylation and inhibited ERK activation. By using the inhibitor of AMPK or a lentiviral vector expressing AMPK short hairpin RNA (shRNA cancelled the positive effect of APN on miR-133a. The ERK inhibitor PD98059 reversed the downregulation of miR-133a induced by Ang II. These results indicated that the AMPK activation and ERK inhibition were responsible for the positive effect of APN on miR-133a. Furthermore, adiponectin receptor 1 (AdipoR1 mRNA expression was inhibited by Ang II stimulation. The positive effects of APN on AMPK activation and miR-133a, and the inhibitory effect on ERK phosphorylation were inhibited in NRVMs transfected with lentiviral AdipoR1shRNA. In addition, APN depressed the elevated expression of connective tissue growth factor (CTGF, a direct target of miR-133a, through the AMPK pathway. Taken together, our data indicated that APN reversed miR-133a levels through AMPK activation, reduced ERK1/2 phosphorylation in

  8. Cesium accumulation by aquatic organisms at different trophic levels following an experimental release into a small reservoir

    International Nuclear Information System (INIS)

    The rates of accumulation and subsequent loss of stable cesium (133Cs) by organisms at different trophic levels within plankton-based and periphyton-based food chains were measured following the addition of 133Cs into a small reservoir near Aiken, South Carolina, USA. An uptake parameter u (L kg-1 d-1 dry mass) and a loss rate parameter k (d-1) were estimated for each organism using time-series measurements of 133Cs concentrations in water and biota, and these parameters were used to estimate maximum concentrations, times to maximum concentrations, and concentration ratios (Cr). The maximum 133Cs concentrations for plankton, periphyton, the insect larva Chaoborus punctipennis, which feeds on plankton, and the snail Helisoma trivolvis, which feeds on periphyton, occurred within the first 14 days following the addition, whereas the maximum concentrations for the fish species Lepomis macrochirus and Micropterus salmoides occurred after 170 days. The Cr based on dry mass for plankton and C. punctipennis were 1220 L kg-1 and 5570 L kg-1, respectively, and were less than the Cr of 8630 L kg-1 for periphyton and 47,700 L kg-1 for H. trivolvis. Although the Cr differed between plankton-based and periphyton-based food chains, they displayed similar levels of biomagnification. Biomagnification was also indicated for fish where the Cr for the mostly nonpiscivorous L. macrochirus of 22,600 L kg-1 was three times less than that for mostly piscivorous M. salmoides of 71,500 L kg-1. Although the Cr for M. salmoides was greater than those for periphyton and H. trivolvis, the maximum 133Cs concentrations for periphyton and H. trivolvis were greater than that for M. salmoides. - Research highlights: → A simple uptake and loss model described the Cs dynamics in all the various biota. → Concentrations of Cs were greater in periphyton than in plankton. → Biota other than fish demonstrated the greatest maximum Cs concentrations. → Concentration ratios were generally consisted

  9. Production of negative D- ions by double charge exchange using cesium

    International Nuclear Information System (INIS)

    The first experimental results on the source of D- negative ions developed at SIG confirm a certain number of essential points: (1) the use of a positive ion source obtained by a resonance electronic cyclotron permits the production of D+ ion beams with a very small gas output, therefore it has a very good gas efficiency; (2) the supersonic cesium target obtained after the release of a high temperature cesium vapor functions perfectly with the desired characteristics; (3) the conversion efficiency measured in D- ions is close to those which were deduced from experimental cross sections; and (4) the mean density of D- ion currents is on the order of 10 mA/cm2 at 1 keV. They could be 15 at 25 mA/cm2 at 300 eV. This presupposes that we modify the extraction optic for the D+ ions to extract 60 at 70 mA/cm2 of D+ at 300 eV with a maximum electric field of 30 DV/cm and a greater perveance of the optic

  10. 21 CFR 133.179 - Pasteurized process cheese spread.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese spread. 133.179 Section... Standardized Cheese and Related Products § 133.179 Pasteurized process cheese spread. (a)(1) Pasteurized process cheese spread is the food prepared by comminuting and mixing, with the aid of heat, one or more...

  11. 21 CFR 133.173 - Pasteurized process cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese food. 133.173 Section 133.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for...

  12. 21 CFR 133.147 - Grated American cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133.147 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  13. 21 CFR 133.145 - Granular cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular cheese for manufacturing. 133.145 Section... Standardized Cheese and Related Products § 133.145 Granular cheese for manufacturing. Granular cheese for manufacturing conforms to the definition and standard of identity prescribed for granular cheese by §...

  14. 21 CFR 133.119 - Colby cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Colby cheese for manufacturing. 133.119 Section... Standardized Cheese and Related Products § 133.119 Colby cheese for manufacturing. Colby cheese for manufacturing conforms to the definition and standard of identity prescribed for colby cheese by §...

  15. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by §...

  16. 21 CFR 133.114 - Cheddar cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cheddar cheese for manufacturing. 133.114 Section... Standardized Cheese and Related Products § 133.114 Cheddar cheese for manufacturing. Cheddar cheese for manufacturing conforms to the definition and standard of identity prescribed for cheddar cheese by §...

  17. 21 CFR 133.137 - Washed curd cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd cheese for manufacturing. 133.137... Standardized Cheese and Related Products § 133.137 Washed curd cheese for manufacturing. Washed curd cheese for manufacturing conforms to the definition and standard of identity prescribed for washed curd cheese by §...

  18. 21 CFR 133.189 - Skim milk cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Skim milk cheese for manufacturing. 133.189... Standardized Cheese and Related Products § 133.189 Skim milk cheese for manufacturing. (a) Skim milk cheese for manufacturing is the food prepared from skim milk and other ingredients specified in this section, by...

  19. 21 CFR 133.109 - Brick cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Brick cheese for manufacturing. 133.109 Section... Standardized Cheese and Related Products § 133.109 Brick cheese for manufacturing. Brick cheese for manufacturing conforms to the definition and standard of identity for brick cheese prescribed by §...

  20. 50 CFR 20.133 - Hunting regulations for crows.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Hunting regulations for crows. 20.133... WILDLIFE AND PLANTS (CONTINUED) MIGRATORY BIRD HUNTING Administrative and Miscellaneous Provisions § 20.133 Hunting regulations for crows. (a) Crows may be taken, possessed, transported, exported, or imported,...

  1. 21 CFR 133.171 - Pasteurized process pimento cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process pimento cheese. 133.171... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.171 Pasteurized process pimento cheese. Pasteurized...

  2. Radiological protection and calibration of an activity meter with cesium and barium sources in a nuclear medicine center; Proteccion radiologica y calibracion de un activimetro con fuentes de cesio y bario en un centro de medicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Morales L, M.E. [IPEN INEN Centro de Medicina Nuclear, Av. Aviacion 3799, Lima 34 (Peru)

    2005-07-01

    Presently work is shown the results when gauging a team Deluxe Isotope (Caliper 11) with some sources of Cesium 137 and Barium 133, in a Center of Medicine Nuclear that operates from the anus 1983 in a modern building inside the one Institute of Illnesses Neoplasia (Inn). This Center was equipped initially with teams donated by the International Organism of Atomic Energy (Oa) with those that it develops assistance, educational works and of investigation, giving services to patient of the Inn and other public and private medical centers. (Author)

  3. A method for reducing the cesium-137 content in meat

    International Nuclear Information System (INIS)

    Reports a study of a method for reducing the amount of cesium-137 in meat from wild animals. The method is intended for use in the kitchen and is based on a combined leaching and mechanical process. (K.A.E.)

  4. Cesium-137 Levels Detected in Otters from Austria

    Directory of Open Access Journals (Sweden)

    Gutleb A.C.

    1991-02-01

    Full Text Available Pollution seems to be one of the most important causes for the decline of the European otter (Lutra lutra. The accident in the Chernobyl nuclear power plant added another aspect to environmental pollution. Few data on cesium-137 contents in otters are available, so levels were measured in 3 otters from Austria. All levels found were very low.

  5. Fission-product tellurium and cesium telluride chemistry revisited

    International Nuclear Information System (INIS)

    The chemistry of fission-product tellurium is discussed with a focus on conditions in an operating CANDU reactor and in an accident scenario, i.e., a loss of coolant accident (LOCA). Cesium telluride, Cs2Te, is likely to be one of the most abundant tellurium species released to containment. Available thermodynamic data on gas phase Cs2Te is not complete; hence the volatility of cesium telluride was studied by Knudsen-cell mass spectrometry. Cesium telluride was found to vapourize incongruently, becoming more tellurium-rich in the condensed phase as vapourization progressed. Vapour-phase species that were observed were elemental cesium and tellurium, CsTe, Cs2Te, Cs2Te2 and Cs2Te3. Second-law enthalpies and entropies were obtained for many of these species, and a third-law value, ΔH298o, of 186 ± 2 kJ·mol-1 was obtained for Cs2Te. (author)

  6. Discovery of Cesium, Lanthanum, Praseodymium and Promethium Isotopes

    OpenAIRE

    May, E.; Thoennessen, M

    2011-01-01

    Currently, forty-one cesium, thirty-five lanthanum, thirty-two praseodymium, and thirty-one promethium, isotopes have been observed and the discovery of these isotopes is discussed here. For each isotope a brief synopsis of the first refereed publication, including the production and identification method, is presented.

  7. Strontium-90 and cesium-137 in fresh water

    International Nuclear Information System (INIS)

    Japan Chemical Analysis Center has analysed the strontium-90 and Cesium-137 contents in fresh water from 7 prefectures in Japan by the commission of Science and Technology Agency of Japanese Government. The method described in ''Radioactivity Survey Data in Japan No. 43 (NIRS-RSD-43, 1977) was applied to the analysis of these two radionuclides in samples. (author)

  8. Cesium ion desorption ionization with Fourier transform mass spectrometry

    International Nuclear Information System (INIS)

    Cesium ions (Cs+) are used for the production of the feed ions necessary to obtain Fourier transform mass spectra (FTMS). The molecule chosen for the initial study of this Cs+ desorption ionization (DI-FTMS) was vitamin B-12 because of its nonvolatile, thermally labile character. 21 references

  9. Membrane-based separation technologies for cesium, strontium, and technetium

    Energy Technology Data Exchange (ETDEWEB)

    Kafka, T.

    1996-10-01

    This work is one of two parallel projects that are part of an ESP task to develop high-capacity, selective, solid extractants for cesium, strontium, and technetium from nuclear wastes. In this subtask, Pacific Northwest National Laboratory (PNNL) is collaborating with 3M, St. Paul, Minnesota, working in cooperation with IBC Advanced Technologies, American Fork, Utah.

  10. Hot demonstration of proposed commercial cesium removal technology

    International Nuclear Information System (INIS)

    This report describes the work done in support of the development of technology for the continuous removal and concentration of radioactive cesium in supernatant from Melton Valley Storage Tanks (MVSTs) at the ORNL site. The primary objective was to test candidate absorbers and ion exchangers under continuous-flow conditions using actual supernatant from the MVSTs. An experimental system contained in a hot-cell facility was constructed to test the materials in columns or modules using the same batch of supernatant to allow comparison on an equal basis. Resorcinol/formaldehyde (RF) resin was evaluated at three flow rates with 50% breakthrough ranges of 35 to 50 column volumes (CV) and also through a series of five loading/elution/regeneration cycles. The results reported here include the cesium loading breakthrough curves, elution curves (when applicable), and operational problems and observations for each material. The comparative evaluations should provide critical data for the selection of the sorbent for the ORNL Cesium Removal Demonstration project. These results will be used to help determine the design parameters for demonstration-scale systems. Such parameters include rates of cesium removal, quantity of resin or sorbent to be used, and elution and regeneration requirements, if applicable

  11. Cesium-137 Levels Detected in Otters from Austria

    OpenAIRE

    Gutleb A.C.; Mraz, G.

    1991-01-01

    Pollution seems to be one of the most important causes for the decline of the European otter (Lutra lutra). The accident in the Chernobyl nuclear power plant added another aspect to environmental pollution. Few data on cesium-137 contents in otters are available, so levels were measured in 3 otters from Austria. All levels found were very low.

  12. Influence of water management and fertilizer application on (137)Cs and (133)Cs uptake in paddy rice fields.

    Science.gov (United States)

    Wakabayashi, Shokichi; Itoh, Sumio; Kihou, Nobuharu; Matsunami, Hisaya; Hachinohe, Mayumi; Hamamatsu, Shioka; Takahashi, Shigeru

    2016-06-01

    Cesium-137 derived from the Tokyo Electric Power Company's Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident contaminated large areas of agricultural land in Eastern Japan. Previous studies before the accident have indicated that flooding enhances radiocesium uptake in rice fields. We investigated the influence of water management in combination with fertilizers on (137)Cs concentrations in rice plants at two fields in southern Ibaraki Prefecture. Stable Cs ((133)Cs) in the plants was also determined as an analogue for predicting (137)Cs behavior after long-term aging of soil (137)Cs. The experimental periods comprised 3 y starting from 2012 in one field, and 2 y from 2013 in another field. These fields were divided into three water management sections: a long-flooding section without midsummer drainage, and medial-flooding, and short-flooding sections with one- or two-week midsummer drainage and earlier end of flooding than the long-flooding section. Six or four types of fertilizer subsections (most differing only in potassium application) were nested in each water management section. Generally, the long-flooding treatment led to higher (137)Cs and (133)Cs concentrations in both straw and brown rice than medial- and short-flooding treatments, although there were some notable exceptions in the first experimental year at each site. Effects of differing potassium fertilizer treatments were cumulative; the effects on (137)Cs and (133)Cs concentrations in rice plants were not obvious in 2012 and 2013, but in 2014, these concentrations were highest where potassium fertilizer had been absent and lowest where basal dressings of K had been tripled. The relationship between (137)Cs and (133)Cs in rice plants was not correlative in the first experimental year at each site, but correlation became evident in the subsequent year(s). This study demonstrates a novel finding that omitting midsummer drainage and/or delaying drainage during the grain-filling period enhances

  13. Selective extraction of cesium: from compound to process

    International Nuclear Information System (INIS)

    Under the French law of 30 December 1991 on nuclear waste management, research is conducted to recover long-lived fission products from high-level radioactive effluents generated by spent fuel reprocessing, in order to destroy them by transmutation or encapsulate them in specific matrices. Cesium extraction with mono and bis-crown calix(4)arenes (Frame 1) is a candidate for process development. These extractants remove cesium from highly acidic or basic pH media even with high salinity. A real raffinate was treated in 1994 in a hot cell to extract cesium with a calix-crown extractant. The success of this one batch experiment confirmed the feasibility of cesium decontamination from high-level liquid waste. It was then decided to develop a process flowchart to extract cesium selectively from high-level raffinate, to be included in the general scheme of long-lived radionuclide partitioning. It was accordingly decided to develop a process based on liquid-liquid extraction and hence optimize a calixarene/diluent solvent according to: - hydraulic properties: density, viscosity, interfacial tension, - chemical criteria: sufficient cesium extraction (depending on the diluent), kinetics, third phase elimination... New mono-crown-calixarenes branched with long aliphatic groups (Frame 2) were designed to be soluble in aliphatic diluents. To prevent third phase formation associated with nitric acid extraction, the addition of modifiers (alcohol, phosphate and amide) in the organic phase was tested (Frame 3). Table 1 shows examples of calixarene/diluent systems suitable for a process flowchart, and Figure 2 provides data on cesium extraction with these new systems. Alongside these improvements, a system based on a modified 1,3-di(n-octyl-oxy)2,4-calix[4]arene crown and a modified diluent was also developed, considering a mixed TPH/NPHE system as the diluent, where TPH (hydrogenated tetra propylene) is a common aliphatic industrial solvent and NPHE is nitrophenyl

  14. Dynamic immobilization of simulated radionuclide 133Cs in soil by thermal treatment/vitrification with nanometallic Ca/CaO composites

    International Nuclear Information System (INIS)

    Although direct radiation induced health impacts were considered benign, soil contamination with 137Cs, due to its long-term radiological impact (30 years half-life) and its high biological availability is of a major concern in Japan in the aftermath of the Fukushima nuclear power plant disaster. Therefore 137Cs reduction and immobilization in contaminated soil are recognized as important problems to be solved using suitable and effective technologies. One such thermal treatment/vitrification with nanometallic Ca/CaO amendments is a promising treatment for the ultimate immobilization of simulated radionuclide 133Cs in soil, showing low leachability and zero evaporation. Immobilization efficiencies were 88%, 95% and 96% when the 133Cs soil was treated at 1200 °C with activated carbon, fly ash and nanometallic Ca/CaO additives. In addition, the combination of nanometallic Ca/CaO and fly ash (1:1) enhanced the immobilization efficiency to 99%, while no evaporation of 133Cs was observed. At lower temperatures (800 °C) the leachable fraction of Cs was only 6% (94% immobilization). Through the SEM–EDS analysis, decrease in the amount of Cs mass percent detectable on soil particle surface was observed after soil vitrified with nCa/CaO + FA. The 133Cs soil was subjected to vitrified with nCa/CaO + FA peaks related to Ca, crystalline phases (CaCO3/Ca(OH)2), wollastonite, pollucite and hematite appeared in addition to quartz, kaolinite and bentonite, which probably indicates that the main fraction of enclosed/bound materials includes Ca-associated complexes. Thus, the thermal treatment with the addition of nanometallic Ca/CaO and fly ash may be considered potentially applicable for the remediation of radioactive Cs contaminated soil at zero evaporation, relatively at low temperature. - Graphical abstract: SEM–EDS element maps of 133Cs contaminated soil before and after thermal treatment at 1200 °C with different addictives. Color intensity for Cs is from 0 to 100 (low

  15. Promoter hypomethylation regulates CD133 expression in human gliomas

    Institute of Scientific and Technical Information of China (English)

    Kouichi Tabu; Ken Sasai; Taichi Kimura; Lei Wang; Eiko Aoyanagi; Shinji Kohsaka; Mishie Tanino; Hiroshi Nishihara; Shinya Tanaka

    2008-01-01

    Brain tumor-initiating cells (BTICs) have been enriched using antibodies against the cell surface protein CD133;however,the biological relevance and the regulatory mechanism of CD133 expression in human gliomas are not yet understood.In this study,we initially demonstrated that CD133 was overexpressed in high-grade human glioblastomas where CD133-positive cells were focally observed as a micro-cluster.In addition,CD133 transcripts with exon 1A,1B,or 1C were predominantly expressed in glioblastomas.To elucidate the mechanism regulating this aberrant expression of CD133,three proximal promoters (P1,P2,and P3) containing a CpG island were isolated.In U251MG and T98Gglioblastoma cells,the P1 region flanking exon 1A exhibited the highest activity among the three promoters,and this activity was significantly inactivated by in vitro methylation.After treatment with the demethylating agent 5-azacytidine and/or the histone deacetylase inhibitor valproic acid,the expression level of CD133 mRNA was significantly restored in glioma cells.Importantly,hypomethylation of CpG sites within the P1,P2,and P3 regions was observed by bisulfite sequencing in human glioblastoma tissues with abundant CD133 mRNA.Taken together,our results indicate that DNA hypomethylation is an important determinant of CD133 expression in glioblastomas,and this epigenetic event may be associated with the development of BTICs expressing CD133.

  16. Deletion 22q13.3 syndrome

    Directory of Open Access Journals (Sweden)

    Phelan Mary C

    2008-05-01

    Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements

  17. Demonstration test for decontamination technology of cesium-contaminated ash

    International Nuclear Information System (INIS)

    KEPCO Engineering and Construction Company (KEPCO E and C), architecture and engineering company of nuclear power plant, developed the 'decontamination technology of cesium-contaminated ash' in the basis of pre-owned 'decontamination technology of cesium-contaminated soil'. The new technology was demonstrated in Fukushima prefecture during 12 days from November 5, 2013, in order to verify the performance. Demonstration equipment (CEDECON-DA), with a capacity of treatment of 20 ℓ per batch, can be carried in a container in order to promote the ease of transportation and in-situ installation. Through the demonstration test it was verified the superior performance and the possibility of commercialization. This technique comprises of cesium separation and cesium coagulation processes. Briefly speaking, the principal of this process is as follows; cesium is separated from ash, detached to the coagulation and then deposited. The decontaminated ash can be disposed of into municipal landfills as conventional non-radioactive waste. The present technology is evaluated such that the disposal amount of radioactive waste will be significantly reduced. The ash with average concentration of 6,200 Bq/kg from a conventional incineration plant was used for the demonstration test. Each separate performance test has been carried out under acid, neutral and alkaline conditions, respectively. The test result for alkaline condition showed the highest decontamination ratio of 82-85% and the volume reduction ratio of 95%. Radioactive Waste Management and Nuclear Facility Decommissioning Technology Center (RANDEC) performed the radiation protection management, activity measurement and evaluation in the demonstration test results. (author)

  18. Some aspects of cesium deposition in Transilvania (Romania)

    International Nuclear Information System (INIS)

    Following the accident of the Chernobyl atomic electric power station, a great quantity of radionuclides (∼100MCi) escaped from the reactor. It was estimated that 13% of the inventory activity of cesium representing 1.5-2 MCi left the reactor. The radioactive deposits were very nonuniform for the same distance and in the same direction from Chernobyl nuclear center having a close dependence upon direction and speed of wind and pluviometric conditions. The rains, especially the storms, spectacularly increased the radioactive fallout. Although, for the first two-three days, subsequent to accident, the meteorological conditions were favorable for Romania, after April 29/30, because of the changing in the wind direction on SW (initial it was N and NW) the countries were on this direction - Romania, Bulgaria, Greece, former Yugoslavia - began to be intensely contaminated with radioactive fallout. In Romania, the radioactive cloud passing coincided with abundant rains, especially on the direction mentioned above. On this direction, the cesium deposits are of 8-2 times larger than other Romanian regions. The torrential rain which fell on May 1st 1986, in the western side of Cluj Napoca town caused an intense contamination especially with short-life isotopes as Te, I, Ba, La, Mo. Medium and long-life isotopes as Ru, Zr, Cs, Sr were present in large quantities in this area.too. For the total contribution the value obtained was 1130 kBq/m2, much larger than the average in Romania. This work presents data about cesium content of pollen samples gathered daily between 1-30 May 1986; cesium deposits in five areas and some measurements in connection with cesium mitigation in soils

  19. Internal radiotherapy with copper-64-diacetyl-bis (N4-methylthiosemicarbazone) reduces CD133+ highly tumorigenic cells and metastatic ability of mouse colon carcinoma

    International Nuclear Information System (INIS)

    Introduction: 64Cu-diacetyl-bis (N4-methylthiosemicarbazone) (64Cu-ATSM) is an imaging agent for positron emission tomography (PET) that targets hypoxic tumors. 64Cu-ATSM is also reported to be a potential agent for internal radiotherapy. In a mouse colon carcinoma (Colon-26) model, we have shown that 64Cu-ATSM preferentially localizes in intratumoral regions with a high density of CD133+ cells, which show characteristics of cancer stem cells or cancer stem cell-like cells (collectively referred here as CSCs). In this study, we evaluated the therapeutic effect of 64Cu-ATSM in relation to CD133 expression using this model. Methods: Systemic administration of 37 MBq 64Cu-ATSM or saline was conducted twice within a 1-week interval to mice bearing 1-week-old Colon-26 tumors (days 0-7). At day 19, tumor size measurement, flow cytometry analysis and experimental lung metastatic assay were performed. The therapeutic effect of 64Cu-ATSM on sorted CD133+ and CD133- Colon-26 cells was also examined in vitro. Results: In vivo studies showed that 64Cu-ATSM treatment inhibited tumor growth. The percentage of CD133+ cells and metastatic ability in 64Cu-ATSM treated tumors was decreased compared with that in control animals. In vitro studies demonstrated that 64Cu-ATSM accumulated in cells under hypoxic conditions and incorporation of 64Cu-ATSM under hypoxia caused cell death in both CD133+ and CD133- cells in a similar extent. Conclusions: 64Cu-ATSM administration reduced tumor volume as well as the percentage of CD133+ cells and the metastatic ability of Colon-26 tumors. Together with our data, it is suggested that 64Cu-ATSM accumulates in regions high in CD133+ highly tumorigenic cells and kills such regions by radiation, resulting in a decrease of the percentage of CD133+ cells.

  20. Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis.

    Directory of Open Access Journals (Sweden)

    Mian-Bo Huang

    Full Text Available BACKGROUND: The insulin-like growth factor (IGF signaling pathway has long been established as playing critical roles in skeletal muscle development. However, the underlying regulatory mechanism is poorly understood. Recently, a large family of small RNAs, named microRNAs (miRNAs, has been identified as key regulators for many developmental processes. Because miRNAs participate in the regulation of various signaling pathways, we hypothesized that miRNAs may be involved in the regulation of IGF signaling in skeletal myogenesis. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we determined that the cell-surface receptor IGF-1R is directly regulated by a muscle-specific miRNA, microRNA-133 (miR-133. A conserved and functional binding site for miR-133 was identified in the 3'untranslated region (3'UTR of IGF-1R. During differentiation of C2C12 myoblasts, IGF-1R protein, but not messenger RNA (mRNA expression, was gradually reduced, concurrent with the upregulation of miR-133. Overexpression of miR-133 in C2C12 cells significantly suppressed IGF-1R expression at the posttranscriptional level. We also demonstrated that both overexpression of miR-133 and knockdown of IGF-1R downregulated the phosphorylation of Akt, the central mediator of the PI3K/Akt signaling pathway. Furthermore, upregulation of miR-133 during C2C12 differentiation was significantly accelerated by the addition of IGF-1. Mechanistically, we found that the expression of myogenin, a myogenic transcription factor reported to transactivate miR-133, was increased by IGF-1 stimulation. CONCLUSION/SIGNIFICANCE: Our results elucidate a negative feedback circuit in which IGF-1-stimulated miR-133 in turn represses IGF-1R expression to modulate the IGF-1R signaling pathway during skeletal myogenesis. These findings also suggest that miR-133 may be a potential therapeutic target in muscle diseases.

  1. Tumour-initiating cells vs. cancer 'stem' cells and CD133: What's in the name?

    International Nuclear Information System (INIS)

    Recent evidence suggests that a subset of cells within a tumour have 'stem-like' characteristics. These tumour-initiating cells, distinct from non-malignant stem cells, show low proliferative rates, high self-renewing capacity, propensity to differentiate into actively proliferating tumour cells, resistance to chemotherapy or radiation, and they are often characterised by elevated expression of the stem cell surface marker CD133. Understanding the molecular biology of the CD133+ cancer cells is now essential for developing more effective cancer treatments. These may include drugs targeting organelles, such as mitochondria or lysosomes, using highly efficient and selective inducers of apoptosis. Alternatively, agents or treatment regimens that enhance sensitivity of these therapy-resistant 'tumour stem cells' to the current or emerging anti-tumour drugs would be of interest as well

  2. Measurement of parity violation in the 6S-7S transition of cesium using stimulated emission; Mesure de la violation de la parite sur la transition 6S-7S du cesium par emission stimulee dans une vapeur atomique

    Energy Technology Data Exchange (ETDEWEB)

    Lintz, M

    2005-11-15

    This document describes the design and implementation of a pump-probe polarimetry experiment in a cesium vapor, aiming at a 1% precision measurement of atomic parity violation (APV) induced by Z{sup 0} boson exchange. The experimental scheme, relying on induced emission by a probe laser, allows a detection efficiency close to unity, and the left-right asymmetry to be measured is amplified during the propagation of the probe beam in the excited vapour. The interest of the result presented here is to cross-check the unique previous result by an experiment with a completely different design, and hence with completely different systematics, that also allows measurements on long-lived isotopes especially {sup 135}Cs (nuclear spin 7/2 like {sup 133}Cs, half-life 3 million years). We have demonstrated improvements in polarimetry techniques (rejection of instrumental errors, implementation of a polarization magnifier), especially in pulsed polarimetry (doubly-differential, balanced-mode polarization analysis). But most importantly, the expected pump-probe chiral optical gain has been observed in a Cs vapor. The precision on the {theta}{sup pv} measurement has been improved to 2.6%, and the achieved signal/noise ratio allows measurements at the 1% precision level. The achieved precision on lm E{sub 1}{sup pv} is 2 x 10{sup -13} ea{sub 0}, 15 times better than the measurements obtained with the lead and thallium atoms. Our result is in agreement with the more precise Boulder result. The required amount of cesium is small enough to allow a measurement with {sup 135}Cs provided one takes reasonable radioprotection measures. (author)

  3. Exposure mode study to xenon-133 in a reactor building

    International Nuclear Information System (INIS)

    The work described in this thesis focuses on the external and internal dose assessment to xenon-133. During the nuclear reactor operation, fission products and radioactive inert gases, as 133Xe, are generated and might be responsible for the exposure of workers in case of clad defect. Particle Monte Carlo transport code is adapted in radioprotection to quantify dosimetric quantities. The study of exposure to xenon-133 is conducted by using Monte-Carlo simulations based on GEANT4, an anthropomorphic phantom, a realistic geometry of the reactor building, and compartmental models. The external exposure inside a reactor building is conducted with a realistic and conservative exposure scenario. The effective dose rate and the eye lens equivalent dose rate are determined by Monte-Carlo simulations. Due to the particular emission spectrum of xenon-133, the equivalent dose rate to the lens of eyes is discussed in the light of expected new eye dose limits. The internal exposure occurs while xenon-133 is inhaled. The lungs are firstly exposed by inhalation, and their equivalent dose rate is obtained by Monte-Carlo simulations. A biokinetic model is used to evaluate the internal exposure to xenon-133. This thesis gives us a better understanding to the dosimetric quantities related to external and internal exposure to xenon-133. Moreover the impacts of the dosimetric changes are studied on the current and future dosimetric limits. The dosimetric quantities are lower than the current and future dosimetric limits. (author)

  4. Distribution and retention of cesium and strontium in Swedish boreal forest ecosystems

    International Nuclear Information System (INIS)

    The retention and distribution of cesium, and to some extent strontium, in forest environments are being studied at three sites in Sweden. The main part of the cesium found in the soil was recovered in horizons rich in organic matter. The cesium was retained in the soil organic matter in a more or less extractable form. As different soil types have a different distribution pattern of organic matter, the distribution of cesium will depend on the forest soil type. The clay content in Swedish forest soils is, in general, low which will mitigate the retention of cesium in the soil mineral horizons. The cesium and strontium present in the trees was considered to be an effect of assimilation by the tissues in the canopy as well as by the roots. The redistribution of cesium within the trees was extensive which was considered to be the effect of a high mobility of cesium in the trees. The recovery of strontium-90 in pines, in relation to the deposition rate was higher compared to the relative recovery of cesium-137, 30 years after deposition. The cesium and strontium will remain in the forest environment for a considerable time but can be reduced by forest practice, by leaching out of the soil profile or by radioactive decay

  5. Estimation of Physical Properties of AN-107 Cesium and Technetium Eluate Blend

    Energy Technology Data Exchange (ETDEWEB)

    Choi, A.S.

    2001-06-12

    The objective of this study, as defined in the associated test specifications and task technical and quality assurance plan, was to estimate all the physical properties that are required to design the storage and transport facilities for the concentrated cesium and technetium eluates. Specifically, the scope of this study included: (1) modeling of the aqueous electrolyte chemistry of Tank 241-AN-107 Cs and Tc eluate evaporators, (2) process modeling of semi-batch and continuous evaporation operations, (3) determination of the operating vacuum and target endpoint of each evaporator, (4) calculation of the physical properties of the concentrated Cs and Tc eluate blend, and (5) development of the empirical correlations for the physical properties thus estimated.

  6. Examination of post operative split lung function using quantitative xenon 133 (133Xe) inhalation scan

    International Nuclear Information System (INIS)

    133Xe inhalation scan and ordinary lung function testing were performed three times in 34 patients undergoing pulmonary resection: before surgery, and one and six months postoperatively. Forced vital capacity (FVC) and forced expiratory volume in the first second (FEV1.0) were used as spirometric parameters. From the 133Xe inhalation scan, a split lung capacity (right to left, upper, middle and lower) and T1/2 (time required for half of the inhalation of 133Xe gas to be expired) were calculated by computer and used as indices of split lung capacity and ventilation, respectively. The predicted postoperative lung functions were calculated using preoperative spirometric respiratory function and 133Xe inhalation data according to the formula reported by Ali and associates. At sixth postoperative month, both predicted FVC (r=0.895, p1.0 (r=0.897, p<0.001) correlated highly with those actually observed. These results appear to be very useful for preoperative evaluation of operative indications and the choice of surgical method. The ratios of observed to predicted lung capacity in the post operative state were examined by splitting the right and left lung and the means±S.D.(%) were 80.5±9.7% on the operated side and 119.2±11.7% on the opposite side one month after surgery. Six months after surgery, the corresponding figures were 111.0±5.6% and 96.7±16.4%. The post operative T1/2 values on the operated sides were about 2.4 times the preoperative values at one month after surgery but returned to the preoperative values by the six postoperative month. From these results, it can be said that respiratory functions after pulmonary resection are maintained primarily by compensatory lung function of opposite and operated sides at one and six months, respectively. These results also provide valuable information on postoperative respiratory care for patients who have undergone lung resection. (author)

  7. Usefulness of 3-D dynamic pulmonary xenon-133 SPECT for thoracoscopic lung volume reduction surgery in patients with pulmonary emphysema

    International Nuclear Information System (INIS)

    Six patients with pulmonary emphysema scheduled to undergo thoracoscopic lung volume reduction surgery (TLVRS) were evaluated by three-dimensional (3-D) dynamic pulmonary xenon-133 SPECT. Serial 30-second dynamic SPECT data for equilibrium and washout (for 5 min) were acquired using a continuous repetitive rotating acquisition mode with a triple-detector SPECT system. SPECT data were reconstructed to 3-D images with a color, surface-rendering technique, and a 3-D fusion image of the 3-min washout image over the equilibrium image was obtained. Regional ventilation was visually assessed on the fusion 3-D images and quantified by xenon-133 half-washout time (T1/2) and mean transit time (MTT). The 3-D fusion image localized and lateralized the worst diseased sites with xenon-133 retention. Xenon-133 retention, T1/2 and MTT were reduced on these images in five patients with improved pulmonary function tests following TLVRS. However, xenon-133 retention was greater in one with asynchronous diaphragm movement after TLVRS. This modality will assist TLVRS in determining the lung-resection target and in evaluating the treatment effect. (author)

  8. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    International Nuclear Information System (INIS)

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations. The process, described by a three-level model with the Λ scheme, shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms. The |Fg = 3> → |Fe = 4> resonance pumping can result in the ground state |Fg = 4, mF = 4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg = 4. To enhance the anisotropy in the ground state, we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg = 4> → |Fe = 3> transition, in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field. (atomic and molecular physics)

  9. Electrode activation in cesium-free negative ion sources

    International Nuclear Information System (INIS)

    Features of emission electrode activation leading to enhancement of negative ion emission in cesium-free discharges are discussed. In some ion sources with cesium-free discharges, the emission of negative ions has been increased significantly by emission electrode activation using strong heating of the negative biased electrode by discharge plasma. A simple explanation of this enhancement is that it is due to an accumulation on the emission surface of the plasma electrode of impurities with low ionization potential that decreases in surface work function and increases the secondary emission of negative ions similar to ''Cesiation.'' The negative biasing of emission surface is important for accumulation and trapping the impurities on the emission surface. To effectively control the activation process it is important to directly detect the evolution of the work function and the impurity concentration during electrode activation with enhancement of negative ion emission.

  10. Trapping and cooling cesium atoms in a speckle field

    International Nuclear Information System (INIS)

    We present the results of two experiments where cold cesium atoms are trapped in a speckle field. In the first experiment, a YAG laser creates the speckle pattern and induces a far-detuned dipole potential which is a nearly-conservative potential. Localization of atoms near the intensity maxima of the speckle field is observed. In a second experiment we use two counterpropagating laser beams tuned close to a resonance line of cesium and in the lin perpendicular to lin configuration, one of them being modulated by a holographic diffuser that creates the speckle field. Three-dimensional cooling is observed. Variations of the temperature and of the spatial diffusion coefficient with the size of a speckle grain are presented. (orig.)

  11. Cesium exchange reaction on natural and modified clinoptilolite zeolites

    International Nuclear Information System (INIS)

    Cesium cation exchange reaction with K, Na, Ca and Mg ions on natural and modified clinoptilolite has been studied. Batch cation-exchange experiments were performed by placing 0.5 g of clinoptilolite into 10 ml or 20 ml of 1 x 10-3M CsCl solution for differing times. Two type deposits of clinoptilolite zeolites from, Nizny Hrabovec (NH), Slovakia and Metaxades (MX), Greece were used for ion-exchange study. The distribution coefficient (Kd) and sorption capacity (Γ) were evaluated. For the determination of K, Na, Ca and Mg isotachophoresis method, the most common cations in exchange reaction was used. Cesium sorption was studied using 137Cs tracer and measured by γ-spectrometry. (author)

  12. Kelvin Probe Studies of Cesium Telluride Photocathode for AWA Photoinjector

    CERN Document Server

    Wisniewski, Eric; Yusof, Zikri; Spentzouris, Linda; Terry, Jeff; Harkay, Katherine

    2012-01-01

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (~50 nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin Probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating.

  13. Strontium-90 and cesium-137 in air-borne dust

    International Nuclear Information System (INIS)

    Under the commission of Science and Technology Agency, Japan Chemical Analysis Center and prefectural public health laboratories and institutes have determined the levels of strontium-90 and cesium-137 in air-borne dust samples. Dust samples were collected by the aspiration of 3000 m3 or more air at 1.0 -- 1.5 m above the ground surface in 10 prefectural public health laboratories and institutes. The samples collected during three months were combined, and were forwarded to Japan Chemical Analysis Center after carbonization. These samples were ashed in an electric muffle furnance at Japan Chemical Analysis Center. The ash to which both some carriers and hydrochloric acid were added, was destroyed under heating. The solution was dissolved into hydrochloric and filtered, after it was added with nitric acid and heated to dryness. The filtrate was radiochemically analysed for strontium-90 and cesium-137 with low background beta-ray spectrometer. (author)

  14. Cesium and lead uptake by CSH phases of hydrated cement

    International Nuclear Information System (INIS)

    As Kd from radwaste elements in concrete systems show a wide range of values, a modelling of cesium and lead immobilization in Calcium Silicate Hydrate (CSH, xCaO.SiO2.H2O, with 0.7 (aged cements)SiOH) and precipitation equilibria. Values of Kd from cesium and lead in CSH matrix can thus be calculated with Ca/Si evolution and ionic strength effect. Predictive calculations have been carried out with success with different Ca/Si ratios, ionic strengths and liquid/solid ratios, and results are well superimposed with experimental isotherm data. If the CSH really allow accounting for the radwaste behavior in hydrated cement matrices, this model can be used in safety assessment calculations, with varying pH and [Ca2+] as cement degradation state parameters. Copyright (2001) Material Research Society

  15. New thermodynamic regularity for cesium over the whole liquid range

    CERN Document Server

    Ghatee, M H

    2001-01-01

    In this paper we derive an equation of state for liquid cesium based on a suggested potential function in accord to the characteristics large attraction and soft repulsion at the asymptotes of interaction potentials. By considering the interaction of nearest adjacent atoms in dense fluid, the equation of state predicts that the isotherm is linear function of, where is the compression factor, is the molar volume, and is the molar density. The linear parameters are identified as interaction coefficients related to attraction and repulsion, and are used to evaluate the molecular parameters with interesting implications. The isotherm is intended to resolve the particular thermodynamic properties of alkali metals, which have been known for their unusual change of the nature of intermolecular force as the characteristic metal-nonmetal transition range is approached. When applied to liquid cesium, the isotherms persist linear over the whole liquid range including the metal non-metals transition range and at the crit...

  16. Strontium-90 and cesium-137 in air-borne dust

    International Nuclear Information System (INIS)

    The levels of strontium-90 and cesium-137 in airborne dust have been determined by Japan Chemical Analysis Center under the contact with Science and Technology Agency. Dust samples were collected at 1.0 -- 1.5m above the ground surface with electrostatic precipitators or on filter papers by each prefectural public health laboratories and institutes in 9 prefectures, and these samples were forwarded to Japan Chemical Analysis Center after the carbonization. These samples were asked in an electric muffle furnance at Japan Chemical Analysis Center. The ask to which both some carriers and hydrochloric acid were added, was destroyed under heating. The solution was dissolved into hydrochloric acid and filtered, after it was added with nitric acid and heated to dryness. The filtrate was analysed for strontium-90 and cesium-137 using the method recommended by science and Technology Agency. (author)

  17. Cesium-137, a drama recounted; Cesio-137, um drama recontado

    Energy Technology Data Exchange (ETDEWEB)

    Vieira, Suzane de Alencar

    2013-01-15

    The radiological accident with Cesium-137, which started on Goiania in 1987, did not stop with the end of radiological contamination and continues in a judicial, scientific and narrative process of identification and recognition of new victims. The drama occupies a central place on the dynamics of radiological event, as it extends its limits, inflects its intensity and updates the event. As a narrative of the event, the ethnography incorporates and brings up to date the drama as an analysis landmark and the description of the theme as it is absorbed by a dramatic process. Cesium-137, a drama recounted is a textual experimentation based on real events and characters picked out from statements reported in various narratives about the radiological accident. (author)

  18. 21 CFR 133.127 - Cook cheese, koch kaese.

    Science.gov (United States)

    2010-04-01

    ... in § 133.3. (2) Clotting enzymes. Rennet and/or other clotting enzymes of animal, plant, or microbial... of parts 101 and 130, except that enzymes of animal, plant, or microbial origin may be declared...

  19. Review of xenon-133 production and related problems

    International Nuclear Information System (INIS)

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs

  20. Genetics Home Reference: 15q13.3 microdeletion

    Science.gov (United States)

    ... behavioral problems, including a short attention span, aggression, impulsive behavior, and hyperactivity. Some people with a 15q13.3 ... and management of various health conditions: Diagnostic Tests Drug Therapy Surgery and Rehabilitation Genetic Counseling Palliative Care ...

  1. Migration behavior of cesium in compacted sodium montmorillonite

    International Nuclear Information System (INIS)

    For safety assessments of geological disposal of high-level radioactive wastes, it is important to study the migration behavior of radioactive nuclides in compacted bentonite. In the present study, the apparent diffusion coefficients and activation energies of the diffusion were determined for cesium ions in compacted montmorillonite, a major clay mineral in bentonite. The activation energies obtained in the present study were 32.9 to 52.9 kJ mol-1, clearly higher than for the diffusion of cesium ions in free water, 16.2 kJ mol-1. The activation energies for Na-montmorillonite specimens with dry densities of 1.0, 1.2, and 1.4 x 103 kg m-3 were similar at approximately 34 kJ mol-1. When the dry density of the Na-montmorillonite specimens increases, the activation energy also increases, to reach 52.9 kJ mol-1 at 1.8 x 103 kg m-3. These findings suggest that the cesium in the compacted Na-montmorillonite diffuses with a different process from that in free water. Basal spacings were determined by the X-ray diffraction method for water-saturated, compacted Na-montmorillonite specimens. Three-water layer hydrate in the interlamellar space was observed for the Na-montmorillonite with dry densities of 1.0, 1.2, and 1.4 x 103 kg m-3, where the activation energies for the diffusion were nearly constant. Only the two-water layer hydrate was found in the Na-montmorillonite with dry densities of 1.6 and 1.8 x 103 kg m-3, in which the activation energy increases with the dry density. It is possible that the basal spacing could affect the migration behavior of cesium in compacted Na-montmorillonite. (author)

  2. Radioactive cesium. Dynamics and transport in forestal food-webs

    International Nuclear Information System (INIS)

    This report summarises results from a radioecological study during 1994-1995 concerning turnover, redistribution and loss of radioactive Cesium (134 and 137) in boreal forest ecosystems, as well as uptake and transfer in important food-chains over moose, vole and vegetation. The basis for this report are 9 publications published 1994-95. These reports are presented in summary form. 9 refs, 17 figs

  3. Optimized production of a cesium Bose-Einstein condensate

    OpenAIRE

    Kraemer, Tobias; Herbig, Jens; Mark, Michael; Weber, Tino; Chin, Cheng; Naegerl, Hanns-Christoph; Grimm, Rudolf

    2004-01-01

    We report on the optimized production of a Bose-Einstein condensate of cesium atoms using an optical trapping approach. Based on an improved trap loading and evaporation scheme we obtain more than $10^5$ atoms in the condensed phase. To test the tunability of the interaction in the condensate we study the expansion of the condensate as a function of scattering length. We further excite strong oscillations of the trapped condensate by rapidly varying the interaction strength.

  4. Cesium dihydrophosphate monocrystal growth and certain of their properties

    International Nuclear Information System (INIS)

    Crystals of cesium dihydrophosphate (centrisymmetrical, monoclinic, point symmetric group 2/m) are obtained by methods involving solvent evaporation and temperature reduction. At -122 deg C, a ferroelectric phase transition occurs, and at 230 and 265 deg C first-kind transitions, which are not accompanied by composition changes. CsH2PO4 solubility substantially increases with higher medium acidity, and remains approximately constant in alkali medium

  5. Behaviour of radioactive cesium in northern boreal forest ecosystems

    International Nuclear Information System (INIS)

    Full text: In 1997-2001 a large number of environmental samples have been collected from the Muddusjaervi area in Finnish Lappland. These samples include soil, water, sediment, vegetation and fish samples. Radioactive contamination in this subarctic environment has mainly resulted from the nuclear weapons test fallout in the 1950s and 1960s. Chernobyl accident did not considerably increase the contamination level in this area. The Laboratory of Radiochemistry, University of Helsinki, has been studying the behaviour of fallout radionuclides in the environment and in food chains in Lappland from the beginning of the 1960s. The study area lies in the middle of northern reindeer herding area where accumulation of radioactive cesium has been observed in food chains. In this paper we report on the behaviour of radioactive cesium in soil columns. The soil in this area is typically nutrient-poor podzolic soil. Altogether thirty soil columns were collected and they were divided into horizons (litter, organic and mineral layers). The activity concentrations of the horizons were determined by gamma spectrometry. In general, cesium has been concentrated mainly in the litter and organic layers and it has not been migrated considerably to mineral layers. To study the long term behaviour of cesium in soil the activity concentrations have been compared to those found in earlier decades and to the activity concentrations earlier determined for other radionuclides, especially for Pu. A further major objective was to study runoff of radionuclides from ground to lakes and brooks and therefore many of the soil samples were collected from various distances from lakes and brooks. (author)

  6. Detection of the actinides and cesium from environmental samples

    Science.gov (United States)

    Snow, Mathew Spencer

    Detection of the actinides and cesium in the environment is important for a variety of applications ranging from environmental remediation to safeguards and nuclear forensics. The utilization of multiple different elemental concentrations and isotopic ratios together can significantly improve the ability to attribute contamination to a unique source term and/or generation process; however, the utilization of multiple elemental "signatures" together from environmental samples requires knowledge of the impact of chemical fractionation for various elements under a variety of environmental conditions (including predominantly aqueous versus arid conditions). The research reported in this dissertation focuses on three major areas: 1. Improving the understanding of actinide-mineral interactions at ultra-low concentrations. Chapter 2 reports a batch sorption and modeling study of Np(V) sorption to the mineral goethite from attomolar to micromolar concentrations. 2. Improving the detection capabilities for Thermal Ionization Mass Spectrometry (TIMS) analyses of ultra-trace cesium from environmental samples. Chapter 4 reports a new method which significantly improves the chemical yields, purification, sample processing time, and ultimately, the detection limits for TIMS analyses of femtogram quantities of cesium from a variety of environmental sample matrices. 3. Demonstrating how actinide and cesium concentrations and isotopic ratios from environmental samples can be utilized together to determine a wealth of information including environmental transport mechanisms (e.g. aqueous versus arid transport) and information on the processes which generated the original material. Chapters1, 3 and 5 demonstrate these principles using Pu, Am, Np, and Cs concentrations and isotopic ratios from contaminated soils taken near the Subsurface Disposal Area (SDA) of Idaho National Laboratory (INL) (a low level radioactive waste disposal site in southeastern Idaho).

  7. Corrections to our results for optical nanofiber traps in Cesium

    CERN Document Server

    Ding, D; Choi, K S; Kimble, H J

    2012-01-01

    Several errors in Refs. [1, 2] are corrected related to the optical trapping potentials for a state-insensitive, compensated nanofiber trap for the D2 transition of atomic Cesium. Section I corrects our basic formalism in Ref. [1] for calculating dipole-force potentials. Section II corrects erroneous values for a partial lifetime and a transition wavelength in Ref. [1]. Sections III and IV present corrected figures for various trapping configurations considered in Refs. [1] and [2], respectively.

  8. Electrically switched cesium ion exchange. FY 1997 annual report

    International Nuclear Information System (INIS)

    This paper describes the Electrically Switched Ion Exchange (ESIX) separation technology being developed as an alternative to ion exchange for removing radionuclides from high-level waste. Progress in FY 1997 for specific applications of ESIX is also outlined. The ESIX technology, which combines ion exchange and electrochemistry, is geared toward producing electroactive films that are highly selective, regenerable, and long lasting. During the process, ion uptake and elution can be controlled directly by modulating the potential of an ion exchange film that has been electrochemically deposited onto a high surface area electrode. This method adds little sodium to the waste stream and minimizes the secondary wastes associated with traditional ion exchange techniques. Development of the ESIX process is well underway for cesium removal using ferrocyanides as the electroactive films. Films having selectivity for perrhenate (a pertechnetate surrogate) over nitrate also have been deposited and tested. Based on the ferrocyanide film capacity, stability, rate of uptake, and selectivity shown during performance testing, it appears possible to retain a consistent rate of removal and elute cesium into the same elution solution over several load/unload cycles. In batch experiments, metal hexacyanoferrate films showed high selectivities for cesium in concentrated sodium solutions. Cesium uptake was unaffected by Na/Cs molar ratios of up to 2 x 104 , and reached equilibrium within 18 hours. During engineering design tests using 60 pores per inch, high surface area nickel electrodes, nickel ferrocyanide films displayed continued durability. losing less than 20% of their capacity after 1500 load/unload cycles. Bench-scale flow system studies showed no change in capacity or performance of the ESIX films at a flow rate up to 13 BV/h, the maximum flow rate tested, and breakthrough curves further supported once-through waste processing. 9 refs., 24 figs

  9. Studies on the Separation of Cesium From Fission Products

    Institute of Scientific and Technical Information of China (English)

    QIANLi-juan; ZHANGSheng-dong; GUOJing-ru; CUIAn-zhi; YANGLei; WUWang-suo

    2003-01-01

    135Cs is a long-life fission product. When measuring its thermal cross section, we must separate radiochemical purity cesium from fission products. Except for decontaminating radio- nuclides, others which can be activated must be avoided to come into solution. So ion exchanger is used. Inorganic ion exchangers have received increased attention because of their high resistance to radiation and their very efficient separation of alkali metal ions.

  10. Automated analysis of Xe-133 pulmonary ventilation (AAPV) in children

    Science.gov (United States)

    Cao, Xinhua; Treves, S. Ted

    2011-03-01

    In this study, an automated analysis of pulmonary ventilation (AAPV) was developed to visualize the ventilation in pediatric lungs using dynamic Xe-133 scintigraphy. AAPV is a software algorithm that converts a dynamic series of Xe- 133 images into four functional images: equilibrium, washout halftime, residual, and clearance rate by analyzing pixelbased activity. Compared to conventional methods of calculating global or regional ventilation parameters, AAPV provides a visual representation of pulmonary ventilation functions.

  11. Dicty_cDB: SFJ133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFJ133 (Link to dictyBase) - - - Contig-U13863-1 SFJ133P (Link to Original ... thaliana chromosome 2... 131 3e-29 G84651( G84651 )biotin ... holocarboxylase synthetase [imported] - Ara... 129 ... inus CCE9901... 124 4e-27 ( P50747 ) RecName: Full=Biotin --protein ligase; EC=6.3.4... 122 2e-26 AK168925_1( ...

  12. A mechanical valve assembly for xenon 133 gas delivery systems

    International Nuclear Information System (INIS)

    Some gas delivery systems used in pulmonary ventilation scanning are unable to satisfactorily supply 133Xe gas to bed-ridden patients. A mechanical gas valve assembly to control the flow of gas in such systems was constructed. A commercially produced 133Xe gas delivery system when fitted with the new assembly was able to ventilate almost all patients whereas previously this could be achieved with approximately only 50% of patients

  13. Characterization of colon cancer cells: a functional approach characterizing CD133 as a potential stem cell marker

    International Nuclear Information System (INIS)

    Isolation and characterization of tumourigenic colon cancer initiating cells may help to develop novel diagnostic and therapeutic procedures. We characterized a panel of fourteen human colon carcinoma cell lines and their corresponding xenografts for the surface expression of potential stem cell markers CD133, CD24, CD44, CDCP1 and CXCR4. In five cell lines and nine xenografts, mRNA expression of these markers was determined. Tumour growth behaviour of CD133+, CD133- and unsorted SW620 cells was evaluated in vivo. All five putative stem cell markers showed distinct expression patterns in the tumours examined. Two patient-derived cell lines highly expressed CD133 (> 85% of positive cells) and three other cell lines had an expression level of about 50% whereas in long-term culture based models CD133 expression ranged only from 0 to 20%. In 8/14 cell lines, more than 80% of the cells were positive for CD24 and 11/14 were over 70% positive for CD44. 10/14 cell lines expressed CDCP1 on ≥ 83% of cells. CXCR4 expression was determined solely on 94 L and SW480. Analyses of the corresponding xenografts revealed a significant reduction of cell numbers expressing the investigated surface markers and showed single cell fractions expressing up to three markers simultaneously. Statistical analysis revealed that the CXCR4 mRNA level correlates negatively with the protein expression of CD133, CD44, CD24 and CDCP1 in cell lines and xenografts. A lower differentiation grade of donor material correlated with a higher CDCP1 mRNA expression level in the respective tumour model. In vivo growth behaviour studies of SW620 revealed significantly higher take rates and shorter doubling times in the tumour growth of CD133 positive subclones in comparison to the unsorted cell line or CD133 negative subclones. Our data revealed correlations in the expression of surface markers CD44 and CD24 as well as CD44 and CDCP1 and strongly suggest that CD133 is a stem cell marker within our colon

  14. An improved radiosynthesis of [{sup 18}F]AV-133: a PET imaging agent for vesicular monoamine transporter 2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Lin; Liu Yajing [Key Laboratory of Radiopharmaceuticals, Beijing Normal University, Ministry of Education, Beijing 100875 (China); Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Ploessl, Karl; Lieberman, Brian [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Liu Jingying [Key Laboratory of Radiopharmaceuticals, Beijing Normal University, Ministry of Education, Beijing 100875 (China); Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States)], E-mail: kunghf@sunmac.spect.upenn.edu

    2010-02-15

    Introduction: Recently, a PET tracer, 9-[{sup 18}F]fluoropropyl-(+)-dihydrotetrabenazine ([{sup 18}F]AV-133), targeting vesicular monoamine transporter 2 (VMAT2) in the central nervous system has been reported. It is currently under Phase II clinical trials to establish its usefulness in the diagnosis of neurodegenerative diseases including dementia with Lewy bodies and Parkinson's disease. The radiolabeling of [{sup 18}F]AV-133, nucleophilic fluorination reaction and potential effects of pseudo-carrier were evaluated by in vivo biodistribution. Methods: The preparation of [{sup 18}F]AV-133 was evaluated under different conditions, specifically by employing different precursors (-OTs or -Br as the leaving group at the 9-propoxy position), reagents (K222/K{sub 2}CO{sub 3} vs. tributylammonium bicarbonate) and solvents (acetonitrile vs. DMSO), reaction temperature and reaction time. With optimized conditions from these experiments, radiosynthesis and purification with solid-phase extraction (SPE) of [{sup 18}F]AV-133 were performed by an automated nucleophilic [{sup 18}F]fluorination module. In vivo biodistribution in mice on [{sup 18}F]AV-133 purified by either HPLC (no-carrier-added) or the SPE method (containing a pseudo-carrier) was performed and the results compared. Results: Under a mild fluorination condition (heating at 115 deg. C for 5 min in dimethyl sulfoxide), [{sup 18}F]AV-133 was obtained in a high yield using either -OTs or -Br as the leaving group. However, the -OTs precursor gave better radiochemical yields (>70%, thin layer chromatography analysis) compared to those of the -Br precursor. The optimized reaction conditions were successfully implemented to an automated nucleophilic fluorination module. Labeling and purification of [{sup 18}F]AV133 were readily achieved via this automatic module in good radiochemical yield of 21-41% (n=10) in 40 min. The radiochemical purity was larger than 95%. Biodistribution of SPE-purified product (containing a

  15. Brain uptake of a non-radioactive pseudo-carrier and its effect on the biodistribution of [18 F]AV-133 in mouse brain

    International Nuclear Information System (INIS)

    Introduction: 9-[18 F]Fluoropropyl-(+)-dihydrotetrabenazine ([18 F]AV-133) is a new PET imaging agent targeting vesicular monoamine transporter type II (VMAT2). To shorten the preparation of [18 F]AV-133 and to make it more widely available, a simple and rapid purification method using solid-phase extraction (SPE) instead of high-pressure liquid chromatography (HPLC) was developed. The SPE method produced doses containing the non-radioactive pseudo-carrier 9-hydroxypropyl-(+)-dihydrotetrabenazine (AV-149). The objectives of this study were to evaluate the brain uptake of AV-149 by UPLC-MS/MS and its effect on the biodistribution of [18 F]AV-133 in the brains of mice. Methods: The mice were injected with a bolus including [18 F]AV-133 and different doses of AV-149. Brain tissue and blood samples were harvested. The effect of different amounts of AV-149 on [18 F]AV-133 was evaluated by quantifying the brain distribution of radiolabelled tracer [18 F]AV-133. The concentrations of AV-149 in the brain and plasma were analyzed using a UPLC-MS/MS method. Results: The concentrations of AV-149 in the brain and plasma exhibited a good linear relationship with the doses. The receptor occupancy curve was fit, and the calculated ED50 value was 8.165 mg/kg. The brain biodistribution and regional selectivity of [18 F]AV-133 had no obvious differences at AV-149 doses lower than 0.1 mg/kg. With increasing doses of AV-149, the brain biodistribution of [18 F]AV-133 changed significantly. Conclusion: The results are important to further support that the improved radiolabelling procedure of [18 F]AV-133 using an SPE method may be suitable for routine clinical application

  16. Extraction of rubidium and cesium from micas following sulfate-extraction technology

    International Nuclear Information System (INIS)

    Results are presented of semicommercial tests of procedure of rubidium and cesium extraction from micas. Micas has been processed by the 40% solution of sulphuric acid at boiling temperature. Separate extraction of cesium and rubidium from the solution with arylalkylsubstituted phenol has been conducted after alum crystallization and decomposition by lime. Pure rubidium carbonate and technical cesium carbonate with their 80 and 95% extraction, respectively, are prepared

  17. Investigations of the method of sodium decontamination from cesium and tritium aiming its utilization or disposal

    International Nuclear Information System (INIS)

    Effective methods of removing cesium and tritium from sodium are submitted. It is shown, that the cleaning from cesium with consecutive use of portions of carbon materials will allow on the orders to reduce amount of sorbent, in which is concentrated cesium. For cleaning from tritium technological process with use of a cold trap and special dosage hydrogen in sodium is offered. The data on required time of cleaning and depth of cleaning at various capacity of hydrogen source are given. (author)

  18. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  19. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  20. MODELING RESULTS FROM CESIUM ION EXCHANGE PROCESSING WITH SPHERICAL RESINS

    Energy Technology Data Exchange (ETDEWEB)

    Nash, C.; Hang, T.; Aleman, S.

    2011-01-03

    Ion exchange modeling was conducted at the Savannah River National Laboratory to compare the performance of two organic resins in support of Small Column Ion Exchange (SCIX). In-tank ion exchange (IX) columns are being considered for cesium removal at Hanford and the Savannah River Site (SRS). The spherical forms of resorcinol formaldehyde ion exchange resin (sRF) as well as a hypothetical spherical SuperLig{reg_sign} 644 (SL644) are evaluated for decontamination of dissolved saltcake wastes (supernates). Both SuperLig{reg_sign} and resorcinol formaldehyde resin beds can exhibit hydraulic problems in their granular (nonspherical) forms. SRS waste is generally lower in potassium and organic components than Hanford waste. Using VERSE-LC Version 7.8 along with the cesium Freundlich/Langmuir isotherms to simulate the waste decontamination in ion exchange columns, spherical SL644 was found to reduce column cycling by 50% for high-potassium supernates, but sRF performed equally well for the lowest-potassium feeds. Reduced cycling results in reduction of nitric acid (resin elution) and sodium addition (resin regeneration), therefore, significantly reducing life-cycle operational costs. These findings motivate the development of a spherical form of SL644. This work demonstrates the versatility of the ion exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. The value of a resin with increased selectivity for cesium over potassium can be assessed for further development.

  1. Transition of cesium in food chains [after Chernobyl catastrophe

    International Nuclear Information System (INIS)

    An investigation of 25,000 samples of foodstuffs and feedstuffs in Czechoslovakia, contaminated by fall-out cesium after the accident in the Chernobyl nuclear power plant, performed from May 5, 1986 to March 31, 1988, revealed that both the values of cesium transfer-factors in food--animal tissues--milk transitions and the values of biological half-life of cesium are functions of internal and external conditions of contamination. Organism individuality as the main internal condition causes the variance of about +/- 50% of the mean value of the respective transfer-factor. Through the external conditions, mainly the environmental contamination level, type of ingested food and time of ingestion, the mean values of transfer-factors are influenced up to 500%, e.g. to the value of 0.5. But this value converges with growing up contamination of food and environment to the limit of 0.3. The first two to three biological half-lives after the last ingestion of contaminated food are up to ten-times shorter than those at stabilized state

  2. Cesium transfer to agricultural crops for three years after Chernobyl

    International Nuclear Information System (INIS)

    In 1986 about 50 farms in the fallout region were selected for sampling at fixed sites of the soil surface layer and of the grassland and grain crops to come. The aim was to cover the different soil types and the farming practices of the region during studies on the transfer levels and on the change with time in transfer of cesium to the crops. It was found that the transfer level, as expected, was much higher for the grassland than for the grain crops. However, within both groups of considerable variation in the transfer level for the same year as measured by the transfer factors has occurred. For the former crops it can be concluded that the transfer factor during year 1 depends on the interception capacity of the plant cover and on the dilution by growth i.e on soil fertility and on fertilization level. In the following years the cesium TF-value for the grass cover was reduced by a factor from 2 to about 10. The reduction rate differed above all between the organic soils and the mineral soils and should largely depend on the type of the grass cover, on the different cesium fixing capacities of the two soil groups and on the potassium fertilization level. On ploughed land the transfer by root uptake to grain crops was about one magnitude lower than the transfer to the hey crops. (orig.)

  3. Expression of CD133 in various premalignant and proliferative lesions

    Directory of Open Access Journals (Sweden)

    Rahmi Amtha

    2015-06-01

    Full Text Available Background: In Jakarta, oral squamous cell carcinoma (OSCC usually detected in late stage with very low survival rate ofabout 1.1 years. OSCC may be preceded by premalignant lesion, so that early detection of the lesion may decrease the mortality rate due to oral malignancy. CD133 is a hematopoietic stem cell that play role in tissue regeneration, inflammation and tumor. Upregulated of CD133 was reported on tumor progression. Purpose: The aim of study is to determine circulating CD133 expression on premalignant (PML and proliferative (PL lesion. Method: Observational research was carried out on patients who seek treatment of PML and PL at Oral Medicine clinic. CD133 was taken from peripheral blood serum, examined using PCR. Data was analyzed by Chi square test. Result: 15 subjects (each of five subjects for PML, PL and control consist of 40% male and 60% female. Age group of above 41 years old was most affected PML and PL (66.7%. Tongue is common site for oral lesion (40%. There is a significant different of circulating CD133 rate among all groups lesion (p=0.039. Conclusion: CD133 express differently in premalignant and proliferative lesions.

  4. Study of regional lung ventilation and perfusion by xenon 133

    International Nuclear Information System (INIS)

    The present work consists of a regional lung exploration after injection of xenon 133, dissolved in physiological serum, followed a few minutes later by that of 99m Tc-labelled serumalbumin microspheres. The aim is three fold: first of all to study perfusion and ventilation by xenon 133, next to compare the results obtained after xenon 133 and 99 m Tc-labelled microsphere injection, lastly to establish the value of the technique and its routine application. This examination has not solved all problems of lung exploration by xenon 133. For example we deliberately kept to intraveinous injection of the gas dissolved in physiological serum, leaving aside the breathing test. Xenon 133 scintigraphy in our opinion will not tend to replace 99m Tc-labelled microsphere scintigraphy, which has irreplaceable morphological qualities, but will serve as an excellent complement. The basic advantage of xenon 133 is the regional ventilation estimate it provides allowing any anomaly of the lung parenchyma to be located immediately or conversely the functional value of the healthy lung to be established with a view to a surgical removal of a diseased zone

  5. Review of xenon-133 production and related problems; Estudio bibliografico de la produccion de xenon-133 y problemas afines

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Ropero, M.

    1980-07-01

    A literature survey is given on the production methods of fission xenon-133 and related problems, such as purification, metrological and dosimetric aspects, preparation of isotopic solutions, recycling, etc. 127 references are included. (Author) 127 refs.

  6. Preparation of Modified Kaolin Filler with Cesium and Its Application in Security Paper

    OpenAIRE

    Houssni El-Saied; Samya El-Sherbiny; Omnia Ali; Wafaa El-Saied; Said Rohyem

    2013-01-01

    In this study, cesium was added intentionally during paper manufacture for protecting the papers against forgery and counterfeiting by sorbing cesium ions (Cs+) on kaolin, used as special filler in papermaking. The sorption of cesium from aqueous solution by kaolin was studied as a function of pH, shaking time, cesium initial concentration, and mass of kaolin using batch technique. The results showed that a solution containing 10 mg/L Cs+ and 250 mg of kaolin at pH 6 can be used to modify the...

  7. Mobility of cesium through the Callovo-Oxfordian claystones under partially saturated conditions

    International Nuclear Information System (INIS)

    The diffusion of cesium was studied in an unsaturated core of Callovo-Oxfordian claystone, which is a potential host rock for retrievable disposal of high-level radioactive wastes. In-diffusion laboratory experiments were performed on rock samples with water saturation degrees ranging from 81% to 100%. The analysis of both cesium concentration monitoring in the source reservoir and postmortem cesium rock concentration profile of the samples was carried out using a chemical-transport code where the sorption of cesium was described by a multi-site ion-exchange model. The results showed that cesium exhibited a clear trend related to the saturation degree of the sample. The more dehydrated the rock sample, the slower the decrease of cesium concentration, and the thinner the penetration depth of cesium was. The effective diffusion coefficient (De) for cesium decreased from 18.5 *10-11 m2 s-1 at full-saturation to 0.3 * 10-11 m2 s-1 for the more dehydrated sample. This decrease is almost 1 order of magnitude higher than that for tritiated water (HTO), although a similar behavior could have been expected, since cesium is known to diffuse in the same parts of the pore space as HTO in fully saturated claystones. (authors)

  8. Cesium transport in Four Mile Creek of the Savannah River Plant

    International Nuclear Information System (INIS)

    The behavior of a large radioactive cesium release to a Savannah River Plant (SRP) stream was examined using a stable cesium release to Four Mile Creek. Measurements following the release show that most of the cesium released was transported downstream; however, sorption and desorption decreased the maximum concentration and increased the travel time and duration, relative to a dye tracer, at sampling stations downstream. The study was made possible by the development of an analytical technique using ammonium molybdophosphate and neutron activation that permitted the measurement of stable cesium concentrations as low as 0.2 μg/L

  9. Radioactive cesium dynamics derived from hydrographic observations in the Abukuma River Estuary, Japan.

    Science.gov (United States)

    Kakehi, Shigeho; Kaeriyama, Hideki; Ambe, Daisuke; Ono, Tsuneo; Ito, Shin-Ichi; Shimizu, Yugo; Watanabe, Tomowo

    2016-03-01

    Large quantities of radioactive materials were released into the air and the ocean as a result of the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident, caused by the 2011 Tohoku earthquake and the subsequent major tsunami off the Pacific coast. There is much concern about radioactive contamination in both the watershed of the Abukuma River, which flows through Fukushima Prefecture, and its estuary, where it discharges into the sea in Miyagi Prefecture. We investigated radioactive cesium dynamics using mixing diagrams obtained from hydrographic observations of the Abukuma River Estuary. Particulate radioactive cesium dominates the cesium load in the river, whereas the dissolved form dominates in the sea. As the salinity increased from <0.1 to 0.1-2.3, the mixing diagram showed that dissolved radioactive cesium concentrations increased, because of desorption. Desorption from suspended particles explained 36% of dissolved radioactive cesium in estuarine water. However, the dissolved and particulate radioactive cesium concentrations in the sea decreased sharply because of dilution. It is thought that more than 80% of the discharged particulate radioactive cesium was deposited off the river mouth, where the radioactive cesium concentrations in sediment were relatively high (217-2440 Bq kg(-1)). Radioactive cesium that was discharged to the sea was transported southward by currents driven by the density distribution. PMID:26698826

  10. Laboratory plant for the separation of cesium from waste solutions of the PUREX process

    International Nuclear Information System (INIS)

    A laboratory plant for the separation of cesium from a fission product waste solution of the fuel reprocessing is described. The plant consists of two stages. In the first stage cesium is adsorbed on ammonium molybdatophosphate (AMP). Then the adsorbent is dissolved. From the solution cesium is adsorbed on a cationic ion exchanger in the second stage. Then AMP can be reproduced from this solution. For the elution of cesium in the second stage a NH4NO3 solution (3 m) is used. Flow sheet, construction and the control device of the plant are described and the results of tests with a model solution are given. (author)

  11. Structure of cesium loaded iron phosphate glasses: An infrared and Raman spectroscopy study

    International Nuclear Information System (INIS)

    The structure of cesium loaded iron phosphate glasses (IPG) was investigated using infrared and Raman spectroscopy. The spectra of the cesium doped samples revealed a structural modification of the parent glass owing to the incorporation of cesium. The structural changes could be correlated with the variation observed in the glass transition temperature of these glasses. Increased Cs-mediated cationic cross linking appears to be the reason for the initial rise in glass transition temperature up to 21 mol% Cs2O in IPG; while, breakdown of the phosphate network with increasing cesium content, brings down the glass transition temperature.

  12. Radioactive cesium content in selected food products. Pt. 1. Radioactive cesium content in dried milk (1987-1988)

    International Nuclear Information System (INIS)

    The content of radioactive cesium in dried and dried skimmed milk from selected dairies was double determined. The highest content was found in samples from milk from OSM Siedlce (98 Bq/kg) and skimmed milk from Radzyn Podlaski and Ostroleka, (the former 90, the latter 62 Bq/kg). The lowest level of radioactive cesium was observed in samples from dried milk from Sieradz, Slups, Wrzesnia, Olecko and Elblag (about or below 10 Bq/kg). Although those levels of contamination with radiocesium did not exceed values recommended by FAO they were determined as high for year 1987/88 as compared milk dates from previous 1985 year. (author). 13 refs, 4 tabs

  13. Enhanced invasion in vitro and the distribution patterns in vivo of CD133+ glioma stem cells

    Institute of Scientific and Technical Information of China (English)

    YU Sheng-ping; YANG Xue-jun; ZHANG Bin; MING Hao-lang; CHEN Cong; REN Bing-cheng; LIU Zhi-feng; LIU Bin

    2011-01-01

    Background Recent studies have suggested that cancer stem cells cause tumor recurrence based on their resistance to radiotherapy and chemotherapy.Although the highly invasive nature of glioblastoma cells is also implicated in the failure of current therapies,it is not clear whether cancer stem cells are involved in invasiveness.This study aimed to assess invasive ability of glioma stem cells (GSCs) derived from C6 glioma cell line and the distribution patterns of GSCs in Sprague-Dawley (SD) rat brain tumor.Methods Serum-free medium culture and magnetic isolation were used to gain purely CD133+ GSCs.The invasive stem cell markers and luxol fast blue staining for white matter tracts were performed to show the distribution patterns of GSCs in brain tumor of rats and the relationship among GSCs,vessels,and white matter tracts.The results of matrigel invasion assay were estimated using the Student's t test and the analysis of Western blotting was performed using the one-way analysis of variance (ANOVA) test.Results CD133+GSCs(number:85.3±4.1)were significantly more invasive in vitro than matched CD133- cells(number:25.9±3.1) (t=14.5,P <0.005).GSCs invaded into the brain diffusely and located in perivascular niche of tumor-brain interface or resided within perivascular niche next to white fiber tracts.The polarity of glioma cells containing GSCs was parallel to the white matter tracts.Conclusions Our data suggest that CD133+ GSCs exhibit more aggressive invasion in vitro and GSCs in vivo probably disseminate along the long axis of blood vessels and transit through the white matter tracts.The therapies targeting GSCs invasion combined with traditional glioblastoma multiforme therapeutic paradigms might be a new approach for avoiding malignant glioma recurrence.

  14. Radioactive cesium. Dynamics and transport in forestal food-webs; Radioaktivt cesium. Dynamik och transport i skogliga naeringsvaevar

    Energy Technology Data Exchange (ETDEWEB)

    Palo, T.; Nelin, P. [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Animal Ecology; Bergman, R.; Nylen, T. [FOA NBC Defence, Umeaa (Sweden)

    1995-12-01

    This report summarises results from a radioecological study during 1994-1995 concerning turnover, redistribution and loss of radioactive Cesium (134 and 137) in boreal forest ecosystems, as well as uptake and transfer in important food-chains over moose, vole and vegetation. The basis for this report are 9 publications published 1994-95. These reports are presented in summary form. 9 refs, 17 figs.

  15. The biological difference between CD13+CD133+ and CD13¬CD133¬liver cancer cells and its clinical significance

    OpenAIRE

    Shi-long JIN; Zhong-rong HUANG; Chen, Hua; Tian-wu YU; Cao, Hong; Yun-quan LONG; Zhou, Jian; Li, He; Yi GOU; Li, Yuan; Liao, Juan

    2013-01-01

    Objective To compare the biological difference between CD13+CD133+ and CD13-CD133- hepatocellular carcinoma (HCC) cells in HuH7 cell line and its clinical significance. Methods The status of proliferation, phase of the cell cycle, tumor formation in vivo, differentiation, and their chemoresistance to 5-FU and pirarubicin of CD13+CD133+ and CD13-CD133-HCC cells were studied to analyze the clinical implication of CD13+CD133+HCC cell subset. Results The proliferation rate of CD13+CD133+HCC cells...

  16. Cesium and strontium exchange properties of marsh soils

    International Nuclear Information System (INIS)

    The cesium and strontium exchange properties of some typical marsh soils of the estuary and lower river Weser region were described. Soil samples were taken according to the existing soil maps 1:25000 of Lower Saxony e.g. a “sea marsh soil”. a “brackish marsh soil”, and a “river marsh soil”. The exchange properties were determined by Cs/Ca and Sr/Ca exchange curves (Q/I relations) as generally used in soil potassium research. In addition to the Q/I relations the following investigations were carried out: - Cs and Sr desorption experiments (one time equilibration with Ca++ solutions) - Cs and Sr reexchange experiments (eight times equilibration with water, Ca++, Ba++, and K+ solutions) - the naturally-occuring Cs and Sr contents of the soils including amounts caused by imissions or fallout, respectively - clay mineral composition and swelling of layer silicates due to saturation with Ca++, Sr++, Cs+, and K+ ions. Q/I relations as well as desorption and reexchange experiments indicated strong cesium and low strontium fixation by the soils investigated. This was considered the reason for the stronger transfer of Sr from soil to plants as compared with Cs. Furthermore, the reexchange experiment revealed nearly complete reversibility of the Sr sorption reactions by equilibration with the divalent cations Ca++ and Ba++ and some Sr fixation after treatment with K+ solutions. However, cesium was much better reexchanged by K+ than by Ca++ and Ba++ ions. This led to the conclusion that Cs fixed in interlayer positions of clay minerals could be remobilized by potassium and ammonium fertilization. The naturally-occuring Cs contents of the soils were found to be below the detection limit of the analytical methods used. The contents of naturally-occuring exchangeable Sr, however, was in agreement with the amounts of “labile Sr” as derived from the Sr/Ca exchange curves. Concerning the cesium exchange properties a clear distinction between “sea and river marsh

  17. Elastic and inelastic scattering of cesium, cesium iodide, and cesium chloride by argon and xenon in the crossed atomic and molecular beams

    International Nuclear Information System (INIS)

    Velocity and angular distributions of cesium atoms and two cesium halide molecules scattered by rare gas atoms have been measured for the following systems at the indicated initial relative collision energies, anti E: Cs + Ar, anti E = 0.94, 1.29, and 1.85 kcal/mole; Cs + Xe, E = 1.15, 1.91, and 3.10 kcal/mole; Csl + Ar, anti E = 1.06, 1.46, and 2.08 kcal/mole; CsI + Ar, anti E = 1.36, 1.63, and 1.94 kcal/mole; CsI + Xe, anti E = 1.52, 2.52, and 4.09 kcal/mole. At the collision energies indicated the atom-atom scattering can only be elastic. Thus the experiments with those systems can be used for apparatus calibration and a standard of comparison for the diatom-atom experiments. The velocity distributions in the diatom-atom systems are analyzed for the relative contributions of elastic and inelastic scattering

  18. Next Generation Solvent (NGS): Development for Caustic-Side Solvent Extraction of Cesium

    International Nuclear Information System (INIS)

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Interlaboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  19. Next Generation Solvent (NGS): Development for Caustic-Side Solvent Extraction of Cesium

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Birdwell, Jr, Joseph F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bonnesen, Peter V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bruffey, Stephanie H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Duncan, Nathan C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ensor, Dale [Tennessee Technological Univ., Cookeville, TN (United States); Hill, Talon G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lee, Denise L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rajbanshi, Arbin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Roach, Benjamin D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Szczygiel, Patricia L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sloop, Jr., Frederick V. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Stoner, Erica L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Neil J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-03-01

    This report summarizes the FY 2010 and 2011 accomplishments at Oak Ridge National Laboratory (ORNL) in developing the Next Generation Caustic-Side Solvent Extraction (NG-CSSX) process, referred to commonly as the Next Generation Solvent (NGS), under funding from the U.S. Department of Energy, Office of Environmental Management (DOE-EM), Office of Technology Innovation and Development. The primary product of this effort is a process solvent and preliminary flowsheet capable of meeting a target decontamination factor (DF) of 40,000 for worst-case Savannah River Site (SRS) waste with a concentration factor of 15 or higher in the 18-stage equipment configuration of the SRS Modular Caustic-Side Solvent Extraction Unit (MCU). In addition, the NG-CSSX process may be readily adapted for use in the SRS Salt Waste Processing Facility (SWPF) or in supplemental tank-waste treatment at Hanford upon appropriate solvent or flowsheet modifications. Efforts in FY 2010 focused on developing a solvent composition and process flowsheet for MCU implementation. In FY 2011 accomplishments at ORNL involved a wide array of chemical-development activities and testing up through single-stage hydraulic and mass-transfer tests in 5-cm centrifugal contactors. Under subcontract from ORNL, Argonne National Laboratory (ANL) designed a preliminary flowsheet using ORNL cesium distribution data, and Tennessee Technological University confirmed a chemical model for cesium distribution ratios (DCs) as a function of feed composition. Interlaboratory efforts were coordinated with complementary engineering tests carried out (and reported separately) by personnel at Savannah River National Laboratory (SRNL) and Savannah River Remediation (SRR) with helpful advice by Parsons Engineering and General Atomics on aspects of possible SWPF implementation.

  20. Risk-Based Information to Support the Evaluation of Management Options for Cesium and Strontium Capsules at the Hanford Site

    International Nuclear Information System (INIS)

    Evaluations are under way to support U.S. Department of Energy decisions on how to manage cesium and strontium capsules currently in storage at the Hanford site. Health-based exposure limits for drinking water, oral toxicity data, and environmental fate information were combined in an initial evaluation to frame performance targets for managing chemicals and radionuclides that could leach from the capsules and migrate to groundwater over time. More than 50 relevant benchmarks were identified for 15 of the 17 contaminants in the study set. Of those multiple benchmarks, EPA limits for drinking water served as the main basis for the leachate performance targets. For the remaining two contaminants, stable cesium and zirconium, preliminary indicators were derived from a limited review of toxicity data. Thus, preliminary candidate concentrations were identified for the full study set to support the ongoing evaluation of capsule management options. In summary: In an earlier scoping study, three radionuclides and eight chemicals were identified as contaminants of interest for leachate from cesium and strontium capsules stored at the Hanford site. To frame management options for these capsules, it is assumed that contaminants will leach to groundwater and serve as a drinking water source in the long-term future. Before developing performance targets for the initial set of contaminants, a combined fate and toxicity evaluation was conducted to determine if any others should be added to account for decay or fate products and chemical toxicity. From this review, the list was expanded to produce a final study set of 17 contaminants. Established exposure limits and toxicity data were then reviewed and integrated to develop candidate health-based concentrations to frame performance targets for assessing options for long-term capsule management. This review of more than a dozen different benchmarks and toxicity sources translated to hundreds of individual data checks to support the

  1. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.

    Science.gov (United States)

    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P

    2010-05-01

    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  2. Cesium-137 inventories in undisturbed areas in different regions of Brazil

    International Nuclear Information System (INIS)

    Cesium-137 is an anthropogenic radionuclide introduced in the environment in the early of 1960s to the end of 1970s. The Cesium-137 has very used to assess soil redistribution in the landscape because this is very tight in the fine soil particles and its movement in the landscape is due to soil redistribution. To use Cesium-137 to assess soil redistribution is need to known the Cesium-137 inventory in an area that not has experimented soil erosion neither soil deposition. So, this work present Cesium-137 inventories in undisturbed areas in different regions of Brazil, from South to Northeast of Brazil. The inventories in these areas represent the variational deposition of Cesium-137 in the whole national territory of Brazil. The inventories of Cesium-137 varied from 200 ± 15 Bq.m-2 for South region to 15 ± 2 Bq.m-2 for Northeast region. Moreover, was verified that the Cesium- 137 inventories depend on latitude and altitude of the area. (author)

  3. Vacuum squeezed light for atomic memories at the D2 cesium line

    CERN Document Server

    Burks, Sidney; Giacobino, Elisabeth; Laurat, Julien; Ortalo, Jérémie; Jia, Xiaojun; Villa, Fabrizio; Chuimmo, Antonino

    2008-01-01

    We report the experimental generation of squeezed light at 852 nm, locked on the Cesium D2 line. 50% of noise reduction down to 50 kHz has been obtained with a doubly resonant optical parametric oscillator operating below threshold, using a periodically-polled KTP crystal. This light is directly utilizable with Cesium atomic ensembles for quantum networking applications

  4. Ionizing mechanisms in a cesium plasma irradiated with a ruby laser

    Science.gov (United States)

    Shimada, K.; Robinson, L. B.

    1975-01-01

    A cesium filled diode--laser plasmadynamic converter was built to investigate the feasibility of converting laser energy to electrical energy at large power levels. Experiments were performed with a pulsed ruby laser to determine the quantity of electrons and cesium ions generated per pulse of laser beam and to determine the output voltage. A current density as high as 200 amp/sq cm from a spot of approximately 1 sq mm area and an open circuit voltage as high as 1.5 volts were recorded. A qualitative theory was developed to explain these results. In the operation of the device, the laser beam evaporates some of the cesium and ionizes the cesium gas. A dense cesium plasma is formed to absorb further the laser energy. Results suggest that the simultaneous absorption of two ruby laser photons by the cesium atoms plays an important role in the initial ionization of cesium. Inverse bremsstrahlung absorption appears to be the dominant mechanism in subsequent processes. Recombinations of electrons and cesium ions appear to compete favorably with the simultaneous absorption of two photons.

  5. Peculiarities of presence of cesium-137 in soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    The granulometric composition of soil and the distribution of cesium-137 by soil fractions at the Azgir test site was determined. The characterization of cesium-137 presence in the layer of the thickness of 1 cm of the surface soil was gave. (author)

  6. Velocity Distribution of Effective Atoms in a Small Optically Pumped Cesium Beam Frequency Standard

    Institute of Scientific and Technical Information of China (English)

    CHEN Jingbiao; WANG Fengzhi; YANG Donghai; WANG YiQiu

    2001-01-01

    In this paper, the velocity distribution of effective atoms in a small optically pumped cesium beam frequency standard has been achieved from the Fourier transforms of the experimentally recorded Ramsey patterns. The result fits well with the theoretical calculation. The second order Doppler shift correction of the small cesium atomic clock is obtained from the velocity distribution of effective atoms.

  7. Cesium-134 and cesium-137 in honey bees and cheese samples collected in the U.S. after the Chernobyl accident

    International Nuclear Information System (INIS)

    As a result of the Chernobyl accident on April 25, 1986, possible radioactive contamination of honey bees and cheese sampled in several areas of the United States were measured. Of bees collected in May and June of 1986 in both Oregon and New York, only those from Oregon showed detectable levels of cesium-134 (T1/2 = 2.05 years), a radionuclide which would have originated from the Chernobyl incident. Cheese produced in Oregon and New York before the accident showed only cesium-137 (T1/2 = 30.23 years) but cheese produced afterwards (May and September, 1986) in Oregon contained cesium-134. Cheese produced in Ohio and California at the time of the accident and thereafter contained only cesium-137. In general, the levels of radioactivity were higher in the West coast samples as compared to those taken in the East. The levels of radioactivity detected were considered to be toxicologically of no consequence. (author)

  8. Occupational exposure to xenon-133 among hospital workers

    International Nuclear Information System (INIS)

    During procedures for pulmonary ventilation studies on patients in hospitals, xenon-133 may escape into ambient air. Measurements of air concentrations were required to permit an evaluation of the exposure to which hospital workers are subjected. Two complementary methods of in situ measurements of air concentrations were employed: a commercial air monitor and evacuated blood sampling tubes. Personal dosimeters (TLDs) were exposed simultaneously with the commercial air monitor, and the results were compared. This report presents the results of the measurements of air concentrations during studies on patients. Substantial leakage of xenon-133 was noted, but workers received less than the maximum permissible dose. Personal dosimeters do not permit accurate evaluation of the skin doses resulting from exposure to xenon-133; measurements of air concentrations are required for such evaluation. A number of procedures are recommended to minimize leakage and personnel exposure

  9. Cesium ion exchange using actual waste: Column size considerations

    International Nuclear Information System (INIS)

    It is presently planned to remove cesium from Hanford tank waste supernates and sludge wash solutions using ion exchange. To support the development of a cesium ion exchange process, laboratory experiments produced column breakthrough curves using wastes simulants in 200 mL columns. To verify the validity of the simulant tests, column runs with actual supernatants are being planned. The purpose of these actual waste tests is two-fold. First, the tests will verify that use of the simulant accurately reflects the equilibrium and rate behavior of the resin compared to actual wastes. Batch tests and column tests will be used to compare equilibrium behaviors and rate behaviors, respectively. Second, the tests will assist in clarifying the negative interactions between the actual waste and the ion exchange resin, which cannot be effectively tested with simulant. Such interactions include organic fouling of the resin and salt precipitation in the column. These effects may affect the shape of the column breakthrough curve. The reduction in column size also may change the shape of the curve, making the individual effects even more difficult to sort out. To simplify the evaluation, the changes due to column size must be either understood or eliminated. This report describes the determination of the column size for actual waste testing that best minimizes the effect of scale-down. This evaluation will provide a theoretical basis for the dimensions of the column. Experimental testing is still required before the final decision can be made. This evaluation will be confined to the study of CS-100 and R-F resins with NCAW simulant and to a limited extent DSSF waste simulant. Only the cesium loading phase has been considered

  10. Sorption of iodine, chlorine, technetium and cesium in soil

    International Nuclear Information System (INIS)

    The safety assessment of final disposal of spent nuclear fuel will include an estimate for the behavior of waste nuclides in the biosphere. As a part of this estimate also the sorption of radioactive iodine, chlorine, technetium and cesium in soil is to be considered. The chemistry and the sorption of these radionuclides in soils are described in this literature survey. Behavior of I-129, Cl-36 and Tc-99 in the environment is of great interest because of their long half-lives and relatively high mobilities. The importance of Cs-135 arises from its high content in spent nuclear fuel and long physical half-life, even though it is considered relatively immobile in soil. Factors affecting the migration and sorption of radionuclides in soils can be divided into elemental and soil specific parameters. The most important elemental factor is the speciation of the element, which is influenced by the soil redox potential, pH and complex forming ligands. Soil micro-organisms can either serve as sorbents for radionuclides or affect their speciation by altering the prevailing soil redox conditions. Soil organic matter content and mineral properties have a marked influence on the retention of radionuclides. The sorption of anionic radionuclides such as I-, Cl- and TcO4 - is pronounced in the presence of organic matter. Clay minerals are known to bound cesium effectively. The effect of speciation of radioactive iodine, chlorine, technetium and cesium in soil is considered in this study, as well as the effect of soil micro-organisms, organic matter and mineral properties. (orig.)

  11. Cesium Eluate Evaporation Solubility and Physical Property Behavior

    International Nuclear Information System (INIS)

    The baseline flowsheet for low activity waste (LAW) in the Hanford River Protection Project (RPP) Waste Treatment Plant (WTP) includes pretreatment of supernatant by removing cesium using ion exchange. When the ion exchange column is loaded, the cesium will be eluted with a 0.5M nitric acid (HNO3) solution to allow the column to be conditioned for re-use. The cesium eluate solution will then be concentrated in a vacuum evaporator to minimize storage volume and recycle HNO3. To prevent the formation of solids during storage of the evaporator bottoms, criteria have been set for limiting the concentration of the evaporator product to 80 percent of saturation at 25 degrees C. A fundamental element of predicting evaporator product solubility is to collect data that can be used to estimate key operating parameters. The data must be able to predict evaporator behavior for a range of eluate concentrations that are evaporated to the point of precipitation. Parameters that were selected for modeling include solubility, density, viscosity, thermal conductivity, and heat capacity. Of central importance is identifying the effect of varying feed components on overall solubility. The point of solubility defines the upper limit for eluate evaporation operations and liquid storage. The solubility point also defines those chemical compounds that have the greatest effects on physical properties. Third, solubility behavior identifies intermediate points where physical property data should be measured for the database. Physical property data (density, viscosity, thermal conductivity, and heat capacity) may be an integral part of tracking evaporator operations as they progress toward their end point. Once the data have been collected, statistical design software can develop mathematical equations that estimate solubility and other physical properties

  12. Cesium-137 inventory of the undisturbed soil areas in the Londrina Region, Parana, Brazil

    International Nuclear Information System (INIS)

    Cesium-137 is an artificial radionuclide introduced in the environment through the radioactive fallout of the superficial tests of nuclear weapons. The cesium-137 deposition occurred to middles of the 1980-decade and, due to the Chernobyl accident, great part of Europe had a additional fallout of cesium-137. The contaminations of this accident do not have reached Southern Hemisphere. Cesium-137 is an alkaline metal, high electropositive, that in contact with the soil is strongly adsorbed to the clay in the FES (Frayed Edge Sites) and RES (Regular Edge Sites) positions, and it movement by chemical processes in the soil is insignificant. Because of this, cesium-137 became a good soil marker, and its movement is related to the soil movement particles, so that the cesium-137 have been used in the study of the soil redistribution processes, as a tool of quantifying the rates of soil losses and gain. To use this methodology, it is necessary the knowledge of the reference inventory of cesium-137, that is given as function of the total concentration of cesium-137 deposited in an area by the radioactive fallout. If a sampling point presents less cesium-137 than the reference inventory, this point is considered a point with soil loss; otherwise, the point is considered a point with soil deposition. To evaluate the cesium-137 inventory in the Londrina region, four areas of the undisturbed soil were sampling in grid of 3x3, with a distance of 9 meters among the points. Of these four sampling areas, three areas were of native forest (labeled Mata1, Mata2 and Mata UEL), and one was a pasture area. Cesium-137 inventory was 223 ± 41 Bq m-2, 240 ± 65 Bq m-2 and 305 ± 36 Bq m-2 for Mata UEL, Mata1 and Mata2, respectively, and of 211 ± 28 Bq m-2 for the native pasture. Considering the deviation in each value, it is not possible to conclude that there are differences among the values of cesium-137 inventory, so that the average reference inventory of cesium-137 for the Londrina

  13. Characterization of quantum efficiency and robustness of cesium-based photocathodes

    Science.gov (United States)

    Montgomery, Eric J.

    High quantum efficiency, robust photocathodes produce picosecond-pulsed, high-current electron beams for photoinjection applications like free electron lasers. In photoinjectors, a pulsed drive laser incident on the photocathode causes photoemission of short, dense bunches of electrons, which are then accelerated into a relativistic, high quality beam. Future free electron lasers demand reliable photocathodes with long-lived quantum efficiency at suitable drive laser wavelengths to maintain high current density. But faced with contamination, heating, and ion back-bombardment, the highest efficiency photocathodes find their delicate cesium-based coatings inexorably lost. In answer, the work herein presents careful, focused studies on cesium-based photocathodes, particularly motivated by the cesium dispenser photocathode. This is a novel device comprised of an efficiently photoemissive, cesium-based coating deposited onto a porous sintered tungsten substrate, beneath which is a reservoir of elemental cesium. Under controlled heating cesium diffuses from the reservoir through the porous substrate and across the surface to replace cesium lost to harsh conditions---recently shown to significantly extend the lifetime of cesium-coated metal cathodes. This work first reports experiments on coated metals to validate and refine an advanced theory of photoemission already finding application in beam simulation codes. Second, it describes a new theory of photoemission from much higher quantum efficiency cesium-based semiconductors and verifies its predictions with independent experiment. Third, it investigates causes of cesium loss from both coated metal and semiconductor photocathodes and reports remarkable rejuvenation of full quantum efficiency for contaminated cesium-coated surfaces, affirming the dispenser prescription of cesium resupply. And fourth, it details continued advances in cesium dispenser design with much-improved operating characteristics: lower temperature

  14. Patient derived cell culture and isolation of CD133⁺ putative cancer stem cells from melanoma.

    Science.gov (United States)

    Welte, Yvonne; Davies, Cathrin; Schäfer, Reinhold; Regenbrecht, Christian R A

    2013-01-01

    Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression. Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin. Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133(+) CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133(+) CSCs and CD133(-) bulk, which can be cultivated and functionally analyzed thereafter. PMID:23525090

  15. Characterizing optical dipole trap via fluorescence of trapped cesium atoms

    Institute of Scientific and Technical Information of China (English)

    LIU; Tao; GENG; Tao; YAN; Shubin; LI; Gang; ZHANG; Jing; WANG; Junmin; PENG; Kunchi; ZHANG; Tiancai

    2006-01-01

    Optical dipole trap (ODT) is becoming an important tool of manipulating neutral atoms. In this paper ODT is realized with a far-off resonant laser beam strongly focused in the magneto-optical trap (MOT) of cesium atoms. The light shift is measured by simply monitoring the fluorescence of the atoms in the magneto-optical trap and the optical dipole trap simultaneously. The advantages of our experimental scheme are discussed, and the effect of the beam waist and power on the potential of dipole trap as well as heating rate is analyzed.

  16. Cesium fallout in Norway after the Chernobyl accident

    International Nuclear Information System (INIS)

    Results of country-wide measurements of 137Cs and 134 Cs in soil samples in Norway after the Chernobyl accident are reported. The results clearly demonstrates that municipalities in the central part of southern Norway, Troendelag and the southern part of Nordland, have been rather heavily contaminated. The total fallout of 137Cs and 134Cs from the Chernobyl accident in Norway is estimated to 2300 TBq and 1200 TBq, respectively. This is approximately 6% of the cesium activity released from the reactor

  17. Sensitive Detection of Cold Cesium Molecules by Radiative Feshbach Spectroscopy

    OpenAIRE

    Chin, Cheng; Kerman, Andrew J.; Vuletić, Vladan; Chu, Steven

    2002-01-01

    We observe the dynamic formation of $Cs_2$ molecules near Feshbach resonances in a cold sample of atomic cesium using an external probe beam. This method is 300 times more sensitive than previous atomic collision rate methods, and allows us to detect more than 20 weakly-coupled molecular states, with collisional formation cross sections as small as $\\sigma =3\\times 10^{-16}$cm$^2$. We propose a model to describe the atom-molecule coupling, and estimate that more than $2 \\times 10^5$ $Cs_2$ mo...

  18. Specific heat and thermodynamic properties of the cesium perchlorate

    International Nuclear Information System (INIS)

    The cesium perchlorate specific heat has been measured in a vacuum adiabatic microcalorimeter in the 10-365 K range. On the basis of the data obtained the thermodynamic functions are calculated. Csub(p)sup(0) (298.15 K) = 110.4+-0.2 J/Kxmol; S0 (298.15 K)=175.9+-0.5 J/Kxmol; H0 (298.15 K) - H0(0)=22280+-50 J/mol; - [G0 (289.15 K) - H0(0)]/T = 101.2+-0.2 J/Kxmol

  19. Equilibrium and kinetic studies of the sorption of cesium by potassium nickel hexacyanoferrate complex

    International Nuclear Information System (INIS)

    Sorption of cesium from nitric acid medium by potassium nickel hexacyanoferrate, KNiFC, was investigated using the batch technique. The effect of hydrogen ion concentration on the distribution coefficient of cesium has been studied in the pH range 1-5.5. The effect of particle size, the temperature on the sorption equilibrium and rate of uptake of cesium were investigated. The temperature effect on both sorption equilibrium and rate of uptake was found to be limited. The kinetic study shows that the sorption is controlled by particle diffusion mechanism. The diffusivity of cesium ions into different particle sizes of KNiFC, the activation energy, and the entropy change of the sorption process were calculated. The effect of the presence of cobalt ions on the equilibrium and the rate of uptake of cesium is presented. (author)

  20. Rational Design of Cesium-Selective Ionophores and Chemosensors: Dihydrocalix[4]arene Crown-6 Ethers

    Energy Technology Data Exchange (ETDEWEB)

    Sachleben, Richard A.; Bryan, Jeffrey C.; Brown, Gilbert M.; Engle, Nancy L.; Haverlock, Tamara J.; Hay, Benjamin P.; Urvoas, Agathe; Moyer, Bruce A.

    2003-12-15

    Molecular mechanics calculations performed on calix[4]arene crown-6 ethers predict that the 1,3-dihydro derivatives will exhibit greater complementarity for potassium and cesium ions than the parent 1,3-dialkoxy calix crowns. The X-ray crystal structures of 1,3-alt bis-octyloxycalix[4]arene benzocrown-6 ether, dihydrocalix[4]arene benzocrown-6 ether, and the cesium nitrate complex of dihydrocalix[4]arene benzocrown-6 ether were determined. The cesium complex structure corresponds closely to the structure predicted by molecular mechanics. The dihydrocalix[4]arene crown-6 ethers exhibit enhanced cesium selectivity in the extraction of alkali metal salts and provide a platform for a highly sensitive and selective cesium chemosensor.

  1. Investigation of the behavior during incineration of cesium adsorbed in vegetation waste

    International Nuclear Information System (INIS)

    The decontamination of wood and grass contaminated by radioactive cesium released after a nuclear power plant accident is a significant problem. During this research, the behavior of radioactive cesium during incineration was investigated experimentally. Non-radioactive cesium chloride was adsorbed into sunflower and wood pellet samples, and was burned in a lab-scale fluidized bed combustor. Up to 70% of the cesium was transferred to fly ash, which is captured in the quartz filter of the exhaust line. The concentration of cesium in the fly ash is 10 times greater than in the bottom ash, as the amount of fly ash makes up approximately 20% of the entire ash content. Careful management is vital when handling and disposing of fly ash generated from the incineration of vegetation waste. (author)

  2. Preliminary application of dynamic pulmonary xenon-133 single-photon emission tomography in the evaluation of patients with pulmonary emphysema for thoracoscopic lung volume reduction surgery

    Energy Technology Data Exchange (ETDEWEB)

    Suga, Kazuyoshi; Nishigauchi, Kazuya; Matsunaga, Naofumi; Matsumoto, Tsuneo; Kume, Norihiko [Univ. School of Medicine, Yamaguchi (Japan). Dept. of Radiol.; Sugi, Kazuro; Esato, Kensuke [First Department of Surgery, Yamaguchi University School of Medicine, Ube, Yamaguchi (Japan)

    1998-04-01

    Dynamic pulmonary xenon-133 single-photon emission tomography (SPET) with three-dimensional (3D) displays was preliminarily applied to select resection targets for thoracoscopic lung volume reduction surgery (LVRS) and to assess regional ventilatory changes following surgery. Dynamic SPET was performed using a triple-detector SPET system in 14 patients with pulmonary emphysema before and after LVRS. After reconstructing colour-illuminated, surface-rendered 3D images of equilibrium (EQ) and 3-min washout (WO{sub 3}), a single 3D fusion display was created from these two different time-course image sets, in which the 3D WO{sub 3} image indicating {sup 133}Xe retention was visible through the overlying 3D EQ image delineating lung contours. Volumetric extent of retention on this display was quantified by a {sup 133}Xe retention index, defined as the ratio (%) of total pixel numbers of segmented 3-min WO data to those of EQ data. {sup 133}Xe SPET and appropriately thresholded 3D displays efficiently localized a total of 36 retention sites; 19 (52.7%) of these sites were not localized by CT because they were within the widely or homogeneously spreading non-bullous emphysematous lung tissues. The 3D displays enhanced the perception of anatomical configurations and the extent of {sup 133}Xe retention compared with multislice tomograms. Postoperatively, 3D fusion display visualized the details of regional changes in retention, and changes in the retention index on the 3D display with a standardized threshold correlated well with changes in {sup 133}Xe clearance time (T{sub 1/2}) and %FEV{sub 1} (r = 0.881 and 0.856, respectively; P<0.0001). This preliminary study indicates that {sup 133}Xe SPET and appropriately thresholded, topographic 3D displays are of potential use in selecting resection targets for LVRS, and in evaluating the treatment effects on regional ventilation. (orig.) With 4 figs., 1 tab., 32 refs.

  3. Preliminary application of dynamic pulmonary xenon-133 single-photon emission tomography in the evaluation of patients with pulmonary emphysema for thoracoscopic lung volume reduction surgery

    International Nuclear Information System (INIS)

    Dynamic pulmonary xenon-133 single-photon emission tomography (SPET) with three-dimensional (3D) displays was preliminarily applied to select resection targets for thoracoscopic lung volume reduction surgery (LVRS) and to assess regional ventilatory changes following surgery. Dynamic SPET was performed using a triple-detector SPET system in 14 patients with pulmonary emphysema before and after LVRS. After reconstructing colour-illuminated, surface-rendered 3D images of equilibrium (EQ) and 3-min washout (WO3), a single 3D fusion display was created from these two different time-course image sets, in which the 3D WO3 image indicating 133Xe retention was visible through the overlying 3D EQ image delineating lung contours. Volumetric extent of retention on this display was quantified by a 133Xe retention index, defined as the ratio (%) of total pixel numbers of segmented 3-min WO data to those of EQ data. 133Xe SPET and appropriately thresholded 3D displays efficiently localized a total of 36 retention sites; 19 (52.7%) of these sites were not localized by CT because they were within the widely or homogeneously spreading non-bullous emphysematous lung tissues. The 3D displays enhanced the perception of anatomical configurations and the extent of 133Xe retention compared with multislice tomograms. Postoperatively, 3D fusion display visualized the details of regional changes in retention, and changes in the retention index on the 3D display with a standardized threshold correlated well with changes in 133Xe clearance time (T1/2) and %FEV1 (r = 0.881 and 0.856, respectively; P133Xe SPET and appropriately thresholded, topographic 3D displays are of potential use in selecting resection targets for LVRS, and in evaluating the treatment effects on regional ventilation. (orig.)

  4. Photo-association of cold cesium atoms. Formation and characterisation of a cold cloud of diatomic cesium molecules

    International Nuclear Information System (INIS)

    In a photo-association process, two colliding cold cesium atoms absorb one photon to form an ultracold molecule, electronically excited in a well defined ro-vibration level. Because of the small initial kinetic energy of the free atoms, the photo-association is resonant and permits high resolution spectroscopy of long-range states. We report spectra for states correlated to the excited limit 6S+6P. The 1u (6S+6P3/2) state is a pure long-range molecules. It hardly consists in a molecule, but rather in a pair of two atoms linked at 1, 5 nm by the multipolar electrostatic interaction. The intensity modulation of spectral lines for a given vibrational progression reflects the nodal structure of the radial s-wave function of two ground state atoms. The photo-association of the state 0g-(6S +6P3/2) of polarized atoms permits determining the scattering length of the triplet state of cesium (aT = -530 a0) and the Van der Waals parameter of the molecular ground state (C6 = 6510 u.a.). Photo-association of cold cesium atoms also leads to the formation of translationally cold molecules in singlet and triplet fundamental states after spontaneous emission of the excited molecules. Various schemes are characterized. The particular double-well shape of 0g-(6S+6P3/2) and 1u(6S+6P3/2) states creates a Condon point at intermediate distance. These states constitute ideal cases for very efficient formation of cold molecules. The cold molecular cloud is analyzed: temperatures as low as 20 micro-Kelvin are measured and the distribution of the ro-vibrational levels is studied. The efficiencies of the photo-association process and of the formation of cold molecules are measured, and compared with theoretical calculations. (author)

  5. Transportable cesium irradiator (TPCI): Final safety analysis report: Revision 1

    International Nuclear Information System (INIS)

    This Final Safety Analysis Report describes the Transportable Cesium Irradiator (TPCI) and assesses the hazards associated with its operation. The TPCI consists of a mobile, lead-shielded, irradiation unit with support equipment mounted within an enclosed trailer. The irradiation unit has two basic compartments; a source chamber sized to mate with the transportation cask which houses the source capsules, and an irradiation chamber formed as a large shielded cylinder (drum) with a window. The irradiation chamber is mounted on a large diameter support bearing. As this chamber is rotated its window moves from the product access door, where produce is inserted or extracted, to a position in line with a similar window in the source chamber. When the windows are aligned the produce is irradiated, while the back wall of the irradiation chamber shields the product access door. The TPCI is designed to be transported throughout the continental United States. The transportation cask containing the cesium source capsules is transported separately from the irradiation unit and is installed when the TPCI unit has been readied for operation at a particular site. The transportation cask is a separate unit and is documented in a separate FSAR

  6. Morphological and electrical properties of zirconium vanadate doped with cesium

    Directory of Open Access Journals (Sweden)

    Marwa F. Elkady

    2014-09-01

    Full Text Available Cesium doped zirconium vanadate ZrV2O7 with different Cs dopant content (Cs/Zr varied from 0 to 0.5 in weight ratio were fabricated by hydrothermal technique at 120 °C for 60 min. The synthesized materials are thermally treated using microwave technique. The structural and morphological properties of the synthesized materials and thermally treated samples were investigated using XRD and SEM respectively. It was evident that all synthesized specimens have cubic phase structural without any extra phase but after heat treatment Orthorhombic phase appear with doped samples. However, the morphological structure of the doped synthesized materials has transferred from nanoparticles into rods aspect with heat treatment for the different dopant ratio. Moreover, the electrical properties of both the synthesized and thermally treated materials are studied by AC impedance measurements. The results indicated that the ionic conductivity of Cs-doped ZrV2O7 materials decreased by increasing the dopant ratio while that thermally treated samples the ionic conductivity increase by increasing the dopant ratio. Finally, the concentration of cesium dopants is found to play crucial role in tuning the morphology and electrical properties of nanostructures.

  7. A study of strontium and cesium sorption on granite

    International Nuclear Information System (INIS)

    The diffusion and sorption of cesium and strontium in crushed granite particles is discussed. Sorption experiments have been performed with one granite from Finnsjoen outside Forsmark on the east coast of Sweden and one granite from the Stripa mine in central Sweden. Granite samples have been crushed and screened, and six different particle size fractions from 0.10-0.12 mm to 4-5 mm of each rock have been used in the experiments. The initial concentrations of inactive cesium and strontium were 10-15 ppm. The experimental data indicate that the amount of sorption is dependent not only on the mass of granite particles, but also to some extent on the size of the particles. An attempt has been made to distinguish between sorption on external surfaces and inner surfaces. The amount of external surface adsorption was found to vary from 15-40 % of the total adsorption capacity for the particle size fraction 0.10-0.12 mm to a few percent or less for the largest particles used. (Auth.)

  8. Kelvin probe studies of cesium telluride photocathode for AWA photoinjector

    International Nuclear Information System (INIS)

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (≈50nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating. -- Highlights: ► The correlation between Quantum Efficiency (QE) and work function. ► How QE and work function evolve together. ► Rejuvenation of the photocathode via heating and the effect on work function. ► The effects on the work function due to exposure to UV light

  9. Radiation doses resulting from incorporated radioactive cesium isotopes

    International Nuclear Information System (INIS)

    Age-dependent dose factors are given for inhaled or ingested cesium isotopes, which have been calculated on the basis of published data on the biokinetics of cesium in the human organism. Tabulated data are presented for Cs-129, Cs-130, Cs-131, Cs-132, Cs-134, Cs-135, Cs-136, Cs-137(+Ba-137m), and Cs-138. Comparison of results obtained for adults with relevant data published by the ICRP (1978), the NCRP (1977), and Schwarz (1982) shows very good agreement. More significant deviations are however found when comparing the results with data given in the Federal German Radiation Protection Ordinance, both with regard to adults and to infants, particularly refering to the lung data and to those for the gastro-intestinal tract and the skeleton. These discrepancies are primarily due to improved models developed since the time the Radiation Protection Ordinance has been issued, (respiratory and gastro-intestinal tracts), and to improvements achieved with the dosimetric concepts (calculation of dose for bone surfaces instead of the whole skeleton). The dose factors for newborn given by the publication in hand are significantly lower than those given in the Ordinance (for infants); this is a result of age-dependent retention functions having been considered for this publication. The reliability of the dose factor calculations for various ages, pregnant women and fetuses is discussed and quantified. (orig./HP)

  10. Kelvin probe studies of cesium telluride photocathode for AWA photoinjector

    Energy Technology Data Exchange (ETDEWEB)

    Wisniewski, Eric E., E-mail: ewisniew@anl.gov [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Velazquez, Daniel [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Yusof, Zikri, E-mail: zyusof@hawk.iit.edu [High Energy Physics Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States); Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Spentzouris, Linda; Terry, Jeff [Physics Department, Illinois Institute of Technology, 3300 South Federal Street, Chicago, IL 60616 (United States); Sarkar, Tapash J. [Rice University, 6100 Main, Houston, TX 77005 (United States); Harkay, Katherine [Accelerator Science Division, Argonne National Laboratory, 9700 S. Cass, Lemont, IL 60439 (United States)

    2013-05-21

    Cesium telluride is an important photocathode as an electron source for particle accelerators. It has a relatively high quantum efficiency (>1%), is sufficiently robust in a photoinjector, and has a long lifetime. This photocathode is grown in-house for a new Argonne Wakefield Accelerator (AWA) beamline to produce high charge per bunch (≈50nC) in a long bunch train. Here, we present a study of the work function of cesium telluride photocathode using the Kelvin probe technique. The study includes an investigation of the correlation between the quantum efficiency and the work function, the effect of photocathode aging, the effect of UV exposure on the work function, and the evolution of the work function during and after photocathode rejuvenation via heating. -- Highlights: ► The correlation between Quantum Efficiency (QE) and work function. ► How QE and work function evolve together. ► Rejuvenation of the photocathode via heating and the effect on work function. ► The effects on the work function due to exposure to UV light.

  11. Studies on cesium sorption in hydrous zirconium and titanium oxides

    International Nuclear Information System (INIS)

    Significant quantities of 137Cs (T1/2 = 30.1 y) and 90Sr (T1/2 = 28.5 y) are produced as fission products in nuclear reactors. These long-lived gamma-emitting radionuclides, regarded as a waste few decades ago, are being termed now as valuables owing to the upsurge in the utilization of these radioisotopes in the area of medicine, food irradiation, and sewage treatment technologies in recent years. For long-term waste management it is necessary to minimize the volume and toxicity of the waste. Selective recovery and utilization of these radionuclides from the waste is the concept of growing interest to many researchers. Inorganic sorbents are proven candidates for the separation and recovery of cesium and strontium from aqueous waste streams. They are chemically durable and stable against ionizing radiation. In addition, these materials can be converted into unleachable ceramic form for final disposal. Hydrous metal oxides belong to a particular class of inorganic ion exchangers extensively investigated for various applications in nuclear waste treatment. The present study deals with the preparation of hydrous zirconium and titanium oxide and the studies aimed at separation of cesium from aqueous wastes

  12. Spectrally selective optical pumping in Doppler-broadened cesium atoms

    Institute of Scientific and Technical Information of China (English)

    Zhang Jun-Hai; Zeng Xian-Jin; Li Qing-Meng; Huang Qiang; Sun Wei-Min

    2013-01-01

    The D1 line spectrally selective pumping process in Doppler-broadened cesium is analyzed by solving the optical Bloch equations.The process,described by a three-level model with the A scheme,shows that the saturation intensity of broadened atoms is three orders of magnitude larger than that of resting atoms.The |Fg =3> → |Fe-4> resonance pumping can result in the ground state |Fg =4,mF =4> sublevel having a maximum population of 0.157 and the population difference would be about 0.01 in two adjacent magnetic sublevels of the hyperfine (HF) state Fg =4.To enhance the anisotropy in the ground state,we suggest employing dichromatic optical HF pumping by adding a laser to excite D1 line |Fg =4> → |Fe =3>transition,in which the cesium magnetometer sensitivity increases by half a magnitude and is unaffected by the nonlinear Zeeman effect even in Earth's average magnetic field.

  13. Diffusion of strontium, technetium, iodine and cesium in granitic rock

    International Nuclear Information System (INIS)

    The migration of strontium, technetium, iodine and cesium in granitic rock has been studied. Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at trace levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the diffusion into the rock were studied by an autoradiographic technique. The cationic strontium and cesium have apparent diffusivities of 10-13 - 10-14 m2/s. The migration is confined to microfissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with high capacity minerals (e.g. biotite). The anionic iodine and technetium have apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. (orig.)

  14. Mobility of radioactive cesium in soil originated from the Fukushima Daiichi nuclear disaster. Application of extraction experiments

    International Nuclear Information System (INIS)

    Extraction experiments on soil radioactively contaminated by the Fukushima Daiichi Nuclear Power Plant accident were conducted by using a variety of extractants to acquire knowledge on the mobility of radioactive cesium in soil. The experimental results revealed that cesium is tightly bound with soil particles and that radioactive cesium newly deposited on soil due to the accident had apparently a higher mobility than stable cesium commonly existing in soil. The results suggested that radioactive cesium deposited on soil hardly migrates via aqueous processes, although chemical and mineralogical conditions of soil affect their mobility. (author)

  15. Thermoemission and adsorption properties of diborides of transition metals of IV-V groups in cesium vapours

    International Nuclear Information System (INIS)

    Emission and adsorption properties of titanium, zirconium, hafnium, vanadium diborides were studied in vacuum and cesium vapours. Some regularities were established in changes of thermoemission properties in transition from one boride to another. Under pressures p0K interaction of these diborides with cesium plasma is of adsorption character. Evaluation of absorption properties for the diborides in cesium vapours showed for oprimal surface coating with cesium the adsorption energy for cesium ions is qsub(a)=(1.1/1.3) eV and work function is phi sub(min)=(1.25/1.45) eV

  16. {sup 133}Xenon study in various pulmonary diseases

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Q.C.; Mori, Yutaka; Uchiyama, Masayuki; Kawakami, Kenji [Jikei Univ., Tokyo (Japan). School of Medicine; Tominaga, Shigeru

    1997-08-01

    An aim of this study is to evaluate the role of {sup 133}Xe examination for patients with various pulmonary diseases (diffuse pan bronchiolitis and bronchiectasis end so on were included) whose pulmonary function was within normal limits. Subjects consist of 21 cases (9 cases of chronic bronchitis, 3 cases of lower respiratory infectious disease were contained; 5 of bronchiectasis, 1 case of lower respiratory infectious disease were contained; 3 of diffuse pan bronchiolitis; 1 case of pulmonary emphysema; 2 cases of sequestration of the lung; 1 case of bacterial pneumonia). These patients were treated by Levofloxacin (200-300 mg/day) from 2-6 months and Ofloxacin (300 mg/day) from 3-6 months. Ventilation scintigraphy was performed with {sup 133}Xe before and after therapy. Chest X-P, CT imaging, pulmonary function test and blood gas analysis were examined at the same period. All cases showed abnormal regions of ventilation before therapy, although results of pulmonary function test and blood gas analysis were within normal ranges. Abnormal areas of ventilation were improved by therapy in all cases, but most of the patients still showed abnormal retention of {sup 133}Xe. This finding suggests that it is necessary to continue the treatment. As conclusion, {sup 133}Xe is useful to evaluate an indication of treatment for various pulmonary diseases. (author)

  17. 27 CFR 31.133 - Change in management.

    Science.gov (United States)

    2010-04-01

    ... controlling the management policies or buying or selling practices of the business pertaining to alcohol... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Change in management. 31... § 31.133 Change in management. A change in management that involves no change in ownership of...

  18. 21 CFR 133.155 - Mozzarella cheese and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... defined in § 133.3, or the corresponding products of water buffalo origin, except that cow's milk products are not combined with water buffalo products. (2) Clotting enzymes. Rennet and/or other clotting... buffalo milk, the name of the food is accompanied by the phrase “made with water buffalo milk”. (d)...

  19. 19 CFR 133.42 - Infringing copies or phonorecords.

    Science.gov (United States)

    2010-04-01

    ... other use in pursuit of a related private civil remedy for copyright infringement. To obtain a sample..., testing, or other use in pursuit of a related private civil remedy for copyright infringement. In the... pursuant to 19 CFR 133.42(e) was (damaged/destroyed/lost) during examination, testing, or other use.”...

  20. Investigation of positive parity degenerate dipole bands in 133Ce

    International Nuclear Information System (INIS)

    A pair of dipole bands B2 and B3 have been identified with same parity in 133Ce. To study the decay properties of these bands and measure their electromagnetic transition strengths, an experiment was carried out to collect high statistics and high fold γ-coincidence data

  1. 49 CFR 237.133 - Supervision of repairs and modifications.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Supervision of repairs and modifications. 237.133... Supervision of repairs and modifications. Each repair or modification pursuant to this part shall be performed under the immediate supervision of a railroad bridge supervisor as defined in § 237.55 of this part...

  2. 40 CFR 35.133 - Programs eligible for inclusion.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Programs eligible for inclusion. 35.133... Programs eligible for inclusion. (a) Eligible programs. Except as provided in paragraph (b) of this section, the environmental programs eligible, in accordance with appropriation acts, for inclusion in...

  3. 40 CFR 61.133 - Standard: Light-oil sumps.

    Science.gov (United States)

    2010-07-01

    ... Emissions from Coke By-Product Recovery Plants § 61.133 Standard: Light-oil sumps. (a) Each owner or... detectable emissions, using Method 21 (40 CFR part 60, appendix A) and the procedures specified in § 61.245(c... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard: Light-oil sumps....

  4. 50 CFR 600.133 - Scientific and Statistical Committee (SSC).

    Science.gov (United States)

    2010-10-01

    ... Fishery Management Councils § 600.133 Scientific and Statistical Committee (SSC). (a) Each Council shall...) Each SSC shall provide its Council ongoing scientific advice for fishery management decisions... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Scientific and Statistical Committee...

  5. 41 CFR 105-53.133 - Information Security Oversight Office.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Security... FUNCTIONS Central Offices § 105-53.133 Information Security Oversight Office. (a) Creation and authority. The Information Security Oversight Office (ISOO), headed by the Director of ISOO, who is appointed...

  6. 40 CFR 180.133 - Lindane; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Lindane; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.133 Lindane; tolerances for residues. (a) General. Tolerances are established for residues of the...

  7. Biology and clinical implications of CD133+ liver cancer stem cells

    International Nuclear Information System (INIS)

    Hepatocellular carcinoma (HCC) is the most common primary malignant tumor of the liver, accounting for 80%–90% of all liver cancers. The disease ranks as the fifth most common cancer worldwide and is the third leading cause of all cancer-associated deaths. Although advances in HCC detection and treatment have increased the likelihood of a cure at early stages of the disease, HCC remains largely incurable because of late presentation and tumor recurrence. Only 25% of HCC patients are deemed suitable for curative treatment, with the overall survival at just a few months for inoperable patients. Apart from surgical resection, loco-regional ablation and liver transplantation, current treatment protocols include conventional cytotoxic chemotherapy. But due to the highly resistant nature of the disease, the efficacy of the latter regimen is limited. The recent emergence of the cancer stem cell (CSC) concept lends insight into the explanation of why treatment with chemotherapy often may seem to be initially successful but results in not only a failure to eradicate the tumor but also possibly tumor relapse. Commonly used anti-cancer drugs in HCC work by targeting the rapidly proliferating and differentiated liver cancer cells that constitute the bulk of the tumor. However, a subset of CSCs exists within the tumor, which are more resistant and are able to survive and maintain residence after treatment, thus, growing and self-renewing to generate the development and spread of recurrent tumors in HCC. In the past few years, compelling evidence has emerged in support of the hierarchic CSC model for solid tumors, including HCC. And in particular, CD133 has drawn significant attention as a critical liver CSC marker. Understanding the characteristics and function of CD133+ liver CSCs has also shed light on HCC management and treatment, including the implications for prognosis, prediction and treatment resistance. In this review, a detailed summary of the recent progress in CD

  8. Fast concentration of dissolved forms of cesium radioisotopes from large seawater samples

    International Nuclear Information System (INIS)

    The method developed for cesium concentration from large freshwater samples was tested and adapted for analysis of cesium radionuclides in seawater. Concentration of dissolved forms of cesium in large seawater samples (about 100 L) was performed using composite absorbers AMP-PAN and KNiFC-PAN with ammonium molybdophosphate and potassium–nickel hexacyanoferrate(II) as active components, respectively, and polyacrylonitrile as a binding polymer. A specially designed chromatography column with bed volume (BV) 25 mL allowed fast flow rates of seawater (up to 1,200 BV h-1). The recovery yields were determined by ICP-MS analysis of stable cesium added to seawater sample. Both absorbers proved usability for cesium concentration from large seawater samples. KNiFC-PAN material was slightly more effective in cesium concentration from acidified seawater (recovery yield around 93 % for 700 BV h-1). This material showed similar efficiency in cesium concentration also from natural seawater. The activity concentrations of 137Cs determined in seawater from the central Pacific Ocean were 1.5 ± 0.1 and 1.4 ± 0.1 Bq m-3 for an offshore (January 2012) and a coastal (February 2012) locality, respectively, 134Cs activities were below detection limit (-3). (author)

  9. Development of cesium trapper and single-gas-bubble injector into sodium pool

    International Nuclear Information System (INIS)

    On the core disruptive accident in the sodium cooled fast breeder reactor, in fuel pins the cesium fission product with a high hazard is transferred to the sodium coolant together with noble gas including fission product, and the cesium accumulates on the cover gas area because of its low migration rate to sodium. The high temperature and high pressure in the cover gas due to the decay heat of fission products including cesium cause the leakage of cesium to the outside of reactor vessel. However the exact migration rate of cesium to sodium has not been reported because of difficulty on the evaluation of the interfacial area of large gas bubble (Minges et al., 1986). In this study, we developed a cesium trapper composed of β”-alumina cylindrical container and a single-gas-bubble injector without wettability. We confirmed that a single argon gas bubble was steadily produced in our injector. Bhaga proposed the bubble shape region map, which correlates the bubble shape with Reynolds number, Eotvos number and Morton number of the bubble ejected into sodium pool. The bubble shapes were estimated to be always ellipsoidal. We could successfully confirmed that the liquid sodium can be separated from liquid sodium cesium mixture by using β”-alumina, whose separation rate was found to be calculated by the Faraday's law of electrolysis. (author)

  10. Cesium-plasma-conductivity enhancement in the advanced thermionic energy converter. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Manikopoulos, C.N.

    Two methods of plasma conductivity enhancement in a cesium vapor thermionic energy converter have been studied. The first involved resonance photoabsorption of several cesium lines and the second utilized cesium plasma sustenance by application of microwave power. An extensive study of ionization processes in a cesium discharge in the presence of resonance ionization was made. Calculations were made of expected percentage excitation levels for several cesium resonance transitions for different values of neutral density and temperature as well as incident radiation power levels. The results of some of these computations were tabulated. Several ionization schemes were considered. A number of cesium transitions were investigated in the range of 799 to 870 nanometers for four different cesium reservoir temperatures, 467, 511, 550 and 591 K. The related absorption coefficients of the radiation lines in the plasma were deduced and tabulated. The resulting plasma conductivity increase was recorded and the associated ionization enhancement was deduced. A microwave cavity was built where the emitter and collector of a simple thermionic converter made up two of the cavity walls and resonant microwave power was externally applied. The I-V characteristics of the thermionic converter were studied under several microwave power levels in the range of 0 to 2 watts. Significant shifts to higher currents were observed as the microwave power levels were raised. In conclusion, both methods show promise as auxiliary ionization mechanisms for the thermionic energy converter, especially at low emitter temperatures.

  11. Cesium-plasma-conductivity enhancement in the advanced thermionic energy converter. Final report

    International Nuclear Information System (INIS)

    Two methods of plasma conductivity enhancement in a cesium vapor thermionic energy converter have been studied. The first involved resonance photoabsorption of several cesium lines and the second utilized cesium plasma sustenance by application of microwave power. An extensive study of ionization processes in a cesium discharge in the presence of resonance ionization was made. Calculations were made of expected percentage excitation levels for several cesium resonance transitions for different values of neutral density and temperature as well as incident radiation power levels. The results of some of these computations were tabulated. Several ionization schemes were considered. A number of cesium transitions were investigated in the range of 799 to 870 nanometers for four different cesium reservoir temperatures, 467, 511, 550 and 591 K. The related absorption coefficients of the radiation lines in the plasma were deduced and tabulated. The resulting plasma conductivity increase was recorded and the associated ionization enhancement was deduced. A microwave cavity was built where the emitter and collector of a simple thermionic converter made up two of the cavity walls and resonant microwave power was externally applied. The I-V characteristics of the thermionic converter were studied under several microwave power levels in the range of 0 to 2 watts. Significant shifts to higher currents were observed as the microwave power levels were raised. In conclusion, both methods show promise as auxiliary ionization mechanisms for the thermionic energy converter, especially at low emitter temperatures

  12. Equilibrium, kinetic and thermodynamic study of cesium adsorption onto nanocrystalline mordenite from high-salt solution.

    Science.gov (United States)

    Lee, Keun-Young; Park, Minsung; Kim, Jimin; Oh, Maengkyo; Lee, Eil-Hee; Kim, Kwang-Wook; Chung, Dong-Yong; Moon, Jei-Kwon

    2016-05-01

    In this study, the equilibrium, kinetics and thermodynamics of cesium adsorption by nanocrystalline mordenite were investigated under cesium contamination with high-salt solution, simulating the case of an operation and decommissioning of nuclear facilities or an accident during the processes. The adsorption rate constants were determined using a pseudo second-order kinetic model. The kinetic results strongly demonstrated that the cesium adsorption rate of nano mordenite is extremely fast, even in a high-salt solution, and much faster than that of micro mordenite. In the equilibrium study, the Langmuir isotherm model fit the cesium adsorption data of nano mordenite better than the Freundlich model, which suggests that cesium adsorption onto nano mordenite is a monolayer homogeneous adsorption process. The obtained thermodynamic parameters indicated that the adsorption involved a very stable chemical reaction. In particular, the combination of rapid particle dispersion and rapid cesium adsorption of the nano mordenite in the solution resulted in a rapid and effective process for cesium removal without stirring, which may offer great advantages for low energy consumption and simple operation. PMID:26683820

  13. Vitrification of spent organic ion exchange resins- 137Cesium volatility during oxidation

    International Nuclear Information System (INIS)

    Organic ion exchange (IX) resins are used to purify coolant water in nuclear power plants. The spent IX resins contain 137Cesium as major long-lived radioisotope. Their vitrification requires complete combustion of organic matter. 137Cesium volatility during their oxidation is most important factor for selection of oxidation procedure. Based on TGA studies, copper and vanadate catalysts were selected respectively for cationic and anionic IX resins to oxidise them at 500-700 degC. Experiments were conducted with 137Cesium and catalyst loaded cationic and anionic resins. About 56 to 60% 137Cesium was released from cationic resins in 3 hours. 137Cesium release from cationic resins could be brought down to 19 to 22% by addition of glass formers. The 137Cesium releases from anionic resins were nearly same for 2 hours heating. In absence of glass formers, the catalyst on anionic resins formed molten mass, which was difficult to remove. Experiment with one litre of 137Cesiuin loaded mixed cationic and anionic resins released 16.8% 137Cesium to off gases and formed a slag having specific gravity of 1.73 due to difficulty in oxidising last traces of carbon. The volume reduction factor achieved was 18.2 as against 68 expected for complete oxidation of IX resins. The higher volume reduction factor can be achieved by using improved oxidation procedure in scaling up studies. (author)

  14. Factors affecting the sorption of cesium in a nutrient-poor boreal bog

    International Nuclear Information System (INIS)

    135Cs is among the most important radionuclides in the long-term safety assessments of spent nuclear fuel, due to its long half-life of 2.3 My and large inventory in spent nuclear fuel. Batch sorption experiments were conducted to evaluate the sorption behavior of radiocesium (134Cs) in the surface moss, peat, gyttja, and clay layers of 7-m-deep profiles taken from a nutrient-poor boreal bog. The batch distribution coefficient (Kd) values of radiocesium increased as a function of sampling depth. The highest Kd values, with a geometric mean of 3200 L/kg dry weight (DW), were observed in the bottom clay layer and the lowest in the 0.5–1.0 m peat layer (50 L/kg DW). The maximum sorption in all studied layers was observed at a pH between 7 and 9.5. The in situ Kd values of 133Cs in surface Sphagnum moss, peat and gyttja samples were one order of magnitude higher than the Kd values obtained using the batch method. The highest in situ Kd values (9040 L/kg DW) were recorded for the surface moss layer. The sterilization of fresh surface moss, peat, gyttja and clay samples decreased the sorption of radiocesium by 38%, although the difference was not statistically significant. However, bacteria belonging to the genera Pseudomonas, Paenibacillus, Rhodococcus and Burkholderia isolated from the bog were found to remove radiocesium from the solution under laboratory conditions. The highest biosorption was observed for Paenibacillus sp. V0-1-LW and Pseudomonas sp. PS-0-L isolates. When isolated bacteria were added to sterilized bog samples, the removal of radiocesium from the solution increased by an average of 50% compared to the removal recorded for pure sterilized peat. Our results demonstrate that the sorption of radiocesium in the bog environment is dependent on pH and the type of the bog layer and that common environmental bacteria prevailing in the bog can remove cesium from the solution phase. - Highlights: • pH and the type of the bog layer affect the sorption

  15. CD133 does not enrich for the stem cell activity in vivo in adult mouse prostates

    Directory of Open Access Journals (Sweden)

    Xing Wei

    2016-05-01

    Full Text Available CD133 is widely used as a marker for stem/progenitor cells in many organ systems. Previous studies using in vitro stem cell assays have suggested that the CD133-expressing prostate basal cells may serve as the putative prostate stem cells. However, the precise localization of the CD133-expressing cells and their contributions to adult murine prostate homeostasis in vivo remain undetermined. We show that loss of function of CD133 does not impair murine prostate morphogenesis, homeostasis and regeneration, implying a dispensable role for CD133 in prostate stem cell function. Using a CD133-CreERT2 model in conjunction with a fluorescent report line, we show that CD133 is not only expressed in a fraction of prostate basal cells, but also in some luminal cells and stromal cells. CD133+ basal cells possess higher in vitro sphere-forming activities than CD133− basal cells. However, the in vivo lineage tracing study reveals that the two cell populations possess the same regenerative capacity and contribute equally to the maintenance of the basal cell lineage. Similarly, CD133+ and CD133− luminal cells are functionally equivalent in maintaining the luminal cell lineage. Collectively, our study demonstrates that CD133 does not enrich for the stem cell activity in vivo in adult murine prostate. This study does not contradict previous reports showing CD133+ cells as prostate stem cells in vitro. Instead, it highlights a substantial impact of biological contexts on cellular behaviors.

  16. A New Pumping-Probing Scheme for the Optically Pumped Cesium Beam Frequency Standard

    Institute of Scientific and Technical Information of China (English)

    陈景标; 朱程锦; 王凤芝; 杨东海

    2001-01-01

    A new pumping-probing scheme for the optically pumped cesium beam frequency standard has been experimentally tested in our laboratory. The stability of the optically pumped cesium beam frequency standard was measured by comparing its 10 MHz output with an HP5071A commercial cesium atomic clock. The result shows that the frequency stability for the 1 s and 30000s sample times are 1.2 × 10-11 and 3.7 × 10-13, respectively. It was proved that the new pumping scheme works well.

  17. A new ion exchanger for the removal of cesium from aqueous solutions

    International Nuclear Information System (INIS)

    A new exchange potassium copper nickel hexacyanoferrates(II) was prepared. It was characterized by chemical composition and surface area measurements. The removal of cesium from aqueous solution by ion exchange was studied as function of shaking time. pH and concentration of acids, salts and cesium. The data indicates high value of distribution coefficient over a wide range of pH, nitric and hydrochloric acids concentration and in the presence of higher concentration of Na and K ions. A potassium copper nickel hexacyanoferrate(II) column was also tested for elution of cesium using 8 M ammonium nitrate solution. (author)

  18. Cesium leaching from {gamma}-irradiated CsA and CsX zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Enrique [Universidad Autonoma Metropolitana, Iztapalapa, A. P. 55-532, Av. San Rafael Atlixco No. 186 Col. Vicentina, 09340 Mexico, D.F. (Mexico)], E-mail: lima@xanum.uam.mx; Ibarra, Ilich A.; Lara, Victor [Universidad Autonoma Metropolitana, Iztapalapa, A. P. 55-532, Av. San Rafael Atlixco No. 186 Col. Vicentina, 09340 Mexico, D.F. (Mexico); Bosch, Pedro [Instituto de Investigaciones en Materiales, A. P. 70-360, Universidad Nacional Autonoma de Mexico, Circuito Exterior, Ciudad Universitaria, 04510 Mexico, D.F. (Mexico); Bulbulian, Silvia [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, Col. Escandon, Delegacion Miguel Hidalgo, 11801 Mexico, D.F. (Mexico)

    2008-12-30

    The present study discusses the effect of {gamma}-irradiation on Cs{sup +}-exchanged X and A zeolites. The incorporation of Cs{sup +} ions into A and X zeolites was performed using three different cesium salts (chloride, nitrate or acetate). Cs{sup +} ions immobilized into the vitrified zeolites by thermal treatment are located in different sites of the zeolite networks. It is found that {gamma}-irradiation favors cesium retention depending on the cesium precursor salt used in the cationic exchange step.

  19. Specific interaction of cesium with the surface of calcium silicate hydrates

    International Nuclear Information System (INIS)

    The sorption of cesium at the calcium silicate hydrates (CSH) surface was investigated, both through sorption isotherm data and by solid-state NMR experiments. The sorption ability of CSH towards cesium is favored for low solid Ca/Si molar ratios, in agreement with the negative surface charge they develop then. A significant proportion of these sorbed cesium cations remains tightly bound to the surface sites forming, in dehydrated CSH, inner-sphere complexes, which can not be removed by alcohol washing. Chloride seems to present a lower affinity for CSH, even for high Ca/Si molar ratios, where the surface charge becomes positive. (orig.)

  20. First-principles study of cesium adsorption to weathered micaceous clay minerals

    Science.gov (United States)

    Okumura, Masahiko; Nakamura, Hiroki; Machida, Masahiko

    2014-05-01

    A large amount of radioactive nuclides was produced into environment due to the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident. Residents near FDNPP were suffering from radioactive cesium and then evacuated, because which has long half-life and is retained by surface soil for long time. The Japanese government has been decontaminating the cesium by removing the surface soil in order to return them to their home. This decontamination method is very effective, but which produces huge amount of waste soil. This becomes another big problem in Fukushima, because it is not easy to find large storage sites. Then effective and economical methods to reduce the volume of the waste soil are needed. However, it has not been invented yet. One of the reasons is lack of knowledge about microscopic process of adsorption/desorption of cesium to/from soil. It is known that weathered micaceous clay minerals play crucial role on adsorption and retention of cesium. They are expected to have special sorption sites, called frayed edge sites (FESs), which adsorb cesium selectively and irreversibly. Properties of FES have been intensely investigated by experiments. But microscopic details of the adsorption process on FES are still unclear. Because direct observation of the process with current experimental techniques is quite difficult. We investigated the adsorption of cesium to FES in muscovite, which is a typical micaceous clay mineral, via first-principles calculations (density functional theory). We made a minimal model of FES and evaluate the energy difference before and after cesium adsorption to FES. This is the first numerical modeling of FES. It was shown that FES does adsorb cesium if the weathering of muscovite has been weathered. In addition, we revealed the mechanism of cesium adsorption to FES, which is competition between ion radius of cesium and the degree of weathering. I plan to discuss volume reduction of the waste soil based on our result. Reference M. Okumura

  1. High voltage holding in the negative ion sources with cesium deposition

    Energy Technology Data Exchange (ETDEWEB)

    Belchenko, Yu.; Abdrashitov, G.; Ivanov, A.; Sanin, A.; Sotnikov, O., E-mail: O.Z.Sotnikov@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)

    2016-02-15

    High voltage holding of the large surface-plasma negative ion source with cesium deposition was studied. It was found that heating of ion-optical system electrodes to temperature >100 °C facilitates the source conditioning by high voltage pulses in vacuum and by beam shots. The procedure of electrode conditioning and the data on high-voltage holding in the negative ion source with small cesium seed are described. The mechanism of high voltage holding improvement by depletion of cesium coverage is discussed.

  2. Test procedures and instructions for single shell tank saltcake cesium removal with crystalline silicotitanate

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, J.B.

    1997-01-07

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Single Shell Tank Saltcake from tanks 24 t -BY- I 10, 24 1 -U- 108, 24 1 -U- 109, 24 1 -A- I 0 1, and 24 t - S-102, in a bench-scale column. The cesium sorbent to be tested is crystalline siticotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-024, Hanford Single Shell Tank Saltcake Cesium Removal Test Plan.

  3. Increasing the Space Charge Limit and Other Effects of Cesium Seeding in Hydrogen Negative Ion Sources

    International Nuclear Information System (INIS)

    The role of cesium seeding in increasing the negative ion current in volume sources is described. By a reduction in the local plasma potential the current of extracted electrons is vastly reduced. As a result, cesium increases the fraction of the transverse space charge limit available to the ions by as much as a factor of three. In addition, cesium can increase the total space charge limit by injection of Cs+ into the presheath-a newly recognized phenomenon consistent with experimental measurements and determined from application of a Double-Vlasov model for negative ion extraction

  4. Investigation of adsorption and wetting of 3He on cesium and cesiated glass

    International Nuclear Information System (INIS)

    Experiments have been carried out to investigate the binding of 3He on cesium substrates, using optical pumping to spin-polarize the atoms. The behavior of 3He on the walls at low temperature can be analyzed through the evolution of the nuclear magnetization of the sample. Preliminary results are presented, including: (1) adsorption studies of gaseous 3He on cesiated glass; (2) magnetic relaxation time of polarized liquid 3He on cesium and cesiated glass; (3) evidence for wetting of liquid 3He on cesium. 8 refs., 2 figs

  5. Differential number of CD34+, CD133+ and CD34+/CD133+ cells in peripheral blood of patients with congestive heart failure

    Directory of Open Access Journals (Sweden)

    Fritzenwanger M

    2009-03-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC which are characterised by the simulateous expression of CD34, CD133 and vascular endothelial growth receptor 2 (VEGF 2 are involved in the pathophysiology of congestive heart failure (CHF and their number and function is reduced in CHF. But so far our knowledge about the number of circulating hematopoietic stem/progenitor cells (CPC expressing the early hematopoietic marker CD133 and CD34 in CHF is spares and therefore we determined their number and correlated them with New York Heart Association (NYHA functional class. Methods CD34 and CD133 surface expression was quantified by flow cytometry in the peripheral venous blood of 41 healthy adults and 101 patients with various degrees of CHF. Results CD34+, CD133+ and CD34+/CD133+ cells correlated inversely with age. Both the number of CD34+ and of CD34+/CD133+ cells inversely correlated with NYHA functional class. The number of CD133+ cells was not affected by NYHA class. Furthermore the number of CD133+ cells did not differ between control and CHF patients. Conclusion In CHF the release of CD34+, CD133+ and CD34+/CD133+ cells from the bone marrow seems to be regulated differently. Modulating the releasing process in CHF may be a tool in CHF treatment.

  6. Internal radiotherapy with copper-64-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) reduces CD133{sup +} highly tumorigenic cells and metastatic ability of mouse colon carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Yoshii, Yukie [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Furukawa, Takako [Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan); Kiyono, Yasushi [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Watanabe, Ryo [Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Mori, Tetsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Yoshii, Hiroshi [Faculty of Medical Sciences, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Asai, Tatsuya [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Faculty of Engineering, University of Fukui, Fukui 910-8507 (Japan); Okazawa, Hidehiko [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Welch, Michael J. [Mallinckrodt Institute of Radiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Fujibayashi, Yasuhisa, E-mail: yfuji@nirs.go.j [Biomedical Imaging Research Center, University of Fukui, Eiheiji, Fukui 910-1193 (Japan); Molecular Imaging Center, National Institute of Radiological Sciences, Inage, Chiba 263-8555 (Japan)

    2011-02-15

    Introduction: {sup 64}Cu-diacetyl-bis (N{sup 4}-methylthiosemicarbazone) ({sup 64}Cu-ATSM) is an imaging agent for positron emission tomography (PET) that targets hypoxic tumors. {sup 64}Cu-ATSM is also reported to be a potential agent for internal radiotherapy. In a mouse colon carcinoma (Colon-26) model, we have shown that {sup 64}Cu-ATSM preferentially localizes in intratumoral regions with a high density of CD133{sup +} cells, which show characteristics of cancer stem cells or cancer stem cell-like cells (collectively referred here as CSCs). In this study, we evaluated the therapeutic effect of {sup 64}Cu-ATSM in relation to CD133 expression using this model. Methods: Systemic administration of 37 MBq {sup 64}Cu-ATSM or saline was conducted twice within a 1-week interval to mice bearing 1-week-old Colon-26 tumors (days 0-7). At day 19, tumor size measurement, flow cytometry analysis and experimental lung metastatic assay were performed. The therapeutic effect of {sup 64}Cu-ATSM on sorted CD133{sup +} and CD133{sup -} Colon-26 cells was also examined in vitro. Results: In vivo studies showed that {sup 64}Cu-ATSM treatment inhibited tumor growth. The percentage of CD133{sup +} cells and metastatic ability in {sup 64}Cu-ATSM treated tumors was decreased compared with that in control animals. In vitro studies demonstrated that {sup 64}Cu-ATSM accumulated in cells under hypoxic conditions and incorporation of {sup 64}Cu-ATSM under hypoxia caused cell death in both CD133{sup +} and CD133{sup -} cells in a similar extent. Conclusions: {sup 64}Cu-ATSM administration reduced tumor volume as well as the percentage of CD133{sup +} cells and the metastatic ability of Colon-26 tumors. Together with our data, it is suggested that {sup 64}Cu-ATSM accumulates in regions high in CD133{sup +} highly tumorigenic cells and kills such regions by radiation, resulting in a decrease of the percentage of CD133{sup +} cells.

  7. Molecular analysis of ex-vivo CD133+ GBM cells revealed a common invasive and angiogenic profile but different proliferative signatures among high grade gliomas

    Directory of Open Access Journals (Sweden)

    Garcia Juan L

    2010-08-01

    Full Text Available Abstract Background Gliomas are the most common type of primary brain tumours, and in this group glioblastomas (GBMs are the higher-grade gliomas with fast progression and unfortunate prognosis. Two major aspects of glioma biology that contributes to its awful prognosis are the formation of new blood vessels through the process of angiogenesis and the invasion of glioma cells. Despite of advances, two-year survival for GBM patients with optimal therapy is less than 30%. Even in those patients with low-grade gliomas, that imply a moderately good prognosis, treatment is almost never curative. Recent studies have demonstrated the existence of a small fraction of glioma cells with characteristics of neural stem cells which are able to grow in vitro forming neurospheres and that can be isolated in vivo using surface markers such as CD133. The aim of this study was to define the molecular signature of GBM cells expressing CD133 in comparison with non expressing CD133 cells. This molecular classification could lead to the finding of new potential therapeutic targets for the rationale treatment of high grade GBM. Methods Eight fresh, primary and non cultured GBMs were used in order to study the gene expression signatures from its CD133 positive and negative populations isolated by FACS-sorting. Dataset was generated with Affymetrix U133 Plus 2 arrays and analysed using the software of the Affymetrix Expression Console. In addition, genomic analysis of these tumours was carried out by CGH arrays, FISH studies and MLPA; Results Gene expression analysis of CD133+ vs. CD133- cell population from each tumour showed that CD133+ cells presented common characteristics in all glioblastoma samples (up-regulation of genes involved in angiogenesis, permeability and down-regulation of genes implicated in cell assembly, neural cell organization and neurological disorders. Furthermore, unsupervised clustering of gene expression led us to distinguish between two groups

  8. Molecular analysis of ex-vivo CD133+ GBM cells revealed a common invasive and angiogenic profile but different proliferative signatures among high grade gliomas

    International Nuclear Information System (INIS)

    Gliomas are the most common type of primary brain tumours, and in this group glioblastomas (GBMs) are the higher-grade gliomas with fast progression and unfortunate prognosis. Two major aspects of glioma biology that contributes to its awful prognosis are the formation of new blood vessels through the process of angiogenesis and the invasion of glioma cells. Despite of advances, two-year survival for GBM patients with optimal therapy is less than 30%. Even in those patients with low-grade gliomas, that imply a moderately good prognosis, treatment is almost never curative. Recent studies have demonstrated the existence of a small fraction of glioma cells with characteristics of neural stem cells which are able to grow in vitro forming neurospheres and that can be isolated in vivo using surface markers such as CD133. The aim of this study was to define the molecular signature of GBM cells expressing CD133 in comparison with non expressing CD133 cells. This molecular classification could lead to the finding of new potential therapeutic targets for the rationale treatment of high grade GBM. Eight fresh, primary and non cultured GBMs were used in order to study the gene expression signatures from its CD133 positive and negative populations isolated by FACS-sorting. Dataset was generated with Affymetrix U133 Plus 2 arrays and analysed using the software of the Affymetrix Expression Console. In addition, genomic analysis of these tumours was carried out by CGH arrays, FISH studies and MLPA; Gene expression analysis of CD133+ vs. CD133- cell population from each tumour showed that CD133+ cells presented common characteristics in all glioblastoma samples (up-regulation of genes involved in angiogenesis, permeability and down-regulation of genes implicated in cell assembly, neural cell organization and neurological disorders). Furthermore, unsupervised clustering of gene expression led us to distinguish between two groups of samples: those discriminated by tumour location

  9. Surface expression of CXCR4 on circulating CD133+ progenitor cells is associated with plaque instability in subjects with carotid artery stenosis

    Directory of Open Access Journals (Sweden)

    Sadikovic Suwad

    2009-12-01

    Full Text Available Abstract Background Circulating progenitor cells (PCs are considered to contribute to the remodeling of atherosclerotic plaques. Their surface receptor CXCR4 plays an important role in the recruitment of PCs to their target. This study compares the mobilization of PCs and their functional characteristics in asymptomatic subjects with stable and with unstable carotid plaques. This could provide insight into plaque remodeling and help to develop biomarkers for plaque stability. Methods In 31 subjects with asymptomatic carotid artery stenosis we analyzed the number of CD133+ PCs, VEGFR2+CD34+ PCs and the surface expression of CXCR4 on CD133+ PCs by flow cytometry. Subjects underwent bilateral carotid MRI in a 1.5-T scanner in order to allow the categorization of plaques, following the modified criteria of the American Heart Association. Results The number of CD133+ PCs and VEGFR2+CD34+ PCs showed no significant difference between subjects with stable and unstable carotid plaques. The expression of CXCR4 on CD133+ PCs was higher in subjects with unstable plaques than in subjects with stable plaques (p = 0.009. Conclusions This study demonstrates an association between functional characteristics of circulating CD133+ PCs and plaque stability in subjects with asymptomatic carotid artery stenosis. The higher expression of CXCR4 on CD133+ PCs suggests a difference in the recruitment of PCs to the injured tissue in subjects with unstable plaques and subjects with stable plaques. As surface expression of CXCR4 on CD133+ PCs differs in subjects with unstable and with stable plaques, CXCR4 is a promising candidate for a serological biomarker for plaque stability.

  10. Quantum dots affect expression of CD133 surface antigen in melanoma cells

    Directory of Open Access Journals (Sweden)

    Steponkiene S

    2011-10-01

    Full Text Available Simona Steponkiene1-3, Simona Kavaliauskiene1, Rasa Purviniene4, Ricardas Rotomskis3,5, Petras Juzenas11Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Radiumhospital, Oslo, Norway; 2Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania; 3Biomedical Physics Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 4Immunology Laboratory of Oncology Institute, Vilnius University, Vilnius, Lithuania; 5Biophotonics Laboratory, Laser Research Center, Vilnius University, Vilnius, LithuaniaBackground: In novel treatment approaches, therapeutics should be designed to target cancer stem cells (CSCs. Quantum dots (QDs are a promising new tool in fighting against cancer. However, little is known about accumulation and cytotoxicity of QDs in CSCs.Methods: Accumulation and cytotoxicity of CdTe-MPA (mercaptopropionic acid QDs in CSCs were assessed using flow cytometry and fluorescence-activated cell sorting techniques as well as a colorimetric cell viability assay.Results: We investigated the expression of two cell surface-associated glycoproteins, CD44 and CD133, in four different cancer cell lines (glioblastoma, melanoma, pancreatic, and prostate adenocarcinoma. Only the melanoma cells were positive to both markers of CD44 and CD133, whereas the other cells were only CD44-positive. The QDs accumulated to a similar extent in all subpopulations of the melanoma cells. The phenotypical response after QD treatment was compared with the response after ionizing radiation treatment. The percentage of the CD44high-CD133high subpopulation decreased from 72% to 55%–58% for both treatments. The stem-like subpopulation CD44highCD133low/- increased from 26%–28% in the untreated melanoma cells to 36%–40% for both treatments.Conclusion: Treatment of melanoma cells with QDs results in an increase of stem-like cell subpopulations. The changes in phenotype distribution of the melanoma cells after

  11. Determinations of cesium-134, cesium-137 and potassium-40 as a measure of intrauterine exposure to rays and contamination of human milk after the Chernobyl reactor accident

    International Nuclear Information System (INIS)

    In order to gain better insights into the degree of intrauterine exposure to rays after the Chernobyl reactor accident, placental measurements of the activity levels of cesium-134 and cesium-137 were carried out in 125 expectant mothers from the Munich area using four thallium-activated sodium iodine crystal detectors. The lower limit of detection determined for this technique was 1-2 bq/kg. Parallel tests were performed on human milk samples to establish their contents of cesium-137 and potassium-40. The ultrapure germanium detector used for this purpose measured levels down to a detection threshold of 1 bq/l. In a total of 13 placentae (10 %) and 56 milk samples (57%) the activity of cesium-137 was found to be so low as to preclude detection. The highest values measured were 18.6 bq/kg for the placentae and 10.6 bq/l for the milk samples. The activity concentrations of potassium-40 were frequently seen to exceed those of cesium-137, the highest value determined here being 73.6 bq/l. The author has come to the conclusion that the alleged increases in radiation levels remain within the range of variations generally expected to occur with natural radiation. Mothers are not discouraged from breast-feeding, even though their attention must be drawn to the fact that the rates of malignant diseases and genetic damage tend to rise on a global scale. (KST)

  12. Diffusion of water, cesium and neptunium in pores of rocks

    International Nuclear Information System (INIS)

    Teollisuuden Voima Oy (TVO) is investigating the feasibility to dispose of spent nuclear fuel within Finland. The present plan calls for the repository to be located in crystalline rock at a depth of several hundred meters. The safety assessment of the repository includes calculations of migration of waste nuclides. The flow of waste elements in groundwater will be retarded through sorption interaction with minerals and through diffusion into rock. Diffusion is the only mechanism retarding the migration of non-sorbing species and, it is expected to be the dominating retardation mechanism of many of the sorbing elements. In the investigation the simultaneous diffusion of tritiated water (HTO), cesium and neptunium in rocks of TVO investigation sites at Kivetty, Olkiluoto and Romuvaara were studied. (11 refs., 33 figs., 9 tabs.)

  13. Cesium-137 accident lessons in Goiania, Goias State, Brazil

    International Nuclear Information System (INIS)

    This document relates the experience obtained by several professionals which had an important role in the cesium-137 accident occurred in Goiania, Goias State, Brazil in September, 1987. It's divided into chapters, according to the action area - medical, nursing, social assistance, odontological and psychological. At first, some notions of radioprotection are explained, followed by the accident history and by the doctors and nurses action during the emergency phase and the medical, odontological, social and psychological assistance to the victims. The social assistance report shows some statistical data about the economic, occupational and social conditions of the accident victims. It is shown some information about the health institutions and the sanitary care in the ionizing radiation and about the occupational radiological protection in Goiania

  14. Coherence properties of nanofiber-trapped cesium atoms

    CERN Document Server

    Reitz, D; Mitsch, R; Schneeweiss, P; Rauschenbeutel, A

    2013-01-01

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized 200 nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time $T_2^\\ast=0.6$ ms and an irreversible dephasing time $T_2^\\prime=3.7$ ms. By theoretically modelling the signals, we find that, for our experimental parameters, $T_2^\\ast$ and $T_2^\\prime$ are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  15. Coherence Properties of Nanofiber-Trapped Cesium Atoms

    Science.gov (United States)

    Reitz, D.; Sayrin, C.; Mitsch, R.; Schneeweiss, P.; Rauschenbeutel, A.

    2013-06-01

    We experimentally study the ground state coherence properties of cesium atoms in a nanofiber-based two-color dipole trap, localized ˜200nm away from the fiber surface. Using microwave radiation to coherently drive the clock transition, we record Ramsey fringes as well as spin echo signals and infer a reversible dephasing time of T2*=0.6ms and an irreversible dephasing time of T2'=3.7ms. By modeling the signals, we find that, for our experimental parameters, T2* and T2' are limited by the finite initial temperature of the atomic ensemble and the heating rate, respectively. Our results represent a fundamental step towards establishing nanofiber-based traps for cold atoms as a building block in an optical fiber quantum network.

  16. Trade study for the disposition of cesium and strontium capsules

    International Nuclear Information System (INIS)

    This trade study analyzes alternatives for the eventual disposal of cesium and strontium capsules currently stored at the Waste Encapsulation and Storage Facility as by-product. However, for purposes of this study, it is assumed that at some time in the future, the capsules will be declared high-level waste and therefore will require disposal at an offsite geologic repository. The study considered numerous alternatives and selected three for detailed analysis: (1) overpack and storage at high-level waste canister storage building, (2) overpack at the high-level waste vitrification facility followed by storage at a high-level waste canister storage building, and (3) blend capsule contents with other high-level waste feed streams and vitrify at the high-level waste vitrification facility

  17. Norbadione A: synthetic approach and cesium complexation studies

    International Nuclear Information System (INIS)

    This work was dedicated to the study of the synthesis and complexation studies of norbadione A: a pigment originating from a mushroom. A synthetic approach, based on a double Suzuki-Miyaura coupling, was developed. This strategy was applied with high yields to the synthesis of various norbadione A analogues, as well as to the synthesis of simple pulvinic acids. Access to functionalized precursors of the molecule was also studied and the final coupling remains to be done. Besides, a speciation study based on electro-spray ionization mass spectrometry was conducted with norbadione A and one of the analogues. This study allowed the assessment of the cesium complexation abilities of each molecule. Structural data was also obtained and complexation constants were calculated. Finally, norbadione A and various synthetic products have been tested via high-throughput screening methods and strong antioxidant properties were observed. Other biological results are also reported. (author)

  18. Comparative study of cesium adsorption on dioctahedral and trioctahedral smectites

    International Nuclear Information System (INIS)

    Bentonites which are characterized by good rheological, mineralogical and chemical stability is considered used as sealing barriers in multibarrier Slovak system of deep geological repository for high-level radioactive waste and spent nuclear fuel. In Slovak Republic there are several significant deposits of bentonite, which are characterized by appropriate adsorption properties and meet the geotechnical requirements for this type of barriers. Study of adsorption properties of bentonites and other smectites is an essential step for developing the migration model long-lived corrosion and activation products, and fission products of uranium. Nuclear wastes contain the most important nuclear fission products, radioisotopes 134Cs and 137Cs. The present paper investigates and compares the cesium adsorption properties of Slovak and North America bentonites composed mainly of dioctahedral smectite montmorillonite (J, L, SAz-1 and STx-1) and trioctahedral smectites saponite (SapCa-2) and hectorite (SHCa-1). (author)

  19. Quality assurance program plan for cesium legacy project

    International Nuclear Information System (INIS)

    This Quality Assurance Program Plan (QAPP) provides information on how the Quality Assurance Program is implemented for the Cesium Legacy Project. It applies to those items and tasks which affect the completion of activities identified in the work breakdown structure of the Project Management Plan (PMP). These activities include all aspects of cask transportation, project related operations within the 324 Building, and waste management as it relates to the specific activities of this project. General facility activities (i.e. 324 Building Operations, Central Waste Complex Operations, etc.) are covered in other appropriate QAPPs. The 324 Building is currently transitioning from being a Pacific Northwest National Laboratory (PNNL) managed facility to a B and W Hanford Company (BWHC) managed facility. During this transition process existing PNNL procedures and documents will be utilized until replaced by BWHC procedures and documents

  20. Quantitative analysis of cesium in synthetic lithium molten salts

    International Nuclear Information System (INIS)

    An analytical technique for fission products in lithium molten salts of spent PWR (Pressurized Water Reactor) fuels has been studied for the establishment of optimum chemical engineering process and the evaluation of process material balance in developing Direct Oxide Reduction Process with lithium metal. As part of the basic research, synthetic dissolver solutions of lithium chloride containing trace amounts of fission product elements (La, Ce, Pr, Nd, Sm, Eu, Gd, Y, Cs, Ru, Rh, Pd, Mo, Zr, Cd, Ba, Sr, Te and Se) was prepared and used in establishing the selective separation technique of cesium from lithium chloride matrix using cation exchange chromatography. Its recovery was measured by flame atomic absorption spectrometry and the reliability of this technique was evaluate

  1. Vector Cesium Magnetometer for the nEDM Experiment

    International Nuclear Information System (INIS)

    Full text: We use optical pumping combined with magnetic resonance in a Cesium vapor cell in order to measure the magnetic field. A Vector Cs Magnetometer uses multiple laser beams to follow the dynamics of the spin in 3D. The 3D signal is used to extract the Larmor frequency of the spins, and to extract the direction of the magnetic field through the path of the spins. The magnetometer was successfully tested in a proof of principle experiment. Its measured performance is ∼50 pT/Hz1/2 for the directions perpendicular to the magnetic field, and ∼500 fT/Hz1/2 for the direction parallel to the magnetic field. (author)

  2. Cesium and strontium sorption behavior in amended agricultural soils

    Science.gov (United States)

    Mehmood, Khalid; Hofmann, Diana; Burauel, Peter; Vereecken, Harry; Berns, Anne E.

    2014-05-01

    Biogas digestates and biochar are emerging soil amendments. Biochar is a byproduct of pyrolysis process which is thermal decomposition of biomass to produce syngas and bio-oil. The use of biochar for soil amendment is being promoted for higher crop yields and carbon sequestration. Currently, the numbers of biogas plants in Germany are increasing to meet the new energy scenarios. The sustainability of biogas industry requires proper disposal options for digestate. Biogas digestates being rich in nutrients are beneficial to enhance agricultural productions. Contrary to the agronomical benefits of these organic amendments, their use can influence the mobility and bioavailability of soil contaminants due to nutrients competition and high organic matter content. So far, the impact of such amendments on highly problematic contaminants like radionuclides is not truly accounted for. In the present study, sorption-desorption behavior of cesium and strontium was investigated in three soils of different origin and texture. Two agricultural soils, a loamy sand and a silty soil, were amended with biochar and digestate in separate experiments, with field application rates of 25 Mg/ha and 34 Mg/ha, respectively. For comparison a third soil, a forest soil, was incubated without any amendment. The amendments were mixed into the top 20 cm of the field soils, resulting in final concentrations of 8-9 g biochar/Kg soil and 11-12 g digestate/Kg soil. The soils were incubated for about six months at room temperature. Sorption-desorption experiments were performed with CsCl and SrCl2 after pre-equilibrating the soils with CaCl2 solutions. The amendments with field application rates did not have a significant effect on the relevant soil parameters responsible for the sorption behavior of the two radionuclides. Comparatively, the soil type lead to distinctive differences in sorption-desorption dynamics of the two radionuclides. Cesium showed a higher affinity for silty soil followed by

  3. Elastic scattering of sodium and cesium atoms at ultracold temperatures

    Institute of Scientific and Technical Information of China (English)

    Zhang Ji-Cai; Wang Ke-Dong; Liu Yu-Fang; Sun Jin-Feng

    2011-01-01

    The elastic scattering properties in a mixture of sodium and cesium atoms are investigated at cold and ultracold temperatures. Based on the accurate interatomic potential for the NaCs mixture,the interspecies s-wave scattering lengths,the effective ranges and the p-wave scattering lengths are calculated by the quantal method and the semiclassical method,respectively. The s-wave scattering lengths are 512.7ao for the singlet state and 33.4ao for the triplet state. In addition,the spin-change and elastic cross sections are also calculated,and the g-wave shape resonance is found in the total elastic cross sections.

  4. Hot demonstration of proposed commercial cesium removal technology: Progress report

    International Nuclear Information System (INIS)

    Cesium, strontium, and technetium radionuclides constitute a small fraction of the primarily sodium and potassium salts present in supernatants that are being stored in tanks at Hanford, Oak Ridge, Savannah River, and Idaho and must be remediated. Nuclide removal technologies supplied by the US Department of Energy Office of Science and Technology's Efficient Separations and Processing (ESP) Cross-Cutting Program have been previously proposed and tested in small batch and column tests using both simulated and actual supernatants. These technologies must now be tested and the most appropriate ones selected using a flow system of a scale suitable to obtain engineering data that can be applied to the design of pilot-scale equipment. This report describes the operation of the experimental test unit that is located in Building 4501 (ORNL) and the results using the sorbent materials that were tested

  5. Prognostic role of CD133 expression in colorectal cancer: a meta-analysis

    OpenAIRE

    Wang Ke; Xu Jianjun; Zhang Junshu; Huang Jian

    2012-01-01

    Abstract Background CD133 has been identified as a putative cancer stem cell marker in colorectal cancer (CRC). However, the clinical and prognostic significance of CD133 in CRC remains controversial. Methods Publications were identified which assessed the clinical or prognostic significance of CD133 in CRC up to October 2012. A meta-analysis was performed to clarify the association between CD133 expression and clinical outcomes. Results A total of 12 studies met the inclusion criteria, and c...

  6. Calibration of thermoluminescent dosimeters to xenon-133 for both submersion and non-submersion geometries

    International Nuclear Information System (INIS)

    This work developed calibration factors for a two element dosimeter that was exposed to several geometries of xenon-133. The three geometries examined were an infinite overhead xenon-133 plume greater than 80 cm above the dosimeter, a dosimeter submersed in an infinite cloud of xenon-133;and a dosimeter exposed to a xenon-133 cloud in a 91 cm calibration chamber. 17 refs., 2 figs., 47 tabs

  7. Sorption of cesium on bentonite: The role of calcite

    International Nuclear Information System (INIS)

    Full text: Since bentonite is investigated for its use in Engineered Barriers Systems as backfill material, many studies of their surfaces properties have been performed in the past years to qualify and quantify adsorption on their surfaces, which can be one of the major processes limiting migration of radionuclides away from a disposal site. Nevertheless, most of these studies concerned simplified systems, such as Na-montmorillonite in mono-electrolyte solution. As ion-exchange processes are of importance in water-clays interactions, adsorption of natural major ions has also to be taken into account for natural systems. The aim of this work is (i) to quantify the sorption of the natural major cations on the montmorillonite surface, (ii) to compare the sorption of cesium, in two different systems, a simple one (Na-montmorillonite in NaNO3 0.05 Mol.L-1) and a complex one (natural bentonite in a synthetic natural water) and then (iii) to assess the influence of the natural major ions on this sorption, and to identify the role of the calcite phase present in bentonite. The methodology used consists in several batch experiments, first considering a very simple solution (NaNO3), then using mixtures of two different electrolytes, and lastly using a synthetic natural water. A surface complexation model, describing the surface of clays as a mixture of ion-exchange and complexation surface sites, is used to provide interpretations and quantifications of the sorption processes. Observed results indicate that affinity for the montmorillonite surface is greatest for Ca, then Mg and then K. The sorption of cesium is strongly affected by the presence in solution of Ca, witch can come from the partial dissolution of calcite. (author)

  8. Sorption of cesium on bentonite: The role of calcite

    International Nuclear Information System (INIS)

    Full text: Since bentonite is investigated for its use in Engineered Barriers Systems as backfill material, many studies of their surfaces properties have been performed in the past years to qualify and quantify adsorption on their surfaces, which can be one of the major processes limiting migration of radionuclides away from a disposal site. Nevertheless, most of these studies concerned simplified systems, such as Na-montmorillonite in mono-electrolyte solution. As ion-exchange processes are of importance in water-clays interactions, adsorption of natural major ions has also to be taken into account for natural systems. The aim of this work is (i) to quantify the sorption of the natural major cations on the montmorillonite surface; (ii) to compare the sorption of cesium, in two different systems, a simple one ( Na-montmorillonite in NaNO3 0.05 Mol.L-1) and a complex one (natural bentonite in a synthetic natural water) and then; (iii) to assess the influence of the natural major ions on this sorption, and to identify the role of the calcite phase present in bentonite. The methodology used consists in several batch experiments, first considering a very simple solution (NaNO3), then using mixtures of two different electrolytes, and lastly using a synthetic natural water. A surface complexation model, describing the surface of clays as a mixture of ion-exchange and complexation surface sites, is used to provide interpretations and quantifications of the sorption processes. Observed results indicate that affinity for the montmorillonite surface is greatest for Ca, then Mg and then K. The sorption of cesium is strongly affected by the presence in solution of Ca, witch can come from the partial dissolution of calcite. This study is one part of a work supported by ANDRA on the retention properties of bentonite materials. (author)

  9. Vitrification of cesium-contaminated organic ion exchange resin

    Energy Technology Data Exchange (ETDEWEB)

    Sargent, T.N. Jr. [Clemson Univ., SC (United States)

    1994-08-01

    Vitrification has been declared by the Environmental Protection Agency (USEPA) as the Best Demonstrated Available Technology (BDAT) for the permanent disposal of high-level radioactive waste. Savannah River Site currently uses a sodium tetraphenylborate (NaTPB) precipitation process to remove Cs-137 from a wastewater solution created from the processing of nuclear fuel. This process has several disadvantages such as the formation of a benzene waste stream. It has been proposed to replace the precipitation process with an ion exchange process using a new resorcinol-formaldehyde resin developed by Savannah River Technical Center (SRTC). Preliminary tests, however, showed that problems such as crust formation and a reduced final glass wasteform exist when the resin is placed in the melter environment. The newly developed stirred melter could be capable of overcoming these problems. This research explored the operational feasibility of using the stirred tank melter to vitrify an organic ion exchange resin. Preliminary tests included crucible studies to determine the reducing potential of the resin and the extent of oxygen consuming reactions and oxygen transfer tests to approximate the extent of oxygen transfer into the molten glass using an impeller and a combination of the impeller and an external oxygen transfer system. These preliminary studies were used as a basis for the final test which was using the stirred tank melter to vitrify nonradioactive cesium loaded organic ion exchange resin. Results from this test included a cesium mass balance, a characterization of the semi-volatile organic compounds present in the off gas as products of incomplete combustion (PIC), a qualitative analysis of other volatile metals, and observations relating to the effect the resin had on the final redox state of the glass.

  10. Vitrification of cesium-contaminated organic ion exchange resin

    International Nuclear Information System (INIS)

    Vitrification has been declared by the Environmental Protection Agency (USEPA) as the Best Demonstrated Available Technology (BDAT) for the permanent disposal of high-level radioactive waste. Savannah River Site currently uses a sodium tetraphenylborate (NaTPB) precipitation process to remove Cs-137 from a wastewater solution created from the processing of nuclear fuel. This process has several disadvantages such as the formation of a benzene waste stream. It has been proposed to replace the precipitation process with an ion exchange process using a new resorcinol-formaldehyde resin developed by Savannah River Technical Center (SRTC). Preliminary tests, however, showed that problems such as crust formation and a reduced final glass wasteform exist when the resin is placed in the melter environment. The newly developed stirred melter could be capable of overcoming these problems. This research explored the operational feasibility of using the stirred tank melter to vitrify an organic ion exchange resin. Preliminary tests included crucible studies to determine the reducing potential of the resin and the extent of oxygen consuming reactions and oxygen transfer tests to approximate the extent of oxygen transfer into the molten glass using an impeller and a combination of the impeller and an external oxygen transfer system. These preliminary studies were used as a basis for the final test which was using the stirred tank melter to vitrify nonradioactive cesium loaded organic ion exchange resin. Results from this test included a cesium mass balance, a characterization of the semi-volatile organic compounds present in the off gas as products of incomplete combustion (PIC), a qualitative analysis of other volatile metals, and observations relating to the effect the resin had on the final redox state of the glass

  11. Removal and adsorption of radioactive cesium from contaminated soil caused by the Fukushima Daiichi Nuclear Power Station accident

    International Nuclear Information System (INIS)

    The removal and adsorption of radioactive cesium, 137Cs or 134Cs, from contaminated soil was investigated using various extractants: sodium hydroxide, hydrochloric acid, and sulfuric acid. In this experiment, a sand sample was used as contaminated soil. Although the radioactive cesium could not be removed from the soil by using sodium hydroxide, 64% of the removal efficiency was provided at room temperature when 10 M hydrochloric acid was used. Eighty percent of the radioactive cesium was removed by using 1 M sulfuric acid containing 0.1 M thiourea at 90℃. A more than 90% removal efficiency was obtained by increasing of the volume of sulfuric acid containing thiourea. The same result was obtained using custom-made radioactive cesium removal equipment. The adsorption of the radioactive cesium was also investigated. In an experiment of concerning adsorption, contaminated water containing radioactive cesium was prepared from a contaminated sand sample. More than 96% adsorption was obtained using zeolite (clinoptilolite). However, when commercial activated carbon was used, most the radioactive cesium was hardly removed. The influence of shaking time on the adsorption of radioactive cesium was investigated by a batch-system using zeolite. As a result, a shaking time of at least 5 min showed that the radioactive cesium was quantitatively adsorbed to zeolite. The adsorptive behavior of the radioactive cesium by a flow-system was also examined using zeolite. (author)

  12. 46 CFR 108.133 - Hull superstructure, structural bulkheads, decks, and deckhouses.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hull superstructure, structural bulkheads, decks, and deckhouses. 108.133 Section 108.133 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.133 Hull...

  13. 41 CFR 301-10.133 - What is a U.S. flag air carrier?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false What is a U.S. flag air carrier? 301-10.133 Section 301-10.133 Public Contracts and Property Management Federal Travel Regulation... Carrier Transportation Use of United States Flag Air Carriers § 301-10.133 What is a U.S. flag air...

  14. 21 CFR 133.158 - Low-moisture part-skim mozzarella and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... cheese. 133.158 Section 133.158 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.158 Low-moisture part-skim mozzarella...

  15. 21 CFR 133.123 - Cold-pack and club cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cold-pack and club cheese. 133.123 Section 133.123... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.123 Cold-pack and club cheese. (a)(1) Cold-pack cheese, club cheese,...

  16. The new Tunka-133 EAS Cherenkov array: Status of 2009

    International Nuclear Information System (INIS)

    The deployment of the new Extensive air shower Cherenkov installation Tunka-133 with about 1 km2 geometric acceptance area was completed in October 2009. The array will permit a detailed long-term study of the cosmic ray energy spectrum and mass composition in the energy range 1015-1018 eV with a unique and more elaborate method. The array construction and data acquisition system, preliminary results and plans for future development are presented.

  17. Separation of radio cesium from acid-Purex solutions by sorption on granulated AMP

    International Nuclear Information System (INIS)

    An organic polymer, poly vinylbutyral was used for the preparation of the composite exchanger containing ammonium molybdo phosphate (AMP) as the active component. The resultant granulated product (AMP-GR) has excellent column properties and stands high flow rates without generating fines. The method of preparation of the granulated sorbent, the batch and breakthrough capacities of the granules for cesium ions, their hydraulic properties and the results of column tests for cesium separation from acidic cesium solutions and simulated high level wastes (HLW) solutions is described. The process can be adapted to remove cesium from HLW solutions and could thus be incorporated in a waste management scheme. (author). 16 refs., 3 figs., 3 tabs

  18. New separation techniques of cesium by redox type ion exchange materials

    International Nuclear Information System (INIS)

    RIECS method, new cesium separation method, was developed in which a porous strong base anionic exchanger with copper ferrocyanide (CuFC) and inhibitor were used. Cesium could be separated from the high concentration nitric solution. By developing new impregnation method, large amount of CuFC was impregnated into the micropolar porous resin and silica gel pores. KFC adhered to outside of pores was recovered. Good complex with CuFC was prepared by use of copper chloride in ethyl alcohol solution. The adsorption ratio of cesium increased radically to 80% level in the very small range of hydrazine concentration 1.7 to 2.4x10-4M. The adsorption-desorption ratio of cesium did not decrease by repeating it seven times. The glassificated materials decreased large amount of γ-ray unless increase of volume could be produced by built RIECS method in the high level waste processing system. (S.Y.)

  19. Preparation, structure and application of a new ecomaterials cesium ion-sieve

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A new ecomaterials cesium ion-sieve (Cs-IS), which has high selectivity to cesium and excellent acid resistance, is prepared with zirconyl molybdopyrophosphate as its matrix by specific chemical sieve-making means. Cs-IS has large exchange capacity ( 1.83mmol@g-1) and high distribution coefficient (4.09 x 104 mL@ L-1) in the medium of 3 mol@ L- 1 HNO3. In the static exchange with strongly acidic high-level radioactive liquid waste (HLLW) (3 mol@ L-1 HNO3), Cs-IS exhibits high exchange rate for cesium (above 96.53 % ) and large separation factor (greater than 958.41). These indicate the possible use of Cs-IS in cesium-137 selective removal and recovery from highly saline acidic HLLW system.

  20. Cesium-137 in Lake Michigan sediments: areal distribution and correlation with other man-made materials

    International Nuclear Information System (INIS)

    Grab samples of sediment were collected at 530 locations in Lake Michigan, primarily in the southeastern quarter of the lake. Each sample was analysed in the field and in the laboratory for fallout cesium-137. Twenty-five of the samples collected near the mouth of the St. Joseph River, were also analysed in the laboratory for 11 other man-made materials known to be discharged into the river. Two statistical methods were used to determine if cesium-137 can be used as an environmental tracer to predict the areal distributions of other man-made materials. The results show fallout cesium-137 to be a moderate to good tracer for locating areas of accumulation of plutonium-238, plutonium-239, zinc, copper, chromium, lead, dieldrin, DDT and PCB in sediment. Little or no correlation is found between fallout cesium-137 and strontium-90 or nickel. (author)

  1. Candlestick oven with a silica wick provides an intense collimated cesium atomic beam

    Science.gov (United States)

    Pailloux, A.; Alpettaz, T.; Lizon, E.

    2007-02-01

    This article shows that readily available glass and silica fibers and braids are suitable capillary structure for recirculating ovens, such as candlestick ovens, becoming then an alternative wick material to conventional metal based capillary structures. In order to study wettability and capillarity of metallic liquid cesium on borosilicate and silica microstructures, samples were selected, prepared, and tested experimentally. The contact angle of cesium on silica glass was roughly measured: θ =35°±10°. A commercially available silica braid was then introduced inside a candlestick oven to transfer the metallic liquid cesium from the cold reservoir to the hot emission point of the candlestick. A collimated cesium atomic beam of intensity of 2×1016at./ssr was obtained, stable and reproducible. Furthermore, this modified oven is easy to handle daily.

  2. Fission of Multiply Charged Cesium and Potassium Clusters in Helium Droplets - Approaching the Rayleigh Limit

    CERN Document Server

    Renzler, Michael; Daxner, Matthias; Kranabetter, Lorenz; Kuhn, Martin; Scheier, Paul; Echt, Olof

    2016-01-01

    Electron ionization of helium droplets doped with cesium or potassium results in doubly and, for cesium, triply charged cluster ions. The smallest observable doubly charged clusters are $Cs_{9}^{2+}$ and $K_{11}^{2+}$; they are a factor two smaller than reported previously. The size of potassium dications approaches the Rayleigh limit nRay for which the fission barrier is calculated to vanish, i.e. their fissilities are close to 1. Cesium dications are even smaller than nRay, implying that their fissilities have been significantly overestimated. Triply charged cesium clusters as small as $Cs_{19}^{3+}$ are observed; they are a factor 2.6 smaller than previously reported. Mechanisms that may be responsible for enhanced formation of clusters with high fissilities are discussed.

  3. Assessment of food calcium radioprotection effectiveness against cesium-137, added alone and with iodine-131

    International Nuclear Information System (INIS)

    New fish product with addition of food calcium had radioprotective properties, resulted in decreased cesium-137 content in organs and tissues of animals by 40-60% and lesser changes in differential blood count and biochemical indexes of blood serum

  4. Cold cesium molecules produced directly in a magneto-optical trap

    Institute of Scientific and Technical Information of China (English)

    Zhang Hong-Shan; Ji Zhong-Hua; Yuan Jin-Peng; Zhao Yan-Ting; Ma Jie; Wang Li-Rong; Xiao Lian-Tuan; Jia Suo-Tang

    2011-01-01

    We report on the observation of ultracold ground electric-state cesium molecules produced directly in a magnetooptical trap with a good signal-to-noise ratio.These molecules arise from the photoassociation of magneto-optical trap lasers and they are detected by resonantly enhanced multiphoton ionization technology.The production rate of ultracold cesium molecules is up to 4× 104 s-1.We measure the characteristic time of the ground electric-state cesium molecules generated in the experiment and investigate the Cs2+ molecular ion intensity as a function of the trapping laser intensity and the ionization pulse laser energy.We conclude that the production of cold cesium molecules may be enhanced by using appropriate experimental parameters,which is useful for future experiments involving the production and trapping of ultracold ground electric-state molecules.

  5. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium.

    Science.gov (United States)

    Hu, Baiyang; Fugetsu, Bunshi; Yu, Hongwen; Abe, Yoshiteru

    2012-05-30

    We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent. PMID:22464752

  6. Removal of cesium from low level waste solutions by copper hexacyanoferrate loaded resins

    International Nuclear Information System (INIS)

    Sorbents for the separation of radio cesium from aqueous solutions were synthesized by incorporating copper hexacyanoferrate (II) in the matrix of anion exchange resins of Indian origin, viz. Indion-810 and Tulsion-A27MP. Their efficiency for the cesium removal was tested under both static and dynamic conditions. The resins were found to be highly selective for radio cesium from a variety of salt and acid solutions. In general, Tulsion-based resins showed more tolerance towards chemical load in the solutions than the other. Pilot column run with Indion-based loaded resin showed that it effectively removed all the cesium activity from few thousands of litres of mixed low level waste streams from reactors, fuel reprocessing plant and nuclear laboratories. (author). 24 refs., 2 figs., 3 tabs

  7. Biological effects of cesium-137 injected in beagle dogs of different ages

    Energy Technology Data Exchange (ETDEWEB)

    Nikula, K.J.; Muggenburg, B.A.; Griffith, W.C. [and others

    1995-12-01

    The toxicity of cesium-137 ({sup 137}Cs) in the Beagle dog was investigated at the Argonne National Laboratory (ANL) as part of a program to evaluate the biological effects of internally deposited radionuclides. The toxicity and health effects of {sup 137}Cs are important to understand because {sup 137}Cs is produced in large amounts in light-water nuclear reactors. Large quantities of cesium radioisotopes have entered the human food chain as a result of atmospheric nuclear weapons test, and additional cesium radioisotopes were released during the Chernobyl accident. Although the final analyses are not complete, three findings are significant: older dogs dies significantly earlier than juvenile and young adult dogs; greater occurrence of sarcomas in the cesium-137 injected dogs; the major nonneoplastic effect in dogs surviving beyond 52 d appears to be testicular atrophy.

  8. Total deposition of cesium-137 measured in Finland during the exercise `RESUME 95` in August 1995

    Energy Technology Data Exchange (ETDEWEB)

    Geer, L.E. De; Vintersved, I.; Arntsing, R. [National Defence Research Establisment, Nuclear Detection Group, Stockholm (Sweden)

    1997-12-31

    In the exercise called `RESUME 95` the Nuclear Detection Group from the National Defence Research Establishment in Stockholm participated with field gamma ray measurements combined with soil sampling and profile measurements. The results are presented in this report for the measurements of cesium-137. We considered the measurements of cesium-137 at the airfield the most important part of the in-situ exercise. Data was of course collected also for cesium-134 and natural radionuclides but time has not permitted a full analysis of these radionuclides. The methodology would, however, be the same as applied for cesium-137. Less attention was paid for area II and due to limited personnel resources the search exercise was not fully carried out. (au).

  9. Cs2 ‘diffuse bands’ emission from superheated cesium vapor

    Science.gov (United States)

    Pichler, G.; Makdisi, Y.; Kokaj, J.; Thomas, N.; Mathew, J.; Beuc, R.

    2016-07-01

    Thermal emission from superheated cesium vapor was studied to very high temperatures from 700 °C to 1000 °C. This was performed in the vapor condition only and with no liquid cesium present in the all-sapphire cell. We observed a number of atomic and molecular spectral features simultaneously in emission and absorption, especially peculiar thermal emission of cesium dimer diffuse bands (2 3Πg → a 3∑u + transitions) around 710 nm coexisting with absorption bands around first resonance lines at 852 and 894 nm. We performed appropriate calculations of the diffuse band emission profiles and compared them with measured profiles. We also performed absorption measurements and compared observed diffuse band profiles with calculated ones. Possible applications of the observed phenomena will be discussed in terms of the solar energy conversion using dense cesium vapor.

  10. Co-precipitation and solubility studies of cesium, potassium and sodium tetraphenylborate

    International Nuclear Information System (INIS)

    This report contains the results from a study requested by High Level Waste Division on the co-precipitation and solubility of cesium, potassium, and sodium tetraphenylborate. Co-precipitation of cesium (Cs), potassium (K), and sodium (Na) tetraphenylborate (TPB) helps determine the efficiency of reagent usage in the Small Tank Precipitation Process. This process uses NaTPB to remove cesium from waste by means of precipitation. Previous studies by McCabe suggested that if the sodium ion concentration [Na+] increased the rate at which cesium tetraphenylborate (KTPB) in the presence of high [Na+] (∼5M) appears to produce a mixed solid phase composed of NaTPB and KTPB together in the crystal lattice

  11. Distribution of cesium 137 between different sorption sites of soils contaminated by Chernobyl catastrophe products

    International Nuclear Information System (INIS)

    The results of investigation of distribution of cesium 137 ions between different sorption sites of soils contaminated by Chernobyl catastrophe products are received. Using NH42 and Sr2+ as ousted cations the portion of radionuclide adsorbed by specific (FES) and regular (RES) exchangeable sites have been determined. The distribution of cesium 137 ions and its exchangeable form between soils and liquid phases of water saturated soils have been established. The distribution coefficients have been evaluated. The behavior of cesium 137 in a system 'soil - solution' with different contribution of FES and RES sites into radionuclide adsorption were considered. Effect of solution acidity and cation concentration compete for exchangeable adsorption have been analyzed. Higher cesium 137 mobility during its transfer from solid phase into solution in soils, where content of specific adsorption sites is limited, was revealed

  12. Calibration of 133Ba by Sum-Peak Method

    International Nuclear Information System (INIS)

    A calibration laboratory should have several methods of measurement in order to ensure robustness on the values applied. The National Laboratory for Metrology of Ionizing Radiation, (LNMRI IRD), provides gamma sources of radionuclide in various geometries and standardized in activity with reduced uncertainties. Some absolute and relative methods of calibrations could be used routinely. Relative methods require standards to determine the activity of sample to be calibrated, while the absolute methods do not need, simply make the counting and the calculation of the activity is obtained directly. The great advantage of calibrations of radionuclides by absolute method is the accuracy and low uncertainties. 133Ba is a radionuclide enough used in research laboratories and calibration of detectors for environmental analysis and, according to the scheme, it decays 100% by electron capture and emits about 14 energy gamma and X-ray lines, forming several coincidences. However, the classical methods of absolute measurement, as coincidence 4 πβ-γ have difficulty to calibrate 133Ba due to its complex decay scheme. The sum-peak method, developed by Brickman, could allow this calibration. It is used for radionuclide calibration that emits at least two photons in coincidence. Therefore, it was developed a methodology that combines gamma spectrometry technique with sum-peak method to standardize 133Ba samples. Activity results obtained proved compatible, with uncertainties of less than 1%, and, when compared with other methods of calibration, sum-peak demonstrated the feasibility of this methodology, particularly, for simplicity and effectiveness. (author)

  13. [Value of radioactive cesium content in selected food products. I. Content of radioactive cesium in dried milk (1987-1988)].

    Science.gov (United States)

    Skibniewska, K A; Smoczyński, S S; Werner, B

    1993-01-01

    The content of radioactive cesium in dried and dried skimmed milk from selected dairies was double determined. The highest content was found in samples from milk from OSM Siedlce (98 Bq/kg) and skimmed milk from Radzyń Podlaski and Ostrołeka, (the former 90, the latter 62 Bq/kg). The lowest level of radioactive caesium was observed in samples from dried milk from Sieradz, Słupsk, Września, Olecko and Elblag (about or below 10 Bq/kg). Although those levels of contamination with radiocesium didn't exceed values recommended by FAO they were determined as high for year 1987/88 as compared milk data from previous 1985 year. PMID:8016538

  14. Fabrication and performance of fl y ash granule filter for trapping gaseous cesium

    Directory of Open Access Journals (Sweden)

    Park Jang Jin

    2015-09-01

    Full Text Available Although a disk-type fly ash filter has shown a good performance in trapping gaseous cesium, it has difficulty in charging filters into a filter container and discharging waste filters containing radioactive cesium from a container by remote action. To solve the difficulty of the disk-type fly ash filter, five types of granule filters, including a ball type, tube type, and sponge-structure type have been made. Among them, the best filter type was chosen through simple crucible tests. The five types of granule filters packed into containers were loaded into five alumina crucibles of 50 cc. Five grams of CsNO3 was used as a gaseous cesium source. They were then placed in a muffle furnace and heated to 900°C and maintained for 2 hours. After the experiment, the weights of the cesium trapped filters were measured. Among the five types of granule filters, the sponge-structure type granule filter was the best, which has the highest trapping capacity of cesium. Its capacity is 0.42 g-Cs/g-filter. The chosen sponge-structure type granule filters and disk-type filters have been tested using a two-zone tube furnace. Cs volatilization and Cs trapping zones were maintained at 900 and 1000°C, respectively. Sixteen grams of CsNO3 was used as a gaseous cesium source. The cesium trapping profile of the sponge-structure type granule filters was almost similar to that of the disk-type fly ash filters. For both cases, cesium was successfully trapped within the third filter.

  15. Calculations of neutron and proton radii of cesium isotopes. Final report, April 23--September 30, 1993

    International Nuclear Information System (INIS)

    This task involved the calculation of neutron and proton radii of cesium isotopes. The author has written a computer code that calculates radii according to two models: Myers 1983 and FRDM 1992. Results of calculations in both these models for both cesium and francium isotopes are attached as figures. He is currently interpreting these results in collaboration with D. Vieira and J.R. Nix, and they expect to use the computer code for further studies of nuclear radii

  16. Thermoemission and adsorption properties of tungsten alloy with osmium in cesium atoms flow

    International Nuclear Information System (INIS)

    Thermoemission and absorption properties of (110) and (100) planes of monocrystal of W+0.5%Os melt in a flux of cesium atoms are studied. Despite the fact that the electron work function from planes (100) and (110) was only 0.05 eV different it turned out during adsorption of Cs atoms that plane (110) adsorbes cesium atoms much better and reduces the work function to a greater extent

  17. Dosage of cesium 137 in radioactive wastes by the application of sodium tetraphenylborate

    International Nuclear Information System (INIS)

    A simple technique of the dosage of 137Cs has been developed. The technique consists in the formation of cesium tetraphenyl borate, followed by a double extraction with isoamyl acetate, and washing of the organic phase. The counting of known parts of the cesium solution assaying of its purity by γ spectrometry enable the determination of the 137Cs. The yield is about 98 per cent. (authors)

  18. Contribution of the pectin in the cesium elimination in organism. results of analysis on Belarus children

    International Nuclear Information System (INIS)

    The results make appear that the cesium 137 would be eliminated less quick than what the ICRP considered for its models. Pectin would accelerate the cesium elimination but less quick than what is announced by its promotors. Politically speaking, the pectin is ignored by the officials of medicine and radiation protection at the pretext that its efficiency is not proved but no study is made. (N.C.)

  19. Iodine and cesium behavior during the first PBF Severe Fuel Damage Test

    International Nuclear Information System (INIS)

    The results of iodine and cesium measurements made during the Severe Fuel Damage Scoping Test at the Power Burst Facility are presented. On-line gamma spectroscopy and grab samples of the test effluent were used to measure the isotopic release histories at four locations in the effluent sampling system. Total release fractions, release rates, analysis of filter debris, and sample line deposition characteristics are discussed. Iodine and cesium release rate constants measured during the experiment are compared with published NRC data

  20. Iodine and cesium behavior during the first PBF severe fuel damage test

    International Nuclear Information System (INIS)

    The results of iodine and cesium measurements made during the Severe Fuel Damage Scoping Test at the Power Burst Facility are presented. On-line gamma spectroscopy and grab samples of the test effluent were used to measure the isotopic release histories at four locations in the effluent sampling system. Total release fractions, release rates, analysis of filter debris, and sample line deposition characteristics are discussed. Iodine and cesium release rate constants measured during the experiment are compared with published NRC data

  1. Iodine and cesium behavior during the first PBF Severe Fuel Damage test: Chapter 4

    International Nuclear Information System (INIS)

    The results of iodine and cesium measurements made during the Severe Fuel Damage Scoping Test at the Power Burst Facility are presented. On-line gamma spectroscopy and grab samples of the test effluent were used to measure the isotopic release histories at four locations in the effluent sampling system. Total release fractions, release rates, analysis of filter debris, and sample line deposition characteristics are discussed. Iodine and cesium release rate constants measured during the experiment are compared with published NRC data

  2. Enhanced electronic injection in organic light-emitting diodes by incorporating silver nanoclusters and cesium carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying-Chung; Gao, Chia-Yuan [Department of Electrical Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan (China); Chen, Kan-Lin [Department of Electronic Engineering, Fortune Institute of Technology, Kaohsiung, Taiwan (China); Sze, Po-Wen [Department of Electro-Optical Science and Engineering, Kao Yuan University, Kaohsiung, Taiwan (China); Huang, Chien-Jung, E-mail: chien@nuk.edu.tw [Department of Applied Physics, National University of Kaohsiung, Kaohsiung, Taiwan (China)

    2015-10-01

    Highlights: • The localized electric field around SNCs is enhanced. • When the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained. • The structure for efficient electron injection is critical to characteristics of the device. - Abstract: The influence of the cesium carbonate/silver nanoclusters/cesium carbonate electron-injection structure (CSC-EIS) on the performance of organic light-emitting diodes is investigated in this study. The silver nanoclusters (SNCs) are introduced between the electron-injection layers by means of thermal evaporation. When the CSC-EIS replaces the cesium carbonate electron-injection structure, higher electron-injection ability is obtained because the electron-injection barrier between the cathode and the electron-transport layer is remarkably reduced from 1.2 to 0 eV. In addition, surface plasmon resonance effect will cause the enhanced localized electric field around the SNCs, resulting that electron-injection ability is further enhanced from the cathode to the emitting layer.

  3. Cesium absorption from acidic solutions using ammonium molybdophosphate on a polyacrylonitrile support (AMP-PAN)

    International Nuclear Information System (INIS)

    Recent efforts at the Idaho Chemical Processing Plant (ICPP) have included evaluation of cesium removal technologies as applied to ICPP acidic radioactive waste streams. Ammonium molybdophosphate (AMP) immobilized on a polyacrylonitrile support (AMP-PAN) has been studied as an ion exchange agent for cesium removal from acidic waste solutions. Capacities, distribution coefficients, elutability, and kinetics of cesium-extraction have been evaluated. Exchange breakthrough curves using small columns have been determined from 1M HNO3 and simulated waste solutions. The theoretical capacity of AMP is 213 g Cs/kg AMP. The average experimental capacity in batch contacts with various acidic solutions was 150 g Cs/kg AMP. The measured cesium distribution coefficients from actual waste solutions were 3287 mL/g for dissolved zirconia calcines, and 2679 mL/g for sodium-bearing waste. The cesium in the dissolved alumina calcines was analyzed for; however, the concentration was below analytical detectable limits resulting in inconclusive results. The reaction kinetics are very rapid (2-10 minutes). Cesium absorption appears to be independent of acid concentration over the range tested (0.1 M to 5 M HNO3)

  4. Measurement of cesium emissions during the vitrification of simulated high level radioactive waste

    International Nuclear Information System (INIS)

    In the Defense Waste Processing Facility at the Savannah River Site, it is desired to eliminate a startup test that would involve adding small amounts of radioactive cesium-137 to simulated high-level waste. In order to eliminate this test, a reliable method for measuring non-radioactive cesium in the offgas system from the glass melter is required. From a pilot scale melter system, offgas particulate samples were taken on filter paper media and analyzed by Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). The ICPMS method proved to be sufficiently sensitive to measure cesium quantities as low as 0.135 μg, with the sensitivity being limited by the background cesium present in the filter paper. Typical particulate loadings ranged from 800 μg of cesium. This sensitivity allowed determination of cesium decontamination factors for four of the five major components of the offgas system. The decontamination factors measured experimentally compared favorably with the process design basis values

  5. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    International Nuclear Information System (INIS)

    Highlights: ► Prussian blue was sealed in cavities of diatomite using carbon nanotubes. ► The caged Prussian blue after being permanently immobilized in polyurethane spongy showed a 167 mg/g capability for absorbing cesium. ► Cesium elimination was accomplished by simply adding the Prussian-blue based spongiform adsorbent to radioactive water. - Abstract: We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  6. Prussian blue caged in spongiform adsorbents using diatomite and carbon nanotubes for elimination of cesium

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Baiyang [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Fugetsu, Bunshi, E-mail: hu@ees.hokudai.ac.jp [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Yu, Hongwen [Graduate School of Environmental Science, Hokkaido University, Sapporo 060-0810 (Japan); Abe, Yoshiteru [Kyoei Engineering Corporation, Niigata 959-1961 (Japan)

    2012-05-30

    Highlights: Black-Right-Pointing-Pointer Prussian blue was sealed in cavities of diatomite using carbon nanotubes. Black-Right-Pointing-Pointer The caged Prussian blue after being permanently immobilized in polyurethane spongy showed a 167 mg/g capability for absorbing cesium. Black-Right-Pointing-Pointer Cesium elimination was accomplished by simply adding the Prussian-blue based spongiform adsorbent to radioactive water. - Abstract: We developed a spongiform adsorbent that contains Prussian blue, which showed a high capacity for eliminating cesium. An in situ synthesizing approach was used to synthesize Prussian blue inside diatomite cavities. Highly dispersed carbon nanotubes (CNTs) were used to form CNT networks that coated the diatomite to seal in the Prussian blue particles. These ternary (CNT/diatomite/Prussian-blue) composites were mixed with polyurethane (PU) prepolymers to produce a quaternary (PU/CNT/diatomite/Prussian-blue), spongiform adsorbent with an in situ foaming procedure. Prussian blue was permanently immobilized in the cell walls of the spongiform matrix and preferentially adsorbed cesium with a theoretical capacity of 167 mg/g cesium. Cesium was absorbed primarily by an ion-exchange mechanism, and the absorption was accomplished by self-uptake of radioactive water by the quaternary spongiform adsorbent.

  7. Test evaluation of a cesium vapor source and regulator for thermionic space power systems

    International Nuclear Information System (INIS)

    This paper presents the results of nearly 8000 hours of testing of a fully developed cesium vapor source on the integrated TOPAZ II Ya-21U thermionic space power system. The test period included 4000 hours of system thermal vacuum operation and evaluation by Russian specialists at the Central Design Bureau for Machine Building (CDBMB), St. Petersburg, Russia; nearly 4000 hours of thermal vacuum tests at the Thermionic Systems Evaluation Test (TSET) laboratory; and mechanical tests at the Sandia National Laboratories (SNL), Albuquerque, NM. Testing of the non-nuclear Ya-21U system provided significant information for evaluation and characterization of the cesium vapor source that could not be obtained by development and qualification testing of only components. The Ya-21U system and cesium vapor source were subjected to excessive, unplanned stress levels during the system evaluation tests which resulted in leakage of oxygen into the cesium subsystem and cesium vapor from the TFEs. The information and experience gained during the thermionic system evaluation test are useful for improvement of future cesium vapor subsystem designs, test support equipment, and system test procedures. copyright 1996 American Institute of Physics

  8. Review and assessment of technologies for the separation of cesium from acidic media

    International Nuclear Information System (INIS)

    A preliminary literature survey has been conducted to identify and evaluate methods for the separation of cesium from acidic waste. The most promising solvent extraction, precipitation, and ion exchange methods, along with some of the attributes for each method, are listed. The main criteria used in evaluating the separation methods were as follows: (1) good potential for cesium separation must be demonstrated (i.e., cesium decontamination factors on the order of 50 to 100). (2) Good selectivity for cesium over bulk components must be demonstrated. (3) The method must show promise for evolving into a practical and fairly simple process. (4) The process should be safe to operate. (5) The method must be robust (i.e., capable of separating cesium from various acidic waste types). (6) Secondary waste generation must be minimized. (7) The method must show resistance to radiation damage. The most promising separation methods did not necessarily satisfy all of the above criteria, thus key areas requiring further development are suggested for each method. The report discusses in detail these and other areas requiring further development, as well as alternative solvent extraction, precipitation, ion exchange, and open-quote other close-quote technologies that, based on current information, show less promise for the separation of cesium from acidic wastes because of significant process limitations. When appropriate, the report recommends areas of future development

  9. Individual difference of concentration of radio cesium on olive flounder (Paralichthys olivaceus)

    International Nuclear Information System (INIS)

    Marine organisms were contaminated with radio cesium released from TEPCO Fukushima Nuclear Power Plants and coastal fisheries are still restricted. Olive flounder is one of the most important fishery species in Japan and live in coastal area. About one hundred of olive flounder were caught in northern and southern part of Fukushima prefecture and the concentrations of radio cesium in muscle of them were measured individually. The averages of concentration (with standard deviations) of total radio cesium in the muscle of the fish were 87.0 (72.3) Bq/kg-wet and 101 (104) Bq/kg-wet in the northern and southern coasts, respectively. Seventy percent of the results were distributed between 50 and 150 Bq/kg-wet but some of them were much higher (and much lower) than the average. According to the individuals with under 200 Bq/kg-wet of radio cesium collected in northern part of Fukushima, the concentrations of radio cesium were correlated to the amounts of 15N in the muscles. It suggests that the concentration of radio cesium in olive flounder might be influenced by the species of prey organisms that individual flounder predated a certain period before catch. (author)

  10. Modeling Ion-Exchange Processing With Spherical Resins For Cesium Removal

    Energy Technology Data Exchange (ETDEWEB)

    Hang, T.; Nash, C. A.; Aleman, S. E.

    2012-09-19

    The spherical Resorcinol-Formaldehyde and hypothetical spherical SuperLig(r) 644 ion-exchange resins are evaluated for cesium removal from radioactive waste solutions. Modeling results show that spherical SuperLig(r) 644 reduces column cycling by 50% for high-potassium solutions. Spherical Resorcinol Formaldehyde performs equally well for the lowest-potassium wastes. Less cycling reduces nitric acid usage during resin elution and sodium addition during resin regeneration, therefore, significantly decreasing life-cycle operational costs. A model assessment of the mechanism behind ''cesium bleed'' is also conducted. When a resin bed is eluted, a relatively small amount of cesium remains within resin particles. Cesium can bleed into otherwise decontaminated product in the next loading cycle. The bleed mechanism is shown to be fully isotherm-controlled vs. mass transfer controlled. Knowledge of residual post-elution cesium level and resin isotherm can be utilized to predict rate of cesium bleed in a mostly non-loaded column. Overall, this work demonstrates the versatility of the ion-exchange modeling to study the effects of resin characteristics on processing cycles, rates, and cold chemical consumption. This evaluation justifies further development of a spherical form of the SL644 resin.

  11. Behavior of cesium in municipal solid waste incineration.

    Science.gov (United States)

    Oshita, Kazuyuki; Aoki, Hiroshi; Fukutani, Satoshi; Shiota, Kenji; Fujimori, Takashi; Takaoka, Masaki

    2015-05-01

    As a result of the Fukushima Daiichi Nuclear Power Plant accident on March 11, 2011 in Japan radioactive nuclides, primarily (134)Cs and (137)Cs were released, contaminating municipal solid waste and sewage sludge in the area. Although stabilizing the waste and reducing its volume is an important issue differing from Chernobyl nuclear power plant accident, secondary emission of radioactive nuclides as a result of any intermediate remediation process is of concern. Unfortunately, there is little research on the behavior of radioactive nuclides during waste treatment. This study focuses on waste incineration in an effort to clarify the behavior of radioactive nuclides, specifically, refuse-derived fuel (RDF) with added (133)Cs (stable nuclide) or (134)Cs (radioactive nuclide) was incinerated in laboratory- and pilot-scale experiments. Next, thermogravimetric (TG) and differential thermal analysis (DTA) of stable Cs compounds, as well as an X-ray absorption fine structure (XAFS) analysis of Cs concentrated in the ashes were performed to validate the behavior and chemical forms of Cs during the combustion. Our results showed that at higher temperatures and at larger equivalence ratios, (133)Cs was distributed to the bottom ash at lower concentration, and the influence of the equivalence ratio was more significant at lower temperatures. (134)Cs behaved in a similar fashion as (133)Cs. We found through TG-DTA and XAFS analysis that a portion of Cs in RDF vaporizes and is transferred to fly ash where it exists as CsCl in the MSW incinerator. We conclude that Cs-contaminated municipal solid wastes could be incinerated at high temperatures resulting in a small amount of fly ash with a high concentration of radioactive Cs, and a bottom ash with low concentrations. PMID:25697082

  12. Behavior of cesium in municipal solid waste incineration

    International Nuclear Information System (INIS)

    As a result of the Fukushima Daiichi Nuclear Power Plant accident on March 11, 2011 in Japan radioactive nuclides, primarily 134Cs and 137Cs were released, contaminating municipal solid waste and sewage sludge in the area. Although stabilizing the waste and reducing its volume is an important issue differing from Chernobyl nuclear power plant accident, secondary emission of radioactive nuclides as a result of any intermediate remediation process is of concern. Unfortunately, there is little research on the behavior of radioactive nuclides during waste treatment. This study focuses on waste incineration in an effort to clarify the behavior of radioactive nuclides, specifically, refuse-derived fuel (RDF) with added 133Cs (stable nuclide) or 134Cs (radioactive nuclide) was incinerated in laboratory- and pilot-scale experiments. Next, thermogravimetric (TG) and differential thermal analysis (DTA) of stable Cs compounds, as well as an X-ray absorption fine structure (XAFS) analysis of Cs concentrated in the ashes were performed to validate the behavior and chemical forms of Cs during the combustion. Our results showed that at higher temperatures and at larger equivalence ratios, 133Cs was distributed to the bottom ash at lower concentration, and the influence of the equivalence ratio was more significant at lower temperatures. 134Cs behaved in a similar fashion as 133Cs. We found through TG–DTA and XAFS analysis that a portion of Cs in RDF vaporizes and is transferred to fly ash where it exists as CsCl in the MSW incinerator. We conclude that Cs-contaminated municipal solid wastes could be incinerated at high temperatures resulting in a small amount of fly ash with a high concentration of radioactive Cs, and a bottom ash with low concentrations. - Highlights: • Behaviors of Cs on the incineration of the model waste were investigated. • More Cs was moved to fly ash with increasing of equivalence ratio and temperature. • Chemical forms of Cs in the fly ash were

  13. Monitoring of radionuclides in the environment. Part. 4. Factors influencing depth profiles of radioactive cesium in soils

    International Nuclear Information System (INIS)

    In order to evaluate the vertical migration behavior of radioactive cesium, which contaminated by the Fukushima Dai-ichi NPP accident, the distribution of radioactive cesium in different type of soils, e.g., bare ground, grass land, conifer forest floor were measured on October 2011, 2012, 2013, in Abiko, Chiba, Japan. Even three years after the deposition, most of radioactive cesium were deposited in the depths of within 5 cm at anywhere in this area. Depth profiles of radioactive cesium in soil was significantly correlated with organic matter content in soils (r=0.82; p<0.0001), whereas the factors such as potassium ion and ammonium ion in soil, stable cesium content, and clay mineral content were not correlated clearly. This indicates that the vertical migration rate of radioactive cesium is very slow and it would be influenced by organic matter in soil, not just clay. (author)

  14. Weather-dependent change of cesium, strontium, barium and tellurium contamination deposited as aerosols on various cultures

    International Nuclear Information System (INIS)

    Various types of plants (wheat, bean, lettuce, radish and grass) were contaminated by dry deposition of radioactive aerosols (137Cs, 85Sr, 133Ba and 123mTe) in order to supplement the radioecological data necessary for operational post-accidental codes. A few days after deposition, rainfalls were applied to these cultures to evaluate the influence of some characteristics of the rain on the contamination of the culture over time. On the other hand, for wheat and bean, the influence of the humidity condition of the foliage at the contamination time was considered. For a given plant species at a given vegetative stage, the four radionuclides were intercepted in an identical way. The interception varied from 30% for bean (young sprout) to 80% for lettuce (near maturity). The global transfer factor values were dependent on both the radionuclides and the plant species; nevertheless, a higher value was obtained for cesium, regardless of the plant and the rainfall (from 0.006 m2 kgfresh-1 for wheat-grains - contaminated at the shooting stage - or for bean-pods - contaminated at the pre-flowering stage - to 0.1 m2 kgfresh-1 for a whole lettuce). The analysis of the results allowed us on the one hand, to extract parameter values of the foliar transfer directly usable in operational codes, in particular those relating to barium and tellurium, unknown until then, and on the other hand, to lay the foundations of a future, more mechanistic model, taking into account the foliar processes in a finer way

  15. Engineered Materials for Cesium and Strontium Storage Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Sean M. McDeavitt

    2010-04-14

    Closing the nuclear fuel cycle requires reprocessing spent fuel to recover the long-lived components that still have useful energy content while immobilizing the remnant waste fission products in stable forms. At the genesis of this project, next generation spent fuel reprocessing methods were being developed as part of the U.S. Department of Energy's Advanced Fuel Cycle Initiative. One of these processes was focused on solvent extraction schemes to isolate cesium (Cs) and strontium (Sr) from spent nuclear fuel. Isolating these isotopes for short-term decay storage eases the design requirements for long-term repository disposal; a significant amount of the radiation and decay heat in fission product waste comes from Cs-137 and Sr-90. For the purposes of this project, the Fission Product Extraction (FPEX) process is being considered to be the baseline extraction method. The objective of this project was to evaluate the nature and behavior of candidate materials for cesium and strontium immobilization; this will include assessments with minor additions of yttrium, barium, and rubidium in these materials. More specifically, the proposed research achieved the following objectives (as stated in the original proposal): (1) Synthesize simulated storage ceramics for Cs and Sr using an existing labscale steam reformer at Purdue University. The simulated storage materials will include aluminosilicates, zirconates and other stable ceramics with the potential for high Cs and Sr loading. (2) Characterize the immobilization performance, phase structure, thermal properties and stability of the simulated storage ceramics. The ceramic products will be stable oxide powders and will be characterized to quantify their leach resistance, phase structure, and thermophysical properties. The research progressed in two stages. First, a steam reforming process was used to generate candidate Cs/Sr storage materials for characterization. This portion of the research was carried out at

  16. Engineered Materials for Cesium and Strontium Storage. Final Technical Report

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle requires reprocessing spent fuel to recover the long-lived components that still have useful energy content while immobilizing the remnant waste fission products in stable forms. At the genesis of this project, next generation spent fuel reprocessing methods were being developed as part of the U.S. Department of Energy's Advanced Fuel Cycle Initiative. One of these processes was focused on solvent extraction schemes to isolate cesium (Cs) and strontium (Sr) from spent nuclear fuel. Isolating these isotopes for short-term decay storage eases the design requirements for long-term repository disposal; a significant amount of the radiation and decay heat in fission product waste comes from Cs-137 and Sr-90. For the purposes of this project, the Fission Product Extraction (FPEX) process is being considered to be the baseline extraction method. The objective of this project was to evaluate the nature and behavior of candidate materials for cesium and strontium immobilization; this will include assessments with minor additions of yttrium, barium, and rubidium in these materials. More specifically, the proposed research achieved the following objectives (as stated in the original proposal): (1) Synthesize simulated storage ceramics for Cs and Sr using an existing labscale steam reformer at Purdue University. The simulated storage materials will include aluminosilicates, zirconates and other stable ceramics with the potential for high Cs and Sr loading. (2) Characterize the immobilization performance, phase structure, thermal properties and stability of the simulated storage ceramics. The ceramic products will be stable oxide powders and will be characterized to quantify their leach resistance, phase structure, and thermophysical properties. The research progressed in two stages. First, a steam reforming process was used to generate candidate Cs/Sr storage materials for characterization. This portion of the research was carried out at Purdue

  17. Effect of electrolytes concentration on recovery of cesium from AMP-PAN by Electrodialysis-Ion Exchange (EDIX)

    International Nuclear Information System (INIS)

    Cesium from the simulated acidic waste solution was separated using Ammonium Molybdophosphate (AMP) - Polyacrylonitrile (PAN) ion exchange resin in column operations. Electrodialysis - Ion exchange (EDIX) has been tried for the recovery of cesium from the AMP-PAN which was saturated with cesium. The electrodialysis setup consists of three compartments; cesium loaded AMP-PAN is placed in the middle compartment and is separated from the anode and cathode compartments by cation exchange membranes. Ammonium sulphate was used as anolyte and HNO3 as catholyte. 0.1N HNO3 was circulated in the middle compartment containing AMP-PAN to keep the resin in acidic form. On application of potential, the ammonium ions from the anode compartment migrate towards cathode through the middle compartment where they exchange with cesium ions on the resin and the exchanged cesium ions migrate towards cathode to get concentrated. Some part of cesium is recovered in the middle compartment due to convection. Cesium recovery from the AMP-PAN in the electrodialysis setup was studied at different anolyte and catholyte concentrations. All the experiments were carried out at constant current density of 40 mA/cm2 for 15h. It was found that more than 50% of cesium recovery was observed for all the experiments studied and recovery percentage increased with increasing the anolyte concentration. It was observed that the electrolytes concentration affects the voltage drop across the cell

  18. Binding characteristics of 9-fluoropropyl-(+)-dihydrotetrabenzazine (AV-133) to the vesicular monoamine transporter type 2 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Tsao, H.-H. [Department of Medical Imaging and Radiological Sciences, Chang Gung University, Taoyuan, Taiwan (China); Lin, K.-J. [Department of Medical Imaging and Radiological Sciences, Chang Gung University, Taoyuan, Taiwan (China); Department of Nuclear Medicine, Chang Gung University and Memorial Hospital, Taoyuan, Taiwan (China); Juang, J.-H. [Division of Endocrinology and Metabolism, Chung Gung University and Chung Gung Memorial Hospital, Taoyuan, Taiwan (China); Skovronsky, Daniel M. [Avid Radiopharmaceuticals, Philadelphia, PA (United States); Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Yen, T.-C. [Department of Nuclear Medicine, Chang Gung University and Memorial Hospital, Taoyuan, Taiwan (China); Wey, S.-P. [Department of Medical Imaging and Radiological Sciences, Chang Gung University, Taoyuan, Taiwan (China); Kung, M.-P. [Department of Medical Imaging and Radiological Sciences, Chang Gung University, Taoyuan, Taiwan (China); Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States)], E-mail: kungmp@sunmac.spect.upenn.edu

    2010-05-15

    The vesicular monoamine transporter type 2 (VMAT2) is highly expressed in pancreatic {beta}-cells and thus has been proposed to be a potential target for measuring {beta}-cell mass (BCM) by molecular imaging. C-11- and F-18-labeled tetrabenazine derivatives targeting VMAT2 have shown some promising results as potential biomarkers for BCM. In the present study, we examined the binding characteristics of 9-fluoropropyl-(+)-dihydrotetrabenzazine ([{sup 18}F]AV-133), a potential PET tracer for BCM imaging, in rat pancreas and rat brain. Methods: Pancreatic exocrine cells and pancreatic islet cells were isolated and purified from Sprague-Dawley rats. Membrane homogenates, prepared from both pancreatic exocrine and islet cells as well as from brain striatum and hypothalamus regions, were used for in vitro binding studies. In vitro and ex vivo autoradiography studies with [{sup 18}F]AV-133 were performed on rat brain and rat pancreas sections. Immunohistochemistry studies were performed to confirm the distribution of VMAT2 on islet {beta}-cells. Results: Excellent binding affinities of [{sup 18}F]AV-133 were observed in rat striatum and hypothalamus homogenates with K{sub d} values of 0.19 and 0.25 nM, respectively. In contrast to single-site binding observed in rat striatum homogenates, rat islet cell homogenates showed two saturable binding sites (site A: K{sub d}=6.76 nM, B{sub max}=60 fmol/mg protein; site B: K{sub d}=241 nM, B{sub max}=1500 fmol/mg protein). Rat exocrine pancreas homogenates showed only a single low-affinity binding site (K{sub d}=209 nM), which was similar to site B in islet cells. In vitro autoradiography of [{sup 18}F]AV-133 using frozen sections of rat pancreas showed specific labeling of islets, as evidenced by co-localization with anti-insulin antibody. Ex vivo VMAT2 pancreatic autoradiography in the rat, however, was not successful, in contrast to the excellent ex vivo autoradiography of VMAT2 binding sites in the brain. In vivo/ex vivo islet

  19. Study of the elastic scattering differential cross sections of a proton beam by a cesium target

    International Nuclear Information System (INIS)

    The elastic differential cross section of H+ on Cs is studied experimentally and theoretically. The experimental device is described, after which the differential cross-section values obtained as a function of the laboratory angle are given for four incident energies: 13.4 eV, 15.1 eV, 17.7 eV and 24.2 eV. By means of an interaction potential of the quasi-molecule H+Cs the differential cross sections are calculated for the same incident energies; this calculation uses the semi-classical method of stationary phases which shows clearly the limits of conventional description and the changes introduced by quantum effects. Very good agreement is obtained between theoretical and experimental results, which shows that elastic scattering is very little perturbed by inelastic channels in this energy range. The estimated inelastic cross section at 24 eV is about 1.9 10-15cm2, corresponding to 1.6% of the scattering process

  20. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica;

    2013-01-01

    duplications that include both the YWHAE and LIS1 genes. These patients had a relatively distinct facial phenotype and frequent structural brain abnormalities involving the corpus callosum, cerebellar vermis, and cranial base. Autism spectrum disorders were seen in a third of duplication probands, most......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...

  1. Buoyant Bubbles and the Disturbed Cool Core of Abell 133

    Science.gov (United States)

    Randall, Scott W.; Clarke, T.; Nulsen, P.; Owers, M.; Sarazin, C.; Forman, W.; Jones, C.; Murray, S.

    2010-03-01

    X-ray cavities, often filled with radio-emitting plasma, are routinely observed in the intracluster medium of clusters of galaxies. These cavities, or "bubbles", are evacuated by jets from central AGN and subsequently rise buoyantly, playing a vital role in the "AGN feedback" model now commonly evoked to explain the balance between heating and radiative cooling in cluster cores. As the bubbles rise, they can displace cool central gas, promoting mixing and the redistribution of metals. I will show a few examples of buoyant bubbles, then argue that the peculiar morphology of the Abell 133 is due to buoyant lifting of cool central gas by a radio-filled bubble.

  2. Study of regional lung function with xenon 133

    International Nuclear Information System (INIS)

    Exploration of regional lung function includes study of the closed circuit perfusion and ventilation respectively by injection and inhalation of xenon 133. The radiation is measured across the chest using 4 fixed scintillation counters, placed opposite the subject's back, 2 per lung field. Theoretical regional values using 15 normal young subjects are determined. Three cases justified the practical interest of this method. The percentage of variation for the parameters studied was about 10%. The method proved very useful for the clinician to whom it provides a numerical assessment of regional ventilation and perfusion

  3. Regional study of ventilation with inhaled xenon 133 in children

    International Nuclear Information System (INIS)

    A regional exploration of pulmonary ventilation in a population of 104 infants and children by a study of distribution and washout of xenon 133 inhaled with rebreathing is carried out. The results are expressed by photographs (gamma-camera) and time-activity curves. The indications for regional exploration were oriented by the existence on the straight X-ray film of a localised ventilation disorder (a hyperlucent area or an opacity). This study permitted physiopathological analysis and guided endobronchial examinations. The functional results obtained, complete and explain other methods of exploration of lung function by spirography, ventilatory mechanics, transthoracic electrical measurements and study of lung perfusion with technetium 99m

  4. A 15q13.3 microdeletion segregating with autism

    OpenAIRE

    Pagnamenta, Alistair T.; Wing, Kirsty; Akha, Elham Sadighi; Knight, Samantha JL; Bölte, Sven; Schmötzer, Gabriele; Duketis, Eftichia; Poustka, Fritz; Klauck, Sabine M; Poustka, Annemarie; Ragoussis, Jiannis; Bailey, Anthony J; Monaco, Anthony P

    2008-01-01

    Autism and mental retardation (MR) show high rates of comorbidity and potentially share genetic risk factors. In this study, a rare ∼2 Mb microdeletion involving chromosome band 15q13.3 was detected in a multiplex autism family. This genomic loss lies between distal break points of the Prader–Willi/Angelman syndrome locus and was first described in association with MR and epilepsy. Together with recent studies that have also implicated this genomic imbalance in schizophrenia, our data indicat...

  5. 133Xe labelling of acrylate for catheter embolisation

    International Nuclear Information System (INIS)

    A method for radio-nucleide labelling of histo-acryl/lipiodol with 133Xe gas is described. The method consists of disolving the gas in lipiodol under sterile conditions. After embolisation and angiography, the localisation of the embolising material can be determined by means of a scintillation camera. The labelling method was used in 15 patients. In all patients the position of the embolising material, as demonstrated by scintigraphy, corresponded with the radiological findings. It was not possible to demonstrate escape of the material by scintigraphy. (orig.)

  6. Gamma-ray spectroscopic determination of iodine-131 and cesium-137 in foods: Two collaborative studies

    International Nuclear Information System (INIS)

    The AOAC method for iodine-131, cesium-137, and barium-140 in milk by gamma-ray spectroscopy (48.025-48.029) was extended to include other foods for the radionuclides iodine-131 and cesium-137. Two collaborative studies were performed to validate this extension. In the first study, a food sample containing 119 pCi 131I/kg and 53 pCi 137Cs/kg was sent to each of 45 laboratories for triplicate analyses. For 25 responses, the mean of the reported values was 123.8 pCi/kg for iodine-131, and for 27 responses, the mean was 53.4 pCi/kg for cesium-137. Repeatability (within-laboratory) standard deviations (Sr) for iodine-131 and cesium-137 were 4.6 and 3.7 pCi/kg, respectively. Reproducibility (among-laboratories) standard deviations (SR) for iodine-131 and cesium-137 were 12.1 and 6.0 pCi/kg, respectively. In the second study, a food sample containing 25 pCi 131I/kg and 27 pCi 137Cs/kg was sent to each of 54 laboratories for triplicate analyses. For 21 responses, the mean of the reported values was 25.0 pCi/kg for iodine-131, and for 19 responses, the mean was 28.9 pCi/kg for cesium-137. Sr Values were 4.0 and 1.6 pCi/kg for iodine-131 and cesium-137, respectively, and SR values were 5.0 and 2.8 pCi/kg, respectively. The method extension was adopted official first action

  7. Preparation and characterization of cesium-137 aluminosilicate pellets for radioactive source applications

    International Nuclear Information System (INIS)

    Twenty-seven fully loaded 137Cs aluminosilicate pellets were fabricated in a hot cell by the vacuum hot pressing of a cesium carbonate/montmorillonite clay mixture at 15000C and 570 psig. Four pellets were selected for characterization studies which included calorimetric measurements, metallography, scanning electron microscope and electron backscattering (SEM-BSE), electron microprobe, x-ray diffraction, and cesium ion leachability measurements. Each test pellet contained 437 to 450 curies of 137Cs as determined by calorimetric measurements. Metallographic examinations revealed a two-phase system: a primary, granular, gray matrix phase containing large and small pores and small pore agglomerations, and a secondary fused phase interspersed throughout the gray matrix. SEM-BSE analyses showed that cesium and silicon were uniformly distributed throughout both phases of the pellet. This indicated that the cesium-silicon-clay reaction went to completion. Aluminum homogeneity was unconfirmed due to the high background noise associated with the inherent radioactivity of the test specimens. X-ray diffraction analyses of both radioactive and non-radioactive aluminosilicate pellets confirmed the crystal lattice structure to be pollucite. Cesium ion quasistatic leachability measurements determined the leach rates of fully loaded 137Cs sectioned pollucite pellets to date to be 4.61 to 34.4 x 10-10 kg m-2s-1, while static leach tests performed on unsectioned fully loaded pellets showed the leach rates of the cesium ion to date to be 2.25 to 3.41 x 10-12 kg m-2s-1. The cesium ion diffusion coefficients through the pollucite pellet were calculated using Fick's first and second laws of diffusion. The diffusion coefficients calculated for three tracer level 137Cs aluminosilicate pellets were 1.29 x 10-16m2s-1, 6.88 x 10-17m2s-1, and 1.35 x 10-17m2s-1, respectively

  8. Co-precipitation and solubility studies of cesium, potassium and sodium tetraphenylborate

    International Nuclear Information System (INIS)

    This report contains the results from a study requested by High Level Waste on the co-precipitation and solubility of cesium, potassium, and sodium tetraphenylborate. Co-precipitation of cesium (Cs), potassium (K), and sodium (Na) tetraphenylborate (TPB) helps determine the efficiency of reagent usage in the Small Tank Precipitation Process. This process uses NaTPB to remove cesium from waste by means of precipitation. Previous studies by McCabe suggested that if the sodium ion concentration [Na+] increased the rate at which cesium tetraphenylborate (CsTPB) precipitates also increases. Serkiz also demonstrated that the precipitation of potassium tetraphenylborate (KTPB) in the presence of high [Na+] (∼5M) appears to produce a mixed solid phase composed of NaTPB and KTPB together in the crystal lattice. In the crystallographic structure of these three tetraphenylborate salts (Cs,K,NaTPB), the tetraphenylborate ion dominates the size of the crystals. Also, note that the three crystals have nearly identical structures with the exception of two additional peaks in the cesium pattern. Given these similarities, TPB precipitation in the presence of Na+, Cs+ and K+ likely produces an impure isomorphic crystalline mixture of CsTPB, KTPB and NaTPB. The authors speculate that the primary crystalline structure resembles that of KTPB with NaTPB and CsTPB mixed throughout the crystal structure. The precipitation of NaTPB makes some of the anticipated excess tetraphenylborate relatively unavailable for precipitation of cesium. Thus, the amount of excess tetraphenylborate required to completely precipitate all of the potassium and cesium may increase significantly

  9. Improvement of cesium retention in uranium dioxide by additional phases; Amelioration de la retention du cesium dans le dioxyde d`uranium au moyen de phases exogenes

    Energy Technology Data Exchange (ETDEWEB)

    Gamaury Dubois, S.

    1995-09-19

    The objective of this study is to improve the cesium retention in nuclear fuel. A bibliographic survey indicates that cesium is rapidly released from uranium dioxide in an accident condition. At temperatures higher than 1500 deg C or in oxidising conditions, our experiments show the difficulty of maintaining cesium inside simulated fuel. Two ternary systems are potentially interesting for the retention of cesium and to reduce the kinetics of release from the fuel: Cs{sub 2}O-Al{sub 2}O{sub 3}-SiO{sub 2} et Cs{sub 2}O-ZrO{sub 2}-SO{sub 2}. The compounds CsAISi{sub 2}O{sub 6} and Cs{sub 2}ZrSi{sub 6}O{sub 15} were studied from 1200 deg C to 2000 deg C by thermogravimetric analysis. The volumetric diffusion coefficients of cesium in these structures, in solid state as well as in liquid one, were measured. A fuel was sintered with (Al{sub 2}O{sub 3} + SiO{sub 2}) or (ZrO{sub 2} + SiO{sub 2}) and the intergranular phase was characterized. In the presence of (Al{sub 2}O{sub 3} + SiO{sub 2}), the sintering is realized at 1610 deg C in H{sub 2}. It is a liquid phase sintering. On the other end, with (ZrO{sub 2} + SiO{sub 2}), the sintering is a low temperature one in oxidising atmosphere. Finally, cesium containing simulated fuels were produced with these additives. According to the effective diffusion coefficients that were measured, the additives improved the retention of cesium. We have predicted the improvement that could be hoped for in a nuclear reactor, depending on the dispersion of the intergranular additives, the temperature and the degree of oxidation of the UO{sub 2+x}. We wait for a factor of 2 for x=0 and more than 8 for x=0.05, up to 2000 deg C. (author). 148 refs., 122 figs., 34 tabs.

  10. Ion exchange performance of commercial crystalline silicotitanates for cesium removal

    International Nuclear Information System (INIS)

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST), invented by researchers at Sandia National Laboratories and Texas A ampersand M University, has been commercialized in a joint Sandia-UOP effort. The original developmental materials exhibited high selectivity for the ion exchange of cesium, strontium, and several other radionuclides from highly alkaline solutions containing molar concentrations of Na+. The materials also showed excellent chemical and radiation stability. Together, the high selectivity and stability of the CSTs made them excellent candidates for treatment of solutions such as the Hanford tank supernates and other DOE radwastes. Sandia National Laboratories and UOP have teamed under a Cooperative Research and Development Agreement (CRADA) to develop CSTs in the powdered form and in an engineered form suitable for column ion exchange use. A continuous-flow, column ion exchange process is expected to be used to remove Cs and other radionuclides from the Hanford supernatant. The powder material invented by the Sandia and Texas A ampersand M team consists of submicron-size particles. It is not designed for column ion exchange but may be used in other applications

  11. Ion exchange performance of commercial crystalline silicotitanates for cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Braun, R.; Dangieri, T.J.; Fennelly, D.J. [and others

    1996-03-01

    A new class of inorganic ion exchangers called crystalline silicotitanates (CST), invented by researchers at Sandia National Laboratories and Texas A&M University, has been commercialized in a joint Sandia-UOP effort. The original developmental materials exhibited high selectivity for the ion exchange of cesium, strontium, and several other radionuclides from highly alkaline solutions containing molar concentrations of Na{sup +}. The materials also showed excellent chemical and radiation stability. Together, the high selectivity and stability of the CSTs made them excellent candidates for treatment of solutions such as the Hanford tank supernates and other DOE radwastes. Sandia National Laboratories and UOP have teamed under a Cooperative Research and Development Agreement (CRADA) to develop CSTs in the powdered form and in an engineered form suitable for column ion exchange use. A continuous-flow, column ion exchange process is expected to be used to remove Cs and other radionuclides from the Hanford supernatant. The powder material invented by the Sandia and Texas A&M team consists of submicron-size particles. It is not designed for column ion exchange but may be used in other applications.

  12. Hanford Isotope Project strategic business analysis Cesium-137 (Cs-137)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    The purpose of this business analysis is to address the beneficial reuse of Cesium 137 (Cs-137) in order to utilize a valuable national asset and possibly save millions of tax dollars. Food irradiation is the front runner application along with other uses. This business analysis supports the objectives of the Department of Energy National Isotope Strategy distributed in August 1994 which describes the DOE plans for the production and distribution of isotope products and services. As part of the Department`s mission as stated in that document. ``The Department of Energy will also continue to produce and distribute other radioisotopes and enriched stable isotopes for medical diagnostics and therapeutics, industrial, agricultural, and other useful applications on a businesslike basis. This is consistent with the goals and objectives of the National Performance Review. The Department will endeavor to look at opportunities for private sector to co-fund or invest in new ventures. Also, the Department will seek to divest from ventures that can more profitably or reliably be operated by the private sector.``

  13. Biogeochemistry of Cesium in a Sagebrush Steppe Ecosystem

    Science.gov (United States)

    Palmer, C. D.; Hess, J. R.; Hamilton, M. A.; Cook, L. L.; Siegel, L. S.; Yancey, N. A.

    2002-12-01

    The nature of radiocesium sources is such that they often have resulted in the contamination of shallow (SL-1 reactor show changes in concentrations and transfer factors with the stage of plant growth. The samples included both rhizosphere and bulk soils as well as roots and shoots from the crested wheatgrass. The ranges of total cesium in rhizosphere and bulk soils are similar, are fairly narrow (1.7 to 5.2 mg kg-1), and do not appear to vary seasonally. In contrast, 137Cs activities in rhizosphere and bulk soils are significantly different, vary over orders of magnitude (10-180 pCi g-1), and show seasonal differences. Shoot and root 137Cs activities decrease between April and May. Total Cs shoot-to-root ratios are greater than the corresponding ratios for radiocesium. Total Cs root-to-rhizosphere soil ratios are lower than the corresponding ratios for 137Cs. These results are being used to enhance our understanding of phytoremediation scenarios and issues associated with long-term stewardship of 137Cs-contaminated lands.

  14. Cesium sorption and desorption behavior of clay minerals

    International Nuclear Information System (INIS)

    Cesium sorption and desorption of clay minerals (montmorillonite, beidellite, nontronite, weathered biotite, rectorite and illite) were investigated by consecutive sorption-desorption (CSD) experiments. In batch sorption experiment, two solutions with different Cs concentration 10-3 and 10-7 mol/L) were used. In batch desorption experiments, Cs sorbed samples in sorption experiments were treated 5 times with 1 mol/L ammonium acetate solution. In the case of CSD experiments using 10-3 mol/L Cs solution, the exchangeable cations (Na, Ca, and K) in the clay samples affected to the sorption ratio of Cs, and this effect depended on the type of clay mineral. The desorption ratios of untreated, Na-exchanged and Ca-exchanged weathered biotite ranged from 23 to 33%, while that of other samples was over 80%. In the case of CSD experiments using 10-7 mol/L Cs solution, the sorption ratio of montmorillonite was smaller than that of the other clay samples. In desorption experiments, more than 10-9 mol sorbed Cs remained in 1.0 g of the sample after 5 extraction times. These results indicate that all examined clay samples are able to strongly adsorb Cs with a capacity of more than 10-9 mol/g. (author)

  15. ATLAS tile calorimeter cesium calibration control and analysis software

    International Nuclear Information System (INIS)

    An online control system to calibrate and monitor ATLAS Barrel hadronic calorimeter (TileCal) with a movable radioactive source, driven by liquid flow, is described. To read out and control the system an online software has been developed, using ATLAS TDAQ components like DVS (Diagnostic and Verification System) to verify the hardware before running, IS (Information Server) for data and status exchange between networked computers, and other components like DDC (DCS to DAQ Connection), to connect to PVSS-based slow control systems of Tile Calorimeter, high voltage and low voltage. A system of scripting facilities, based on Python language, is used to handle all the calibration and monitoring processes from hardware perspective to final data storage, including various abnormal situations. A QT based graphical user interface to display the status of the calibration system during the cesium source scan is described. The software for analysis of the detector response, using online data, is discussed. Performance of the system and first experience from the ATLAS pit are presented

  16. Broadband Vibrational Cooling of Cold Cesium Molecules: Theory and Experiments

    Institute of Scientific and Technical Information of China (English)

    D. Sofikitis; A. Fioretti; S. Weber; M. Viteau; A. Chotia; R. Horchani; M. Allegrini; B. Chatel; D. Comparat; P. Pillet

    2009-01-01

    The use of a broadband, frequency shaped femtosecond laser on translationally cold cesium molecules has recently demonstrated to be a very efficient method of cooling also the vibrational degree of freedom. A sample of cold molecules, initially distributed over several vibrational levels, has thus been transfered into a single selected vibrational level of the singlet X1∑g ground electronic state. Our method is based on repeated optical pumping by laser light with a spectrum broad enough to excite all populated vibrational levels but limited in its frequency bandwidth with a spatial light modulator. In such a way we are able to eliminate transitions from the selected level, in which molecules accumulate. In this paper we briefly report the main experimental results and then address, in a detailed way by computer simulations, the perspectives for a "complete" cooling of the molecules, including also the rotational degree of freedom. Since the pumping process strongly depends on the rclative shape of the ground and excited potential curves, ro-vibrational cooling through different excited states is theoretically compared.

  17. Evaluation of a cesium adsorbent grafted with ammonium 12-molybdophosphate

    Science.gov (United States)

    Shibata, Takuya; Seko, Noriaki; Amada, Haruyo; Kasai, Noboru; Saiki, Seiichi; Hoshina, Hiroyuki; Ueki, Yuji

    2016-02-01

    A fibrous cesium (Cs) adsorbent was developed using radiation-induced graft polymerization with a cross-linked structure containing a highly stable adsorption ligand. The ligand, ammonium 12-molybdophosphate (AMP), was successfully introduced onto the fibrous polyethylene trunk material. The resulting Cs adsorbent contained 36% nonwoven fabric polyethylene (NFPE), 1% AMP, 2% triallyl isocyanurate (TAIC) and 61% glycidyl methacrylate (GMA). The adsorbent's Cs adsorption capacity was evaluated using batch and column tests. It was determined that the adsorbent could be used in a wide pH range. The amount of desorbed molybdenum, which can be used as an estimate for AMP stability on the Cs adsorbent, was minimized at the standard drinking water pH range of 5.8-8.6. Based from the inspection on the adherence of these results to the requirements set forth by the Food Sanitation Act by a third party organization, it can be concluded that the developed Cs adsorbent can be safely utilized for drinking water.

  18. Hanford Isotope Project strategic business analysis Cesium-137 (Cs-137)

    International Nuclear Information System (INIS)

    The purpose of this business analysis is to address the beneficial reuse of Cesium 137 (Cs-137) in order to utilize a valuable national asset and possibly save millions of tax dollars. Food irradiation is the front runner application along with other uses. This business analysis supports the objectives of the Department of Energy National Isotope Strategy distributed in August 1994 which describes the DOE plans for the production and distribution of isotope products and services. As part of the Department's mission as stated in that document. ''The Department of Energy will also continue to produce and distribute other radioisotopes and enriched stable isotopes for medical diagnostics and therapeutics, industrial, agricultural, and other useful applications on a businesslike basis. This is consistent with the goals and objectives of the National Performance Review. The Department will endeavor to look at opportunities for private sector to co-fund or invest in new ventures. Also, the Department will seek to divest from ventures that can more profitably or reliably be operated by the private sector.''

  19. Proton tunneling in low dimensional cesium silicate LDS-1

    International Nuclear Information System (INIS)

    In low dimensional cesium silicate LDS-1 (monoclinic phase of CsHSi2O5), anomalous infrared absorption bands observed at 93, 155, 1210, and 1220 cm−1 are assigned to the vibrational mode of protons, which contribute to the strong hydrogen bonding between terminal oxygen atoms of silicate chain (O–O distance = 2.45 Å). The integrated absorbance (oscillator strength) for those modes is drastically enhanced at low temperatures. The analysis of integrated absorbance employing two different anharmonic double-minimum potentials makes clear that proton tunneling through the potential barrier yields an energy splitting of the ground state. The absorption bands at 93 and 155 cm−1, which correspond to the different vibrational modes of protons, are attributed to the optical transition between the splitting levels (excitation from the ground state (n = 0) to the first excited state (n = 1)). Moreover, the absorption bands at 1210 and 1220 cm−1 are identified as the optical transition from the ground state (n = 0) to the third excited state (n = 3). Weak Coulomb interactions in between the adjacent protons generate two types of vibrational modes: symmetric mode (93 and 1210 cm−1) and asymmetric mode (155 and 1220 cm−1). The broad absorption at 100–600 cm−1 reveals an emergence of collective mode due to the vibration of silicate chain coupled not only with the local oscillation of Cs+ but also with the proton oscillation relevant to the second excited state (n = 2)

  20. Cesium 137 redistribution by horizontal migration in soil

    International Nuclear Information System (INIS)

    During radiation monitoring the local nonuniformities of contamination density were noticed which can not be explained by meteorologic conditions at the moment of fallout. The mathematical model of redistribution of cesium 137 radionuclides of Chernobyl origin for the post accidental period on account of migration with horizontal outflow in the upper layer of soils was developed. It has been shown that for nonuniform landscapes (borders of fields, forests, roads etc.) redistribution of radionuclides with increasing of their concentration at the places, where the objects with different migration characteristics are connected, will take place. In Belarus the typical size of such 'spots' will increase with the time up to 1 m/year. It is possible the increasing of contamination density of territories on account of the process of shifting of radioactive 'spots', caused by horizontal flow. The speed of replacement of such 'spots' along the direction of underground water is about 1 m/year; increasing of their typical size is going on with the speed up to 0.3 m/year. 4 refs., 1 fig

  1. Desorption of cesium from granite under various aqueous conditions

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T.-H. [Institute of Nuclear Engineering and Science, National Tsing Hua University, Hsinchu 300, Taiwan (China); Li, M.-H. [Institute of Hydrological and Oceanic Sciences, National Central University, Jungli 320, Taiwan (China); Wei, Y.-Y. [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu 300, Taiwan (China); Teng, S.-P., E-mail: spteng@ess.nthu.edu.t [Institute of Nuclear Engineering and Science, National Tsing Hua University, Hsinchu 300, Taiwan (China)

    2010-12-15

    In this work the desorption of cesium ions from crushed granite in synthetic groundwater (GW) and seawater (SW) was investigated. Results were compared with those obtained in deionized water (DW) and in two kinds of extraction solutions, namely: MgCl{sub 2} and NaOAc (sodium acetate). In general, the desorption rate of Cs from crushed granite increased proportionally with initial Cs loadings. Also, amounts of desorbed Cs ions followed the tendency in the order SW>GW>NaOAc{approx}MgCl{sub 2}>DW solutions. This indicated that the utilization of extraction reagents for ion exchange will underestimate the Cs desorption behavior. Fitting these experimental data by Langmuir model showed that these extraction reagents have reduced Cs uptake by more than 90%, while only less than 1% of adsorbed Cs ions are still observed in GW and SW solutions in comparison to those in DW. Further SEM/EDS mapping studies clearly demonstrate that these remaining adsorbed Cs ions are at the fracture areas of biotite.

  2. The crystal structures of potassium and cesium trivanadates

    Science.gov (United States)

    Evans, H.T., Jr.; Block, S.

    1966-01-01

    Potassium and cesium trivanadates are monoclinic and isomorphous, space group P21/m, with the following dimensions (Z = 2): KV3O8, a = 7.640 A, b = 8.380 A, c = 4.979 A, ??= 96?? 57???; CsV3O8, a = 8.176 A, b = 8.519 A, c = 4.988 A, ?? = 95?? 32???. The crystal structure of KV3O8 has been determined from hk0, 0kl, and h0l Weissenberg data with an R factor of 0.15. The structure of CsV3O8 has been refined with 1273 hkl Weissenberg data to an R factor of 0.089. The structures consist of corrugated sheets based on a linkage of distorted VO6, octahedra. Two of the vanadium atoms lie in double, square-pyramid groups V2O8, which are linked through opposite basal corners into chains along the b axis. The chains are joined laterally along the c axis into sheets by the third vanadium atom in VO groups, also forming part of a square-pyramid coordination. Various aspects of these structures are compared with other known oxovanadate structures.

  3. Biology and clinical implications of CD133{sup +} liver cancer stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Stephanie, E-mail: stefma@hku.hk [Department of Clinical Oncology, State Key Laboratory for Liver Research, LKS Faculty of Medicine, The University of Hong Kong (Hong Kong)

    2013-01-15

    Hepatocellular carcinoma (HCC) is the most common primary malignant tumor of the liver, accounting for 80%–90% of all liver cancers. The disease ranks as the fifth most common cancer worldwide and is the third leading cause of all cancer-associated deaths. Although advances in HCC detection and treatment have increased the likelihood of a cure at early stages of the disease, HCC remains largely incurable because of late presentation and tumor recurrence. Only 25% of HCC patients are deemed suitable for curative treatment, with the overall survival at just a few months for inoperable patients. Apart from surgical resection, loco-regional ablation and liver transplantation, current treatment protocols include conventional cytotoxic chemotherapy. But due to the highly resistant nature of the disease, the efficacy of the latter regimen is limited. The recent emergence of the cancer stem cell (CSC) concept lends insight into the explanation of why treatment with chemotherapy often may seem to be initially successful but results in not only a failure to eradicate the tumor but also possibly tumor relapse. Commonly used anti-cancer drugs in HCC work by targeting the rapidly proliferating and differentiated liver cancer cells that constitute the bulk of the tumor. However, a subset of CSCs exists within the tumor, which are more resistant and are able to survive and maintain residence after treatment, thus, growing and self-renewing to generate the development and spread of recurrent tumors in HCC. In the past few years, compelling evidence has emerged in support of the hierarchic CSC model for solid tumors, including HCC. And in particular, CD133 has drawn significant attention as a critical liver CSC marker. Understanding the characteristics and function of CD133{sup +} liver CSCs has also shed light on HCC management and treatment, including the implications for prognosis, prediction and treatment resistance. In this review, a detailed summary of the recent progress

  4. Xenon-133 determination of muscle blood flow in electrical injury

    International Nuclear Information System (INIS)

    Xe-133 washout determination of muscle blood flow (MBF) was used to detect muscle ischemia in electrical injury of an experimental animal model and three patients. The control MBF of rabbit hindlimbs, which averaged 11.29 +- 1.07 cc/min/100 gm, was significantly reduced by electrical injury, to 5.82 +- 1.49 cc/min/100 gm (p less than 0.001). An electrical injury of 4,000 watt-seconds or greater was associated with uniform MBF less than 1.00 cc/min/100 gm and with histopathologic alterations of muscle necrosis. Thenar MBF less than 1.00 cc/min/100 gm in two patients was associated with muscle necrosis requiring distal arm amputation. The remaining patient with sequential muscle blood flows above this level had uneventful healing of hand electrical injuries. Xe-133 determination of MBF may be a useful objective technique to determine the extent of electrical injury in muscle

  5. Interactions between cesium and dispersed kaolinite powders at high temperatures for the treatment of mixed wastes

    International Nuclear Information System (INIS)

    The potential use of sorbents to manage emissions of trace radiological metals during mixed waste incineration was investigated using a down-fired 82-k W-rated laboratory-scale refractory-lined combustor. Non-radioactive aqueous cesium acetate was sprayed down the center of a natural gas flame supported on a variable swirl burner. Kaolinite powder was injected at a post-flame location in the combustor. Cesium sorption was determined by differences in the particle size distributions (PSDs) as measured by micro-orifice uniform deposition impactor (MOUDI) samples and x-ray fluorescence (XRF) analysis. Without kaolinite injection, the cesium readily vaporizes within the combustor to form difficult to collect ultrafine particles with a mean diameter of approximately 0.09μm. With kaolinite injection rates representing 8:1 molar stoichiometry (A12O3-2SiO2:Cs), up to 85% of the cesium reported to collectable supermicron particle sizes representative of the kaolinite (mean diameter - 1.4μm). However, this capture was dependent on the kaolinite injection temperature with a maximum seen between 1400 and 1500 K. The data suggest that kaolinite powders are effective at capturing vapor phase cesium. However, mechanisms and rates still remain to be quantified

  6. Development program for magnetically assisted chemical separation: Evaluation of cesium removal from Hanford tank supernatant

    International Nuclear Information System (INIS)

    Magnetic particles (MAG*SEPSM) coated with various absorbents were evaluated for the separation and recovery of low concentrations of cesium from nuclear waste solutions. The MAG*SEPSM particles were coated with (1) clinoptilolite, (2) transylvanian volcanic tuff, (3) resorcinol formaldehyde, and (4) crystalline silico-titanate, and then were contacted with a Hanford supernatant simulant. Particles coated with the crystalline silico-titanate were identified by Bradtec as having the highest capacity for cesium removal under the conditions tested (variation of pH, ionic strength, cesium concentration, and absorbent/solution ratio). The MAG*SEPSM particles coated with resorcinol formaldehyde had high distribution ratios values and could also be used to remove cesium from Hanford supernant simulant. Gamma irradiation studies were performed on the MAG*SEPSM particles with a gamma dose equivalent to 100 cycles of use. This irradiation decreased the loading capacity and distribution ratios for the particles by greater than 75%. The particles demonstrated high sensitivity to radiolytic damage due to the degradation of the polymeric regions. These results were supported by optical microscopy measurements. Overall, use of magnetic particles for cesium separation under nuclear waste conditions was found to be marginally effective

  7. Efficiency of fly ash belite cement and zeolite matrices for immobilizing cesium.

    Science.gov (United States)

    Goñi, S; Guerrero, A; Lorenzo, M P

    2006-10-11

    The efficiency of innovative matrices for immobilizing cesium is presented in this work. The matrix formulation included the use of fly ash belite cement (FABC-2-W) and gismondine-type Na-P1 zeolite, both of which are synthesized from fly ash of coal combustion. The efficiency for immobilizing cesium is evaluated from the leaching test ANSI/ANS 16.1-1986 at the temperature of 40 degrees C, from which the apparent diffusion coefficient of cesium is obtained. Matrices with 100% of FABC-2-W are used as a reference. The integrity of matrices is evaluated by porosity and pore-size distribution from mercury intrusion porosimetry, X-ray diffraction and nitrogen adsorption analyses. Both matrices can be classified as good solidify systems for cesium, specially the FABC-2-W/zeolite matrix in which the replacement of 50% of belite cement by the gismondine-type Na-P1 zeolite caused a decrease of two orders of magnitude of cesium mean Effective Diffusion Coefficient (D(e)) (2.8e-09 cm(2)/s versus 2.2e-07 cm(2)/s, for FABC-2-W/zeolite and FABC-2-W matrices, respectively). PMID:16759800

  8. Improvement of cesium leaching resistance of solidified borate wastes with copper-ferrocyanide-vermiculite adsorbent

    International Nuclear Information System (INIS)

    Removal of cesium from deionized water, sea water, and lime water with copper ferrocyanide (CFC) and porous media including silica gel, bentonite, vermiculite, and zeolite were investigated; CFC and vermiculite were incorporated to prepare a compound adsorbent which was used to improve the Cs-leaching resistance of solidified borate wastes. It was shown that the Cs-removal efficiency by CFC is largely affected by pHs of the solutions, good cesium removal occurs in pHs ranged from 3 to 12 and the best from 7 to 10; the effect of Cs concentration is significantly only from lime water for Cs > 10-6 M at high pH and is insignificant from other solutions. Vermiculite and zeolite were shown to have better removal efficiency than silica gel and bentonite, and vermiculite was chosen to incorporate with CFC to make compound adsorbents because of its good compatibility with CFC. Compound adsorbents with different CFC contents were used as additives in the solidification of borate radwaste for improving the cesium leaching resistance of waste forms. Experimental results showed that the measured, cesium leaching index following ANSI/ANS 16.1, was increased from 7.96 to 9.76 by adding 0.25% of a compound adsorbent containing 20% CFC and 80% vermiculite, which indicated that the CFC-vermiculite compound adsorbent is very useful for improving cesium leaching resistance of the solidified borate radwastes

  9. Preparation of Modified Kaolin Filler with Cesium and Its Application in Security Paper

    Directory of Open Access Journals (Sweden)

    Houssni El-Saied

    2013-01-01

    Full Text Available In this study, cesium was added intentionally during paper manufacture for protecting the papers against forgery and counterfeiting by sorbing cesium ions (Cs+ on kaolin, used as special filler in papermaking. The sorption of cesium from aqueous solution by kaolin was studied as a function of pH, shaking time, cesium initial concentration, and mass of kaolin using batch technique. The results showed that a solution containing 10 mg/L Cs+ and 250 mg of kaolin at pH 6 can be used to modify the kaolin. Paper handsheets were prepared containing various percentages of the modified kaolin. The mechanical and optical properties of paper handsheets were studied. The prepared paper handsheets were irradiated by gamma irradiation using different doses. Fourier transform infrared (FTIR spectroscopy was used to study the effect of kaolin modification by cesium and gamma irradiation on paper handsheets properties. The results indicated that modified kaolin enhanced the mechanical and optical properties of paper handsheets. Electron spin resonance (ESR spectroscopy and laser-induced breakdown spectroscopy (LIBS were also used. They provided rapid, sensitive and nondestructive techniques in differentiating between different questioned documents. This study presents a new concept in manufacturing security papers and anticounterfeiting applications.

  10. Misinterpretation on the risk of radioactive cesium contained in the disaster wastes

    International Nuclear Information System (INIS)

    Osaka Prefectural Government accepted the disaster wastes contained radioactive cesium after investigation them during one year. I explained the process and discussed about the risk management by people and the self-government body. The environmental pollution by radioactive cesium and Act on Special Measures concerning the Handling of Pollution by Radioactive Materials, the progress of treatment of debris, the concentration of radioactive cesium in debris, the acceptance conditions of debris contained small amount of radioactive cesium, evaluation of effects of radioactive materials in debris on the environment, and citizen's opinion of Osaka prefecture are described. The important investigation area of radioactive contamination on the basis of Act on Special Measures concerning the Handling of Pollution by Radioactive Materials, total amount of waste from Fukushima nuclear accident and debris in Miyagi, Iwate and Fukushima prefecture, the concentration of radioactive cesium in debris in Rikuzentakata and Miyako city as of September, 2011, and cumulative number of citizen's opinion to Osaka are illustrated. (S.Y.)

  11. Local mat-forming cyanobacteria effectively facilitate decontamination of radioactive cesium in rice fields

    International Nuclear Information System (INIS)

    The most effective and widespread method to decontaminate radioactive cesium from the Fukushima Daiichi Nuclear Power Plant Disaster was peeling topsoil. But the method had problems, such as large amounts of discarded soil and large-scale work. In nature, cyanobacteria formed biomats on the ground surface and facilitated peeling topsoil when the biomats dried. The cyanobacteria-facilitating peeling decontamination method utilized these cyanobacterial properties. Cyanobacteria are located all over Japan and 'local' cyanobacteria could be used for decontamination without introducing new species. Utilizing cyanobacteria could decrease the amount of discarded soil to about 30% and downsize the execution-scale to individual locations. Cyanobacterial biomats were easily cultivated, especially in rice fields, by maintaining wet conditions and exposure to 100 - 83% solar radiation. Shading by a thin net was helpful in maintaining an environment suitable for cyanobacteria. Nowadays, to prevent uptake of radioactive cesium into rice, K+ is usually added to fertilizer in rice fields. The K+ fertilization in rice fields might also enhance cyanobacterial capture of radioactive cesium, because high concentrations of K+ enhanced cyanobacterial uptake of Cs+. Cyanobacteria could also mitigate the risk of radioactive cesium moving away from a decontaminating rice field. Therefore, the cyanobacteria-facilitating peeling decontamination method was proposed as an easy and safe 'D.I.Y.' method for both farmers and the environment. Besides, plowing rice fields with water before peeling improved the efficiency of this method, because plowing increased the radioactive cesium concentration in the topsoil. (author)

  12. New Limits on Local Lorentz Invariance in Mercury and Cesium

    CERN Document Server

    Peck, S K; Stein, D; Orbaker, D; Foss, A; Hummon, M T; Hunter, L R

    2012-01-01

    We report new bounds on Local Lorentz Invariance (LLI) violation in Cs and Hg. The limits are obtained through the observation of the the spin- precession frequencies of 199Hg and 133Cs atoms in their ground states as a function of the orientation of an applied magnetic field with respect to the fixed stars. We measure the amplitudes of the dipole couplings to a preferred direction in the equatorial plane to be 19(11) nHz for Hg and 9(5) microHz for Cs. The upper bounds established here improve upon previous bounds by about a factor of four. The improvement is primarily due to mounting the apparatus on a rotating table. New bounds are established on several terms in the standard model extension including the first bounds on the spin-couplings of the neutron and proton to the z direction, <7e-30 GeV and <7e-29 GeV, respectively.

  13. Cesium-137 in soil texture fractions and its impact on Cesium-137 soil-to-plant transfer

    International Nuclear Information System (INIS)

    Field studies at two sites contaminated by the Chernobyl fallout showed 137Cesium (Cs) soil-to-plant transfer factors in wheat, rye and potato. Transfer values ranged from 0.0017 (potato tuber) to 0.07 (wheat straw). Generally transfer coefficients in cereal grains and potato tubers were significantly below the values of the shoots. A comparison of the two sites led to the conclusion that for all plants investigated 137Cs transfer factors were higher in Lower Austria (Calcic Chernozem) than in Upper Austria (Eutric Cambisol). The specific activities of the texture fractions of the two soil types increased from sand to silt and clay. In the Calcic Chernozem the ratio of the 137Cs activity in the silt fraction to the total activity in the soil was considerably higher than in the Eutric Cambisol. At the same time extractability of 137Cs from the silt fraction of the latter soil was clearly lower. Both results mainly were attributed to the differences between the soils according to the organic matter content of the silt fractions, the Calcic Chernozem being seven times higher. Therefore, the differences in the 137Cs-soil-to-plant transfer can be attributed partly to these soil characteristics. (authors)

  14. An Integrated Hydrologic Modeling Approach to Cesium-137 Transport in Forested Fukushima Watersheds

    Science.gov (United States)

    Siirila-Woodburn, E. R.; Steefel, C. I.; Williams, K. H.; Birkholzer, J. T.

    2015-12-01

    The 2011 Fukushima Daiichi Nuclear Power Plant (FDNPP) accident in Japan resulted in a significant dissemination of cesium-137 (Cs-137) over a wide area west of the plant, including the contamination of many watersheds and the subsequent evacuation of many communities. Today approximately 90% of on-land Cs-137 fallout following the accident resides in the upper 5 cm of forest soils. While this can be partially attributed to the forested composition of the prefecture (70%), there is also difficulty in cleanup efforts in these regions due to a lack of understanding and predictive capability of radioisotopes transport at the catchment to watershed scale. Subsequently, there is an uncertain, but likely long-term impact on local communities with implications for the use of nuclear energy use worldwide. Due to the complex nature of forest eco-hydrology, sophisticated modeling tools to accurately predict Cs-137 fluxes across different spatial and temporal scales are required. High fidelity, high resolution numerical modeling techniques in conjunction with parallel high performance computing is required to accurately determine transport and feedbacks in these complex systems. To better understand the fundamental transport of Cs-137, a watershed near the FDNPP is modeled with an integrated hydrologic model that includes variably saturated groundwater and overland flow in addition to atmospheric and vegetative processes via a coupled land surface model. Of specific interest is the impact of land cover type on hydrologic flow in the area, which will likely play an important role in erosion patterns and the consequent transport of Cs-137 strongly sorbed to surface soils. Risk management practices (for example, passive remediation versus active remediation such as targeted logging) for two principal tree types (evergreen and deciduous) are informed given the simulated responses to flow patterns assuming different quantities and spatial distribution patterns of each tree type.

  15. Measurement of regional hepatic blood flow and scintigraphic imaging of portal circulation with /sup 133/Xe

    Energy Technology Data Exchange (ETDEWEB)

    Kroiss, A. (Krankenanstalt der Stadt Wien Rudolfstiftung (Austria) 1. Medizinische Abt.)

    1980-01-01

    Regional hepatic blood flow has been determined by 4 methods with the aid of /sup 133/Xe washout technique: 1. scintisplenoportography (direct application of /sup 133/Xe into the spleen by means of a thin needle); 2. arterial method (/sup 133/Xe is injected into the A. hepatica by means of a catheter); 3. retrograde-venous method (/sup 133/Xe administered by an occluding hepatic vein catheter); 4. percutaneous intrahepatic method (/sup 133/Xe administered directly into the parenchyma by means of a Chiba needle). It was possible to demonstrate that hepatic blood flow values established with the aid of /sup 133/Xe are independent of the form of application (scintisplenoportography, arterial method, retrograde-venous method).

  16. Seasonal concentrations of cesium-137 in rumen content, skeletal muscles and feces of caribou from the porcupine herd: lichen ingestion rates and implications for human consumption

    International Nuclear Information System (INIS)

    The Porcupine caribou herd was monitored for cesium-137 during 1987 to address human health concerns over potential meat contamination by radioactive fallout from the Chernobyl accident, and to determine lichen intake rates based on body burdens of radiocesium. A total of 36 caribou were collected from northwestern Alaska and the Yukon Territories in March, June, September, and November. Mean radiocesium concentrations in skeletal muscle peaked in March at 133 Bq/kg fresh weight. This value should not prove hazardous to human health. Radiocesium concentrations in skeletal muscle (wet weight) ranged from approximately 22 to 50% of radiocesium concentrations in rumen contents (dry weight), and from approximately 15 to 37% of radiocesium concentrations in feces (dry weight). Radioactivity in feces was significantly correlated with radioactivity in rumen contents. Computer simulations relating lichen intake rates to radiocesium body burdens are presented for 3 scenarios: (1) when seasonal intakes were adjusted to provide the optimum fit between simulated and observed radiocesium body burdens (2) when seasonal intakes were based on empirical data, and (3) when seasonal intakes were adjusted to yield a ''conventional'' radiocesium curve of a slow fall build-up prior to a late winter plateau

  17. Sympathetic cooling in a rubidium cesium mixture: Production of ultracold cesium atoms; Sympathetisches Kuehlen in einer Rubidium-Caesium-Mischung: Erzeugung ultrakalter Caesiumatome

    Energy Technology Data Exchange (ETDEWEB)

    Haas, M.

    2007-07-01

    This thesis presents experiments for the production of ultracold rubidium cesium mixture in a magnetic trap. The long-termed aim of the experiment is the study of the interaction of few cesium atoms with a Bose-Einstein condensate of rubidium atoms. Especially by controlled variation of the cesium atom number the transition in the description of the interaction by concepts of the one-particle physics to the description by concepts of the many-particle physics shall be studied. The rubidium atoms are trapped in a magneto-optical trap (MOT) and from there reloaded into a magnetic trap. In this the rubidium atoms are stored in the state vertical stroke f=2,m{sub f}=2 right angle of the electronic ground state and evaporatively cooled by means of microwave-induced transitions into the state vertical stroke f=1,m{sub f}=1] (microwave cooling). The cesium atoms are also trppaed in a MOT and into the same magnetic trap reloaded, in which they are stored in the state vertical stroke f=4,m{sub f}=4 right angle of the electronic ground state together with rubidium. Because of the different hyperfine splitting only rubidium is evaporatively cooled, while cesium is cooled jointly sympathetically - i.e. by theramal contact via elastic collisions with rubidium atoms. The first two chapters contain a description of interatomic interactions in ultracold gases as well as a short summary of theoretical concepts in the description of Bose-Einstein condensates. The chapters 3 and 4 contain a short presentation of the methods applied in the experiment for the production of ultracold gases as well as the experimental arrangement; especially in the framework of this thesis a new coil system has been designed, which offers in view of future experiments additionally optical access for an optical trap. Additionally the fourth chapter contains an extensive description of the experimental cycle, which is applied in order to store rubidium and cesium atoms together into the magnetic trap. The

  18. 29 CFR 780.133 - Farmers' cooperative as a “farmer.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Farmers' cooperative as a âfarmer.â 780.133 Section 780.133... General Scope of Agriculture Practices Performed âby A Farmerâ § 780.133 Farmers' cooperative as a “farmer.” (a) The phrase “by a farmer” covers practices performed either by the farmer himself or by the...

  19. Clinicopathological significance of CD133 in lung cancer: A meta-analysis

    OpenAIRE

    Yaoxi TAN; Chen, Bo; Xu, Wei; Zhao, Weihong; Wu, Jianqing

    2013-01-01

    CD133 is one of the most commonly used markers of lung cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical value and significance of CD133 in lung cancer remains controversial. Due to the limited size of the individual studies, the association between CD133 and the clinicopathological characteristics of lung cancer had not been fully elucidated. A meta-analysis based on published studies was performed with the aim of ev...

  20. The utility and limitations of glycosylated human CD133 epitopes in defining cancer stem cells

    OpenAIRE

    Bidlingmaier, Scott; Zhu, Xiaodong; Liu, Bin

    2008-01-01

    Human CD133 (human prominin-1), a five transmembrane domain glycoprotein, was originally identified as a cell surface antigen present on CD34+ hematopoietic stem cells. Although the biological function of CD133 is not well understood, antibodies to CD133 epitopes have been widely used to purify hematopoietic stem and progenitor cells. The cancer stem cell (CSC) hypothesis postulates that a rare population of tumor cells possessing increased capacities for self-renewal and tumor initiation is ...