WorldWideScience

Sample records for cells produce pathogenic

  1. IL-10 produced by iTreg cells controls colitis and pathogenic ex-iTreg cells during immunotherapy1

    OpenAIRE

    Schmitt, Erica G.; Haribhai, Dipica; Williams, Jason B; Aggarwal, Praful; Jia, Shuang; Charbonnier, Louis-Marie; Yan, Ke; Lorier, Rachel; Turner, Amy; Ziegelbauer, Jennifer; Georgiev, Peter; Simpson, Pippa; Salzman, Nita H.; Hessner, Martin J.; Broeckel, Ulrich

    2012-01-01

    “Natural” regulatory T (nTreg) cells that express the transcription factor Foxp3 and produce IL-10 are required for systemic immunological tolerance. “Induced” Treg (iTreg) cells are non-redundant and essential for tolerance at mucosal surfaces, yet their mechanisms of suppression and stability are unknown. We investigated the role of iTreg cell-produced IL-10 and iTreg cell fate in a treatment model of inflammatory bowel disease. Colitis was induced in Rag1−/− mice by the adoptive transfer o...

  2. Generation of IL-23 producing dendritic cells (DCs by airborne fungi regulates fungal pathogenicity via the induction of T(H-17 responses.

    Directory of Open Access Journals (Sweden)

    Georgios Chamilos

    Full Text Available Interleukin-17 (IL-17 producing T helper cells (T(H-17 comprise a newly recognized T cell subset with an emerging role in adaptive immunity to a variety of fungi. Whether different airborne fungi trigger a common signaling pathway for T(H-17 induction, and whether this ability is related to the inherent pathogenic behavior of each fungus is currently unknown. Here we show that, as opposed to primary pathogenic fungi (Histoplasma capsulatum, opportunistic fungal pathogens (Aspergillus and Rhizopus trigger a common innate sensing pathway in human dendritic cells (DCs that results in robust production of IL-23 and drives T(H-17 responses. This response requires activation of dectin-1 by the fungal cell wall polysaccharide b-glucan that is selectively exposed during the invasive growth of opportunistic fungi. Notably, unmasking of b-glucan in the cell wall of a mutant of Histoplasma not only abrogates the pathogenicity of this fungus, but also triggers the induction of IL-23 producing DCs. Thus, b-glucan exposure in the fungal cell wall is essential for the induction of IL-23/T(H-17 axis and may represent a key factor that regulates protective immunity to opportunistic but not pathogenic fungi.

  3. Effectiveness of Broad-Spectrum Chemical Produce Sanitizers against Foodborne Pathogens as In Vitro Planktonic Cells and on the Surface of Whole Cantaloupes and Watermelons.

    Science.gov (United States)

    Svoboda, Amanda; Shaw, Angela; Dzubak, John; Mendonca, Aubrey; Wilson, Lester; Nair, Ajay

    2016-04-01

    Over the past few years, foodborne disease outbreaks linked to enteric pathogens present on cantaloupe and watermelon surfaces have raised concerns in the melon industry. This research evaluated the effectiveness of commercially available produce sanitizers against selected foodborne pathogens, both in cell suspensions and on the outer rind surface of melons. The sanitizers (65 and 200 ppm of chlorine, 5 and 35% hydrogen peroxide, 5 and 50 ppm of liquid chlorine dioxide, various hydrogen peroxide-acid combinations, 0.78 and 2.5% organic acids, and 300 ppm of quaternary ammonium) were tested against Escherichia coli O157:H7, Listeria monocytogenes, Salmonella, and non-O157 Shiga toxin-producing E. coli (O26, O45, O103, O111, O121, and O145). The cell suspension study revealed the ability of all tested sanitizers to reduce all selected pathogens by 0.6 to 9.6 log CFU/ml in vitro. In the melon study, significant differences in pathogen reduction were observed between sanitizers but not between melon types. The most effective sanitizers were quaternary ammonium and hydrogen peroxide-acid combinations, with 1.0- to 2.2-log CFU/g and 1.3- to 2.8-log CFU/g reductions, respectively, for all pathogens. The other sanitizers were less effective in killing the pathogens, with reductions ranging from 0.0 to 2.8 log CFU/g depending on pathogen and sanitizer. This study provides guidance to the melon industry on the best produce sanitizers for use in implementing a broadspectrum pathogen intervention strategy. PMID:27052854

  4. Loss of IL-17-producing CD8 T cells during late chronic stage of pathogenic simian immunodeficiency virus infection.

    Science.gov (United States)

    Nigam, Pragati; Kwa, Suefen; Velu, Vijayakumar; Amara, Rama Rao

    2011-01-15

    Progressive disease caused by pathogenic SIV/HIV infections is marked by systemic hyperimmune activation, immune dysregulation, and profound depletion of CD4(+) T cells in lymphoid and gastrointestinal mucosal tissues. IL-17 is important for protective immunity against extracellular bacterial infections at mucosa and for maintenance of mucosal barrier. Although IL-17-secreting CD4 (Th17) and CD8 (Tc17) T cells have been reported, very little is known about the latter subset for any infectious disease. In this study, we characterized the anatomical distribution, phenotype, and functional quality of Tc17 and Th17 cells in healthy (SIV-) and SIV+ rhesus macaques. In healthy macaques, Tc17 and Th17 cells were present in all lymphoid and gastrointestinal tissues studied with predominance in small intestine. About 50% of these cells coexpressed TNF-α and IL-2. Notably, ∼50% of Tc17 cells also expressed the co-inhibitory molecule CTLA-4, and only a minority (<20%) expressed granzyme B suggesting that these cells possess more of a regulatory than cytotoxic phenotype. After SIV infection, unlike Th17 cells, Tc17 cells were not depleted during the acute phase of infection. However, the frequency of Tc17 cells in SIV-infected macaques with AIDS was lower compared with that in healthy macaques demonstrating the loss of these cells during end-stage disease. Antiretroviral therapy partially restored the frequency of Tc17 and Th17 cells in the colorectal mucosa. Depletion of Tc17 cells was not observed in colorectal mucosa of chronically infected SIV+ sooty mangabeys. In conclusion, our results suggest a role for Tc17 cells in regulating disease progression during pathogenic SIV infection. PMID:21148794

  5. The vascular plant-pathogenic bacterium Ralstonia solanacearum produces biofilms required for its virulence on the surfaces of tomato cells adjacent to intercellular spaces.

    Science.gov (United States)

    Mori, Yuka; Inoue, Kanako; Ikeda, Kenichi; Nakayashiki, Hitoshi; Higashimoto, Chikaki; Ohnishi, Kouhei; Kiba, Akinori; Hikichi, Yasufumi

    2016-08-01

    The mechanism of colonization of intercellular spaces by the soil-borne and vascular plant-pathogenic bacterium Ralstonia solanacearum strain OE1-1 after invasion into host plants remains unclear. To analyse the behaviour of OE1-1 cells in intercellular spaces, tomato leaves with the lower epidermis layers excised after infiltration with OE1-1 were observed under a scanning electron microscope. OE1-1 cells formed microcolonies on the surfaces of tomato cells adjacent to intercellular spaces, and then aggregated surrounded by an extracellular matrix, forming mature biofilm structures. Furthermore, OE1-1 cells produced mushroom-type biofilms when incubated in fluids of apoplasts including intercellular spaces, but not xylem fluids from tomato plants. This is the first report of biofilm formation by R. solanacearum on host plant cells after invasion into intercellular spaces and mushroom-type biofilms produced by R. solanacearum in vitro. Sugar application led to enhanced biofilm formation by OE1-1. Mutation of lecM encoding a lectin, RS-IIL, which reportedly exhibits affinity for these sugars, led to a significant decrease in biofilm formation. Colonization in intercellular spaces was significantly decreased in the lecM mutant, leading to a loss of virulence on tomato plants. Complementation of the lecM mutant with native lecM resulted in the recovery of mushroom-type biofilms and virulence on tomato plants. Together, our findings indicate that OE1-1 produces mature biofilms on the surfaces of tomato cells after invasion into intercellular spaces. RS-IIL may contribute to biofilm formation by OE1-1, which is required for OE1-1 virulence. PMID:26609568

  6. Contamination of produce with human pathogens: sources and solutions

    Science.gov (United States)

    Outbreaks of foodborne illnesses associated with the presence of human pathogens have led to increased concern about the prevalence of pathogens in the environment and the vulnerability of fresh produce to contamination by these pathogens. As the FDA strives to mandate treatments to reduce pathogen...

  7. Pathogen-associated molecular patterns activate expression of genes involved in cell proliferation, immunity and detoxification in the amebocyte-producing organ of the snail Biomphalaria glabrata.

    Science.gov (United States)

    Zhang, Si-Ming; Loker, Eric S; Sullivan, John T

    2016-03-01

    The anterior pericardial wall of the snail Biomphalaria glabrata has been identified as a site of hemocyte production, hence has been named the amebocyte-producing organ (APO). A number of studies have shown that exogenous abiotic and biotic substances, including pathogen associated molecular patterns (PAMPs), are able to stimulate APO mitotic activity and/or enlarge its size, implying a role for the APO in innate immunity. The molecular mechanisms underlying such responses have not yet been explored, in part due to the difficulty in obtaining sufficient APO tissue for gene expression studies. By using a modified RNA extraction technique and microarray technology, we investigated transcriptomic responses of APOs dissected from snails at 24 h post-injection with two bacterial PAMPs, lipopolysaccharide (LPS) and peptidoglycan (PGN), or with fucoidan (FCN), which may mimic fucosyl-rich glycan PAMPs on sporocysts of Schistosoma mansoni. Based upon the number of genes differentially expressed, LPS exhibited the strongest activity, relative to saline-injected controls. A concurrent activation of genes involved in cell proliferation, immune response and detoxification metabolism was observed. A gene encoding checkpoint 1 kinase, a key regulator of mitosis, was highly expressed after stimulation by LPS. Also, seven different aminoacyl-tRNA synthetases that play an essential role in protein synthesis were found to be highly expressed. In addition to stimulating genes involved in cell proliferation, the injected substances, especially LPS, also induced expression of a number of immune-related genes including arginase, peptidoglycan recognition protein short form, tumor necrosis factor receptor, ficolin, calmodulin, bacterial permeability increasing proteins and E3 ubiquitin-protein ligase. Importantly, significant up-regulation was observed in four GiMAP (GTPase of immunity-associated protein) genes, a result which provides the first evidence suggesting an immune role of Gi

  8. Contamination of fresh produce with human pathogens: sources and solutions

    Science.gov (United States)

    Since 1991 there have been several outbreaks of foodborne illnesses associated with the presence of human pathogens on fresh and fresh-cut fruits and vegetables. These outbreaks have led to increased concern about the prevalence of pathogens in the environment and the vulnerability of fresh produce...

  9. Adenoviral Producer Cells

    Directory of Open Access Journals (Sweden)

    Imre Kovesdi

    2010-08-01

    Full Text Available Adenovirus (Ad vectors, in particular those of the serotype 5, are highly attractive for a wide range of gene therapy, vaccine and virotherapy applications (as discussed in further detail in this issue. Wild type Ad5 virus can replicate in numerous tissue types but to use Ad vectors for therapeutic purposes the viral genome requires modification. In particular, if the viral genome is modified in such a way that the viral life cycle is interfered with, a specific producer cell line is required to provide trans-complementation to overcome the modification and allow viral production. This can occur in two ways; use of a producer cell line that contains specific adenoviral sequences incorporated into the cell genome to trans-complement, or use of a producer cell line that naturally complements for the modified Ad vector genome. This review concentrates on producer cell lines that complement non-replicating adenoviral vectors, starting with the historical HEK293 cell line developed in 1977 for first generation Ad vectors. In addition the problem of replication-competent adenovirus (RCA contamination in viral preparations from HEK293 cells is addressed leading to the development of alternate cell lines. Furthermore novel cell lines for more complex Ad vectors and alternate serotype Ad vectors are discussed.

  10. Extracellular proteolytic enzymes produced by human pathogenic Vibrio species

    Directory of Open Access Journals (Sweden)

    Shin-IchiMiyoshi

    2013-11-01

    Full Text Available Bacteria in the genus Vibrio produce extracellular proteolytic enzymes to obtain nutrients via digestion of various protein substrates. However, the enzymes secreted by human pathogenic species have been documented to modulate the bacterial virulence. Several species including Vibrio cholerae and V. vulnificus are known to produce thermolysin-like metalloproteases termed vibriolysin. The vibriolysin from V. vulnificus, a causative agent of serious systemic infection, is a major toxic factor eliciting the secondary skin damage characterized by formation of the hemorrhagic brae. The vibriolysin from intestinal pathogens may play indirect roles in pathogenicity because it can activate protein toxins and hemagglutinin by the limited proteolysis and can affect the bacterial attachment to or detachment from the intestinal surface by degradation of the mucus layer. Two species causing wound infections, V. alginolyticus and V. parahaemolyticus, produce another metalloproteases so-called collagenases. Although the detailed pathological roles have not been studied, the collagenase is potent to accelerate the bacterial dissemination through digestion of the protein components of the extracellular matrix. Some species produce cymotrypsin-like serine proteases, which may also affect the bacterial virulence potential. The intestinal pathogens produce sufficient amounts of the metalloprotease at the small intestinal temperature; however, the metalloprotease production by extra-intestinal pathogens is much higher around the body surface temperature. On the other hand, the serine protease is expressed only in the absence of the metalloprotease.

  11. Extracellular proteolytic enzymes produced by human pathogenic vibrio species

    OpenAIRE

    Miyoshi, Shin-Ichi

    2013-01-01

    Bacteria in the genus Vibrio produce extracellular proteolytic enzymes to obtain nutrients via digestion of various protein substrates. However, the enzymes secreted by human pathogenic species have been documented to modulate the bacterial virulence. Several species including Vibrio cholerae and V. vulnificus are known to produce thermolysin-like metalloproteases termed vibriolysin. The vibriolysin from V. vulnificus, a causative agent of serious systemic infection, is a major toxic factor e...

  12. Human commensals producing a novel antibiotic impair pathogen colonization.

    Science.gov (United States)

    Zipperer, Alexander; Konnerth, Martin C; Laux, Claudia; Berscheid, Anne; Janek, Daniela; Weidenmaier, Christopher; Burian, Marc; Schilling, Nadine A; Slavetinsky, Christoph; Marschal, Matthias; Willmann, Matthias; Kalbacher, Hubert; Schittek, Birgit; Brötz-Oesterhelt, Heike; Grond, Stephanie; Peschel, Andreas; Krismer, Bernhard

    2016-07-28

    The vast majority of systemic bacterial infections are caused by facultative, often antibiotic-resistant, pathogens colonizing human body surfaces. Nasal carriage of Staphylococcus aureus predisposes to invasive infection, but the mechanisms that permit or interfere with pathogen colonization are largely unknown. Whereas soil microbes are known to compete by production of antibiotics, such processes have rarely been reported for human microbiota. We show that nasal Staphylococcus lugdunensis strains produce lugdunin, a novel thiazolidine-containing cyclic peptide antibiotic that prohibits colonization by S. aureus, and a rare example of a non-ribosomally synthesized bioactive compound from human-associated bacteria. Lugdunin is bactericidal against major pathogens, effective in animal models, and not prone to causing development of resistance in S. aureus. Notably, human nasal colonization by S. lugdunensis was associated with a significantly reduced S. aureus carriage rate, suggesting that lugdunin or lugdunin-producing commensal bacteria could be valuable for preventing staphylococcal infections. Moreover, human microbiota should be considered as a source for new antibiotics. PMID:27466123

  13. Human enteric pathogens in produce: un-answered ecological questions with direct implications for food safety.

    Science.gov (United States)

    Teplitski, Max; Barak, Jeri D; Schneider, Keith R

    2009-04-01

    Recent outbreaks of gastroenteritis linked to the consumption of fresh produce raise questions about the mechanisms by which human pathogens colonize plants and persist within marketable produce. Neither Salmonella nor Escherichia coli appear to produce enzymes that degrade plant cell walls, therefore it is not yet certain how these bacteria enter plant tissues and spread within them. Similar to plant-associated bacteria, enterics use cellulose and aggregative fimbriae for their attachment to plant surfaces. Salmonella can be an effective plant endophyte, even though it is capable of triggering plant defenses. Plant-associated microbiota contributes to the fitness and translocation of these human pathogens within plant hosts, although interactions and mechanisms of communication between plant-associated microbiota and enteric pathogens are not yet characterized. PMID:19349159

  14. Incidence of Bacteriocins Produced by Food-Related Lactic Acid Bacteria Active towards Oral Pathogens

    Directory of Open Access Journals (Sweden)

    Konstantinos Papadimitriou

    2013-02-01

    Full Text Available In the present study we investigated the incidence of bacteriocins produced by 236 lactic acid bacteria (LAB food isolates against pathogenic or opportunistic pathogenic oral bacteria. This set of LAB contained several strains (≥17% producing bacteriocins active against food-related bacteria. Interestingly only Streptococcus macedonicus ACA-DC 198 was able to inhibit the growth of Streptococcus oralis, Streptococcus sanguinis and Streptococcus gordonii, while Lactobacillus fermentum ACA-DC 179 and Lactobacillus plantarun ACA-DC 269 produced bacteriocins solely against Streptococcus oralis. Thus, the percentage of strains that were found to produce bacteriocins against oral bacteria was ~1.3%. The rarity of bacteriocins active against oral LAB pathogens produced by food-related LAB was unexpected given their close phylogenetic relationship. Nevertheless, when tested in inhibition assays, the potency of the bacteriocin(s of S. macedonicus ACA-DC 198 against the three oral streptococci was high. Fourier-transform infrared spectroscopy combined with principal component analysis revealed that exposure of the target cells to the antimicrobial compounds caused major alterations of key cellular constituents. Our findings indicate that bacteriocins produced by food-related LAB against oral LAB may be rare, but deserve further investigation since, when discovered, they can be effective antimicrobials.

  15. Hemolysin, Protease, and EPS Producing Pathogenic Aeromonas hydrophila Strain An4 Shows Antibacterial Activity against Marine Bacterial Fish Pathogens

    Directory of Open Access Journals (Sweden)

    Anju Pandey

    2010-01-01

    Full Text Available A pathogenic Aeromonas hydrophila strain An4 was isolated from marine catfish and characterized with reference to its proteolytic and hemolytic activity along with SDS-PAGE profile (sodium dodecyl sulphate-Polyacrylamide gel electrophoresis of ECPs (extracellular proteins showing hemolysin (approximately 50 kDa. Agar well diffusion assay using crude cell extract of the bacterial isolate clearly demonstrated antibacterial activity against indicator pathogenic bacteria, Staphylococcus arlettae strain An1, Acinetobacter sp. strain An2, Vibrio parahaemolyticus strain An3, and Alteromonas aurentia SE3 showing inhibitory zone >10 mm well comparable to common antibiotics. Further GC-MS analysis of crude cell extract revealed several metabolites, namely, phenolics, pyrrolo-pyrazines, pyrrolo-pyridine, and butylated hydroxytoluene (well-known antimicrobials. Characterization of EPS using FTIR indicated presence of several protein-related amine and amide groups along with peaks corresponding to carboxylic and phenyl rings which may be attributed to its virulent and antibacterial properties, respectively. Besides hemolysin, EPS, and protease, Aeromonas hydrophila strain An4 also produced several antibacterial metabolites.

  16. Irrigation waters as a source of pathogenic microorganisms in produce: a review

    Science.gov (United States)

    There is increasing evidence that consumption of raw fresh produce is a major factor contributing to human gastrointestinal illness. A wide variety of pathogens contribute to food-borne illnesses, including bacteria (e.g., Salmonella, pathogenic E. coli), protozoa (e.g., Cryptosporidium, Giardia), ...

  17. Bioactive Secondary Metabolites Produced by the Oak Pathogen Diplodia corticola.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Cimmino, Alessio; D'Amico, Wanda; Scanu, Bruno; Evidente, Marco; Tuzi, Angela; Evidente, Antonio

    2016-01-13

    Three new lactones and a new fatty acid ester, named sapinofuranones C and D, diplopyrone B, and diplobifuranylone C, respectively, were isolated from Diplodia corticola, together with sphaeropsidins A and C, diplopyrone, diplobifuranylones A and B, diplofuranone A, and the (S,S)-enantiomer of sapinofuranone B. Sapinofuranones C and D, diplopyrone B, and diplobifuranylone C were characterized as (5S)-5-((1,S-1,6-dihydroxyhexa-2,4-dienyl)-dihydrofuran-2-one, 4,5-dihydroxy-deca-6,8-dienoic acid methyl ester, (5S)-5-hydroxy-6-(penta-1,3-dienyl)-5,6-dihydro-pyran-2-one, and 5'-((1R)-1-hydroxyethyl)-2',5'-dihydro-2H-[2,2']bifuranyl-5-one by spectroscopic and chemical methods, respectively. The relative configuration of sapinofuranone C was assigned by X-ray diffraction analysis, whereas its absolute configuration was determined by applying the advanced Mosher's method to its 11-O-p-bromobenzoyl derivative. The same method was used to assign the absolute configuration to C-5 of diplopyrone B and to that of the hydroxyethyl of the side chain of diplobifuranylone C, respectively. The metabolites isolated were tested at 1 mg/mL on leaves of cork oak, grapevine cv. 'Cannonau', and tomato using the leaf puncture assay. They were also tested on tomato cuttings at 0.2, 0.1, and 0.05 mg/mL. Each compound was tested for zootoxic activity on Artemia salina L. larvae. The efficacy of sapinofuranone C and diplopyrone B on three plant pathogens, namely, Athelia rolfsii, Fusarium avenaceum, and Phytophthora nicotianae was also evaluated. In all phytotoxic assays only diplopyrone B was found to be active. It also showed strong inhibition on the vegetative growth of A. rolfsii and P. nicotianae. All metabolites were inactive in the assay performed for the zootoxic activity (A. salina) even at the highest concentration used (200 μg/mL). Diplopyrone B showed a promising antioomycete activity for the control of Phytophthora spp. also taking into account the absence of zootoxic activity

  18. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Directory of Open Access Journals (Sweden)

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  19. Most Common Foodborne Pathogens and Mycotoxins on Fresh Produce: A Review of Recent Outbreaks.

    Science.gov (United States)

    Yeni, F; Yavaş, S; Alpas, H; Soyer, Y

    2016-07-01

    Every year millions of people are affected and thousands of them die due to infections and intoxication as a result of foodborne outbreaks, which also cause billions of dollars' worth of damage, public health problems, and agricultural product loss. A considerable portion of these outbreaks is related to fresh produce and caused by foodborne pathogens on fresh produce and mycotoxins. Escherichia coli O104:H4 outbreak, occurred in Germany in 2011, has attracted a great attention on foodborne outbreaks caused by contaminated fresh produce, and especially the vulnerability and gaps in the early warning and notification networks in the surveillance systems in all around the world. In the frame of this paper, we reviewed the most common foodborne pathogens on fresh produce, traceback investigations of the outbreaks caused by these pathogens, and lastly international early warning and notification systems, including PulseNet International and Rapid Alert System for Food and Feed, aiming to detect foodborne outbreaks. PMID:26583913

  20. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater

    OpenAIRE

    Eelco Franz; Christiaan Veenman; Hoek, Angela H.A.M. van; Ana de Roda Husman; Hetty Blaak

    2015-01-01

    To assess public health risks from environmental exposure to Extended-Spectrum β-Lactamases (ESBL)-producing bacteria, it is necessary to have insight in the proportion of relative harmless commensal variants and potentially pathogenic ones (which may directly cause disease). In the current study, 170 ESBL-producing E. coli from Dutch wastewater (n = 82) and surface water (n = 88) were characterized with respect to ESBL-genotype, phylogenetic group, resistance phenotype and virulence markers ...

  1. Post irradiation effect on some antiphagocytic substances produced by pathogenic microorganisms

    International Nuclear Information System (INIS)

    Some clinical isolated microorganiams can produce antiphagocytic virulence substance. In this study 43 bacterial strains were isolated from cervix of 50 patients. Escheruchia coli was the most common species isolated (39.53%) followed by Klebsiella pneumoniae (23.26), Pseudomonas aeruginosa (11.63%), Proteus mirabilis (9.30%), Klebsiella oxytoca (4.65%), Staphylococcus warneri (4.65%), Klebsiella group 47 (2.33%), Morganella morganii (2.33%) and Staphylococcus hominis (2.33%) four yeast fungal organisms were isolated in this study Candida albicans was the only Candida species isolated representing 8.51% of total number of pathogenic bacteria and yeast fungi isolated. Radiotherapy of these cancer patients had many effects on the microbial cells. The tested isolates were exposed to in-vivo multiple fractionated doses 10-50Gy and in-vitro single equivalent dose 7.04-20Gy. The isolated strains were tested for antimicrbial agent susceptibility using 18 different antibiotics for bacterial isolates and anystatin for Candida albicans. The effect of bacterial and yeast fungal virulence factors on neutrophil phagocytosis and antimicrobial activity was examined. Disk susceptibility testing suggested that, the isolated producer strains which were positive for extracellular proteinase enzyme and/or for slime production that correlate with infectivity were resistant to erythromycin, streptomycin, neomycin, kanamycin, tetracycline, cephalothin and sulphamethoxazol/trimethoprim and rarely susceptible to amoxicillin /clavulanic acid and cefotaxime. In contrast, many non-producer strains were susceptible to most of the tested antibiotics with marked variability among species. In case of Candida albicans all the tested strains were susceptible to the tested antimycotic agent used before and after in-vitro irradiation at a dose level of 20gy. It was found that slime substance and/or proteinase enzyme reduced the phagocytic activity of the leukocytes against the producer bacterial

  2. Enteric pathogen survival varies substantially in irrigation water from Belgian lettuce producers.

    Science.gov (United States)

    Van Der Linden, Inge; Cottyn, Bart; Uyttendaele, Mieke; Berkvens, Nick; Vlaemynck, Geertrui; Heyndrickx, Marc; Maes, Martine

    2014-01-01

    It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water temperature and chemical water quality was evaluated, and the survival tests were also performed in water samples from which the resident aquatic microbiota had previously been eliminated by filter sterilization. The pathogen's survival differed greatly in the different irrigation waters. Three water samples contained nutrients to support important growth of the pathogens, and another enabled weaker growth. However, for all, growth was only observed in the samples that did not contain the resident aquatic microbiota. In the original waters with their specific water biota, pathogen levels declined. The same survival tendencies existed in water of 4 °C and 20 °C, although always more expressed at 20 °C. Low water temperatures resulted in longer pathogen survival. Remarkably, the survival capacity of two E. coli 0157:H7 strains differed, while Salmonella Thompson and Salmonella Typhimurium behaved similarly. The pathogens were also transferred to detached lettuce leaves, while suspended in two of the water samples or in a buffer. The effect of the water sample on the pathogen's fitness was also reproduced on the leaves when stored at 100% relative humidity. Inoculation of the suspension in buffer or in one of the water samples enabled epiphytic growth and survival, while the pathogen level in the other water sample decreased once loaded on the leaves. Our results show that irrigation waters from different origin may have a different capacity to transmit enteric pathogens and an

  3. Producing Insulin from Neural Cells

    OpenAIRE

    Yuichi Hori; Xueying Gu; Xiaodong Xie; Kim, Seung K.

    2005-01-01

    BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals t...

  4. Enteric Pathogen Survival Varies Substantially in Irrigation Water from Belgian Lettuce Producers

    OpenAIRE

    Inge Van der Linden; Bart Cottyn; Mieke Uyttendaele; Nick Berkvens; Geertrui Vlaemynck; Marc Heyndrickx; Martine Maes

    2014-01-01

    It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water t...

  5. Distribution of Pathogenicity Islands OI-122, OI-43/48, and OI-57 and a High-Pathogenicity Island in Shiga Toxin-Producing Escherichia coli

    OpenAIRE

    Ju, Wenting; Shen, Jinling; Toro, Magaly; Zhao, Shaohua; Meng, Jianghong

    2013-01-01

    Pathogenicity islands (PAIs) play an important role in Shiga toxin-producing Escherichia coli (STEC) pathogenicity. The distribution of PAIs OI-122, OI-43/48, and OI-57 and a high-pathogenicity island (HPI) were determined among 98 STEC strains assigned to seropathotypes (SPTs) A to E. PCR and PCR-restriction fragment length polymorphism assays were used to identify 14 virulence genes that belonged to the four PAIs and to subtype eae and stx genes, respectively. Phylogenetic trees were constr...

  6. Enteric Pathogen Survival Varies Substantially in Irrigation Water from Belgian Lettuce Producers

    Directory of Open Access Journals (Sweden)

    Inge Van Der Linden

    2014-09-01

    Full Text Available It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water temperature and chemical water quality was evaluated, and the survival tests were also performed in water samples from which the resident aquatic microbiota had previously been eliminated by filter sterilization. The pathogen’s survival differed greatly in the different irrigation waters. Three water samples contained nutrients to support important growth of the pathogens, and another enabled weaker growth. However, for all, growth was only observed in the samples that did not contain the resident aquatic microbiota. In the original waters with their specific water biota, pathogen levels declined. The same survival tendencies existed in water of 4 °C and 20 °C, although always more expressed at 20 °C. Low water temperatures resulted in longer pathogen survival. Remarkably, the survival capacity of two E. coli 0157:H7 strains differed, while Salmonella Thompson and Salmonella Typhimurium behaved similarly. The pathogens were also transferred to detached lettuce leaves, while suspended in two of the water samples or in a buffer. The effect of the water sample on the pathogen’s fitness was also reproduced on the leaves when stored at 100% relative humidity. Inoculation of the suspension in buffer or in one of the water samples enabled epiphytic growth and survival, while the pathogen level in the other water sample decreased once loaded on the leaves. Our results show that irrigation waters from different origin may have a different capacity to transmit

  7. Extended spectrum beta lactamase producing Proteus penneri: A rare missed pathogen?

    OpenAIRE

    Anita Pandey; Himani Verma; Ashish K Asthana; Molly Madan

    2014-01-01

    Indole negative Proteus species are invariably incorrectly identified as Proteus mirabilis, often missing out isolates of Proteus penneri. We report a case of extended spectrum beta lactamase producing and multidrug-resistant P. penneri isolated from pus from pressure sore of a patient of road traffic accident. Correct and rapid isolation and identification of such resistant pathogen are important as they are significant nosocomial threat.

  8. Response of organically and conventionally produced potatoes to a controlled attack of a pathogen

    OpenAIRE

    Dasko, L'ubomír; Drímal, Jozef; Klimekova, Marta; Urgeová, Eva

    2012-01-01

    Organic agricultural products have increasing share of the food market in Europe. The questions related to benefits of organic versus conventionally produced agricultural crops are of increasing meaning. In our paper we have focused on assessment of the reaction of the immunity system of potato tubers from both agricultural systems on an external controlled attack of Phytophthora infestans, a pathogenic microorganism. The reaction of organic and conventional potato tubers was expressed via d...

  9. Toxins Produced by Valsa mali var. mali and Their Relationship with Pathogenicity

    Directory of Open Access Journals (Sweden)

    Caixia Wang

    2014-03-01

    Full Text Available Valsa mali var. mali (Vmm, the causal agent of apple tree canker disease, produces various toxic compounds, including protocatechuic acid, p-hydroxybenzoic acid, p-hydroxyacetophenone, 3-(p-hydroxyphenylpropanoic acid and phloroglucinol. Here, we examined the relationship between toxin production and the pathogenicity of Vmm strains and determined their bioactivities in several assays, for further elucidating the pathogenesis mechanisms of Vmm and for developing new procedures to control this disease. The toxins were quantified with the high performance liquid chromatography (HPLC method, and the results showed that the strain with attenuated virulence produced low levels of toxins with only three to four kinds of compounds being detectable. In contrast, higher amounts of toxins were produced by the more aggressive strain, and all five compounds were detected. This indicated a significant correlation between the pathogenicity of Vmm strains and their ability to produce toxins. However, this correlation only existed in planta, but not in vitro. During the infection of Vmm, protocatechuic acid was first detected at three days post inoculation (dpi, and the others at seven or 11 dpi. In addition, all compounds produced noticeable symptoms on host plants at concentrations of 2.5 to 40 mmol/L, with protocatechuic acid being the most effective compound, whereas 3-(p-hydroxyphenylpropanoic acid or p-hydroxybenzoic acid were the most active compounds on non-host plants.

  10. Indoctrinating T cells to attack pathogens through homeschooling

    OpenAIRE

    Parello, Caitlin S.; Huseby, Eric S.

    2015-01-01

    Adaptive immunity is predicated on the ability of the T cell repertoire to have pre-existing specificity for the universe of potential pathogens. Recent findings suggest that TCR-self-pMHC interactions limit autoimmune responses while enhancing T cell response to foreign antigens. We review these findings here, placing them in context of the current understanding of how TCR-self-pMHC interactions regulate T cell activation thresholds, and suggest that TCR-self-pMHC interactions increase the e...

  11. Single-Cell Genomics Unveils Critical Regulators of Th17 Cell Pathogenicity.

    Science.gov (United States)

    Gaublomme, Jellert T; Yosef, Nir; Lee, Youjin; Gertner, Rona S; Yang, Li V; Wu, Chuan; Pandolfi, Pier Paolo; Mak, Tak; Satija, Rahul; Shalek, Alex K; Kuchroo, Vijay K; Park, Hongkun; Regev, Aviv

    2015-12-01

    Extensive cellular heterogeneity exists within specific immune-cell subtypes classified as a single lineage, but its molecular underpinnings are rarely characterized at a genomic scale. Here, we use single-cell RNA-seq to investigate the molecular mechanisms governing heterogeneity and pathogenicity of Th17 cells isolated from the central nervous system (CNS) and lymph nodes (LN) at the peak of autoimmune encephalomyelitis (EAE) or differentiated in vitro under either pathogenic or non-pathogenic polarization conditions. Computational analysis relates a spectrum of cellular states in vivo to in-vitro-differentiated Th17 cells and unveils genes governing pathogenicity and disease susceptibility. Using knockout mice, we validate four new genes: Gpr65, Plzp, Toso, and Cd5l (in a companion paper). Cellular heterogeneity thus informs Th17 function in autoimmunity and can identify targets for selective suppression of pathogenic Th17 cells while potentially sparing non-pathogenic tissue-protective ones. PMID:26607794

  12. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Directory of Open Access Journals (Sweden)

    Jennifer L. Banach

    2015-07-01

    Full Text Available The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  13. Financial effects of the highly pathogenic avian influenza outbreaks on the Turkish broiler producers.

    Science.gov (United States)

    Aral, Y; Yalcin, C; Cevger, Y; Sipahi, C; Sariozkan, S

    2010-05-01

    This research aimed at assessing the financial effects of the 2005 to 2006 highly pathogenic avian influenza outbreaks on Turkish broiler enterprises. The data were obtained from an interview survey carried out in 499 enterprises randomly selected from 14 provinces that accounted for 79% of the national broiler production. The research revealed that the contracted broiler producers lost on average 1.38 cycles of production and their management fee reduced by 14.7% in 8 mo after the outbreaks. As a result, the broiler production and the enterprise income declined by 34.8 and 44.3%, respectively. The bank loan of the producers rose by 161%. A total of 93% of the producers did not do any other supplementary work during the idle production period in spite of the fact that broiler production was the only business of 36% of them. Furthermore, more than half of the producers (56%) stated that they were considering expanding their business, but suspended this idea due to the outbreak. Approximately 87% of the producers increased the biosecurity measures after the outbreaks. The nationwide effects of the avian influenza outbreaks on the contracted broilers farms were estimated to be US$100.8 million (US$7,967/broiler house). The futures of the contracted broiler producers are fully dependent upon those of the integrated firms. Any negative effects on the latter appeared to be transferred directly to the former. However, the government neglected the integrated firms in the avian influenza compensation programs. PMID:20371863

  14. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  15. Pathogen Inactivation of red cells: challenges and opportunities

    Institute of Scientific and Technical Information of China (English)

    Stephen J. Wagner

    2006-01-01

    @@ Introduction Virus inactivation methods for blood have been explored as a means to further reduce the risk from tested agents and to decrease the risk of emerging or variant agents for whom no deferral or effective screening methods are available. Although inactivation methods promise to reduce transfusion-related infectious disease risk, these methods are not perfect. Most techniques for pathogen reduction will not kill bacterial spores, or inactivate bacterial endotoxin, prion protein, or certain non-enveloped viruses whose tightly packed capsid proteins prevent access of the virucidal agent to its nucleic acid target. In addition,various inactivation methods have been known to decrease blood cell yield, affect blood cell recovery or survival, and may pose risk to recipients or blood center workers. My presentation today will review two methods for pathogen inactivation of red cells.

  16. A novel cell subset: Interferon-producing killer dendritic cells

    Institute of Scientific and Technical Information of China (English)

    WANG JiongKun; XING FeiYue

    2008-01-01

    Recent reports introduce a novel cell subset of DCs with antigenic phenotypes shared by both NK cells and B cells, but without surface markers of pDCs and T cells, appearing to be a chimera of NK cells and DCs, namely interferon-producing killer dendritic cells (IKDCs). IKDCs not only secret type Ⅰ and type Ⅱ interferons to recognize and kill tumor cells effectively, but also express MHC-Ⅱ molecules to present antigens. Thus, IKDCs are considered as important immunosurveilance cells for tumors, providing a link between innate and adaptive immunity.

  17. A novel cell subset:Interferon-producing killer dendritic cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Recent reports introduce a novel cell subset of DCs with antigenic phenotypes shared by both NK cells and B cells, but without surface markers of pDCs and T cells, appearing to be a chimera of NK cells and DCs, namely interferon-producing killer dendritic cells(IKDCs).IKDCs not only secret type I and type II interferons to recognize and kill tumor cells effectively, but also express MHC-II molecules to present antigens.Thus, IKDCs are considered as important immunosurveilance cells for tumors, providing a link between innate and adaptive immunity.

  18. Indoctrinating T cells to attack pathogens through homeschooling.

    Science.gov (United States)

    Parello, Caitlin S; Huseby, Eric S

    2015-06-01

    Adaptive immunity is predicated on the ability of the T cell repertoire to have pre-existing specificity for the universe of potential pathogens. Recent findings suggest that T cell receptor (TCR)-self-major histocompatibility protein (pMHC) interactions limit autoimmune responses while enhancing T cell response to foreign antigens. We review these findings here, placing them in context of the current understanding of how TCR-self-pMHC interactions regulate T cell activation thresholds, and suggest that TCR-self-pMHC interactions increase the efficiency of the T cell repertoire by giving a competitive advantage to peptide cross-reactive T cells. We propose that self-reactivity and peptide cross-reactivity are controlled by particular CDR3 sequence motifs, which would allow thymic selection to contribute to solving the feat of broad pathogen specificity by exporting T cells that are pre-screened by positive and negative selection for the ability to be 'moderately' peptide cross-reactive. PMID:25979654

  19. Infection strategies of intestinal parasite pathogens and host cell responses

    Directory of Open Access Journals (Sweden)

    Bruno Martorell Di Genova

    2016-03-01

    Full Text Available Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica are important pathogenic intestinal parasites and are amongst the leading cause worldwide of diarrheal illness in humans. Diseases caused by these organisms, Giardiasis, Cryptosporidiosis and Amoebiasis, respectively, are characterized by self-limited diarrhea but can evolve to long-term complications. The cellular and molecular mechanisms underlying the pathogenesis of diarrhea associated with these tree pathogens are being unraveled, with knowledge of both the strategies explored by the parasites to establish infection and the methods evolved by hosts to avoid it. Special attention is being given to molecules participating in parasite-host interaction and in the mechanisms implicated in the diseases pathophysiologic processes. This review focuses on cell mechanisms that are modulated during infection, including gene transcription, cytoskeleton rearrangements, signal transduction pathways and cell death.

  20. Infection Strategies of Intestinal Parasite Pathogens and Host Cell Responses.

    Science.gov (United States)

    Di Genova, Bruno M; Tonelli, Renata R

    2016-01-01

    Giardia lamblia, Cryptosporidium sp., and Entamoeba histolytica are important pathogenic intestinal parasites and are amongst the leading causes worldwide of diarrheal illness in humans. Diseases caused by these organisms, giardiasis, cryptosporidiosis, and amoebiasis, respectively, are characterized by self-limited diarrhea but can evolve to long-term complications. The cellular and molecular mechanisms underlying the pathogenesis of diarrhea associated with these three pathogens are being unraveled, with knowledge of both the strategies explored by the parasites to establish infection and the methods evolved by hosts to avoid it. Special attention is being given to molecules participating in parasite-host interaction and in the mechanisms implicated in the diseases' pathophysiologic processes. This review focuses on cell mechanisms that are modulated during infection, including gene transcription, cytoskeleton rearrangements, signal transduction pathways, and cell death. PMID:26973630

  1. Caenorhabditis elegans bacterial pathogen resistant bus-4 mutants produce altered mucins.

    Directory of Open Access Journals (Sweden)

    Lisa M Parsons

    Full Text Available Caenorabditis elegans bus-4 glycosyltransferase mutants are resistant to infection by Microbacterium nematophilum, Yersinia pestis and Yersinia pseudotuberculosis and have altered susceptibility to two Leucobacter species Verde1 and Verde2. Our objective in this study was to define the glycosylation changes leading to this phenotype to better understand how these changes lead to pathogen resistance. We performed MALDI-TOF MS, tandem MS and GC/MS experiments to reveal fine structural detail for the bus-4 N- and O-glycan pools. We observed dramatic changes in O-glycans and moderate ones in N-glycan pools compared to the parent strain. Ce core-I glycans, the nematode's mucin glycan equivalent, were doubled in abundance, halved in charge and bore shifts in terminal substitutions. The fucosyl O-glycans, Ce core-II and neutral fucosyl forms, were also increased in abundance as were fucosyl N-glycans. Quantitative expression analysis revealed that two mucins, let-653 and osm-8, were upregulated nearly 40 fold and also revealed was a dramatic increase in GDP-Man 4,6 dehydratease expression. We performed detailed lectin binding studies that showed changes in glycoconjugates in the surface coat, cuticle surface and intestine. The combined changes in cell surface glycoconjugate distribution, increased abundance and altered properties of mucin provide an environment where likely the above pathogens are not exposed to normal glycoconjugate dependent cues leading to barriers to these bacterial infections.

  2. TLR4-dependent hepcidin expression by myeloid cells in response to bacterial pathogens

    OpenAIRE

    Peyssonnaux, Carole; Zinkernagel, Annelies S.; Datta, Vivekanand; Lauth, Xavier; Johnson, Randall S; Nizet, Victor

    2006-01-01

    Hepcidin is an antimicrobial peptide secreted by the liver during inflammation that plays a central role in mammalian iron homeostasis. Here we demonstrate the endogenous expression of hepcidin by macrophages and neutrophils in vitro and in vivo. These myeloid cell types produced hepcidin in response to bacterial pathogens in a toll-like receptor 4 (TLR4)-dependent fashion. Conversely, bacterial stimulation of macrophages triggered a TLR4-dependent reduction in the iron exporter ferroportin. ...

  3. Bacterial-induced cell reprogramming to stem cell-like cells: new premise in host-pathogen interactions

    OpenAIRE

    Hess, Samuel; Rambukkana, Anura

    2014-01-01

    Bacterial pathogens employ a myriad of strategies to alter host tissue cell functions for bacterial advantage during infection. Recent advances revealed a fusion of infection biology with stem cell biology by demonstrating developmental reprogramming of lineage committed host glial cells to progenitor/stem cell-like cells by an intracellular bacterial pathogen Mycobacterium leprae. Acquisition of migratory and immunomodulatory properties of such reprogrammed cells provides an added advantage ...

  4. Antimicrobial activity against oral pathogens and immunomodulatory effects and toxicity of geopropolis produced by the stingless bee Melipona fasciculata Smith

    OpenAIRE

    Liberio Silvana A; Pereira Antônio Luís A; Dutra Richard P; Reis Aramys S; Araújo Maria José AM; Mattar Nadia S; Silva Lucilene A; Ribeiro Maria Nilce S; Nascimento Flávia Raquel F; Guerra Rosane NM; Monteiro-Neto Valério

    2011-01-01

    Abstract Background Native bees of the tribe Meliponini produce a distinct kind of propolis called geopropolis. Although many pharmacological activities of propolis have already been demonstrated, little is known about geopropolis, particularly regarding its antimicrobial activity against oral pathogens. The present study aimed at investigating the antimicrobial activity of M. fasciculata geopropolis against oral pathogens, its effects on S. mutans biofilms, and the chemical contents of the e...

  5. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  6. De novo identification of viral pathogens from cell culture hologenomes

    Directory of Open Access Journals (Sweden)

    Patowary Ashok

    2012-01-01

    Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

  7. Secreted and immunogenic proteins produced by the honeybee bacterial pathogen, Paenibacillus larvae.

    Science.gov (United States)

    Antúnez, Karina; Anido, Matilde; Evans, Jay D; Zunino, Pablo

    2010-03-24

    American Foulbrood is a severe disease affecting larvae of honeybee Apis mellifera, causing significant decrease in the honeybee population, beekeeping industries and agricultural production. In spite of its importance, little is known about the virulence factors secreted by Paenibacillus larvae during larval infection. The aim of the present work was to perform a first approach to the identification and characterization of P. larvae secretome. P. larvae secreted proteins were analyzed by SDS-PAGE and identified by MALDI-TOF. Protein toxicity was evaluated using an experimental model based on feeding of A. mellifera larvae and immunogenicity was evaluated by Western blot, using an antiserum raised against cells and spores of P. larvae. Ten different proteins were identified among P. larvae secreted proteins, including proteins involved in transcription, metabolism, translation, cell envelope, transport, protein folding, degradation of polysaccharides and motility. Although most of these proteins are cytosolic, many of them have been previously detected in the extracellular medium of different Bacillus spp. cultures and have been related to virulence. The secreted proteins resulted highly toxic and immunogenic when larvae were exposed using an experimental model. This is the first description of proteins secreted by the honeybee pathogen P. larvae. This information may be relevant for the elucidation of bacterial pathogenesis mechanisms. PMID:19781868

  8. Transcriptional Profiling of Th2 Cells Identifies Pathogenic Features Associated with Asthma.

    Science.gov (United States)

    Seumois, Grégory; Zapardiel-Gonzalo, Jose; White, Brandie; Singh, Divya; Schulten, Veronique; Dillon, Myles; Hinz, Denize; Broide, David H; Sette, Alessandro; Peters, Bjoern; Vijayanand, Pandurangan

    2016-07-15

    Allergic asthma and rhinitis are two common chronic allergic diseases that affect the lungs and nose, respectively. Both diseases share clinical and pathological features characteristic of excessive allergen-induced type 2 inflammation, orchestrated by memory CD4(+) T cells that produce type 2 cytokines (Th2 cells). However, a large majority of subjects with allergic rhinitis do not develop asthma, suggesting divergence in disease mechanisms. Because Th2 cells play a pathogenic role in both these diseases and are also present in healthy nonallergic subjects, we performed global transcriptional profiling to determine whether there are qualitative differences in Th2 cells from subjects with allergic asthma, rhinitis, and healthy controls. Th2 cells from asthmatic subjects expressed higher levels of several genes that promote their survival as well as alter their metabolic pathways to favor persistence at sites of allergic inflammation. In addition, genes that enhanced Th2 polarization and Th2 cytokine production were also upregulated in asthma. Several genes that oppose T cell activation were downregulated in asthma, suggesting enhanced activation potential of Th2 cells from asthmatic subjects. Many novel genes with poorly defined functions were also differentially expressed in asthma. Thus, our transcriptomic analysis of circulating Th2 cells has identified several molecules that are likely to confer pathogenic features to Th2 cells that are either unique or common to both asthma and rhinitis. PMID:27271570

  9. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  10. Cell wall integrity signalling in human pathogenic fungi.

    Science.gov (United States)

    Dichtl, Karl; Samantaray, Sweta; Wagener, Johannes

    2016-09-01

    Fungi are surrounded by a rigid structure, the fungal cell wall. Its plasticity and composition depend on active regulation of the underlying biosynthesis and restructuring processes. This involves specialised signalling pathways that control gene expression and activities of biosynthetic enzymes. The cell wall integrity (CWI) pathway is the central signalling cascade required for the adaptation to a wide spectrum of cell wall perturbing conditions, including heat, oxidative stress and antifungals. In the recent years, great efforts were made to analyse the CWI pathway of diverse fungi. It turned out that the CWI signalling cascade is mostly conserved in the fungal kingdom. In this review, we summarise as well as compare the current knowledge on the canonical CWI pathway in the human pathogenic fungi Candida albicans, Candida glabrata, Aspergillus fumigatus and Cryptococcus neoformans. Understanding the differences and similarities in the stress responses of these organisms could become a key to improving existing or developing new antifungal therapies. PMID:27155139

  11. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  12. Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Sandra Mojsova

    2015-10-01

    Full Text Available The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1 isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua. One isolate had a broader antimicrobial activity. None of the isolates showed inhibitory activity against S. enteritidis, E. coli and Y. enterocolitica. The genes enterocin P, cytolysin and enterocin A were the most frequently detected structural genes among the PCR positive strains. No amplification was obtained in two strains E. faecalis-25 and E. faecalis-86. Three different genes were identified in some strains. With the exclusion of strains possessing a virulence factor, such as cytolysin, producers of more than one enterocins could be of a great technological potential as protective cultures in the cheese industry.

  13. Antagonistic activity of antibiotic producing Streptomyces sp. against fish and human pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Nazmul Hossain

    2014-04-01

    Full Text Available In this study, attempts were made to isolate Streptomyces sp. from soil samples of two different regions of Bangladesh and evaluate their antagonistic activity against fish and human pathogenic bacteria. A total of 10 isolates were identified as Streptomyces sp. based on several morphological, physiological and biochemical tests. Cross streak method was used to observe the antagonistic activity of the Streptomyces sp. isolates against different fish pathogens belonging to the genus Aeromonas, Pseudomonas and Edwardsiella and human clinical isolates belonging to the genus Klebsiella, Salmonella and Streptococcus. Seven Streptomyces sp. isolates showed antagonism against both fish and human pathogenic bacteria. Four isolates viz., N24, N26, N28 and N47 showed broad spectrum of antagonistic activity (80-100% against all genera of fish and human pathogenic bacteria. The isolate N49 exhibited highest spectrum of antagonism against all fish pathogens (90-100% but comparatively lower degree of antagonism against human pathogens (50-60%. Rest of the two isolates (N21 and N23 showed variability in their antagonism. Results showed that broad spectrum antibiotic(s could be developed from the isolates N24, N26, N28 and N47against several human and fish pathogens. The isolate N49 could be a potential source of antibiotic, especially for fish pathogenic bacteria.

  14. Bacterial ‘Cell’ Phones: Do cell phones carry potential pathogens?

    OpenAIRE

    Kiran Chawla; Chiranjay Mukhopadhayay; Bimala Gurung; Priya Bhate; Indira Bairy

    2009-01-01

    Cell phones are important companions for professionals especially health care workers (HCWs) for better communication in hospital. The present study compared the nature of the growth of potentially pathogenic bacterial flora on cell phones in hospital and community. 75% cell phones from both the categories grew at least one potentially pathogenic organism. Cell phones from HCWs grew significantly more potential pathogens like MRSA (20%), Acinetobacter species (5%), Pseudomonas species (2.5%) ...

  15. [Comparative analysis of total cell protein electrophoregram of pathogenic Burkholderia].

    Science.gov (United States)

    Budchenko, A A; Iliukhin, V I; Viktorov, D V

    2005-01-01

    Whole-cell proteins of 22 strain of Burkhoderia pseudomallei, including 13 B. mallei, 5 B. cepacia strains and 14 strains of opportunistically pathogenic Pseudomonas defined by 1D SDC-PAAG electrophoresis. Electrophoregrams contained 35 to 45 protein fractions sized 19 to 130 kDa, which were highly reproductive. On the basis of computer-aided comparative analysis of protein patterns the interspecies and intraspecies grouping of studied microorganisms was made. The cluster analysis of the similarity matrix of protein spectra made it possible to allocate two groups of strains at the level of similarity of 78%. Group I was formed by Burkholderia species that previously belonged to the II RNA-DNA homology group of Pseudomonas: B. pseudomallei, B. mallei, B. cepacia. All Pseudomonas species were added to the 2nd Group: P. aeruginosa, P. stutzeri, P. testosterone, P. fluorescens, P. putida, P. mendocina. Four phenons were isolated among the strains of B. pseudomallei and 2 phenons--among the strains of B. mallei at the threshold similarity level (89%). The authors conclude that the comparative analysis of electrophoregrams of whole-cell proteins can be useful in the identification and typing of pathogenic Burkholderia. PMID:15954473

  16. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  17. Pathogenic T cells persist after reversal of autoimmune disease by immunosuppression with regulatory T cells.

    Science.gov (United States)

    Tu, Eric; Bourges, Dorothée; Gleeson, Paul A; Ang, Desmond K Y; van Driel, Ian R

    2013-05-01

    Autoimmune disease can be prevented with immunosuppressive agents; however, the effectiveness of these treatments in advanced stage of disease and the fate of pathogenic T cells following such treatments are not clear. In this study we demonstrate that a single dose of in vitro-induced Treg cells (iTreg cells) resulted in the functional repair and restitution of stomach tissue that had been severely damaged in advanced autoimmune gastritis. iTreg cells caused depletion or inactivation of autoreactive naïve T cells that were antigen inexperienced, however, autoreactive effector/memory T cells persisted in treated mice, resulting in residual cellular infiltrates within the repaired stomach tissue. The persisting autoreactive T cells were able to rapidly cause autoimmune disease if iTreg cells were removed. Similar data were obtained from mice treated continuously with corticosteroid, in that there was substantial restitution of the gastric mucosa; however, effector T cells persisted and rapidly caused pathology following drug removal. Therefore, iTreg cells or corticosteroid can suppress pathogenic autoreactive cells in advanced autoimmune disease, reversing tissue damage and improving tissue function. However, the persistence of pathogenic T cells represents a disease risk. PMID:23420509

  18. Coronatine inhibits stomatal closure and delays hypersensitive response cell death induced by nonhost bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    2013-02-01

    Full Text Available Pseudomonas syringae is the most widespread bacterial pathogen in plants. Several strains of P. syringae produce a phytotoxin, coronatine (COR, which acts as a jasmonic acid mimic and inhibits plant defense responses and contributes to disease symptom development. In this study, we found that COR inhibits early defense responses during nonhost disease resistance. Stomatal closure induced by a nonhost pathogen, P. syringae pv. tabaci, was disrupted by COR in tomato epidermal peels. In addition, nonhost HR cell death triggered by P. syringae pv. tabaci on tomato was remarkably delayed when COR was supplemented along with P. syringae pv. tabaci inoculation. Using isochorismate synthase (ICS-silenced tomato plants and transcript profiles of genes in SA- and JA-related defense pathways, we show that COR suppresses SA-mediated defense during nonhost resistance.

  19. Bioreactor and methods for producing synchronous cells

    Science.gov (United States)

    Helmstetter, Charles E. (Inventor); Thornton, Maureen (Inventor); Gonda, Steve (Inventor)

    2005-01-01

    Apparatus and methods are directed to a perfusion culture system in which a rotating bioreactor is used to grow cells in a liquid culture medium, while these cells are attached to an adhesive-treated porous surface. As a result of this arrangement and its rotation, the attached cells divide, with one cell remaining attached to the substrate, while the other cell, a newborn cell is released. These newborn cells are of approximately the same age, that are collected upon leaving the bioreactor. The populations of newborn cells collected are of synchronous and are minimally, if at all, disturbed metabolically.

  20. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells

    OpenAIRE

    Qilin Yu; Jianrong Li; Yueqi Zhang; Yufan Wang; Lu Liu; Mingchun Li

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxici...

  1. Memory IL-22-producing CD4+ T cells specific for Candida albicans are present in humans.

    Science.gov (United States)

    Liu, Yun; Yang, Binyan; Zhou, Maohua; Li, Li; Zhou, Hui; Zhang, Jianping; Chen, Hui; Wu, Changyou

    2009-06-01

    Co-expression of IL-22 and IL-17 has been identified and demonstrated to be involved in the immunopathogenesis of some autoimmune diseases as well as the defense against pathogenic infections in animal studies. However, the properties of IL-22-producing cells in humans remain largely unclear. In the present study, we showed that IL-22 could be induced from human PBMC following various polyclonal stimulations. The majority of IL-22-producing cells in PBMC were CD4(+) T cells with a memory cell phenotype. In addition, we found that a subset of IL-22(+) T cells produced IL-22 alone, whereas other IL-22(+) T cells co-expressed cytokines typical of Th1, Th2 and Th17 cells. Importantly, stimulation of PBMC from healthy adults with heat-inactivated Candida albicans (C. albicans) yeast or hyphae resulted in IL-22 production by central and effector memory CD4(+) T cells. Moreover, CD4(+)CCR6(+) but not CD4(+)CCR6(-) T cells produced IL-22 when stimulated with either C. albicans or PMA and ionomycin. In addition, PBMC from the individuals infected with C. albicans produced a significantly higher amount of IL-22 compared with healthy controls following stimulation with C. albicans. These data demonstrate that IL-22-producing T cells in humans may play an important role in the defense against fungal infections such as C. albicans. PMID:19449309

  2. Potential Pathogenicity and Host Range of Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates from Healthy Poultry ▿

    OpenAIRE

    Bortolaia, Valeria; Larsen, Jesper; Damborg, Peter; Guardabassi, Luca

    2011-01-01

    Thirty of 33 epidemiologically unrelated extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolates from healthy poultry lacked the virulence genes commonly associated with human-pathogenic strains. The main zoonotic risk is associated with the broad host range of avian E. coli belonging to sequence type complex 10 and of IncN and IncI1 plasmids carrying blaCTX-M or blaSHV.

  3. Exposure to the paralytic shellfish toxin producer Alexandrium catenella increases the susceptibility of the oyster Crassostrea gigas to pathogenic vibrios.

    OpenAIRE

    Celina Abi-Khalil; Carmen Lopez-Joven; Eric Abadie; Veronique Savar; Zouher Amzil; Mohamed Laabir; Jean-Luc Rolland

    2016-01-01

    International audience The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France), we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs), was concomitant with the accumulation of PSTs in oyster flesh and the occurrenc...

  4. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    OpenAIRE

    2013-01-01

    Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates con...

  5. Nanoscale biophysical properties of the cell surface galactosaminogalactan from the fungal pathogen Aspergillus fumigatus

    Science.gov (United States)

    Beaussart, Audrey; El-Kirat-Chatel, Sofiane; Fontaine, Thierry; Latgé, Jean-Paul; Dufrêne, Yves F.

    2015-09-01

    Many fungal pathogens produce cell surface polysaccharides that play essential roles in host-pathogen interactions. In Aspergillus fumigatus, the newly discovered polysaccharide galactosaminogalactan (GAG) mediates adherence to a variety of substrates through molecular mechanisms that are poorly understood. Here we use atomic force microscopy to unravel the localization and adhesion of GAG on living fungal cells. Using single-molecule imaging with tips bearing anti-GAG antibodies, we found that GAG is massively exposed on wild-type (WT) germ tubes, consistent with the notion that this glycopolymer is secreted by the mycelium of A. fumigatus, while it is lacking on WT resting conidia and on germ tubes from a mutant (Δuge3) deficient in GAG. Imaging germ tubes with tips bearing anti-β-glucan antibodies shows that exposure of β-glucan is strongly increased in the Δuge3 mutant, indicating that this polysaccharide is masked by GAG during hyphal growth. Single-cell force measurements show that expression of GAG on germ tubes promotes specific adhesion to pneumocytes and non-specific adhesion to hydrophobic substrates. These results provide a molecular foundation for the multifunctional adhesion properties of GAG, thus suggesting it could be used as a potential target in anti-adhesion therapy and immunotherapy. Our methodology represents a powerful approach for characterizing the nanoscale organization and adhesion of cell wall polysaccharides during fungal morphogenesis, thereby contributing to increase our understanding of their role in biofilm formation and immune responses.

  6. The Intracellular Pathogen Rhodococcus equi Produces a Catecholate Siderophore Required for Saprophytic Growth▿

    OpenAIRE

    Miranda-CasoLuengo, Raúl; Prescott, John F.; Vázquez-Boland, José A.; Meijer, Wim G.

    2007-01-01

    Little is known about the iron acquisition systems of the soilborne facultative intracellular pathogen Rhodococcus equi. We previously reported that expression of iupABC, encoding a putative siderophore ABC transporter system, is iron regulated and required for growth at low iron concentrations. Here we show that disruption of iupA leads to the concomitant accumulation of catecholates and a chromophore with absorption maxima at 341 and 528 nm during growth under iron-replete conditions. In co...

  7. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells.

    Science.gov (United States)

    Yu, Qilin; Li, Jianrong; Zhang, Yueqi; Wang, Yufan; Liu, Lu; Li, Mingchun

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxicity to the tested pathogens, Candida albicans and Pseudomonas aeruginosa, the nanoparticles strongly inhibited pathogenic biofilm formation and invasion to dental pulp stem cells (DPSCs). Further investigations revealed that AuNPs abundantly bound to the pathogen cells, which likely contributed to their inhibitory effect on biofilm formation and invasion. Moreover, treatment of AuNPs led to activation of immune response-related genes in DPSCs, which may enhance the activity of host immune system against the pathogens. Zeta potential analysis and polyethylene glycol (PEG)/polyethyleneimine (PEI) coating tests further showed that the interaction between pathogen cells and AuNPs is associated with electrostatic attractions. Our findings shed novel light on the application of nanomaterials in fighting against clinical pathogens, and imply that the traditional growth inhibition test is not the only way to evaluate the drug effect during the screening of antimicrobial agents. PMID:27220400

  8. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells

    Science.gov (United States)

    Yu, Qilin; Li, Jianrong; Zhang, Yueqi; Wang, Yufan; Liu, Lu; Li, Mingchun

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxicity to the tested pathogens, Candida albicans and Pseudomonas aeruginosa, the nanoparticles strongly inhibited pathogenic biofilm formation and invasion to dental pulp stem cells (DPSCs). Further investigations revealed that AuNPs abundantly bound to the pathogen cells, which likely contributed to their inhibitory effect on biofilm formation and invasion. Moreover, treatment of AuNPs led to activation of immune response-related genes in DPSCs, which may enhance the activity of host immune system against the pathogens. Zeta potential analysis and polyethylene glycol (PEG)/polyethyleneimine (PEI) coating tests further showed that the interaction between pathogen cells and AuNPs is associated with electrostatic attractions. Our findings shed novel light on the application of nanomaterials in fighting against clinical pathogens, and imply that the traditional growth inhibition test is not the only way to evaluate the drug effect during the screening of antimicrobial agents. PMID:27220400

  9. Effects of volatile organic compounds produced by Bacillus amyloliquefaciens on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum.

    Science.gov (United States)

    Raza, Waseem; Wang, Jichen; Wu, Yuncheng; Ling, Ning; Wei, Zhong; Huang, Qiwei; Shen, Qirong

    2016-09-01

    The production of volatile organic compounds (VOCs) by microbes is an important characteristic for their selection as biocontrol agents against plant pathogens. In this study, we identified the VOCs produced by the biocontrol strain Bacillus amyloliquefaciens T-5 and evaluated their impact on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum. The results showed that the VOCs of strain T-5 significantly inhibited the growth of R. solanacearum in agar medium and in soil. In addition, VOCs significantly inhibited the motility traits, root colonization, biofilm formation, and production of antioxidant enzymes and exopolysaccharides by R. solanacearum. However, no effect of VOCs on the production of hydrolytic enzymes by R. solanacearum was observed. The strain T-5 produced VOCs, including benzenes, ketones, aldehydes, alkanes, acids, and one furan and naphthalene compound; among those, 13 VOCs showed 1-10 % antibacterial activity against R. solanacearum in their produced amounts by T-5; however, the consortium of all VOCs produced on agar medium, in sterilized soil, and in natural soil showed 75, 62, and 85 % growth inhibition of R. solanacearum, respectively. The real-time PCR analysis further confirmed the results when the expression of different virulence- and metabolism-related genes in R. solanacearum cells was decreased after exposure to the VOCs of strain T-5. The results of this study clearly revealed the significance of VOCs in the control of plant pathogens. This information would help to better comprehend the microbial interactions mediated by VOCs in nature and to develop safer strategies to control plant disease. PMID:27183998

  10. Photodynamic pathogen inactivation in red cell concentrates with the silicon phthalocyanine Pc 4

    Science.gov (United States)

    Ben-Hur, Ehud; Chan, Wai-Shun; Yim, Zachary; Zuk, Maria M.; Dayal, Vinay; Roth, Nathan; Heldman, Eli; Lazlo, A.; Valeri, C. R.; Horowitz, Bernard

    2000-03-01

    The silicon phthalocyanine Pc 4, a photosensitizer activated with red light, has been studied for pathogen inactivation in red blood cell concentrates (RBCC). Pc 4 targets the envelope of pathogenic viruses such as HIV. To protect RBC during the process two main approaches are used: 1) Inclusion of quenches of reactive oxygen species produced during treatment. Tocopherol succinate was found to be most effective for this purpose. 2) Formulation of Pc 4, a lipophilic compound, in liposomes that reduce its binding to RBC but not to viruses. As a light source we used a light emitting diode array emitting at 660-680 nm. An efficient mixing device ensures homogeneous light exposure during treatment of intact RBCC. Treatment of RBCC with 5 (mu) M Pc 4 a d light results in the inactivation of >= 5.5 log10 HIV, >= 6.6 log10 VSV, and >= 5 log10 of PRV and BVDV. Parasites that can be transmitted by blood transfusion are even more sensitive than viruses. Following treatment, RBCC can be stored for 28 days at 4 degrees C with hemolysis below 1 percent. Baboon RBC circulate with an acceptable 24 hour recovery and half-life. Genetic toxicological studies of Pc 4 with or without light exposure are negative. We conclude that a process using Pc 4 and red light can potentially reduce the risk of transmitting pathogens in RBCC used for transfusion.

  11. Plant cell wall dynamics and wall-related susceptibility in plant–pathogen interactions

    OpenAIRE

    Bellincampi, Daniela; Cervone, Felice; Lionetti, Vincenzo

    2014-01-01

    The cell wall is a dynamic structure that often determines the outcome of the interactions between plants and pathogens. It is a barrier that pathogens need to breach to colonize the plant tissue. While fungal necrotrophs extensively destroy the integrity of the cell wall through the combined action of degrading enzymes, biotrophic fungi require a more localized and controlled degradation of the cell wall in order to keep the host cells alive and utilize their feeding structures. Also bacteri...

  12. Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions

    OpenAIRE

    Daniela eBellincampi; Felice eCervone; Vincenzo eLionetti

    2014-01-01

    The cell wall is a dynamic structure that often determines the outcome of the interactions between plants and pathogens. It is a barrier that pathogens need to breach to colonize the plant tissue. While fungal necrotrophs extensively destroy the integrity of the cell wall through the combined action of degrading enzymes, biotrophic fungi require a more localized and controlled degradation of the cell wall in order to keep the host cells alive and utilize their feeding structures. Also bacteri...

  13. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    Directory of Open Access Journals (Sweden)

    Chotiah S

    2013-06-01

    Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

  14. Broad and efficient control of major foodborne pathogenic strains of Escherichia coli by mixtures of plant-produced colicins.

    Science.gov (United States)

    Schulz, Steve; Stephan, Anett; Hahn, Simone; Bortesi, Luisa; Jarczowski, Franziska; Bettmann, Ulrike; Paschke, Anne-Katrin; Tusé, Daniel; Stahl, Chad H; Giritch, Anatoli; Gleba, Yuri

    2015-10-01

    Enterohemorrhagic Escherichia coli (EHEC) is one of the leading causes of bacterial enteric infections worldwide, causing ∼100,000 illnesses, 3,000 hospitalizations, and 90 deaths annually in the United States alone. These illnesses have been linked to consumption of contaminated animal products and vegetables. Currently, other than thermal inactivation, there are no effective methods to eliminate pathogenic bacteria in food. Colicins are nonantibiotic antimicrobial proteins, produced by E. coli strains that kill or inhibit the growth of other E. coli strains. Several colicins are highly effective against key EHEC strains. Here we demonstrate very high levels of colicin expression (up to 3 g/kg of fresh biomass) in tobacco and edible plants (spinach and leafy beets) at costs that will allow commercialization. Among the colicins examined, plant-expressed colicin M had the broadest antimicrobial activity against EHEC and complemented the potency of other colicins. A mixture of colicin M and colicin E7 showed very high activity against all major EHEC strains, as defined by the US Department of Agriculture/Food and Drug Administration. Treatments with low (less than 10 mg colicins per L) concentrations reduced the pathogenic bacterial load in broth culture by 2 to over 6 logs depending on the strain. In experiments using meats spiked with E. coli O157:H7, colicins efficiently reduced the population of the pathogen by at least 2 logs. Plant-produced colicins could be effectively used for the broad control of pathogenic E. coli in both plant- and animal-based food products and, in the United States, colicins could be approved using the generally recognized as safe (GRAS) regulatory approval pathway. PMID:26351689

  15. Trophic dynamics in an aquatic community: interactions among primary producers, grazers, and a pathogenic fungus.

    Science.gov (United States)

    Buck, Julia C; Scholz, Katharina I; Rohr, Jason R; Blaustein, Andrew R

    2015-05-01

    Free-living stages of parasites are consumed by a variety of predators, which might have important consequences for predators, parasites, and hosts. For example, zooplankton prey on the infectious stage of the amphibian chytrid fungus, Batrachochytrium dendrobatidis (Bd), a pathogen responsible for amphibian population declines and extinctions worldwide. Predation on parasites is predicted to influence community structure and function, and affect disease risk, but relatively few studies have explored its consequences empirically. We investigated interactions among Rana cascadae tadpoles, zooplankton, and Bd in a fully factorial experiment in outdoor mesocosms. We measured growth, development, survival, and infection of amphibians and took weekly measurements of the abundance of zooplankton, phytoplankton (suspended algae), and periphyton (attached algae). We hypothesized that zooplankton might have positive indirect effects on tadpoles by consuming Bd zoospores and by consuming phytoplankton, thus reducing the shading of a major tadpole resource, periphyton. We also hypothesized that zooplankton would have negative effects on tadpoles, mediated by competition for algal resources. Mixed-effects models, repeated-measures ANOVAs, and a structural equation model revealed that zooplankton significantly reduced phytoplankton but had no detectable effects on Bd or periphyton. Hence, the indirect positive effects of zooplankton on tadpoles were negligible when compared to the indirect negative effect mediated by competition for phytoplankton. We conclude that examination of host-pathogen dynamics within a community context may be necessary to elucidate complex community dynamics. PMID:25432573

  16. Volatiles produced by soil-borne endophytic bacteria increase plant pathogen resistance and affect tritrophic interactions.

    Science.gov (United States)

    D'Alessandro, Marco; Erb, Matthias; Ton, Jurriaan; Brandenburg, Anna; Karlen, Danielle; Zopfi, Jakob; Turlings, Ted C J

    2014-04-01

    Volatile organic compounds (VOCs) released by soil microorganisms influence plant growth and pathogen resistance. Yet, very little is known about their influence on herbivores and higher trophic levels. We studied the origin and role of a major bacterial VOC, 2,3-butanediol (2,3-BD), on plant growth, pathogen and herbivore resistance, and the attraction of natural enemies in maize. One of the major contributors to 2,3-BD in the headspace of soil-grown maize seedlings was identified as Enterobacter aerogenes, an endophytic bacterium that colonizes the plants. The production of 2,3-BD by E. aerogenes rendered maize plants more resistant against the Northern corn leaf blight fungus Setosphaeria turcica. On the contrary, E. aerogenes-inoculated plants were less resistant against the caterpillar Spodoptera littoralis. The effect of 2,3-BD on the attraction of the parasitoid Cotesia marginiventris was more variable: 2,3-BD application to the headspace of the plants had no effect on the parasitoids, but application to the soil increased parasitoid attraction. Furthermore, inoculation of seeds with E. aerogenes decreased plant attractiveness, whereas inoculation of soil with a total extract of soil microbes increased parasitoid attraction, suggesting that the effect of 2,3-BD on the parasitoid is indirect and depends on the composition of the microbial community. PMID:24127750

  17. Diversity and natural functions of antibiotices produced by beneficial and pathogenic soil bacteria

    Science.gov (United States)

    Soil and plant-associated environments harbor numerous bacterial species that produce antibiotic metabolites. Many of these bacteria have been exploited for the discovery of clinical antibiotics and other therapeutics. In the field of plant pathology, antibiotic-producing bacteria are used as a reso...

  18. Purification and Structural Analysis of a Selective Toxin Fraction Produced by the Plant Pathogen Setosphaeria turcica

    Institute of Scientific and Technical Information of China (English)

    ZHANG Li-hui; DONG Jin-gao; WANG Chao-hua; LI Zheng-ping

    2007-01-01

    Thirteen fractions from the pathogenic plant fungus Setosphaeria turcica race 1 were separated and collected using high performance liquid chromatography (HPLC). Their toxic activities were assayed through leaf puncturing on corn differentials (OH43, OH43Htl, OH43Ht2, and OH43HtN), and the results revealed that eight fractions were toxic and fraction 6 was specifically toxic to OH43Htl, which could be taken as a gene-selective toxin fraction. Fraction 6 was finely purified via HPLC and condensed by freeze desiccation. Its chemical structure was analyzed with EI-MS, IR, HMBC, 1H-NMR, and two-dimensional NMR. The results suggested that fraction 6 contained an unsaturated double bond, carbonyl and methylene groups with molecular weight of 142.

  19. Antitumor Immunity Produced by the Liver Kupffer Cells, NK Cells, NKT Cells, and CD8+ CD122+ T Cells

    OpenAIRE

    Shuhji Seki; Hiroyuki Nakashima; Masahiro Nakashima; Manabu Kinoshita

    2011-01-01

    Mouse and human livers contain innate immune leukocytes, NK cells, NKT cells, and macrophage-lineage Kupffer cells. Various bacterial components, including Toll-like receptor (TLR) ligands and an NKT cell ligand ( α -galactocylceramide), activate liver Kupffer cells, which produce IL-1, IL-6, IL-12, and TNF. IL-12 activates hepatic NK cells and NKT cells to produce IFN- γ , which further activates hepatic T cells, in turn activating phagocytosis and cytokine production by Kupffer cells in a p...

  20. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  1. Chicken dendritic cells are susceptible to highly pathogenic avian influenza viruses which induce strong cytokine responses

    NARCIS (Netherlands)

    Vervelde, L.; Reemens, S.S.; Haarlem, van D.A.; Post, J.; Claassen, E.A.W.; Rebel, J.M.J.; Jansen, C.A.

    2013-01-01

    Infection with highly pathogenic avian influenza (HPAI) in birds and mammals is associated with severe pathology and increased mortality. We hypothesize that in contrast to low pathogenicity avian influenza (LPAI) infection, HPAI infection of chicken dendritic cells (DC) induces a cytokine deregulat

  2. mTOR Regulation of Lymphoid Cells in Immunity to Pathogens.

    Science.gov (United States)

    Keating, Rachael; McGargill, Maureen Ann

    2016-01-01

    Immunity to pathogens exists as a fine balance between promoting activation and expansion of effector cells, while simultaneously limiting normal and aberrant responses. These seemingly opposing functions are kept in check by immune regulators. The mechanistic target of rapamycin (mTOR) is a serine/threonine kinase that senses nutrient availability and, in turn, regulates cell metabolism, growth, and survival accordingly. mTOR plays a pivotal role in facilitating immune defense against invading pathogens by regulating the differentiation, activation, and effector functions of lymphoid cells. Here, we focus on the emerging and sometimes contradictory roles of mTOR in orchestrating lymphoid cell-mediated host immune responses to pathogens. A thorough understanding of how mTOR impacts lymphoid cells in pathogen defense will provide the necessary base for developing therapeutic interventions for infectious diseases. PMID:27242787

  3. mTOR regulation of lymphoid cells in immunity to pathogens

    Directory of Open Access Journals (Sweden)

    Rachael eKeating

    2016-05-01

    Full Text Available Immunity to pathogens exists as a fine balance between promoting activation and expansion of effector cells, while simultaneously limiting normal and aberrant responses. These seemingly opposing functions are kept in check by immune regulators. The mechanistic target of rapamycin (mTOR is a serine/threonine kinase that senses nutrient availability and in turn, regulates cell metabolism, growth, and survival accordingly. mTOR plays a pivotal role in facilitating immune defense against invading pathogens by regulating the differentiation, activation, and effector functions of lymphoid cells. Here we focus on the emerging and sometimes contradictory roles of mTOR in orchestrating lymphoid cell-mediated host immune responses to pathogens. A thorough understanding of how mTOR impacts lymphoid cells in pathogen defense will provide the necessary base for developing therapeutic interventions for infectious diseases.

  4. Enteric human pathogens associated with fresh produce: sources, transport and ecology.

    Science.gov (United States)

    The consumption of fresh fruits and vegetables has been growing in the United States and other western countries due to their health benefits and the year-round availability of many produce commodities. However, the increase in consumption has correlated with an increase in foodborne outbreaks asso...

  5. Combining biocontrol with chlorine dioxide and other intervention technologies for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Produce contamination incited by Salmonella enterica, Escherichia coli O157:H7 and Listeria monocytogenes are of considerable importance to food safety. Post-harvest intervention measures can reduce or eliminate contamination and enhance food safety. In this reserach, the effectiveness of biocontr...

  6. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2004-2005 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2005-05-01

    In the spring of 2004 naturally produced smolts outmigrating from the Yakima River Basin were collected for the sixth year of pathogen screening. This component of the evaluation is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Since 1999 the Cle Elum Hatchery has been releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. In 1998 and 2000 through 2004 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. Of these pathogens, only R. salmoninarum was detected in very low levels in the naturally produced smolts outmigrating in 2004. To date, only bacterial pathogens have been detected and prevalences have been low. There have been small variations each year and these changes are attributed to normal fluctuations in prevalence. All of the pathogens detected are widely distributed in Washington State.

  7. Extrapancreatic insulin-producing cells in multiple organs in diabetes

    OpenAIRE

    Kojima, Hideto; Fujimiya, Mineko; Matsumura, Kazuhiro; Nakahara, Tamio; Hara, Manami; Chan, Lawrence

    2004-01-01

    Insulin-producing cells normally occur only in the pancreas and thymus. Surprisingly, we found widespread insulin mRNA and protein expression in different diabetic mouse and rat models, including streptozotocin-treated mice and rats, ob/ob mice, and mice fed high-fat diets. We detected in diabetic mice proinsulin- and insulin-positive cells in the liver, adipose tissue, spleen, bone marrow, and thymus; many cells also produced glucagon, somatostatin, and pancreatic polypeptide. By in situ nuc...

  8. An optical biosensor for detection of pathogen biomarkers from Shiga toxin-producing Escherichia coli in ground beef samples

    Science.gov (United States)

    Lamoureux, Loreen; Adams, Peter; Banisadr, Afsheen; Stromberg, Zachary; Graves, Steven; Montano, Gabriel; Moxley, Rodney; Mukundan, Harshini

    2014-03-01

    Shiga toxin-producing Escherichia coli (STEC) poses a serious threat to human health through the consumption of contaminated food products, particularly beef and produce. Early detection in the food chain, and discrimination from other non-pathogenic Escherichia coli (E. coli), is critical to preventing human outbreaks, and meeting current agricultural screening standards. These pathogens often present in low concentrations in contaminated samples, making discriminatory detection difficult without the use of costly, time-consuming methods (e.g. culture). Using multiple signal transduction schemes (including novel optical methods designed for amphiphiles), specific recognition antibodies, and a waveguide-based optical biosensor developed at Los Alamos National Laboratory, we have developed ultrasensitive detection methods for lipopolysaccharides (LPS), and protein biomarkers (Shiga toxin) of STEC in complex samples (e.g. beef lysates). Waveguides functionalized with phospholipid bilayers were used to pull down amphiphilic LPS, using methods (membrane insertion) developed by our team. The assay format exploits the amphiphilic biochemistry of lipoglycans, and allows for rapid, sensitive detection with a single fluorescent reporter. We have used a combination of biophysical methods (atomic force and fluorescence microscopy) to characterize the interaction of amphiphiles with lipid bilayers, to efficiently design these assays. Sandwich immunoassays were used for detection of protein toxins. Biomarkers were spiked into homogenated ground beef samples to determine performance and limit of detection. Future work will focus on the development of discriminatory antibodies for STEC serotypes, and using quantum dots as the fluorescence reporter to enable multiplex screening of biomarkers.

  9. IL-10-producing type 1 regulatory T cells and allergy.

    Science.gov (United States)

    Wu, Kui; Bi, Yutian; Sun, Kun; Wang, Changzheng

    2007-08-01

    As an important subset of regulatory T (Treg) cells, IL-10-producing type 1 regulatory T cells (Tr1), have some different features to thymic-derived naturally occurring CD4+CD25+Foxp3+ Treg cells(nTreg cells). Similar to nTreg cells, Tr1 also play important roles in the control of allergic inflammation in several ways. There is a fine balance between Tr1 and Th2 responses in healthy subjects. Skewing of allergic-specific effector T cells to a Tr1 phenotype appears to be a critical event in successful allergen-specific immunotherapy and glucocorticoids and beta2-agonists treatment. Tr1 suppress Th2 cells and effector cells of allergic inflammation, such as eosinophils, mast cells, basophils, through producing IL-10, and perhaps TGF-beta. Understanding of Tr1 may be helpful in developing new strategies for treatment of allergic diseases. PMID:17764617

  10. IL-10-Producing Type 1 Regulatory T Cells and Allergy

    Institute of Scientific and Technical Information of China (English)

    Kui Wu; Yutian Bi; Kun Sun; Changzheng Wang

    2007-01-01

    As an important subset of regulatory T (Treg) cells, IL-10-producing type 1 regulatory T cells (Tr1), have some different features to thymic-derived naturally occurring CD4+CD25+Foxp3+ Treg cells(nTreg cells). Similar to nTreg cells, Tr1 also play important roles in the control of allergic inflammation in several ways. There is a fine balance between Tr1 and Th2 responses in healthy subjects. Skewing of allergic-specific effctor T cells to a Tr1 phenotype appears to be a critical event in successful allergen-specific immunotherapy and glucocorticoids and β2-agonists treatment. Tr1 suppress Th2 cells and effector cells of allergic inflammation, such as eosinophils, mast cells, basophils, through producing IL-10, and perhaps TGF-β. Understanding of Tr1 may be helpful in developing new strategies for treatment of allergic diseases.

  11. Development of disease preventive method using radiated pathogenic microorganisms, cell lines and animals

    International Nuclear Information System (INIS)

    The effects of radiation were investigated on pathogenic plasmid aiming at a development of a method to induce mutagenesis in plasmid DNA by radiation. To construct an experimental system which allows to detect a plasmid-segregated cell, kanamycin-resistant casette was inserted into pX02, a capsule plasmid in Bacillus anthracis to produce acpA:: Kmr by homologous recombination. This plasmid is thought available for analyzing the rate of plasmid segregation caused by radiation. Next, developments of detection and determination methods for various cytokines were attempted by RT-PCR method with an aim to investigate the expression changes of cytokine mRNA in calf immunocytes by radiation. In calf peripheral monocytes and alveolar macrophages, expressions of cytokine mRNAs such as IL-4, IFNα and GM-CSF mRNA as well as IL-1α, IL-1β, IL-2 and IL-6 were detected by RT-PCR method. (M.N.)

  12. Draft Genome Sequence of Pseudomonas fluorescens LMG 5329, a White Line-Inducing Principle-Producing Bioindicator for the Mushroom Pathogen Pseudomonas tolaasii

    OpenAIRE

    Ghequire, Maarten G.K.; Rokni-Zadeh, Hassan; Zarrineh, Peyman; De Mot, René

    2013-01-01

    Pseudomonas tolaasii, the causative agent of Agaricus bisporus brown blotch disease, can be identified by the white line reaction, occurring upon confrontation of the tolaasin-producing mushroom pathogen with “Pseudomonas reactans,” producing the lipopeptide white line-inducing principle (WLIP). The draft genome sequence of the WLIP-producing indicator Pseudomonas fluorescens strain LMG 5329 is reported here.

  13. RNA structures that resist degradation by Xrn1 produce a pathogenic Dengue virus RNA.

    Science.gov (United States)

    Chapman, Erich G; Moon, Stephanie L; Wilusz, Jeffrey; Kieft, Jeffrey S

    2014-01-01

    Dengue virus is a growing global health threat. Dengue and other flaviviruses commandeer the host cell's RNA degradation machinery to generate the small flaviviral RNA (sfRNA), a noncoding RNA that induces cytopathicity and pathogenesis. Host cell exonuclease Xrn1 likely loads on the 5' end of viral genomic RNA and degrades processively through ∼10 kB of RNA, halting near the 3' end of the viral RNA. The surviving RNA is the sfRNA. We interrogated the architecture of the complete Dengue 2 sfRNA, identifying five independently-folded RNA structures, two of which quantitatively confer Xrn1 resistance. We developed an assay for real-time monitoring of Xrn1 resistance that we used with mutagenesis and RNA folding experiments to show that Xrn1-resistant RNAs adopt a specific fold organized around a three-way junction. Disrupting the junction's fold eliminates the buildup of disease-related sfRNAs in human cells infected with a flavivirus, directly linking RNA structure to sfRNA production. DOI: http://dx.doi.org/10.7554/eLife.01892.001. PMID:24692447

  14. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios.

    Science.gov (United States)

    Abi-Khalil, Celina; Lopez-Joven, Carmen; Abadie, Eric; Savar, Veronique; Amzil, Zouher; Laabir, Mohamed; Rolland, Jean-Luc

    2016-01-01

    The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France), we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs), was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events. PMID:26784228

  15. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios

    Directory of Open Access Journals (Sweden)

    Celina Abi-Khalil

    2016-01-01

    Full Text Available The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France, we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs, was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events.

  16. Elucidation of sevadicin, a novel non-ribosomal peptide secondary metabolite produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Ensle, Paul; Süssmuth, Roderich D; Genersch, Elke

    2014-05-01

    American foulbrood (AFB) caused by the bee pathogenic bacterium Paenibacillus larvae is the most devastating bacterial disease of honey bees worldwide. From AFB-dead larvae, pure cultures of P. larvae can normally be cultivated indicating that P. larvae is able to defend its niche against all other bacteria present. Recently, comparative genome analysis within the species P. larvae suggested the presence of gene clusters coding for multi-enzyme complexes, such as non-ribosomal peptide synthetases (NRPSs). The products of these enzyme complexes are known to have a wide range of biological activities including antibacterial activities. We here present our results on antibacterial activity exhibited by vegetative P. larvae and the identification and analysis of a novel antibacterially active P. larvae tripeptide (called sevadicin; Sev) produced by a NRPS encoded by a gene cluster found in the genome of P. larvae. Identification of Sev was ultimately achieved by comparing the secretome of wild-type P. larvae with knockout mutants of P. larvae lacking production of Sev. Subsequent mass spectrometric studies, enantiomer analytics and chemical synthesis revealed the sequence and configuration of the tripeptide, D-Phe-D-ALa-Trp, which was shown to have antibacterial activity. The relevance of our findings is discussed in respect to host-pathogen interactions. PMID:25118351

  17. Host cells and methods for producing isoprenyl alkanoates

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-12-01

    The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

  18. Jasmonate ZIM-domain (JAZ protein regulates host and nonhost pathogen-induced cell death in tomato and Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Ishiga

    Full Text Available The nonhost-specific phytotoxin coronatine (COR produced by several pathovars of Pseudomonas syringae functions as a jasmonic acid-isoleucine (JA-Ile mimic and contributes to disease development by suppressing plant defense responses and inducing reactive oxygen species in chloroplast. It has been shown that the F-box protein CORONATINE INSENSITIVE 1 (COI1 is the receptor for COR and JA-Ile. JASMONATE ZIM DOMAIN (JAZ proteins act as negative regulators for JA signaling in Arabidopsis. However, the physiological significance of JAZ proteins in P. syringae disease development and nonhost pathogen-induced hypersensitive response (HR cell death is not completely understood. In this study, we identified JAZ genes from tomato, a host plant for P. syringae pv. tomato DC3000 (Pst DC3000, and examined their expression profiles in response to COR and pathogens. Most JAZ genes were induced by COR treatment or inoculation with COR-producing Pst DC3000, but not by the COR-defective mutant DB29. Tomato SlJAZ2, SlJAZ6 and SlJAZ7 interacted with SlCOI1 in a COR-dependent manner. Using virus-induced gene silencing (VIGS, we demonstrated that SlJAZ2, SlJAZ6 and SlJAZ7 have no effect on COR-induced chlorosis in tomato and Nicotiana benthamiana. However, SlJAZ2-, SlJAZ6- and SlJAZ7-silenced tomato plants showed enhanced disease-associated cell death to Pst DC3000. Furthermore, we found delayed HR cell death in response to the nonhost pathogen Pst T1 or a pathogen-associated molecular pattern (PAMP, INF1, in SlJAZ2- and SlJAZ6-silenced N. benthamiana. These results suggest that tomato JAZ proteins regulate the progression of cell death during host and nonhost interactions.

  19. First report of Pseudobodo sp, a new pathogen for a potential energy-producing algae: Chlorella vulgaris cultures.

    Directory of Open Access Journals (Sweden)

    Zhangran Chen

    Full Text Available Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4-5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant.

  20. Sequential necrotizing fasciitis caused by the monomicrobial pathogens Streptococcus equisimilis and extended-spectrum beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Endo, Akiko; Matsuoka, Ryosuke; Mizuno, Yasushi; Doi, Asako; Nishioka, Hiroaki

    2016-08-01

    Necrotizing fasciitis is a rapidly progressing bacterial infection of the superficial fascia and subcutaneous tissue that is associated with a high mortality rate and is caused by a single species of bacteria or polymicrobial organisms. Escherichia coli is rarely isolated from patients with monomicrobial disease. Further, there are few reports of extended-spectrum beta-lactamase (ESBL)-producing E. coli associated with necrotizing fasciitis. We report here our treatment of an 85-year-old man who was admitted because of necrotizing fasciitis of his right thigh. Streptococcus equisimilis was detected as a monomicrobial pathogen, and the infection was cured by amputation of the patient's right leg and the administration of antibiotics. However, 5 days after discontinuing antibiotic therapy, he developed necrotizing fasciitis on his right upper limb and died. ESBL-producing E. coli was the only bacterial species isolated from blood and skin cultures. This case demonstrates that ESBL-producing E. coli can cause monomicrobial necrotizing fasciitis, particularly during hospitalization and that a different bacterial species can cause disease shortly after a previous episode. PMID:26912298

  1. LDS1-produced oxylipins are negative regulators of growth, conidiation and fumonisin synthesis in the fungal maize pathogen Fusarium verticillioides.

    Science.gov (United States)

    Scala, Valeria; Giorni, Paola; Cirlini, Martina; Ludovici, Matteo; Visentin, Ivan; Cardinale, Francesca; Fabbri, Anna A; Fanelli, Corrado; Reverberi, Massimo; Battilani, Paola; Galaverna, Gianni; Dall'Asta, Chiara

    2014-01-01

    Oxylipins are fatty acid-derived signaling compounds produced by all eukaryotes so far investigated; in mycotoxigenic fungi, they modulate toxin production and interactions with the host plants. Among the many enzymes responsible for oxylipin generation, Linoleate Diol Synthase 1 (LDS1) produces mainly 8-hydroperoxyoctadecenoic acid and subsequently different di-hydroxyoctadecenoic acids. In this study, we inactivated a copy of the putative LDS1 ortholog (acc. N. FVEG_09294.3) of Fusarium verticillioides, with the aim to investigate its influence on the oxylipin profile of the fungus, on its development, secondary metabolism and virulence. LC-MS/MS oxylipin profiling carried out on the selected mutant strain revealed significant quali-quantitative differences for several oxylipins when compared to the WT strain. The Fvlds1-deleted mutant grew better, produced more conidia, synthesized more fumonisins and infected maize cobs faster than the WT strain. We hypothesize that oxylipins may act as regulators of gene expression in the toxigenic plant pathogen F. verticillioides, in turn causing notable changes in its phenotype. These changes could relate to the ability of oxylipins to re-shape the transcriptional profile of F. verticillioides by inducing chromatin modifications and exerting a direct control on the transcription of secondary metabolism in fungi. PMID:25566199

  2. A hepatocellular carcinoma cell line producing mature hepatitis B viral particles

    International Nuclear Information System (INIS)

    Current in vitro models for hepatitis B virus (HBV) are based on human hepatoblastoma cell lines transfected with HBV genome. The objective of this work was to develop an in vitro, hepatocellular carcinoma (HCC)-based system supporting HBV full replication and producing mature viral particles. The FLC4 human HCC cell line was stably transfected with a plasmid carrying a head-to-tail dimer of the adwHBV genome. One of the clones, FLC4A10II, exhibited prolonged expression of HBV, as was demonstrated by secreted levels of HBsAg, HBeAg, and HBV DNA in the culture medium of the growing cells. Furthermore, the cells produced HBV particles that were detected by a cesium chloride density gradient performed on the culture medium. Analysis by Southern blot revealed that HBV DNA has integrated into the FLC4A10II cell genome. The presence of HBV in the FLC4A10II cells did not cause alterations in cell morphology and the cells continued to resemble mature hepatocytes. They do exhibit a high mitotic activity. The new HBV stably transfected cell line, FLC4A10II, can serve as an important tool for further exploration of HBV host-pathogen interaction, viral life cycle, and for assessing new antiviral agents

  3. Occurrence of foodborne pathogens and characterization of Staphylococcus aureus in cheese produced on farm-dairies.

    Science.gov (United States)

    Rosengren, Asa; Fabricius, Ane; Guss, Bengt; Sylvén, Susanne; Lindqvist, Roland

    2010-12-15

    The objective of this study was to address knowledge gaps identified in an earlier risk assessment of Staphylococcus aureus and raw milk cheese. A survey of fresh and short-time ripened cheeses produced on farm-dairies in Sweden was conducted to investigate the occurrence and levels of S. aureus, Listeria monocytogenes and Escherichia coli, to characterize S. aureus isolates with special emphasis on enterotoxin genes, antibiotic resistance, bio-typing and genetic variation, and to collect information related to production practices. In general, the hygienic quality of farm-dairy cheeses appeared to be of an acceptable microbiological quality, e.g. L. monocytogenes and staphylococcal enterotoxin were not detected in cheese samples. However, E. coli and enterotoxigenic S. aureus were frequently found in raw milk cheeses and sometimes at levels that are of concern, especially in fresh cheese. Interestingly, levels in raw milk fresh cheese were significantly lower when starter cultures were used. Up to five S. aureus colonies per cheese, if possible, were characterized and about 70% of isolates carried one or more enterotoxin genes, most common were sec and sea. The Ovine biotype (73%) was most common among isolates from goat milk cheese and the Human biotype (60%) from cow milk cheese. Of all isolates, 39% showed decreased susceptibility to penicillin, but the proportion of isolates from cows' cheese (66%) compared to isolates from goats' cheese (27%) was significantly higher. S. aureus isolates with different properties were detected in cheese from the same farm and, sometimes even the same cheese. Isolates with the same pulsed-field gel electrophoresis (PFGE)-pattern were detected on geographically distant dairies. This indicates that multiple sources and routes of contamination are important. To improve the safety of these products efforts to raise awareness of the importance of hygiene barriers and raw milk quality as well as improved process control can be

  4. Hydrogen Peroxide Produced by Oral Streptococci Induces Macrophage Cell Death

    OpenAIRE

    Okahashi, Nobuo; Nakata, Masanobu; Sumitomo, Tomoko; Terao, Yutaka; Kawabata, Shigetada

    2013-01-01

    Hydrogen peroxide (H2O2) produced by members of the mitis group of oral streptococci plays important roles in microbial communities such as oral biofilms. Although the cytotoxicity of H2O2 has been widely recognized, the effects of H2O2 produced by oral streptococci on host defense systems remain unknown. In the present study, we investigated the effect of H2O2 produced by Streptococcus oralis on human macrophage cell death. Infection by S. oralis was found to stimulate cell death of a THP-1 ...

  5. Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

    Science.gov (United States)

    Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

    2016-04-01

    Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria. PMID:26830743

  6. Arsenal of plant cell wall degrading enzymes reflects host preference among plant pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Bergstrom Gary C

    2011-02-01

    Full Text Available Abstract Background The discovery and development of novel plant cell wall degrading enzymes is a key step towards more efficient depolymerization of polysaccharides to fermentable sugars for the production of liquid transportation biofuels and other bioproducts. The industrial fungus Trichoderma reesei is known to be highly cellulolytic and is a major industrial microbial source for commercial cellulases, xylanases and other cell wall degrading enzymes. However, enzyme-prospecting research continues to identify opportunities to enhance the activity of T. reesei enzyme preparations by supplementing with enzymatic diversity from other microbes. The goal of this study was to evaluate the enzymatic potential of a broad range of plant pathogenic and non-pathogenic fungi for their ability to degrade plant biomass and isolated polysaccharides. Results Large-scale screening identified a range of hydrolytic activities among 348 unique isolates representing 156 species of plant pathogenic and non-pathogenic fungi. Hierarchical clustering was used to identify groups of species with similar hydrolytic profiles. Among moderately and highly active species, plant pathogenic species were found to be more active than non-pathogens on six of eight substrates tested, with no significant difference seen on the other two substrates. Among the pathogenic fungi, greater hydrolysis was seen when they were tested on biomass and hemicellulose derived from their host plants (commelinoid monocot or dicot. Although T. reesei has a hydrolytic profile that is highly active on cellulose and pretreated biomass, it was less active than some natural isolates of fungi when tested on xylans and untreated biomass. Conclusions Several highly active isolates of plant pathogenic fungi were identified, particularly when tested on xylans and untreated biomass. There were statistically significant preferences for biomass type reflecting the monocot or dicot host preference of the

  7. Produced Water Treatment Using Microbial Fuel Cell Technology

    Energy Technology Data Exchange (ETDEWEB)

    Borole, A. P.; Campbell, R. [Campbell Applied Physics

    2011-05-20

    ORNL has developed a treatment for produced water using a combination of microbial fuel cells and electrosorption. A collaboration between Campbell Applied Physics and ORNL was initiated to further investigate development of the technology and apply it to treatment of field produced water. The project successfully demonstrated the potential of microbial fuel cells to generate electricity from organics in produced water. A steady voltage was continuously generated for several days using the system developed in this study. In addition to the extraction of electrical energy from the organic contaminants, use of the energy at the representative voltage was demonstrated for salts removal or desalination of the produced water. Thus, the technology has potential to remove organic as well as ionic contaminants with minimal energy input using this technology. This is a novel energy-efficient method to treat produced water. Funding to test the technology at larger scale is being pursued to enable application development.

  8. New Roles for Mast Cells in Modulating Allergic Reactions and Immunity Against Pathogens

    OpenAIRE

    Hofmann, Alison M.; Abraham, Soman N.

    2009-01-01

    Mast cells have primarily been associated with mediating the pathological secondary responses to allergens in sensitized hosts. In view of the recent evidence for a mast cell role in modulating primary immune responses to pathogens, the likelihood for a role of mast cells in influencing primary immune response to allergens has grown. New evidence suggests that mast cells drive the development of Th2 responses to allergens, particularly when allergen exposure occurs concomitantly with exposure...

  9. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2001 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Pearsons, Todd N.; Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-01-01

    The change in pathogens prevalence to wild fish is probably the least studied ecological interaction associated with hatchery operations. In 1999, the Cle Elum Hatchery began releasing spring chinook smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to evaluate whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and monitored for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition, the fish were tested for Ceratomyxa shasta spores in 2001. Not all testing has been completed for every year, but to date, there have only been minimal changes in levels of the bacterial pathogens in the naturally produced smolts. At this point, due to the limited testing so far, these changes are attributed to normal fluctuation of prevalence.

  10. Francisella novicida pathogenicity island encoded proteins were secreted during infection of macrophage-like cells.

    Science.gov (United States)

    Hare, Rebekah F; Hueffer, Karsten

    2014-01-01

    Intracellular pathogens and other organisms have evolved mechanisms to exploit host cells for their life cycles. Virulence genes of some intracellular bacteria responsible for these mechanisms are located in pathogenicity islands, such as secretion systems that secrete effector proteins. The Francisella pathogenicity island is required for phagosomal escape, intracellular replication, evasion of host immune responses, virulence, and encodes a type 6 secretion system. We hypothesize that some Francisella novicida pathogenicity island proteins are secreted during infection of host cells. To test this hypothesis, expression plasmids for all Francisella novicida FPI-encoded proteins with C-terminal and N-terminal epitope FLAG tags were developed. These plasmids expressed their respective epitope FLAG-tagged proteins at their predicted molecular weights. J774 murine macrophage-like cells were infected with Francisella novicida containing these plasmids. The FPI proteins expressed from these plasmids successfully restored the intramacrophage growth phenotype in mutants of the respective genes that were deficient for intramacrophage growth. Using these expression plasmids, the localization of the Francisella pathogenicity island proteins were examined via immuno-fluorescence microscopy within infected macrophage-like cells. Several Francisella pathogenicity island encoded proteins (IglABCDEFGHIJ, PdpACE, DotU and VgrG) were detected extracellularly and they were co-localized with the bacteria, while PdpBD and Anmk were not detected and thus remained inside bacteria. Proteins that were co-localized with bacteria had different patterns of localization. The localization of IglC was dependent on the type 6 secretion system. This suggests that some Francisella pathogenicity island proteins were secreted while others remain within the bacterium during infection of host cells as structural components of the secretion system and were necessary for secretion. PMID:25158041

  11. Antimicrobial activity against oral pathogens and immunomodulatory effects and toxicity of geopropolis produced by the stingless bee Melipona fasciculata Smith

    Directory of Open Access Journals (Sweden)

    Liberio Silvana A

    2011-11-01

    Full Text Available Abstract Background Native bees of the tribe Meliponini produce a distinct kind of propolis called geopropolis. Although many pharmacological activities of propolis have already been demonstrated, little is known about geopropolis, particularly regarding its antimicrobial activity against oral pathogens. The present study aimed at investigating the antimicrobial activity of M. fasciculata geopropolis against oral pathogens, its effects on S. mutans biofilms, and the chemical contents of the extracts. A gel prepared with a geopropolis extract was also analyzed for its activity on S. mutans and its immunotoxicological potential. Methods Antimicrobial activities of three hydroalcoholic extracts (HAEs of geopropolis, and hexane and chloroform fractions of one extract, were evaluated using the agar diffusion method and the broth dilution technique. Ethanol (70%, v/v and chlorhexidine (0.12%, w/w were used as negative and positive controls, respectively. Total phenol and flavonoid concentrations were assayed by spectrophotometry. Immunotoxicity was evaluated in mice by topical application in the oral cavity followed by quantification of biochemical and immunological parameters, and macro-microscopic analysis of animal organs. Results Two extracts, HAE-2 and HAE-3, showed inhibition zones ranging from 9 to 13 mm in diameter for S. mutans and C. albicans, but presented no activity against L. acidophilus. The MBCs for HAE-2 and HAE-3 against S. mutans were 6.25 mg/mL and 12.5 mg/mL, respectively. HAE-2 was fractionated, and its chloroform fraction had an MBC of 14.57 mg/mL. HAE-2 also exhibited bactericidal effects on S. mutans biofilms after 3 h of treatment. Significant differences (p Conclusions In summary, geopropolis produced by M. fasciculata can exert antimicrobial action against S. mutans and C. albicans, with significant inhibitory activity against S. mutans biofilms. The extract with the highest flavonoid concentration, HAE-2, presented the

  12. Detection and Characterization of Cancer Cells and Pathogenic Bacteria Using Aptamer-Based Nano-Conjugates

    Directory of Open Access Journals (Sweden)

    Vinayakumar Gedi

    2014-09-01

    Full Text Available Detection and characterization of cells using aptamers and aptamer-conjugated nanoprobes has evolved a great deal over the past few decades. This evolution has been driven by the easy selection of aptamers via in vitro cell-SELEX, permitting sensitive discrimination between target and normal cells, which includes pathogenic prokaryotic and cancerous eukaryotic cells. Additionally, when the aptamer-based strategies are used in conjunction with nanomaterials, there is the potential for cell targeting and therapeutic effects with improved specificity and sensitivity. Here we review recent advances in aptamer-based nano-conjugates and their applications for detecting cancer cells and pathogenic bacteria. The multidisciplinary research utilized in this field will play an increasingly significant role in clinical medicine and drug discovery.

  13. The role of the secondary cell wall in plant resistance to pathogens.

    Science.gov (United States)

    Miedes, Eva; Vanholme, Ruben; Boerjan, Wout; Molina, Antonio

    2014-01-01

    Plant resistance to pathogens relies on a complex network of constitutive and inducible defensive barriers. The plant cell wall is one of the barriers that pathogens need to overcome to successfully colonize plant tissues. The traditional view of the plant cell wall as a passive barrier has evolved to a concept that considers the wall as a dynamic structure that regulates both constitutive and inducible defense mechanisms, and as a source of signaling molecules that trigger immune responses. The secondary cell walls of plants also represent a carbon-neutral feedstock (lignocellulosic biomass) for the production of biofuels and biomaterials. Therefore, engineering plants with improved secondary cell wall characteristics is an interesting strategy to ease the processing of lignocellulosic biomass in the biorefinery. However, modification of the integrity of the cell wall by impairment of proteins required for its biosynthesis or remodeling may impact the plants resistance to pathogens. This review summarizes our understanding of the role of the plant cell wall in pathogen resistance with a focus on the contribution of lignin to this biological process. PMID:25161657

  14. TH17 cells in autoimmunity and immunodeficiency: protective or pathogenic?

    Directory of Open Access Journals (Sweden)

    Ashish eMarwaha

    2012-06-01

    Full Text Available In 2005 a newly discovered T helper cell subset that secreted interleukin (IL-17 became the center of attention in immunology. Initial studies painted Th17 cells as the culprit for destruction caused in many different autoimmune and auto-inflammatory diseases. Subsequently, the discovery of patients with primary immunodeficiencies in the IL-17 pathway taught us that Th17 cells have a critical role in defense against certain fungal and bacterial infections. Moreover, the paradoxical exacerbation of Crohn’s disease in the clinical trials of a Secukiumab (AIN457, a fully human neutralizing antibody to IL-17A, has cast into doubt a universal pro-inflammatory and harmful role for Th17 cells. Evidence now suggests that depending on the environment Th17 cell can alter their differentiation program, ultimately giving rise to either protective or pro-inflammatory cells. In this review will summarize the evidence from patients with immunodeficiencies, autoimmune, or auto-inflammatory disease that teaches us how the pro-inflammatory versus protective function of Th17 cells varies within the context of different human diseases.

  15. T regulatory cell chemokine production mediates pathogenic T cell attraction and suppression.

    Science.gov (United States)

    Patterson, Scott J; Pesenacker, Anne M; Wang, Adele Y; Gillies, Jana; Mojibian, Majid; Morishita, Kim; Tan, Rusung; Kieffer, Timothy J; Verchere, C Bruce; Panagiotopoulos, Constadina; Levings, Megan K

    2016-03-01

    T regulatory cells (Tregs) control immune homeostasis by preventing inappropriate responses to self and nonharmful foreign antigens. Tregs use multiple mechanisms to control immune responses, all of which require these cells to be near their targets of suppression; however, it is not known how Treg-to-target proximity is controlled. Here, we found that Tregs attract CD4+ and CD8+ T cells by producing chemokines. Specifically, Tregs produced both CCL3 and CCL4 in response to stimulation, and production of these chemokines was critical for migration of target T cells, as Tregs from Ccl3-/- mice, which are also deficient for CCL4 production, did not promote migration. Moreover, CCR5 expression by target T cells was required for migration of these cells to supernatants conditioned by Tregs. Tregs deficient for expression of CCL3 and CCL4 were impaired in their ability to suppress experimental autoimmune encephalomyelitis or islet allograft rejection in murine models. Moreover, Tregs from subjects with established type 1 diabetes were impaired in their ability to produce CCL3 and CCL4. Together, these results demonstrate a previously unappreciated facet of Treg function and suggest that chemokine secretion by Tregs is a fundamental aspect of their therapeutic effect in autoimmunity and transplantation. PMID:26854929

  16. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    OpenAIRE

    PURNIMA R. CHITLANGE

    2014-01-01

    Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP) is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check wh...

  17. The kiwifruit emerging pathogen Pseudomonas syringae pv. actinidiae does not produce AHLs but possesses three luxR solos.

    Science.gov (United States)

    Patel, Hitendra Kumar; Ferrante, Patrizia; Covaceuszach, Sonia; Lamba, Doriano; Scortichini, Marco; Venturi, Vittorio

    2014-01-01

    Pseudomonas syringae pv. actinidiae (Psa) is an emerging phytopathogen causing bacterial canker disease in kiwifruit plants worldwide. Quorum sensing (QS) gene regulation plays important roles in many different bacterial plant pathogens. In this study we analyzed the presence and possible role of N-acyl homoserine lactone (AHL) quorum sensing in Psa. It was established that Psa does not produce AHLs and that a typical complete LuxI/R QS system is absent in Psa strains. Psa however possesses three putative luxR solos designated here as PsaR1, PsaR2 and PsaR3. PsaR2 belongs to the sub-family of LuxR solos present in many plant associated bacteria (PAB) that binds and responds to yet unknown plant signal molecules. PsaR1 and PsaR3 are highly similar to LuxRs which bind AHLs and are part of the canonical LuxI/R AHL QS systems. Mutation in all the three luxR solos of Psa showed reduction of in planta survival and also showed additive effect if more than one solo was inactivated in double mutants. Gene promoter analysis revealed that the three solos are not auto-regulated and investigated their possible role in several bacterial phenotypes. PMID:24498215

  18. Gliotoxin-producing endophytic Acremonium sp. from Zingiber officinale found antagonistic to soft rot pathogen Pythium myriotylum.

    Science.gov (United States)

    Anisha, C; Radhakrishnan, E K

    2015-04-01

    Soft rot caused by Pythium sp. is a major cause of economic loss in ginger cultivation. Endophytic fungi isolated from Zingiber officinale were screened for its activity against the soft rot pathogen Pythium myriotylum. Among the isolates screened, an endophytic fungus which was identified as Acremonium sp. showed promising activity against the phytopathogen in dual culture. The selected fungus was cultured in large scale on solid rice media and was extracted with ethyl acetate. The crude extract was subjected to column chromatography and preparative HPLC to obtain the fraction with the antifungal activity. LC-QTOF-MS/MS analysis of this fraction done using water-acetonitrile gradient identified a mass of m/z 327 (M + H) corresponding to gliotoxin with specific fragments m/z 263, 245, 227, and 111. The result was reconfirmed in negative mode ionization. Gliotoxin is the major antagonistic peptide produced by the commercially used biocontrol agent, Trichoderma sp., which shows high antagonism against Pythium sp. The gliotoxin production by the isolated endophytic Acremonium sp. of Z. officinale shows the possible natural biocontrol potential of this endophytic fungus. PMID:25820297

  19. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.;

    2015-01-01

    line with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of...

  20. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.;

    2014-01-01

    line with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of...

  1. Epigenetically Mediated Pathogenic Effects of Phenanthrene on Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Jing Liu

    2013-01-01

    Full Text Available Phenanthrene (Phe, a polycyclic aromatic hydrocarbon (PAH, is a major constituent of urban air pollution. There have been conflicting results regarding the role of other AhR ligands 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD and 6-formylindolo [3,2-b]carbazole (FICZ in modifying regulatory T cell populations (Treg or T helper (Th17 differentiation, and the effects of Phe have been understudied. We hypothesized that different chemical entities of PAH induce Treg to become either Th2 or Th17 effector T cells through epigenetic modification of FOXP3. To determine specific effects on T cell populations by phenanthrene, primary human Treg were treated with Phe, TCDD, or FICZ and assessed for function, gene expression, and phenotype. Methylation of CpG sites within the FOXP3 locus reduced FOXP3 expression, leading to impaired Treg function and conversion of Treg into a CD4+CD25lo Th2 phenotype in Phe-treated cells. Conversely, TCDD treatment led to epigenetic modification of IL-17A and conversion of Treg to Th17 T cells. These findings present a mechanism by which exposure to AhR-ligands mediates human T cell responses and begins to elucidate the relationship between environmental exposures, immune modulation, and initiation of human disease.

  2. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development. PMID:25044543

  3. Crystalline bacterial biofilm formation on urinary catheters by urease-producing urinary tract pathogens: a simple method of control.

    Science.gov (United States)

    Broomfield, Robert J; Morgan, Sheridan D; Khan, Azhar; Stickler, David J

    2009-10-01

    The problem of catheter encrustation stems from infection by urease-producing bacteria. These organisms generate ammonia from urea, elevate the pH of urine and cause crystals of calcium and magnesium phosphates to form in the urine and the biofilm that develops on the catheter. In this study, a laboratory model was used to compare the ability of 12 urease-positive species of urinary tract pathogens to encrust and block catheters. Proteus mirabilis, Proteus vulgaris and Providencia rettgeri were able to raise the urinary pH above 8.3 and produce catheter-blocking crystalline biofilms within 40 h. Morganella morganii and Staphylococcus aureus elevated the pH of urine to 7.4 and 6.9, respectively, and caused some crystal deposition in the biofilms but did not block catheters in the 96 h experimental period. Isolates of Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter cloacae, Serratia marcescens, Pseudomonas aeruginosa and Providencia stuartii were only capable of raising the pH of urine to a maximum of 6.4 and failed to cause crystal deposition in the biofilm. The most effective way to prevent catheter encrustation was shown to be diluting urine and increasing its citrate concentration. This strategy raises the nucleation pH (pH(n)) at which calcium and magnesium phosphates crystallize from urine. Increasing the fluid intake of a healthy volunteer with citrated drinks resulted in urine with a pH(n) of >8.0 in which catheter encrustation was inhibited. It is suggested that this dietary strategy will be an effective means of controlling catheter encrustation, whichever bacterial species is causing the problem. PMID:19556373

  4. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation Report 6 of 7, 2003-2004 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2004-05-01

    In 1999 the Cle Elum Hatchery began releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. In 1998 and 2000 through 2003 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. To date, only the bacterial pathogens have been detected and prevalences have been low. Prevalences have varied each year and these changes are attributed to normal fluctuation of prevalence. All of the pathogens detected are widely distributed in Washington State.

  5. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2002 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-05-01

    In 1999 the Cle Elem Hatchery began releasing spring chinook smolts into the upper Yakima River for restoration and supplementation. This project was designed to evaluate whether introduction of intensively reared hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and 130 smolts were collected in 2002 for monitoring for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition the fish were tested for Ceratomyxa shasta spores in 2000 and 2001 (a correction from the 2001 report). To date, the only changes have been in the levels the bacterial pathogens in the naturally produced smolts and they have been minimal. These changes are attributed to normal fluctuation of prevalence.

  6. Colonization of Arabidopsis roots by Pseudomonas fluorescens primes the plant to produce higher levels of ethylene upon pathogen infection

    NARCIS (Netherlands)

    Hase, S.; Pelt, J.A. van; Loon, L.C. van; Pieterse, C.M.J.

    2003-01-01

    Plants develop an enhanced defensive capacity against a broad spectrum of plant pathogens after colonization of the roots by selected strains of non-pathogenic, fluorescent Pseudomonas spp. In Arabidopsis thaliana, this rhizobacteria-induced systemic resistance (ISR) functions independently of salic

  7. Hydrogen peroxide produced by oral Streptococci induces macrophage cell death.

    Directory of Open Access Journals (Sweden)

    Nobuo Okahashi

    Full Text Available Hydrogen peroxide (H2O2 produced by members of the mitis group of oral streptococci plays important roles in microbial communities such as oral biofilms. Although the cytotoxicity of H2O2 has been widely recognized, the effects of H2O2 produced by oral streptococci on host defense systems remain unknown. In the present study, we investigated the effect of H2O2 produced by Streptococcus oralis on human macrophage cell death. Infection by S. oralis was found to stimulate cell death of a THP-1 human macrophage cell line at multiplicities of infection greater than 100. Catalase, an enzyme that catalyzes the decomposition of H2O2, inhibited the cytotoxic effect of S. oralis. S. oralis deletion mutants lacking the spxB gene, which encodes pyruvate oxidase, and are therefore deficient in H2O2 production, showed reduced cytotoxicity toward THP-1 macrophages. Furthermore, H2O2 alone was capable of inducing cell death. The cytotoxic effect seemed to be independent of inflammatory responses, because H2O2 was not a potent stimulator of tumor necrosis factor-α production in macrophages. These results indicate that streptococcal H2O2 plays a role as a cytotoxin, and is implicated in the cell death of infected human macrophages.

  8. Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

    Directory of Open Access Journals (Sweden)

    Francesco Marras

    2011-01-01

    Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

  9. Human granulosa-luteal cells initiate an innate immune response to pathogen-associated molecules.

    Science.gov (United States)

    Ibrahim, Laila A; Kramer, Joseph M; Williams, R Stan; Bromfield, John J

    2016-10-01

    The microenvironment of the ovarian follicle is key to the developmental success of the oocyte. Minor changes within the follicular microenvironment can significantly disrupt oocyte development, compromising the formation of competent embryos and reducing fertility. Previously described as a sterile environment, the ovarian follicle of women has been shown to contain colonizing bacterial strains, whereas in domestic species, pathogen-associated molecules are concentrated in the follicular fluid of animals with uterine infection. The aim of this study is to determine whether human granulosa-luteal cells mount an innate immune response to pathogen-associated molecules, potentially disrupting the microenvironment of the ovarian follicle. Human granulosa-luteal cells were collected from patients undergoing assisted reproduction. Cells were cultured in the presence of pathogen-associated molecules (LPS, FSL-1 and Pam3CSK4) for 24h. Supernatants and total RNA were collected for assessment by PCR and ELISA. Granulosa-luteal cells were shown to express the molecular machinery required to respond to a range of pathogen-associated molecules. Expression of TLR4 varied up to 15-fold between individual patients. Granulosa-luteal cells increased the expression of the inflammatory mediators IL1B, IL6 and CXCL8 in the presence of the TLR4 agonist E. coli LPS. Similarly, the TLR2/6 ligand, FSL-1, increased the expression of IL6 and CXCL8. Although no detectable changes in CYP19A1 or STAR expression were observed in granulosa-luteal cells following challenge, a significant reduction in progesterone secretion was measured after treatment with FSL-1. These findings demonstrate the ability of human granulosa-luteal cells to respond to pathogen-associated molecules and generate an innate immune response. PMID:27512120

  10. Characterization of xenoantiserum produced against B cell acute lymphoblastic leukemia cell line

    OpenAIRE

    Akagi,Tadaatsu; Sonobe, Hiroshi; Miyoshi, Isao; Yoshimoto,Shizuo

    1982-01-01

    Antiserum was produced in white rabbit by intravenously injecting living cells of a B cell acute lymphoblastic leukemia (ALL) line (BALL-1). The reactivity of the antiserum against various lymphoid cell lines was examined by membrane immunofluorescence after appropriate absorption. Serum absorbed with non-T, non-B (NALL-1) and T-ALL (TALL-1) cells recognized B cell antigens distinct from Ia-like antigens on both normal and neoplastic B cells. After further absorption with tonsillar cells or n...

  11. 黄瓜黑星病菌致病机理的研究Ⅲ细胞壁降解酶和毒素对寄主超微结构的影响及其协同作用%PATHOGENIC MECHANISM OF SCAB OF CUCUMBER CAUSED BY Cladosporium cucumerinum Ⅲ EFFECTS AND SYNERGISM OF CELL WALL-DEGRADING ENZYMES ANDTOXIN PRODUCED BY C. cucumerinum ON ULTRASTRUCTURE OF CUCUMBER

    Institute of Scientific and Technical Information of China (English)

    李宝聚; 周长力; 赵奎华; 李凤云; 黄国坤

    2001-01-01

    本文通过透射电镜和扫描电镜观察,初步明确了果胶酶、纤维素酶及毒素对黄瓜叶组织超微结构的影响。在致病过程中,3种致病因子起着各自独立又相互联系的作用。3种致病因子对寄主超微结构的影响中,纤维素酶分解细胞壁能力最强,毒素对细胞质膜的作用最大,3种致病因子均可造成质壁分离,液泡、内质网受损。而叶绿体的被膜、片层结构主要被纤维素酶降解,线粒体的被膜主要被果胶酶降解,3种致病因子均能使叶绿体、线粒体内部空泡化。在分解叶表皮的过程中,所研究的3种致病因子首先是果胶酶降解果胶层,然后是纤维素酶、果胶酶、毒素对栅栏组织的分解,最后是纤维素酶、毒素作用于薄壁细胞壁,毒素、纤维素酶、果胶酶协同作用于细胞内部组织。%The effects of the cellulase, pectinase and toxin produced by Cladosporium cucumerinum on the leaf cell of cucumber were studied by TEM and SEM. The results indicated that the three pathogenic factors played independent and symplastic roles. The cellulase and pectinase played leading roles respectively in decomposition of cell wall and plasma membrane. The three factors could all result in plasmolysis and damage vacuoles and endoplasmic reticulum. Chloroplast envelope and lamellae structure were mainly digested by cellulase, whiles, mitochondrion envelope was chiefly digested by the pectinase. Each of the three factors could cause vacuolation in chloroplast and mitochondria. During the process of breach up the structure of epidermis of leaf, the cellulase acted on reticulate region, then the pectinase dissolved pectic layer.Following this, palisade tissue was damaged by the cellulase, pectinase and toxin. Finally,parenchyma was destroyed by cellulase and toxin,successively.

  12. The influence of T cell development on pathogen specificity and autoreactivity

    CERN Document Server

    Kosmrlj, Andrej; Chakraborty, Arup K

    2012-01-01

    T cells orchestrate adaptive immune responses upon activation. T cell activation requires sufficiently strong binding of T cell receptors on their surface to short peptides derived from foreign proteins bound to protein products of the major histocompatibility (MHC) gene products, which are displayed on the surface of antigen presenting cells. T cells can also interact with peptide-MHC complexes, where the peptide is derived from host (self) proteins. A diverse repertoire of relatively self-tolerant T cell receptors is selected in the thymus. We study a model, computationally and analytically, to describe how thymic selection shapes the repertoire of T cell receptors, such that T cell receptor recognition of pathogenic peptides is both specific and degenerate. We also discuss the escape probability of autoimmune T cells from the thymus.

  13. Pathogenic Fungi Regulate Immunity by Inducing Neutrophilic Myeloid-Derived Suppressor Cells

    OpenAIRE

    Rieber, Nikolaus; Singh, Anurag; ÖZ, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N.; Weber, Alexander N.R.; Handgretinger, Rupert; Krappmann, Sven

    2015-01-01

    Summary Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically...

  14. New roles for mast cells in modulating allergic reactions and immunity against pathogens.

    Science.gov (United States)

    Hofmann, Alison M; Abraham, Soman N

    2009-12-01

    Mast cells (MCs) have primarily been associated with mediating the pathological secondary responses to allergens in sensitized hosts. In view of the recent evidence for a MC role in modulating primary immune responses to pathogens, the likelihood for a role of MCs in influencing primary immune response to allergens has grown. New evidence suggests that MCs drive the development of Th2 responses to allergens, particularly when allergen exposure occurs concomitantly with exposure to pathogen products present in the environment. These new roles for MCs in allergy and infection suggest additional drug targets to prevent the development of allergic disease and allergic exacerbations of established disease. PMID:19828301

  15. Insulin-producing Surrogate β-cells From Embryonic Stem Cells: Are We There Yet?

    OpenAIRE

    Naujok, Ortwin; Burns, Chris; Jones, Peter M; Lenzen, Sigurd

    2011-01-01

    Embryonic stem cells (ESCs) harbor the potential to generate every cell type of the body by differentiation. The use of hESCs holds great promise for potential cell replacement therapies for degenerative diseases including diabetes mellitus. The recently discovered induced pluripotent stem cells (iPSCs) exhibit immense potential for regenerative medicine as they allow the generation of autologous cells tailored to the patients' immune system. Research for insulin-producing surrogate cells fro...

  16. Derivation of Insulin-Producing Beta-Cells from Human Pluripotent Stem Cells

    OpenAIRE

    Schiesser, Jacqueline V.; Micallef, Suzanne J.; Hawes, Susan; Elefanty, Andrew G.; Stanley, Edouard G.

    2014-01-01

    Human embryonic stem cells have been advanced as a source of insulin-producing cells that could potentially replace cadaveric-derived islets in the treatment of type 1 diabetes. To this end, protocols have been developed that promote the formation of pancreatic progenitors and endocrine cells from human pluripotent stem cells, encompassing both embryonic stem cells and induced pluripotent stem cells. In this review, we examine these methods and place them in the context of the developmental a...

  17. [Investigation of antitumorigenic effects of food-borne non-pathogenic and pathogenic Salmonella enterica strains on MEF, DU145 and HeLa cell lines].

    Science.gov (United States)

    Altıntaş Kazar, Gamze; Şen, Ece

    2016-07-01

    Basic applications in cancer therapy may fail to eradicate cancer cells completely, they can show toxic affects to healthy cells and development of resistance to antitumor agents may increase tendency to metastasis. Bacterial therapies have the advantage of specific targetting of tumors by selective toxicity, responsiveness to external signals, self-propelling capacity, and the sense of microenvironment. The most interest on the bacterial cancer therapy is about Salmonella spp. with a special emphasis of S.Typhimurium. The aim of this study was to investigate the antitumorigenic effects of food-borne non-pathogenic and pathogenic Salmonella enterica strains on different cell cultures. Non-pathogenic Salmonella Enteriditis (A17) and pathogenic Salmonella Telaviv (A22) strains isolated from chicken carcasses which were put on the market in Edirne province (located at Thrace region of Turkey), and Salmonella Typhimurium ATCC 14028 strain were used in the study. ATCC-derived MEF (mouse embryonic fibroblasts), DU145 (human prostate cancer cells), and HeLa (human cervical cancer cells) cell lines were cocultivated with Salmonella strains of MOI (Multiplicity of infection; number of bacteria:number of cell) of 1000:1, 100:1, 10:1, 1:1, 0.1:1. The cell viability was measured by colorimetric MTT cytotoxicity assay, the percentage of apoptosis was assessed by Tali® Apoptosis Assay-Annexin V Alexa Fluor® 488 kit (Invitrogen, Molecular Probes, Life Technologies, USA), and the caspase-3 activity was determined by colorimetric protease ApoTarget™ kit (Invitrogen, BioSource International, USA). It was shown that non-pathogenic S.Enteriditis (A17) decreased cell viability approximately to 70%, wheras patogenic S.Telaviv (A22) and standart S.Typhimurium ATCC 14028 strains reduced cell viability approximately to 80%. Adversely, it was also observed that pathogenic S.Telaviv (A22) strain induces apoptosis more effectively than non-pathogenic S.Enteriditis (A17) and S

  18. Mapping epigenetic changes to the host cell genome induced by Burkholderia pseudomallei reveals pathogen-specific and pathogen-generic signatures of infection

    Science.gov (United States)

    Cizmeci, Deniz; Dempster, Emma L.; Champion, Olivia L.; Wagley, Sariqa; Akman, Ozgur E.; Prior, Joann L.; Soyer, Orkun S.; Mill, Jonathan; Titball, Richard W.

    2016-01-01

    The potential for epigenetic changes in host cells following microbial infection has been widely suggested, but few examples have been reported. We assessed genome-wide patterns of DNA methylation in human macrophage-like U937 cells following infection with Burkholderia pseudomallei, an intracellular bacterial pathogen and the causative agent of human melioidosis. Our analyses revealed significant changes in host cell DNA methylation, at multiple CpG sites in the host cell genome, following infection. Infection induced differentially methylated probes (iDMPs) showing the greatest changes in DNA methylation were found to be in the vicinity of genes involved in inflammatory responses, intracellular signalling, apoptosis and pathogen-induced signalling. A comparison of our data with reported methylome changes in cells infected with M. tuberculosis revealed commonality of differentially methylated genes, including genes involved in T cell responses (BCL11B, FOXO1, KIF13B, PAWR, SOX4, SYK), actin cytoskeleton organisation (ACTR3, CDC42BPA, DTNBP1, FERMT2, PRKCZ, RAC1), and cytokine production (FOXP1, IRF8, MR1). Overall our findings show that pathogenic-specific and pathogen-common changes in the methylome occur following infection. PMID:27484700

  19. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    Directory of Open Access Journals (Sweden)

    Kempf Volkhard AJ

    2011-04-01

    Full Text Available Abstract Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA, the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (VirB/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  20. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae.

    Science.gov (United States)

    Franz, Bettina; Kempf, Volkhard A J

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  1. Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

    Science.gov (United States)

    Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

    2016-02-01

    Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. PMID:26771167

  2. In vitro quenching of fish pathogen Edwardsiella tarda AHL production using marine bacterium Tenacibaculum sp. strain 20J cell extracts.

    Science.gov (United States)

    Romero, Manuel; Muras, Andrea; Mayer, Celia; Buján, Noemí; Magariños, Beatriz; Otero, Ana

    2014-04-01

    Quorum quenching (QQ) has become an interesting alternative for solving the problem of bacterial antibiotic resistance, especially in the aquaculture industry, since many species of fish-pathogenic bacteria control their virulence factors through quorum sensing (QS) systems mediated by N-acylhomoserine lactones (AHLs). In a screening for bacterial strains with QQ activity in different marine environments, Tenacibaculum sp. strain 20J was identified and selected for its high degradation activity against a wide range of AHLs. In this study, the QQ activity of live cells and crude cell extracts (CCEs) of strain 20J was characterized and the possibilities of the use of CCEs of this strain to quench the production of AHLs in cultures of the fish pathogen Edwardsiella tarda ACC35.1 was explored. E. tarda ACC35.1 produces N-hexanoyl-L-homoserine lactone (C6-HSL) and N-oxohexanoyl-L-homoserine lactone (OC6-HSL). This differs from profiles registered for other E. tarda strains and indicates an important intra-specific variability in AHL production in this species. The CCEs of strain 20J presented a wide-spectrum QQ activity and, unlike Bacillus thuringiensis serovar Berliner ATCC10792 CCEs, were effective in eliminating the AHLs produced in E. tarda ACC35.1 cultures. The fast and wide-spectrum AHL-degradation activity shown by this member of the Cytophaga-Flexibacter-Bacteroidetes group consolidates this strain as a promising candidate for the control of AHL-based QS pathogens, especially in the marine fish farming industry. PMID:24695235

  3. Pathogen-specific regulatory T cells delay the arrival of effector T cells in the lung during early tuberculosis

    OpenAIRE

    Shafiani, Shahin; Tucker-Heard, Glady’s; Kariyone, Ai; Takatsu, Kiyoshi; Urdahl, Kevin B.

    2010-01-01

    The ability of the adaptive immune system to restrict Mycobacterium tuberculosis (Mtb) is impeded by activated Foxp3+ regulatory T (T reg) cells. The importance of pathogen-specific T reg cells in this process has not been addressed. We show that T reg cell expansion after aerosol Mtb infection does not occur until Mtb is transported to the pulmonary lymph node (pLN), and Mtb-specific T reg cells have an increased propensity to proliferate. Even small numbers of Mtb-specific T reg cells are c...

  4. A sensitive nested reverse transcriptase PCR assay to detect viable cells of the fish pathogen Renibacterium salmoninarum in Atlantic salmon (Salmo salar L.).

    Science.gov (United States)

    Cook, M; Lynch, W H

    1999-07-01

    A nested reverse transcriptase (RT) PCR assay detected mRNA of the salmonid pathogen Renibacterium salmoninarum in samples of RNA extracts of between 1 and 10 cells. Total RNA was extracted from cultured bacteria, Atlantic salmon (Salmo salar L.) kidney tissue and ovarian fluid seeded with the pathogen, and kidney tissue from both experimentally challenged and commercially raised fish. Following DNase treatment, extracted RNA was amplified by both RT PCR and PCR by using primers specific for the gene encoding the major protein antigen of R. salmoninarum. A 349-bp amplicon was detected by polyacrylamide gel electrophoresis and silver stain. Inactivation of cultured bacteria by rifampin or erythromycin produced a loss of nested RT PCR mRNA detection corresponding to a loss of bacterial cell viability determined from plate counts but no loss of DNA detection by PCR. In subclinically diseased fish, nested RT PCR identified similar levels of infected fish as determined by viable pathogen culture. Higher percentages of fish testing positive were generated by PCR, particularly in samples from fish previously subjected to antibiotic chemotherapy where 93% were PCR positive, but only 7% were nested RT PCR and culture positive. PCR can generate false-positive data from amplification of target DNA from nonviable pathogen cells. Therefore, nested RT PCR may prove useful for monitoring cultured Atlantic salmon for the presence of viable R. salmoninarum within a useful time frame, particularly samples from broodstock where antibiotic chemotherapy is used prior to spawning to reduce vertical pathogen transmission. PMID:10388701

  5. Characterization of xenoantiserum produced against B cell acute lymphoblastic leukemia cell line

    Directory of Open Access Journals (Sweden)

    Akagi,Tadaatsu

    1982-10-01

    Full Text Available Antiserum was produced in white rabbit by intravenously injecting living cells of a B cell acute lymphoblastic leukemia (ALL line (BALL-1. The reactivity of the antiserum against various lymphoid cell lines was examined by membrane immunofluorescence after appropriate absorption. Serum absorbed with non-T, non-B (NALL-1 and T-ALL (TALL-1 cells recognized B cell antigens distinct from Ia-like antigens on both normal and neoplastic B cells. After further absorption with tonsillar cells or normal B cell line (KO-HL-3, it reacted only with BALL-1 cells and did not react with other leukemia/lymphoma and normal B cell lines. The serum absorbed with tonsillar cells reacted only with BALL-1 and some B cell lines. Thus we were able to obtain antisera with specificity to B cell antigen, B-ALL antigen, and B cell line antigen.

  6. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  7. Comparative Pathogenicity of Liver Homogenate and Cell Culture Propagated Hydropericardium Syndrome Virus in Broiler Birds

    Directory of Open Access Journals (Sweden)

    M. D. Ahmad, S. Zaman1, M. H. Mushtaq*, A. A. Anjum1 and M. Akram1

    2011-10-01

    Full Text Available Comparative pathogenicity of liver homogenate and cell culture propagated agents of hydropericardium syndrome was studied in broiler birds. In Experiment I, 25-day-old while in experiment II, broiler birds at different ages were inoculated through different routes. In Experiment I, liver homogenate caused 64% mortality through intramuscular route and 33.33% mortality through oral route. The cell culture propagated HPS virus caused 60 and 13.33% mortality in broiler birds through intramuscular and oral routes, respectively. In Experiment II, none of the day-old-chicks died when challenged with liver homogenate and cell culture propagated HPS virus through S/C and oral route. The liver homogenate and cell culture propagated HPS virus caused higher mortality in different age groups of broiler birds through s/c route compared to oral route. The values of hemoglobin (Hb and packed cell volume (PCV showed highly significant (P<0.05 reduction indicating anemia. The values of Hb and PCV of the broiler birds inoculated with infectious liver homogenate were significantly lower as compared to birds inoculated with cell culture propagated HPS virus. The results indicated that the liver homogenate is more pathogenic than cell culture propagated HPS virus. These changes may be due to adoptability of the original FAdVs (fowl adenovirus after continued passages in the culture of chicken embryo liver cells. Importance of this study in vaccine production is also discussed.

  8. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    Science.gov (United States)

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. PMID:26251043

  9. The modular nature of dendritic cell responses to commensal and pathogenic fungi.

    Directory of Open Access Journals (Sweden)

    Lisa Rizzetto

    Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

  10. Human B cells produce chemokine CXCL10 in the presence of Mycobacterium tuberculosis specific T cells

    DEFF Research Database (Denmark)

    Hoff, Soren T; Salman, Ahmed M; Ruhwald, Morten;

    2015-01-01

    BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment. A...... candidate for such regulation could be the chemokine CXCL10. CXCL10 is mainly produced by human monocytes, but a few reports have also found CXCL10 production by human B cells. The objective of this study was to investigate CXCL10 production by human B cells in response to in vitro stimulation with Mtb...... antigens. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed human blood samples from 30 volunteer donors using multiparameter flow cytometry, and identified a subgroup of B cells producing CXCL10 in response to in vitro stimulation with antigens. T cells did not produce CXCL10, but CXCL10 production by B cells...

  11. Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

    Directory of Open Access Journals (Sweden)

    Sophie Coudeyras

    2008-01-01

    Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

  12. Extension of Shelf Life and Control of Human Pathogens in Produce by Antimicrobial Edible Films and Coatings

    Science.gov (United States)

    This chapter provides general information about edible films and coatings, and their use with fruits and vegetables to control human pathogens. It reviews potential antimicrobial phytochemicals used in edible films and coatings, and summarizes methods for measuring the antimicrobial activity and ph...

  13. Draft genome sequence of Pantoea agglomerans R190, a producer of antibiotics against phytopathogens and foodborne pathogens.

    Science.gov (United States)

    Lim, Jeong-A; Lee, Dong Hwan; Kim, Byoung-Young; Heu, Sunggi

    2014-10-20

    Pantoea agglomerans R190, isolated from an apple orchard, showed antibacterial activity against various spoilage bacteria, including Pectobacterium carotovorum subsp. carotovorum, and foodborne pathogens such as Escherichia coli O157:H7. Here, we report the genome sequence of P. agglomerans R190. This report will raise the value of P. agglomerans as an agent for biocontrol of disease. PMID:25087741

  14. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  15. Use of Image Cytometry for Quantification of Pathogenic Fungi in Association with Host Cells

    OpenAIRE

    Berkes, Charlotte; Chan, Leo Li-Ying; Wilkinson, Alisha; Paradis, Benjamin

    2013-01-01

    Studies of the cellular pathogenesis mechanisms of pathogenic yeasts such as Candida albicans, Histoplasma capsulatum, and Cryptococcus neoformans commonly employ infection of mammalian hosts or host cells (i.e. macrophages) followed by yeast quantification using colony forming unit analysis or flow cytometry. While colony forming unit enumeration has been the most commonly used method in the field, this technique has disadvantages and limitations, including slow growth of some fungal species...

  16. Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

    Science.gov (United States)

    Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

    2014-11-01

    The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

  17. Lights, camera and action: vertebrate skin sets the stage for immune cell interaction with arthropod-vectored pathogens

    Directory of Open Access Journals (Sweden)

    Shu Zhen eChong

    2013-09-01

    Full Text Available Despite increasing studies targeted at host-pathogen interactions, vector-borne diseases remain one of the largest economic health burdens worldwide. Such diseases are vectored by hematophagous arthropods that deposit pathogens into the vertebrate host’s skin during a blood meal. These pathogens spend a substantial amount of time in the skin that allows for interaction with cutaneous immune cells, suggesting a window of opportunity for development of vaccine strategies. In particular, the recent availability of intravital imaging approaches has provided further insights into immune cell behavior in living tissues. Here, we discuss how such intravital imaging studies have contributed to our knowledge of cutaneous immune cell behavior and specifically, towards pathogen and tissue trauma from the arthropod bite. We also suggest future imaging approaches that may aid in better understanding of the complex interplay between arthropod-vectored pathogens and cutaneous immunity that could lead to improved therapeutic strategies.

  18. Response of tomato wilt pathogen Ralstonia solanacearum to the volatile organic compounds produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9

    Science.gov (United States)

    Raza, Waseem; Ling, Ning; Yang, Liudong; Huang, Qiwei; Shen, Qirong

    2016-01-01

    It is important to study the response of plant pathogens to the antibiosis traits of biocontrol microbes to design the efficient biocontrol strategies. In this study, we evaluated the role of volatile organic compounds (VOCs) produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9 on the growth and virulence traits of tomato wilt pathogen Ralstonia solanacearum (RS). The VOCs of SQR-9 significantly inhibited the growth of RS on agar medium and in soil. In addition, the VOCs significantly inhibited the motility traits, production of antioxidant enzymes and exopolysaccharides, biofilm formation and tomato root colonization by RS. The strain SQR-9 produced 22 VOCs, but only nine VOCs showed 1–11% antibacterial activity against RS in their corresponding amounts; however, the consortium of all VOCs showed 70% growth inhibition of RS. The proteomics analysis showed that the VOCs of SQR-9 downregulated RS proteins related to the antioxidant activity, virulence, carbohydrate and amino acid metabolism, protein folding and translation, while the proteins involved in the ABC transporter system, amino acid synthesis, detoxification of aldehydes and ketones, methylation, protein translation and folding, and energy transfer were upregulated. This study describes the significance and effectiveness of VOCs produced by a biocontrol strain against tomato wilt pathogen. PMID:27103342

  19. Response of tomato wilt pathogen Ralstonia solanacearum to the volatile organic compounds produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9.

    Science.gov (United States)

    Raza, Waseem; Ling, Ning; Yang, Liudong; Huang, Qiwei; Shen, Qirong

    2016-01-01

    It is important to study the response of plant pathogens to the antibiosis traits of biocontrol microbes to design the efficient biocontrol strategies. In this study, we evaluated the role of volatile organic compounds (VOCs) produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9 on the growth and virulence traits of tomato wilt pathogen Ralstonia solanacearum (RS). The VOCs of SQR-9 significantly inhibited the growth of RS on agar medium and in soil. In addition, the VOCs significantly inhibited the motility traits, production of antioxidant enzymes and exopolysaccharides, biofilm formation and tomato root colonization by RS. The strain SQR-9 produced 22 VOCs, but only nine VOCs showed 1-11% antibacterial activity against RS in their corresponding amounts; however, the consortium of all VOCs showed 70% growth inhibition of RS. The proteomics analysis showed that the VOCs of SQR-9 downregulated RS proteins related to the antioxidant activity, virulence, carbohydrate and amino acid metabolism, protein folding and translation, while the proteins involved in the ABC transporter system, amino acid synthesis, detoxification of aldehydes and ketones, methylation, protein translation and folding, and energy transfer were upregulated. This study describes the significance and effectiveness of VOCs produced by a biocontrol strain against tomato wilt pathogen. PMID:27103342

  20. Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.;

    2008-01-01

    The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...

  1. Culture of human cell lines by a pathogen-inactivated human platelet lysate.

    Science.gov (United States)

    Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L

    2016-08-01

    Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety. PMID:25944665

  2. Comparison of the pathogen species-specific immune response in udder derived cell types and their models.

    Science.gov (United States)

    Günther, Juliane; Koy, Mirja; Berthold, Anne; Schuberth, Hans-Joachim; Seyfert, Hans-Martin

    2016-01-01

    The outcome of an udder infection (mastitis) largely depends on the species of the invading pathogen. Gram-negative pathogens, such as Escherichia coli often elicit acute clinical mastitis while Gram-positive pathogens, such as Staphylococcus aureus tend to cause milder subclinical inflammations. It is unclear which type of the immune competent cells residing in the udder governs the pathogen species-specific physiology of mastitis and which established cell lines might provide suitable models. We therefore profiled the pathogen species-specific immune response of different cell types derived from udder and blood. Primary cultures of bovine mammary epithelial cells (pbMEC), mammary derived fibroblasts (pbMFC), and bovine monocyte-derived macrophages (boMdM) were challenged with heat-killed E. coli, S. aureus and S. uberis mastitis pathogens and their immune response was scaled against the response of established models for MEC (bovine MAC-T) and macrophages (murine RAW 264.7). Only E. coli provoked a full scale immune reaction in pbMEC, fibroblasts and MAC-T cells, as indicated by induced cytokine and chemokine expression and NF-κB activation. Weak reactions were induced by S. aureus and none by S. uberis challenges. In contrast, both models for macrophages (boMdM and RAW 264.7) reacted strongly against all the three pathogens accompanied by strong activation of NF-κB factors. Hence, the established cell models MAC-T and RAW 264.7 properly reflected key aspects of the pathogen species-specific immune response of the respective parental cell type. Our data imply that the pathogen species-specific physiology of mastitis likely relates to the respective response of MEC rather to that of professional immune cells. PMID:26830914

  3. Adult Stem Cells as a Renewable Source of Insulin-Producing Cells

    OpenAIRE

    Jun, Hee-Sook; Park, Eun-Young

    2009-01-01

    Diabetes mellitus is a metabolic disorder resulting from an inadequate mass of insulin-producing pancreatic beta cells. The replacement or restoration of damaged beta cells would be considered the optimal therapeutic options. Islet transplantation seems to be a promising approach for replacement therapy; however, the main obstacle is the shortage of organ donors. As mature beta cells have been shown to be difficult to expand in vitro, regeneration of beta cells from embryonic or adult stem ce...

  4. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    OpenAIRE

    Chooi, Yit-Heng; Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression syst...

  5. Polar release of pathogenic Old World hantaviruses from renal tubular epithelial cells

    Directory of Open Access Journals (Sweden)

    Krautkrämer Ellen

    2012-11-01

    Full Text Available Abstract Background Epithelio- and endotheliotropic viruses often exert polarized entry and release that may be responsible for viral spread and dissemination. Hantaviruses, mostly rodent-borne members of the Bunyaviridae family infect epithelial and endothelial cells of different organs leading to organ dysfunction or even failure. Endothelial and renal epithelial cells belong to the target cells of Old World hantavirus. Therefore, we examined the release of hantaviruses in several renal epithelial cell culture models. We used Vero cells that are commonly used in hantavirus studies and primary human renal epithelial cells (HREpC. In addition, we analyzed MDCKII cells, an epithelial cell line of a dog kidney, which represents a widely accepted in vitro model of polarized monolayers for their permissiveness for hantavirus infection. Results Vero C1008 and primary HREpCs were grown on porous-support filter inserts for polarization. Monolayers were infected with hantavirus Hantaan (HTNV and Puumala (PUUV virus. Supernatants from the apical and basolateral chamber of infected cells were analyzed for the presence of infectious particles by re-infection of Vero cells. Viral antigen and infectious particles of HTNV and PUUV were exclusively detected in supernatants collected from the apical chamber of infected Vero C1008 cells and HREpCs. MDCKII cells were permissive for hantavirus infection and polarized MDCKII cells released infectious hantaviral particles from the apical surface corresponding to the results of Vero and primary human epithelial cells. Conclusions Pathogenic Old World hantaviruses are released from the apical surface of different polarized renal epithelial cells. We characterized MDCKII cells as a suitable polarized cell culture model for hantavirus infection studies.

  6. Intracellular periodontal pathogen exploits recycling pathway to exit from infected cells.

    Science.gov (United States)

    Takeuchi, Hiroki; Takada, Akihiko; Kuboniwa, Masae; Amano, Atsuo

    2016-07-01

    Although human gingival epithelium prevents intrusions by periodontal bacteria, Porphyromonas gingivalis, the most well-known periodontal pathogen, is able to invade gingival epithelial cells and pass through the epithelial barrier into deeper tissues. We previously reported that intracellular P. gingivalis exits from gingival epithelial cells via a recycling pathway. However, the underlying molecular process remains unknown. In the present study, we found that the pathogen localized in early endosomes recruits VAMP2 and Rab4A. VAMP2 was found to be specifically localized in early endosomes, although its localization remained unclear in mammalian cells. A single transmembrane domain of VAMP2 was found to be necessary and sufficient for localizing in early endosomes containing P. gingivalis in gingival epithelial cells. VAMP2 forms a complex with EXOC2/Sec5 and EXOC3/Sec6, whereas Rab4A mediates dissociation of the EXOC complex followed by recruitment of RUFY1/Rabip4, Rab4A effector, and Rab14. Depletion of VAMP2 or Rab4A resulted in accumulation of bacteria in early endosomes and disturbed bacterial exit from infected cells. It is suggested that these novel dynamics allow P. gingivalis to exploit fast recycling pathways promoting further bacterial penetration of gingival tissues. PMID:26617273

  7. GSTP1 Is a Driver of Triple-Negative Breast Cancer Cell Metabolism and Pathogenicity.

    Science.gov (United States)

    Louie, Sharon M; Grossman, Elizabeth A; Crawford, Lisa A; Ding, Lucky; Camarda, Roman; Huffman, Tucker R; Miyamoto, David K; Goga, Andrei; Weerapana, Eranthie; Nomura, Daniel K

    2016-05-19

    Breast cancers possess fundamentally altered metabolism that fuels their pathogenicity. While many metabolic drivers of breast cancers have been identified, the metabolic pathways that mediate breast cancer malignancy and poor prognosis are less well understood. Here, we used a reactivity-based chemoproteomic platform to profile metabolic enzymes that are enriched in breast cancer cell types linked to poor prognosis, including triple-negative breast cancer (TNBC) cells and breast cancer cells that have undergone an epithelial-mesenchymal transition-like state of heightened malignancy. We identified glutathione S-transferase Pi 1 (GSTP1) as a novel TNBC target that controls cancer pathogenicity by regulating glycolytic and lipid metabolism, energetics, and oncogenic signaling pathways through a protein interaction that activates glyceraldehyde-3-phosphate dehydrogenase activity. We show that genetic or pharmacological inactivation of GSTP1 impairs cell survival and tumorigenesis in TNBC cells. We put forth GSTP1 inhibitors as a novel therapeutic strategy for combatting TNBCs through impairing key cancer metabolism and signaling pathways. PMID:27185638

  8. A modified method of insulin producing cells' generation from bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Czubak, Paweł; Bojarska-Junak, Agnieszka; Tabarkiewicz, Jacek; Putowski, Lechosław

    2014-01-01

    Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells' transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs). In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs). We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors' concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells. PMID:25405207

  9. Stx-Producing Shigella Species From Patients in Haiti: An Emerging Pathogen With the Potential for Global Spread

    OpenAIRE

    Gray, Miranda D.; Leonard, Susan R.; Lacher, David W.; Lampel, Keith A.; Alam, Meer T.; Morris, J. Glenn; Ali, Afsar; LaBreck, Patrick T.; Maurelli, Anthony T.

    2015-01-01

    Shiga toxins (Stx) are commonly produced by Shigella dysenteriae serotype 1 and Stx-producing Escherichia coli. However, the toxin genes have been detected in additional Shigella species. We recently reported the emergence of Stx-producing Shigella in travelers in the United States and France who had recently visited Hispaniola (Haiti and the Dominican Republic). In this study, we confirm this epidemiological link by identifying Stx-producing Shigella from Haitian patients attending clinics n...

  10. Pathogenic fungi regulate immunity by inducing neutrophilic myeloid-derived suppressor cells.

    Science.gov (United States)

    Rieber, Nikolaus; Singh, Anurag; Öz, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N; Weber, Alexander N R; Handgretinger, Rupert; Krappmann, Sven; Liese, Johannes; Engeholm, Maik; Schüle, Rebecca; Salih, Helmut Rainer; Marodi, Laszlo; Speckmann, Carsten; Grimbacher, Bodo; Ruland, Jürgen; Brown, Gordon D; Beilhack, Andreas; Loeffler, Juergen; Hartl, Dominik

    2015-04-01

    Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically, pathogenic fungi induce neutrophilic MDSCs through the pattern recognition receptor Dectin-1 and its downstream adaptor protein CARD9. Fungal MDSC induction is further dependent on pathways downstream of Dectin-1 signaling, notably reactive oxygen species (ROS) generation as well as caspase-8 activity and interleukin-1 (IL-1) production. Additionally, exogenous IL-1β induces MDSCs to comparable levels observed during C. albicans infection. Adoptive transfer and survival experiments show that MDSCs are protective during invasive C. albicans infection, but not A. fumigatus infection. These studies define an innate immune mechanism by which pathogenic fungi regulate host defense. PMID:25771792

  11. Human Epithelial Cells Discriminate between Commensal and Pathogenic Interactions with Candida albicans

    Science.gov (United States)

    Rast, Timothy J.; Kullas, Amy L.; Southern, Peter J.; Davis, Dana A.

    2016-01-01

    The commensal fungus, Candida albicans, can cause life-threatening infections in at risk individuals. C. albicans colonizes mucosal surfaces of most people, adhering to and interacting with epithelial cells. At low concentrations, C. albicans is not pathogenic nor does it cause epithelial cell damage in vitro; at high concentrations, C. albicans causes mucosal infections and kills epithelial cells in vitro. Here we show that while there are quantitative dose-dependent differences in exposed epithelial cell populations, these reflect a fundamental qualitative difference in host cell response to C. albicans. Using transcriptional profiling experiments and real time PCR, we found that wild-type C. albicans induce dose-dependent responses from a FaDu epithelial cell line. However, real time PCR and Western blot analysis using a high dose of various C. albicans strains demonstrated that these dose-dependent responses are associated with ability to promote host cell damage. Our studies support the idea that epithelial cells play a key role in the immune system by monitoring the microbial community at mucosal surfaces and initiating defensive responses when this community is dysfunctional. This places epithelial cells at a pivotal position in the interaction with C. albicans as epithelial cells themselves promote C. albicans stimulated damage. PMID:27088599

  12. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    Directory of Open Access Journals (Sweden)

    Boomsma Jacobus J

    2010-12-01

    Full Text Available Abstract Background Leaf-cutting (attine ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. Results We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21% of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Conclusions Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to

  13. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    KAUST Repository

    Alsalah, Dhafer

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  14. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    Directory of Open Access Journals (Sweden)

    Dhafer Alsalah

    2015-10-01

    Full Text Available This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not

  15. Adaptive response to starvation in the fish pathogen Flavobacterium columnare: cell viability and ultrastructural changes

    Directory of Open Access Journals (Sweden)

    Arias Covadonga R

    2012-11-01

    Full Text Available Abstract Background The ecology of columnaris disease, caused by Flavobacterium columnare, is poorly understood despite the economic losses that this disease inflicts on aquaculture farms worldwide. Currently, the natural reservoir for this pathogen is unknown but limited data have shown its ability to survive in water for extended periods of time. The objective of this study was to describe the ultrastructural changes that F. columnare cells undergo under starvation conditions. Four genetically distinct strains of this pathogen were monitored for 14 days in media without nutrients. Culturability and cell viability was assessed throughout the study. In addition, cell morphology and ultrastructure was analyzed using light microscopy, scanning electron microscopy, and transmission electron microscopy. Revival of starved cells under different nutrient conditions and the virulence potential of the starved cells were also investigated. Results Starvation induced unique and consistent morphological changes in all strains studied. Cells maintained their length and did not transition into a shortened, coccus shape as observed in many other Gram negative bacteria. Flavobacterium columnare cells modified their shape by morphing into coiled forms that comprised more than 80% of all the cells after 2 weeks of starvation. Coiled cells remained culturable as determined by using a dilution to extinction strategy. Statistically significant differences in cell viability were found between strains although all were able to survive in absence of nutrients for at least 14 days. In later stages of starvation, an extracellular matrix was observed covering the coiled cells. A difference in growth curves between fresh and starved cultures was evident when cultures were 3-months old but not when cultures were starved for only 1 month. Revival of starved cultures under different nutrients revealed that cells return back to their original elongated rod shape upon

  16. Activity of 2,4-Di-tert-butylphenol produced by a strain of Streptomyces mutabilis isolated from a Saharan soil against Candida albicans and other pathogenic fungi.

    Science.gov (United States)

    Belghit, S; Driche, E H; Bijani, C; Zitouni, A; Sabaou, N; Badji, B; Mathieu, F

    2016-06-01

    In a search for new antifungal antibiotics active against Candida albicans and others pathogenic fungi, a strain of actinobacteria, designated G61, was isolated from a Saharan soil and tested for its activity against these microorganisms. The analysis of its 16S rDNA sequence showed a similarity level of 100% with Streptomyces mutabilis NBRC 12800(T). The highest anticandidal activities produced by the strain G61 were obtained on Bennett medium in the fourth day of incubation. The active product, extracted by n-butanol, contained one bioactive spot detected on thin layer chromatography plates. It was purified by HPLC and its chemical structure was determined by spectroscopic analyses as 2,4-Di-tert-butylphenol. The minimum inhibitory concentrations (MIC) of this product against several strains of pathogenic microorganisms are interesting. PMID:27107984

  17. Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

    OpenAIRE

    Wong, Rebecca S. Y.

    2011-01-01

    Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs) from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering ...

  18. Inactivation of plant-pathogenic fungus Colletotrichum acutatum with natural plant-produced photosensitizers under solar radiation.

    Science.gov (United States)

    Fracarolli, Letícia; Rodrigues, Gabriela B; Pereira, Ana C; Massola Júnior, Nelson S; Silva-Junior, Geraldo José; Bachmann, Luciano; Wainwright, Mark; Bastos, Jairo Kenupp; Braga, Gilberto U L

    2016-09-01

    The increasing tolerance to currently used fungicides and the need for environmentally friendly antimicrobial approaches have stimulated the development of novel strategies to control plant-pathogenic fungi such as antimicrobial phototreatment (APT). We investigated the in vitro APT of the plant-pathogenic fungus Colletotrichum acutatum with furocoumarins and coumarins and solar radiation. The compounds used were: furocoumarins 8-methoxypsoralen (8-MOP) and 5,8-dimethoxypsoralen (isopimpinellin), coumarins 2H-chromen-2-one (coumarin), 7-hydroxycoumarin, 5,7-dimethoxycoumarin (citropten) and a mixture (3:1) of 7-methoxycoumarin and 5,7-dimethoxycoumarin. APT of conidia with crude extracts from 'Tahiti' acid lime, red and white grapefruit were also performed. Pure compounds were tested at 50μM concentration and mixtures and extracts at 12.5mgL(-1). The C. acutatum conidia suspension with or without the compounds was exposed to solar radiation for 1h. In addition, the effects of APT on the leaves of the plant host Citrus sinensis were determined. APT with 8-MOP was the most effective treatment, killing 100% of the conidia followed by the mixture of two coumarins and isopimpinellin that killed 99% and 64% of the conidia, respectively. APT with the extracts killed from 20% to 70% of the conidia, and the extract from 'Tahiti' lime was the most effective. No damage to sweet orange leaves was observed after APT with any of the compounds or extracts. PMID:27434699

  19. Scanning electron microscopy as a tool for the analysis of colony architecture produced by phenotypic switching of a human pathogenic yeast Candida tropicalis

    International Nuclear Information System (INIS)

    Candida tropicalis has been identified as one of the most prevalent pathogenic yeast species of the Candida-non-albicans group. Phenotypic switching is a biological phenomenon related to the occurrence of spontaneous emergence of colonies with different morphologies that provides variability within colonizing populations in order to adapt to different environments. Currently, studies of the microstructure of switching variant colonies are not subject of extensive research. SEM analysis was used to verify the architecture of whole Candida colonies. The strain 49/07 exhibited a hemispherical shape character, while the strain 335/07 showed a volcano shape with mycelated-edge colony. The ring switch variant is characterized by a highly wrinkled centre and an irregular periphery. The rough phenotype exhibited a three-dimensional architecture and was characterized by the presence of deep central and peripheral depressions areas. The ultrastructural analysis also allowed the observation of the arrangement of individual cells within the colonies. The whole smooth colony consisted entirely of yeast cells. Differently, aerial filaments were found all around the colony periphery of the volcano shape colony. For this colony type the mycelated-edge consisted mainly of hyphae, although yeast cells are also seen. The ring and rough colonies phenotypes comprised mainly yeast cells with the presence of extracellular material connecting neighbouring cells. This study has shown that SEM can be used effectively to examine the microarchitecture of colonies morphotypes of the yeast C. tropicalis and further our understanding of switching event in this pathogen.

  20. Insulin-producing cells generated from dedifferentiated human pancreatic beta cells expanded in vitro.

    Directory of Open Access Journals (Sweden)

    Holger A Russ

    Full Text Available BACKGROUND: Expansion of beta cells from the limited number of adult human islet donors is an attractive prospect for increasing cell availability for cell therapy of diabetes. However, attempts at expanding human islet cells in tissue culture result in loss of beta-cell phenotype. Using a lineage-tracing approach we provided evidence for massive proliferation of beta-cell-derived (BCD cells within these cultures. Expansion involves dedifferentiation resembling epithelial-mesenchymal transition (EMT. Epigenetic analyses indicate that key beta-cell genes maintain open chromatin structure in expanded BCD cells, although they are not transcribed. Here we investigated whether BCD cells can be redifferentiated into beta-like cells. METHODOLOGY/PRINCIPAL FINDING: Redifferentiation conditions were screened by following activation of an insulin-DsRed2 reporter gene. Redifferentiated cells were characterized for gene expression, insulin content and secretion assays, and presence of secretory vesicles by electron microscopy. BCD cells were induced to redifferentiate by a combination of soluble factors. The redifferentiated cells expressed beta-cell genes, stored insulin in typical secretory vesicles, and released it in response to glucose. The redifferentiation process involved mesenchymal-epithelial transition, as judged by changes in gene expression. Moreover, inhibition of the EMT effector SLUG (SNAI2 using shRNA resulted in stimulation of redifferentiation. Lineage-traced cells also gave rise at a low rate to cells expressing other islet hormones, suggesting transition of BCD cells through an islet progenitor-like stage during redifferentiation. CONCLUSIONS/SIGNIFICANCE: These findings demonstrate for the first time that expanded dedifferentiated beta cells can be induced to redifferentiate in culture. The findings suggest that ex-vivo expansion of adult human islet cells is a promising approach for generation of insulin-producing cells for

  1. Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Rebecca S. Y. Wong

    2011-01-01

    Full Text Available Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects.

  2. Differentiation of stem cells into insulin-producing cells under the influence of nanostructural polyoxometalates.

    Science.gov (United States)

    Bâlici, Ştefana; Şuşman, Sergiu; Rusu, Dan; Nicula, Gheorghe Zsolt; Soriţău, Olga; Rusu, Mariana; Biris, Alexandru S; Matei, Horea

    2016-03-01

    Two polyoxometalates (POMs) with W were synthesized by a two-step, self-assembling method. They were used for stimulation of mesenchymal stem cell differentiation into insulin-producing cells. The nanocompounds (tris(vanadyl)-substituted tungsto-antimonate(III) anions [POM1] and tris-butyltin-21-tungsto-9-antimonate(III) anions [POM2]) were characterized by analytical techniques, including ultraviolet-visible, Fourier transform infrared, nuclear magnetic resonance spectroscopy, and transmission electron microscopy. We found that these polyoxotungstates, with 2-4 nm diameters, did not present toxic effects at the tested concentrations. In vitro, POM1 stimulated differentiation of a greater number of dithizone-positive cells (also organized in clusters) than the second nanocompound (POM2). Based on our in vitro studies, we have concluded that both the POMs tested had significant biological activity acting as active stimuli for differentiation of stem cells into insulin-producing cells. PMID:26397720

  3. Capnocytophaga canimorsus: a human pathogen feeding at the surface of epithelial cells and phagocytes.

    Directory of Open Access Journals (Sweden)

    Manuela Mally

    Full Text Available Capnocytophaga canimorsus, a commensal bacterium of the canine oral flora, has been repeatedly isolated since 1976 from severe human infections transmitted by dog bites. Here, we show that C. canimorsus exhibits robust growth when it is in direct contact with mammalian cells, including phagocytes. This property was found to be dependent on a surface-exposed sialidase allowing C. canimorsus to utilize internal aminosugars of glycan chains from host cell glycoproteins. Although sialidase probably evolved to sustain commensalism, by releasing carbohydrates from mucosal surfaces, it also contributed to bacterial persistence in a murine infection model: the wild type, but not the sialidase-deficient mutant, grew and persisted, both when infected singly or in competition. This study reveals an example of pathogenic bacteria feeding on mammalian cells, including phagocytes by deglycosylation of host glycans, and it illustrates how the adaptation of a commensal to its ecological niche in the host, here the dog's oral cavity, contributes to being a potential pathogen.

  4. Stability analysis of simple models for immune cells interacting with normal pathogens and immune system retroviruses.

    Science.gov (United States)

    Reibnegger, G; Fuchs, D; Hausen, A; Werner, E R; Werner-Felmayer, G; Dierich, M P; Wachter, H

    1989-01-01

    A mathematical analysis is presented for several simple dynamical systems that might be considered as crude descriptions for the situation when an immune system retrovirus, immune cells, and normal autonomously replicating pathogens interact. By stability analysis of the steady-state solutions, the destabilizing effect of the immune system retrovirus is described. The qualitative behavior of the solutions depending on the system parameters is analyzed in terms of trajectories moving in a phase space in which the axes are defined by the population numbers of the interacting biological entities. PMID:2522657

  5. Potentially pathogenic bacteria in shower water and air of a stem cell transplant unit.

    Science.gov (United States)

    Perkins, Sarah D; Mayfield, Jennie; Fraser, Victoria; Angenent, Largus T

    2009-08-01

    Potential pathogens from shower water and aerosolized shower mist (i.e., shower aerosol) have been suggested as an environmental source of infection for immunocompromised patients. To quantify the microbial load in shower water and aerosol samples, we used culture, microscopic, and quantitative PCR methods to investigate four shower stalls in a stem cell transplant unit at Barnes-Jewish Hospital in St. Louis, MO. We also tested membrane-integrated showerheads as a possible mitigation strategy. In addition to quantification, a 16S rRNA gene sequencing survey was used to characterize the abundant bacterial populations within shower water and aerosols. The average total bacterial counts were 2.2 x 10(7) cells/liter in shower water and 3.4 x 10(4) cells/m(3) in shower aerosol, and these counts were reduced to 6.3 x 10(4) cells/liter (99.6% efficiency) and 8.9 x 10(3) cells/m(3) (82.4% efficiency), respectively, after membrane-integrated showerheads were installed. Potentially pathogenic organisms were found in both water and aerosol samples from the conventional showers. Most notable was the presence of Mycobacterium mucogenicum (99.5% identity) in the water and Pseudomonas aeruginosa (99.3% identity) in the aerosol samples. Membrane-integrated showerheads may protect immunocompromised patients from waterborne infections in a stem cell transplant unit because of efficient capture of vast numbers of potentially pathogenic bacteria from hospital water. However, an in-depth epidemiological study is necessary to investigate whether membrane-integrated showerheads reduce hospital-acquired infections. The microbial load in shower aerosols with conventional showerheads was elevated compared to the load in HEPA-filtered background air in the stem cell unit, but it was considerably lower than typical indoor air. Thus, in shower environments without HEPA filtration, the increase in microbial load due to shower water aerosolization would not have been distinguishable from

  6. Towards the molecular characterization of the stable producer phenotype of recombinant antibody-producing NS0 myeloma cells

    OpenAIRE

    Prieto, Y.; Rojas, L.; Hinojosa, L.; González, I.; Aguiar, D.; de la Luz, K.; Castillo, A.; Pérez, R.

    2011-01-01

    The loss of heterologous protein expression is one of the major problems faced by industrial cell line developers and has been reported by several authors. Therefore, the understanding of the mechanisms involved in the generation of stable and high producer cell lines is a critical issue, especially for those processes based on long term continuous cultures. We characterized two recombinant NS0 myeloma cell lines expressing Nimotuzumab, a humanized anti-human epidermal growth factor receptor ...

  7. Probing host pathogen cross-talk by transcriptional profiling of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages.

    Directory of Open Access Journals (Sweden)

    Ludovic Tailleux

    Full Text Available BACKGROUND: Transcriptional profiling using microarrays provides a unique opportunity to decipher host pathogen cross-talk on the global level. Here, for the first time, we have been able to investigate gene expression changes in both Mycobacterium tuberculosis, a major human pathogen, and its human host cells, macrophages and dendritic cells. METHODOLOGY/PRINCIPAL FINDINGS: In addition to common responses, we could identify eukaryotic and microbial transcriptional signatures that are specific to the cell type involved in the infection process. In particular M. tuberculosis shows a marked stress response when inside dendritic cells, which is in accordance with the low permissivity of these specialized phagocytes to the tubercle bacillus and to other pathogens. In contrast, the mycobacterial transcriptome inside macrophages reflects that of replicating bacteria. On the host cell side, differential responses to infection in macrophages and dendritic cells were identified in genes involved in oxidative stress, intracellular vesicle trafficking and phagosome acidification. CONCLUSIONS/SIGNIFICANCE: This study provides the proof of principle that probing the host and the microbe transcriptomes simultaneously is a valuable means to accessing unique information on host pathogen interactions. Our results also underline the extraordinary plasticity of host cell and pathogen responses to infection, and provide a solid framework to further understand the complex mechanisms involved in immunity to M. tuberculosis and in mycobacterial adaptation to different intracellular environments.

  8. Indole-3-Acetic Acid Is Produced by Emiliania huxleyi Coccolith-Bearing Cells and Triggers a Physiological Response in Bald Cells

    Science.gov (United States)

    Labeeuw, Leen; Khey, Joleen; Bramucci, Anna R.; Atwal, Harjot; de la Mata, A. Paulina; Harynuk, James; Case, Rebecca J.

    2016-01-01

    Indole-3-acetic acid (IAA) is an auxin produced by terrestrial plants which influences development through a variety of cellular mechanisms, such as altering cell orientation, organ development, fertility, and cell elongation. IAA is also produced by bacterial pathogens and symbionts of plants and algae, allowing them to manipulate growth and development of their host. They do so by either producing excess exogenous IAA or hijacking the IAA biosynthesis pathway of their host. The endogenous production of IAA by algae remains contentious. Using Emiliania huxleyi, a globally abundant marine haptophyte, we investigated the presence and potential role of IAA in algae. Homologs of genes involved in several tryptophan-dependent IAA biosynthesis pathways were identified in E. huxleyi. This suggests that this haptophyte can synthesize IAA using various precursors derived from tryptophan. Addition of L-tryptophan to E. huxleyi stimulated IAA production, which could be detected using Salkowski's reagent and GC × GC-TOFMS in the C cell type (coccolith bearing), but not in the N cell type (bald). Various concentrations of IAA were exogenously added to these two cell types to identify a physiological response in E. huxleyi. The N cell type, which did not produce IAA, was more sensitive to it, showing an increased variation in cell size, membrane permeability, and a corresponding increase in the photosynthetic potential quantum yield of Photosystem II (PSII). A roseobacter (bacteria commonly associated with E. huxleyi) Ruegeria sp. R11, previously shown to produce IAA, was co-cultured with E. huxleyi C and N cells. IAA could not be detected from these co-cultures, and even when stimulated by addition of L-tryptophan, they produced less IAA than axenic C type culture similarly induced. This suggests that IAA plays a novel role signaling between different E. huxleyi cell types, rather than between a bacteria and its algal host.

  9. B cells contribute to heterogeneity of IL-17 producing cells in rheumatoid arthritis and healthy controls.

    Directory of Open Access Journals (Sweden)

    Paul Martin Schlegel

    Full Text Available Secretion of the proinflammatory cytokine Interleukin-17A (IL-17A is the hallmark of a unique lineage of CD4 T cells designated Th17 cells, which may play a crucial role in the pathogenesis of rheumatoid arthritis (RA and many autoimmune diseases. Recently, IL-17-producing cells other than T cells have been described, including diverse innate immune cells. Here, we show that the cellular sources of IL-17A in RA include a significant number of non-T cells. Multicolour fluorescence analysis of IL-17-expressing peripheral blood mononuclear cells (PBMC revealed larger proportions of IL-17(+CD3(- non-T cells in RA patients than in healthy controls (constitutive, 13.6% vs. 8.4%, and after stimulation with PMA/ionomycin 17.4% vs. 7.9% p < 0.001 in both cases. The source of IL-17 included CD3(-CD56(+ NK cells, CD3(-CD14(+ myeloid cells as well as the expected CD3(+CD4(+ Th17 cells and surprisingly a substantial number of CD3(-CD19(+ B cells. The presence of IL-17A-expressing B cells was confirmed by specific PCR of peripheral MACS-sorted CD19(+ B cells, as well as by the analysis of different EBV-transformed B cell lines. Here we report for the first time that in addition to Th17 cells and different innate immune cells B cells also contribute to the IL-17A found in RA patients and healthy controls.

  10. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Nathan T Reem

    2016-05-01

    Full Text Available The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity and function remains unclear. Modifications of cell wall composition can induce plant responses known as Cell Wall Integrity control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, increased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant cell wall integrity, which contributes to plant resistance to necrotrophic pathogens.

  11. LDS1-produced oxylipins are negative regulators of growth, conidiation and fumonisin synthesis in the fungal maize pathogen Fusarium verticillioides

    OpenAIRE

    Scala, Valeria; Giorni, Paola; Cirlini, Martina; Ludovici, Matteo; Visentin, Ivan; Cardinale, Francesca; Fabbri, Anna A.; Fanelli, Corrado; Reverberi, Massimo; Battilani, Paola; Galaverna, Gianni; Dall'Asta, Chiara

    2014-01-01

    Oxylipins are fatty acid-derived signaling compounds produced by all eukaryotes so far investigated; in mycotoxigenic fungi, they modulate toxin production and interactions with the host plants. Among the many enzymes responsible for oxylipin generation, Linoleate Diol Synthase 1 (LDS1) produces mainly 8-hydroperoxyoctadecenoic acid and subsequently different di-hydroxyoctadecenoic acids. In this study, we inactivated a copy of the putative LDS1 ortholog (acc. N. FVEG_09294.3) of Fusarium ver...

  12. Fibroblastic reticular cells from lymph nodes attenuate T cell expansion by producing nitric oxide.

    Science.gov (United States)

    Siegert, Stefanie; Huang, Hsin-Ying; Yang, Chen-Ying; Scarpellino, Leonardo; Carrie, Lucie; Essex, Sarah; Nelson, Peter J; Heikenwalder, Matthias; Acha-Orbea, Hans; Buckley, Christopher D; Marsland, Benjamin J; Zehn, Dietmar; Luther, Sanjiv A

    2011-01-01

    Adaptive immune responses are initiated when T cells encounter antigen on dendritic cells (DC) in T zones of secondary lymphoid organs. T zones contain a 3-dimensional scaffold of fibroblastic reticular cells (FRC) but currently it is unclear how FRC influence T cell activation. Here we report that FRC lines and ex vivo FRC inhibit T cell proliferation but not differentiation. FRC share this feature with fibroblasts from non-lymphoid tissues as well as mesenchymal stromal cells. We identified FRC as strong source of nitric oxide (NO) thereby directly dampening T cell expansion as well as reducing the T cell priming capacity of DC. The expression of inducible nitric oxide synthase (iNOS) was up-regulated in a subset of FRC by both DC-signals as well as interferon-γ produced by primed CD8+ T cells. Importantly, iNOS expression was induced during viral infection in vivo in both LN FRC and DC. As a consequence, the primary T cell response was found to be exaggerated in Inos(-/-) mice. Our findings highlight that in addition to their established positive roles in T cell responses FRC and DC cooperate in a negative feedback loop to attenuate T cell expansion during acute inflammation. PMID:22110693

  13. Lutein, a Natural Carotenoid, Induces α-1,3-Glucan Accumulation on the Cell Wall Surface of Fungal Plant Pathogens.

    Science.gov (United States)

    Otaka, Junnosuke; Seo, Shigemi; Nishimura, Marie

    2016-01-01

    α-1,3-Glucan, a component of the fungal cell wall, is a refractory polysaccharide for most plants. Previously, we showed that various fungal plant pathogens masked their cell wall surfaces with α-1,3-glucan to evade plant immunity. This surface accumulation of α-1,3-glucan was infection specific, suggesting that plant factors might induce its production in fungi. Through immunofluorescence observations of fungal cell walls, we found that carrot (Daucus carota) extract induced the accumulation of α-1,3-glucan on germlings in Colletotrichum fioriniae, a polyphagous fungal pathogen that causes anthracnose disease in various dicot plants. Bioassay-guided fractionation of carrot leaf extract successfully identified two active substances that caused α-1,3-glucan accumulation in this fungus: lutein, a carotenoid widely distributed in plants, and stigmasterol, a plant-specific membrane component. Lutein, which had a greater effect on C. fioriniae, also induced α-1,3-glucan accumulation in other Colletotrichum species and in the phylogenetically distant rice pathogen Cochliobolus miyabeanus, but not in the rice pathogen Magnaporthe oryzae belonging to the same phylogenetic subclass as Colletotrichum. Our results suggested that fungal plant pathogens reorganize their cell wall components in response to specific plant-derived compounds, which these pathogens may encounter during infection. PMID:27483218

  14. The majority of murine γδ T cells at the maternal-fetal interface in pregnancy produce IL-17.

    Science.gov (United States)

    Pinget, Gabriela V; Corpuz, Theresa M; Stolp, Jessica; Lousberg, Erin L; Diener, Kerrilyn R; Robertson, Sarah A; Sprent, Jonathan; Webster, Kylie E

    2016-08-01

    Compared with lymphoid tissues, the immune cell compartment at mucosal sites is enriched with T cells bearing the γδ T-cell receptor (TCR). The female reproductive tract, along with the placenta and uterine decidua during pregnancy, are populated by γδ T cells predominantly expressing the invariant Vγ6(+)Vδ1(+) receptor. Surprisingly little is understood about the function of these cells. We found that the majority of γδ T cells in the non-pregnant uterus, pregnant uterus, decidua and placenta of mice express the transcription factor RORγt and produce interleukin-17 (IL-17). In contrast, IFNγ-producing γδ T cells were markedly reduced in gestational tissues compared with uterine-draining lymph nodes and spleen. Both uterine-resident invariant Vγ6(+) and Vγ4(+) γδ T cells which are more typically found in lymphoid tissues and circulating blood, were found to express IL-17. Vγ4(+) γδ T cells were particularly enriched in the placenta, suggesting a pregnancy-specific recruitment or expansion of these cells. A small increase in IL-17-producing γδ T cells was observed in allogeneic compared with syngeneic pregnancy, suggesting a contribution to regulating the maternal response to paternally-derived alloantigens. However, their high proportions also in non-pregnant uteri and gestational tissues of syngeneic pregnancy imply a role in the prevention of intrauterine infection or quality control of fetal development. These data suggest the need for a more rigorous evaluation of the role of IL-17 in sustaining normal pregnancy, particularly as emerging data points to a pathogenic role for IL-17 in pre-eclampsia, pre-term birth, miscarriage and maternal immune activation-induced behavioral abnormalities in offspring. PMID:27241697

  15. TLR-4 ligation of dendritic cells is sufficient to drive pathogenic T cell function in experimental autoimmune encephalomyelitis

    Directory of Open Access Journals (Sweden)

    Mellanby Richard J

    2012-10-01

    Full Text Available Abstract Background Experimental autoimmune encephalomyelitis (EAE depends on the initial activation of CD4+ T cells responsive to myelin autoantigens. The key antigen presenting cell (APC population that drives the activation of naïve T cells most efficiently is the dendritic cell (DC. As such, we should be able to trigger EAE by transfer of DC that can present the relevant autoantigen(s. Despite some sporadic reports, however, models of DC-driven EAE have not been widely adopted. We sought to test the feasibility of this approach and whether activation of the DC by toll-like receptor (TLR-4 ligation was a sufficient stimulus to drive EAE. Findings Host mice were seeded with myelin basic protein (MBP-reactive CD4+ T cells and then were injected with DC that could present the relevant MBP peptide which had been exposed to lipopolysaccharide as a TLR-4 agonist. We found that this approach induced robust clinical signs of EAE. Conclusions DC are sufficient as APC to effectively drive the differentiation of naïve myelin-responsive T cells into autoaggressive effector T cells. TLR-4-stimulation can activate the DC sufficiently to deliver the signals required to drive the pathogenic function of the T cell. These models will allow the dissection of the molecular requirements of the initial DC-T cell interaction in the lymphoid organs that ultimately leads to autoimmune pathology in the central nervous system.

  16. VIGOR OF PLANTLET FROM MICROPLANTLET TREATED BY FILTRATE AND CELL SUSPENSION OF SOME ISOLATES OF BACILLUS AND RESISTANCE TO BANANA WILT PATHOGEN AFTER ACCLIMATIZATION

    Directory of Open Access Journals (Sweden)

    Hadi wiyono

    2013-08-01

    Full Text Available Blood Disease Bacterium (BDB and Fusarium oxysporum f.sp. cubense (FOC is a couple wilt pathogen  of  banana.  These pathogens are the most important constraint in cultivation of banana in Indonesia.  In the integrated control strategy of the disease, the use of healthy seedlings produced from tissue culture technique is recommended.  The seedling produced by tissue culture technique however leads to lower vigor and susceptibility to the disease due to the aseptic work in vitro causing the beneficial bacterial endophytic to be eliminated. Therefore, the utility of the beneficial endophytic bacteria should be studied for recovering the vigor and resistance of the seedling.     Three isolates of endophytic Bacillus (B04, B05, B10 have been effective as growth promoter of microplantlet and antagonist of BDB and FOC in vitro.   Here then, this article reports the study results of the vigor of the plantlet (treated microplantlet by filtrate or cell suspension of the Bacillus after 3 months in acclimatization. The results were similar to the previous results on microplantlet in vitro, that Bacillus isolates B04, B05, and B10 were capable of promoting the growth and inducing the resistance to wilt pathogens on banana plantlets.  The treatments with bacterial cell inoculums were more effective than those bacterial filtrate. Isolate B10 was most potential followed by B05 and B04 respectively.

  17. Programmed Cell Death and Postharvest Deterioration of Horticultural Produce

    NARCIS (Netherlands)

    Woltering, E.J.; Iakimova, E.T.

    2010-01-01

    Programmed cell death (PCD) is a process where cells or tissues are broken down in an orderly and predictable manner, whereby nutrients are re-used by other cells, tissues or plant parts. The process of (petal) senescence shows many similarities to autophagic PCD in animal cells including a massive

  18. Enhanced production of phenazine-like metabolite produced by Streptomyces aurantiogriseus VSMGT1014 against rice pathogen, Rhizoctonia solani.

    Science.gov (United States)

    Harikrishnan, Hariharan; Shanmugaiah, Vellasamy; Nithya, Karmegham; Balasubramanian, Natesan; Sharma, Mahaveer P; Gachomo, Emma W; Kotchoni, Simeon O

    2016-02-01

    The efficacy of a rhizobacterium Streptomyces aurantiogriseus VSMGT1014 for the production of bioactive metabolites with antifungal properties was evaluated under in vitro conditions. The production of bioactive metabolites by S. aurantiogriseus VSMGT1014 in International Streptomyces Project-2 (ISP-2) broth, supplemented with glucose and ammonium acetate was found to be the most suitable carbon and nitrogen sources for the maximum production of bioactive metabolites against rice pathogen, Rhizoctonia solani. The zone of inhibition range from 23.5 to 28.5 mm and 10.3 to 18.3 mm for glucose and ammonium acetate supplemented media, respectively. The culture filtrate of S. aurantiogriseus VSMGT1014 at pH 7.5, 37 °C at 120 rpm in 6 days of incubation showed the maximum production of bioactive metabolites with antagonistic potential. The crude metabolite was characterized by different spectral studies such as Ultraviolet spectrum, infrared-spectrum and based on the different analytical techniques, including thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) with the retention time 29.4 and the bioactive metabolite was identified as phenazine, which was confirmed by pure phenazine compound as positive control. PMID:26627705

  19. An in planta-expressed polyketide synthase produces (R)-mellein in the wheat pathogen Parastagonospora nodorum.

    Science.gov (United States)

    Chooi, Yit-Heng; Krill, Christian; Barrow, Russell A; Chen, Shasha; Trengove, Robert; Oliver, Richard P; Solomon, Peter S

    2015-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  20. From pathogens to microbiota: How Drosophila intestinal stem cells react to gut microbes.

    Science.gov (United States)

    Bonfini, Alessandro; Liu, Xi; Buchon, Nicolas

    2016-11-01

    The intestine acts as one of the interfaces between an organism and its external environment. As the primary digestive organ, it is constantly exposed to a multitude of stresses as it processes and absorbs nutrients. Among these is the recurring damage induced by ingested pathogenic and commensal microorganisms. Both the bacterial activity and immune response itself can result in the loss of epithelial cells, which subsequently requires replacement. In the Drosophila midgut, this regenerative role is fulfilled by intestinal stem cells (ISCs). Microbes not only trigger cell loss and replacement, but also modify intestinal and whole organism physiology, thus modulating ISC activity. Regulation of ISCs is integrated through a complex network of signaling pathways initiated by other gut cell populations, including enterocytes, enteroblasts, enteroendocrine and visceral muscles cells. The gut also receives signals from circulating immune cells, the hemocytes, to properly respond against infection. This review summarizes the types of gut microbes found in Drosophila, mechanisms for their elimination, and provides an integrated view of the signaling pathways that regulate tissue renewal in the midgut. PMID:26855015

  1. The Plant Pathogen Pantoea ananatis Produces N-Acylhomoserine Lactone and Causes Center Rot Disease of Onion by Quorum Sensing▿

    OpenAIRE

    Morohoshi, Tomohiro; Nakamura, Yuta; Yamazaki, Go; Ishida, Akio; Kato, Norihiro; Ikeda, Tsukasa

    2007-01-01

    A number of gram-negative bacteria have a quorum-sensing system and produce N-acyl-l-homoserine lactone (AHL) that they use them as a quorum-sensing signal molecule. Pantoea ananatis is reported as a common colonist of wheat heads at ripening and causes center rot of onion. In this study, we demonstrated that P. ananatis SK-1 produced two AHLs, N-hexanoyl-l-homoserine lactone (C6-HSL) and N-(3-oxohexanoyl)-l-homoserine lactone (3-oxo-C6-HSL). We cloned the AHL-synthase gene (eanI) and AHL-rec...

  2. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Donghui Zhang; Wei Jiang; Meng Liu; Xin Sui; Xiaolei Yin; Song Chen; Yan Shi; Hongkui Deng

    2009-01-01

    Human pluripotent stem cells represent a potentially unlimited source of functional pancreatic endocrine lineage cells. Here we report a highly efficient approach to induce human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells to differentiate into mature insulin-producing cells in a chemical-defined culture system. The differentiated human ES cells obtained by this approach comprised nearly 25% insulin-positive cells as assayed by flow cytometry analysis, which released insulin/C-peptide in response to glucose stimuli in a manner comparable to that of adult human islets. Most of these insulin-producing cells co-expressed mature β cell-specific markers such as NKX6-1 and PDX1, indicating a similar gene expression pattern to adult islet β cells in vivo. In this study, we also demonstrated that EGF facilitates the expansion of PDX1-positive pancreatic progenitors. Moreover, our protocol also succeeded in efficiently inducing human iPS cells to differentiate into insulin-producing cells. Therefore, this work not only provides a new model to study the mechanism of human pancreatic specialization and maturation in vitro, but also enhances the possibility of utilizing patient-specific iPS cells for the treatment of diabetes.

  3. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    International Nuclear Information System (INIS)

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  4. Human Liver Cells Expressing Albumin and Mesenchymal Characteristics Give Rise to Insulin-Producing Cells

    Directory of Open Access Journals (Sweden)

    Irit Meivar-Levy

    2011-01-01

    Full Text Available Activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients. Transcription factors-induced liver-to-pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro. However, human-derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized. It is yet unknown whether hepatic-like stem cells or rather adult liver cells give rise to insulin-producing cells. Using an in vitro experimental system, we demonstrate that proliferating adherent human liver cells acquire mesenchymal-like characteristics and a considerable level of cellular plasticity. However, using a lineage-tracing approach, we demonstrate that insulin-producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers. Taken together, our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity, which could be exploited in regenerative medicine approaches.

  5. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

    2010-07-09

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  6. Fusarium praegraminearum sp. nov. is a novel nivalenol mycotoxin-producing head blight pathogen from New Zealand

    Science.gov (United States)

    We report on the molecular and morphological characterization of a novel B-type trichothecene toxin-producing species (i.e., B clade) recovered from litter in a maize field near Wellington, New Zealand, which is described as Fusarium praegraminearum sp. nov. This species was initially identified as ...

  7. Urease genes in non-O157 Shiga toxin-producing Escherichia coli : mostly silent but valuable markers for pathogenicity

    NARCIS (Netherlands)

    Friedrich, A W; Lukas, R; Mellmann, A; Köck, R; Zhang, W; Mathys, W; Bielaszewska, M; Karch, H

    2006-01-01

    The distribution of ureC was investigated among 294 Escherichia coli isolates, comprising 72 strains from the E. coli standard reference collection (ECOR), 62 strains from the diarrhoeagenic E. coli (DEC) collection, and 160 clinical isolates of Shiga toxin-producing E. coli (STEC). The ureC gene wa

  8. Transcriptomic Crosstalk between Fungal Invasive Pathogens and Their Host Cells: Opportunities and Challenges for Next-Generation Sequencing Methods

    OpenAIRE

    Francisco J Enguita; Costa, Marina C.; Ana Marisa Fusco-Almeida; Maria José Mendes-Giannini; Ana Lúcia Leitão

    2016-01-01

    Fungal invasive infections are an increasing health problem. The intrinsic complexity of pathogenic fungi and the unmet clinical need for new and more effective treatments requires a detailed knowledge of the infection process. During infection, fungal pathogens are able to trigger a specific transcriptional program in their host cells. The detailed knowledge of this transcriptional program will allow for a better understanding of the infection process and consequently will help in the future...

  9. Fibronectin-, vitronectin- and laminin-binding proteins at the cell walls of Candida parapsilosis and Candida tropicalis pathogenic yeasts

    OpenAIRE

    Kozik, Andrzej; Karkowska-Kuleta, Justyna; Zajac, Dorota; Bochenska, Oliwia; Kedracka-Krok, Sylwia; Jankowska, Urszula; Rapala-Kozik, Maria

    2015-01-01

    Background Candida parapsilosis and C. tropicalis increasingly compete with C. albicans—the most common fungal pathogen in humans—as causative agents of severe candidiasis in immunocompromised patients. In contrast to C. albicans, the pathogenic mechanisms of these two non-albicans Candida species are poorly understood. Adhesion of Candida yeast to host cells and the extracellular matrix is critical for fungal invasion of hosts. Methods The fungal proteins involved in interactions with extrac...

  10. Influence of Additives on the Yield and Pathogenicity of Conidia Produced by Solid State Cultivation of an Isaria javanica Isolate.

    Science.gov (United States)

    Kim, Jeong Jun; Xie, Ling; Han, Ji Hee; Lee, Sang Yeob

    2014-12-01

    Recently, the Q biotype of tobacco whitefly has been recognized as the most hazardous strain of Bemisia tabaci worldwide, because of its increased resistance to some insecticide groups. As an alternative control agent, we selected an Isaria javanica isolate as a candidate for the development of a mycopesticide against the Q biotype of sweet potato whitefly. To select optimal mass production media for solid-state fermentation, we compared the production yield and virulence of conidia between 2 substrates (barley and brown rice), and we also compared the effects of various additives on conidia production and virulence. Barley was a better substrate for conidia production, producing 3.43 × 10(10) conidia/g, compared with 3.05 × 10(10) conidia/g for brown rice. The addition of 2% CaCO3 + 2% CaSO4 to barley significantly increased conidia production. Addition of yeast extract, casein, or gluten also improved conidia production on barley. Gluten addition (3% and 1.32%) to brown rice improved conidia production by 14 and 6 times, respectively, relative to brown rice without additives. Conidia cultivated on barley produced a mortality rate of 62% in the sweet potato whitefly after 4-day treatment, compared with 53% for conidia cultivated on brown rice. The amendment of solid substrate cultivation with additives changed the virulence of the conidia produced; the median lethal time (LT50) was shorter for conidia produced on barley and brown rice with added yeast extract (1.32% and 3%, respectively), KNO3 (0.6% and 1%), or gluten (1.32% and 3%) compared with conidia produced on substrates without additives. PMID:25606006

  11. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage

    Science.gov (United States)

    Jin, Xiao-Lu; Shen, Xiao-Ge; Sun, Li-Ping; Wu, Li-Ming; Wei, Jiang-Qin; Marcucci, Maria Cristina; Hu, Fu-Liang; Liu, Jian-Xin

    2016-01-01

    Chinese propolis (CP), an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T), we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS), heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA) did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis. PMID:27433029

  12. Search for MicroRNAs Expressed by Intracellular Bacterial Pathogens in Infected Mammalian Cells

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A.; Xet-Mull, Ana M.; Sisk, Dana M.; Smith, Kristen L. Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H.; Tobin, David M.; Cullen, Bryan R.

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin. PMID:25184567

  13. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  14. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  15. Complementarity and redundancy of IL-22-producing innate lymphoid cells.

    Science.gov (United States)

    Rankin, Lucille C; Girard-Madoux, Mathilde J H; Seillet, Cyril; Mielke, Lisa A; Kerdiles, Yann; Fenis, Aurore; Wieduwild, Elisabeth; Putoczki, Tracy; Mondot, Stanislas; Lantz, Olivier; Demon, Dieter; Papenfuss, Anthony T; Smyth, Gordon K; Lamkanfi, Mohamed; Carotta, Sebastian; Renauld, Jean-Christophe; Shi, Wei; Carpentier, Sabrina; Soos, Tim; Arendt, Christopher; Ugolini, Sophie; Huntington, Nicholas D; Belz, Gabrielle T; Vivier, Eric

    2016-02-01

    Intestinal T cells and group 3 innate lymphoid cells (ILC3 cells) control the composition of the microbiota and gut immune responses. Within the gut, ILC3 subsets coexist that either express or lack the natural cytoxicity receptor (NCR) NKp46. We identified here the transcriptional signature associated with the transcription factor T-bet-dependent differentiation of NCR(-) ILC3 cells into NCR(+) ILC3 cells. Contrary to the prevailing view, we found by conditional deletion of the key ILC3 genes Stat3, Il22, Tbx21 and Mcl1 that NCR(+) ILC3 cells were redundant for the control of mouse colonic infection with Citrobacter rodentium in the presence of T cells. However, NCR(+) ILC3 cells were essential for cecal homeostasis. Our data show that interplay between intestinal ILC3 cells and adaptive lymphocytes results in robust complementary failsafe mechanisms that ensure gut homeostasis. PMID:26595889

  16. A Resealed-Cell System for Analyzing Pathogenic Intracellular Events: Perturbation of Endocytic Pathways under Diabetic Conditions

    OpenAIRE

    Kano, Fumi; Nakatsu, Daiki; Noguchi, Yoshiyuki; Yamamoto, Akitsugu; Murata, Masayuki

    2012-01-01

    Cell-based assay systems that can serve as cellular models of aberrant function in pathogenic organs would be novel and useful tools for screening drugs and clarifying the molecular mechanisms of various diseases. We constructed model cells that replicated the conditions in diabetic hepatocytes by using the cell resealing technique, which enables the exchange of cytosol. The plasma membrane of HeLa cells was permeabilized with the streptococcal toxin streptolysin O, and cytosol that had been ...

  17. Stem cells as probabilistic self-producing entities.

    Science.gov (United States)

    Ramalho-Santos, Miguel

    2004-09-01

    Stem cells have the capacity both to self-renew and to give rise to differentiated progeny, and are vital to the organization of multicellular organisms. Stem cells raise a number of fundamental questions regarding lineage restriction and cellular differentiation, and they hold enormous promise for cell-based therapies. Here I propose a theoretical framework for stem cell biology based on the concepts of autopoiesis (self-production) and complementarity. I argue that stem cells are pivotal in the self-production of the organism and that we need complementary approaches to understand their probabilistic behavior. I discuss how this framework generates testable hypotheses regarding stem-cell functions. PMID:15351971

  18. A genome-wide transcriptional analysis of producer and non-producer NS0 myeloma cell lines.

    Science.gov (United States)

    Khoo, Soo Hean Gary; Falciani, Francesco; Al-Rubeai, Mohamed

    2007-06-01

    'Genome-wide' or 'global' gene expression profiling provides a powerful approach to the characterization of a cell's transcriptional state. Such technology has been used in animal cell culture to create genome-wide snapshots of transcriptional activity in response to environmental factors or cellular triggers under bioprocessing conditions. Furthermore, it allows us to have a fundamental understanding of genetic mechanisms involved in recombinant protein production. One such mechanism adversely affecting the growth of recombinant bacteria is the increased metabolic burden resulting from the maintenance of plasmid copy number and heterologous protein expression. There have also been some reports on the effect of metabolic burden in mammalian cell systems. In the present study, we have used a mouse array representing 6400 genes to assess the expression profile of a WT (wild-type) mouse plasmacytoma cell line, NS0 WT, and a GS (glutamine synthetase)-NS0 6A1-100 cell line expressing chimaeric monoclonal antibody. The producer cells did not exhibit a slower growth as the result of any metabolic burden, but showed differences in metabolic activity. Gene expression profiling revealed that the producer cell line was selected for a higher expression of chromosomal genes, genes for zinc-finger proteins as well as cell-cycle-related events. On the other hand, protein synthesis is greater and ribosomal genes were more expressed in the WT cells. A possible shift from expressing antigen presenting proteins to recombinant protein could also be seen. Hence, gene expression profiling suggests that the effect of the metabolic burden in slowing growth can be mostly negated in producer cell lines by careful clonal selection, where stable transfected cells are selected for both high productivity as well as high growth rates. PMID:17223793

  19. Microscopic examination and cytokine expression of bone marrow-derived dendritic cells following exposure to low pathogenic avian ionfluenza

    Science.gov (United States)

    Dendritic cells (DC) function as professional antigen presenting cells, and act as sentinels of the immune system. They are a part of the primary immune response to pathogens and help bridge the innate and adaptive immune responses. They are believed to migrate from bone marrow into the blood stre...

  20. Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

    Science.gov (United States)

    Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

    2016-02-01

    Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7-10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

  1. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens

    Science.gov (United States)

    Reem, Nathan T.; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A.; Bellincampi, Daniela; Zabotina, Olga A.

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens. PMID:27242834

  2. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  3. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens.

    Science.gov (United States)

    Reem, Nathan T; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A; Bellincampi, Daniela; Zabotina, Olga A

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens. PMID:27242834

  4. In vitro neuroprotective action of recombinant rat erythropoietin produced by astrocyte cell lines and comparative studies with erythropoietin produced by Chinese hamster ovary cells

    OpenAIRE

    Masuda, Seiji; Kada, Emi; Nagao, Masaya; Sasaki, Ryuzo

    1999-01-01

    In the central nervous system, astrocytes produce erythropoietin (Epo) and neurons express its receptor. To examine whether or not the brain Epo protects the in vitro cultured neurons from glutamate-induced cell death, we established rat astrocyte cell lines containing the plasmid for production of recombinant rat Epo. Epo partially purified from the culture medium showed a neuroprotective effect similar to that of rat Epo produced by Chinese hamster ovary (CHO) cells. Comparison was made in ...

  5. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae

    OpenAIRE

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D.; Genersch, Elke

    2014-01-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been ...

  6. Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital

    Directory of Open Access Journals (Sweden)

    J B Sarma

    2011-01-01

    Full Text Available Purpose: A study was carried out in an Indian teaching hospital in 2009 to detect the rate of surgical site infections (SSI and peripheral vascular access site infections. Materials and Methods: The study was a point-prevalence study involving over 300 patients. The presence of infection was determined according to the CDC criteria. Swabs were taken from the infected sites and identification and sensitivity were carried out using VITEK® 2 automated system. Characterisation of β-lactamase was carried out at ARRML, Colindale, London. Results: The rate of SSI was 15% for the clean and clean-contaminated categories while that for the dirty contaminated category was 85% (NNIS risk index 0. Cultures yielded definite or probable pathogens from 64% (9/14 of the patients with SSI. In 1/3 rd of the cultures, Staphylococcus aureus was grown and the rest had Enterobacteriaceae, either extended-spectrum β-lactamase (ESBL producers or Amp-C hyperproducers and, alarmingly, three isolates were positive for newly recognised New Delhi metallo-β-lactamase-1 (NDM-1. In medicine, 87% (n = 99 of the patients had a peripheral IV access device, 55% developed associated phlebitis/infection and, in seven, probable pathogens were isolated (Candida species and Escherichia coli producing ESBL and NDM-1, respectively, Staphylococcus aureus and Enterococcus faecium. All ESBL and metallo-β-lactamase producers were resistant to multiple classes of antimicrobials, the latter being sensitive only to colistin and tigecycline. The study also found that all post-operative patients were on antibiotics, 92% on IV [213 defined daily doses (DDD/100 post-op patients] limited mainly to the third-generation cephalosporins (26% and aminoglycosides (24% and imidazole derivatives (30%. In medicine, 83% (n = 82 were on IV antibiotics (123 DDD/100 bed-days, limited mainly to the third-generation cephalosporins (74%. Conclusion: Indiscriminate use of antibiotics is a major problem

  7. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other importan

  8. APOBEC3-Mediated Hypermutation of Retroviral Vectors Produced from Some Retrovirus Packaging Cell Lines

    OpenAIRE

    Miller, A. Dusty; Metzger, Michael J.

    2011-01-01

    APOBEC3 proteins are packaged into retrovirus virions and can hypermutate retroviruses during reverse transcription. We find that HT-1080 human fibrosarcoma cells hypermutate retroviruses, and that the HT-1080 cell-derived FLYA13 retrovirus packaging cells also hypermutate a retrovirus vector produced using these cells. We found no hypermutation of the same vector produced by the mouse cell-derived packaging line PT67 or by human 293 cells transfected with the vector and retrovirus packaging ...

  9. Detection of human adenoviruses in organic fresh produce using molecular and cell culture-based methods.

    Science.gov (United States)

    Marti, Elisabet; Barardi, Célia Regina Monte

    2016-08-01

    The consumption of organic fresh produce has increased in recent years due to consumer demand for healthy foods without chemical additives. However, the number of foodborne outbreaks associated with fresh produce has also increased. Contamination of food with enteric viruses is a major concern because the viruses have a low infectious dose and high persistence in the environment. Human adenovirus (HAdV) has been proposed as a good marker of faecal contamination. Therefore, the aim of this study was to evaluate the efficiency of the plaque assay (PA), real time PCR (qPCR) and integrated cell culture-RT-qPCR (ICC-RT-qPCR) for the recovery of HAdV from artificially and naturally contaminated fresh produce. Organic lettuce, strawberries and green onions were selected because these fresh products are frequently associated with foodborne outbreaks. The virus extraction efficiencies from artificially contaminated samples varied from 2.8% to 32.8% depending on the food matrix and the quantification method used. Although the HAdV recoveries determined by qPCR were higher than those determined by PA and ICC-RT-qPCR, PA was defined as the most reproducible method. The qPCR assays were more sensitive than the PA and ICC-RT-qPCR assays; however, this technique alone did not provide information about the viability of the pathogen. ICC-RT-qPCR was more sensitive than PA for detecting infectious particles in fresh produce samples. HAdV genome copies were detected in 93.3% of the analysed naturally contaminated samples, attesting to the common faecal contamination of the fresh produce tested. However, only 33.3% of the total samples were positive for infectious HAdV particles based on ICC-RT-qPCR. In conclusion, this study reported that HAdV can be an efficient viral marker for fresh produce contamination. Good detection of infectious HAdV was obtained with the ICC-RT-qPCR and PA assays. Thus, we suggest that the ICC-RT-qPCR and PA assays should be considered when quantitative

  10. Toxicity and antibacterial assessment of chitosan-coated silver nanoparticles on human pathogens and macrophage cells

    Directory of Open Access Journals (Sweden)

    Jena P

    2012-04-01

    Full Text Available Prajna Jena1, Soumitra Mohanty1, Rojee Mallick1, Biju Jacob2, Avinash Sonawane11School of Biotechnology, KIIT University, Bhubaneswar, Orissa, India; 2Center for Innovation, Technopark Technology Business Incubator, Bangalore, Karnataka, IndiaBackground: Pathogenic bacteria are able to develop various strategies to counteract the bactericidal action of antibiotics. Silver nanoparticles (AgNPs have emerged as a potential alternative to conventional antibiotics because of their potent antimicrobial properties. The purpose of this study was to synthesize chitosan-stabilized AgNPs (CS-AgNPs and test for their cytotoxic, genotoxic, macrophage cell uptake, antibacterial, and antibiofilm activities.Methods: AgNPs were synthesized using chitosan as both a stabilizing and a reducing agent. Antibacterial activity was determined by colony-forming unit assay and scanning electron microscopy. Genotoxic and cytotoxic activity were determined by DNA fragmentation, comet, and MTT [3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide] assays. Cellular uptake and intracellular antibacterial activity were tested on macrophages.Results: CS-AgNPs exhibited potent antibacterial activity against different human pathogens and also impeded bacterial biofilm formation. Scanning electron microscopy analysis indicated that CS-AgNPs kill bacteria by disrupting the cell membrane. CS-AgNPs showed no significant cytotoxic or DNA damage effect on macrophages at the bactericidal dose. Propidium iodide staining indicated active endocytosis of CS-AgNPs resulting in reduced intracellular bacterial survival in macrophages.Conclusion: The present study concludes that at a specific dose, chitosan-based AgNPs kill bacteria without harming the host cells, thus representing a potential template for the design of antibacterial agents to decrease bacterial colonization and to overcome the problem of drug resistance.Keywords: chitosan-silver nanoparticles, antibiofilm, cytotoxicity

  11. Relationship between mastitis causative pathogens and somatic cell counts in milk of dairy cows

    Directory of Open Access Journals (Sweden)

    Sharaf Eldeen Idriss

    2013-12-01

    Full Text Available Milk somatic cell count is a key component of national and international regulation for milk quality and an indicator of udder health and of the prevalence of clinical and subclinical mastitis in dairy herds. The objective of this study was to evaluate the presence of mastitis pathogens in milk samples differed by somatic cell count (SCC in microbiologically positive samples. Also frequency of distribution of samples differed by SCC were studied in non infected samples as well. The milk samples were collected from individual quarters from the dairy farms located in Nitra region with problematic udder health of herd for SCC and bacteriological analysis. Totally, 390 milk samples were examined, and 288 (73.85% positive milk samples were detected. Four SCC groups of samples (400×103 /ml were used to identify presence of microorganisms in positive samples. The most frequently isolated pathogens in samples with high SCC >400×103 /ml according to year were Coagulase-negative Staphylococci (29.11 % in 2012, followed by Staphylococcus aureus (28.0% in 2010, yeasts (24.05% in 2012, Escherichia coli (22.78% in 2012, Bacillus sp. (20% in 2010 and Pseudomonas aerugenosa (11.88% in 2011. Coagulase-negative Staphylococci (66.67% were the predominantly identified in the samples with low SCC <100×103 cells/ml, followed by Bacillus spp (50%, Entrococcus spp. (33.33% and Staphylococcus aureus (16.67% and E. coli (16.67%. The results of this study indicated that the SCC of individual milk samples corresponded with the health status of the udder of dairy cows represented by presence of mastitis microorganisms in milk. However, the contamination of milk samples could be also connected with low SCC. On the ohter side the samples with high SCC were found out without presence of microorganism. The further study is needed to identify the reason of high SCC in milk from negative samples.

  12. Application of antimicrobial-producing lactic acid bacteria to control pathogens in ready-to-use vegetables.

    Science.gov (United States)

    Vescovo, M; Torriani, S; Orsi, C; Macchiarolo, F; Scolari, G

    1996-08-01

    Five psychrotrophic strains of lactic acid bacteria (Lactobacillus casei, Lact. plantarum and Pediococcus spp.) were isolated from 22 samples of commercial salads. These strains were shown to inhibit Aeromonas hydrophila, Listeria monocytogenes, Salmonella typhimurium and Staphylococcus aureus on MRS agar, in salads and in juice prepared from vegetable salads. Lactobacillus casei IMPCLC34 was most effective in reducing total mesophilic bacteria and the coliform group; Aer. hydrophila, Salm. typhimurium and Staph. aureus disappeared after 6 d of storage, while the counts for L. monocytogenes remained constant. The potential application of antimicrobial-producing lactic acid bacteria as biopreservatives of ready-to-use vegetables is suggested. PMID:8760320

  13. The plant pathogen Pantoea ananatis produces N-acylhomoserine lactone and causes center rot disease of onion by quorum sensing.

    Science.gov (United States)

    Morohoshi, Tomohiro; Nakamura, Yuta; Yamazaki, Go; Ishida, Akio; Kato, Norihiro; Ikeda, Tsukasa

    2007-11-01

    A number of gram-negative bacteria have a quorum-sensing system and produce N-acyl-l-homoserine lactone (AHL) that they use them as a quorum-sensing signal molecule. Pantoea ananatis is reported as a common colonist of wheat heads at ripening and causes center rot of onion. In this study, we demonstrated that P. ananatis SK-1 produced two AHLs, N-hexanoyl-l-homoserine lactone (C6-HSL) and N-(3-oxohexanoyl)-l-homoserine lactone (3-oxo-C6-HSL). We cloned the AHL-synthase gene (eanI) and AHL-receptor gene (eanR) and revealed that the deduced amino acid sequence of EanI/EanR showed high identity to those of EsaI/EsaR from P. stewartii. EanR repressed the ean box sequence and the addition of AHLs resulted in derepression of ean box. Inactivation of the chromosomal eanI gene in SK-1 caused disruption of exopolysaccharide (EPS) biosynthesis, biofilm formation, and infection of onion leaves, which were recovered by adding exogenous 3-oxo-C6-HSL. These results demonstrated that the quorum-sensing system involved the biosynthesis of EPS, biofilm formation, and infection of onion leaves in P. ananatis SK-1. PMID:17827290

  14. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1

    OpenAIRE

    Amir Allahverdi; Saied Abroun; Arefeh Jafarian; Masoud Soleimani; Mohammad Taghikhani; Fatemeh Eskandari

    2015-01-01

    Objective: Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs) in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs) are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1) is a master regulator gene required for embryonic development of...

  15. Mouse endometrial stromal cells produce basement-membrane components

    DEFF Research Database (Denmark)

    Wewer, U M; Damjanov, A; Weiss, J;

    1986-01-01

    During mouse pregnancy, uterine stromal cells transform into morphologically distinct decidual cells under the influence of the implanting embryo and a proper hormonal environment. Mechanical stimulation of hormonally primed uterine stromal cells leads to the same morphologic alterations. The....... Mouse decidual cells isolated from 6- to 7-day pregnant uteri explanted in vitro continue to synthesize basement-membrane-like extracellular matrix. Using immunohistochemistry and metabolic labeling followed by immunoprecipitation, SDS-PAGE, and fluorography, it was shown that the decidual cells...... undergo pseudodecidualization. We thus showed that stromal cells from pregnant and nonpregnant mouse uteri synthesize significant amounts of basement-membrane components in vitro, and hence could serve as a good model for the study of normal basement-membrane components....

  16. Extracts from Flammulina velutipes Inhibit the Adhesion of Pathogenic Fungi to Epithelial Cells

    Science.gov (United States)

    Kashina, Svetlana; Villavicencio, Lérida Liss Flores; Balleza, Marco; Sabanero, Gloria Barbosa; Tsutsumi, Víctor; López, Myrna Sabanero

    2016-01-01

    Background: Recently, extracts from natural sources have been tested for their antifungal properties. In this aspect, Flammulina velutipes extracts possess a significant amount of branch-chained carbohydrates with mannose moieties that, hypothetically, can reduce the adhesion. Objective: In this study, we assessed the capacity of extracts from F. velutipes (wild-type AQF-1 and ATCC 34574 as the reference strain) to inhibit the adhesion of S. schenkii and C. albicans to epithelial cells. Materials and Methods: The aqueous extracts from F. velutipes strains were obtained by sonication, total carbohydrate and protein was analyzed by Dubois and Lowry methods respectively. Effect of the extracts (50, 100 and 150 μg/mL) on the fungi adhesion to host cells was evaluated after 1 h interaction, and the percentage of inhibition of adhesion was measured. After of interaction the cytoskeleton from cell was analyzed with phalloidin-FITC. Results: The extract from strain AQF-1 (50, 100 and 150 μg/mL) inhibited the adhesion of: S. schenkii in a dose-dependent manner (4.9, 7.5 and 12.7%, respectively) and C. albicans in a dose-independent manner (5.2%). The percentage of inhibition by extracts from the strain ATCC34574 at the same concentrations, shown that are dose independent for both fungi: 3.9% for S. schenkii and 2.6% for C. albicans. Conclusion: The extracts from F. velutipes inhibit the adhesion of pathogenic fungi to host cells. The mechanism molecular is unknown; however, is probably an interaction between the polysaccharides from extracts with the fungi receptors. This aspect is currently analyzed. SUMMARY The yields of mycelium from two strains of F. velutipes and the extract from it were similar.Extracts from both strains have inhibited adhesion of S. schenkii and C. albicans to epithelial cells in vitro, but the extract from strain AQF-1 was more effective.The extracts have not prevented damage to epithelial cells caused by pathogenic fungi. Abbreviation Used: YPG

  17. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae. PMID:26922490

  18. Regulation and function of innate and adaptive interleukin-17-producing cells

    OpenAIRE

    Hirota, Keiji; Ahlfors, Helena; Duarte, João H.; Stockinger, Brigitta

    2012-01-01

    IL-17-mediated immunity is key for mucosal host defence against a range of pathogens, but can also elicit or aggravate autoimmune and cardiovascular disease, as well as affect tumour formation. The regulation and function of such versatile cells is discussed here.

  19. Targeting insulin-producing beta cells for regenerative therapy.

    Science.gov (United States)

    Migliorini, Adriana; Roscioni, Sara S; Lickert, Heiko

    2016-09-01

    Pancreatic beta cells differ in terms of glucose responsiveness, insulin secretion and proliferative capacity; however, the molecular pathways that regulate this cellular heterogeneity are unknown. We have identified the Wnt-planar cell polarity (PCP) effector Flattop (FLTP) as a biomarker that identifies mature beta cells in the islets of Langerhans. Interestingly, three-dimensional architecture and Wnt-PCP ligands are sufficient to trigger mouse and human beta cell maturation. These results highlight the fact that novel biomarkers shed light on the long-standing mystery of beta cell heterogeneity and identify the Wnt-PCP pathway as triggering beta cell maturation. Understanding heterogeneity in the islets of Langerhans might allow targeting of beta cell subpopulations for regenerative therapy and provide building principles for stem cell-derived islets. This review summarises a presentation given at the 'Can we make a better beta cell?' symposium at the 2015 annual meeting of the EASD. It is accompanied by two other reviews on topics from this symposium (by Amin Ardestani and Kathrin Maedler, DOI: 10.1007/s00125-016-3892-9 , and by Harry Heimberg and colleagues, DOI: 10.1007/s00125-016-3879-6 ) and a commentary by the Session Chair, Shanta Persaud (DOI: 10.1007/s00125-016-3870-2 ). PMID:27412250

  20. Cytokine-producing T cell subsets in human leishmaniasis

    DEFF Research Database (Denmark)

    Kemp, Kåre

    2000-01-01

    Leishmania specific Th1/Th2 cells have been identified in humans as well as in mice. There is a correlation between the clinical outcome of the infection and the cytokine response profile. Generally, the production of Th2 cytokines leads to severe infection, whereas the production of Th1 cytokines...... leads to subclinical or mild infections. In mice, an infection leads to a polarisation of either Th1 or Th2 Leishmania antigen specific cells. In contrast, both Th1 and Th2 Leishmania antigen specific cells can be identified in humans cured from L. donovani infections. Theoretically, Th1 cells and Th2...

  1. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    DEFF Research Database (Denmark)

    Søndergaard, Jonas Nørskov

    society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response...... eradication of the pDCs that is needed to inhibit initial infection. The results presented in this thesis provide novel insights into immune evasion strategies employed by HIV-1 and Mtb. These findings could eventually be utilized for better treatment strategies against AIDS and tuberculosis disease when......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs for...

  2. Gene expression profiling in host-pathogen interactions and identification of the molecular mechanisms involved in dendrictic cells activation

    OpenAIRE

    Torri,, M.

    2009-01-01

    In this thesis we used a functional genomic approach to study host-pathogen interactions [1]. We analyzed the interaction from the host point of view and in particular from the dendritic cells point of view. Dendritic cells (DCs) constitute a heterogeneous group of antigen-presenting leukocytes important in activation of both innate and adaptive immunity [2]. In the first part of this thesis we explored the possibility to use dendritic cell transcriptomes to generate biomarkers of inflamma...

  3. Virulence of an emerging respiratory pathogen, genus Pandoraea, in vivo and its interactions with lung epithelial cells.

    Science.gov (United States)

    Costello, Anne; Herbert, Gillian; Fabunmi, Lydia; Schaffer, Kirsten; Kavanagh, Kevin A; Caraher, Emma M; Callaghan, Máire; McClean, Siobhán

    2011-03-01

    Pandoraea species have emerged as opportunistic pathogens among cystic fibrosis (CF) and non-CF patients. Pandoraea pulmonicola is the predominant Pandoraea species among Irish CF patients. The objective of this study was to investigate the pathogenicity and potential mechanisms of virulence of Irish P. pulmonicola isolates and strains from other Pandoraea species. Three patients from whom the P. pulmonicola isolates were isolated have since died. The in vivo virulence of these and other Pandoraea strains was examined by determining the ability to kill Galleria mellonella larvae. The P. pulmonicola strains generally were the most virulent of the species tested, with three showing a comparable or greater level of virulence in vivo relative to another CF pathogen, Burkholderia cenocepacia, whilst strains from two other species, Pandoraea apista and Pandoraea pnomenusa, were considerably less virulent. For all Pandoraea species, whole cells were required for larval killing, as cell-free supernatants had little effect on larval survival. Overall, invasive Pandoraea strains showed comparable invasion of two independent lung epithelial cell lines, irrespective of whether they had a CF phenotype. Pandoraea strains were also capable of translocation across polarized lung epithelial cell monolayers. Although protease secretion was a common characteristic across the genus, it is unlikely to be involved in pathogenesis. In conclusion, whilst multiple mechanisms of pathogenicity may exist across the genus Pandoraea, it appears that lung cell invasion and translocation contribute to the virulence of P. pulmonicola strains. PMID:21127160

  4. The Hagfish Gland Thread Cell: A Fiber-Producing Cell Involved in Predator Defense

    Directory of Open Access Journals (Sweden)

    Douglas S. Fudge

    2016-05-01

    Full Text Available Fibers are ubiquitous in biology, and include tensile materials produced by specialized glands (such as silks, extracellular fibrils that reinforce exoskeletons and connective tissues (such as chitin and collagen, as well as intracellular filaments that make up the metazoan cytoskeleton (such as F-actin, microtubules, and intermediate filaments. Hagfish gland thread cells are unique in that they produce a high aspect ratio fiber from cytoskeletal building blocks within the confines of their cytoplasm. These threads are elaborately coiled into structures that readily unravel when they are ejected into seawater from the slime glands. In this review we summarize what is currently known about the structure and function of gland thread cells and we speculate about the mechanism that these cells use to produce a mechanically robust fiber that is almost one hundred thousand times longer than it is wide. We propose that a key feature of this mechanism involves the unidirectional rotation of the cell’s nucleus, which would serve to twist disorganized filaments into a coherent thread and impart a torsional stress on the thread that would both facilitate coiling and drive energetic unravelling in seawater.

  5. High prevalence of extended-spectrum β-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India

    Directory of Open Access Journals (Sweden)

    Pathak A

    2012-04-01

    Full Text Available Ashish Pathak1,2, Yogyata Marothi3, Vandana Kekre4, Kalpana Mahadik5, Ragini Macaden6, Cecilia Stålsby Lundborg11Division of Global Health, Department of Public Health Sciences, Karolinska Institutet, Stockholm, Sweden; 2Department of Pediatrics, 3Department of Microbiology, 4Department of Medicine, 5Department of Obstetrics and Gynecology, RD Gardi Medical College, Ujjain, India; 6St Johns Research Institute, Bangalore, IndiaBackground: Recent reports of the rapid evolution of bacterial resistance in India require urgent antibiotic stewardship programs. This study aimed to define the magnitude and pattern of resistance of bacterial pathogens to guide empirical therapy.Methods: We prospectively collected consecutive, clinically significant, and nonduplicate bacterial isolates from each patient from two hospitals in Ujjain, India. The antibiotic susceptibility of the bacteria was tested using a disc diffusion method as recommended by the Clinical and Laboratory Standards Institute.Results: A total of 716 pathogens were isolated from 2568 patients (median age, 25 years; range, 0 days to 92 years. Gram-negative infections were predominant (62%. The isolated pathogens included Staphylococcus aureus (n = 221; 31%, Escherichia coli (n = 149; 21%, Pseudomonas aeruginosa (n = 127; 18%, and Klebsiella pneumoniae (n = 107; 15%. Common diagnoses included abscesses (56%, urinary tract infections (14%, blood stream infections (10%, pneumonia (10%, and vaginal infections (10%. In E. coli isolates, 69% (95% confidence interval [CI] 61.6–76.6 were extended-spectrum β-lactamase (ESBL producers and 41% (95% CI 31.6–50.5 of K. pneumoniae isolates were ESBL producers. These isolates had a high resistance to fluoroquinolones and β-lactams, except for imipenem and piperacillin-tazobactam. Salmonella typhi remained sensitive to third-generation cephalosporins. Methicillin-resistant S. aureus (MRSA constituted 30% of all S. aureus isolates and showed resistance

  6. Memory-Like Antigen-Specific Human NK Cells from TB Pleural Fluids Produced IL-22 in Response to IL-15 or Mycobacterium tuberculosis Antigens

    Science.gov (United States)

    Fu, Xiaoying; Yu, Sifei; Yang, Binyan; Lao, Suihua; Li, Baiqing; Wu, Changyou

    2016-01-01

    Our previous result indicated that memory-like human natural killer (NK) cells from TB pleural fluid cells (PFCs) produced large amounts of IFN-γ in response to Bacille Calmette Guerin (BCG). Furthermore, recent studies have shown that human lymphoid tissues harbored a unique NK cell subset that specialized in production of interleukin (IL)-22, a proinflammatory cytokine that mediates host defense against pathogens. Yet little information was available with regard to the properties of IL-22 production by memory-like human NK cells. In the present study, we found that cytokines IL-15 induced and IL-12 enhanced the levels of IL-22 by NK cells from TB PFCs. In addition, IL-22 but not IL-17 was produced by NK cells from PFCs in response to BCG and M.tb-related Ags. More importantly, the subset of specific IL-22-producing NK cells were distinct from IFN-γ-producing NK cells in PFCs. CD45RO+ or CD45RO- NK cells were sorted, co-cultured with autologous monocytes and stimulated with BCG for the production of IL-22. The result demonstrated that CD45RO+ but not CD45RO- NK cells produced significantly higher level of IL-22. Anti-IL-12Rβ1 mAbs (2B10) partially inhibit the expression of IL-22 by NK cells under the culture with BCG. Consistently, BCG specific IL-22-producing NK cells from PFCs expressed CD45ROhighNKG2Dhighgranzyme Bhigh. In conclusion, our data demonstrated that memory-like antigen-specific CD45RO+ NK cells might participate in the recall immune response for M. tb infection via producing IL-22, which display a critical role to fight against M. tb. PMID:27031950

  7. On the Thermus thermophilus HB8 potential pathogenicity triggered from rhamnolipids secretion: morphological alterations and cytotoxicity induced on fibroblastic cell line.

    Science.gov (United States)

    Pantazaki, A A; Choli-Papadopoulou, T

    2012-05-01

    A limited number of bacterial strains usually grown under nutrient limitation secrete rhamnolipids (RLs), which are recorded as virulence factors that are implicated in the pathogenicity of a microorganism. The non-pathogenic T. thermophilus HB8 produces extracellular rhamnolipids (TthRLs) under defined cultivation conditions using sunflower seed oil and sodium gluconate as carbon sources. In particular, the secreted TthRLs have been isolated, purified and identified with ATR-FTIR. Their effects on the cells' viability were examined when they were supplemented in a culture of human skin fibroblasts. Purified TthRLs triggered a sequence of rapid and pronounced morphological alterations characterized by transformation of fibroblast shape from polygonal to fusiform; retraction with cytoplasm condensation, rounding up, distortion of nuclei and loss of lamellar processes, and finally disruption of membrane. The addition of TthRLs in the cultured fibroblasts caused cytotoxicity, in contrast to that of rhamnose that stimulated viability, as it was assessed by MTT test. These results revealed that among the constituents of RLs that are implicated in the cytotoxicity, it has to be attributed to the lipidic chain variation and not to the carbohydrate part. TthRLs cytotoxicity on fibroblasts is comparable, and provoked similar effects, to that caused by saponin white, a known surfactant. TthRLs secretion might be a crucial point for the transformation of a non-pathogenic bacterium to a pathogenic one under certain environmental conditions favoring their secretion. RLs secretion in the microorganism's world might be a general route for the passage in the pathogenicity to ensure their survival under nutrient limitation conditions. PMID:21611776

  8. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    OpenAIRE

    Barhoom Sima; Nesher Iris; Sharon Amir

    2008-01-01

    Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria forma...

  9. Cyanobacteria as Cell Factories to Produce Plant Secondary Metabolites

    OpenAIRE

    Xue, Yong; He, Qingfang

    2015-01-01

    Cyanobacteria represent a promising platform for the production of plant secondary metabolites. Their capacity to express plant P450 proteins, which have essential functions in the biosynthesis of many plant secondary metabolites, makes cyanobacteria ideal for this purpose, and their photosynthetic capability allows cyanobacteria to grow with simple nutrient inputs. This review summarizes the advantages of using cyanobacteria to transgenically produce plant secondary metabolites. Some techniq...

  10. Integrating Wind And Solar With Hydrogen Producing Fuel Cells

    NARCIS (Netherlands)

    Hemmes, K.

    2007-01-01

    The often proposed solution for the fluctuating wind energy supply is the conversion of the surplus of wind energy into hydrogen by means of electrolysis. In this paper a patented alternative is proposed consisting of the integration of wind turbines with internal reforming fuel-cells, capable of co

  11. Small GTPases promote actin coat formation on microsporidian pathogens traversing the apical membrane of Caenorhabditis elegans intestinal cells.

    Science.gov (United States)

    Szumowski, Suzannah C; Estes, Kathleen A; Popovich, John J; Botts, Michael R; Sek, Grace; Troemel, Emily R

    2016-01-01

    Many intracellular pathogens co-opt actin in host cells, but little is known about these interactions in vivo. We study the in vivo trafficking and exit of the microsporidian Nematocida parisii, which is an intracellular pathogen that infects intestinal cells of the nematode Caenorhabditis elegans. We recently demonstrated that N. parisii uses directional exocytosis to escape out of intestinal cells into the intestinal tract. Here, we show that an intestinal-specific isoform of C. elegans actin called ACT-5 forms coats around membrane compartments that contain single exocytosing spores, and that these coats appear to form after fusion with the apical membrane. We performed a genetic screen for host factors required for actin coat formation and identified small GTPases important for this process. Through analysis of animals defective in these factors, we found that actin coats are not required for pathogen exit although they may boost exocytic output. Later during infection, we find that ACT-5 also forms coats around membrane-bound vesicles that contain multiple spores. These vesicles are likely formed by clathrin-dependent compensatory endocytosis to retrieve membrane material that has been trafficked to the apical membrane as part of the exocytosis process. These findings provide insight into microsporidia interaction with host cells, and provide novel in vivo examples of the manner in which intracellular pathogens co-opt host actin during their life cycle. PMID:26147591

  12. Cell wall modifications during conidial maturation of the human pathogenic fungus Pseudallescheria boydii.

    Science.gov (United States)

    Ghamrawi, Sarah; Rénier, Gilles; Saulnier, Patrick; Cuenot, Stéphane; Zykwinska, Agata; Dutilh, Bas E; Thornton, Christopher; Faure, Sébastien; Bouchara, Jean-Philippe

    2014-01-01

    Progress in extending the life expectancy of cystic fibrosis (CF) patients remains jeopardized by the increasing incidence of fungal respiratory infections. Pseudallescheria boydii (P. boydii), an emerging pathogen of humans, is a filamentous fungus frequently isolated from the respiratory secretions of CF patients. It is commonly believed that infection by this fungus occurs through inhalation of airborne conidia, but the mechanisms allowing the adherence of Pseudallescheria to the host epithelial cells and its escape from the host immune defenses remain largely unknown. Given that the cell wall orchestrates all these processes, we were interested in studying its dynamic changes in conidia as function of the age of cultures. We found that the surface hydrophobicity and electronegative charge of conidia increased with the age of culture. Melanin that can influence the cell surface properties, was extracted from conidia and estimated using UV-visible spectrophotometry. Cells were also directly examined and compared using electron paramagnetic resonance (EPR) that determines the production of free radicals. Consistent with the increased amount of melanin, the EPR signal intensity decreased suggesting polymerization of melanin. These results were confirmed by flow cytometry after studying the effect of melanin polymerization on the surface accessibility of mannose-containing glycoconjugates to fluorescent concanavalin A. In the absence of melanin, conidia showed a marked increase in fluorescence intensity as the age of culture increased. Using atomic force microscopy, we were unable to find rodlet-forming hydrophobins, molecules that can also affect conidial surface properties. In conclusion, the changes in surface properties and biochemical composition of the conidial wall with the age of culture highlight the process of conidial maturation. Mannose-containing glycoconjugates that are involved in immune recognition, are progressively masked by polymerization of

  13. Effects of TFAR19 gene on the in vivo biorheological properties and pathogenicity of mouse erythroleukemia cell line MEL

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    After injecting VP16, MEL cells and MEL-TF19 cells into the body of mice, with those injected with the same dose of saline as the control group, we observed the mice for their blood pictures, histological changes of the liver and spleen, and the hemorhelogical indexes within 4 weeks. The results indicated that after injecting MEL cells, the mice entered into a pathological status similar to erythroleukemia, which had the following exhibitions: the tissue structures of the liver and spleen were damaged, a mass of proerythroblasts, basophil erythroblasts and polychromatophilic erythroblasts could be observed on the smears of the bone marrow and spleen, and the deformability and orientation ability of erythrocytes were both depressed. The pathogenicity of MEL-TF19 cells carrying TFAR19 gene was obviously lower than that of MEL cells, and the MEL-TF19 cells even lost their faintish pathogenicity under the apop-tosis-inducing effect of the chemotherapeutic reagent. The outcome from the animal experiments suggests that the TFAR19 gene suppresses the pathogenicity of MEL cells to the mice, and the effect may be better exerted with the synergy of the chemotherapeutic reagent.

  14. Characterization of the Inflammasome in Human Kupffer Cells in Response to Synthetic Agonists and Pathogens.

    Science.gov (United States)

    Zannetti, Claudia; Roblot, Guillaume; Charrier, Emily; Ainouze, Michelle; Tout, Issam; Briat, François; Isorce, Nathalie; Faure-Dupuy, Suzanne; Michelet, Maud; Marotel, Marie; Kati, Semra; Schulz, Thomas F; Rivoire, Michel; Traverse-Glehen, Alexandra; Luangsay, Souphalone; Alatiff, Omran; Henry, Thomas; Walzer, Thierry; Durantel, David; Hasan, Uzma

    2016-07-01

    The liver is the largest gland in the human body and functions as an innate immune organ. Liver macrophages called Kupffer cells (KC) constitute the largest group of macrophages in the human body. Innate immune responses involving KC represent the first line of defense against pathogens in the liver. Human monocyte-derived macrophages have been used to characterize inflammasome responses that lead to the release of the proinflammatory cytokines IL-1β and IL-18, but it has not yet been determined whether human KC contain functional inflammasomes. We show, to our knowledge for the first time, that KC express genes and proteins that make up several different inflammasome complexes. Moreover, activation of KC in response to the absent in melanoma 2 (AIM2) inflammasome led to the production of IL-1β and IL-18, which activated IL-8 transcription and hepatic NK cell activity, respectively. Other inflammasome responses were also activated in response to selected bacteria and viruses. However, hepatitis B virus inhibited the AIM2 inflammasome by reducing the mRNA stability of IFN regulatory factor 7, which regulated AIM2 transcription. These data demonstrate the production of IL-1β and IL-18 in KC, suggesting that KC contain functional inflammasomes that could be important players in the innate immune response following certain infections of the liver. We think our findings could potentially aid therapeutic approaches against chronic liver diseases that activate the inflammasome. PMID:27226092

  15. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa.

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M

    2016-01-01

    Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa. PMID:27492542

  16. The impact of hypoxia on intestinal epithelial cell functions: consequences for invasion by bacterial pathogens.

    Science.gov (United States)

    Zeitouni, Nathalie E; Chotikatum, Sucheera; von Köckritz-Blickwede, Maren; Naim, Hassan Y

    2016-12-01

    The maintenance of oxygen homeostasis in human tissues is mediated by several cellular adaptations in response to low-oxygen stress, called hypoxia. A decrease in tissue oxygen levels is initially counteracted by increasing local blood flow to overcome diminished oxygenation and avoid hypoxic stress. However, studies have shown that the physiological oxygen concentrations in several tissues are much lower than atmospheric (normoxic) conditions, and the oxygen supply is finely regulated in individual cell types. The gastrointestinal tract has been described to subsist in a state of physiologically low oxygen level and is thus depicted as a tissue in the state of constant low-grade inflammation. The intestinal epithelial cell layer plays a vital role in the immune response to inflammation and infections that occur within the intestinal tissue and is involved in many of the adaptation responses to hypoxic stress. This is especially relevant in the context of inflammatory disorders, such as inflammatory bowel disease (IBD). Therefore, this review aims to describe the intestinal epithelial cellular response to hypoxia and the consequences for host interactions with invading gastrointestinal bacterial pathogens. PMID:27002817

  17. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Directory of Open Access Journals (Sweden)

    Andrew S Brown

    2016-06-01

    Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  18. Differentiation of insulin-producing cells from human neural progenitor cells.

    Directory of Open Access Journals (Sweden)

    Yuichi Hori

    2005-04-01

    Full Text Available BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals that regulate in vivo pancreatic islet development, form clusters of glucose-responsive insulin-producing cells (IPCs. During in vitro differentiation of neural progenitor cells with this novel method, genes encoding essential known in vivo regulators of pancreatic islet development were expressed. Following transplantation into immunocompromised mice, IPCs released insulin C-peptide upon glucose challenge, remained differentiated, and did not form detectable tumors. CONCLUSION: Production of IPCs solely through extracellular factor modulation in the absence of genetic manipulations may promote strategies to derive transplantable islet-replacement tissues from human neural progenitor cells and other types of multipotent human stem cells.

  19. Prevention of Immunodeficiency Virus induced CD4+ T-Cell depletion by prior infection with a non-pathogenic virus

    OpenAIRE

    Terwee, Julie A.; Carlson, Jennifer K.; Sprague, Wendy S.; Sondgeroth, Kerry S.; Shropshire, Sarah B.; Troyer, Jennifer L.; VandeWoude, Sue

    2008-01-01

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIVPCO) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is no...

  20. Lon Protease Activity Causes Down-Regulation of Salmonella Pathogenicity Island 1 Invasion Gene Expression after Infection of Epithelial Cells

    OpenAIRE

    Boddicker, Jennifer D.; Jones, Bradley D.

    2004-01-01

    Salmonella enterica serovar Typhimurium causes self-limiting gastroenteritis in humans and a typhoid-like disease in mice that serves as a model for typhoid infections in humans. A critical step in Salmonella pathogenesis is the invasion of enterocytes and M cells of the small intestine via expression of a type III secretion system, encoded on Salmonella pathogenicity island 1 (SPI-1), that secretes effector proteins into host cells, leading to engulfment of the bacteria within large membrane...

  1. Regulatory network modelling of iron acquisition by a fungal pathogen in contact with epithelial cells

    Directory of Open Access Journals (Sweden)

    Guthke Reinhard

    2010-11-01

    Full Text Available Abstract Background Reverse engineering of gene regulatory networks can be used to predict regulatory interactions of an organism faced with environmental changes, but can prove problematic, especially when focusing on complicated multi-factorial processes. Candida albicans is a major human fungal pathogen. During the infection process, this fungus is able to adapt to conditions of very low iron availability. Such adaptation is an important virulence attribute of virtually all pathogenic microbes. Understanding the regulation of iron acquisition genes will extend our knowledge of the complex regulatory changes during the infection process and might identify new potential drug targets. Thus, there is a need for efficient modelling approaches predicting key regulatory events of iron acquisition genes during the infection process. Results This study deals with the regulation of C. albicans iron uptake genes during adhesion to and invasion into human oral epithelial cells. A reverse engineering strategy is presented, which is able to infer regulatory networks on the basis of gene expression data, making use of relevant selection criteria such as sparseness and robustness. An exhaustive use of available knowledge from different data sources improved the network prediction. The predicted regulatory network proposes a number of new target genes for the transcriptional regulators Rim101, Hap3, Sef1 and Tup1. Furthermore, the molecular mode of action for Tup1 is clarified. Finally, regulatory interactions between the transcription factors themselves are proposed. This study presents a model describing how C. albicans may regulate iron acquisition during contact with and invasion of human oral epithelial cells. There is evidence that some of the proposed regulatory interactions might also occur during oral infection. Conclusions This study focuses on a typical problem in Systems Biology where an interesting biological phenomenon is studied using a small

  2. Human Dendritic Cells Induce the Differentiation of Interleukin-21-producing T Follicular Helper-like Cells through Interleukin-12

    Science.gov (United States)

    Schmitt, Nathalie; Morita, Rimpei; Bourdery, Laure; Bentebibel, Salah Eddine; Zurawski, Sandra M.; Banchereau, Jacques; Ueno, Hideki

    2009-01-01

    Summary T follicular helper (Tfh) cells help development of antibody responses via Interleukin-21 (IL-21). Here we show that activated human dendritic cells (DCs) induced naïve CD4+ T cells to become IL-21-producing Tfh-like cells through IL-12. CD4+ T cells primed with IL-12 induced B cells to produce immunoglobulins in a fashion dependent on IL-21 and inducible costimulator (ICOS), thus sharing fundamental characteristics with Tfh cells. The induction of Tfh-like cells by activated DCs was inhibited by neutralizing IL-12. IL-12 induced two different IL-21-producers: IL-21+IFN-γ+T-bet+ Th1 cells and IL-21+IFN-γ-T-bet- non-Th1 cells, in a manner dependent on signal transducer and activator of transcription (STAT)4. IL-12 also regulated IL-21 secretion by memory CD4+ T cells. Thus, IL-12 produced by activated DCs regulates antibody responses via developing IL-21-producing Tfh-like cells, and inducing IL-21 secretion from memory CD4+ T cells. These data suggest that the developmental pathway of Tfh cells differs between mice and humans, which have considerable implications for vaccine development. PMID:19592276

  3. NK Cell-Mediated Regulation of Protective Memory Responses against Intracellular Ehrlichial Pathogens.

    Directory of Open Access Journals (Sweden)

    Samar Habib

    Full Text Available Ehrlichiae are gram-negative obligate intracellular bacteria that cause potentially fatal human monocytic ehrlichiosis. We previously showed that natural killer (NK cells play a critical role in host defense against Ehrlichia during primary infection. However, the contribution of NK cells to the memory response against Ehrlichia remains elusive. Primary infection of C57BL/6 mice with Ehrlichia muris provides long-term protection against a second challenge with the highly virulent Ixodes ovatus Ehrlichia (IOE, which ordinarily causes fatal disease in naïve mice. Here, we show that the depletion of NK cells in E. muris-primed mice abrogates the protective memory response against IOE. Approximately, 80% of NK cell-depleted E. muris-primed mice succumbed to lethal IOE infection on days 8-10 after IOE infection, similar to naïve mice infected with the same dose of IOE. The lack of a recall response in NK cell-depleted mice correlated with an increased bacterial burden, extensive liver injury, decreased frequency of Ehrlichia-specific IFN-γ-producing memory CD4+ and CD8+ T-cells, and a low titer of Ehrlichia-specific antibodies. Intraperitoneal infection of mice with E. muris resulted in the production of IL-15, IL-12, and IFN-γ as well as an expansion of activated NKG2D+ NK cells. The adoptive transfer of purified E. muris-primed hepatic and splenic NK cells into Rag2-/-Il2rg-/- recipient mice provided protective immunity against challenge with E. muris. Together, these data suggest that E. muris-induced memory-like NK cells, which contribute to the protective, recall response against Ehrlichia.

  4. The insect pathogen Serratia marcescens Db10 uses a hybrid non-ribosomal peptide synthetase-polyketide synthase to produce the antibiotic althiomycin.

    Directory of Open Access Journals (Sweden)

    Amy J Gerc

    Full Text Available There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1-alb6. Bioinformatic analysis of the proteins encoded by alb1-6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS assembly line (Alb4/5/6, tailoring enzymes (Alb2/3 and an export/resistance protein (Alb1, and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2-Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism.

  5. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk;

    1988-01-01

    Cross-culture contamination of cell lines propagated in continuous culture is a frequent event and particularly difficult to resolve in cells expressing similar phenotypes. We demonstrate that DNA-DNA hybridization to blotted endonuclease-digested cell DNA effectively detects cross-culture contam...... effective use of gene probes to control the origin of cell cultures.......Cross-culture contamination of cell lines propagated in continuous culture is a frequent event and particularly difficult to resolve in cells expressing similar phenotypes. We demonstrate that DNA-DNA hybridization to blotted endonuclease-digested cell DNA effectively detects cross......-culture contamination to monitor inter-species as well as intra-species cross contamination. An insulin-producing cell-line, Clone-16, originally cloned from a human fetal endocrine pancreatic cell line did not produce human c-peptide as anticipated. DNA from these cells showed no hybridization to the human ALU...

  6. Enhancement of insulin-producing cell differentiation from embryonic stem cells using pax4-nucleofection method

    Institute of Scientific and Technical Information of China (English)

    Han-Tso Lin; Hung-Hai Ku; Chung-Lan Kao; Kun-Hsiung Lee; Yuh-Lih Chang; Shih-Hwa Chiou; Fu-Ting Tsai; Tung-Hu Tsai; Dey-Chyi Sheu; Larry LT Ho

    2007-01-01

    AIM: To enhance the differentiation of insulin producing cell (IPC) ability from embryonic stem (ES) cells in vitro.METHODS: Four-day embryoid body (EB)-formatted ES cells were dissociated as single cells for the followed plasmid DNA delivery. The use of Nucleofector- Electroporator (Amaxa biosystems, Germany) in combination with medium-contained G418 provided a high efficiency of gene delivery for advanced selection. Neucleofected cells were plated on the top of fibronectin coated Petri dishes. Addition of Ly294002 and raised the glucose in medium at 24 h before examination.The differentiation status of these cells was monitored by semi-quantitative PCR (SQ-PCR) detection of the expression of relative genes, such as oct-4, sox-17, foxa2, mixl1, pdx-1, insulin 1, glucagons and somatostatin. The percentage of IPC population on d 18 of the experiment was investigated by immunohistochemistry (IHC), and the content/secretion of insulin was estimated by ELISA assay. The mice with severe combined immunodeficiency disease (SCID) pretreated with streptozotocin (STZ) were used to eliminate plasma glucose restoration after pax4+ ES implantation.RESULTS: A high efficiency of gene delivery was demonstrated when neucleofection was used in the present study; approximately 70% cells showed DsRed expression 2 d after neucleofection. By selection of medium-contained G418, the percentage of DsRed expressing cells kept high till the end of study. The pancreatic differentiation seemed to be accelerated by pax4 nucleofection. When compared to the group of cells with mock control, foxa2, mixl1, pdx1, higher insulin and somatostatin levels were detected by SQ-PCR 4 d after nucleofection in the group of pax4 expressing plasmid delivery. Approximately 55% of neucleofected cells showed insulin expression 18 d after neucleofection, and only 18% of cells showed insulin expression in mock control. The disturbance was shown by nucleofected pax4 RNAi vector; only 8% of cells expressed insulin 18

  7. C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

    Directory of Open Access Journals (Sweden)

    Ning Ma

    Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

  8. Antibacterial activity of Green Seaweed Caulerpa racemosa from Takalar Waters against pathogenic bacteria promoting ice-ice diseases in the agar-producing red algae Gracilaria verrucosa.

    OpenAIRE

    Zainuddin, Elmi Nurhaidah; Anshary, Hilal; Huyyirnah; Hiola, Ridha

    2012-01-01

    The Ice-ice disease caused by bacterial pathogens which attack the algae tissue resulted white and brittle of seaweed thallus on red seaweed Gracilaria verrucosa farming. Study of antibacterial activity of green seaweed Caulerpa racemosa against the pathogens has been done using method include isolation of bacteria, pathogenicity test with Koch's postulates method, characterization of ice-ice bacteria, extraction of Caulerpa racemosa, and antibacterial test by agar diffusion method. The res...

  9. Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

    Directory of Open Access Journals (Sweden)

    Soares-Silveira Alda

    2002-07-01

    Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

  10. Transcriptional control of fungal cell cycle and cellular events by Fkh2, a forkhead transcription factor in an insect pathogen

    OpenAIRE

    Wang, Juan-juan; Qiu, Lei; Cai, Qing; Ying, Sheng-Hua; Feng, Ming-Guang

    2015-01-01

    Transcriptional control of the cell cycle by forkhead (Fkh) transcription factors is likely associated with fungal adaptation to host and environment. Here we show that Fkh2, an ortholog of yeast Fkh1/2, orchestrates cell cycle and many cellular events of Beauveria bassiana, a filamentous fungal insect pathogen. Deletion of Fkh2 in B. bassiana resulted in dramatic down-regulation of the cyclin-B gene cluster and hence altered cell cycle (longer G2/M and S, but shorter G0/G1, phases) in unicel...

  11. Atypical and classical memory B cells produce Plasmodium falciparum neutralizing antibodies

    DEFF Research Database (Denmark)

    Muellenbeck, Matthias F; Ueberheide, Beatrix; Amulic, Borko;

    2013-01-01

    . We show at the single cell level that natural Pf infection induces the development of classical memory B cells (CM) and atypical memory B cells (AtM) that produce broadly neutralizing antibodies against blood stage Pf parasites. CM and AtM contribute to anti-Pf serum IgG production, but only AtM show...

  12. SCR96, a small cysteine-rich secretory protein of Phytophthora cactorum, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance.

    Science.gov (United States)

    Chen, Xiao-Ren; Li, Yan-Peng; Li, Qi-Yuan; Xing, Yu-Ping; Liu, Bei-Bei; Tong, Yun-Hui; Xu, Jing-You

    2016-05-01

    Peptides and small molecules produced by both the plant pathogen Phytophthora and host plants in the apoplastic space mediate the relationship between the interplaying organisms. Various Phytophthora apoplastic effectors, including small cysteine-rich (SCR) secretory proteins, have been identified, but their roles during interaction remain to be determined. Here, we identified an SCR effector encoded by scr96, one of three novel genes encoding SCR proteins in P. cactorum with similarity to the P. cactorum phytotoxic protein PcF. Together with the other two genes, scr96 was transcriptionally induced throughout the developmental and infection stages of the pathogen. These genes triggered plant cell death (PCD) in the Solanaceae, including Nicotiana benthamiana and tomato. The scr96 gene did not show single nucleotide polymorphisms in a collection of P. cactorum isolates from different countries and host plants, suggesting that its role is essential and non-redundant during infection. Homologues of SCR96 were identified only in oomycetes, but not in fungi and other organisms. A stable protoplast transformation protocol was adapted for P. cactorum using green fluorescent protein as a marker. The silencing of scr96 in P. cactorum caused gene-silenced transformants to lose their pathogenicity on host plants and these transformants were significantly more sensitive to oxidative stress. Transient expression of scr96 partially recovered the virulence of gene-silenced transformants on plants. Overall, our results indicate that the P. cactorum scr96 gene encodes an important virulence factor that not only causes PCD in host plants, but is also important for pathogenicity and oxidative stress tolerance. PMID:26307454

  13. Immune competence of the mammary gland as affected by somatic cell and pathogenic bacteria in ewes with subclinical mastitis.

    Science.gov (United States)

    Albenzio, M; Santillo, A; Caroprese, M; Ruggieri, D; Ciliberti, M; Sevi, A

    2012-07-01

    Immune competence of the ewe mammary gland was investigated by monitoring the leukocyte differential count, cytokine pattern, and endogenous proteolytic enzymes in milk samples with different somatic cell counts (SCC) and pathogenic bacteria. Furthermore, the leukocyte differential count and T-lymphocyte populations were evaluated in ewe blood. A total of 1,500 individual milk samples were randomly selected from the pool of the samples collected during sampling and grouped into 5 classes of 300 samples each, on the basis of SCC. Classes were 2,000,000 cells/mL. Microbiological analyses of ewe milk were conducted to detect mastitis-related pathogens. Sheep whose udders were without clinical abnormalities, and whose milk was apparently normal but with at least 10(3)cfu/mL of the same pathogen were considered to have subclinical mastitis and therefore defined as infected. Polymorphonuclear neutrophilic leukocytes (PMNL) and macrophages increased with SCC, whereas lymphocytes decreased. Milk samples with SCC >1,000,000 cells/mL showed differences in leukocyte populations between uninfected and infected ewes, with higher percentages of PMNL and macrophages and lower percentages of lymphocytes in infected animals. Nonviable PMNL levels were the highest in ewe milk samples with SCC 500,000 cells/mL, nonviable PMNL were higher in uninfected ewes than in infected ones. In infected animals giving milk with SCC >1,000,000 cells/mL, a higher CD4(+)/CD8(+) ratio was observed, suggesting that the presence of pathogens induced an activation of both CD4(+) and CD8(+). The levels of tumor necrosis factor-α and IL-12 were higher in infected than uninfected ewes, irrespective of SCC. Plasmin activity increased along with SCC and was always higher in infected than uninfected animals; cathepsin D increased starting from 1,001,000 cells/mL in milk samples from noninfected ewes and starting from 301,000 cells/mL in milk samples from infected animals. The associations between somatic

  14. Arginase I–Producing Myeloid-Derived Suppressor Cells in Renal Cell Carcinoma Are a Subpopulation of Activated Granulocytes

    OpenAIRE

    Rodriguez, Paulo C.; Ernstoff, Marc S; Hernandez, Claudia; Atkins, Michael; Zabaleta, Jovanny; Sierra, Rosa; Ochoa, Augusto C.

    2009-01-01

    Myeloid-derived suppressor cells (MDSC) producing arginase I are increased in the peripheral blood of patients with renal cell carcinoma (RCC). MDSC inhibit T-cell function by reducing the availability of l-arginine and are therefore considered an important tumor escape mechanism. We aimed to determine the origin of arginase I–producing MDSC in RCC patients and to identify the mechanisms used to deplete extracellular l-arginine. The results show that human MDSC are a subpopulation of activate...

  15. Tc17 cells are a proinflammatory, plastic lineage of pathogenic CD8+ T cells that induce GVHD without antileukemic effects.

    Science.gov (United States)

    Gartlan, Kate H; Markey, Kate A; Varelias, Antiopi; Bunting, Mark D; Koyama, Motoko; Kuns, Rachel D; Raffelt, Neil C; Olver, Stuart D; Lineburg, Katie E; Cheong, Melody; Teal, Bianca E; Lor, Mary; Comerford, Iain; Teng, Michele W L; Smyth, Mark J; McCluskey, James; Rossjohn, Jamie; Stockinger, Brigitta; Boyle, Glen M; Lane, Steven W; Clouston, Andrew D; McColl, Shaun R; MacDonald, Kelli P A; Hill, Geoffrey R

    2015-09-24

    IL-17-producing cells are important mediators of graft-versus-host disease (GVHD) after allogeneic stem cell transplantation (SCT). Here we demonstrate that a distinct CD8(+) Tc17 population develops rapidly after SCT but fails to maintain lineage fidelity such that they are unrecognizable in the absence of a fate reporter. Tc17 differentiation is dependent on alloantigen presentation by host dendritic cells (DCs) together with IL-6. Tc17 cells express high levels of multiple prototypic lineage-defining transcription factors (eg, RORγt, T-bet) and cytokines (eg, IL-17A, IL-22, interferon-γ, granulocyte macrophage colony-stimulating factor, IL-13). Targeted depletion of Tc17 early after transplant protects from lethal acute GVHD; however, Tc17 cells are noncytolytic and fail to mediate graft-versus-leukemia (GVL) effects. Thus, the Tc17 differentiation program during GVHD culminates in a highly plastic, hyperinflammatory, poorly cytolytic effector population, which we term "inflammatory iTc17" (iTc17). Because iTc17 cells mediate GVHD without contributing to GVL, therapeutic inhibition of iTc17 development in a clinical setting represents an attractive approach for separating GVHD and GVL. PMID:26206951

  16. The Chinese highly pathogenic porcine reproductive and respiratory syndrome virus infection suppresses Th17 cells response in vivo.

    Science.gov (United States)

    Zhang, Long; Zhou, Lei; Ge, Xinna; Guo, Xin; Han, Jun; Yang, Hanchun

    2016-06-30

    Porcine reproductive and respiratory syndrome virus (PRRSV) has been shown to immunomodulate innate and adaptive immunity of pigs. The Chinese highly pathogenic PRRSV (HP-PRRSV) infection causes severe bacterial secondary infection in pigs. However, the mechanism in relation to the bacterial secondary infection induced by HP-PRRSV remains unknown. In the present study, Th17 cells response in peripheral blood, lungs, spleens and lymph nodes of piglets were analyzed, and bacterial loads in lungs of piglets were examined upon HP-PRRSV infection. Meanwhile the changes of CD4(+) and CD8(+) T cells in peripheral blood of the inoculated piglets were analyzed. The results showed that HP-PRRSV-inoculated piglets exhibited a suppressed Th17 cells response in peripheral blood and a reduced number of Th17 cells in lungs, and higher bacterial loads in lungs, compared with low pathogenic PRRSV. Moreover, HP-PRRSV obviously resulted in severe depletion of porcine T cells in peripheral blood at the early stage of infection. These findings indicate that HP-PRRSV infection suppresses the response of Th17 cells that play an important role in combating bacterial infections, suggesting a possible correlation between the suppression of Th17 cells response in vivo and bacterial secondary infection induced by HP-PRRSV. Our present study adds a novel insight into better understanding of the pathogenesis of the Chinese HP-PRRSV. PMID:27259830

  17. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  18. Evidence of a pathogenic role for CD8+ T cells in anti-GABAB receptor limbic encephalitis

    Science.gov (United States)

    Golombeck, Kristin S.; Bönte, Kathrin; Mönig, Constanze; van Loo, Karen M.; Hartwig, Marvin; Schwindt, Wolfram; Widman, Guido; Lindenau, Matthias; Becker, Albert J.; Glatzel, Markus; Elger, Christian E.; Wiendl, Heinz; Meuth, Sven G.; Lohmann, Hubertus; Gross, Catharina C.

    2016-01-01

    Objectives: To characterize the cellular autoimmune response in patients with γ-aminobutyric acid (GABA)B receptor antibody–associated limbic encephalitis (GABAB-R LE). Methods: Patients underwent MRI, extensive neuropsychological assessment, and multiparameter flow cytometry of peripheral blood and CSF. Results: We identified a series of 3 cases of nonparaneoplastic GABAB-R LE and one case of paraneoplastic GABAB-R LE associated with small cell lung cancer. All patients exhibited temporal lobe epilepsy, neuropsychological deficits, and MRI findings typical of LE. Absolute numbers of CD19+ B cells, CD138+ CD19+ plasma cells, CD4+ T cells, activated HLADR+ CD4+ T cells, as well as CD8+ T cells and HLADR+ CD8+ T cells did not differ in peripheral blood but were elevated in CSF of patients with GABAB-R LE compared to controls. Augmented absolute numbers of CD138+ CD19+ plasma cells and activated HLADR+ CD8+ T cells in CSF corresponded to higher overall neuropsychological and memory deficits in patients with GABAB-R LE. A histologic specimen of one patient following selective amygdalohippocampectomy revealed perivascular infiltrates of CD138+ plasma cells and CD4+ T cells, whereas cytotoxic CD8+ T cells were detected within the brain parenchyma in close contact to neurons. Conclusion: Our data suggest a pathogenic role for CD8+ T cells in addition to the established role of plasma cell–derived autoantibodies in GABAB-R LE. PMID:27213174

  19. Pathogenic Role of NKT and NK Cells in Acetaminophen-Induced Liver Injury is Dependent on the Presence of DMSO

    OpenAIRE

    Masson, Mary Jane; Carpenter, Leah D.; Graf, Mary L.; Pohl, Lance R.

    2008-01-01

    Dimethyl sulfoxide (DMSO) is commonly used in biological studies to dissolve drugs and enzyme inhibitors with low solubility. While DMSO is generally thought of as being relatively inert, it can induce biological effects that are often overlooked. An example highlighting this potential problem is found in the recent report demonstrating a pathogenic role for NKT and NK cells in acetaminophen-induced liver injury (AILI) in C57Bl/6 mice in which DMSO was used to facilitate APAP dissolution. We ...

  20. Evaluation of a Rapid, Quantitative Real-Time PCR Method for Enumeration of Pathogenic Candida Cells in Water

    OpenAIRE

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one ...

  1. The Salmochelin Siderophore Receptor IroN Contributes to Invasion of Urothelial Cells by Extraintestinal Pathogenic Escherichia coli In Vitro▿

    OpenAIRE

    Feldmann, Friederike; Sorsa, Liisa Johanna; Hildinger, Kirsten; Schubert, Sören

    2007-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) strains possess several siderophore-dependent iron uptake systems. In this study we demonstrated that the salmochelin siderophore receptor IroN is involved in the invasion of urothelial cells by ExPEC in vitro. Thus, IroN may play a dual role in the establishment of urinary tract infections, displaying an iron uptake receptor as well as an internalization factor.

  2. Pleural mesothelial cells promote expansion of IL-17-producing CD8+ T cells in tuberculous pleural effusion.

    Science.gov (United States)

    Li, X; Zhou, Q; Yang, W B; Xiong, X Z; Du, R H; Zhang, J C

    2013-05-01

    IL-17-producing CD8(+) T lymphocytes (Tc17 cells) have recently been detected in many cancers and autoimmune diseases. However, the possible implication of Tc17 cells in tuberculous pleural effusion remains unclarified. In this study, distribution and phenotypic features of Tc17 cells in both tuberculous pleural effusion (TPE) and peripheral blood from patients with tuberculosis were determined. The effects of proinflammatory cytokines and local accessory cells (pleural mesothelial cells) on Tc17 cell expansion were also explored. We found that TPE contained more Tc17 cells than the blood. Compared with IFN-γ-producing CD8(+) T cells, Tc17 cells displayed higher expression of chemokine receptors (CCRs) and lower expression of cytotoxic molecules. In particularly, Tc17 cells in TPE exhibited high expression levels of CCR6, which could migrate in response to CCL20. Furthermore, IL-1β, IL-6, IL-23, or their various combinations could promote Tc17 cell expansion from CD8(+) T cells, whereas the proliferative response of Tc17 cells to above cytokines was lower than that of Th17 cells. Pleural mesothelial cells (PMCs) were able to stimulate Tc17 cell expansion via cell contact in an IL-1β/IL-6/IL-23 independent fashion. Thus this study demonstrates that Tc17 cells marks a subset of non-cytotoxic, CCR6(+) CD8(+) T lymphocytes with low proliferative capacity. The overrepresentation of Tc17 cells in TPE may be due to Tc17 cell expansion stimulated by pleural proinflammatory cytokines and to recruitment of Tc17 cells from peripheral blood. Additionally, PMCs may promote the production of IL-17 by CD8(+) T cells at sites of TPE via cell-cell interactions. PMID:23299924

  3. Differentiation of human labia minora dermis-derived fibroblasts into insulin-producing cells

    OpenAIRE

    Kim, Bona; Yoon, Byung Sun; Moon, Jai-Hee; Kim, Jonggun; Jun, Eun Kyoung; Lee, Jung Han; Kim, Jun Sung; Baik, Cheong Soon; Kim, Aeree; Whang, Kwang Youn; You, Seungkwon

    2011-01-01

    Recent evidence has suggested that human skin fibroblasts may represent a novel source of therapeutic stem cells. In this study, we report a 3-stage method to induce the differentiation of skin fibroblasts into insulin-producing cells (IPCs). In stage 1, we establish the isolation, expansion and characterization of mesenchymal stem cells from human labia minora dermis-derived fibroblasts (hLMDFs) (stage 1: MSC expansion). hLMDFs express the typical mesenchymal stem cell marker proteins and ca...

  4. Mechanisms underlying the toxicity of lactone aroma compounds towards the producing yeast cells

    OpenAIRE

    Aguedo, Mario; Beney, L.; Waché, Y.; Belin, J.-M.

    2003-01-01

    Aims: To study the fundamental mechanisms of toxicity of the fruity aroma compound γ-decalactone, that lead to alterations in cell viability during its biotechnological production by yeast cells; Yarrowia lipolytica that is able to produce high amounts of this metabolite was used here as a model. Methods and Results: Lactone concentrations above 150 mg l-1 inhibited cell growth, depolarized the living cells and increased membrane fluidity. Infrared spectroscopic measurements revealed that the...

  5. Inner ear hair cells produced in vitro by a mesenchymal-to-epithelial transition

    OpenAIRE

    Hu, Zhengqing; Corwin, Jeffrey T.

    2007-01-01

    Sensory hair cell loss is a major contributor to disabling hearing and balance deficits that affect >250 million people worldwide. Sound exposures, infections, drug toxicity, genetic disorders, and aging all can cause hair cell loss and lead to permanent sensory deficits. Progress toward treatments for these deficits has been limited, in part because hair cells have only been obtainable via microdissection of the anatomically complex internal ear. Attempts to produce hair cells in vitro have ...

  6. Development of a high-titer retrovirus producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells

    International Nuclear Information System (INIS)

    Retroviral-mediated gene transfer into primitive hematopoietic cells has been difficult to achieve in large-animal models. The authors have developed an amphotropic producer clone that generates >1010 recombinant retroviral particles (colony-forming units) per ml of culture medium. Autologous rhesus monkey bone marrow cells were cocultured with either high or low titer producer clones for 4-6 days and reinfused into sublethally irradiated animals. The proviral genome was detected in blood and bone-marrow cells from all three animals reconstituted with cells cocultured with the high-titer producer cells. In contrast, three animals reconstituted with bone marrow cocultured with the low-titer producer clone exhibited no evidence of gene transfer

  7. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells.

    Directory of Open Access Journals (Sweden)

    Tania S Quiroz

    Full Text Available The availability of the complete genome sequence of several Salmonella enterica serovars has revealed the presence of unstable genetic elements in these bacteria, such as pathogenicity islands and prophages. This is the case of Salmonella enterica serovar Enteritidis (S. Enteritidis, a bacterium that causes gastroenteritis in humans and systemic infection in mice. The whole genome sequence analysis for S. Enteritidis unveiled the presence of several genetic regions that are absent in other Salmonella serovars. These regions have been denominated "regions of difference" (ROD. In this study we show that ROD21, one of such regions, behaves as an unstable pathogenicity island. We observed that ROD21 undergoes spontaneous excision by two independent recombination events, either under laboratory growth conditions or during infection of murine cells. Importantly, we also found that one type of excision occurred at higher rates when S. Enteritidis was residing inside murine phagocytic cells. These data suggest that ROD21 is an unstable pathogenicity island, whose frequency of excision depends on the environmental conditions found inside phagocytic cells.

  8. An experimental and theoretical approach to the study of the photoacoustic signal produced by cancer cells

    Directory of Open Access Journals (Sweden)

    Rafael Pérez Solano

    2012-03-01

    Full Text Available The distinctive spectral absorption characteristics of cancer cells make photoacoustic techniques useful for detection in vitro and in vivo. Here we report on our evaluation of the photoacoustic signal produced by a series of monolayers of different cell lines in vitro. Only the melanoma cell line HS936 produced a detectable photoacoustic signal in which amplitude was dependent on the number of cells. This finding appears to be related to the amount of melanin available in these cells. Other cell lines (i.e. HL60, SK-Mel-1, T47D, Hela, HT29 and PC12 exhibited values similar to a precursor of melanin (tyrosinase, but failed to produce sufficient melanin to generate a photoacoustic signal that could be distinguished from background noise. To better understand this phenomenon, we determined a formula for the time-domain photoacoustic wave equation for a monolayer of cells in a non-viscous fluid on the thermoelastic regime. The theoretical results showed that the amplitude and profile of the photoacoustic signal generated by a cell monolayer depended upon the number and distribution of the cells and the location of the point of detection. These findings help to provide a better understanding of the factors involved in the generation of a photoacoustic signal produced by different cells in vitro and in vivo.

  9. An experimental and theoretical approach to the study of the photoacoustic signal produced by cancer cells

    Science.gov (United States)

    Solano, Rafael Pérez; Ramirez-Perez, Francisco I.; Castorena-Gonzalez, Jorge A.; Anell, Edgar Alvarado; Gutiérrez-Juárez, Gerardo; Polo-Parada, Luis

    2012-03-01

    The distinctive spectral absorption characteristics of cancer cells make photoacoustic techniques useful for detection in vitro and in vivo. Here we report on our evaluation of the photoacoustic signal produced by a series of monolayers of different cell lines in vitro. Only the melanoma cell line HS936 produced a detectable photoacoustic signal in which amplitude was dependent on the number of cells. This finding appears to be related to the amount of melanin available in these cells. Other cell lines (i.e. HL60, SK-Mel-1, T47D, Hela, HT29 and PC12) exhibited values similar to a precursor of melanin (tyrosinase), but failed to produce sufficient melanin to generate a photoacoustic signal that could be distinguished from background noise. To better understand this phenomenon, we determined a formula for the time-domain photoacoustic wave equation for a monolayer of cells in a non-viscous fluid on the thermoelastic regime. The theoretical results showed that the amplitude and profile of the photoacoustic signal generated by a cell monolayer depended upon the number and distribution of the cells and the location of the point of detection. These findings help to provide a better understanding of the factors involved in the generation of a photoacoustic signal produced by different cells in vitro and in vivo.

  10. AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6

    International Nuclear Information System (INIS)

    Cell lines derived from Kaposi sarcoma lesions of patients with AIDS (AIDS-KS cells) produce several cytokines, including an endothelial cell growth factor, interleukin 1β, and basic fibroblast growth factor. Since exposure to human immunodeficiency virus increases interleukin 6 (IL-6) production in monocytes and endothelial cells produce IL-6, the authors examined IL-6 expression and response in AIDS-KS cell lines and IL-6 expression in AIDS Kaposi sarcoma tissue. The AIDS-KS cell lines (N521J and EKS3) secreted large amounts of immunoreactive and biologically active IL-6. The authors found both IL-6 and IL-6 receptor (IL-6-R) RNA by slot blot hybridization analysis of AIDS-KS cells. The IL-6-R was functional, as [3H]thymidine incorporation by AIDS-KS cells increased significantly after exposure to human recombinant IL-6 (hrIL-6) at >10 units/ml. When AIDS-KS cells (EKS3) were exposed to IL-6 antisense oligonucleotide, cellular proliferation decreased by nearly two-thirds, with a corresponding decrease in the production of IL-6. These results show that both IL-6 and IL-6-R are produced by AIDS-KS cells and that IL-6 is required for optimal AIDS-KS cell proliferation, and they suggest that IL-6 is an autocrine growth factor for AIDS-KS cells

  11. Perforin-2 Protects Host Cells and Mice by Restricting the Vacuole to Cytosol Transitioning of a Bacterial Pathogen.

    Science.gov (United States)

    McCormack, Ryan; Bahnan, Wael; Shrestha, Niraj; Boucher, Justin; Barreto, Marcella; Barrera, Carlos M; Dauer, Edward A; Freitag, Nancy E; Khan, Wasif N; Podack, Eckhard R; Schesser, Kurt

    2016-04-01

    The host-encoded Perforin-2 (encoded by the macrophage-expressed gene 1,Mpeg1), which possesses a pore-forming MACPF domain, reduces the viability of bacterial pathogens that reside within membrane-bound compartments. Here, it is shown that Perforin-2 also restricts the proliferation of the intracytosolic pathogenListeria monocytogenes Within a few hours of systemic infection, the massive proliferation ofL. monocytogenesinPerforin-2(-/-)mice leads to a rapid appearance of acute disease symptoms. We go on to show in culturedPerforin-2(-/-)cells that the vacuole-to-cytosol transitioning ofL. monocytogenesis greatly accelerated. Unexpectedly, we found that inPerforin-2(-/-)macrophages,Listeria-containing vacuoles quickly (≤15 min) acidify, and that this was coincident with greater virulence gene expression, likely accounting for the more rapid translocation ofL. monocytogenesto its replicative niche in the cytosol. This hypothesis was supported by our finding that aL. monocytogenesstrain expressing virulence factors at a constitutively high level replicated equally well inPerforin-2(+/+)andPerforin-2(-/-)macrophages. Our findings suggest that the protective role of Perforin-2 against listeriosis is based on it limiting the intracellular replication of the pathogen. This cellular activity of Perforin-2 may derive from it regulating the acidification ofListeria-containing vacuoles, thereby depriving the pathogen of favorable intracellular conditions that promote its virulence gene activity. PMID:26831467

  12. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

    LENUS (Irish Health Repository)

    Sibartie, Shomik

    2009-01-01

    BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

  13. Production of islet-like insulin-producing cell clusters in vitro from adipose-derived stem cells

    Directory of Open Access Journals (Sweden)

    Loan Thi-Tung Dang

    2015-01-01

    Full Text Available Diabetes mellitus is a high incidence disease that has increased rapidly in recent years. Many new therapies are being studied and developed in order to find an effective treatment. An ideal candidate is stem cell therapy. In this study, we investigated the differentiation of adipose derived stem cells (ADSCs into pseudo-islets in defined medium in vitro, to produce large quantities of insulin-producing cells (IPCs for transplantation. ADSCs isolated from adipose tissue were induced to differentiate into islet-like insulin-producing cell clusters in vitro by inducing medium DMEM/F12 containing nicotinamide, N2, B27, bFGF, and insulin-transferrin-selenite (ITS. Differentiated cells were analyzed for properties of IPCs, including storage of Zn2+ by dithizone staining, insulin production by ELISA and immunochemistry, and beta cell-related gene expression by reverse transcriptase PCR. The results showed that after 2 weeks of differentiation, the ADSCs aggregated into cell clusters, and after 4 weeks they formed islets, 50 and ndash;400 micrometers in diameter. These islet cells exhibited characteristics of pancreatic beta cells as they were positive for dithizone staining, expressed insulin in vitro and C-peptide in the cytoplasm, and expressed pancreatic beta cell-specific genes, including Pdx-1, NeuroD, and Ngn3. These results demonstrate that ADSCs can be used to produce a large number of functional islets for research as well as application. [Biomed Res Ther 2015; 2(1.000: 184-192

  14. Assay of the multiple energy-producing pathways of mammalian cells.

    Directory of Open Access Journals (Sweden)

    Barry R Bochner

    Full Text Available BACKGROUND: To elucidate metabolic changes that occur in diabetes, obesity, and cancer, it is important to understand cellular energy metabolism pathways and their alterations in various cells. METHODOLOGY AND PRINCIPAL FINDINGS: Here we describe a technology for simultaneous assessment of cellular energy metabolism pathways. The technology employs a redox dye chemistry specifically coupled to catabolic energy-producing pathways. Using this colorimetric assay, we show that human cancer cell lines from different organ tissues produce distinct profiles of metabolic activity. Further, we show that murine white and brown adipocyte cell lines produce profiles that are distinct from each other as well as from precursor cells undergoing differentiation. CONCLUSIONS: This technology can be employed as a fundamental tool in genotype-phenotype studies to determine changes in cells from shared lineages due to differentiation or mutation.

  15. Cytotoxicity and DNA crosslinks produced by mitomycin analogs in aerobic and hypoxic EMT6 cells.

    Science.gov (United States)

    Keyes, S R; Loomis, R; DiGiovanna, M P; Pritsos, C A; Rockwell, S; Sartorelli, A C

    1991-01-01

    Several mitomycin antibiotics were evaluated for their capacities to kill EMT6 tumor cells and to produce DNA crosslinks under conditions of oxygenation and hypoxia. The agents examined included mitomycin C, porfiromycin, and the 7-aminomethyl dithioacetal derivative of mitomycin C (BMY-43324), all of which caused greater kill of hypoxic cells than of their oxygenated counterparts; the N,N'-dimethylaminomethylene derivative of mitomycin C (BMY-25282), which was considerably more cytotoxic under oxygenated conditions than in hypoxia; and the N,N'-dimethylaminomethylene derivative of porfiromycin (BL-6783), which was equal in its toxicity to hypoxic and oxygenated cells. All of these agents produced DNA crosslinks in EMT6 cells, as measured by alkaline elution. The number of crosslinks required to produce a given amount of cell kill was similar, regardless of the mitomycin employed or the degree of oxygenation, suggesting that the crosslinking of DNA was a major lesion in the cytodestructive action of the mitomycins. PMID:1760250

  16. Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

    International Nuclear Information System (INIS)

    NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U-13C-glucose and 15N-glutamate as labeled precursors. This study suggests that uniformly 15N,13C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

  17. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Barhoom Sima

    2008-02-01

    Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

  18. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    Energy Technology Data Exchange (ETDEWEB)

    Su, Xin; Guan, Wuqiang; Yu, Yong-Chun; Fu, Yinghui, E-mail: fuyh@fudan.edu.cn

    2014-07-18

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1{sup +} or nestin{sup +} stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU{sup +} cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU{sup +} cells, very few are mash1{sup +} or nestin{sup +} stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1{sup +} microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition.

  19. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    International Nuclear Information System (INIS)

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1+ or nestin+ stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU+ cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU+ cells, very few are mash1+ or nestin+ stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1+ microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition

  20. Apoptotic effects on cultured cells of atmospheric-pressure plasma produced using various gases

    Science.gov (United States)

    Tominami, Kanako; Kanetaka, Hiroyasu; Kudo, Tada-aki; Sasaki, Shota; Kaneko, Toshiro

    2016-01-01

    This study investigated the effects of low-temperature atmospheric-pressure plasma on various cells such as rat fibroblastic Rat-1 cell line, rat neuroblastoma-like PC12 cell line, and rat macrophage-like NR8383 cell line. The plasma was irradiated directly to a culture medium containing plated cells for 0-20 s. The applied voltage, excitation frequency, and argon or helium gas flow were, respectively, 3-6 kV, 10 kHz, and 3 L/min. Cell viability and apoptotic activity were evaluated using annexin-V/propidium iodide staining. Results showed that the low-temperature atmospheric-pressure plasma irradiation promoted cell death in a discharge-voltage-dependent and irradiation-time-dependent manner. Furthermore, different effects are produced depending on the cell type. Moreover, entirely different mechanisms might be responsible for the induction of apoptosis in cells by helium and argon plasma.

  1. From the Cover: Cell-replacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells

    Science.gov (United States)

    Sapir, Tamar; Shternhall, Keren; Meivar-Levy, Irit; Blumenfeld, Tamar; Cohen, Hamutal; Skutelsky, Ehud; Eventov-Friedman, Smadar; Barshack, Iris; Goldberg, Iris; Pri-Chen, Sarah; Ben-Dor, Lya; Polak-Charcon, Sylvie; Karasik, Avraham; Shimon, Ilan; Mor, Eytan; Ferber, Sarah

    2005-05-01

    Shortage in tissue availability from cadaver donors and the need for life-long immunosuppression severely restrict the large-scale application of cell-replacement therapy for diabetic patients. This study suggests the potential use of adult human liver as alternate tissue for autologous beta-cell-replacement therapy. By using pancreatic and duodenal homeobox gene 1 (PDX-1) and soluble factors, we induced a comprehensive developmental shift of adult human liver cells into functional insulin-producing cells. PDX-1-treated human liver cells express insulin, store it in defined granules, and secrete the hormone in a glucose-regulated manner. When transplanted under the renal capsule of diabetic, immunodeficient mice, the cells ameliorated hyperglycemia for prolonged periods of time. Inducing developmental redirection of adult liver offers the potential of a cell-replacement therapy for diabetics by allowing the patient to be the donor of his own insulin-producing tissue. pancreas | transdifferentiation

  2. A Modified Method of Insulin Producing Cells’ Generation from Bone Marrow-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Paweł Czubak

    2014-01-01

    Full Text Available Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells’ transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs. In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs. We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors’ concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

  3. Firing activity of "diapause hormone" producing cells in the male silkmoth, Bombyx mori.

    Science.gov (United States)

    Ichikawa, Toshio; Suenobu, Akiko

    2003-08-01

    Diapause hormone (DH) originally identified to be a factor originating from neurosecretory cells in the suboesophageal ganglion acts on developing ovaries to produce diapause eggs in a female silkmoth, Bombyx mori. A male silkmoth has homologous neurosecretory cells, but little is known of the physiological nature of the cells and actions of their products. We examined the long-term firing activity of putative DH-producing neurosecretory cells and hormonal activity of their products in male pupae that had been experienced different environmental regimens for diapause induction. Firing activity patterns of male labial cells strongly depended on diapause types of pupae: cells in a diapause-type male were active throughout the pupal period, whereas the same cells in a non-diapause-type male were usually inactive during the early two-thirds of the pupal period. A male pupa with electrically active labial cells could induce diapause eggs in a female pupa connected parabiotically to that male. The firing activity of male neurosecretory cells and hormonal action of their products are qualitatively the same as in the female previously examined. We suggest that there is no evident sexual dimorphism in the physiological and biochemical nature of neurosecretory cells producing DH and the amidated peptide DH has different functions in a male. PMID:12951400

  4. New method to differentiate human peripheral blood monocytes into insulin producing cells: Human hematosphere culture.

    Science.gov (United States)

    Hur, Jin; Yang, Ji Min; Choi, Jae-Il; Yun, Ji-Yeon; Jang, Jae Hee; Kim, Joonoh; Kim, Ju-Young; Oh, Il-Young; Yoon, Chang-Hwan; Cho, Hyun-Jai; Park, Young-Bae; Kim, Hyo-Soo

    2012-02-24

    Strategy to differentiate stem cells into insulin producing cells (IPCs) in vitro has been a promising one to get cell source of β-cell replacement therapy for diabetes. It has been suggested that islets and neurons share features and nestin-positive cells could differentiate into IPCs. We have recently developed a three-dimensional culture system using human peripheral blood cells named as blood-born hematosphere (BBHS). Here we showed that most of BBHS were composed of nestin-positive cells. Under the four-stage differentiation protocol for IPCs, we plated nestin-positive BBHS onto fibronectin-coated dish. These cells form islet-like clusters and most of them expressed insulin. Pancreatic specific genes were turned on, such as transcription factors (Pdx-1, Ngn3 and Nkx6.1), genes related to endocrine function (Glut-2 and PC2) or β cell function (Kir6.2, SUR1). Furthermore islet differentiation was confirmed by dithizone (DTZ) staining to detect zinc ion which binds insulin protein within the cells. Finally, IPCs derived from BBHS showed capability to secrete insulin in response to glucose stimulation. Taken together, our novel protocol successfully induced islet-like human insulin producing cells out of BBHS. This strategy of ex vivo expansion of IPCs using BBHS provides an autologous therapeutic cell source for the treatment of diabetes. PMID:22310720

  5. Generation of Insulin-Producing Human Mesenchymal Stem Cells Using Recombinant Adeno-Associated Virus

    OpenAIRE

    Kim, Jeong Hwan; Park, Si-Nae; Suh, Hwal

    2007-01-01

    The purpose of current experiment is the generation of insulin-producing human mesenchymal stem cells as therapeutic source for the cure of type 1 diabetes. Type 1 diabetes is generally caused by insulin deficiency accompanied by the destruction of islet β-cells. In various trials for the treatment of type 1 diabetes, cell-based gene therapy using stem cells is considered as one of the most useful candidate for the treatment. In this experiment, human mesenchymal stem cells were transduced wi...

  6. Thymic self-reactivity selects natural interleukin 17-producing T cells that can regulate peripheral inflammation

    OpenAIRE

    Marks, Benjamin R.; Heba N. Nowyhed; Choi, Jin-Young; Poholek, Amanda C; Odegard, Jared M.; Flavell, Richard A; Craft, Joe

    2009-01-01

    Interleukin 17 (IL-17)-producing CD4+ T (TH-17) cells share a developmental relationship with FoxP3+ regulatory T (Treg) cells. Here we show that a TH-17 population differentiates within the thymus in a manner influenced by self-antigen recognition, and by the cytokines IL-6 and transforming growth factor (TGF)-β. Like previously described TH-17 cells, TH-17 cells that develop in the thymus expressed the orphan nuclear receptor RORγt and the IL-23 receptor. These cells also expressed α4β1 int...

  7. CCR6 marks regulatory T cells as a colon-tropic, interleukin-10-producing phenotype1

    OpenAIRE

    Kitamura, Kazuya; Farber, Joshua M; Kelsall, Brian L.

    2010-01-01

    Expression of CCR6 and its ligand, CCL20, are increased in the colon of humans with inflammatory bowel diseases and mice with experimental colits, however their role in disease pathogenesis remains obscure. Here we demonstrate a role for CCR6 on regulatory T (Treg)3 cells in the T cell-transfer model of colitis. Rag2−/− mice given Ccr6−/− CD4+CD45RBhigh T cells had more severe colitis with increased IFN-γ-producing T cells, compared to the mice given WT cells. While equivalent frequency of in...

  8. What makes pathogens pathogenic

    OpenAIRE

    Ehrlich, Garth D.; Hiller, N.Luisa; Hu, Fen Ze

    2008-01-01

    Metazoans contain multiple complex microbial ecosystems in which the balance between host and microbe can be tipped from commensalism to pathogenicity. This transition is likely to depend both on the prevailing environmental conditions and on specific gene-gene interactions placed within the context of the entire ecosystem.

  9. Eugenol alters the integrity of cell membrane and acts against the nosocomial pathogen Proteus mirabilis.

    Science.gov (United States)

    Devi, K Pandima; Sakthivel, R; Nisha, S Arif; Suganthy, N; Pandian, S Karutha

    2013-03-01

    Eugenol, a member of the phenylpropanoids class of chemical compounds, is a clear to pale yellow oily liquid extracted from certain essential oils especially from clove oil, nutmeg, cinnamon, and bay leaf. The antibacterial activity of eugenol and its mechanism of bactericidal action against Proteus mirabilis were evaluated. Treatment with eugenol at their minimum inhibitory concentration [0.125 % (v/v)] and minimum bactericidal concentration [0.25 % (v/v)] reduced the viability and resulted in complete inhibition of P. mirabilis. A strong bactericidal effect on P. mirabilis was also evident, as eugenol inactivated the bacterial population within 30 min exposure. Chemo-attractant property and the observance of highest antibacterial activity at alkaline pH suggest that eugenol can work more effectively when given in vivo. Eugenol inhibits the virulence factors produced by P. mirabilis as observed by swimming motility, swarming behavior and urease activity. It interacts with cellular membrane of P. mirabilis and makes it highly permeable, forming nonspecific pores on plasma membrane, which in turn directs the release of 260 nm absorbing materials and uptake of more crystal violet from the medium into the cells. SDS-polyacrylamide gel, scanning electron microscopy and Fourier transform infrared analysis further proves the disruptive action of eugenol on the plasma membrane of P. mirabilis. The findings reveal that eugenol shows an excellent bactericidal activity against P. mirabilis by altering the integrity of cell membrane. PMID:23444040

  10. Effects of Supplementation of Various Medium Components on Chinese Hamster Ovary Cell Cultures Producing Recombinant Antibody

    OpenAIRE

    Kim, Do Yun; Lee, Joon Chul; Chang, Ho Nam; Oh, Duk Jae

    2005-01-01

    Thirteen vitamins, twenty amino acids, hormones, inorganic salts, and other chemical agents, which constitute typical serum-free media, were evaluated for the development of fortified medium to enhance cell growth and productivity of recombinant antibody in the cultures of the recombinant Chinese hamster ovary (rCHO) cells. Two different rCHO cell lines, rCHO-A producing recombinant antibodies against the human platelet and rCHO-B secreting recombinant antibodies against the S surface antigen...

  11. Drug Delivery and Cell Transfection Using Shock Waves Produced by Nanothermites

    Science.gov (United States)

    Gangopadhyay, Shubhra

    2009-06-01

    Shock waves have non-destructive life science applications in cell transfection and drug delivery. Based on molecular dynamics simulations, the shockwave causes transient compression of the cell membrane, which causes the hydrophobic interior of the lipid bilayer to become thinner. This allows diffusion of water molecules across the membrane. Recently, the nanothermite composition consisting of CuO nanorods and Al nanoparticles was shown to propagate at velocities in the same range as metallic azides and fulminates; however, the CuO/Al mixture produces lower pressure levels. An in vitro testing system was developed to deliver shock waves produced by nanothermites into cell suspensions and/or tissues. The plasmid encoded for production of green-fluorescent protein was delivered into cells including, among other types, chicken cardiomyocytes, cell lines (T47-D and Ins-1), and Arabidopsis plant cells. It was found that the nanothermite pressure impulses induced transfection resulting in production of green fluorescent protein in 99% of the cardiomyocytes. Additionally, transfected cell survival was evaluated, and the pressure impulses did not produce any elevated levels of cell death compared with control cell suspensions.

  12. Dynamic regulation of effector IFN-γ-producing and IL-17-producing T cell subsets in the development of acute graft-versus-host disease.

    Science.gov (United States)

    Zhao, Kai; Ruan, Suhong; Yin, Lingling; Zhao, Dongmei; Chen, Chong; Pan, Bin; Zeng, Lingyu; Li, Zhenyu; Xu, Kailin

    2016-02-01

    Graft-versus-host disease (GVHD) as the predominant complication of allogeneic hematopoietic stem cell transplantation remains to be fully understood. It is known that the cytokines produced by allogeneic reactive effector CD4+ and CD8+ T cells are involved in GVHD. However, the regulation and coordination of IFN-γ-producing and IL-17-producing effector T cells remain unclear. The present study aimed to investigate the dynamic changes of alloantigen-specific effector CD4+ T and CD8+ T cell subsets by flow cytometry, which produce inflammatory cytokines involved in the multistep GVHD pathogenesis progress. The results demonstrated that IL-17-producing CD8+ T (Tc17) cells and IFN-γ+CD8+ T (Tc1) cells were detected in the early stage of GVHD. The differentiation of CD4+ T cells into Th1 cell (IFN-γ+CD4+ T) and Th17 (IL-17+CD4+ T) cells was later than that of the Tc1 and Tc17 cells. The effector CD4+ T and CD8+ T cell subsets either became exhausted or became memory cells, exhibiting a CD62L-CD44+ phenotype following marked expansion during GVHD. Furthermore, T cell-associated type I (IL-2 and IFN-γ) and type II (IL-4 and IL-10) classical cytokines exhibited coordinated dynamic regulation. It was concluded that the differentiation of cytokine-producing Tc1 and Tc17 cells may be the key step in the initiation of GVHD, whereas CD4+ effector Th1 and Th17 cells are considered to be pathophysiological factors leading to the continuous aggravation of GVHD. PMID:26647759

  13. In vitro cell quality of buffy coat platelets in additive solution treated with pathogen reduction technology

    DEFF Research Database (Denmark)

    Ostrowski, Sisse R; Bochsen, Louise; Salado-Jimena, José A;

    2010-01-01

    Pathogen reduction technologies (PRTs) may induce storage lesion in platelet (PLT) concentrates. To investigate this, buffy coat PLTs (BCPs) in PLT additive solution (AS; SSP+) with or without Mirasol PRT (CaridianBCT Biotechnologies) were assessed by quality control tests and four-color flow cyt...

  14. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  15. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  16. Staphylococcus aureus produces membrane-derived vesicles that induce host cell death.

    Directory of Open Access Journals (Sweden)

    Mamata Gurung

    Full Text Available Gram-negative bacteria produce outer membrane vesicles that play a role in the delivery of virulence factors to host cells. However, little is known about the membrane-derived vesicles (MVs produced by gram-positive bacteria. The present study examined the production of MVs from Staphylococcus aureus and investigated the delivery of MVs to host cells and subsequent cytotoxicity. Four S. aureus strains tested, two type strains and two clinical isolates, produced spherical nanovesicles during in vitro culture. MVs were also produced during in vivo infection of a clinical S. aureus isolate in a mouse pneumonia model. Proteomic analysis showed that 143 different proteins were identified in the S. aureus-derived MVs. S. aureus MVs were interacted with the plasma membrane of host cells via a cholesterol-rich membrane microdomain and then delivered their component protein A to host cells within 30 min. Intact S. aureus MVs induced apoptosis of HEp-2 cells in a dose-dependent manner, whereas lysed MVs neither delivered their component into the cytosol of host cells nor induced cytotoxicity. In conclusion, this study is the first report that S. aureus MVs are an important vehicle for delivery of bacterial effector molecules to host cells.

  17. Ankylosing spondylitis patients display altered dendritic cell and T cell populations that implicate pathogenic roles for the IL-23 cytokine axis and intestinal inflammation

    OpenAIRE

    Wright, Pamela B.; McEntegart, Anne; McCarey, David; McInnes, Iain B.; Siebert, Stefan; Milling, Simon W F

    2015-01-01

    Objective. AS is a systemic inflammatory disease of the SpA family. Polymorphisms at loci including HLA-B27, IL-23R and ERAP-1 directly implicate immune mechanisms in AS pathogenesis. Previously, in an SpA model, we identified HLA-B27–mediated effects on dendritic cells that promoted disease-associated Th17 cells. Here we extend these studies to AS patients using deep immunophenotyping of candidate pathogenic cell populations. The aim of our study was to functionally characterize the immune p...

  18. From the regulatory functions of B cells to the identification of cytokine-producing plasma cell subsets.

    Science.gov (United States)

    Dang, Van Duc; Hilgenberg, Ellen; Ries, Stefanie; Shen, Ping; Fillatreau, Simon

    2014-06-01

    B lymphocytes have a unique role as antibody-producing cells. Antibodies are key mediators of humoral immunity against infections, and are thought to account for the protection afforded by successful vaccines. B cells can also secrete cytokines and subsequently regulate immune responses mediated by T and innate cells. Remarkably, recent studies identified plasma blasts/plasma cells as the main types of activated B cells producing the cytokines interleukin (IL)-10, IL-35, tumor necrosis factor (TNF)-α, IL-17, and GM-CSF in various contexts in mice. Here, we discuss these observations, which suggest the existence of various subsets of plasma blast/plasma cells distinguishable through their cytokine expression pattern. PMID:24637161

  19. Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells

    Science.gov (United States)

    Zalzman, Michal; Gupta, Sanjeev; Giri, Ranjit K.; Berkovich, Irina; Sappal, Baljit S.; Karnieli, Ohad; Zern, Mark A.; Fleischer, Norman; Efrat, Shimon

    2003-06-01

    Beta-cell replacement is considered to be the most promising approach for treatment of type 1 diabetes. Its application on a large scale is hindered by a shortage of cells for transplantation. Activation of insulin expression, storage, and regulated secretion in stem/progenitor cells offers novel ways to overcome this shortage. We explored whether fetal human progenitor liver cells (FH) could be induced to differentiate into insulin-producing cells after expression of the pancreatic duodenal homeobox 1 (Pdx1) gene, which is a key regulator of pancreatic development and insulin expression in beta cells. FH cells possess a considerable replication capacity, and this was further extended by introduction of the gene for the catalytic subunit of human telomerase. Immortalized FH cells expressing Pdx1 activated multiple beta-cell genes, produced and stored considerable amounts of insulin, and released insulin in a regulated manner in response to glucose. When transplanted into hyperglycemic immunodeficient mice, the cells restored and maintained euglycemia for prolonged periods. Quantitation of human C-peptide in the mouse serum confirmed that the glycemia was normalized by the transplanted human cells. This approach offers the potential of a novel source of cells for transplantation into patients with type 1 diabetes.

  20. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  1. In vitro cultivation of human fetal pancreatic ductal stem cells and their differentiation into insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Zhong-Xiang Yao; Mao-Lin Qin; Jian-Jun Liu; Xing-Shu Chen; De-Shan Zhou

    2004-01-01

    AIM: To isolate, culture and identify the human fetal pancreatic ductal stem cells in vitro, and to observe the potency of these multipotential cells differentiation into insulin-producing cells.METHODS: The human fetal pancreas was digested by 1 g/L collagease type Ⅳ and then 2.5 g/L trypsin was used to isolate the pancreatic ducta stem cells, followed by culture in serum-free, glucose-free DMEM media with some additional chemical substrates in vitro (according to the different Stage). The cells were induced by glucose-free (control),5 mmol/L, 17.8 mmol/L and 25 mmol/L glucose, respectively.The cell types of differentiated cells were identified using immunocytochemical staining.RESULTS: The shape of human fetal pancreatic ductal stem cells culturedin vitro was firstly fusiform in the first 2 wk,and became monolayer and cobblestone pattern after another 3 to 4 wk. After induced and differentiated by the glucose of different concentrations for another 1 to 2 wk,the cells formed the pancreatic islet-like structures. The identification and potency of these cells were then identified by using the pancreatic ductal stem cell marker, cytokeratin-19 (CK-19), pancreatic β cell marker, insulin and pancreatic α cell marker, glucagons with immunocytochemical staining.At the end of the second week, 95.2% of the cells were positive for CK-19 immunoreactivity. Up to 22.7% of the cells induced by glucose were positive for insulin immunoreactivity, and less than 3.8% of the cells were positive for glucagon immunoreactivity in pancreatic isletlike structures. The positive ratio of immunoreactive staining was dependent on the concentration of glucose, and it was observed that the 17.8 mmol/L glucose stimulated effectively to produce insulin- and glucagons-producing cells.CONCLUSION: The human fetal pancreatic ductal stem cells are capable of proliferation in vitro. These cells have multidifferentiation potential and can be induced by glucose and differentiated into insulin-producing

  2. Characteristics of the early immune response following transplantation of mouse ES cell derived insulin-producing cell clusters.

    OpenAIRE

    Boyd, Ashleigh S.; Wood, Kathryn J.

    2010-01-01

    Background The fully differentiated progeny of ES cells (ESC) may eventually be used for cell replacement therapy (CRT). However, elements of the innate immune system may contribute to damage or destruction of these tissues when transplanted. Methodology/Principal Findings Herein, we assessed the hitherto ill-defined contribution of the early innate immune response in CRT after transplantation of either ESC derived insulin producing cell clusters (IPCCs) or adult pancreatic islets....

  3. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Directory of Open Access Journals (Sweden)

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  4. Enhanced immunoregulation of mesenchymal stem cells by IL-10-producing type 1 regulatory T cells in collagen-induced arthritis.

    Science.gov (United States)

    Lim, Jung-Yeon; Im, Keon-Il; Lee, Eun-Sol; Kim, Nayoun; Nam, Young-Sun; Jeon, Young-Woo; Cho, Seok-Goo

    2016-01-01

    Mesenchymal stem cells (MSCs) possess immunomodulatory properties and have potential, however, there have been conflicting reports regarding their effects in rheumatoid arthritis (RA), which causes inflammation and destruction of the joints. Through a comparative analysis of regulatory T (Treg) and IL-10-producing type 1 regulatory T (Tr1) cells, we hypothesized that Tr1 cells enhance the immunoregulatory functions of MSCs, and that a combinatorial approach to cell therapy may exert synergistic immunomodulatory effects in an experimental animal model of rheumatoid arthritis (RA). A combination of MSCs and Tr1 cells prevented the development of destructive arthritis compared to single cell therapy. These therapeutic effects were associated with an increase in type II collagen (CII)-specific CD4+CD25+Foxp3+ Treg cells and inhibition of CII-specific CD4+IL-17+ T cells. We observed that Tr1 cells produce high levels of IL-10-dependent interferon (IFN)-β, which induces toll-like receptor (TLR) 3 expression in MSCs. Moreover, induction of indoleamine 2,3-dioxygenase (IDO) by TLR3 involved an autocrine IFN-β that was dependent on STAT1 signaling. Furthermore, we observed that production of IFN-β and IL-10 in Tr1 cells synergistically induces IDO in MSCs through the STAT1 pathway. These findings suggest co-administration of MSCs and Tr1 cells to be a novel therapeutic modality for clinical autoimmune diseases. PMID:27246365

  5. Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

    Directory of Open Access Journals (Sweden)

    Juliana Branco Novo

    2012-01-01

    Full Text Available Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher’s patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr− cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa and secreted (63–69 kDa form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources.

  6. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Science.gov (United States)

    Narusaka, Mari; Minami, Taichi; Iwabuchi, Chikako; Hamasaki, Takashi; Takasaki, Satoko; Kawamura, Kimito; Narusaka, Yoshihiro

    2015-01-01

    Housaku Monogatari (HM) is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA) pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods. PMID:25565273

  7. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Directory of Open Access Journals (Sweden)

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  8. The periodontal pathogen Porphyromonas gingivalis induces expression of transposases and cell death of Streptococcus mitis in a biofilm model.

    Science.gov (United States)

    Duran-Pinedo, Ana E; Baker, Vinesha D; Frias-Lopez, Jorge

    2014-08-01

    Oral microbial communities are extremely complex biofilms with high numbers of bacterial species interacting with each other (and the host) to maintain homeostasis of the system. Disturbance in the oral microbiome homeostasis can lead to either caries or periodontitis, two of the most common human diseases. Periodontitis is a polymicrobial disease caused by the coordinated action of a complex microbial community, which results in inflammation of tissues that support the teeth. It is the most common cause of tooth loss among adults in the United States, and recent studies have suggested that it may increase the risk for systemic conditions such as cardiovascular diseases. In a recent series of papers, Hajishengallis and coworkers proposed the idea of the "keystone-pathogen" where low-abundance microbial pathogens (Porphyromonas gingivalis) can orchestrate inflammatory disease by turning a benign microbial community into a dysbiotic one. The exact mechanisms by which these pathogens reorganize the healthy oral microbiome are still unknown. In the present manuscript, we present results demonstrating that P. gingivalis induces S. mitis death and DNA fragmentation in an in vitro biofilm system. Moreover, we report here the induction of expression of multiple transposases in a Streptococcus mitis biofilm when the periodontopathogen P. gingivalis is present. Based on these results, we hypothesize that P. gingivalis induces S. mitis cell death by an unknown mechanism, shaping the oral microbiome to its advantage. PMID:24866802

  9. Human CD141+ DCs induce CD4+ T cells to produce type 2 cytokines1

    Science.gov (United States)

    Yu, Chun I; Becker, Christian; Metang, Patrick; Marches, Florentina; Wang, Yuanyuan; Toshiyuki, Hori; Banchereau, Jacques; Merad, Miriam; Palucka, Karolina

    2014-01-01

    Dendritic cells (DCs) play the central role in the priming of naïve T cells and the differentiation of unique effector T cells. Here, using lung tissues and blood from both humans and humanized mice, we analyzed the response of human CD1c+ and CD141+ DC subsets to live-attenuated influenza virus (LAIV). Specifically, we analyzed the type of CD4+ T cell immunity elicited by LAIV-exposed DCs. Both DC subsets induce proliferation of allogeneic naïve CD4+ T cells with capacity to secrete IFN-γ. However, CD141+ DCs are uniquely able to induce the differentiation of IL-4 and IL-13 producing CD4+ T cells. CD141+ DCs induce IL-4 and IL-13 secreting CD4+ T cells through OX40L. Thus, CD141+ DCs demonstrate remarkable plasticity in guiding adaptive immune responses. PMID:25246496

  10. Differentiation of embryonic stem cells into insulin-producing cells promoted by Nkx2.2 gene transfer

    Institute of Scientific and Technical Information of China (English)

    Akira Shiroi; Shigehiko Ueda; Yukiteru Ouji; Ko Saito; Kei Moriya; Yuko Sugie; Hiroshi Fukui; Shigeaki Ishizaka; Masahide Yoshikawa

    2005-01-01

    AIM: To investigate the ability of a genetically altered embryonic stem (ES) cell line to generate insulin-producing cells in vitro following transfer of the Nkx2.2 gene.METHODS: Hamster Nkx2.2 genes were transferred into mouse ES cells. Parental and Nkx2.2-transfected ES cells were initiated toward differentiation in embryoid body (EB)culture for 5 d and the resulting EBs were transferred to an attached culture system. Dithizone (DTZ), a zincchelating agent known to selectively stain pancreatic beta cells, was used to detect insulin-producing cells.The outgrowths were incubated in DTZ solution (final concentration, 100 μg/mL) for 15 min before being examined microscopically. Gene expression of the endocrine pancreatic markers was also analyzed by RT-PCR. In addition, insulin production was determined immunohistochemically and its secretion was examined using an ELISA.RESULTS: DTZ-stained cellular clusters appeared after approximately 14 d in the culture of Nkx2.2-transfected ES cells (Nkx-ES cells), which was as much as 2 wk earlier, than those in the culture of parental ES cells (wt-ES). The frequency of DTZ-positive cells among total cultured cells on day 28 accounted for approximately 1.0% and 0.1% of the Nkx-ES- and wt-ES-derived EB outgrowths, respectively. The DTZ-positive cellular clusters were found to be immunoreactive to insulin, while the gene expressions of pancreatic-duodenal homeobox 1(PDX1), proinsulin 1 and proinsulin 2 were observed in the cultures that contained DTZ-positive cellular clusters.Insulin secretion was also confirmed by ELISA, whereas glucose-dependent secretion was not demonstrated.CONCLUSION: Nkx2.2-transfected ES cells showed an ability to differentiate into insulin-producing cells.

  11. Host cell capable of producing enzymes useful for degradation of lignocellulosic material

    Science.gov (United States)

    Los, Alrik Pieter; Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Damveld, Robbertus Antonius

    2015-08-18

    The invention relates to a host cell comprising at least four different heterologous polynucleotides chosen from the group of polynucleotides encoding cellulases, hemicellulases and pectinases, wherein the host cell is capable of producing the at least four different enzymes chosen from the group of cellulases, hemicellulases and pectinases, wherein the host cell is a filamentous fungus and is capable of secretion of the at least four different enzymes. This host cell can suitably be used for the production of an enzyme composition that can be used in a process for the saccharification of cellulosic material.

  12. Platelet activating factor produced in vitro by Kaposi's sarcoma cells induces and sustains in vivo angiogenesis.

    OpenAIRE

    Bussolino, F.; Arese, M; Montrucchio, G; Barra, L; Primo, L; Benelli, R; Sanavio, F; M. Aglietta; Ghigo, D; Rola-Pleszczynski, M R

    1995-01-01

    Imbalance in the network of soluble mediators may play a pivotal role in the pathogenesis of Kaposi's sarcoma (KS). In this study, we demonstrated that KS cells grown in vitro produced and in part released platelet activating factor (PAF), a powerful lipid mediator of inflammation and cell-to-cell communication. IL-1, TNF, and thrombin enhanced the synthesis of PAF. PAF receptor mRNA and specific, high affinity binding site for PAF were present in KS cells. Nanomolar concentration of PAF stim...

  13. Anti-proliferative effect of fungal taxol extracted from Cladosporium oxysporum against human pathogenic bacteria and human colon cancer cell line HCT 15

    Science.gov (United States)

    Gokul Raj, K.; Manikandan, R.; Arulvasu, C.; Pandi, M.

    2015-03-01

    Cladosporium oxysporum a new taxol producing endophytic fungus was identified and production of taxol were characterized using UV-visible spectroscopy (UV-vis), high-performance liquid chromatography (HPLC), infrared (IR) nuclear magnetic resonance spectroscopy (NMR (13C and 1H)) and liquid chromatography-mass spectrometry (LC-MS). The taxol biosynthetic gene (dbat) was evaluated for new taxol producing fungus. Antibacterial activity against six different human pathogenic bacteria was done by agar well diffusion method. The anticancer efficacy of isolated fungal taxol were also evaluated in human colon cancer cell HCT 15 by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), cytotoxicity and nuclear morphology analysis. The isolated fungal taxol showed positive towards biosynthetic gene (dbat) and effective against both Gram positive as well as Gram negative. The fungal taxol suppress growth of cancer cell line HCT 15 with an IC50 value of 3.5 μM concentration by 24 h treatment. Thus, the result reveals that C. oxysporum could be a potential alternative source for production of taxol and have antibacterial as well as anticancer properties with possible clinical applications.

  14. Light scattering sensing detection of pathogens based on the molecular recognition of immunoglobulin with cell wall-associated protein A

    International Nuclear Information System (INIS)

    In this contribution, we report a rapid optical detection method of pathogens using Staphylococcus aureus (S. aureus) as the model analyte based on the molecular recognition of immunoglobulin with cell wall-associated Protein A (SpA). It was found that the molecular recognition of human immunoglobulin (IgG) with protein A on the cell wall of S. aureus on glass slide sensing area could result in strong surface enhanced light scattering (SELS) signals, and the SELS intensity (ΔI) increases proportionally with the concentration of S. aureus over the range of 2.5 x 105-1.0 x 108 CFU mL-1 with right angle light scattering (RALS) signals detection mode. In order to identify the solid support based molecular recognition between IgG with SpA, we also employed water-soluble CdS quantum dots (CdS-QDs) as a fluorescent marker for IgG by immobilizing the IgG onto the surfaces of CdS-QDs through covalent binding in order to generate recognition probes for SpA on the cell wall of S. aureus. Consequently, the fluorescent method also showed that the detection for pathogens with solid supports is reliable based on the molecular recognition of IgG with SpA

  15. Edwardsiella tarda Endocarditis Confirmed by Indium-111 White Blood Cell Scan: An Unusual Pathogen and Diagnostic Modality.

    Science.gov (United States)

    Litton, Kayleigh M; Rogers, Bret A

    2016-01-01

    Edwardsiella tarda is a freshwater marine member of the family Enterobacteriaceae which often colonizes fish, lizards, snakes, and turtles but is an infrequent human pathogen. Indium-111- ((111)In-) labeled white blood cell (WBC) scintigraphy is an imaging modality which has a wide range of reported sensitivity and specificity (from 60 to 100% and from 68 to 92%, resp.) for diagnosing acute and chronic infection. We describe a case of suspected E. tarda prosthetic aortic valve and mitral valve endocarditis with probable vegetations and new mitral regurgitation on transthoracic and transesophageal echocardiograms which was supported with the use of (111)In-labeled WBC scintigraphy. PMID:26885418

  16. Identification of a modular pathogenicity island that is widespread among urease-producing uropathogens and shares features with a diverse group of mobile elements.

    Science.gov (United States)

    Flannery, Erika L; Mody, Lona; Mobley, Harry L T

    2009-11-01

    Pathogenicity islands (PAIs) are a specific group of genomic islands that contribute to genomic variability and virulence of bacterial pathogens. Using a strain-specific comparative genomic hybridization array, we report the identification of a 94-kb PAI, designated ICEPm1, that is common to Proteus mirabilis, Providencia stuartii, and Morganella morganii. These organisms are highly prevalent etiologic agents of catheter-associated urinary tract infections (caUTI), the most common hospital acquired infection. ICEPm1 carries virulence factors that are important for colonization of the urinary tract, including a known toxin (Proteus toxic agglutinin) and the high pathogenicity island of Yersinia spp. In addition, this PAI shares homology and gene organization similar to the PAIs of other bacterial pathogens, several of which have been classified as mobile integrative and conjugative elements (ICEs). Isolates from this study were cultured from patients with caUTI and show identical sequence similarity at three loci within ICEPm1, suggesting its transfer between bacterial genera. Screening for the presence of ICEPm1 among P. mirabilis colonizing isolates showed that ICEPm1 is more prevalent in urine isolates compared to P. mirabilis strains isolated from other body sites (P<0.0001), further suggesting that it contributes to niche specificity and is positively selected for in the urinary tract. PMID:19687197

  17. T4-like coliphage ΦKAZ14 virulent to pathogenic and extended spectrum β-lactamase-producing Escherichia coli of poultry origin

    Institute of Scientific and Technical Information of China (English)

    Kaikabo; Adamu; Ahmad; Abdulkarim; Sabo; Mohanmmed; Faridah; Abas; Sieo; Chin; Chin

    2015-01-01

    <正>Dear Editor,Bacteriophages(otherwise called phages)are a type of virus that infect bacteria.This viral type has found useful applications in the control of bacterial pathogens in foods and food processing environments.In addition,phages may be useful to prevent colonization and shedding of bacteria into the surrounding environment.

  18. Ebola virus-like particles produced in insect cells exhibit dendritic cell stimulating activity and induce neutralizing antibodies

    International Nuclear Information System (INIS)

    Recombinant baculoviruses (rBV) expressing Ebola virus VP40 (rBV-VP40) or GP (rBV-GP) proteins were generated. Infection of Sf9 insect cells by rBV-VP40 led to assembly and budding of filamentous particles from the cell surface as shown by electron microscopy. Ebola virus-like particles (VLPs) were produced by coinfection of Sf9 cells with rBV-VP40 and rBV-GP, and incorporation of Ebola GP into VLPs was demonstrated by SDS-PAGE and Western blot analysis. Recombinant baculovirus infection of insect cells yielded high levels of VLPs, which were shown to stimulate cytokine secretion from human dendritic cells similar to VLPs produced in mammalian cells. The immunogenicity of Ebola VLPs produced in insect cells was evaluated by immunization of mice. Analysis of antibody responses showed that most of the GP-specific antibodies were of the IgG2a subtype, while no significant level of IgG1 subtype antibodies specific for GP was induced, indicating the induction of a Th1-biased immune response. Furthermore, sera from Ebola VLP immunized mice were able to block infection by Ebola GP pseudotyped HIV virus in a single round infection assay, indicating that a neutralizing antibody against the Ebola GP protein was induced. These results show that production of Ebola VLPs in insect cells using recombinant baculoviruses represents a promising approach for vaccine development against Ebola virus infection

  19. Spray deposition of live cells throughout the electrospinning process produces nanofibrous three-dimensional tissue scaffolds

    Directory of Open Access Journals (Sweden)

    Seil J

    2011-05-01

    Full Text Available Justin T Seil, Thomas J WebsterLaboratories for Nanomedicine Research, School of Engineering, Brown University, Providence, RI, USAAbstract: Compared with traditional in-vitro cell culture materials, three-dimensional nanofibrous scaffolds provide a superior environment for promoting cell functions. Since nanofibrous scaffolds have nanometer pore sizes, cells are unable to penetrate on their own, so must be incorporated into the scaffold during fabrication to ensure proper cell distribution. In this study, biodegradable and cytocompatible poly(DL-lactide-co-glycolide (PLGA nanofibers were produced using an electrospinning process. As a model cell line, fibroblasts were periodically sprayed from a pump-action spray bottle onto the developing scaffold. The viability of cells before and after spraying, and also after incorporation into the scaffold, was compared. Results indicated that cell spraying and the scaffold fabrication process did not significantly reduce cell viability. These findings, thus, contribute to the understanding of how to produce more physiological relevant cell-seeded nanofibrous scaffolds, an important element for the future of nanotechnology and tissue engineering.Keywords: nanomaterials, tissue engineering, PLGA, nanotechnology

  20. A Rapid Culture Technique Produces Functional Dendritic-Like Cells from Human Acute Myeloid Leukemia Cell Lines

    Directory of Open Access Journals (Sweden)

    Jian Ning

    2011-01-01

    Full Text Available Most anti-cancer immunotherapeutic strategies involving dendritic cells (DC as vaccines rely upon the adoptive transfer of DC loaded with exogenous tumour-peptides. This study utilized human acute myeloid leukemia (AML cells as progenitors from which functional dendritic-like antigen presenting cells (DLC were generated, that constitutively express tumour antigens for recognition by CD8+ T cells. DLC were generated from AML cell lines KG-1 and MUTZ-3 using rapid culture techniques and appropriate cytokines. DLC were evaluated for their cell-surface phenotype, antigen uptake and ability to stimulate allogeneic responder cell proliferation, and production of IFN-γ; compared with DC derived from normal human PBMC donors. KG-1 and MUTZ-3 DLC increased expression of CD80, CD83, CD86, and HLA-DR, and MUTZ-3 DLC downregulated CD14 and expressed CD1a. Importantly, both KG-1 and MUTZ-3-derived DLC promoted proliferation of allogeneic responder cells more efficiently than unmodified cells; neither cells incorporated FITC-labeled dextran, but both stimulated IFN-γ production from responding allogeneic CD8+ T cells. Control DC produced from PBMC using the FastDC culture also expressed high levels of critical cell surface ligands and demonstrated good APC function. This paper indicates that functional DLC can be cultured from the AML cell lines KG-1 and MUTZ-3, and FastDC culture generates functional KG-1 DLC.

  1. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    OpenAIRE

    Shruti Dave

    2014-01-01

    The pathophysiology of type 1 diabetes mellitus (T1DM) is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs) offer a ...

  2. Differential effect of environmental conditions on the growth and regulation of the fumonisin biosynthetic gene FUM1 in the maize pathogens and fumonisin producers Fusarium verticillioides and Fusarium proliferatum

    OpenAIRE

    Marin, P.; Magan, Naresh; Vazquez, C.; Gonzalez-Jaen, M. T.

    2010-01-01

    The effects of ecophysiological factors, temperature and solute potential, on both the growth and the regulation of the fumonisin biosynthetic FUM1 gene were studied and compared in one isolate each of the two closely related fumonisin- producing and maize pathogens Fusarium verticillioides and Fusarium proliferatum. The effect of solute potential and temperature was examined on in vitro mycelia growth and on the expression of the FUM1 gene, quantified by species-specific re...

  3. Volatiles produced by interacting microorganisms potentially useful for the control of plant pathogens Voláteis produzidos pela interação entre microorganismos potencialmente úteis no controle de fitopatógenos

    OpenAIRE

    Vicente Paulo Campos; Renata Silva Canuto de Pinho; Eduardo Souza Freire

    2010-01-01

    The results of studies about interactions between microorganisms involving at least one plant pathogen are of interest to the areas of ethiology and control in Plant Pathology. Various aspects of these interactions have been studied over the years but the toxicity of volatile organic compounds (VOCs) has been emphasized only recently, developing techniques and procedures, and producing additional knowledge to those already obtained with water-soluble substances. This new facet of these intera...

  4. Heat Shock Protein 47: A Novel Biomarker of Phenotypically Altered Collagen-Producing Cells

    International Nuclear Information System (INIS)

    Heat shock protein 47 (HSP47) is a collagen-specific molecular chaperone that helps the molecular maturation of various types of collagens. A close association between increased expression of HSP47 and the excessive accumulation of collagens is found in various human and experimental fibrotic diseases. Increased levels of HSP47 in fibrotic diseases are thought to assist in the increased assembly of procollagen, and thereby contribute to the excessive deposition of collagens in fibrotic areas. Currently, there is not a good universal histological marker to identify collagen-producing cells. Identifying phenotypically altered collagen-producing cells is essential for the development of cell-based therapies to reduce the progression of fibrotic diseases. Since HSP47 has a single substrate, which is collagen, the HSP47 cellular expression provides a novel universal biomarker to identify phenotypically altered collagen-producing cells during wound healing and fibrosis. In this brief article, we explained why HSP47 could be used as a universal marker for identifying phenotypically altered collagen-producing cells

  5. New strategies to produce and detect singlet oxygen in a cell

    DEFF Research Database (Denmark)

    Gollmer, Anita

    2012-01-01

    transfers its energy of excitation to oxygen. Systems with light, light absorbing molecules and molecular oxygen are present everywhere in nature, so this is a pertinent process. It is also conveniently reproduced with lamps and/or lasers to purposely kill undesired cells. The development and improvement of......, experiments were performed to achieve a reproducible assessment of cell response to a controlled dose of singlet oxygen produced in a spatially-localized two-photon sensitized experiment. Different assays were used to visualize cell response. In this dissertation, various aspects of fluorescence imaging and......Singlet oxygen, the first excited electronic state of molecular oxygen, plays a major role in oxygen-dependent photo-induced cell death. In such systems, singlet oxygen is generally produced in a photosensitized process wherein light is absorbed by a molecule (the so-called sensitizer) which then...

  6. CD45RO+ memory T-cells produce IL-17 in patients with atherosclerosis.

    Science.gov (United States)

    Behnamfar, N; Zibaeenezhad, M J; Golmoghaddam, H; Doroudchi, M

    2015-01-01

    Several CD4+ T helper (Th) cell subsets are shown to play a role in atherosclerotic lesion formation and progression. We investigated the frequencies of IL-17 and IFN-γ producing CD4+ T-cell subsets in the peripheral blood mononuclear cells (PBMCs) of 10 patients with atherosclerosis and 6 individuals with normal/insignificant coronary artery disease. Th1 and Th17 memory and effector T-cells were enumerated by flowcytometry and correlated with the clinical data and lipid profiles of the subjects. We found the ex-vivo (P=0.0001) and in-vitro production of IL-17 (P=0.001) but not IFN-γ by CD4+ memory T-cells of patients. CD45RO+ memory cells were the major producers of IL-17 and the CD4+CD45RO+PD-1- T-cells of the patients produced higher levels of IFN-γ than controls (P=0.02). Positive correlations between the frequency of CD4+CD45RO+IL-17+IFN-γ- T-cells and serum LDL-C (P=0.007), triglyceride (P=0.02), and systolic (P=0.001) and diastolic (P=0.009) blood pressures (BP) were found. The frequency of CD4+CD45RO+IL-17-IFN-γ- T-cells, which was higher in controls than patients, showed negative correlations with the serum LDL-C (P=0.01) and triglyceride (P=0.02) levels and systolic (P=0.003) and diastolic (P=0.01) BPs. The ex-vivo Th17 deviation of memory T-cells in atherosclerosis and high PD-1 expression are associated with the correlates of atherogenesis such as LDL, TG, and BP. PMID:26667768

  7. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17

    OpenAIRE

    Park, Heon; Li, Zhaoxia; Yang, Xuexian O.; Chang, Seon Hee; Nurieva, Roza; Wang, Yi-hong; Wang, Ying; Hood, Leroy; Zhu, Zhou; Tian, Qiang; Dong, Chen

    2005-01-01

    Interleukin 17 (IL-17) has been linked to autoimmune diseases, although its regulation and function have remained unclear. Here we have evaluated in vitro and in vivo the requirements for the differentiation of naive CD4 T cells into effector T helper cells that produce IL-17. This process required the costimulatory molecules CD28 and ICOS but was independent of the cytokines and transcription factors required for T helper type 1 or type 2 differentiation. Furthermore, both IL-4 and interfero...

  8. De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts

    Directory of Open Access Journals (Sweden)

    Yi-Ju Chen

    2014-03-01

    Full Text Available The ability to interconvert terminally differentiated cells could serve as a powerful tool for cell-based treatment of degenerative diseases, including diabetes mellitus. To determine which, if any, adult tissues are competent to activate an islet β cell program, we performed an in vivo screen by expressing three β cell “reprogramming factors” in a wide spectrum of tissues. We report that transient intestinal expression of these factors—Pdx1, MafA, and Ngn3 (PMN—promotes rapid conversion of intestinal crypt cells into endocrine cells, which coalesce into “neoislets” below the crypt base. Neoislet cells express insulin and show ultrastructural features of β cells. Importantly, intestinal neoislets are glucose-responsive and able to ameliorate hyperglycemia in diabetic mice. Moreover, PMN expression in human intestinal “organoids” stimulates the conversion of intestinal epithelial cells into β-like cells. Our results thus demonstrate that the intestine is an accessible and abundant source of functional insulin-producing cells.

  9. Proteomic differences in recombinant CHO cells producing two similar antibody fragments.

    Science.gov (United States)

    Sommeregger, Wolfgang; Mayrhofer, Patrick; Steinfellner, Willibald; Reinhart, David; Henry, Michael; Clynes, Martin; Meleady, Paula; Kunert, Renate

    2016-09-01

    Chinese hamster ovary (CHO) cells are the most commonly used mammalian hosts for the production of biopharmaceuticals. To overcome unfavorable features of CHO cells, a lot of effort is put into cell engineering to improve phenotype. "Omics" studies investigating elevated growth rate and specific productivities as well as extracellular stimulus have already revealed many interesting engineering targets. However, it remains largely unknown how physicochemical properties of the recombinant product itself influence the host cell. In this study, we used quantitative label-free LC-MS proteomic analyses to investigate product-specific proteome differences in CHO cells producing two similar antibody fragments. We established recombinant CHO cells producing the two antibodies, 3D6 and 2F5, both as single-chain Fv-Fc homodimeric antibody fragments (scFv-Fc). We applied three different vector strategies for transgene delivery (i.e., plasmid, bacterial artificial chromosome, recombinase-mediated cassette exchange), selected two best performing clones from transgene variants and transgene delivery methods and investigated three consecutively passaged cell samples by label-free proteomic analysis. LC-MS-MS profiles were compared in several sample combinations to gain insights into different aspects of proteomic changes caused by overexpression of two different heterologous proteins. This study suggests that not only the levels of specific product secretion but the product itself has a large impact on the proteome of the cell. Biotechnol. Bioeng. 2016;113: 1902-1912. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26913574

  10. Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

    Science.gov (United States)

    Lamont-Friedrich, Stephanie J.; Michl, Thomas D.; Giles, Carla; Griesser, Hans J.; Coad, Bryan R.

    2016-07-01

    The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata. Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others.

  11. CD4(+) T cells producing interleukin (IL)-17, IL-22 and interferon-? are major effector T cells in nickel allergy

    DEFF Research Database (Denmark)

    Dyring Andersen, Beatrice; Skov, Lone; Løvendorf, Marianne B; Bzorek, Michael; Søndergaard, Knud; Lauritsen, Jens-Peter H; Dabelsteen, Sally Anne Malene; Geisler, Carsten; Bonefeld, Charlotte Menné

    2013-01-01

    Background It has been suggested that interleukin (IL)-17 and IL-22 play important roles in the elicitation of human allergic contact dermatitis; however, the frequencies of T cell subtypes producing IL-17 and IL-22 in human allergic contact dermatitis are unknown. Objectives To determine the...... frequencies of CD4(+) , CD8(+) and γδ T cells producing IL-17, IL-22 and interferon (IFN)-γ in the blood and skin from nickel-allergic patients. Patients/materials/methods Blood samples were collected from 14 patients and 17 controls, and analysed by flow cytometry. Biopsies were taken from 5 patients and 6......-allergic patients, there was massive cellular infiltration dominated by CD4(+) T cells producing IL-17, IL-22 and IFN-γ in nickel-challenged skin but not in vehicle-challenged skin. Conclusion CD4(+) T cells producing IL-17, IL-22 and IFN-γ are important effector cells in the eczematous reactions of nickel...

  12. Pathogenic and regulatory T cells in type 1 diabetes: losing self-control, restoring it, and how to take the temperature.

    Science.gov (United States)

    Culina, Slobodan; Mallone, Roberto

    2011-10-01

    The central role of T cells in type 1 diabetes pathogenesis is well established, but these cells continue to pose numerous challenges in understanding their dynamics and in following their modifications. Important progress has been recently made in pinpointing some novel antigens targeted by pathogenic T cells and the epitope sequences recognized. Studies on the interplay between effector T cells, their regulatory counterparts, and cells of the innate immune system have unraveled novel pathways and may inspire new therapeutic approaches. At the same time, the appreciation of the plasticity of regulatory T cells has raised important caveats on their use for cell-based therapies. Continuous development of T-cell assays exploring both pathogenic and regulatory players will be critical to "take the temperature" of undergoing disease progression and reversal. PMID:21732231

  13. Human umbilical cord mesenchymal stem cells derived from Wharton's jelly differentiate into insulin-producing cells in vitro

    Institute of Scientific and Technical Information of China (English)

    WANG Hong-wu; LIN Li-min; HE Hong-yan; YOU Fang; LI Wei-zhong; HUANG Tian-hua; MA Gui-xia; MA Lian

    2011-01-01

    Background Islet transplantation is an effective way of reversing type Ⅰ diabetes. However, islet transplantation is hampered by issues such as immune rejection and shortage of donor islets. Mesenchymal stem cells can differentiate into insulin-producing cells. However, the potential of human umbilical cord mesenchymal stem cells (huMSCs) to become insulin-producing cells remains undetermined.Methods We isolated and induced cultured huMSCs under islet cell culture conditions. The response of huMSCs were monitored under an inverted phase contrast microscope. Immunocytochemical and immunofluorescence staining methods were used to measure insulin and glucagon protein levels. Reverse transcription-polymerase chain reaction (RT-PCR) was performed to detect gene expression of human insulin and PDX-1. Dithizone-staining was employed to determine the zinc contents in huMSCs. Insulin secretion was also evaluated through radioimmunoassay.Results HuMSCs induced by nicotinamide and β-mercaptoethanol or by neurogenic differentiation 1 gene (NeuroD1)transfection gradually changed morphology from typically elongated fibroblast-shaped cells to round cells. They had a tendency to form clusters. Immunocytochemical studies showed positive expression of human insulin and glucagon in these cells in response to induction. RT-PCR experiments found that huMSCs expressed insulin and PDX-1 genes following induction and dithizone stained the cytoplasm of huMSCs a brownish red color after induction. Insulin secretion in induced huMSCs was significantly elevated compared with the control group (t=6.183, P<0.05).Conclusions HuMSCs are able to differentiate into insulin-producing cells in vitro. The potential use of huMSCs in βcell replacement therapy of diabetes needs to be studied further.

  14. MicroRNA-146a expresses in interleukin-17 producing T cells in rheumatoid arthritis patients

    Directory of Open Access Journals (Sweden)

    Niimoto Takuya

    2010-09-01

    Full Text Available Abstract Background Interleukin (IL-17 is an important factor in rheumatoid arthritis (RA pathogenesis. MicroRNA (miRNAs are a family of non coding RNAs and associated with human diseases including RA. The purpose of this study is to identify the miRNAs in the differentiation of IL-17 producing cells, and analyze their expression pattern in the peripheral blood mononuclear cells (PBMC and synovium from RA patients. Methods IL-17 producing cells were expanded from CD4+T cell. MiRNA microarray was performed to identify the miRNAs in the differentiation of IL-17 producing cells. Quantitative polymerase chain reaction was performed to examine the expression patterns of the identified miRNAs in the PBMC and synovium from RA and osteoarthritis (OA patients. Double staining combining in situ hybridization and immunohistochemistry of IL-17 was performed to analyze the expression pattern of identified miRNA in the synovium. Results Six miRNAs, let-7a, miR-26, miR-146a/b, miR-150, and miR-155 were significantly up regulated in the IL-17 producing T cells. The expression of miR-146a and IL-17 was higher than in PBMC in the patients with low score of Larsen grade and short disease duration. MiR-146a intensely expressed in RA synovium in comparison to OA. MiR-146a expressed intensely in the synovium with hyperplasia and high expression of IL-17 from the patients with high disease activity. Double staining revealed that miR-146a expressed in IL-17 expressing cells. Conclusion These results indicated that miR-146a was associated with IL-17 expression in the PBMC and synovium in RA patients. There is the possibility that miR-146a participates in the IL-17 expression.

  15. Cell-penetration by Co(III)cyclen-based peptide-cleaving catalysts selective for pathogenic proteins of amyloidoses.

    Science.gov (United States)

    Chei, Woo Suk; Lee, Joo-Won; Kim, Jae Bum; Suh, Junghun

    2010-07-15

    Derivatives of the Co(III) complex of 1,4,7,10-tetraazacyclododecane (cyclen) with various organic pendants have been reported as target-selective peptide-cleaving catalysts, which can be exploited as catalytic drugs. In order to provide a firm basis for the catalytic drugs based on Co(III)cyclen, the ability of the Co(III)cyclen-containing peptide-cleaving catalysts to penetrate animal cells such as mouse fibroblast NIH-3T 3 or human embryonic kidney (HEK) 293 cells is demonstrated in the present study. Since the catalysts destroy pathogenic proteins for amyloidoses, results of the present study are expected to initiate extensive efforts to obtain therapeutically safe catalytic drugs for amyloidoses such as Alzheimer's disease, type 2 diabetes mellitus, Parkinson's disease, Huntington's disease, mad cow disease, and so on. PMID:20542701

  16. IL-22 is produced by innate lymphoid cells and limits inflammation in allergic airway disease

    OpenAIRE

    Taube, C; Tertilt, C; Gyülveszi, G; Dehzad, N; Kreymborg, K; Schneeweiss, K; E. Michel; Reuter, S; Renauld, J C; Arnold-Schild, D; Schild, H; Buhl, R; Becher, B. (Bertram)

    2011-01-01

    Interleukin (IL)-22 is an effector cytokine, which acts primarily on epithelial cells in the skin, gut, liver and lung. Both pro- and anti-inflammatory properties have been reported for IL-22 depending on the tissue and disease model. In a murine model of allergic airway inflammation, we found that IL-22 is predominantly produced by innate lymphoid cells in the inflamed lungs, rather than TH cells. To determine the impact of IL-22 on airway inflammation, we used allergen-sensitized IL-22-defi...

  17. IL-22 Is Produced by Innate Lymphoid Cells and Limits Inflammation in Allergic Airway Disease.

    OpenAIRE

    Taube, Christian; Tertilt, Christine; Gyülveszi, Gabor; Dehzad, Nina; Kreymborg, Katharina; Schneeweiss, Kristin; Michel, Erich; Reuter, Sebastian; Renauld, Jean-Christophe; Arnold-Schild, Danielle; Schild, Hansjörg; Buhl, Roland; Becher, Burkhard

    2011-01-01

    Interleukin (IL)-22 is an effector cytokine, which acts primarily on epithelial cells in the skin, gut, liver and lung. Both pro- and anti-inflammatory properties have been reported for IL-22 depending on the tissue and disease model. In a murine model of allergic airway inflammation, we found that IL-22 is predominantly produced by innate lymphoid cells in the inflamed lungs, rather than TH cells. To determine the impact of IL-22 on airway inflammation, we used allergen-sensitized IL-22-defi...

  18. Human B Cell-Derived Lymphoblastoid Cell Lines Constitutively Produce Fas Ligand and Secrete MHCII+FasL+ Killer Exosomes

    OpenAIRE

    Klinker, Matthew W.; Lizzio, Vincent; Reed, Tamra J.; Fox, David A.; Lundy, Steven K.

    2014-01-01

    Immune suppression mediated by exosomes is an emerging concept with potentially immense utility for immunotherapy in a variety of inflammatory contexts, including allogeneic transplantation. Exosomes containing the apoptosis-inducing molecule Fas ligand (FasL) have demonstrated efficacy in inhibiting antigen-specific immune responses upon adoptive transfer in animal models. We report here that a very high frequency of human B cell-derived lymphoblastoid cell lines (LCL) constitutively produce...

  19. IL-21-producer CD4+ T cell kinetics during primary simian immunodeficiency virus infection.

    Science.gov (United States)

    Shi, Shoi; Seki, Sayuri; Matano, Tetsuro; Yamamoto, Hiroyuki

    2013-01-01

    IL-21 signaling is important for T cell and B cell-mediated clearance of chronic viral infections. While non-cognate follicular helper CD4+ T cells (TFH) are indicated to be pivotal in providing IL-21-mediated help to activated B cells within germinal centers, how this signaling may be disrupted in early AIDS virus infection is not clear. In this study, we assessed the lineage and kinetics of peripheral blood IL-21-producing CD4+ T cells in primary simian immunodeficiency virus (SIV) infection of rhesus macaques. After SIV challenge, antigen-nonspecific IL-21 production was observed in Th1, Th2 and Th17 cells with Th1 dominance. While IL-21+ Th2 and IL-21+ Th17 showed variable kinetics, an increase in total IL-21+ CD4+ T cells and IL-21+ Th1 from week 3 to week 8 was observed, preceding plasma SIV-specific IgG development from week 5 to week 12. SIV Gag-specific IL-21+ CD4+ T cells detectable at week 2 were decreased in frequencies at week 5. Results imply that kinetics of IL-21+ CD4+ T cells comprised of multiple lineages, potentially targeted by SIV with a bias of existing frequencies during their precursor stage, associate with availability of cooperative B-cell help provided through a proportionate precursor pool developing into TFH and subsequent anti-SIV antibody responses. PMID:23791954

  20. Characterization of polyhormonal insulin-producing cells derived in vitro from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bruin

    2014-01-01

    Full Text Available Human embryonic stem cells (hESCs were used as a model system of human pancreas development to study characteristics of the polyhormonal cells that arise during fetal pancreas development. HESCs were differentiated into fetal-like pancreatic cells in vitro using a 33-day, 7-stage protocol. Cultures were ~90–95% PDX1-positive by day (d 11 and 70–75% NKX6.1-positive by d17. Polyhormonal cells were scattered at d17, but developed into islet-like clusters that expressed key transcription factors by d33. Human C-peptide and glucagon secretion were first detected at d17 and increased thereafter in parallel with INS and GCG transcript levels. HESC-derived cells were responsive to KCl and arginine, but not glucose in perifusion studies. Compared to adult human islets, hESC-derived cells expressed ~10-fold higher levels of glucose transporter 1 (GLUT1 mRNA, but similar levels of glucokinase (GCK. In situ hybridization confirmed the presence of GLUT1 transcript within endocrine cells. However, GLUT1 protein was excluded from this population and was instead observed predominantly in non-endocrine cells, whereas GCK was co-expressed in insulin-positive cells. In rubidium efflux assays, hESC-derived cells displayed mild potassium channel activity, but no responsiveness to glucose, metabolic inhibitors or glibenclamide. Western blotting experiments revealed that the higher molecular weight SUR1 band was absent in hESC-derived cells, suggesting a lack of functional KATP channels at the cell surface. In addition, KATP channel subunit transcript levels were not at a 1:1 ratio, as would be expected (SUR1 levels were ~5-fold lower than KIR6.2. Various ratios of SUR1:KIR6.2 plasmids were transfected into COSM6 cells and rubidium efflux was found to be particularly sensitive to a reduction in SUR1. These data suggest that an impaired ratio of SUR1:KIR6.2 may contribute to the observed KATP channel defects in hESC-derived islet endocrine cells, and along with

  1. IL-17 produced by Paneth cells drives TNF-induced shock.

    NARCIS (Netherlands)

    Takahashi, N.; Laere, I. van; Rycke, R de; Cauwels, A.; Joosten, L.A.B.; Lubberts, E.; Berg, W.B. van den; Libert, C.

    2008-01-01

    Tumor necrosis factor (TNF) has very potent antitumor activity, but it also provokes a systemic inflammatory response syndrome that leads to shock, organ failure, and death. Here, we demonstrate that interleukin (IL)-17, a proinflammatory cytokine known to be produced mainly by activated T cells, ha

  2. Pathogenicity of Toxoplasma gondii through B-2 cell-mediated downregulation of host defense responses

    International Nuclear Information System (INIS)

    IFN-γ is the primary mediator of anti-parasite effector mechanisms against Toxoplasma gondii. After intraperitoneal infection with the Fukaya strain of T. gondii, unirradiated IFN-γ knock-out (GKO) mice transferred with wild type (WT) CD8+ effector T cells from infected mice failed to induce the production of IFN-γ and died, whereas irradiated (IR) GKO mice transferred with WT CD8+ T cells induced IFN-γ production and survived more than 6 months. IR GKO mice transferred with WT CD8+ T cells together with GKO B-2 cells died 8 days after infection, whereas those transferred with WT CD8+ T cells together with B-1a or T cells survived. B-2 cells of infected GKO mice activated CD11b+ cells for IL-4 production, and down-regulated NO release, STAT1 phosphorylation, and interferon regulatory factor-1 expression in the peritoneal exudates cells of IR GKO mice transferred with WT CD8+ T cells together with GKO B-2 cells after infection. Thus, B-2 cells in T. gondii-infected mice act as suppressor cells in the host defense of infected mice. (author)

  3. Primary B-cell deficiencies reveal a link between human IL-17-producing CD4 T-cell homeostasis and B-cell differentiation.

    Directory of Open Access Journals (Sweden)

    Rita R Barbosa

    Full Text Available IL-17 is a pro-inflammatory cytokine implicated in autoimmune and inflammatory conditions. The development/survival of IL-17-producing CD4 T cells (Th17 share critical cues with B-cell differentiation and the circulating follicular T helper subset was recently shown to be enriched in Th17 cells able to help B-cell differentiation. We investigated a putative link between Th17-cell homeostasis and B cells by studying the Th17-cell compartment in primary B-cell immunodeficiencies. Common Variable Immunodeficiency Disorders (CVID, defined by defects in B-cell differentiation into plasma and memory B cells, are frequently associated with autoimmune and inflammatory manifestations but we found no relationship between these and Th17-cell frequency. In fact, CVID patients showed a decrease in Th17-cell frequency in parallel with the expansion of activated non-differentiated B cells (CD21(lowCD38(low. Moreover, Congenital Agammaglobulinemia patients, lacking B cells due to impaired early B-cell development, had a severe reduction of circulating Th17 cells. Finally, we found a direct correlation in healthy individuals between circulating Th17-cell frequency and both switched-memory B cells and serum BAFF levels, a crucial cytokine for B-cell survival. Overall, our data support a relationship between Th17-cell homeostasis and B-cell maturation, with implications for the understanding of the pathogenesis of inflammatory/autoimmune diseases and the physiology of B-cell depleting therapies.

  4. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Shogo [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Research Fellow of the Japan Society for the Promotion of Science, Tokyo (Japan); Nagasawa, Ayumi; Masuda, Yuya; Tsunematsu, Tetsuya [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Hayasaka, Koji; Matsuno, Kazuhiko; Shimizu, Chikara [Division of Laboratory and Transfusion Medicine, Hokkaido University Hospital, Sapporo (Japan); Ozaki, Yukio [Department of Clinical and Laboratory Medicine, Faculty of Medicine, University of Yamanashi (Japan); Moriyama, Takanori, E-mail: moriyama@hs.hokuda.ac.jp [Medical Laboratory Science, Faculty of Health Sciences, Hokkaido University, Sapporo (Japan)

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer It has been thought that BDNF is not produced in the megakaryocytic lineage. Black-Right-Pointing-Pointer MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. Black-Right-Pointing-Pointer BDNF accelerates proliferation of MEG-01 in an autocrine manner. Black-Right-Pointing-Pointer BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  5. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    International Nuclear Information System (INIS)

    Highlights: ► It has been thought that BDNF is not produced in the megakaryocytic lineage. ► MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. ► BDNF accelerates proliferation of MEG-01 in an autocrine manner. ► BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  6. Proteome data from a host-pathogen interaction study with Staphylococcus aureus and human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kristin Surmann

    2016-06-01

    Full Text Available To simultaneously obtain proteome data of host and pathogen from an internalization experiment, human alveolar epithelial A549 cells were infected with Staphylococcus aureus HG001 which carried a plasmid (pMV158GFP encoding a continuously expressed green fluorescent protein (GFP. Samples were taken hourly between 1.5 h and 6.5 h post infection. By fluorescence activated cell sorting GFP-expressing bacteria could be enriched from host cell debris, but also infected host cells could be separated from those which did not carry bacteria after contact (exposed. Additionally, proteome data of A549 cells which were not exposed to S. aureus but underwent the same sample processing steps are provided as a control. Time-resolved changes in bacterial protein abundance were quantified in a label-free approach. Proteome adaptations of host cells were monitored by comparative analysis to a stable isotope labeled cell culture (SILAC standard. Proteins were extracted from the cells, digested proteolytically, measured by nanoLC–MS/MS, and subsequently identified by database search and then quantified. The data presented here are related to a previously published research article describing the interplay of S. aureus HG001 and human epithelial cells (Surmann et al., 2015 [1]. They have been deposited to the ProteomeXchange platform with the identifiers PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002384 for the S. aureus HG001 proteome dataset and PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002388 for the A549 proteome dataset.

  7. The regulation of function, growth and survival of GLP-1-producing L-cells

    DEFF Research Database (Denmark)

    Kuhre, Rune Ehrenreich; Holst, Jens Juul; Kappe, Camilla

    2016-01-01

    absorption and disposal, as well as cell proliferation and survival. In Type 2 Diabetes (T2D) reduced plasma levels of GLP-1 have been observed, and plasma levels of GLP-1, as well as reduced numbers of GLP-1 producing cells, have been correlated to obesity and insulin resistance. Increasing endogenous...... secretion of GLP-1 by selective targeting of the molecular mechanisms regulating secretion from the L-cell has been the focus of much recent research. An additional and promising strategy for enhancing endogenous secretion may be to increase the L-cell mass in the intestinal epithelium, but the mechanisms......Glucagon-like peptide-1 (GLP-1) is a peptide hormone, released from intestinal L-cells in response to hormonal, neural and nutrient stimuli. In addition to potentiation of meal-stimulated insulin secretion, GLP-1 signalling exerts numerous pleiotropic effects on various tissues, regulating energy...

  8. Evidence for paracrine/autocrine regulation of GLP-1-producing cells

    DEFF Research Database (Denmark)

    Kappe, Camilla; Zhang, Qimin; Holst, Jens Juul;

    2013-01-01

    Glucagon-like peptide-1 (GLP-1), secreted from gut L cells upon nutrient intake, forms the basis for novel drugs against type 2 diabetes (T2D). Secretion of GLP-1 has been suggested to be impaired in T2D and in conditions associated with hyperlipidemia and insulin resistance. Further, recent...... studies support lipotoxicity of GLP-1-producing cells in vitro. However, little is known about the regulation of L-cell viability/function, the effects of insulin signaling, or the potential effects of stable GLP-1 analogs and dipeptidyl peptidase-4 (DPP-4) inhibitors. We determined effects of insulin as...... well as possible autocrine action of GLP-1 on viability/apoptosis of GLP-1-secreting cells in the presence/absence of palmitate, while also assessing direct effects on function. The studies were performed using the GLP-1-secreting cell line GLUTag, and palmitate was used to simulate hyperlipidemia. Our...

  9. Augmenting the Activity of Monoterpenoid Phenols against Fungal Pathogens Using 2-Hydroxy-4-methoxybenzaldehyde that Target Cell Wall Integrity.

    Science.gov (United States)

    Kim, Jong H; Chan, Kathleen L; Mahoney, Noreen

    2015-01-01

    Disruption of cell wall integrity system should be an effective strategy for control of fungal pathogens. To augment the cell wall disruption efficacy of monoterpenoid phenols (carvacrol, thymol), antimycotic potency of benzaldehyde derivatives that can serve as chemosensitizing agents were evaluated against strains of Saccharomyces cerevisiae wild type (WT), slt2Δ and bck1Δ (mutants of the mitogen-activated protein kinase (MAPK) and MAPK kinase kinase, respectively, in the cell wall integrity pathway). Among fourteen compounds investigated, slt2Δ and bck1Δ showed higher susceptibility to nine benzaldehydes, compared to WT. Differential antimycotic activity of screened compounds indicated "structure-activity relationship" for targeting the cell wall integrity, where 2-hydroxy-4-methoxybenzaldehyde (2H4M) exhibited the highest antimycotic potency. The efficacy of 2H4M as an effective chemosensitizer to monoterpenoid phenols (viz., 2H4M + carvacrol or thymol) was assessed in yeasts or filamentous fungi (Aspergillus, Penicillium) according to European Committee on Antimicrobial Susceptibility Testing or Clinical Laboratory Standards Institute M38-A protocols, respectively. Synergistic chemosensitization greatly lowers minimum inhibitory or fungicidal concentrations of the co-administered compounds. 2H4M also overcame the tolerance of two MAPK mutants (sakAΔ, mpkCΔ) of Aspergillus fumigatus to fludioxonil (phenylpyrrole fungicide). Collectively, 2H4M possesses chemosensitizing capability to magnify the efficacy of monoterpenoid phenols, which improves target-based (viz., cell wall disruption) antifungal intervention. PMID:26569223

  10. B-cell exposure to self-antigen induces IL-10 producing B cells as well as IL-6- and TNF-α-producing B-cell subsets in healthy humans

    DEFF Research Database (Denmark)

    Langkjær, Anina; Kristensen, Birte; Hansen, Bjarke E;

    2012-01-01

    Human B cells are able to secrete IL-10 after stimulation with mitogens, but their ability to produce IL-10 and regulate T-cell responses after stimulation with self-antigens is unclear. We co-cultured thyroglobulin-pulsed B cells from healthy donors with autologous T cells and observed production...... of IL-10 and TGF-β, in addition to TNF-α and IL-6. Pulsing with foreign antigen, tetanus toxoid (TT), induced a Th1-response with minimal IL-10 production. After thyroglobulin-pulsing, 1.10±0.50% of B cells and 1.00±0.20% of CD4(+) T cells produced IL-10, compared to 0.29±0.19% of B cells (P=0.......01) and 0.13±0.15% of CD4(+) T cells (P=0.006) following TT-pulsing. Thyroglobulin-stimulated, IL-10-secreting B cells were enriched within CD5(+) and CD24(high) cells. While thyroglobulin-pulsed B cells induced only modest proliferation of CD4(+) T cells, B cells pulsed with TT induced vigorous...

  11. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1

    Directory of Open Access Journals (Sweden)

    Amir Allahverdi

    2015-07-01

    Full Text Available Objective: Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1 is a master regulator gene required for embryonic development of the pancreas and is crucial for normal pancreatic islets activities in adults. Materials and Methods: We induced the over-expression of the PDX1 gene in human bone marrow MSCs (BM-MSCs by Lenti-PDX1 in order to generate IPCs. Next, we examine the ability of the cells by measuring insulin/c-peptide production and INSULIN and PDX1 gene expressions. Results: After transduction, MSCs changed their morphology at day 5 and gradually differentiated into IPCs. INSULIN and PDX1 expressions were confirmed by real time polymerase chain reaction (RT-PCR and immunostaining. IPC secreted insulin and C-peptide in the media that contained different glucose concentrations. Conclusion: MSCs differentiated into IPCs by genetic manipulation. Our result showed that lentiviral vectors could deliver PDX1 gene to MSCs and induce pancreatic differentiation.

  12. B-cell infiltration and frequency of cytokine producing cells differ between localized and disseminated human cutaneous leishmaniases

    Directory of Open Access Journals (Sweden)

    MGS Vieira

    2002-10-01

    Full Text Available Biopsies from human localized cutaneous lesions (LCL n = 7 or disseminated lesions (DL n = 8 cases were characterized according to cellular infiltration,frequency of cytokine (IFN-g, TNF-alpha or iNOS enzyme producing cells. LCL, the most usual form of the disease with usually one or two lesions, exhibits extensive tissue damage. DL is a rare form with widespread lesions throughout the body; exhibiting poor parasite containment but less tissue damage. We demonstrated that LCL lesions exhibit higher frequency of B lymphocytes and a higher intensity of IFN-gamma expression. In both forms of the disease CD8+ were found in higher frequency than CD4+ T cells. Frequency of TNF-alpha and iNOS producing cells, as well as the frequency of CD68+ macrophages, did not differ between LCL and DL. Our findings reinforce the link between an efficient control of parasite and tissue damage, implicating higher frequency of IFN-gamma producing cells, as well as its possible counteraction by infiltrated B cells and hence possible humoral immune response in situ.

  13. Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

    OpenAIRE

    Carlos P Taborda; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

    2008-01-01

    Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

  14. Pathogenic Actions of Cell Adhesion Molecule 1 in Pulmonary Emphysema and Atopic Dermatitis

    OpenAIRE

    Yoneshige, Azusa; Hagiyama, Man; Fujita, Mitsugu; Ito, Akihiko

    2015-01-01

    Cell adhesion mediated by adhesion molecules is of central importance in the maintenance of tissue homeostasis. Therefore, altered expression of adhesion molecules leads to the development of various tissue disorders involving cell activation, degeneration, and apoptosis. Nevertheless, it still remains unclear what initiates the altered expression of adhesion molecules and how the subsequent pathological cascades proceed. In this regard, cell adhesion molecule 1 (CADM1) is one of the candidat...

  15. Differentiation of P19 embryonal carcinoma stem cells into insulin-producing cells promoted by pancreas-conditioned medium.

    Science.gov (United States)

    Mansouri, Akram; Esmaeili, Fariba; Nejatpour, Azadeh; Houshmand, Fariba; Shabani, Leila; Ebrahimie, Esmaeil

    2016-07-01

    The ability of embryonal carcinoma )EC (stem cells to generate insulin-producing cells (IPCs) is still unknown. We examined the trophic effects of pancreas-conditioned medium (PCM) on in vitro production of IPCs. Initially, P19 EC cells were characterized by the expression of stem cell markers, Oct3/4, Sox-2 and Nanog. To direct differentiation, P19-derived embryoid bodies (EBs) were induced by selection of nestin-positive cells and treatment with different concentrations of PCM. Morphological studies documented the presence of islet-like cell IPCs clusters. The differentiated cells were immunoreactive for β cell-specific proteins, including insulin, proinsulin, C-peptide and insulin receptor-β. The expression of genes related to pancreatic β cell development and function (PDX-1, INS1, INS2, EP300 and CREB1) was confirmed by qPCR. During differentiation, the expression of EP300 and CREB1 increased by 2.5 and 3.1 times, respectively. In contrast, a sharp decrease in the expression of Oct3/4, Sox-2 and Nanog by 4, 1.5 and 1.5 times, respectively, was observed. The differentiated cells were functionally active, synthesizing and secreting insulin in a glucose-regulated manner. Network prediction highlighted crosstalk between PDX-1 transcription factor and INS2 ligand in IPC generation and revealed positive regulatory effects of EP300, CREB1, PPARA, EGR, KIT, GLP1R, and PKT2 on activation of PDX-1 and INS2. This is the first report of the induction of IPC differentiation from EC cells by using neonate mouse PCM. Since P19 EC cells are widely available, easily cultured without feeders and do not require special growth conditions, they would provide a valuable tool for studying pancreatic β cell differentiation and development. Copyright © 2016 John Wiley & Sons, Ltd. PMID:25044225

  16. Starting to Gel: How Arabidopsis Seed Coat Epidermal Cells Produce Specialized Secondary Cell Walls

    Directory of Open Access Journals (Sweden)

    Cătălin Voiniciuc

    2015-02-01

    Full Text Available For more than a decade, the Arabidopsis seed coat epidermis (SCE has been used as a model system to study the synthesis, secretion and modification of cell wall polysaccharides, particularly pectin. Our detailed re-evaluation of available biochemical data highlights that Arabidopsis seed mucilage is more than just pectin. Typical secondary wall polymers such as xylans and heteromannans are also present in mucilage. Despite their low abundance, these components appear to play essential roles in controlling mucilage properties, and should be further investigated. We also provide a comprehensive community resource by re-assessing the mucilage phenotypes of almost 20 mutants using the same conditions. We conduct an in-depth functional evaluation of all the SCE genes described in the literature and propose a revised model for mucilage production. Further investigation of SCE cells will improve our understanding of plant cell walls.

  17. Androgen excess produces systemic oxidative stress and predisposes to beta-cell failure in female mice.

    Directory of Open Access Journals (Sweden)

    Suhuan Liu

    Full Text Available In women, excess production of the male hormone, testosterone (T, is accompanied by insulin resistance. However, hyperandrogenemia is also associated with beta-cell dysfunction and type 2 diabetes raising the possibility that androgen receptor (AR activation predisposes to beta-cell failure. Here, we tested the hypothesis that excess AR activation produces systemic oxidative stress thereby contributing to beta-cell failure. We used normal female mice (CF and mice with androgen resistance by testicular feminization (Tfm. These mice were exposed to androgen excess and a beta-cell stress induced by streptozotocin (STZ. We find that following exposure to T, or the selective AR-agonist dehydrotestosterone (DHT, CF mice challenged with STZ, which are normally protected, are prone to beta-cell failure and insulin-deficient diabetes. Conversely, T-induced predisposition to beta-cell failure is abolished in Tfm mice. We do not observe any proapoptotic effect of DHT alone or in the presence of H(2O(2 in cultured mouse and human islets. However, we observe that exposure of CF mice to T or DHT provokes systemic oxidative stress, which is eliminated in Tfm mice. This work has significance for hyperandrogenic women; excess activation of AR by testosterone may provoke systemic oxidative stress. In the presence of a prior beta-cell stress, this may predispose to beta-cell failure.

  18. Prevention of immunodeficiency virus induced CD4+ T-cell depletion by prior infection with a non-pathogenic virus

    International Nuclear Information System (INIS)

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIVPCO) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is not the primary cause of immunodeficiency. Although this approach was analogous to immunization with a modified live vaccine, correlates of immunity such as a serum-neutralizing antibody or virus-specific T-cell proliferative response were not found in protected animals. Differences in cytokine transcription profile, most notably in interferon gamma, were observed between the protected and unprotected groups. These data provide support for the importance of non-adaptive enhancement of the immune response in the prevention of CD4+ T-cell loss

  19. The ClpP protease homologue is required for the transmission traits and cell division of the pathogen Legionella pneumophila

    Directory of Open Access Journals (Sweden)

    Zhang Qin-fen

    2010-02-01

    Full Text Available Abstract Background Legionella pneumophila, the intracellular bacterial pathogen that causes Legionnaires' disease, exhibit characteristic transmission traits such as elevated stress tolerance, shortened length and virulence during the transition from the replication phase to the transmission phase. ClpP, the catalytic core of the Clp proteolytic complex, is widely involved in many cellular processes via the regulation of intracellular protein quality. Results In this study, we showed that ClpP was required for optimal growth of L. pneumophila at high temperatures and under several other stress conditions. We also observed that cells devoid of clpP exhibited cell elongation, incomplete cell division and compromised colony formation. Furthermore, we found that the clpP-deleted mutant was more resistant to sodium stress and failed to proliferate in the amoebae host Acanthamoeba castellanii. Conclusions The data present in this study illustrate that the ClpP protease homologue plays an important role in the expression of transmission traits and cell division of L. pneumophila, and further suggest a putative role of ClpP in virulence regulation.

  20. Surface properties and cell behaviour of diamond-like carbon coatings produced by plasma immersion

    International Nuclear Information System (INIS)

    The morphology, microstructure and roughness of the diamond-like carbon (DLC) films produced by plasma immersion were investigated. Vero cells (fibroblasts) were utilized for the in vitro biocompatibility studies of the DLC-coated Ti-13Nb-13Zr alloy. In the cytotoxicity assay, fibroblast cells were cultured for a period of 24 h, and in the adhesion assay, cells were cultured for a period of 2 and 24 h. The cell morphology was investigated by scanning electron microscopy (SEM) and atomic force microscopy (AFM). No evidence was found that the presence of the DLC coating had any adverse effect. Our results show that the adherence of fibroblasts was significantly enhanced when Ti alloy was coated with DLC from the uncoated

  1. A case of an alpha-fetoprotein-producing intrahepatic cholangiocarcinoma suggests probable cancer stem cell origin.

    Science.gov (United States)

    Ishikawa, Kenji; Sasaki, Atsushi; Haraguchi, Naotsugu; Yoshikawa, Yasuji; Mori, Masaki

    2007-03-01

    Recent evidence suggests that some cancers may originate from cancer stem cells, which may derive from carcinogenesis of normal stem cells. A hepatic progenitor cell population, which gives rise to hepatocytes and cholangiocytes, has been suggested in humans, though whether these cells can give rise to malignant tumors has not been confirmed. We report here a case of an alpha-fetoprotein (AFP)-producing intrahepatic cholangiocarcinoma (ICC) in an 81-year-old woman with chronic hepatitis C viral infection, suggesting malignant transformation of hepatic stem cells as a mechanism for hepatic neoplasia. Abdominal computed tomography revealed a low-density mass with surrounding enhancement measuring 5 cm x 5 cm in segments IV and VIII of the liver. The preoperative serum levels of tumor markers were 1.7 ng/ml of carcinoembryonic antigen, 22 mAU/ml of protein induced by vitamin K absence or antagonist II, 43.4 U/ml of carbohydrate antigen 19-9, and 1,560 ng/ml of AFP. Following central bisegmentectomy of the liver, serum AFP levels decreased dramatically. Histologically, the tumor cells showed indistinct glandular structures with abundant fibrous stroma. Immunohistochemical analysis demonstrated that the neoplastic cells reacted strongly to antibodies against AFP and cytokeratin (CK) 7. In addition, cancer cells showed partially positive reaction to anti-CK14, a liver stem cell marker, and to anticluster designation (CD) 133, a hematopoietic stem cell marker, and negative reaction to antihepatocyte paraffin (HepPar) 1. These data may indicate that the tumor was derived from a normal liver stem cell that underwent oncogenic transformation. PMID:17405896

  2. Preadipocyte factor 1 induces pancreatic ductal cell differentiation into insulin-producing cells.

    Science.gov (United States)

    Rhee, Marie; Lee, Seung-Hwan; Kim, Ji-Won; Ham, Dong-Sik; Park, Heon-Seok; Yang, Hae Kyung; Shin, Ju-Young; Cho, Jae-Hyoung; Kim, Young-Bum; Youn, Byung-Soo; Sul, Hei Sook; Yoon, Kun-Ho

    2016-01-01

    The preadipocyte factor 1 (Pref-1) is involved in the proliferation and differentiation of various precursor cells. However, the intracellular signaling pathways that control these processes and the role of Pref-1 in the pancreas remain poorly understood. Here, we showed that Pref-1 induces insulin synthesis and secretion via two independent pathways. The overexpression of Pref-1 activated MAPK signaling, which induced nucleocytoplasmic translocation of FOXO1 and PDX1 and led to the differentiation of human pancreatic ductal cells into β-like cells and an increase in insulin synthesis. Concurrently, Pref-1 activated Akt signaling and facilitated insulin secretion. A proteomics analysis identified the Rab43 GTPase-activating protein as a downstream target of Akt. A serial activation of both proteins induced various granular protein syntheses which led to enhanced glucose-stimulated insulin secretion. In a pancreatectomised diabetic animal model, exogenous Pref-1 improved glucose homeostasis by accelerating pancreatic ductal and β-cell regeneration after injury. These data establish a novel role for Pref-1, opening the possibility of applying this molecule to the treatment of diabetes. PMID:27044861

  3. Analysis of the role of the LH92_11085 gene of a biofilm hyper-producing Acinetobacter baumannii strain on biofilm formation and attachment to eukaryotic cells.

    Science.gov (United States)

    Álvarez-Fraga, Laura; Pérez, Astrid; Rumbo-Feal, Soraya; Merino, María; Vallejo, Juan Andrés; Ohneck, Emily J; Edelmann, Richard E; Beceiro, Alejandro; Vázquez-Ucha, Juan C; Valle, Jaione; Actis, Luis A; Bou, Germán; Poza, Margarita

    2016-05-18

    Acinetobacter baumannii is a nosocomial pathogen that has a considerable ability to survive in the hospital environment partly due to its capacity to form biofilms. The first step in the process of establishing an infection is adherence of the bacteria to target cells. Chaperone-usher pili assembly systems are involved in pilus biogenesis pathways that play an important role in adhesion to host cells and tissues as well as medically relevant surfaces. After screening a collection of strains, a biofilm hyper-producing A. baumannii strain (MAR002) was selected to describe potential targets involved in pathogenicity. MAR002 showed a remarkable ability to form biofilm and attach to A549 human alveolar epithelial cells. Analysis of MAR002 using transmission electron microscopy (TEM) showed a significant presence of pili on the bacterial surface. Putative protein-coding genes involved in pili formation were identified based on the newly sequenced genome of MAR002 strain (JRHB01000001/2 or NZ_JRHB01000001/2). As assessed by qRT-PCR, the gene LH92_11085, belonging to the operon LH92_11070-11085, is overexpressed (ca. 25-fold more) in biofilm-associated cells compared to exponential planktonic cells. In the present work we investigate the role of this gene on the MAR002 biofilm phenotype. Scanning electron microscopy (SEM) and biofilm assays showed that inactivation of LH92_11085 gene significantly reduced bacterial attachment to A549 cells and biofilm formation on plastic, respectively. TEM analysis of the LH92_11085 mutant showed the absence of long pili formations normally present in the wild-type. These observations indicate the potential role this LH92_11085 gene could play in the pathobiology of A baumannii. PMID:26854744

  4. Deoxysphingolipids, novel biomarkers for type 2 diabetes, are cytotoxic for insulin-producing cells.

    Science.gov (United States)

    Zuellig, Richard A; Hornemann, Thorsten; Othman, Alaa; Hehl, Adrian B; Bode, Heiko; Güntert, Tanja; Ogunshola, Omolara O; Saponara, Enrica; Grabliauskaite, Kamile; Jang, Jae-Hwi; Ungethuem, Udo; Wei, Yu; von Eckardstein, Arnold; Graf, Rolf; Sonda, Sabrina

    2014-04-01

    Irreversible failure of pancreatic β-cells is the main culprit in the pathophysiology of diabetes, a disease that is now a global epidemic. Recently, elevated plasma levels of deoxysphingolipids, including 1-deoxysphinganine, have been identified as a novel biomarker for the disease. In this study, we analyzed whether deoxysphingolipids directly compromise the functionality of insulin-producing Ins-1 cells and primary islets. Treatment with 1-deoxysphinganine induced dose-dependent cytotoxicity with senescent, necrotic, and apoptotic characteristics and compromised glucose-stimulated insulin secretion. In addition, 1-deoxysphinganine altered cytoskeleton dynamics, resulting in intracellular accumulation of filamentous actin and activation of the Rho family GTPase Rac1. Moreover, 1-deoxysphinganine selectively upregulated ceramide synthase 5 expression and was converted to 1-deoxy-dihydroceramides without altering normal ceramide levels. Inhibition of intracellular 1-deoxysphinganine trafficking and ceramide synthesis improved the viability of the cells, indicating that the intracellular metabolites of 1-deoxysphinganine contribute to its cytotoxicity. Analyses of signaling pathways identified Jun N-terminal kinase and p38 mitogen-activated protein kinase as antagonistic effectors of cellular senescence. The results revealed that 1-deoxysphinganine is a cytotoxic lipid for insulin-producing cells, suggesting that the increased levels of this sphingolipid observed in diabetic patients may contribute to the reduced functionality of pancreatic β-cells. Thus, targeting deoxysphingolipid synthesis may complement the currently available therapies for diabetes. PMID:24379346

  5. Embryonic stem-like cells derived from in vitro produced bovine blastocysts

    Directory of Open Access Journals (Sweden)

    Erika Regina Leal de Freitas

    2011-06-01

    Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.

  6. IL-17A-producing T cells are associated with the progression of lung adenocarcinoma.

    Science.gov (United States)

    Bao, Zhang; Lu, Guohua; Cui, Dawei; Yao, Yinan; Yang, Guangdie; Zhou, Jianying

    2016-08-01

    Accumulating evidence has shown that T cells are crucial in shaping the tumor microenvironment and regulating tumor development. However, the roles of IL-17A‑producingcells (IL-17A+CD4+ Th17, IL-17A+CD8+ Tc17 and IL-17A+ γδT17 cells) and related cytokines in the progression of lung cancer (LC) remain uncertain. Here, we found that the frequencies of both Th17 and γδT17 cells in the peripheral blood of patients with lung adenocarcinoma (LA) were higher than those in healthy controls (HCs), whereas the frequency of Tc17 cells in the patients with LA was decreased. In addition, the frequencies of circulating Th17 and γδT17 cells, but not Tc17 cells, were positively associated with tumor invasion and metastasis. Furthermore, the major source of IL-17A production was Th17 cells, followed by Tc17 and γδT17 cells, in peripheral blood from patients with LA and HCs; but the percentages of Th17 and γδT17 cells in total intracellular IL-17A+ cells obtained from the patients with LC were higher than those from HCs. Moreover, the protein and corresponding mRNA levels of IL-17A, IL-23, IL-1β, and TGF-β1 were much higher in the patients with LA than those in HCs, and the levels of IL-17A in patients were positively correlated with numbers of both Th17 and γδT17 cells, but not Tc17 cells. Finally, the frequencies of circulating Th17 and γδT17 cells, along with the levels of IL-17A, IL-23, IL-1β, and TGF-β1 were decreased in the patients with LA after tumor resection, whereas the frequency of circulating Tc17 cells was inversely increased in these patients. Our findings indicate that Th17, Tc17, γδT17 cells, and IL-17A-associated cytokines contribute to the development of LA and thus represent promising targets for therapeutic strategies. PMID:27277161

  7. Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector.

    OpenAIRE

    Smith, G.E.; Ju, G; Ericson, B L; Moschera, J; Lahm, H W; Chizzonite, R; Summers, M D

    1985-01-01

    A cDNA coding for human interleukin 2 (IL-2) was inserted into the genome of Autographa californica nuclear polyhedrosis virus adjacent to the polyhedrin promoter. Cells infected with recombinant virus produced high levels of Mr 15,500 IL-2 polypeptide, the majority of which was secreted into the culture medium during infection. The recombinant IL-2 was able to stimulate the growth of an IL-2-dependent cell line. The N-terminal amino acid sequence of the insect-derived IL-2 was identical to t...

  8. Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

    Energy Technology Data Exchange (ETDEWEB)

    Lea, P.J.; Pawlowski, A.; Persad, S.D.; Menon, I.A.; Haberman, H.F.

    1988-01-01

    Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells.

  9. Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

    International Nuclear Information System (INIS)

    Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells

  10. Pathogen-mediated proteolysis of the cell death regulator RIPK1 and the host defense modulator RIPK2 in human aortic endothelial cells.

    Directory of Open Access Journals (Sweden)

    Andrés G Madrigal

    Full Text Available Porphyromonas gingivalis is the primary etiologic agent of periodontal disease that is associated with other human chronic inflammatory diseases, including atherosclerosis. The ability of P. gingivalis to invade and persist within human aortic endothelial cells (HAEC has been postulated to contribute to a low to moderate chronic state of inflammation, although how this is specifically achieved has not been well defined. In this study, we demonstrate that P. gingivalis infection of HAEC resulted in the rapid cleavage of receptor interacting protein 1 (RIPK1, a mediator of tumor necrosis factor (TNF receptor-1 (TNF-R1-induced cell activation or death, and RIPK2, a key mediator of both innate immune signaling and adaptive immunity. The cleavage of RIPK1 or RIPK2 was not observed in cells treated with apoptotic stimuli, or cells stimulated with agonists to TNF-R1, nucleotide oligomerization domain receptor 1(NOD1, NOD2, Toll-like receptor 2 (TLR2 or TLR4. P. gingivalis-induced cleavage of RIPK1 and RIPK2 was inhibited in the presence of a lysine-specific gingipain (Kgp inhibitor. RIPK1 and RIPK2 cleavage was not observed in HAEC treated with an isogenic mutant deficient in the lysine-specific gingipain, confirming a role for Kgp in the cleavage of RIPK1 and RIPK2. Similar proteolysis of poly (ADP-ribose polymerase (PARP was observed. We also demonstrated direct proteolysis of RIPK2 by P. gingivalis in a cell-free system which was abrogated in the presence of a Kgp-specific protease inhibitor. Our studies thus reveal an important role for pathogen-mediated modification of cellular kinases as a potential strategy for bacterial persistence within target host cells, which is associated with low-grade chronic inflammation, a hallmark of pathogen-mediated chronic inflammatory disorders.

  11. Interaction of the pathogenic mold Aspergillus fumigatus with lung epithelial cells

    Directory of Open Access Journals (Sweden)

    NirOsherov

    2012-09-01

    Full Text Available Aspergillus fumigatus is an opportunistic environmental mold that can cause severe allergic responses in atopic individuals and poses a life-threatening risk for severely immunocompromised patients. Infection is caused by inhalation of fungal spores (conidia into the lungs. The initial point of contact between the fungus and the host is a monolayer of lung epithelial cells. Understanding how these cells react to fungal contact is crucial to elucidating the pathobiology of Aspergillus-related disease states. The experimental systems, both in vitro and in vivo, used to study these interactions, are described. Distinction is made between bronchial and alveolar epithelial cells. The experimental findings suggest that lung epithelial cells are more than just “innocent bystanders” or a purely physical barrier against infection. They can be better described as an active extension of our innate immune system, operating as a surveillance mechanism that can specifically identify fungal spores and activate an offensive response to block infection. This response includes the internalization of adherent conidia and the release of cytokines, antimicrobial peptides and reactive oxygen species. In the case of allergy, lung epithelial cells can dampen an over-reactive immune response by releasing anti-inflammatory compounds such as kinurenine. This review summarizes our current knowledge regarding the interaction of A. fumigatus with lung epithelial cells. A better understanding of the interactions between A. fumigatus and lung epithelial cells has therapeutic implications, as stimulation or inhibition of the epithelial response may alter disease outcome.

  12. Structure and function of a unique pore-forming protein from a pathogenic acanthamoeba

    NARCIS (Netherlands)

    Michalek, M.; Sönnichsen, F.D.; Wechselberger, R.W.; Wienk, H.L.J.; Leippe, M.; et al., [No Value

    2013-01-01

    Human pathogens often produce soluble protein toxins that generate pores inside membranes, resulting in the death of target cells and tissue damage. In pathogenic amoebae, this has been exemplified with amoebapores of the enteric protozoan parasite Entamoeba histolytica. Here we characterize acantha

  13. Development of disease preventive method using radiated pathogenic microorganisms, cell lines and animals

    International Nuclear Information System (INIS)

    A radiated bone marrow chimera mouse has been constructed by grafting. This chimera mouse was thought useful for analyzing gene specific functions in vivo. This study aimed to construct a vector available for a study on the functions of various genes that were cloned from animals through their constitutive expressions. Construction of a retroviral vector was attempted using spleen focus forming virus (SFFV), a mouse leukemia virus. The virus thus obtained was demonstrated to be able to express the gene when infected to NIH3T3, a mouse fibroblast cell line. Furthermore, packaging cells were constructed by transfecting the retroviral vector into the fibroblast cell. Bone marrow cells were incubated with the packaging cells for several days to make gene transfection into the bone marrow cells. After radiation exposure at a lethal dose, the mouse was grafted with the bone marrow cells. Thus, it became possible to investigate in vivo functions of a cloned gene through its expression in the cells. Then, development of a retroviral vector was attempted to use for transfection into bone marrow cells. Aujeszky's disease virus, a large size DNA virus was exposed to Co radiation at -78degC, but the infectivity of the irradiated virus was not detectable. Since viral RNA was demonstrated to be already broken 24 hours after the exposure to β-ray, the effects of β-radiation were examined with swine vesicular disease virus, a small RNA virus. This virus was exposed to α-32dATP (37MBq) as a β-ray source for 1 hour to 96 hours. However, there were no significant differences in the infectivity titer between the virus exposed for any of the durations and the control, non-radiated virus. This suggested that the virus was not inactivated under the present conditions. Further investigation to determine exposure conditions is under way. (M.N.)

  14. Calpains are involved in asexual and sexual development, cell wall integrity and pathogenicity of the rice blast fungus.

    Science.gov (United States)

    Liu, Xiao-Hong; Ning, Guo-Ao; Huang, Lu-Yao; Zhao, Ya-Hui; Dong, Bo; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-01-01

    Calpains are ubiquitous and well-conserved proteins that belong to the calcium-dependent, non-lysosomal cysteine protease family. In this study, 8 putative calpains were identified using Pfam domain analysis and BlastP searches in M. oryzae. Three single gene deletion mutants (ΔMocapn7, ΔMocapn9 and ΔMocapn14) and two double gene deletion mutants (ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7) were obtained using the high-throughput gene knockout system. The calpain disruption mutants showed defects in colony characteristics, conidiation, sexual reproduction and cell wall integrity. The mycelia of the ΔMocapn7, ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7 mutants showed reduced pathogenicity on rice and barley. PMID:27502542

  15. ADAM12 produced by tumor cells rather than stromal cells accelerates breast tumor progression

    DEFF Research Database (Denmark)

    Frohlich, Camilla; Nehammer, Camilla; Albrechtsen, Reidar;

    2011-01-01

    ADAM12 deficiency reduces breast tumor progression in the PyMT model. However, the catalytic activity of ADAM12 appears to be dispensable for its tumor-promoting effect. Interestingly, we demonstrate that ADAM12 endogenously expressed in tumor-associated stroma in the PyMT model does not influence......Expression of ADAM12 is low in most normal tissues, but is markedly increased in numerous human cancers, including breast carcinomas. We have previously shown that overexpression of ADAM12 accelerates tumor progression in a mouse model of breast cancer (PyMT). In the present study, we found that...... tumor progression, but that ADAM12 expression by tumor cells is necessary for tumor progression in these mice. This finding is consistent with our observation that in human breast carcinoma ADAM12 is almost exclusively located in tumor cells and only rarely seen in the tumor-associated stroma. We...

  16. Distinct cytokines balance the development of regulatory T cells and interleukin-10-producing regulatory B cells

    Czech Academy of Sciences Publication Activity Database

    Holáň, Vladimír; Zajícová, Alena; Javorková, Eliška; Trošan, Peter; Chudičková, Milada; Pavlíková, M.; Krulová, Magdaléna

    2014-01-01

    Roč. 141, č. 4 (2014), s. 577-586. ISSN 0019-2805 R&D Projects: GA MZd(CZ) NT14102; GA ČR(CZ) GAP301/11/1568; GA ČR GAP304/11/0653 Grant ostatní: GA MŠk(CZ) MSM0021620858 Institutional support: RVO:68378041 Keywords : Autoregulation * B cells * Cytokines Subject RIV: FF - HEENT, Dentistry Impact factor: 3.795, year: 2014

  17. Vascular cell responses to ECM produced by smooth muscle cells on TiO2 nanotubes

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • TiO2 nanotubes with the tube diameter of 30 nm via anodic oxidation was prepared. • SMCs on TiO2 nanotubes presented enhanced extracellular matrix secreting. • ECM prepared via decellularization retained the components: Fn, Ln and collagen. • ECM-covered TiO2 nanotubes significantly improved the proliferation of ECs. - Abstract: There is an increasing interest in developing new methods to promote biocompatibility of biomedical materials. The TiO2 nanotubes with the tube diameter of 30 nm were prepared by anodization. The response behavior of the human umbilical vein endothelial cell (HUVEC) and human umbilical artery smooth muscle cell (HUASMC) to these different nanotube sizes was investigated. Compared to the flat Ti, the growth and viability of HUVEC are prohibited, but there was no significant difference of HUASMC on 30 nm TiO2 nanotubes. In this study, extracellular matrix (ECM) as a complex cellular environment which provides structural support to cells and regulates the cells functions was further used to modify the biological properties of TiO2 nanotubes. The ECM secreted from HUASMC was successfully deposited onto the 30 nm TiO2 nanotubes. Moreover, immunofluorescence staining of common ECM components, such as fibronectin, laminin and type IV collagen, also indicated the successful ECM-covering on nanotube surfaces. Interestingly, the surface of ECM-covered TiO2 nanotubes significantly improved the proliferation of HUVECs in vitro. This suggested that the ECM secreted from HUASMCs on the TiO2 nanotubular surface could further improve the HUVECs adhesion and proliferation

  18. Protection against lethal challenge by Ebola virus-like particles produced in insect cells

    OpenAIRE

    Sun, Yuliang; Carrion, Ricardo; Ye, Ling; Wen, Zhiyuan; Ro, Young-Tae; Brasky, Kathleen; Ticer, Anysha E.; Schwegler, E. Ellen; Patterson, Jean L.; Compans, Richard W.; Yang, Chinglai

    2008-01-01

    Ebola virus-like particles (VLPs) were produced in insect cells using a recombinant baculovirus expression system and their efficacy for protection against Ebola virus infection was investigated. Two immunizations with 50 ug Ebola VLPs (high dose) induced a high level of antibodies against Ebola GP that exhibited strong neutralizing activity against GP-mediated virus infection and conferred complete protection of vaccinated mice against lethal challenge by a high dose of mouse-adapted Ebola v...

  19. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    OpenAIRE

    Naiara Costa Cinegaglia; Paulo Ricardo Oliveira Bersano; Maria José Abigail Mendes Araújo; Michelle Cristiane Búfalo; José Maurício Sforcin

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

  20. Channel-forming proteins in the cell wall of amino acid-producing Corynebacteria

    OpenAIRE

    Hünten, Peter

    2005-01-01

    Corynebacterium glutamicum is together with C. callunae and C. efficiens a member of the diverse group of mycolic-acid containing actinomycetes, the mycolata. These bacteria are potent producer of glutamate, lysine and other amino acids on industrial scale. The cell walls of most actinomycetes contain besides an arabinogalactan-peptidoglycan complex large amounts of mycolic acids. This three-layer envelope is called MAP (mycolyl-arabinogalactan-peptidoglycan) complex and it represents a secon...

  1. Removal of Cadmium and Zinc from Soil using Immobilized Cell of Biosurfactant Producing Bacteria

    Directory of Open Access Journals (Sweden)

    Charoon Sarin

    2010-07-01

    Full Text Available Immobilized biosurfactant producing bacteria (Bacillus subtilis TP8 and Pseudomonas fluorescens G7 were assessed for survival in heavy metal contaminated soil and for their ability to remove cadmium and zinc from contaminated soil. P. fluorescens G7 was considered to be a good candidate for bioremediation of heavy metals because of its high minimum inhibitory concentrations (MIC for each heavy metal and because of the obviously increased numbers of cell surviving after incubation in the heavy metal contaminated soil up to 4 weeks. The results of soil remediation showed that approximately 19% of Zn and 16.7% of Cd could be removed by this immobilized biosurfactant producing bacteria after incubation for 2 weeks. The results confirm the potential applicability of the immobilized biosurfactant producing bacteria for heavy metal bioremediation.

  2. Canine olfactory ensheathing cells from the olfactory mucosa can be engineered to produce active chondroitinase ABC.

    Science.gov (United States)

    Carwardine, Darren; Wong, Liang-Fong; Fawcett, James W; Muir, Elizabeth M; Granger, Nicolas

    2016-08-15

    A multitude of factors must be overcome following spinal cord injury (SCI) in order to achieve clinical improvement in patients. It is thought that by combining promising therapies these diverse factors could be combatted with the aim of producing an overall improvement in function. Chondroitin sulphate proteoglycans (CSPGs) present in the glial scar that forms following SCI present a significant block to axon regeneration. Digestion of CSPGs by chondroitinase ABC (ChABC) leads to axon regeneration, neuronal plasticity and functional improvement in preclinical models of SCI. However, the enzyme activity decays at body temperature within 24-72h, limiting the translational potential of ChABC as a therapy. Olfactory ensheathing cells (OECs) have shown huge promise as a cell transplant therapy in SCI. Their beneficial effects have been demonstrated in multiple small animal SCI models as well as in naturally occurring SCI in canine patients. In the present study, we have genetically modified canine OECs from the mucosa to constitutively produce enzymatically active ChABC. We have developed a lentiviral vector that can deliver a mammalian modified version of the ChABC gene to mammalian cells, including OECs. Enzyme production was quantified using the Morgan-Elson assay that detects the breakdown products of CSPG digestion in cell supernatants. We confirmed our findings by immunolabelling cell supernatant samples using Western blotting. OECs normal cell function was unaffected by genetic modification as demonstrated by normal microscopic morphology and the presence of the low affinity neurotrophin receptor (p75(NGF)) following viral transduction. We have developed the means to allow production of active ChABC in combination with a promising cell transplant therapy for SCI repair. PMID:27423610

  3. Evasion of peptide, but not lipid antigen presentation, through pathogen-induced dendritic cell maturation

    OpenAIRE

    Hava, David L.; van der Wel, Nicole ,; Cohen, Nadia; Dascher, Christopher C.; Houben, Diane; León, Luis; Agarwal, Sandeep; Sugita, Masahiko; van Zon, Maaike; Kent, Sally C.; Shams, Homayoun; Peters, Peter J.; Brenner, Michael B.

    2008-01-01

    Dendritic cells (DC) present lipid and peptide antigens to T cells on CD1 and MHC Class II (MHCII), respectively. The relative contribution of these systems during the initiation of adaptive immunity after microbial infection is not characterized. MHCII molecules normally acquire antigen and rapidly traffic from phagolysosomes to the plasma membrane as part of DC maturation, whereas CD1 molecules instead continually recycle between these sites before, during, and after DC maturation. We find ...

  4. Development of disease prevention method using radiation irradiated pathogenic microorganisms, cells and animals

    International Nuclear Information System (INIS)

    Enhancement of the abilities of specific and non-specific disease prevention through the regulation of cytokine production has been paid attention in clinical and veterinary fields. Bovine monocytes isolated from the peripheral blood were exposed to X-ray at 0.1-10 Gy and cultured in the conditions with and without LPS stimulation to investigate the radiation effects at a low level on the expression of cytokine mRNA. The expressions of IL-1 and TNFα were significantly increased in the bovine peripheral monocytes by the exposure to X-ray. If it become possible to control the induction of IL-1 and TNFα by low level X-ray, the radiation would be used as a new biophylaxis method. Then, an investigation was made on the radiation effects on pathogenic plasmid such as capsule plasmid of Bacillus anthracis. A system able to detect a one-base change in base sequence was designed using capE gene, which has been known to mediate the positive regulation of capsule expression. Not only phenotypic changes but also little changes in the phenotype caused by gene mutation became detectable. Thus, it became possible by this detection method to make analysis of radiation induced gene mutation in a plasmid and its frequency. (M.N.)

  5. Development of disease prevention method using radiation irradiated pathogenic microorganisms, cells and animals

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Kenichi; Ikeda, Hidetoshi; Yagi, Yukio; Sekizaki, Tsutomu [National Inst. of Animal Health, Tsukuba, Ibaraki (Japan)

    2000-02-01

    Enhancement of the abilities of specific and non-specific disease prevention through the regulation of cytokine production has been paid attention in clinical and veterinary fields. Bovine monocytes isolated from the peripheral blood were exposed to X-ray at 0.1-10 Gy and cultured in the conditions with and without LPS stimulation to investigate the radiation effects at a low level on the expression of cytokine mRNA. The expressions of IL-1 and TNF{alpha} were significantly increased in the bovine peripheral monocytes by the exposure to X-ray. If it become possible to control the induction of IL-1 and TNF{alpha} by low level X-ray, the radiation would be used as a new biophylaxis method. Then, an investigation was made on the radiation effects on pathogenic plasmid such as capsule plasmid of Bacillus anthracis. A system able to detect a one-base change in base sequence was designed using capE gene, which has been known to mediate the positive regulation of capsule expression. Not only phenotypic changes but also little changes in the phenotype caused by gene mutation became detectable. Thus, it became possible by this detection method to make analysis of radiation induced gene mutation in a plasmid and its frequency. (M.N.)

  6. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Shruti Dave

    2014-01-01

    Full Text Available The pathophysiology of type 1 diabetes mellitus (T1DM is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs offer a promising possibility that deserves to be explored further. MSCs are multipotent, nonhematopoietic progenitors. They have been explored as an treatment option in tissue regeneration as well as potential of in vitro transdifferentiation into insulin-secreting cells. Thus, the major therapeutic goals for T1DM have been achieved in this way. The regenerative capabilities of MSCs have been a driving force to initiate studies testing their therapeutic effectiveness; their immunomodulatory properties have been equally exciting; which would appear capable of disabling immune dysregulation that leads to β-cell destruction in T1DM. Furthermore, MSCs can be cultured under specially defined conditions, their transdifferentiation can be directed toward the β-cell phenotype, and the formation of insulin-producing cells (IPCs can be targeted. To date, the role of MSCs-derived IPC in T1DM-a unique approach with some positive findings-have been unexplored, but it is still in its very early phase. In this study, a new approach of MSCs-derived IPCs, as a potential therapeutic benefit for T1DM in experimental animal models as well as in humans has been summarized.

  7. α-Fetoprotein-producing ovarian tumor in a postmenopausal woman with germ cell differentiation.

    Science.gov (United States)

    Meguro, Shiori; Yasuda, Masanori

    2013-02-01

    α-Fetoprotein (AFP)-producing ovarian tumors (APOTs) are rarely encountered in postmenopausal women, irrespective of whether they are of the germ cell or non-germ cell type. The APOTs that do occur in postmenopausal women are characterized by variable histologies such as hepatoid carcinoma, yolk sac tumor, and epithelial malignancies, most of which are combined. We herein present a case with APOT, which arose in a 58-year-old, gravida 2, para 2, postmenopausal woman. Preoperatively, the tumor, which was in the right ovary, was found to produce AFP (102768.0 ng/mL). The tumor was evenly composed of glands mimicking secretory endometrial gland or fetal gut accompanied by abundant stroma. Immunohistochemically, these glands were positive for SALL4, glypican-3, and hepatocyte nuclear factor 1β. We considered the present case as an AFP-producing adenocarcinoma with adenofibroma showing germ cell differentiation, but it seemed controversial that this tumor should be designated as a yolk sac tumor of the glandular type. The expression profiles of SALL4, OCT4, glypican-3, and hepatocyte nuclear factor 1β were thought to provide interesting implications to characterize the present case. PMID:22056036

  8. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    Energy Technology Data Exchange (ETDEWEB)

    Ramadan, Qasem, E-mail: qasem.alramadan@epfl.ch [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore); Christophe, Lay; Teo, William; ShuJun, Li; Hua, Feng Han [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore)

    2010-07-12

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  9. Identification of hop polyphenolic components which inhibit prostaglandin E2 production by gingival epithelial cells stimulated with periodontal pathogen.

    Science.gov (United States)

    Inaba, Hiroaki; Tagashira, Motoyuki; Honma, Daiki; Kanda, Tomomasa; Kou, Yurong; Ohtake, Yasuyuki; Amano, Atsuo

    2008-03-01

    Chronic marginal periodontitis is a destructive inflammatory disease caused by an imbalance between bacterial virulence and host defense ability, resulting in eventual tooth exfoliation. Porphyromonas gingivalis, a major periodontal pathogen, triggers a series of cellular inflammatory responses including the production of prostaglandin E2 (PGE2), which causes periodontal destruction; thus, anti-inflammatory reagents are considered beneficial for periodontal therapy. In the present study, we examined whether hop- and apple-derived polyphenols (HBP and ACT, respectively) inhibit PGE2 production by human gingival epithelial (HGE) cells stimulated with P. gingivalis components. HGE cells were stimulated with P. gingivalis membrane vesicles, and the effects of HBP, ACT and epigallocatechin gallate (EGCg) on PGE2 production by HGE cells were evaluated using an enzyme-linked immunosorbent assay. HBP and EGCg significantly inhibited PGE2 production, whereas ACT did not. By further fractionation steps of HBP to identify the effective components, 3 components of HBP, 2-[(2-methylpropanoyl)-phloroglucinol]1-O-beta-D-glucopyranoside (MPPG), quercetin 3-O-beta-D-glucopyranoside (isoquercitrin), and kaempferol 3-O-beta-glucopyranoside (astragalin), were found to be elements which significantly inhibited cellular PGE2 production. These results suggest that HBP is a potent inhibitor of cellular PGE2 production induced by P. gingivalis, and HBP may be useful for the prevention and attenuation of periodontitis. PMID:18310924

  10. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    International Nuclear Information System (INIS)

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  11. Pathogen Phytosensing: Plants to Report Plant Pathogens

    Directory of Open Access Journals (Sweden)

    C. Neal Stewart

    2008-04-01

    Full Text Available Real-time systems that provide evidence of pathogen contamination in crops can be an important new line of early defense in agricultural centers. Plants possess defense mechanisms to protect against pathogen attack. Inducible plant defense is controlled by signal transduction pathways, inducible promoters and cis-regulatory elements corresponding to key genes involved in defense, and pathogen-specific responses. Identified inducible promoters and cis-acting elements could be utilized in plant sentinels, or ‘phytosensors’, by fusing these to reporter genes to produce plants with altered phenotypes in response to the presence of pathogens. Here, we have employed cis-acting elements from promoter regions of pathogen inducible genes as well as those responsive to the plant defense signal molecules salicylic acid, jasmonic acid, and ethylene. Synthetic promoters were constructed by combining various regulatory elements supplemented with the enhancer elements from the Cauliflower mosaic virus (CaMV 35S promoter to increase basal level of the GUS expression. The inducibility of each synthetic promoter was first assessed in transient expression assays using Arabidopsis thaliana protoplasts and then examined for efficacy in stably transgenic Arabidopsis and tobacco plants. Histochemical and fluorometric GUS expression analyses showed that both transgenic Arabidopsis and tobacco plants responded to elicitor and phytohormone treatments with increased GUS expression when compared to untreated plants. Pathogen-inducible phytosensor studies were initiated by analyzing the sensitivity of the synthetic promoters against virus infection. Transgenic tobacco plants infected with Alfalfa mosaic virus showed an increase in GUS expression when compared to mock-inoculated control plants, whereas Tobacco mosaic virus infection caused no changes in GUS expression. Further research, using these transgenic plants against a range of different

  12. High numbers of IL-2-producing CD8+ T cells during viral infection: correlation with stable memory development

    DEFF Research Database (Denmark)

    Kristensen, Nanna Ny; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    Using infections with lymphocytic choriomeningitis virus (LCMV) and vesicular stomatitis virus in mice as model systems, we have investigated the ability of antigen-primed CD8+ T cells generated in the context of viral infections to produce IL-2. Our results indicate that acute immunizing infection...... normally leads to generation of high numbers of IL-2-producing antigen-specific CD8+ T cells. By costaining for IL-2 and IFN-gamma intracellularly, we found that IL-2-producing cells predominantly constitute a subset of cells also producing IFN-gamma. Comparison of the kinetics of generation revealed that...... chronic LCMV infection. Furthermore, in MHC class II-deficient mice, which only transiently control LCMV infection, IL-2-producing CD8+ T cells are initially generated, but by 4 weeks after infection this subset has nearly disappeared. Eventually the capacity to produce IFN-gamma also becomes impaired...

  13. A closer look at opposing models for the T cell response to pathogens

    Science.gov (United States)

    Hanson, Shalla

    2016-06-01

    The problem of understanding the mechanisms of differentiation, activation, and interconversion of phenotypes of CD8+ T cells is one of crucial importance in cancer therapy, owing to both the anti-tumor efficacy of CD8+ T cells as well as the severe toxicity that results from excess expansion of this population. Several opposing theories exist which describe potential pathways for the development of the CD8+ T cell repertoire; however, the accuracy of each remains controversial. Here we review the current hypotheses, provide a critical overview of pivotal biological data from which these theories are derived, and discuss principle population-level implications. Finally, we offer a novel hypothesis which maintains consistency with each of the experimental studies and seeks to unify the currently opposing but not so disparate theories.

  14. Shale gas produced water treatment using innovative microbial capacitive desalination cell

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, Zachary A. [New Mexico State University, Las Cruces, NM 88003 (United States); Forrestal, Casey [University of Colorado Boulder, Boulder, CO 80309 (United States); Ren, Zhiyong Jason, E-mail: jason.ren@colorado.edu [University of Colorado Boulder, Boulder, CO 80309 (United States); Xu, Pei, E-mail: wxpei@hotmail.com [New Mexico State University, Las Cruces, NM 88003 (United States)

    2015-02-11

    Highlights: • Actual shale gas produced water was treated with no external energy input. • Biodegradation of organics generated stable voltages for desalination. • On average, 36 mg TDS per g activated carbon was removed in 1 h. • A maximum organic removal rate of 6.4 mg DOC per hour was achieved in the reactor. - Abstract: The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization—a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input.

  15. Shale gas produced water treatment using innovative microbial capacitive desalination cell

    International Nuclear Information System (INIS)

    Highlights: • Actual shale gas produced water was treated with no external energy input. • Biodegradation of organics generated stable voltages for desalination. • On average, 36 mg TDS per g activated carbon was removed in 1 h. • A maximum organic removal rate of 6.4 mg DOC per hour was achieved in the reactor. - Abstract: The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization—a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input

  16. The IL-17A-producing CD8+ T-cell population in psoriatic lesional skin comprises mucosa-associated invariant T cells and conventional T cells.

    Science.gov (United States)

    Teunissen, Marcel B M; Yeremenko, Nataliya G; Baeten, Dominique L P; Chielie, Saskia; Spuls, Phyllis I; de Rie, Menno A; Lantz, Olivier; Res, Pieter C M

    2014-12-01

    IL-17A is pivotal in the etiology of psoriasis, and CD8(+) T cells with the ability to produce this cytokine (Tc17 cells) are over-represented in psoriatic lesions. Here we demonstrate that the frequency of Tc17 cells in peripheral blood of psoriasis patients correlated with the clinical severity of the disease. Analysis of cutaneous-associated lymphocyte antigen expression showed that the blood Tc17 population contains a significantly higher proportion of cells with skin-homing potential compared with the CD8(+) T-cell population lacking IL-17A/IL-22 expression. IL-17A-producing CD8(+) T cells in blood have previously been reported to belong mainly to the mucosa-associated invariant T-cell (MAIT cell) lineage characterized by TCR Vα7.2 chain, CD161, IL-18Rα, and multidrug transporter ABCB1 expression. We demonstrate the presence of CD8(+) MAIT cells in the dermis and epidermis of psoriatic plaques, as well as healthy skin; however, IL-17A-producing CD8(+) MAIT cells were predominantly found in psoriatic skin. Notably, we observed IL-17A production in a large proportion of psoriatic plaque-derived CD8(+) T cells devoid of MAIT cell characteristics, likely representing conventional CD8(+) T cells. In conclusion, we provide supporting evidence that implicates Tc17 cells in the pathogenesis of psoriasis and describe the presence of innate CD8(+) MAIT cells in psoriatic lesions as an alternative source of IL-17A. PMID:24945094

  17. The Irish potato famine pathogen Phytophthora infestans translocates the CRN8 kinase into host plant cells

    OpenAIRE

    Damme, van, DA Dick; Bozkurt, T.O.; Cakir, C.; Schornack, S.; Sklenar, J.; Jones, A.M.E.; Kamoun, S

    2012-01-01

    Phytopathogenic oomycetes, such as Phytophthora infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection. We describe CRN8, a host-translocated effector of P. infestans that has kinase activity in planta. CRN8 is a modular protein of the CRN effector family. The C-terminus of CRN8 localizes to the host nucleus and triggers cell death when the protein is expressed in planta. Cell death induction by CRN8 is dependent on its localization to the p...

  18. Lagooning microbial fuel cells: A first approach by coupling electricity-producing microorganisms and algae

    International Nuclear Information System (INIS)

    Highlights: • An algae cathode of a MFC has been used without artificial mediators or catalysts. • To perform a lagooning wastewater treatment coupled with energy-producing MFC. • The producing electricity operates under day/night irradiation cycles, is shown. - Abstract: The paper focused on the start-up and performance characterisation of a new type of microbial fuel cell (MFC), in which an algae culture was seeded in the cathodic chamber to produce the oxygen required to complete the electrochemical reactions of the MFC, thus circumventing the need for a mechanical aerator. The system did not use mediators or high cost catalysts and it can be started-up easily using a straightforward three-stage procedure. The start-up consists of the separate production of the electricity-producing microorganisms and the algae cultures (stage I), replacement of the mechanical aeration system by the algae culture (stage II) and a change in the light dosage from a continuous input to a dynamic day/night profile. The MFC was operated under a regime of 12 h light and 12 h dark and was also operated in batch and continuous substrate-feeding modes. The same cell voltage was achieved when the cathode compartment was operated with air supplied by aerators, which means that this configuration can perform as well as the traditional one. The results also show the influence of both the organic load and light irradiation on electricity production and demonstrate that this type MFC is a robust and promising technology that can be considered as a first approach to perform a lagooning wastewater treatment with microbial fuel cells

  19. Comparative Pathogenicity of United Kingdom Isolates of the Emerging Pathogen Candida auris and Other Key Pathogenic Candida Species.

    Science.gov (United States)

    Borman, Andrew M; Szekely, Adrien; Johnson, Elizabeth M

    2016-01-01

    Candida auris, first described in 2009, has since emerged as an important, multidrug-resistant, nosocomial agent of candidemia, with large outbreaks reported worldwide and high mortality rates associated with therapeutic failure. The current study employed C. auris isolates from a variety of centers in the United Kingdom to evaluate the pathogenicity of this emerging pathogen compared to that of other common pathogenic yeast species in the invertebrate Galleria mellonella infection model. We showed that C. auris isolates differ in their growth characteristics in vitro, with a proportion of isolates failing to release daughter cells after budding, resulting in the formation of large aggregates of cells that cannot be physically disrupted. Our results also demonstrate strain-specific differences in the behavior of C. auris in G. mellonella, with the aggregate-forming isolates exhibiting significantly less pathogenicity than their nonaggregating counterparts. Importantly, the nonaggregating isolates exhibited pathogenicity comparable to that of C. albicans, which is currently accepted as the most pathogenic member of the genus, despite the fact that C. auris isolates do not produce hyphae and produce only rudimentary pseudohyphae either in vitro or in G. mellonella. IMPORTANCE The incidence of invasive candidiasis, which includes candidemia and deep tissue infections, continues to rise and is associated with considerable mortality rates. Candida albicans remains the most common cause of invasive candidiasis, although the prevalence of non-albicans species has increased over recent years. Since its first description in 2009, Candida auris has emerged as a serious nosocomial health risk, with widespread outbreaks in numerous hospitals worldwide. However, despite receiving considerable attention, little is known concerning the pathogenicity of this emerging fungal pathogen. Here, using the Galleria mellonella insect systemic infection model, we show strain

  20. Comparative Pathogenicity of United Kingdom Isolates of the Emerging Pathogen Candida auris and Other Key Pathogenic Candida Species

    Science.gov (United States)

    Szekely, Adrien; Johnson, Elizabeth M.

    2016-01-01

    ABSTRACT Candida auris, first described in 2009, has since emerged as an important, multidrug-resistant, nosocomial agent of candidemia, with large outbreaks reported worldwide and high mortality rates associated with therapeutic failure. The current study employed C. auris isolates from a variety of centers in the United Kingdom to evaluate the pathogenicity of this emerging pathogen compared to that of other common pathogenic yeast species in the invertebrate Galleria mellonella infection model. We showed that C. auris isolates differ in their growth characteristics in vitro, with a proportion of isolates failing to release daughter cells after budding, resulting in the formation of large aggregates of cells that cannot be physically disrupted. Our results also demonstrate strain-specific differences in the behavior of C. auris in G. mellonella, with the aggregate-forming isolates exhibiting significantly less pathogenicity than their nonaggregating counterparts. Importantly, the nonaggregating isolates exhibited pathogenicity comparable to that of C. albicans, which is currently accepted as the most pathogenic member of the genus, despite the fact that C. auris isolates do not produce hyphae and produce only rudimentary pseudohyphae either in vitro or in G. mellonella. IMPORTANCE The incidence of invasive candidiasis, which includes candidemia and deep tissue infections, continues to rise and is associated with considerable mortality rates. Candida albicans remains the most common cause of invasive candidiasis, although the prevalence of non-albicans species has increased over recent years. Since its first description in 2009, Candida auris has emerged as a serious nosocomial health risk, with widespread outbreaks in numerous hospitals worldwide. However, despite receiving considerable attention, little is known concerning the pathogenicity of this emerging fungal pathogen. Here, using the Galleria mellonella insect systemic infection model, we show

  1. Antibacterial and Antimetastatic Potential of Diospyros lycioides Extract on Cervical Cancer Cells and Associated Pathogens

    Science.gov (United States)

    Bagla, V. P.; Lubisi, V. Z.; Ndiitwani, T.; Mokgotho, M. P.; Mampuru, L.; Mbazima, V.

    2016-01-01

    Cervical cancer is among the most prevalent forms of cancer in women worldwide. Diospyros lycioides was extracted using hexane, ethyl acetate, acetone, and methanol and finger print profiles were determined. The leaf material was tested for the presence of flavonoids, tannins, saponins, terpenoids, and cardiac glycosides using standard chemical methods and the presence of flavonoids and phenolics using thin layer chromatography. The total phenolic content was determined using Folin-Ciocalteu procedure. The four extracts were tested for antibacterial activity using bioautography against Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, and Escherichia coli. The acetone extract with the highest number of antibacterial and antioxidant compounds was assessed for its cytotoxicity on BUD-8 cells using the real-time xCELLigence system and its potential effects on metastatic cervical cancer (HeLa) cell migration and invasion were assessed using wound healing migration and invasion assays. The leaf extract tested positive for flavonoids, tannins, and terpenoids while the four different extracts tested in the antimicrobial assay contained constituents active against one or more of the organisms tested, except E. coli. The cytotoxicity of the acetone extract in real-time was concentration-dependent with potent ability to suppress the migration and invasion of HeLa cells. The finding demonstrates the acetone extract to contain constituents with antibacterial and antimetastatic effects on cervical cancer cells. PMID:27239210

  2. Genetic correlations between pathogen-specific mastitis and somatic cell count in Danish Holsteins

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Mark, Thomas; Madsen, P.;

    2009-01-01

    The aim of this study was to estimate genetic correlations (r(a)) between 2 lactation average somatic cell count (LASCC) traits and 6 different mastitis traits in 226,482 first-parity Danish Holstein cows that calved between 1998 and 2008. The LASCC traits were defined from 5 to either 170 d (LASCC...

  3. Arsenal of plant cell wall degrading enzymes reflects host preference among plant pathogenic fungi

    Science.gov (United States)

    Discovery and development of novel plant cell wall degrading enzymes is a key step towards more efficient depolymerization of polysaccharides to fermentable sugars for production of liquid transportation biofuels and other bioproducts. The industrial fungus Trichoderma reesei is known to be highly c...

  4. Bone invading NSCLC cells produce IL-7: mice model and human histologic data

    International Nuclear Information System (INIS)

    Bone metastases are a common and dismal consequence of lung cancer that is a leading cause of death. The role of IL-7 in promoting bone metastases has been previously investigated in NSCLC, but many aspects remain to be disclosed. To further study IL-7 function in bone metastasis, we developed a human-in-mice model of bone aggression by NSCLC and analyzed human bone metastasis biopsies. We used NOD/SCID mice implanted with human bone. After bone engraftment, two groups of mice were injected subcutaneously with A549, a human NSCLC cell line, either close or at the contralateral flank to the human bone implant, while a third control group did not receive cancer cells. Tumor and bone vitality and IL-7 expression were assessed in implanted bone, affected or not by A549. Serum IL-7 levels were evaluated by ELISA. IL-7 immunohistochemistry was performed on 10 human bone NSCLC metastasis biopsies for comparison. At 12 weeks after bone implant, we observed osteogenic activity and neovascularization, confirming bone vitality. Tumor aggressive cells implanted close to human bone invaded the bone tissue. The bone-aggressive cancer cells were positive for IL-7 staining both in the mice model and in human biopsies. Higher IL-7 serum levels were found in mice injected with A549 cells close to the bone implant compared to mice injected with A549 cells in the flank opposite to the bone implant. We demonstrated that bone-invading cells express and produce IL-7, which is known to promote osteoclast activation and osteolytic lesions. Tumor-bone interaction increases IL-7 production, with an increase in IL-7 serum levels. The presented mice model of bone invasion by contiguous tumor is suitable to study bone-tumor cell interaction. IL-7 plays a role in the first steps of metastatic process

  5. Understanding Transcriptional Enhancement in Monoclonal Antibody-Producing Chinese Hamster Ovary Cells

    Science.gov (United States)

    Nicoletti, Sarah E.

    With the demand for monoclonal antibody (mAB) therapeutics continually increasing, the need to better understand what makes a high productivity clone has gained substantial interest. Monoclonal antibody producing Chinese hamster ovary (CHO) cells with different productivities were provided by a biopharmaceutical company for investigation. Gene copy numbers, mRNA levels, and mAb productivities were previously determined for two low producing clones and their amplified progeny. These results showed an increase in mRNA copy number in amplified clones, which correlated to the observed increases in specific productivity of these clones. The presence of multiple copies of mRNA per one copy of DNA in the higher productivity clones has been coined as transcriptional enhancement. The methylation status of the CMV promoter as well as transcription factor/promoter interactions were evaluated to determine the cause of transcriptional enhancement. Methylation analysis via bisulfite sequencing revealed no significant difference in overall methylation status of the CMV promoter. These data did, however, reveal the possibility of differential interactions of transcription factors between the high and low productivity cell clones. This finding was further supported by chromatin immunoprecipitations previously performed in the lab, as well as literature studies. Transcription activator-like effector (TALE) binding proteins were constructed and utilized to selectively immunoprecipitate the CMV promoter along with its associated transcription factors in the different CHO cell clones. Cells were transfected with the TALE proteins, harvested and subjected to a ChIP-like procedure. Results obtained from the TALE ChIP demonstrated the lack of binding of the protein to the promoter and the need to redesign the TALE. Overall, results obtained from this study were unable to give a clear indication as to the causes of transcriptional enhancement in the amplified CHO cell clones. Further

  6. Pathogenic Function of Herpesvirus Entry Mediator in Experimental Autoimmune Uveitis by Induction of Th1- and Th17-Type T Cell Responses.

    Science.gov (United States)

    Sakoda, Yukimi; Nagai, Tomohiko; Murata, Sizuka; Mizuno, Yukari; Kurosawa, Hiromi; Shoda, Hiromi; Morishige, Naoyuki; Yanai, Ryoji; Sonoda, Koh-Hei; Tamada, Koji

    2016-04-01

    Herpesvirus entry mediator (HVEM), a member of the TNFR superfamily, serves as a unique molecular switch to mediate both stimulatory and inhibitory cosignals, depending on its functions as a receptor or ligand interacting with multiple binding partners. In this study, we explored the cosignaling functions of HVEM in experimental autoimmune uveitis (EAU), a mouse model resembling human autoimmune uveitis conditions such as ocular sarcoidosis and Behcet disease. Our studies revealed that EAU severity significantly decreased in HVEM-knockout mice compared with wild-type mice, suggesting that stimulatory cosignals from the HVEM receptor are predominant in EAU. Further studies elucidated that the HVEM cosignal plays an important role in the induction of both Th1- and Th17-type pathogenic T cells in EAU, including differentiation of IL-17-producing αβ(+)γδ(-) conventional CD4(+) T cells. Mice lacking lymphotoxin-like, inducible expression, competes with herpes simplex virus glycoprotein D for HVEM, a receptor expressed by T lymphocytes : LIGHT), B- and T-lymphocyte attenuator (BTLA) or both LIGHT and BTLA are also less susceptible to EAU, indicating that LIGHT-HVEM and BTLA-HVEM interactions, two major molecular pathways mediating HVEM functions, are both important in determining EAU pathogenesis. Finally, blocking HVEM cosignals by antagonistic anti-HVEM Abs ameliorated EAU. Taken together, our studies revealed a novel function of the HVEM cosignaling molecule and its ligands in EAU pathogenesis through the induction of Th1- and Th17-type T cell responses and suggested that HVEM-related molecular pathways can be therapeutic targets in autoimmune uveitis. PMID:26912321

  7. Interferon-¿ production by human T cells and natural killer cells in vitro in response to antigens from the two intracellular pathogens Mycobacterium tuberculosis and Leishmania major

    DEFF Research Database (Denmark)

    Kemp, K; Hviid, L; Kharazmi, A;

    1997-01-01

    Acquired resistance to both mycobacteria and Leishmania is primarily mediated by interferon-gamma (IFN-gamma), which triggers mechanisms leading to the death of the microorganism in macrophages. In this study, cell activation and IFN-gamma production was investigated in human peripheral blood...... mononuclear cells (PBMC) from individuals previously sensitized to tuberculin and without known exposure to Leishmania parasites. Immune staining for intracellular IFN-gamma and surface markers allowed flow cytometric identification of the cellular sources of IFN-gamma in cell cultures incubated with purified...... protein derivative of tuberculin (PPD) and Leishmania antigens. It was found that IFN-gamma was produced in response to both PPD and Leishmania stimulant by T cells in the cultures. Activation of IFN-gamma producing natural killer (NK) cells was demonstrated only in some cultures, and only...

  8. Caspase dependent programmed cell death in developing embryos: a potential target for therapeutic intervention against pathogenic nematodes.

    Directory of Open Access Journals (Sweden)

    Alok Das Mohapatra

    2011-09-01

    Full Text Available BACKGROUND: Successful embryogenesis is a critical rate limiting step for the survival and transmission of parasitic worms as well as pathology mediated by them. Hence, blockage of this important process through therapeutic induction of apoptosis in their embryonic stages offers promise for developing effective anti-parasitic measures against these extra cellular parasites. However, unlike in the case of protozoan parasites, induction of apoptosis as a therapeutic approach is yet to be explored against metazoan helminth parasites. METHODOLOGY/PRINCIPAL FINDINGS: For the first time, here we developed and evaluated flow cytometry based assays to assess several conserved features of apoptosis in developing embryos of a pathogenic filarial nematode Setaria digitata, in-vitro as well as ex-vivo. We validated programmed cell death in developing embryos by using immuno-fluorescence microscopy and scoring expression profile of nematode specific proteins related to apoptosis [e.g. CED-3, CED-4 and CED-9]. Mechanistically, apoptotic death of embryonic stages was found to be a caspase dependent phenomenon mediated primarily through induction of intracellular ROS. The apoptogenicity of some pharmacological compounds viz. DEC, Chloroquine, Primaquine and Curcumin were also evaluated. Curcumin was found to be the most effective pharmacological agent followed by Primaquine while Chloroquine displayed minimal effect and DEC had no demonstrable effect. Further, demonstration of induction of apoptosis in embryonic stages by lipid peroxidation products [molecules commonly associated with inflammatory responses in filarial disease] and demonstration of in-situ apoptosis of developing embryos in adult parasites in a natural bovine model of filariasis have offered a framework to understand anti-fecundity host immunity operational against parasitic helminths. CONCLUSIONS/SIGNIFICANCE: Our observations have revealed for the first time, that induction of apoptosis in

  9. Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.

    Science.gov (United States)

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. PMID:23690851

  10. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Science.gov (United States)

    Reolon, Luciano Antonio; Martello, Carolina Lumertz; Schrank, Irene Silveira; Ferreira, Henrique Bunselmeyer

    2014-01-01

    The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae), the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia. PMID:25386928

  11. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Directory of Open Access Journals (Sweden)

    Luciano Antonio Reolon

    Full Text Available The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae, the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  12. Expression System Based on an MTIIa Promoter to Produce hPSA in Mammalian Cell Cultures.

    Science.gov (United States)

    Santos, Anderson K; Parreira, Ricardo C; Resende, Rodrigo R

    2016-01-01

    Because of the limitations of standard culture techniques, the development of new recombinant protein expression systems with biotechnological potential is a key challenge. Ideally, such systems should be able to effectively and accurately synthesize a protein of interest with intrinsic metabolic capacity. Here, we describe such a system that was designed based on a plasmid vector containing promoter elements derived from the metallothionein MTIIa promoter, as well as processing and purification elements. This promoter can be induced by heavy metals in a culture medium to induce the synthesis of human prostate-specific antigen (hPSA), which has been modified to insert elements for purification, proteolysis, and secretion. We optimized hPSA production in this system by comparing the effects and contributions of ZnCl2, CdCl2, and CuSO4 in HEK293FT, HeLa, BHK-21, and CHO-K1 cells. We also compared the effectiveness of three different transfection agents: multi-walled carbon nanotubes, Lipofectamine 2000, and X-tremeGENE HP Reagent. hPSA production was confirmed via the detection of enhanced green fluorescent protein fluorescence, and cell viability was determined. The expression of hPSA was compared with that of the native protein produced by LNCaP cells, using enzyme-linked immunosorbent assay and sodium dodecyl sulfate polyacrylamide gel electrophoresis. X-tremeGENE reagent, the BHK-21 cell line, and CuSO4 showed the highest hPSA production rates. Furthermore, BHK-21 cells were more resistant to the oxidative stress caused by 100 μM CuSO4. These results suggest that the proposed optimized inducible expression system can effectively produce recombinant proteins with desired characteristics for a wide range of applications in molecular biology. PMID:27582737

  13. Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

    OpenAIRE

    David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

    2015-01-01

    Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widel...

  14. In Vitro Differentiation of Human Umbilical Cord Blood CD133+Cells into Insulin Producing Cells in Co-Culture with Rat Pancreatic Mesenchymal Stem Cells

    Science.gov (United States)

    Sahraneshin Samani, Fazel; Ebrahimi, Marzieh; Zandieh, Tahereh; Khoshchehreh, Reyhaneh; Baghaban Eslaminejad, Mohamadreza; Aghdami, Nasser; Baharvand, Hossein

    2015-01-01

    Objective Pancreatic stroma plays an important role in the induction of pancreatic cells by the use of close range signaling. In this respect, we presume that pancreatic mesenchymal cells (PMCs) as a fundamental factor of the stromal niche may have an effective role in differentiation of umbilical cord blood cluster of differentiation 133+ (UCB-CD133+) cells into newly-formed β-cells in vitro. Materials and Methods This study is an experimental research. The UCB-CD133+cells were purified by magnetic activated cell sorting (MACS) and differentiated into insulin producing cells (IPCs) in co-culture, both directly and indirectly with rat PMCs. Immunocytochemistry and enzyme linked immune sorbent assay (ELISA) were used to determine expression and production of insulin and C-peptide at the protein level. Results Our results demonstrated that UCB-CD133+differentiated into IPCs. Cells in islet-like clusters with (out) co-cultured with rat pancreatic stromal cells produced insulin and C-peptide and released them into the culture medium at the end of the induction protocol. However they did not respond well to glucose challenges. Conclusion Rat PMCs possibly affect differentiation of UCB-CD133+cells into IPCs by increasing the number of immature β-cells. PMID:26199900

  15. In Vitro Differentiation of Human Umbilical Cord Blood CD133+ Cells into Insulin Producing Cells in Co-Culture with Rat Pancreatic Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Fazel Sahraneshin Samani

    2015-07-01

    Full Text Available Objective: Pancreatic stroma plays an important role in the induction of pancreatic cells by the use of close range signaling. In this respect, we presume that pancreatic mesenchymal cells (PMCs as a fundamental factor of the stromal niche may have an effective role in differentiation of umbilical cord blood cluster of differentiation 133+ (UCB-CD133+ cells into newly-formed β-cells in vitro. Materials and Methods: This study is an experimental research. The UCB-CD133+ cells were purified by magnetic activated cell sorting (MACS and differentiated into insulin producing cells (IPCs in co-culture, both directly and indirectly with rat PMCs. Immunocytochemistry and enzyme linked immune sorbent assay (ELISA were used to determine expression and production of insulin and C-peptide at the protein level. Results: Our results demonstrated that UCB-CD133+ differentiated into IPCs. Cells in islet-like clusters with (out co-cultured with rat pancreatic stromal cells produced insulin and C-peptide and released them into the culture medium at the end of the induction protocol. However they did not respond well to glucose challenges. Conclusion: Rat PMCs possibly affect differentiation of UCB-CD133+ cells into IPCs by increasing the number of immature β-cells.

  16. Genome sequencing and comparative genomics provides insights on the evolutionary dynamics and pathogenic potential of different H-Types of Shiga toxin-producing Escherichia coli O104

    Science.gov (United States)

    Various Shiga toxin-producing Escherichia coli (STEC) O104 H-types including H4, H7, H21, and H¯ have been associated with sporadic cases of illness and have caused outbreaks globally. In the U.S., STEC O104:H21 caused an outbreak associated with milk in 1994. The aim of this work was to conduct a...

  17. RHIZOBIUM ETLI USDA9032 ENGINEERED TO PRODUCE A PHENAZINE ANTIBIOTIC INHIBITS THE GROWTH OF FUNGAL PATHOGENS BUT IS IMPAIRED IN SYMBIOTIC PERFORMANCE

    Science.gov (United States)

    Phenazine antibiotics produced by Pseudomonas spp. play a major role in preventing various plant diseases. In this study, the phenazine biosynthesis locus of P. chlororaphis O6, a plant growth-promoting rhizobacteria (PGPR), was introduced into several symbiotic bacteria belonging to the family Rh...

  18. HCN Producing Bacteria Enable Sensing Of Non-Bioavailable Hg Species by the Whole Cell Biosensor

    Science.gov (United States)

    Horvat, M.; Rijavec, T.; Koron, N.; Lapanje, A.

    2015-12-01

    Bacteria play an important role in Hg transformation reactions. The production of cyanide (HCN) and other secondary metabolites seems to be key elements involved in these transformations. Current hypotheses link the role of HCN production to growth inhibition of nonHCN producing competitor organisms (role of an antimicrobial agent). Our past investigations showed that HCN production did not correlate with antimicrobial activity and since pK value of HCN is very high (pK = 9,21), it can be expected that most of the produced HCN is removed from the microenvironment. This way, the expected inhibitory concentrations can hardly be reached. Accordingly, we proposed a new concept, where the ability of complexation of transient metals by HCN served as a regulation process for the accessibility of micro-elements. In our study, we focused on the presence of HCN producing bacteria and carried it out in the Hg contaminated environment connected to the Idrija Mercury Mine, Slovenia. We characterised the isolates according to the presence of Hg resistance (HgR), level of HCN production and genetic similarities. In laboratory setups, using our merR whole cell based biosensor, we determined the transformation of low bioavailable Hg0 and HgS forms into bioavailable Hg by these HCN producing bacteria. We observed that HgR strains producing HCN had the highest impact on increased Hg bioavailability. In the proposed ecological strategy HgR HCN producing bacteria increase their competitive edge over non-HgR competitors through the increase of Hg toxicity. Due to their activity, Hg is made available to other organisms as well and thus enters into the ecosystem. Finally, using some of the characteristics of bacteria (e.g. Hg resistance genetic elements), we developed a fully automated sensing approach, combining biosensorics and mechatronics, to measure the bioavailability of Hg in situ.

  19. Metabolic analysis of antibody producing Chinese hamster ovary cell culture under different stresses conditions.

    Science.gov (United States)

    Badsha, Md Bahadur; Kurata, Hiroyuki; Onitsuka, Masayoshi; Oga, Takushi; Omasa, Takeshi

    2016-07-01

    Chinese hamster ovary (CHO) cells are commonly used as the host cell lines concerning their ability to produce therapeutic proteins with complex post-translational modifications. In this study, we have investigated the time course extra- and intracellular metabolome data of the CHO-K1 cell line, under a control and stress conditions. The addition of NaCl and trehalose greatly suppressed cell growth, where the maximum viable cell density of NaCl and trehalose cultures were 2.2-fold and 2.8-fold less than that of a control culture. Contrariwise, the antibody production of both the NaCl and trehalose cultures was sustained for a longer time to surpass that of the control culture. The NaCl and trehalose cultures showed relatively similar dynamics of cell growth, antibody production, and substrate/product concentrations, while they indicated different dynamics from the control culture. The principal component analysis of extra- and intracellular metabolome dynamics indicated that their dynamic behaviors were consistent with biological functions. The qualitative pattern matching classification and hierarchical clustering analyses for the intracellular metabolome identified the metabolite clusters whose dynamic behaviors depend on NaCl and trehalose. The volcano plot revealed several reporter metabolites whose dynamics greatly change between in the NaCl and trehalose cultures. The elastic net identified some critical, intracellular metabolites that are distinct between the NaCl and trehalose. While a relatively small number of intracellular metabolites related to the cell growth, glucose, glutamine, lactate and ammonium ion concentrations, the mechanism of antibody production was suggested to be very complicated or not to be explained by elastic net regression analysis. PMID:26803706

  20. Shale gas produced water treatment using innovative microbial capacitive desalination cell.

    Science.gov (United States)

    Stoll, Zachary A; Forrestal, Casey; Ren, Zhiyong Jason; Xu, Pei

    2015-01-01

    The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization-a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input. PMID:25464328

  1. IL-11 produced by breast cancer cells augments osteoclastogenesis by sustaining the pool of osteoclast progenitor cells

    Directory of Open Access Journals (Sweden)

    McCoy Erin M

    2013-01-01

    Full Text Available Abstract Background Interleukin (IL-11, a cytokine produced by breast cancer, has been implicated in breast cancer-induced osteolysis (bone destruction but the mechanism(s of action remain controversial. Some studies show that IL-11 is able to promote osteoclast formation independent of the receptor activator of NF-κB ligand (RANKL, while others demonstrate IL-11 can induce osteoclast formation by inducing osteoblasts to secrete RANKL. This work aims to further investigate the role of IL-11 in metastasis-induced osteolysis by addressing a new hypothesis that IL-11 exerts effects on osteoclast progenitor cells. Methods To address the precise role of breast cancer-derived IL-11 in osteoclastogenesis, we determined the effect of breast cancer conditioned media on osteoclast progenitor cells with or without an IL-11 neutralizing antibody. We next investigated whether recombinant IL-11 exerts effects on osteoclast progenitor cells and survival of mature osteoclasts. Finally, we examined the ability of IL-11 to mediate osteoclast formation in tissue culture dishes and on bone slices in the absence of RANKL, with suboptimal levels of RANKL, or from RANKL-pretreated murine bone marrow macrophages (BMMs. Results We found that freshly isolated murine bone marrow cells cultured in the presence of breast cancer conditioned media for 6 days gave rise to a population of cells which were able to form osteoclasts upon treatment with RANKL and M-CSF. Moreover, a neutralizing anti-IL-11 antibody significantly inhibited the ability of breast cancer conditioned media to promote the development and/or survival of osteoclast progenitor cells. Similarly, recombinant IL-11 was able to sustain a population of osteoclast progenitor cells. However, IL-11 was unable to exert any effect on osteoclast survival, induce osteoclastogenesis independent of RANKL, or promote osteoclastogenesis in suboptimal RANKL conditions. Conclusions Our data indicate that a IL-11 plays an

  2. Mycoplasma suis infection results endothelial cell damage and activation: new insight into the cell tropism and pathogenicity of hemotrophic mycoplasma

    Directory of Open Access Journals (Sweden)

    Sokoli Albina

    2013-02-01

    Full Text Available Abstract Hemotrophic mycoplasmas (HM are highly specialized red blood cell parasites that cause infectious anemia in a variety of mammals, including humans. To date, no in vitro cultivation systems for HM have been available, resulting in relatively little information about the pathogenesis of HM infection. In pigs, Mycoplasma suis-induced infectious anemia is associated with hemorrhagic diathesis, and coagulation dysfunction. However, intravasal coagulation and subsequent consumption coagulopathy can only partly explain the sequence of events leading to hemorrhagic diathesis manifesting as cyanosis, petechial bleeding, and ecchymosis, and to disseminated coagulation. The involvement of endothelial activation and damage in M. suis-associated pathogenesis was investigated using light and electron microscopy, immunohistochemistry, and cell sorting. M. suis interacted directly with endothelial cells in vitro and in vivo. Endothelial activation, widespread endothelial damage, and adherence of red blood cells to the endothelium were evident in M. suis-infected pigs. These alterations of the endothelium were accompanied by hemorrhage, intravascular coagulation, vascular occlusion, and massive morphological changes within the parenchyma. M. suis biofilm-like microcolonies formed on the surface of endothelial cells, and may represent a putative persistence mechanism of M. suis. In vitro analysis demonstrated that M. suis interacted with the endothelial cytoskeletal protein actin, and induced actin condensation and activation of endothelial cells, as determined by the up-regulation of ICAM, PECAM, E-selectin, and P-selectin. These findings demonstrate an additional cell tropism of HM for endothelial cells and suggest that M. suis interferes with the protective function of the endothelium, resulting in hemorrhagic diathesis.

  3. The Granulocyte Receptor Carcinoembryonic Antigen-Related Cell Adhesion Molecule 3 (CEACAM3) Directly Associates with Vav to Promote Phagocytosis of Human Pathogens

    OpenAIRE

    Schmitter, Tim; Pils, Stefan; Sakk, Vadim; Frank, Ronald; Fischer, Klaus-Dieter; Hauck, Christof R.

    2007-01-01

    The human granulocyte-specific receptor carcinoembryonic antigen-related cell adhesion molecule (CEACAM)3 is critically involved in the opsonin-independent recognition of several bacterial pathogens. CEACAM3-mediated phagocytosis depends on the integrity of an ITAM-like sequence within the cytoplasmic domain of CEACAM3 and is characterized by rapid stimulation of the GTPase Rac. By performing a functional screen with CEACAM3-expressing cells, we found that overexpression of a dominant-negativ...

  4. Characteristics of the early immune response following transplantation of mouse ES cell derived insulin-producing cell clusters.

    Directory of Open Access Journals (Sweden)

    Ashleigh S Boyd

    Full Text Available BACKGROUND: The fully differentiated progeny of ES cells (ESC may eventually be used for cell replacement therapy (CRT. However, elements of the innate immune system may contribute to damage or destruction of these tissues when transplanted. METHODOLOGY/PRINCIPAL FINDINGS: Herein, we assessed the hitherto ill-defined contribution of the early innate immune response in CRT after transplantation of either ESC derived insulin producing cell clusters (IPCCs or adult pancreatic islets. Ingress of neutrophil or macrophage cells was noted immediately at the site of IPCC transplantation, but this infiltration was attenuated by day three. Gene profiling identified specific inflammatory cytokines and chemokines that were either absent or sharply reduced by three days after IPCC transplantation. Thus, IPCC transplantation provoked less of an early immune response than pancreatic islet transplantation. CONCLUSIONS/SIGNIFICANCE: Our study offers insights into the characteristics of the immune response of an ESC derived tissue in the incipient stages following transplantation and suggests potential strategies to inhibit cell damage to ensure their long-term perpetuation and functionality in CRT.

  5. Amino acid consumption in naïve and recombinant CHO cell cultures: producers of a monoclonal antibody

    OpenAIRE

    Carrillo-Cocom, L. M.; Genel-Rey, T.; Araíz-Hernández, D.; López-Pacheco, F.; López-Meza, J.; Rocha-Pizaña, M. R.; Ramírez-Medrano, A.; Alvarez, M. M.

    2014-01-01

    Most commercial media for mammalian cell culture are designed to satisfy the amino acid requirements for cell growth, but not necessarily those for recombinant protein production. In this study, we analyze the amino acid consumption pattern in naïve and recombinant Chinese hamster ovary (CHO) cell cultures. The recombinant model we chose was a CHO-S cell line engineered to produce a monoclonal antibody. We report the cell concentration, product concentration, and amino acid concentration prof...

  6. Rapid identification of pathogenic Leptospira species (Leptospira interrogans, L. borgpetersenii, and L. kirschneri) with species-specific DNA probes produced by arbitrarily primed PCR.

    OpenAIRE

    Letocart, M; Baranton, G; Perolat, P

    1997-01-01

    Arbitrarily primed PCR (AP-PCR) assays can be used to discriminate between species of Leptospira. Comparative analysis of the fingerprints obtained from representative sets of serovar reference strains of Leptospira interrogans sensu stricto, L. borgpetersenii, and L. kirschneri and the reference strains of the other Leptospira spp. revealed species-specific DNA fragments. These species-specific sequences were reamplified in order to produce digoxigenin-11-dUTP-labeled genomic DNA probes that...

  7. Effective chikungunya virus-like particle vaccine produced in insect cells.

    Directory of Open Access Journals (Sweden)

    Stefan W Metz

    Full Text Available The emerging arthritogenic, mosquito-borne chikungunya virus (CHIKV causes severe disease in humans and represents a serious public health threat in countries where Aedes spp mosquitoes are present. This study describes for the first time the successful production of CHIKV virus-like particles (VLPs in insect cells using recombinant baculoviruses. This well-established expression system is rapidly scalable to volumes required for epidemic responses and proved well suited for processing of CHIKV glycoproteins and production of enveloped VLPs. Herein we show that a single immunization with 1 µg of non-adjuvanted CHIKV VLPs induced high titer neutralizing antibody responses and provided complete protection against viraemia and joint inflammation upon challenge with the Réunion Island CHIKV strain in an adult wild-type mouse model of CHIKV disease. CHIKV VLPs produced in insect cells using recombinant baculoviruses thus represents as a new, safe, non-replicating and effective vaccine candidate against CHIKV infections.

  8. The observation of damage regions produced by neutron irradiation in lithium-doped silicon solar cells.

    Science.gov (United States)

    Ghosh, S.; Sargent, G. A.

    1972-01-01

    Study regions of lattice disorder produced in lithium-doped float-zone melted n/p-type silicon solar cells by irradiation with monoenergetic neutrons at doses between 10 to the 10th and 10 to the 13th per cu cm. The defect regions were revealed by chemically etching the surface of the solar cells and by observing carbon replicas in an electron microscope. It was found that the defect density increased with increasing irradiation dose and increased lithium content, whereas the average defect diameter was found to decrease. From thermal annealing experiments it was found that in the lithium-doped material the defect structure was stable at temperatures between 300 and 1200 K. This was found to be in contrast to the undoped material where at the lowest doses considerable annealing was observed to occur. These results are discussed in terms of the theoretical predictions and models of defect clusters proposed by Gossick (1959) and Crawford and Cleland (1959).

  9. Association of expression levels of pluripotency/stem cell markers with the differentiation outcome of Wharton's jelly mesenchymal stem cells into insulin producing cells.

    Science.gov (United States)

    Kassem, Dina H; Kamal, Mohamed M; El-Kholy, Abd El-Latif G; El-Mesallamy, Hala O

    2016-08-01

    Recently, there has been much attention towards generation of insulin producing cells (IPCs) from stem cells, especially from Wharton's jelly mesenchymal stem cells (WJ-MSCs). However, generation of mature IPCs remains a challenge. Assessment of generation of IPCs was usually done by examining β-cell markers, however, assessment of pluripotency/stem cell markers drew less attention. Therefore, the purpose of this study was to investigate the levels of pluripotency/stem cell markers during differentiation of WJ-MSCs into IPCs and the association of these levels with differentiation outcomes. WJ-MSCs were isolated, characterized then induced to differentiate into IPCs using three different protocols namely A, B and C. Differentiated IPCs were assessed by the expression of pluripotency/stem cell markers, together with β-cell markers using qRT-PCR, and functionally by measuring glucose stimulated insulin secretion. Differentiated cells from protocol A showed lowest expression of pluripotency/stem cell markers and relatively best GSIS. However, protocol B showed concomitant expression of pluripotency/stem cell and β-cell markers with relatively less insulin secretion as compared to protocol A. Protocol C failed to generate glucose-responsive IPCs. In conclusion, sustained expression of pluripotency/stem cell markers could be associated with the incomplete differentiation of WJ-MSCs into IPCs. A novel finding for which further investigations are warranted. PMID:27265786

  10. Infiltration of IL-17-Producing T Cells and Treg Cells in a Mouse Model of Smoke-Induced Emphysema.

    Science.gov (United States)

    Duan, Min-Chao; Zhang, Jian-Quan; Liang, Yue; Liu, Guang-Nan; Xiao, Jin; Tang, Hai-Juan; Liang, Yi

    2016-08-01

    Chronic obstructive pulmonary disease (COPD) is a progressive and irreversible chronic inflammatory disease associated with the accumulation of activated T cells. To date, there is little information concerning the intrinsic association among Th17, Tc17, and regulatory T (Treg) cells in COPD. The objective of this study was to investigate the variation of lungs CD4(+)Foxp3(+) Treg cells and IL-17-producing CD4 and CD8 (Th17 and Tc17) lymphocytes in mice with cigarette-induced emphysema. Groups of mice were exposed to cigarette smoke or room air. At weeks 12 and 24, mice were sacrificed to observe histological changes by HE stain. The frequencies of Th17 (CD4(+)IL-17(+)T), Tc17 (CD8(+)IL-17(+)T), and Treg (CD4(+)Foxp3(+)T) cells in lungs from these mice were analyzed by flow cytometry. The mRNA levels of orphan nuclear receptor ROR γt and Foxp3 were performed by real-time quantitative polymerase chain reaction. The protein levels of interleukin-17 (IL-17), IL-6, IL-10, and transforming growth factor-beta (TGF-β1) were measured by enzyme-linked immunosorbent assay. Cigarette smoke caused substantial enlargement of the air spaces accompanied by the destruction of the normal alveolar architecture and led to emphysema. The frequencies of Th17 and Tc17 cells, as well as the expressions of IL-6, IL-17, TGF-β1, and ROR γt were greater in the lungs of cigarette smoke (CS)-exposed mice, particularly in the 24-week CS-exposed mice. The frequencies of Treg cells and the expressions of IL-10 and Foxp3 were lower in CS-exposed mice compared to control group. More important, the frequencies of Tregs were negatively correlated with Th17 cells and with Tc17 cells. Interestingly, a significant portion of the cells that infiltrate the lungs was skewed towards a Tc17 phenotype. Our findings suggest the contribution of Th17, Tc17, and Treg cells in the pathogenesis of COPD. Rebalance of these cells will be helpful for developing and refining the new immunological therapies for COPD

  11. In vivo ectopic bone formation by devitalized mineralized stem cell carriers produced under mineralizing culture condition.

    Science.gov (United States)

    Chai, Yoke Chin; Geris, Liesbet; Bolander, Johanna; Pyka, Grzegorz; Van Bael, Simon; Luyten, Frank P; Schrooten, Jan

    2014-12-01

    Functionalization of tissue engineering scaffolds with in vitro-generated bone-like extracellular matrix (ECM) represents an effective biomimetic approach to promote osteogenic differentiation of stem cells in vitro. However, the bone-forming capacity of these constructs (seeded with or without cells) is so far not apparent. In this study, we aimed at developing a mineralizing culture condition to biofunctionalize three-dimensional (3D) porous scaffolds with highly mineralized ECM in order to produce devitalized, osteoinductive mineralized carriers for human periosteal-derived progenitors (hPDCs). For this, three medium formulations [i.e., growth medium only (BM1), with ascorbic acid (BM2), and with ascorbic acid and dexamethasone (BM3)] supplemented with calcium (Ca(2+)) and phosphate (PO4 (3-)) ions simultaneously as mineralizing source were investigated. The results showed that, besides the significant impacts on enhancing cell proliferation (the highest in BM3 condition), the formulated mineralizing media differentially regulated the osteochondro-related gene markers in a medium-dependent manner (e.g., significant upregulation of BMP2, bone sialoprotein, osteocalcin, and Wnt5a in BM2 condition). This has resulted in distinguished cell populations that were identifiable by specific gene signatures as demonstrated by the principle component analysis. Through devitalization, mineralized carriers with apatite crystal structures unique to each medium condition (by X-ray diffraction and SEM analysis) were obtained. Quantitatively, BM3 condition produced carriers with the highest mineral and collagen contents as well as human-specific VEGF proteins, followed by BM2 and BM1 conditions. Encouragingly, all mineralized carriers (after reseeded with hPDCs) induced bone formation after 8 weeks of subcutaneous implantation in nude mice models, with BM2-carriers inducing the highest bone volume, and the lowest in the BM3 condition (as quantitated by nano-computed tomography

  12. A high-throughput approach to identify genomic variants of bacterial metabolite producers at the single-cell level

    OpenAIRE

    Binder, Stephan; Schendzielorz, Georg; Stäbler, Norma; Krumbach, Karin; Hoffmann, Kristina; Bott, Michael; Eggeling, Lothar

    2012-01-01

    We present a novel method for visualizing intracellular metabolite concentrations within single cells of Escherichia coli and Corynebacterium glutamicum that expedites the screening process of producers. It is based on transcription factors and we used it to isolate new L-lysine producing mutants of C. glutamicum from a large library of mutagenized cells using fluorescence-activated cell sorting (FACS). This high-throughput method fills the gap between existing high-throughput methods for mut...

  13. Cadmium and cisplatin damage erythropoietin-producing proximal renal tubular cells

    Energy Technology Data Exchange (ETDEWEB)

    Horiguchi, Hyogo; Oguma, Etsuko; Kayama, Fujio [Jichi Medical School, Division of Environmental Medicine, Center for Community Medicine, Tochigi (Japan); Core Research for Evolutional Science and Technology, Japan Science Technology Corporation (CREST-JST), Saitama (Japan)

    2006-10-15

    The concomitant manifestations of proximal renal tubular dysfunction and anemia with erythropoietin (Epo) deficiency observed in chronic cadmium (Cd) intoxication, such as Itai-itai disease, suggest a close local correlation between the Cd-targeted tubular cells and Epo-producing cells in the kidney. Therefore, we investigated the local relationship between hypoxia-induced Epo production and renal tubular injury in rats injected with Cd at 2 mg/kg twice a week for 8 months. Anemia due to insufficient production of Epo was observed in Cd-intoxicated rats. In situ hybridization detected Epo mRNA expression in the proximal renal tubular cells of hypoxic rats without Cd intoxication, and the Cd-intoxicated rats showed atrophy of Epo-expressing renal tubules and replacement of them with fibrotic tissue. A single dose of cisplatin at 8 mg/kg, which can induce clinical manifestations similar to those of Cd including renal tubular damage along with Epo-deficient anemia, resulted in Epo-expressing renal tubule destruction on day 4. These data indicate that Cd and cisplatin would induce anemia through the direct injury of the proximal renal tubular cells that are responsible for Epo production. (orig.)

  14. An antigen-mediated selection system for mammalian cells that produce glycosylated single-chain Fv

    International Nuclear Information System (INIS)

    Selection and production of specific antibodies are limiting the development of high-throughput immunoassays such as antibody chips. In this study, we propose an antigen-mediated selection of antibody producers (ASAP) system in mammalian cells. As a model system, transgenes encoding anti-fluorescein ScFv fused to cytokine receptors were introduced to IL-3-dependent cell lines. Addition of fluorescein-conjugated BSA induced growth signal through the ScFv/receptor chimeras, leading to selective expansion of the transduced cells. Cre recombinase was then used to excise the receptor gene flanked by two loxP recognition sites in the introns, resulting in secretion of his-myc-tagged ScFv to the culture medium. When the first loxP site was used in the exon as a linker between ScFv and receptor, enhanced antigen-mediated cell proliferation and production of unexpectedly glycosylated ScFv were achieved. ASAP is the first mammalian selection/production system of recombinant human ScFvs, without need for subcloning and with the advantage of glycosylated product

  15. [Producing Ad-IFN gamma by suspension culture of HEK293 cells in a disposable bioreactor].

    Science.gov (United States)

    Wu, Quande; Huang, Wenlin

    2014-11-01

    Adenovirus vectors are promising delivery systems for gene therapy. We established a new process for clinic trial of recombinant adenovirus vectors using a novel disposable bioreactor. The suspension HEK293 cells were inoculated into a 5 L disposable bioreactor with parameters control of pH, DO, agitation and temperature. After 6 days of a fed-batch culture, the final cell density reached 2.0 x 10(6) cells/mL. The culture was infected with Ad-IFNγ at an MOI of 30. The harvest was performed at approximately 48 h post-infection and crude viral lysate was obtained after 3 freeze/thaw cycles and centrifugation. The maximum titers of crude viral lysate was 1.49 x 10(13) Infectious units (IFU) and the bulk product specific was 3,800 IFU/cell. Purified Ad-IFNγ by anion-exchange chromatography and the final recovery of infectious unit reached 35.9%. The result demonstrates that an efficient and stable process of producing Ad-IFNγ using a disposable fed-batch bioreactor is established. PMID:25985530

  16. Characterization and Inducing Melanoma Cell Apoptosis Activity of Mannosylerythritol Lipids-A Produced from Pseudozyma aphidis.

    Science.gov (United States)

    Fan, Linlin; Li, Hongji; Niu, Yongwu; Chen, Qihe

    2016-01-01

    Mannosylerythritol lipids (MELs) are natural glycolipid biosurfactants which have potential applications in the fields of food, cosmetic and medicine. In this study, MELs were produced from vegetable oil by Pseudozyma aphidis. Their structural data through LC/MS, GC/MS and NMR analysis revealed that MEL-A with two acetyls was the major compound and the identified homologs of MEL-A contained a length of C8 to C14 fatty acid chains. This glycolipid exhibited a surface tension of 27.69 mN/m at a critical micelle concentration (CMC), self-assembling into particles in the water solution. It was observed to induce cell growth-inhibition and apoptosis of B16 melanoma cells in a dose-dependent manner, as well as cause cell cycle arrest at the S phase. Further quantitative RT-PCR analysis and western blotting revealed an increasing tendency of both mRNA and protein expressions of Caspase-12, CHOP, GRP78 and Caspase-3, and a down-regulation of protein Bcl-2. Combined with the up regulation of signaling IRE1 and ATF6, it can be speculated that MEL-A-induced B16 melanoma cell apoptosis was associated with the endoplasmic reticulum stress (ERS). PMID:26828792

  17. Characterization of Chinese Hamster Ovary Cells Producing Coagulation Factor VIII Using Multi-omics Tools

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder

    The first public draft of a genome from Chinese hamster ovary (CHO) cells was published in 2011, an entire decade after the first draft of the human genome. This publication of a relevant CHO reference genome, in combination with the fact that the cost for DNA sequencing has dropped more than 10,...... for analysis and engineering of industrially relevant CHO cells. Full implementation of such tools for generating specifically engineered CHO production cell lines may allow significant cost-reductions in production of complex biopharmaceuticals such as FVIII....... using omics tools. A wide range of methods were applied including whole-genome sequencing, targeted genome sequencing, mRNA sequencing, miRNA sequencing and mass spectrometry based shotgun proteomics on a number of clones in order to get a more holistic picture of the inner workings of these CHO...... further lead to degradation of FVIII by the endoplasmic-reticulum-associated protein degradation pathway. This is to our knowledge, the first time that such extensive omics tools have been applied to a broad panel of CHO cells producing a very complex protein. The holistic view obtained for the FVIII...

  18. Do laser and led phototherapies influence mast cells and myofibroblasts to produce collagen?

    Science.gov (United States)

    De Castro, Isabele Cardoso Vieira; Rocha, Clarissa Araújo Gurgel; Gomes Henriques, Aguida Cristina; Cavalcanti de Sousa, Ana Paula; Lisboa, Márcio Vieira; Sotero, Drielli da Rocha; Pinheiro, Antônio Luiz Barbosa; Cury, Patrícia Ramos; Santos, Jean Nunes Dos

    2014-07-01

    Laser and LED phototherapies accelerate tissue repair. Mast cells induce the proliferation of fibroblasts and the development of local fibrosis. Increased numbers of myofibroblasts and mast cells are frequently found together in a normal wound repair, suggesting that mediators produced by the mast cells could play a role in the regulation of myofibroblast differentiation and function. The aim of this study was to analyze the involvement of mast cells on the synthesis of collagen and their influence on myofibroblast differentiation in the late phase of tissue repair on wounds treated with LLLT (λ 660 nm, 10 J/cm(2), 40 mW, 252 s) or LED (λ 630 ± 10 nm, 10 J/cm(2), 115 mW, 87 s). A 1 × 1-cm surgical wound was created on the dorsum of 30 rats divided into three groups of ten animals each: control, laser, and LED. The animals of each group were irradiated and sacrificed 7 and 14 days after injury. The statistical analysis was performed using the Mann-Whitney and Spearman correlation tests. Laser light improved the collagen deposition rate along the time points (p = 0.22), but when compared to the control groups during the periods studied, the number of mast cells decreased significantly (p ≤ 0.05). With respect to myofibroblasts, the results showed a trend to their reduction. No statistical significances were observed for LED light according to the parameters used in this study. It is concluded that the mast cell and myofibroblast population might participate in the collagen formation of irradiated wounds particularly in relation to laser phototherapy. PMID:24554451

  19. Effect of the Salmonella Pathogenicity Island 2 Type III Secretion System on Salmonella Survival in Activated Chicken Macrophage-Like HD11 Cells

    OpenAIRE

    Wisner, Amanda L. S.; Potter, Andrew A.; Köster, Wolfgang

    2011-01-01

    In order to better identify the role of the Salmonella pathogenicity island 2 (SPI-2) type III secretion system (T3SS) in chickens, we used the well-known gentamicin protection assay with activated HD11 cells. HD11 cells are a macrophage-like chicken cell line that can be stimulated with phorbol 12-myristate 13-acetate (PMA) to exhibit more macrophage-like morphology and greater production of reactive oxygen species (ROS). Activated HD11 cells were infected with a wild-type Salmonella enteric...

  20. Experimental investigation of solid oxide fuel cells using biomass gasification producer gases

    Energy Technology Data Exchange (ETDEWEB)

    Norheim, Arnstein

    2005-07-01

    The main objective of this thesis is theoretical and experimental investigations related to utilisation of biomass gasification producer gases as fuel for Solid Oxide Fuel Cells (SOFC). Initial fundamental steps towards a future system of combined heat and power production based on biomass gasification and SOFC are performed and include: 1) Theoretical modeling of the composition of biomass gasification producer gases. 2) Experimental investigation of SOFC performance using biomass gasification producer gas as fuel. 3) Experimental investigation of SOFC performance using biomass gasification producer gas containing high sulphur concentration. The modeling of the composition of gasifier producer gas was performed using the program FactSage. The main objective was to investigate the amount and speciation of trace species in the producer gases as several parameters were varied. Thus, the composition at thermodynamic equilibrium of sulphur, chlorine, potassium, sodium and compounds of these were established. This was done for varying content of the trace species in the biomass material at different temperatures and fuel utilisation i.e. varying oxygen content in the producer gas. The temperature interval investigated was in the range of normal SOFC operation. It was found that sulphur is expected to be found as H2S irrespective of temperature and amount of sulphur. Only at very high fuel utilisation some S02 is formed. Important potassium containing compounds in the gas are gaseous KOH and K. When chlorine is present, the amount of KOH and K will decrease due to the formation of KCI. The level of sodium investigated here was low, but some Na, NaOH and NaCl is expected to be formed. Below a certain temperature, condensation of alkali rich carbonates may occur. The temperature at which condensation begins is mainly depending on the amount of potassium present; the condensation temperature increases with increasing potassium content. In the first experimental work

  1. Impedance spectroscopy in biodynamics: Detection of specific cells (pathogens using immune coated electrodes

    Directory of Open Access Journals (Sweden)

    Eugen Gheorghiu

    2002-11-01

    Full Text Available We describe the theoretical and experimental approaches for monitoring the interfacial biomolecular reaction between immobilized antibody and the antigen binding partner (the analyte, or the targeted cell using Impedance Spectroscopy, IS. The key idea is to reveal the presence of the analyte by investigating the dynamics of the impedance changes at the interface between transducer and bulk during the process of antibody-antigen binding (coupling of specific compounds to sensor surface. In this work, antibody-antigen (Ab-Ag reaction was directly monitored using an impedance analyzer capable of ~ 1 measurement/second and covalent immobilization chemistry and modified electrodes in the absence of a redox probe. The proposed approach may be applicable to monitoring other surface interfacial reactions such as protein-protein interactions, DNA-DNA interactions, DNA-protein interactions and DNA-small molecule interactions.

  2. An in-vitro studies on green synthesis of gold nanoparticles against pathogens and cancer cells

    Directory of Open Access Journals (Sweden)

    V. Ramesh

    2015-11-01

    Full Text Available Nanotechnology is a most promising field for generating new applications in medicine. It is imperative to integrate nanoscience and medicine. The present investigation is highly warranted to through more light upon the gold nanoparticles reduced from gold salt through the active principle of medicinal plant. The special emphasis of investigation is the active principle along with gold nanoparticles against for cancer cells. The 70 - 90 nm sized particles were synthesized by using Diospyros ferrea and this confirmed by SEM. These gold nanoparticles showed a characteristic absorption peak at 540 nm in UV spectra. The possibility of protein as a stabilizing material in gold nanoparticles is revealed by FTIR analysis. Remarkably, as a result of wide screening on the application of newly synthesized gold nanoparticles their anticancer potential has been discovered using MTT assay. The antimicrobial activity of AuNPs showed effective against bacteria than the fungal strains.

  3. Heterologous expression of pathogen-specific genes ligA and ligB in the saprophyte Leptospira biflexa confers enhanced adhesion to cultured cells and fibronectin

    Directory of Open Access Journals (Sweden)

    Haake David A

    2011-06-01

    Full Text Available Abstract Background In comparison to other bacterial pathogens, our knowledge of the molecular basis of the pathogenesis of leptospirosis is extremely limited. An improved understanding of leptospiral pathogenetic mechanisms requires reliable tools for functional genetic analysis. Leptospiral immunoglobulin-like (Lig proteins are surface proteins found in pathogenic Leptospira, but not in saprophytes. Here, we describe a system for heterologous expression of the Leptospira interrogans genes ligA and ligB in the saprophyte Leptospira biflexa serovar Patoc. Results The genes encoding LigA and LigB under the control of a constitutive spirochaetal promoter were inserted into the L. biflexa replicative plasmid. We were able to demonstrate expression and surface localization of LigA and LigB in L. biflexa. We found that the expression of the lig genes significantly enhanced the ability of transformed L. biflexa to adhere in vitro to extracellular matrix components and cultured cells, suggesting the involvement of Lig proteins in cell adhesion. Conclusions This work reports a complete description of the system we have developed for heterologous expression of pathogen-specific proteins in the saprophytic L. biflexa. We show that expression of LigA and LigB proteins from the pathogen confers a virulence-associated phenotype on L. biflexa, namely adhesion to eukaryotic cells and fibronectin in vitro. This study indicates that L. biflexa can serve as a surrogate host to characterize the role of key virulence factors of the causative agent of leptospirosis.

  4. Recombinant Nox4 cytosolic domain produced by a cell or cell-free base systems exhibits constitutive diaphorase activity

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Minh Vu Chuong, E-mail: mvchuong@yahoo.fr [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France); Zhang, Leilei [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France); Lhomme, Stanislas; Mouz, Nicolas [PX' Therapeutics, MINATEC/Batiment de Haute Technologie, Grenoble (France); Lenormand, Jean-Luc [HumProTher Laboratory, TheReX/TIMC-IMAG UMR 5525 CNRS UJF, Universite Joseph Fourier, UFR de Medecine, Domaine de la Merci, 38706 La Tronche (France); Lardy, Bernard; Morel, Francoise [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France)

    2012-03-16

    Highlights: Black-Right-Pointing-Pointer A comparison of two bacterial cell and cell-free protein expression systems is presented. Black-Right-Pointing-Pointer Soluble and active truncated Nox4 proteins are produced. Black-Right-Pointing-Pointer Nox4 has a constitutive diaphorase activity which is independent of cytosolic factors. Black-Right-Pointing-Pointer Isoform Nox4B is unable to initiate the first electronic transfer step. Black-Right-Pointing-Pointer Findings contribute to the understanding of the mechanism of Nox4 oxidase activity. -- Abstract: The membrane protein NADPH (nicotinamide adenine dinucleotide phosphate) oxidase Nox4 constitutively generates reactive oxygen species differing from other NADPH oxidases activity, particularly in Nox2 which needs a stimulus to be active. Although the precise mechanism of production of reactive oxygen species by Nox2 is well characterized, the electronic transfer throughout Nox4 remains unclear. Our study aims to investigate the initial electronic transfer step (diaphorase activity) of the cytosolic tail of Nox4. For this purpose, we developed two different approaches to produce soluble and active truncated Nox4 proteins. We synthesized soluble recombinant proteins either by in vitro translation or by bacteria induction. While proteins obtained by bacteria induction demonstrate an activity of 4.4 {+-} 1.7 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 20.5 {+-} 2.8 nmol/min/nmol with cytochrome c, the soluble proteins produced by cell-free expression system exhibit a diaphorase activity with a turn-over of 26 {+-} 2.6 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 48 {+-} 20.2 nmol/min/nmol with cytochrome c. Furthermore, the activity of the soluble proteins is constitutive and does not need any stimulus. We also show that the cytosolic tail of the isoform Nox4B lacking the first NADPH binding site is unable to demonstrate any diaphorase activity pointing out the

  5. Recombinant Nox4 cytosolic domain produced by a cell or cell-free base systems exhibits constitutive diaphorase activity

    International Nuclear Information System (INIS)

    Highlights: ► A comparison of two bacterial cell and cell-free protein expression systems is presented. ► Soluble and active truncated Nox4 proteins are produced. ► Nox4 has a constitutive diaphorase activity which is independent of cytosolic factors. ► Isoform Nox4B is unable to initiate the first electronic transfer step. ► Findings contribute to the understanding of the mechanism of Nox4 oxidase activity. -- Abstract: The membrane protein NADPH (nicotinamide adenine dinucleotide phosphate) oxidase Nox4 constitutively generates reactive oxygen species differing from other NADPH oxidases activity, particularly in Nox2 which needs a stimulus to be active. Although the precise mechanism of production of reactive oxygen species by Nox2 is well characterized, the electronic transfer throughout Nox4 remains unclear. Our study aims to investigate the initial electronic transfer step (diaphorase activity) of the cytosolic tail of Nox4. For this purpose, we developed two different approaches to produce soluble and active truncated Nox4 proteins. We synthesized soluble recombinant proteins either by in vitro translation or by bacteria induction. While proteins obtained by bacteria induction demonstrate an activity of 4.4 ± 1.7 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 20.5 ± 2.8 nmol/min/nmol with cytochrome c, the soluble proteins produced by cell-free expression system exhibit a diaphorase activity with a turn-over of 26 ± 2.6 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 48 ± 20.2 nmol/min/nmol with cytochrome c. Furthermore, the activity of the soluble proteins is constitutive and does not need any stimulus. We also show that the cytosolic tail of the isoform Nox4B lacking the first NADPH binding site is unable to demonstrate any diaphorase activity pointing out the importance of this domain.

  6. The stimulation of EL-4 cells to produce interleukin-2 and its potential use in immunocytotoxicity testing

    International Nuclear Information System (INIS)

    The ability of EL-4 thymoma cells to produce interleukin-2 (IL-2) following exposure to phorbol-12-myristate 13-acetate (PMA) and Concanavalin A (Con A) has been studied in vitro using medium containing either 10% or 1% fetal calf serum (FCS). The potent stimulatory effect of PMA on IL-2 production by EL-4 cells has been confirmed by measuring 3H-thymidine incorporation by the IL-2-dependent T cell line, CTLL-2, in the presence of conditioned medium (CM) from stimulated cultures. EL-4 cells produced several times more IL-2 when cultured in medium containing 10% FCS than when only 1% FCS was present. Added together, PMA and Con A acted synergistically in some EL-4 cell cultures. The ability of E:-4 cells to produce IL-2 was maintained after further incubation without stimulants. CM with IL-2 activity from stimulated EL-4 cells could prove useful in immunotoxicity testing

  7. Tropism and pathogenicity of rickettsiae.

    Science.gov (United States)

    Uchiyama, Tsuneo

    2012-01-01

    Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic, and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group (SFG) and typhus group (TG) rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism toward cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and non-pathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and non-pathogenic species of SFG rickettsiae (SFGR) in mammalian cells. The growth of non-pathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of non-pathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the non-pathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review. PMID:22737150

  8. Isolation and characterization of antimicrobial proteins produced by a potential probiotic strain of human Lactobacillus rhamnosus 231 and its effect on selected human pathogens and food spoilage organisms

    OpenAIRE

    Ambalam, P. S.; Prajapati, J. B.; Dave, J. M.; Nair, Baboo M.; Ljungh, Åsa; Vyas, B. R. M.

    2011-01-01

    Objective: To study in vitro properties of potential probiotics and the antimicrobial activity of Lactobacillus rhamnosus 231 isolated from human faeces. Methods and Results: Lact. rhamnosus 231 isolated from human faeces tolerated bile salt (4%), phenol (0.5%), and NaCl (4%) and retained viability at low pH (2.5). The cell-free culture (CFC) fi ltrate and extracellular protein concentrate (EPC) of Lact. rhamnosus 231 contained antimicrobial substances active against Pseudomonas aeruginosa, E...

  9. Generation of clinical grade dendritic cells with capacity to produce biologically active IL-12p70

    Directory of Open Access Journals (Sweden)

    Bigalke Iris

    2007-04-01

    Full Text Available Abstract Background For optimal T cell activation it is desirable that dendritic cells (DCs display peptides within MHC molecules as signal 1, costimulatory molecules as signal 2 and, in addition, produce IL-12p70 as signal 3. IL-12p70 polarizes T cell responses towards CD4+ T helper 1 cells, which then support the development of CD8+ cytotoxic T lymphocytes. We therefore developed new maturation cocktails allowing DCs to produce biologically active IL-12p70 for large-scale cancer vaccine development. Methods After elutriation of leukapheresis products in a closed bag system, enriched monocytes were cultured with GM-CSF and IL-4 for six days to generate immature DCs that were then matured with cocktails, containing cytokines, interferon-gamma, prostaglandin E2, and a ligand for Toll-like receptor 8, with or without poly (I:C. Results Mature DCs expressed appropriate maturation markers and the lymph node homing chemokine receptor, CCR7. They retained full maturity after culture for two days without maturation cocktails and following cryopreservation. TLR ligand stimulation induced DCs capable of secreting IL-12p70 in primary cultures and after one day of coculture with CD40L-expressing fibroblasts, mimicking an encounter with T cells. DCs matured with our new cocktails containing TLR8 ligand, with or without poly (I:C, induced alloresponses and stimulated virus-specific T cells after peptide-pulsing. DCs matured in cocktails containing TLR8 ligand without poly (I:C could also be loaded with RNA as a source of antigen, whereas DCs matured in cocktails containing poly (I:C were unable to express proteins following RNA transfer by electroporation. Conclusion Our new maturation cocktails allowed easy DC harvesting, stable maturation and substantial recoveries of mature DCs after cryopreservation. Our procedure for generating DCs is easily adaptable for GMP-compliance and yields IL-12p70-secreting DCs suitable for development of cancer vaccines using

  10. Pneumococcal infections in humans are associated with increased apoptosis and trafficking of type 1 cytokine-producing T cells

    DEFF Research Database (Denmark)

    Kemp, Kåre; Bruunsgaard, Helle; Skinhøj, Peter;

    2002-01-01

    , little is known regarding the T-cell response during in vivo infections in humans. The purpose of this study was to test the hypothesis that activated T cells producing type 1 cytokines were engaged in the host response to pneumococcal infections. The phenotype and function of T cells were studied in 22...

  11. Anode microbial communities produced by changing from microbial fuel cell to microbial electrolysis cell operation using two different wastewaters

    KAUST Repository

    Kiely, Patrick D.

    2011-01-01

    Conditions in microbial fuel cells (MFCs) differ from those in microbial electrolysis cells (MECs) due to the intrusion of oxygen through the cathode and the release of H2 gas into solution. Based on 16S rRNA gene clone libraries, anode communities in reactors fed acetic acid decreased in species richness and diversity, and increased in numbers of Geobacter sulfurreducens, when reactors were shifted from MFCs to MECs. With a complex source of organic matter (potato wastewater), the proportion of Geobacteraceae remained constant when MFCs were converted into MECs, but the percentage of clones belonging to G. sulfurreducens decreased and the percentage of G. metallireducens clones increased. A dairy manure wastewater-fed MFC produced little power, and had more diverse microbial communities, but did not generate current in an MEC. These results show changes in Geobacter species in response to the MEC environment and that higher species diversity is not correlated with current. © 2010 Elsevier Ltd.

  12. GLP1- and GIP-producing cells rarely overlap and differ by bombesin receptor-2 expression and responsiveness.

    Science.gov (United States)

    Svendsen, Berit; Pais, Ramona; Engelstoft, Maja S; Milev, Nikolay B; Richards, Paul; Christiansen, Charlotte B; Egerod, Kristoffer L; Jensen, Signe M; Habib, Abdella M; Gribble, Fiona M; Schwartz, Thue W; Reimann, Frank; Holst, Jens J

    2016-01-01

    The incretin hormones glucagon-like peptide-1 (GLP1) and glucose-dependent insulinotropic polypeptide (GIP) are secreted from intestinal endocrine cells, the so-called L- and K-cells. The cells are derived from a common precursor and are highly related, and co-expression of the two hormones in so-called L/K-cells has been reported. To investigate the relationship between the GLP1- and GIP-producing cells more closely, we generated a transgenic mouse model expressing a fluorescent marker in GIP-positive cells. In combination with a mouse strain with fluorescent GLP1 cells, we were able to estimate the overlap between the two cell types. Furthermore, we used primary cultured intestinal cells and isolated perfused mouse intestine to measure the secretion of GIP and GLP1 in response to different stimuli. Overlapping GLP1 and GIP cells were rare (∼5%). KCl, glucose and forskolin+IBMX increased the secretion of both GLP1 and GIP, whereas bombesin/neuromedin C only stimulated GLP1 secretion. Expression analysis showed high expression of the bombesin 2 receptor in GLP1 positive cells, but no expression in GIP-positive cells. These data indicate both expressional and functional differences between the GLP1-producing 'L-cell' and the GIP-producing 'K-cell'. PMID:26483393

  13. The hydrocarbon-degrading marine bacterium Cobetia sp. strain MM1IDA2H-1 produces a biosurfactant that interferes with quorum sensing of fish pathogens by signal hijacking.

    Science.gov (United States)

    Ibacache-Quiroga, C; Ojeda, J; Espinoza-Vergara, G; Olivero, P; Cuellar, M; Dinamarca, M A

    2013-07-01

    Biosurfactants are produced by hydrocarbon-degrading marine bacteria in response to the presence of water-insoluble hydrocarbons. This is believed to facilitate the uptake of hydrocarbons by bacteria. However, these diffusible amphiphilic surface-active molecules are involved in several other biological functions such as microbial competition and intra- or inter-species communication. We report the isolation and characterization of a marine bacterial strain identified as Cobetia sp. MM1IDA2H-1, which can grow using the sulfur-containing heterocyclic aromatic hydrocarbon dibenzothiophene (DBT). As with DBT, when the isolated strain is grown in the presence of a microbial competitor, it produces a biosurfactant. Because the obtained biosurfactant was formed by hydroxy fatty acids and extracellular lipidic structures were observed during bacterial growth, we investigated whether the biosurfactant at its critical micelle concentration can interfere with bacterial communication systems such as quorum sensing. We focused on Aeromonas salmonicida subsp. salmonicida, a fish pathogen whose virulence relies on quorum sensing signals. Using biosensors for quorum sensing based on Chromobacterium violaceum and Vibrio anguillarum, we showed that when the purified biosurfactant was mixed with N-acyl homoserine lactones produced by A. salmonicida, quorum sensing was inhibited, although bacterial growth was not affected. In addition, the transcriptional activities of A. salmonicida virulence genes that are controlled by quorum sensing were repressed by both the purified biosurfactant and the growth in the presence of Cobetia sp. MM1IDA2H-1. We propose that the biosurfactant, or the lipid structures interact with the N-acyl homoserine lactones, inhibiting their function. This could be used as a strategy to interfere with the quorum sensing systems of bacterial fish pathogens, which represents an attractive alternative to classical antimicrobial therapies in fish aquaculture. PMID

  14. PATHOGEN IMPACT ON THE ACTIVITY DYNAMICS OF POTATO SUSPENSION CELLS EXTRA-CELLULAR PEROXIDASE

    Directory of Open Access Journals (Sweden)

    Graskova I.A.

    2005-08-01

    Full Text Available Changes in the activity of extracellular peroxidases were measured in cell suspension cultures of potato infected by Clavibacter michiganensis subsp. sepedonicus (Spieck. et Kotth. Skapt et Burkh. The total extracellular peroxidases activity of the resistant potato variety was higher than that of the sensitive variety both before and after infection. The enzyme of the resistant variety had a рН optimum of 6.2, while that of the sensitive variety was 5.4. Extracellular peroxidases of the sensitive potato variety were activated 10 minutes after infection, and displayed highest activity 1.5-2 hours later. In the resistant variety, peroxidase activity rose sharply in the first minutes of infection, and second peak of activity occurred 1.5-2 hours later. The increase of extracellular peroxidases activity of the sensitive potato variety under pathogenesis is connected with the change of genome expression and synthesis of proteins. The increase of enzyme activity of resistant potato variety in the first moments of infection is not related to proteins synthesis and is apparently conditioned by the change of kinetic parameters.

  15. Metal chloride-treated graphene oxide to produce high-performance polymer solar cells

    International Nuclear Information System (INIS)

    We introduce a simple but effective graphene oxide (GO) modification with metal chloride treatments to produce high-performance polymer solar cells (PSCs). The role of various metal chlorides on GO and their effects on device performances of PSCs was investigated. X-ray photoelectron spectroscopy, ultraviolet photoemission spectroscopy, and current-voltage measurement studies demonstrated that metal chloride can induce a p-doping effect and increase the GO work-function, thus resulting in an improved built-in potential and interfacial resistance in PSCs. The resultant PSCs with metal chloride exhibited improved device efficiency than those with the neat GO. Furthermore, with the metal chloride-doped GO, we finally achieved an excellent PSC-efficiency of 6.58% and a very desirable device stability, which constitute a highly similar efficiency but much better PSC life-time to conventional device with poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS). This study could be a valuable way to produce various PEDOT:PSS alternatives and beneficial for producing high-performance and cost-efficient polymeric devices

  16. Antibacterial activity and immunomodulatory effects on a bovine mammary epithelial cell line exerted by nisin A-producing Lactococcus lactis strains.

    Science.gov (United States)

    Malvisi, M; Stuknytė, M; Magro, G; Minozzi, G; Giardini, A; De Noni, I; Piccinini, R

    2016-03-01

    Twenty-nine strains of mastitis pathogens were used to study the antibacterial activity of the cell-free supernatants (CFS) of 25 strains of Lactococcus lactis ssp. lactis. Out of the tested strains, only the CFS of L. lactis LL11 and SL153 were active, inhibiting and killing most of the pathogens. By means of ultra-performance liquid chromatography/high resolution mass spectrometry, they were shown to produce nisin A, a class I bacteriocin. A variable sensitivity to nisin A-containing CFS was observed among Streptococcus uberis and Enterococcus faecalis strains. Nonetheless, Streptococcus agalactiae, Strep. uberis, and E. faecalis displayed high minimum inhibitory concentration values, reaching 384 arbitrary units/mL. Interestingly, the minimum inhibitory values and the bactericidal concentrations were almost identical among them for each of the 2 stains, LL11 and SL153. Staphylococci were, on average, less sensitive than streptococci, but the 2 CFS inhibited and killed, at different dilutions, strains of methicillin-resistant Staphylococcus aureus. The immune response to nisin A-containing CFS was tested using the bovine mammary epithelial cell line BME-UV1. Application of CFS did not damage epithelial integrity, as demonstrated by the higher activity of N-acetyl-β-d-glucosaminidase (NAGase) and lysozyme inside the cells, in both treated and control samples. On the other hand, the increase of released NAGase after 15 to 24h of treatment with LL11 or SL153 live cultures demonstrated an inflammatory response of epithelial cells. Similarly, a significantly higher lysozyme activity was detected in the cells treated with LL11 live culture confirming the stimulation of lysosomal activity. The treatment of epithelial cells with SL153 live culture induced a significant tumor necrosis factor-α downregulation in the cells, but did not influence IL-8 expression. The control of tumor necrosis factor-α release could be an interesting approach to reduce the symptoms linked

  17. Human odontoblast-like cells produce nitric oxide with antibacterial activity upon TLR2 activation

    Directory of Open Access Journals (Sweden)

    Jean-Christophe FARGES

    2015-06-01

    Full Text Available The penetration of cariogenic oral bacteria into enamel and dentin during the caries process triggers an immune/inflammatory response in the underlying pulp tissue, the reduction of which is considered a prerequisite to dentinogenesis-based pulp regeneration. If the role of odontoblasts in dentin formation is well known, their involvement in the antibacterial response of the dental pulp to cariogenic microorganisms has yet to be elucidated. Our aim here was to determine if odontoblasts produce nitric oxide (NO with antibacterial activity upon activation of Toll-like receptor-2 (TLR2, a cell membrane receptor involved in the recognition of cariogenic Gram-positive bacteria. Human odontoblast-like cells differentiated from dental pulp explants were stimulated with the TLR2 synthetic agonist Pam2CSK4. We found that NOS1, NOS2 and NOS3 gene expression was increased in Pam2CSK4-stimulated odontoblast-like cells compared to unstimulated ones. NOS2 was the most up-regulated gene. NOS1 and NOS3 proteins were not detected in Pam2CSK4-stimulated or control cultures. NOS2 protein synthesis, NOS activity and NO extracellular release were all augmented in stimulated samples. Pam2CSK4-stimulated cell supernatants reduced Streptococcus mutans growth, an effect counteracted by the NOS inhibitor L-NAME. In vivo, the NOS2 gene was up-regulated in the inflamed pulp of carious teeth compared with healthy ones. NOS2 protein was immunolocalized in odontoblasts situated beneath the caries lesion but not in pulp cells from healthy teeth. These results suggest that odontoblasts may participate to the antimicrobial pulp response to dentin-invading Gram-positive bacteria through NOS2-mediated NO production. They might in this manner pave the way for accurate dental pulp healing and regeneration.

  18. HLA-B27 modulates intracellular growth of Salmonella pathogenicity island 2 mutants and production of cytokines in infected monocytic U937 cells.

    Directory of Open Access Journals (Sweden)

    Shichao Ge

    Full Text Available BACKGROUND: Salmonella enterica serovar Enteritidis PT4 KS8822/88 replicates rapidly in HLA-B27-transfected human monocytic U937 cells. In this process, Salmonella pathogenicity island 2 (SPI-2 genes play a crucial role. Our previous study indicated that 118 Salmonella genes, including 8 SPI-2 genes were affected by HLA-B27 antigen during Salmonella infection of U937 cells. METHODS/PRINCIPAL FINDINGS: To further investigate Salmonella replication in HLA-B27-positive U937 monocytic cells, two SPI-2 genes, ssaS and sscA up-regulated most during Salmonella infection of HLA-B27-transfected U937 cells, were mutated by using one-step gene disruption method. Intracellular survival and replication of the mutants in the U937 cells was compared to that of the wild type strain. Surprisingly, the two mutated strains replicated significantly more than the wild type bacteria in HLA-B27-transfected cells. Secretion of tumor necrosis factor alpha (TNF-α and interleukin 10 (IL-10 was significantly induced during the infection of HLA-B27-transfected U937 cells with the mutants. The results indicated that the certain SPI-2 genes in wild type bacteria suppress Salmonella intracellular growth and production of cytokines in infected HLA-B27-transfected cells. HLA-B27-associated modulation of Salmonella SPI-2 genes and cytokine production may have importance in the persistent infection of the bacteria and the pathogenesis of reactive arthritis. CONCLUSIONS: The study provides evidence that certain virulence factors of pathogens can reduce the intracellular growth in the host cells. We suggest that the limiting intracellular growth might be a strategy for persistence of bacteria in host cells, keeping a balance between pathogenic growth and pathogenesis.

  19. MRC5 and QU-DB bystander cells can produce bystander factors and induce radiation bystander effect

    Directory of Open Access Journals (Sweden)

    Mohammad Taghi Bahreyni Toossi

    2014-01-01

    Full Text Available Radiation damages initiated by radiation-induced bystander effect (RIBE are not limited to the first or immediate neighbors of the irradiated cells, but the effects have been observed in the cells far from the irradiation site. It has been postulated that bystander cells, by producing bystander factors, are actively involved in the propagation of bystander effect in the regions beyond the initial irradiated site. Current study was planned to test the hypothesis. MRC5 and QU-DB cell lines were irradiated, and successive medium transfer technique was performed to induce bystander effects in two bystander cell groups. Conditioned medium extracted from the target cells was transferred to the bystander cells (first bystander cells. After one hour, conditioned medium was substituted by fresh medium. Two hours later, the fresh medium was transferred to a second group of non-irradiated cells (second bystander cells. Micronucleated cells (MC were counted to quantify damages induced in the first and second bystander cell groups. Radiation effect was observed in the second bystander cells as well as in the first ones. Statistical analyses revealed that the number of MC in second bystander subgroups was significantly more than the corresponding value observed in control groups, but in most cases it was equal to the number of MC observed in the first bystander cells. MRC5 and QU-DB bystander cells can produce and release bystander signals in the culture medium and affect non-irradiated cells. Therefore, they may contribute to the RIBE propagation.

  20. Longitudinal study of reproductive performance of female cattle produced by somatic cell nuclear transfer.

    Directory of Open Access Journals (Sweden)

    Irina A Polejaeva

    Full Text Available The objective of this study was to determine whether or not reproductive performance in cattle produced by somatic cell nuclear transfer (SCNT is significantly different from that of their genetic donors. To address this question, we directed two longitudinal studies using different embryo production procedures: (1 superovulation followed by artificial insemination (AI and embryo collection and (2 ultrasound-guided ovum pick-up followed by in vitro fertilization (OPU-IVF. Collectively, these two studies represent the largest data set available for any species on the reproductive performance of female clones and their genetic donors as measured by their embryo production outcomes in commercial embryo production program. The large-scale study described herein was conducted over a six-year period of time and provides a unique comparison of 96 clones to the 40 corresponding genetic donors. To our knowledge, this is the first longitudinal study on the reproductive performance of cattle clones using OPU-IVF. With nearly 2,000 reproductive procedures performed and more than 9,200 transferable embryos produced, our observations show that the reproductive performance of cattle produced by SCNT is not different compared to their genetic donors for the production of transferable embryos after either AI followed by embryo collection (P = 0.77 or OPU-IVF (P = 0.97. These data are in agreement with previous reports showing that the reproductive capabilities of cloned cattle are equal to that of conventionally produced cattle. In conclusion, results of this longitudinal study once again demonstrate that cloning technology, in combination with superovulation, AI and embryo collection or OPU-IVF, provides a valuable tool for faster dissemination of superior maternal genetics.

  1. Human dental pulp stem cells produce mineralized matrix in 2D and 3D cultures

    Directory of Open Access Journals (Sweden)

    M. Riccio

    2010-11-01

    Full Text Available The aim of this study was to characterize the in vitro osteogenic differentiation of dental pulp stem cells (DPSCs in 2D cultures and 3D biomaterials. DPSCs, separated from dental pulp by enzymatic digestion, and isolated by magnetic cell sorting were differentiated toward osteogenic lineage on 2D surface by using an osteogenic medium. During the differentiation process, DPSCs express specific bone proteins like Runx-2, Osx, OPN and OCN with a sequential expression, analogous to those occurring during osteoblast differentiation, and produce extracellular calcium deposits. In order to differentiate cells in a 3D space that mimes the physiological environment, DPSCs were cultured in two distinct bioscaffolds, MatrigelTM and Collagen sponge. With the addition of a third dimension, osteogenic differentiation and mineralized extracellular matrix production significantly improved. In particular, in MatrigelTM DPSCs differentiated with osteoblast/osteocyte characteristics and connected by gap junction, and therefore formed calcified nodules with a 3D intercellular network. Furthermore, DPSCs differentiated in collagen sponge actively secrete human type I collagen micro-fibrils and form calcified matrix containing trabecular-like structures. These neo-formed DPSCs-scaffold devices may be used in regenerative surgical applications in order to resolve pathologies and traumas characterized by critical size bone defects.

  2. IL-22 is produced by innate lymphoid cells and limits inflammation in allergic airway disease.

    Directory of Open Access Journals (Sweden)

    Christian Taube

    Full Text Available Interleukin (IL-22 is an effector cytokine, which acts primarily on epithelial cells in the skin, gut, liver and lung. Both pro- and anti-inflammatory properties have been reported for IL-22 depending on the tissue and disease model. In a murine model of allergic airway inflammation, we found that IL-22 is predominantly produced by innate lymphoid cells in the inflamed lungs, rather than TH cells. To determine the impact of IL-22 on airway inflammation, we used allergen-sensitized IL-22-deficient mice and found that they suffer from significantly higher airway hyperreactivity upon airway challenge. IL-22-deficiency led to increased eosinophil infiltration lymphocyte invasion and production of CCL17 (TARC, IL-5 and IL-13 in the lung. Mice treated with IL-22 before antigen challenge displayed reduced expression of CCL17 and IL-13 and significant amelioration of airway constriction and inflammation. We conclude that innate IL-22 limits airway inflammation, tissue damage and clinical decline in allergic lung disease.

  3. Green fluorescent protein (GFP) transgenic pig produced by somatic cell nuclear transfer

    Institute of Scientific and Technical Information of China (English)

    LIU ZhongHua; SUN Shuang; LI YuTian; WANG HongBin; R S PRATHER; SONG Jun; WANG ZhenKun; TIAN JiangTian; KONG QingRan; ZHENG Zhong; YIN Zhi; GAO Li; MA HaiKun

    2008-01-01

    Transgenic somatic cell nuclear transfer is a very promising route for producing transgenic farm ani-mals. Research on GFP transgenic pigs can provide useful information for breeding transgenic pigs, human disease models and human organ xenotransplantation. In this study, a liposomal transfection system was screened and transgenic embryos were reconstructed by nuclear transfer of GFP positive cells into enucleated in vitro matured oocytes. The development of reconstructed embryos both in vitro and in vivo was observed, and GFP expression was determined. The results showed that porcine fe-tal-derived fibroblast cells cultured with 4.0 plJmL liposome and 1.6 pg/mL plasmid DNA for 6 h re-sulted in the highest transfection rate (3.6%). The percentage of GFP reconstructed embryos that de-veloped in vitro to the blastocyst stage was 10%. Of those the GFP positive percentage was 48%. Re-constructed transgenic embryos were transferred to 10 recipients. 5 of them were pregnant, and 3 de-livered 6 cloned piglets in which 4 piglets were transgenic for the GFP as verified by both GFP protein expression and GFP DNA sequence analysis. The percentage of reconstructed embryos that resulted in cloned piglets was 1.0%; while the percentage of piglets that were transgenic was 0.7%. This is the first group of transgenic cloned pigs born in China, marking a great progress in Chinese transgenic cloned pig research.

  4. Recombinant GDNF: Tetanus toxin fragment C fusion protein produced from insect cells

    International Nuclear Information System (INIS)

    Glial cell line-derived neurotrophic factor (GDNF) has potent survival-promoting effects on CNS motor neurons in experimental animals. Its therapeutic efficacy in humans, however, may have been limited by poor bioavailability to the brain and spinal cord. With a view toward improving delivery of GDNF to CNS motor neurons in vivo, we generated a recombinant fusion protein comprised of rat GDNF linked to the non-toxic, neuron-binding fragment of tetanus toxin. Recombinant GDNF:TTC produced from insect cells was a soluble homodimer like wild-type GDNF and was bi-functional with respect to GDNF and TTC activity. Like recombinant rat GDNF, the fusion protein increased levels of immunoreactive phosphoAkt in treated NB41A3-hGFRα-1 neuroblastoma cells. Like TTC, GDNF:TTC bound to immobilized ganglioside GT1b in vitro with high affinity and selectivity. These results support further testing of recombinant GDNF:TTC as a non-viral vector to improve delivery of GDNF to brain and spinal cord in vivo.

  5. Characterization of recombinant human diamine oxidase (rhDAO) produced in Chinese Hamster Ovary (CHO) cells.

    Science.gov (United States)

    Gludovacz, Elisabeth; Maresch, Daniel; Bonta, Maximilian; Szöllösi, Helen; Furtmüller, Paul G; Weik, Robert; Altmann, Friedrich; Limbeck, Andreas; Borth, Nicole; Jilma, Bernd; Boehm, Thomas

    2016-06-10

    Human diamine oxidase (hDAO) efficiently degrades polyamines and histamine. Reduced enzyme activities might cause complications during pregnancy and be involved in histamine intolerance. So far hDAO has been characterized after isolation from either native sources or the heterologous production in insect cells. Accessibility to human enzyme is limited and insect cells produce non-human glycosylation patterns that may alter its biochemical properties. We present the heterologous expression of hDAO in Chinese Hamster Ovary (CHO) cells and a three step purification protocol. Analysis of metal content using ICP-MS revealed that 93% of the active sites were occupied by copper. Topaquinone (TPQ) cofactor content was determined using phenylhydrazine titration. Ninety-four percent of DAO molecules contained TPQ and therefore the copper content at the active site was indirectly confirmed. Mass spectrometric analysis was conducted to verify sequence integrity of the protein and to assess the glycosylation profile. Electronic circular dichroism and UV-vis spectra data were used to characterize structural properties. The substrate preference and kinetic parameters were in accordance with previous publications. The establishment of a recombinant production system for hDAO enables us to generate decent amounts of protein with negligible impurities to address new scientific questions. PMID:27063138

  6. Recombinant GDNF: Tetanus toxin fragment C fusion protein produced from insect cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jianhong; Chian, Ru-Ju; Ay, Ilknur; Celia, Samuel A.; Kashi, Brenda B.; Tamrazian, Eric; Matthews, Jonathan C. [Cecil B. Day Laboratory for Neuromuscular Research, Department of Neurology, Massachusetts General Hospital, Charlestown, MA 02129 (United States); Remington, Mary P. [Research Service, Baltimore Veterans Affairs Medical Center, Baltimore, MD 21201 (United States); Pepinsky, R. Blake [BiogenIdec, Inc., 14 Cambridge Center, Cambridge, MA 02142 (United States); Fishman, Paul S. [Research Service, Baltimore Veterans Affairs Medical Center, Baltimore, MD 21201 (United States); Department of Neurology, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Brown, Robert H. [Cecil B. Day Laboratory for Neuromuscular Research, Department of Neurology, Massachusetts General Hospital, Charlestown, MA 02129 (United States); Francis, Jonathan W., E-mail: jwfrancisby@gmail.com [Cecil B. Day Laboratory for Neuromuscular Research, Department of Neurology, Massachusetts General Hospital, Charlestown, MA 02129 (United States)

    2009-07-31

    Glial cell line-derived neurotrophic factor (GDNF) has potent survival-promoting effects on CNS motor neurons in experimental animals. Its therapeutic efficacy in humans, however, may have been limited by poor bioavailability to the brain and spinal cord. With a view toward improving delivery of GDNF to CNS motor neurons in vivo, we generated a recombinant fusion protein comprised of rat GDNF linked to the non-toxic, neuron-binding fragment of tetanus toxin. Recombinant GDNF:TTC produced from insect cells was a soluble homodimer like wild-type GDNF and was bi-functional with respect to GDNF and TTC activity. Like recombinant rat GDNF, the fusion protein increased levels of immunoreactive phosphoAkt in treated NB41A3-hGFR{alpha}-1 neuroblastoma cells. Like TTC, GDNF:TTC bound to immobilized ganglioside GT1b in vitro with high affinity and selectivity. These results support further testing of recombinant GDNF:TTC as a non-viral vector to improve delivery of GDNF to brain and spinal cord in vivo.

  7. A high-throughput approach to identify genomic variants of bacterial metabolite producers at the single-cell level.

    Science.gov (United States)

    Binder, Stephan; Schendzielorz, Georg; Stäbler, Norma; Krumbach, Karin; Hoffmann, Kristina; Bott, Michael; Eggeling, Lothar

    2012-01-01

    We present a novel method for visualizing intracellular metabolite concentrations within single cells of Escherichia coli and Corynebacterium glutamicum that expedites the screening process of producers. It is based on transcription factors and we used it to isolate new L-lysine producing mutants of C. glutamicum from a large library of mutagenized cells using fluorescence-activated cell sorting (FACS). This high-throughput method fills the gap between existing high-throughput methods for mutant generation and genome analysis. The technology has diverse applications in the analysis of producer populations and screening of mutant libraries that carry mutations in plasmids or genomes. PMID:22640862

  8. Mesenteric IL-10-producing CD5(+) regulatory B cells suppress cow's milk casein-induced allergic responses in mice.

    Science.gov (United States)

    Kim, A-Ram; Kim, Hyuk Soon; Kim, Do Kyun; Nam, Seung Taek; Kim, Hyun Woo; Park, Young Hwan; Lee, Dajeong; Lee, Min Bum; Lee, Jun Ho; Kim, Bokyung; Beaven, Michael A; Kim, Hyung Sik; Kim, Young Mi; Choi, Wahn Soo

    2016-01-01

    Food allergy is a hypersensitive immune reaction to food proteins. We have previously demonstrated the presence of IL-10-producing CD5(+) B cells and suggested their potential role in regulating cow's milk casein allergy in humans and IgE-mediated anaphylaxis in mice. In this study, we determined whether IL-10-producing CD5(+) regulatory B cells control casein-induced food allergic responses in mice and, if so, the underlying mechanisms. The induction of oral tolerance (OT) by casein suppressed casein-induced allergic responses including the decrease of body temperature, symptom score, diarrhea, recruitment of mast cells and eosinophils into jejunum, and other biological parameters in mice. Notably, the population of IL-10-producing CD5(+) B cells was increased in mesenteric lymph node (MLN), but not in spleen or peritoneal cavity (PeC) in OT mice. The adoptive transfer of CD5(+) B cells from MLN, but not those from spleen and PeC, suppressed the casein-induced allergic responses in an allergen-specific and IL-10-dependent manner. The inhibitory effect of IL-10-producing CD5(+) B cells on casein-induced allergic response was dependent on Foxp3(+) regulatory T cells. Taken together, mesenteric IL-10-producing regulatory B cells control food allergy via Foxp3(+) regulatory T cells and could potentially act as a therapeutic regulator for food allergy. PMID:26785945

  9. Inactivated E. coli transformed with plasmids that produce dsRNA against infectious salmon anemia virus hemagglutinin show antiviral activity when added to infected ASK cells.

    Directory of Open Access Journals (Sweden)

    Katherine eGarcía

    2015-04-01

    Full Text Available Infectious salmon anemia virus (ISAV has caused great losses to the Chilean salmon industry, and the success of prevention and treatment strategies is uncertain. The use of RNA interference (RNAi is a promising approach because during the replication cycle, the ISAV genome must be transcribed to mRNA in the cytoplasm. We explored the capacity of E. coli transformed with plasmids that produce double-stranded RNA (dsRNA to induce antiviral activity when added to infected ASK cells. We transformed the non-pathogenic Escherichia coli HT115 (DE3 with plasmids that expressed highly conserved regions of the ISAV genes encoding the nucleoprotein (NP, fusion (F, hemagglutinin (HE and matrix (M proteins as dsRNA, which is the precursor of the RNAi mechanism. The inactivated transformed bacteria carrying dsRNA were tested for their capacity to silence the target ISAV genes, and the dsRNA that were able to inhibit gene expression were subsequently tested for their ability to attenuate the cytopathic effect (CPE and reduce the viral load. Of the four target genes tested, inactivated E. coli transformed with plasmids producing dsRNA targeting HE showed antiviral activity when added to infected ASK cells.

  10. Polysaccharide Multilayer Nanoencapsulation of Insulin-Producing beta-Cells Grown as Pseudoislets for Potential Cellular Delivery of Insulin

    OpenAIRE

    Zhi, Zheng-liang; Liu, Bo; Jones, Peter M.; Pickup, John C

    2010-01-01

    This paper describes the use of a layer-by-layer nanocoating technique for the encapsulation Of insulin-producing pancreatic beta-cell spheroids (pseudoislets) within chitosan/alginate multilayers. We used pseudoislets self-organized from a population of the insulinoma cell line MIN6, derived from a transgenic mouse expressing the large T-antigen of SV40 in pancreatic beta-cells, its an experimental model for the study of cell nanoencapsulation. The maintenance of spheroid morphology and rete...

  11. Pathogenic role of B-cell receptor signaling and canonical NF-κB activation in mantle cell lymphoma.

    Science.gov (United States)

    Saba, Nakhle S; Liu, Delong; Herman, Sarah E M; Underbayev, Chingiz; Tian, Xin; Behrend, David; Weniger, Marc A; Skarzynski, Martin; Gyamfi, Jennifer; Fontan, Lorena; Melnick, Ari; Grant, Cliona; Roschewski, Mark; Navarro, Alba; Beà, Sílvia; Pittaluga, Stefania; Dunleavy, Kieron; Wilson, Wyndham H; Wiestner, Adrian

    2016-07-01

    To interrogate signaling pathways activated in mantle cell lymphoma (MCL) in vivo, we contrasted gene expression profiles of 55 tumor samples isolated from blood and lymph nodes from 43 previously untreated patients with active disease. In addition to lymph nodes, MCL often involves blood, bone marrow, and spleen and is incurable for most patients. Recently, the Bruton tyrosine kinase (BTK) inhibitor ibrutinib demonstrated important clinical activity in MCL. However, the role of specific signaling pathways in the lymphomagenesis of MCL and the biologic basis for ibrutinib sensitivity of these tumors are unknown. Here, we demonstrate activation of B-cell receptor (BCR) and canonical NF-κB signaling specifically in MCL cells in the lymph node. Quantification of BCR signaling strength, reflected in the expression of BCR regulated genes, identified a subset of patients with inferior survival after cytotoxic therapy. Tumor proliferation was highest in the lymph node and correlated with the degree of BCR activation. A subset of leukemic tumors showed active BCR and NF-κB signaling apparently independent of microenvironmental support. In one of these samples, we identified a novel somatic mutation in RELA (E39Q). This sample was resistant to ibrutinib-mediated inhibition of NF-κB and apoptosis. In addition, we identified germ line variants in genes encoding regulators of the BCR and NF-κB pathway previously implicated in lymphomagenesis. In conclusion, BCR signaling, activated in the lymph node microenvironment in vivo, appears to promote tumor proliferation and survival and may explain the sensitivity of this lymphoma to BTK inhibitors. PMID:27127301

  12. HLA-B27 Modulates Intracellular Growth of Salmonella Pathogenicity Island 2 Mutants and Production of Cytokines in Infected Monocytic U937 Cells

    OpenAIRE

    Shichao Ge; Qiushui He; Kaisa Granfors

    2012-01-01

    BACKGROUND: Salmonella enterica serovar Enteritidis PT4 KS8822/88 replicates rapidly in HLA-B27-transfected human monocytic U937 cells. In this process, Salmonella pathogenicity island 2 (SPI-2) genes play a crucial role. Our previous study indicated that 118 Salmonella genes, including 8 SPI-2 genes were affected by HLA-B27 antigen during Salmonella infection of U937 cells. METHODS/PRINCIPAL FINDINGS: To further investigate Salmonella replication in HLA-B27-positive U937 monocytic cells, two...

  13. Heterogeneity of multifunctional IL-17A producing S. Typhi-specific CD8+ T cells in volunteers following Ty21a typhoid immunization.

    Science.gov (United States)

    McArthur, Monica A; Sztein, Marcelo B

    2012-01-01

    Salmonella enterica serovar Typhi (S. Typhi), the causative agent of typhoid fever, continues to cause significant morbidity and mortality world-wide. CD8+ T cells are an important component of the cell mediated immune (CMI) response against S. Typhi. Recently, interleukin (IL)-17A has been shown to contribute to mucosal immunity and protection against intracellular pathogens. To investigate multifunctional IL-17A responses against S. Typhi antigens in T memory subsets, we developed multiparametric flow cytometry methods to detect up to 6 cytokines/chemokines (IL-10, IL-17A, IL-2, interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α) and macrophage inflammatory protein-1β (MIP-1β)) simultaneously. Five volunteers were immunized with a 4 dose regimen of live-attenuated S. Typhi vaccine (Ty21a), peripheral blood mononuclear cells (PBMC) were isolated before and at 11 time points after immunization, and CMI responses were evaluated. Of the 5 immunized volunteers studied, 3 produced detectable CD8+ T cell responses following stimulation with S. Typhi-infected autologous B lymphoblastoid cell lines (B-LCL). Additionally, 2 volunteers had detectable levels of intracellular cytokines in response to stimulation with S. Typhi-infected HLA-E restricted cells. Although the kinetics of the responses differed among volunteers, all of the responses were bi- or tri-phasic and included multifunctional CD8+ T cells. Virtually all of the IL-17A detected was derived from multifunctional CD8+ T cells. The presence of these multifunctional IL-17A+ CD8+ T cells was confirmed using an unsupervised analysis program, flow cytometry clustering without K (FLOCK). This is the first report of IL-17A production in response to S. Typhi in humans, indicating the presence of a Tc17 response which may be important in protection. The presence of IL-17A in multifunctional cells co-producing Tc1 cytokines (IL-2, IFN-γ and TNF-α) may also indicate that the distinction between Tc17 and Tc1

  14. Heterogeneity of multifunctional IL-17A producing S. Typhi-specific CD8+ T cells in volunteers following Ty21a typhoid immunization.

    Directory of Open Access Journals (Sweden)

    Monica A McArthur

    Full Text Available Salmonella enterica serovar Typhi (S. Typhi, the causative agent of typhoid fever, continues to cause significant morbidity and mortality world-wide. CD8+ T cells are an important component of the cell mediated immune (CMI response against S. Typhi. Recently, interleukin (IL-17A has been shown to contribute to mucosal immunity and protection against intracellular pathogens. To investigate multifunctional IL-17A responses against S. Typhi antigens in T memory subsets, we developed multiparametric flow cytometry methods to detect up to 6 cytokines/chemokines (IL-10, IL-17A, IL-2, interferon-γ (IFN-γ, tumor necrosis factor-α (TNF-α and macrophage inflammatory protein-1β (MIP-1β simultaneously. Five volunteers were immunized with a 4 dose regimen of live-attenuated S. Typhi vaccine (Ty21a, peripheral blood mononuclear cells (PBMC were isolated before and at 11 time points after immunization, and CMI responses were evaluated. Of the 5 immunized volunteers studied, 3 produced detectable CD8+ T cell responses following stimulation with S. Typhi-infected autologous B lymphoblastoid cell lines (B-LCL. Additionally, 2 volunteers had detectable levels of intracellular cytokines in response to stimulation with S. Typhi-infected HLA-E restricted cells. Although the kinetics of the responses differed among volunteers, all of the responses were bi- or tri-phasic and included multifunctional CD8+ T cells. Virtually all of the IL-17A detected was derived from multifunctional CD8+ T cells. The presence of these multifunctional IL-17A+ CD8+ T cells was confirmed using an unsupervised analysis program, flow cytometry clustering without K (FLOCK. This is the first report of IL-17A production in response to S. Typhi in humans, indicating the presence of a Tc17 response which may be important in protection. The presence of IL-17A in multifunctional cells co-producing Tc1 cytokines (IL-2, IFN-γ and TNF-α may also indicate that the distinction between Tc17 and

  15. Mechanisms of hepatocyte growth factor-mediated signaling in differentiation of pancreatic ductal epithelial cells into insulin-producing cells

    International Nuclear Information System (INIS)

    Research highlights: → A hypothesis that the differentiation of PDEC is through MAPKs or PI3K/AKT pathways. → Determine if kinases (ERK1/2, p38, JNK, and AKT) are activated in these pathways. → Determine signal pathway(s) that may effect on HGF-induced differentiation of PDEC. → PI3K-AKT pathway is involved in the differentiation of PDECs induced by HGF. → MEK-ERK pathway effect on the proliferation of PDECs but not the differentiation. -- Abstract: Pancreatic ductal epithelial cells (PDECs) were induced to differentiate into insulin-producing cells by hepatocyte growth factor (HGF) in our previous study, but the mechanism through which this induction occurs is still unknown. HGF is a ligand that activates a tyrosine kinase encoded by the c-Met proto-oncogene. This activation is followed by indirect activation of multiple downstream signal transduction pathways (including MAPKs and the PI3K/AKT signaling pathways) that initiate various biological effects. Therefore, we speculated that the differentiation of PDECs is through either the MAPK signaling pathway or the PI3K/AKT signaling pathway. To test this hypothesis, isolated PDECs from adult rats were stimulated by adding HGF to their medium for 28 days. Then, the expression levels of several protein kinases, including MAPKs (ERK1/2, p38, and JNK) and AKT, were determined by Western blotting to determine if specific protein kinases are activated in these pathways. Subsequently, re-isolated from adult rats and cultured PDECs were pre-treated with specific inhibitors of proteins shown to be activated in these signaling pathways; these cells were then induced to differentiate by the addition of HGF. The expression levels of protein kinases were determined by Western blotting, and the differentiation rate of insulin-positive cells was determined by flow cytometry. The change of PDEC differentiation rates were compared between the groups in which cells with or without inhibitors pretreatment to determine the

  16. Early treatment with anti-VLA-4 mAb can prevent the infiltration and/or development of pathogenic CD11b+CD4+ T cells in the CNS during progressive EAE.

    Directory of Open Access Journals (Sweden)

    John E Mindur

    Full Text Available Natalizumab is a humanized monoclonal antibody against the leukocyte adhesion molecule very late antigen (VLA-4, and is currently an approved therapy for patients with relapsing-remitting multiple sclerosis (RRMS. However, it is unknown whether natalizumab is beneficial for progressive forms of MS. Therefore, we assessed the effects of anti-VLA-4 monoclonal antibody (mAb therapy in a progressive experimental autoimmune encephalomyelitis (EAE mouse model. Notably, we found that early therapy could significantly reduce the severity of progressive EAE, while treatment initiated at an advanced stage was less efficient. Furthermore, we observed the accumulation of a novel subset of GM-CSF-producing CD11b+CD4+ T cells in the CNS throughout disease progression. Importantly, early therapeutic anti-VLA-4 mAb treatment suppressed the accumulation of these GM-C