WorldWideScience

Sample records for cells produce pathogenic

  1. Cryptococcal cell morphology affects host cell interactions and pathogenicity.

    Directory of Open Access Journals (Sweden)

    Laura H Okagaki

    Full Text Available Cryptococcus neoformans is a common life-threatening human fungal pathogen. The size of cryptococcal cells is typically 5 to 10 microm. Cell enlargement was observed in vivo, producing cells up to 100 microm. These morphological changes in cell size affected pathogenicity via reducing phagocytosis by host mononuclear cells, increasing resistance to oxidative and nitrosative stress, and correlated with reduced penetration of the central nervous system. Cell enlargement was stimulated by coinfection with strains of opposite mating type, and ste3aDelta pheromone receptor mutant strains had reduced cell enlargement. Finally, analysis of DNA content in this novel cell type revealed that these enlarged cells were polyploid, uninucleate, and produced daughter cells in vivo. These results describe a novel mechanism by which C. neoformans evades host phagocytosis to allow survival of a subset of the population at early stages of infection. Thus, morphological changes play unique and specialized roles during infection.

  2. Interleukin-7 produced by intestinal epithelial cells in response to Citrobacter rodentium infection plays a major role in innate immunity against this pathogen.

    Science.gov (United States)

    Zhang, Wei; Du, Jiang-Yuan; Yu, Qing; Jin, Jun-O

    2015-08-01

    Interleukin-7 (IL-7) engages multiple mechanisms to overcome chronic viral infections, but the role of IL-7 in bacterial infections, especially enteric bacterial infections, remains unclear. Here we characterized the previously unexplored role of IL-7 in the innate immune response to the attaching and effacing bacterium Citrobacter rodentium. C. rodentium infection induced IL-7 production from intestinal epithelial cells (IECs). IL-7 production from IECs in response to C. rodentium was dependent on gamma interferon (IFN-γ)-producing NK1.1(+) cells and IL-12. Treatment with anti-IL-7Rα antibody during C. rodentium infection resulted in a higher bacterial burden, enhanced intestinal damage, and greater weight loss and mortality than observed with the control IgG treatment. IEC-produced IL-7 was only essential for protective immunity against C. rodentium during the first 6 days after infection. An impaired bacterial clearance upon IL-7Rα blockade was associated with a significant decrease in macrophage accumulation and activation in the colon. Moreover, C. rodentium-induced expansion and activation of intestinal CD4(+) lymphoid tissue inducer (LTi) cells was completely abrogated by IL-7Rα blockade. Collectively, these data demonstrate that IL-7 is produced by IECs in response to C. rodentium infection and plays a critical role in the protective immunity against this intestinal attaching and effacing bacterium.

  3. Study of the induced systemic resistance of plants: molecular aspects of the interaction between plant cells and amphiphilic elicitors produced by non-pathogenic rhizobacteria

    OpenAIRE

    Henry, Guillaume

    2013-01-01

    Some non pathogenic rhizobacteria could locally interact with plants, leading to the stimulation of a primed protection state in the host plant. Upon subsequent pathogen attack, this priming state allows an accelerated activation of defense responses extending to all organs of the plant. Fundamental as well as applied research about this induced systemic resistance (ISR) has been tremendously boosted in the past decades, driven by its evident potential for biological control of plant diseases...

  4. Human commensals producing a novel antibiotic impair pathogen colonization.

    Science.gov (United States)

    Zipperer, Alexander; Konnerth, Martin C; Laux, Claudia; Berscheid, Anne; Janek, Daniela; Weidenmaier, Christopher; Burian, Marc; Schilling, Nadine A; Slavetinsky, Christoph; Marschal, Matthias; Willmann, Matthias; Kalbacher, Hubert; Schittek, Birgit; Brötz-Oesterhelt, Heike; Grond, Stephanie; Peschel, Andreas; Krismer, Bernhard

    2016-07-28

    The vast majority of systemic bacterial infections are caused by facultative, often antibiotic-resistant, pathogens colonizing human body surfaces. Nasal carriage of Staphylococcus aureus predisposes to invasive infection, but the mechanisms that permit or interfere with pathogen colonization are largely unknown. Whereas soil microbes are known to compete by production of antibiotics, such processes have rarely been reported for human microbiota. We show that nasal Staphylococcus lugdunensis strains produce lugdunin, a novel thiazolidine-containing cyclic peptide antibiotic that prohibits colonization by S. aureus, and a rare example of a non-ribosomally synthesized bioactive compound from human-associated bacteria. Lugdunin is bactericidal against major pathogens, effective in animal models, and not prone to causing development of resistance in S. aureus. Notably, human nasal colonization by S. lugdunensis was associated with a significantly reduced S. aureus carriage rate, suggesting that lugdunin or lugdunin-producing commensal bacteria could be valuable for preventing staphylococcal infections. Moreover, human microbiota should be considered as a source for new antibiotics.

  5. Incidence of Bacteriocins Produced by Food-Related Lactic Acid Bacteria Active towards Oral Pathogens

    Directory of Open Access Journals (Sweden)

    Konstantinos Papadimitriou

    2013-02-01

    Full Text Available In the present study we investigated the incidence of bacteriocins produced by 236 lactic acid bacteria (LAB food isolates against pathogenic or opportunistic pathogenic oral bacteria. This set of LAB contained several strains (≥17% producing bacteriocins active against food-related bacteria. Interestingly only Streptococcus macedonicus ACA-DC 198 was able to inhibit the growth of Streptococcus oralis, Streptococcus sanguinis and Streptococcus gordonii, while Lactobacillus fermentum ACA-DC 179 and Lactobacillus plantarun ACA-DC 269 produced bacteriocins solely against Streptococcus oralis. Thus, the percentage of strains that were found to produce bacteriocins against oral bacteria was ~1.3%. The rarity of bacteriocins active against oral LAB pathogens produced by food-related LAB was unexpected given their close phylogenetic relationship. Nevertheless, when tested in inhibition assays, the potency of the bacteriocin(s of S. macedonicus ACA-DC 198 against the three oral streptococci was high. Fourier-transform infrared spectroscopy combined with principal component analysis revealed that exposure of the target cells to the antimicrobial compounds caused major alterations of key cellular constituents. Our findings indicate that bacteriocins produced by food-related LAB against oral LAB may be rare, but deserve further investigation since, when discovered, they can be effective antimicrobials.

  6. Endocrine cells producing regulatory peptides.

    Science.gov (United States)

    Solcia, E; Usellini, L; Buffa, R; Rindi, G; Villani, L; Zampatti, C; Silini, E

    1987-07-15

    Recent data on the immunolocalization of regulatory peptides and related propeptide sequences in endocrine cells and tumors of the gastrointestinal tract, pancreas, lung, thyroid, pituitary (ACTH and opioids), adrenals and paraganglia have been revised and discussed. Gastrin, xenopsin, cholecystokinin (CCK), somatostatin, motilin, secretin, GIP (gastric inhibitory polypeptide), neurotensin, glicentin/glucagon-37 and PYY (peptide tyrosine tyrosine) are the main products of gastrointestinal endocrine cells; glucagon, CRF (corticotropin releasing factor), somatostatin, PP (pancreatic polypeptide) and GRF (growth hormone releasing factor), in addition to insulin, are produced in pancreatic islet cells; bombesin-related peptides are the main markers of pulmonary endocrine cells; calcitonin and CGRP (calcitonin gene-related peptide) occur in thyroid and extrathyroid C cells; ACTH and endorphins in anterior and intermediate lobe pituitary cells, alpha-MSH and CLIP (corticotropin-like intermediate lobe peptide) in intermediate lobe cells; met- and leu-enkephalins and related peptides in adrenal medullary and paraganglionic cells as well as in some gut (enterochromaffin) cells; NPY (neuropeptide Y) in adrenaline-type adrenal medullary cells, etc.. Both tissue-appropriate and tissue-inappropriate regulatory peptides are produced by endocrine tumours, with inappropriate peptides mostly produced by malignant tumours.

  7. Cyt toxins produced by Bacillus thuringiensis: a protein fold conserved in several pathogenic microorganisms.

    Science.gov (United States)

    Soberón, Mario; López-Díaz, Jazmin A; Bravo, Alejandra

    2013-03-01

    Bacillus thuringiensis bacteria produce different insecticidal proteins known as Cry and Cyt toxins. Among them the Cyt toxins represent a special and interesting group of proteins. Cyt toxins are able to affect insect midgut cells but also are able to increase the insecticidal damage of certain Cry toxins. Furthermore, the Cyt toxins are able to overcome resistance to Cry toxins in mosquitoes. There is an increasing potential for the use of Cyt toxins in insect control. However, we still need to learn more about its mechanism of action in order to define it at the molecular level. In this review we summarize important aspects of Cyt toxins produced by Bacillus thuringiensis, including current knowledge of their mechanism of action against mosquitoes and also we will present a primary sequence and structural comparison with related proteins found in other pathogenic bacteria and fungus that may indicate that Cyt toxins have been selected by several pathogenic organisms to exert their virulence phenotypes.

  8. HecA, a member of a class of adhesins produced by diverse pathogenic bacteria, contributes to the attachment, aggregation, epidermal cell killing, and virulence phenotypes of Erwinia chrysanthemi EC16 on Nicotiana clevelandii seedlings.

    Science.gov (United States)

    Rojas, Clemencia M; Ham, Jong Hyun; Deng, Wen-Ling; Doyle, Jeff J; Collmer, Alan

    2002-10-01

    Erwinia chrysanthemi is representative of a broad class of bacterial pathogens that are capable of inducing necrosis in plants. The E. chrysanthemi EC16 hecA gene predicts a 3,850-aa member of the Bordetella pertussis filamentous hemagglutinin family of adhesins. A hecATn7 mutant was reduced in virulence on Nicotiana clevelandii seedlings after inoculation without wounding. Epifluorescence and confocal laser-scanning microscopy observations of hecA and wild-type cells expressing the green fluorescent protein revealed that the mutant is reduced in its ability to attach and then form aggregates on leaves and to cause an aggregate-associated killing of epidermal cells. Cell killing also depended on production of the major pectate lyase isozymes and the type II, but not the type III, secretion pathway in E. chrysanthemi. HecA homologs were found in bacterial pathogens of plants and animals and appear to be unique to pathogens and universal in necrogenic plant pathogens. Phylogenetic comparison of the conserved two-partner secretion domains in the proteins and the 16S rRNA sequences in respective bacteria revealed the two datasets to be fundamentally incongruent, suggesting horizontal acquisition of these genes. Furthermore, hecA and its two homologs in Yersinia pestis had a G+C content that was 10% higher than that of their genomes and similar to that of plant pathogenic Ralstonia, Xylella, and Pseudomonas spp. Our data suggest that filamentous hemagglutinin-like adhesins are broadly important virulence factors in both plant and animal pathogens.

  9. Cell entry by human pathogenic arenaviruses.

    Science.gov (United States)

    Rojek, Jillian M; Kunz, Stefan

    2008-04-01

    The arenaviruses Lassa virus (LASV) in Africa and Machupo (MACV), Guanarito (GTOV) and Junin viruses (JUNV) in South America cause severe haemorrhagic fevers in humans with fatality rates of 15-35%. The present review focuses on the first steps of infection with human pathogenic arenaviruses, the interaction with their cellular receptor molecules and subsequent entry into the host cell. While similarities exist in genomic organization, structure and clinical disease caused by pathogenic Old World and New World arenaviruses these pathogens use different primary receptors. The Old World arenaviruses employ alpha-dystroglycan, a cellular receptor for proteins of the extracellular matrix, and the human pathogenic New World arenaviruses use the cellular cargo receptor transferrin receptor 1. While the New World arenavirus JUNV enters cells via clathrin-dependent endocytosis, evidence occurred for clathrin-independent entry of the prototypic Old World arenavirus lymphocytic choriomeningitis virus. Upon internalization, arenaviruses are delivered to the endosome, where pH-dependent membrane fusion is mediated by the envelope glycoprotein (GP). While arenavirus GPs share characteristics with class I fusion GPs of other enveloped viruses, unusual mechanistic features of GP-mediated membrane fusion have recently been discovered for arenaviruses with important implications for viral entry.

  10. Bacteriocin activity against various pathogens produced by Pediococcus pentosaceus VJ13 isolated from Idly batter.

    Science.gov (United States)

    Vidhyasagar, Venkatasubramanian; Jeevaratnam, Kadirvelu

    2013-11-01

    Bacteriocins, an antimicrobial peptide, is known to have wide spectrum antimicrobial activity against various pathogens. Because they are easily digested in the intestine, they are considered as safe and are widely used as food preservatives. Hence their purification and characterization have attracted considerable attraction, especially for those having activity against human pathogens. In this study, the bacteriocin produced by Pediococcus pentosaceus VJ13 was precipitated with cold acetone and purified by gel permeation chromatography and hydrophobic interaction chromatography. The bacteriocin exhibited antimicrobial activity against various pathogens, like Mycobacterium smegmatis, Klebsiella pneumonia, Clostridium perfringens and Staphylococcus epidermidis. The activity of bacteriocin was lost completely after treatment with protease, which revealed its proteinaceous nature. The bacteriocin was stable up to 100°C and exhibited antilisterial property which is a characteristic feature of class IIa bacteriocins. It was active within the pH range of 2-8 and stable against various chemicals and denaturants. Tricine SDS-PAGE revealed its molecular weight to be 4.0 kDa, where the corresponding activity against Listeria monocytogenes was also noted. Treatment of L. monocytogenes with bacteriocin decreased the viable cell count, and scanning electron microscope analysis revealed membrane pore formation that resulted in the release of intracellular content, suggesting its bactericidal effect.

  11. Bioactive Secondary Metabolites Produced by the Oak Pathogen Diplodia corticola.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Cimmino, Alessio; D'Amico, Wanda; Scanu, Bruno; Evidente, Marco; Tuzi, Angela; Evidente, Antonio

    2016-01-13

    Three new lactones and a new fatty acid ester, named sapinofuranones C and D, diplopyrone B, and diplobifuranylone C, respectively, were isolated from Diplodia corticola, together with sphaeropsidins A and C, diplopyrone, diplobifuranylones A and B, diplofuranone A, and the (S,S)-enantiomer of sapinofuranone B. Sapinofuranones C and D, diplopyrone B, and diplobifuranylone C were characterized as (5S)-5-((1,S-1,6-dihydroxyhexa-2,4-dienyl)-dihydrofuran-2-one, 4,5-dihydroxy-deca-6,8-dienoic acid methyl ester, (5S)-5-hydroxy-6-(penta-1,3-dienyl)-5,6-dihydro-pyran-2-one, and 5'-((1R)-1-hydroxyethyl)-2',5'-dihydro-2H-[2,2']bifuranyl-5-one by spectroscopic and chemical methods, respectively. The relative configuration of sapinofuranone C was assigned by X-ray diffraction analysis, whereas its absolute configuration was determined by applying the advanced Mosher's method to its 11-O-p-bromobenzoyl derivative. The same method was used to assign the absolute configuration to C-5 of diplopyrone B and to that of the hydroxyethyl of the side chain of diplobifuranylone C, respectively. The metabolites isolated were tested at 1 mg/mL on leaves of cork oak, grapevine cv. 'Cannonau', and tomato using the leaf puncture assay. They were also tested on tomato cuttings at 0.2, 0.1, and 0.05 mg/mL. Each compound was tested for zootoxic activity on Artemia salina L. larvae. The efficacy of sapinofuranone C and diplopyrone B on three plant pathogens, namely, Athelia rolfsii, Fusarium avenaceum, and Phytophthora nicotianae was also evaluated. In all phytotoxic assays only diplopyrone B was found to be active. It also showed strong inhibition on the vegetative growth of A. rolfsii and P. nicotianae. All metabolites were inactive in the assay performed for the zootoxic activity (A. salina) even at the highest concentration used (200 μg/mL). Diplopyrone B showed a promising antioomycete activity for the control of Phytophthora spp. also taking into account the absence of zootoxic activity.

  12. Immunity to pathogens taught by specialized human dendritic cell subsets.

    Directory of Open Access Journals (Sweden)

    Jens A. E. Geginat

    2015-10-01

    Full Text Available Dendritic cells (DC are specialized antigen-presenting cells (APC that have a key role in immune responses, because they bridge the innate and adaptive arms of the immune system. They mature upon recognition of pathogens and up-regulate MHC molecules and co-stimulatory receptors to activate antigen-specific CD4+ and CD8+ T-cells. It is now well established that DC are not a homogeneous population, but are composed of different subsets with specialized functions in immune responses to specific pathogens. Upon viral infections, plasmacytoid DC (pDC rapidly produce large amounts of IFN-α, which has potent anti-viral functions and activates several other immune cells. However, pDC are not particularly potent APC and induce the tolerogenic cytokine IL-10 in CD4+ T-cells. In contrast, myeloid DC (mDC are very potent APC and possess the unique capacity to prime naïve T-cells and consequently to initiate a primary adaptive immune response. Different subsets of myeloid DC with specialized functions have been identified. In mice, CD8α+ mDC capture antigenic material from necrotic cells, secrete high levels of IL-12, and prime Th1 and cytotoxic T cell responses to control intracellular pathogens. Conversely, CD8α- mDC preferentially prime CD4+ T-cells and promote Th2 or Th17 differentiation. BDCA-3+ mDC2 are the human homologue of CD8α+ mDC, since they share the expression of several key molecules, the capacity to cross-present antigens to CD8+ T-cells and to produce IFN-λ. However, although several features of the DC network are conserved between humans and mice, the expression of several relevant toll-like receptors as well as the production of cytokines that regulate T-cell differentiation are different. Intriguingly, recent data suggests specific roles for human DC subsets in immune responses against individual pathogens. The biology of human DC subsets holds the promise to be exploitable in translational medicine, in particular for the

  13. Inhibition of pathogens on fresh produce by ultraviolet energy.

    Science.gov (United States)

    Yaun, Brian R; Sumner, Susan S; Eifert, Joseph D; Marcy, Joseph E

    2004-01-01

    Ultraviolet energy at a wavelength of 253.7 nm (UVC) was investigated for its bactericidal effects on the surface of Red Delicious apples, leaf lettuce and tomatoes inoculated with cultures of Salmonella spp. or Escherichia coli O157:H7. Inoculated samples were subjected to different doses ranging from 1.5 to 24 mW/cm(2) of UVC and enumerated on tryptic soy agar plus 0.05 g/l nalidixic acid to determine effective log reductions of microbial populations. UVC applied to apples inoculated with E. coli O157:H7 resulted in the highest log reduction of approximately 3.3 logs at 24 mW/cm(2). Lower log reductions were seen on tomatoes inoculated with Salmonella spp. (2.19 logs) and green leaf lettuce inoculated with both Salmonella spp. and E. coli O157:H7 (2.65 and 2.79, respectively). No significant statistical difference (p>0.05) was seen in the ability of UVC to inactivate a higher population of either Salmonella spp. or E. coli O157:H7 on the surface of green leaf lettuce. No significant difference was seen among the use of different doses applied to the surface of fresh produce for reduction of E. coli O157:H7 or Salmonella spp. (p>0.05). The use of UVC may prove to be beneficial in protecting the safety of fruits and vegetables in conjunction with Good Agricultural Practices and Good Manufacturing Practices.

  14. Most Common Foodborne Pathogens and Mycotoxins on Fresh Produce: A Review of Recent Outbreaks.

    Science.gov (United States)

    Yeni, F; Yavaş, S; Alpas, H; Soyer, Y

    2016-07-03

    Every year millions of people are affected and thousands of them die due to infections and intoxication as a result of foodborne outbreaks, which also cause billions of dollars' worth of damage, public health problems, and agricultural product loss. A considerable portion of these outbreaks is related to fresh produce and caused by foodborne pathogens on fresh produce and mycotoxins. Escherichia coli O104:H4 outbreak, occurred in Germany in 2011, has attracted a great attention on foodborne outbreaks caused by contaminated fresh produce, and especially the vulnerability and gaps in the early warning and notification networks in the surveillance systems in all around the world. In the frame of this paper, we reviewed the most common foodborne pathogens on fresh produce, traceback investigations of the outbreaks caused by these pathogens, and lastly international early warning and notification systems, including PulseNet International and Rapid Alert System for Food and Feed, aiming to detect foodborne outbreaks.

  15. Pathogenic memory type Th2 cells in allergic inflammation.

    Science.gov (United States)

    Endo, Yusuke; Hirahara, Kiyoshi; Yagi, Ryoji; Tumes, Damon J; Nakayama, Toshinori

    2014-02-01

    Immunological memory is a hallmark of adaptive immunity. Memory CD4 T helper (Th) cells are central to acquired immunity, and vaccines for infectious diseases are developed based on this concept. However, memory Th cells also play a critical role in the pathogenesis of various chronic inflammatory diseases, including asthma. We refer to these populations as 'pathogenic memory Th cells.' Here, we review recent developments highlighting the functions and characteristics of several pathogenic memory type Th2 cell subsets in allergic inflammation. Also discussed are the similarities and differences between pathogenic memory Th2 cells and recently identified type 2 innate lymphoid cells (ILC2), focusing on cytokine production and phenotypic profiles.

  16. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater.

    Science.gov (United States)

    Franz, Eelco; Veenman, Christiaan; van Hoek, Angela H A M; de Roda Husman, Ana; Blaak, Hetty

    2015-09-24

    To assess public health risks from environmental exposure to Extended-Spectrum β-Lactamases (ESBL)-producing bacteria, it is necessary to have insight in the proportion of relative harmless commensal variants and potentially pathogenic ones (which may directly cause disease). In the current study, 170 ESBL-producing E. coli from Dutch wastewater (n = 82) and surface water (n = 88) were characterized with respect to ESBL-genotype, phylogenetic group, resistance phenotype and virulence markers associated with enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), extraintesinal E. coli (ExPEC), and Shiga toxin-producing E. coli (STEC). Overall, 17.1% of all ESBL-producing E. coli were suspected pathogenic variants. Suspected ExPECs constituted 8.8% of all ESBL-producing variants and 8.3% were potential gastrointestinal pathogens (4.1% EAEC, 1.8% EPEC, 1.2% EIEC, 1.2% ETEC, no STEC). Suspected pathogens were significantly associated with ESBL-genotype CTX-M-15 (X(2) = 14.7, P < 0.001) and phylogenetic group B2 (X(2) = 23.5, P < 0.001). Finally, 84% of the pathogenic ESBL-producing E. coli isolates were resistant to three or more different classes of antibiotics. In conclusion, this study demonstrates that the aquatic environment is a potential reservoir of E. coli variants that combine ESBL-genes, a high level of multi-drug resistance and virulence factors, and therewith pose a health risk to humans upon exposure.

  17. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    NARCIS (Netherlands)

    Banach, J.L.; Sampers, I.; Haute, van S.; Fels, van der H.J.

    2015-01-01

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water dis

  18. Comparison of sample preparation methods for the recovery of foodborne pathogens from fresh produce.

    Science.gov (United States)

    Kim, Se-Ri; Yoon, Yohan; Kim, Won-Il; Park, Kyeong-Hun; Yun, Hye-Jeong; Chung, Duck Hwa; Yun, Jong Chul; Ryu, Kyoung Yul

    2012-07-01

    Sample preparation methods (pummeling, pulsifying, sonication, and shaking by hand) were compared for achieving maximum recovery of foodborne pathogens from iceberg lettuce, perilla leaves, cucumber, green pepper, and cherry tomato. Antimicrobial and dehydration effects also were examined to investigate causes of poor recovery of pathogens. Each produce type was inoculated with Escherichia coli O157:H7, Salmonella Typhimurium, Listeria monocytogenes, Staphylococcus aureus, and Bacillus cereus at 6.0 log CFU/cm(2), and samples were prepared using the four methods. Bacterial populations recovered from the five types of produce were significantly different (P cucumber, and green pepper had no antimicrobial activity, the populations of E. coli O157:H7, Salmonella Typhimurium, B. cereus, and L. monocytogenes in cherry tomato extract were slightly reduced after these treatments (P 2 log CFU/cm(2) after exposure to 40% relative humidity for 1 h. No reduction was observed when the five pathogens were exposed to 90% relative humidity. These data suggest that pummeling and pulsifying are optimal sample preparation methods for detection of microorganisms. Acidic produce such as cherry tomato should be treated with a method that does not cause sample breakdown so that acid stress on the bacteria can be minimized. Dehydration stress also affects recovery of pathogens from produce.

  19. [Helper T cell paradigm: Th17 and regulatory T cells involved in autoimmune inflammatory disorders, pathogen defense and allergic diseases].

    Science.gov (United States)

    Noma, Takeshi

    2010-01-01

    The helper T cell paradigm, divided into two distinct subsets, Th1 and Th2 cells, characterized by distinct cytokine and functions, has been expanded to IL-17-producing Th17 cells. Th1 cells producing IFN-γ are involved in delayed-type hypersensitivity, effective in intracellular pathogens defense, while Th2 cells secrete IL-4, IL-5, IL-13 and IL-25 and has a central role in IgE production, eosinophilic inflammation, and the protection for helminthic parasite infection. Th17 cell lineages, expressing IL-17 family of cytokines and IL-23-mediated functions on T cells, plays a role in immune response to fungi and extracellular pathogens and autoimmune inflammatory disorders. Th17 cells are required the combination of IL-6 and TGF-β and the transcription factors, RORC2/RORgt (mice) and STAT3 for differentiation, and produce IL-17, IL-22, IL-17F, IL-21 and CCL20. FOXP3+ regulatory T (Treg) cells produce TGF-β and IL-10, which regulate effector T cells, and thus maintain peripheral tolerance. Four functionally unique CD4+ T cells, including the regulatory T (Treg) cells are now involved in the regulation of immune responses to pathogens, self-antigens and allergens. Any defect in the entire CD4+T cell population might results in human diseases. In this review, the biology of Th17 cells and Treg cells and their role in immune diseases are presented.

  20. Characterization and pathogenic role of outer membrane vesicles produced by the fish pathogen Piscirickettsia salmonis under in vitro conditions.

    Science.gov (United States)

    Oliver, Cristian; Valenzuela, Karla; Hernández, Mauricio; Sandoval, Rodrigo; Haro, Ronie E; Avendaño-Herrera, Ruben; Cárcamo, Juan G; Villar, Maite T; Artigues, Antonio; Garduño, Rafael; Yáñez, Alejandro J

    2016-02-29

    Piscirickettsia salmonis is one of the major fish pathogens affecting Chilean aquaculture. This Gram-negative bacterium is highly infectious and is the etiological agent of Piscirickettsiosis. Little is currently known about how the virulence factors expressed by P. salmonis are delivered to host cells. However, it is known that several Gram-negative microorganisms constitutively release outer membrane vesicles (OMVs), which have been implicated in the delivery of virulence factors to host cells. In this study, OMVs production by P. salmonis was observed during infection in CHSE-214 cells and during normal growth in liquid media. The OMVs were spherical vesicles ranging in size between 25 and 145 nm. SDS-PAGE analysis demonstrated that the protein profile of the OMVs was similar to the outer membrane protein profile of P. salmonis. Importantly, the bacterial chaperonin Hsp60 was found in the OMVs of P. salmonis by Western-blot and LC-MS/MS analyses. Finally, in vitro infection assays showed that purified OMVs generated a cytopathic effect on CHSE-214 cells, suggesting a role in pathogenesis. Therefore, OMVs might be an important vehicle for delivering effector molecules to host cells during P. salmonis infection.

  1. Antimicrobial peptides targeting Gram-negative pathogens, produced and delivered by lactic acid bacteria.

    Science.gov (United States)

    Volzing, Katherine; Borrero, Juan; Sadowsky, Michael J; Kaznessis, Yiannis N

    2013-11-15

    We present results of tests with recombinant Lactococcus lactis that produce and secrete heterologous antimicrobial peptides with activity against Gram-negative pathogenic Escherichia coli and Salmonella . In an initial screening, the activities of numerous candidate antimicrobial peptides, made by solid state synthesis, were assessed against several indicator pathogenic E. coli and Salmonella strains. Peptides A3APO and Alyteserin were selected as top performers based on high antimicrobial activity against the pathogens tested and on significantly lower antimicrobial activity against L. lactis . Expression cassettes containing the signal peptide of the protein Usp45 fused to the codon-optimized sequence of mature A3APO and Alyteserin were cloned under the control of a nisin-inducible promoter PnisA and transformed into L. lactis IL1403. The resulting recombinant strains were induced to express and secrete both peptides. A3APO- and Alyteserin-containing supernatants from these recombinant L. lactis inhibited the growth of pathogenic E. coli and Salmonella by up to 20-fold, while maintaining the host's viability. This system may serve as a model for the production and delivery of antimicrobial peptides by lactic acid bacteria to target Gram-negative pathogenic bacteria populations.

  2. Extended spectrum beta lactamase producing Proteus penneri: A rare missed pathogen?

    Directory of Open Access Journals (Sweden)

    Anita Pandey

    2014-01-01

    Full Text Available Indole negative Proteus species are invariably incorrectly identified as Proteus mirabilis, often missing out isolates of Proteus penneri. We report a case of extended spectrum beta lactamase producing and multidrug-resistant P. penneri isolated from pus from pressure sore of a patient of road traffic accident. Correct and rapid isolation and identification of such resistant pathogen are important as they are significant nosocomial threat.

  3. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water.

    Science.gov (United States)

    Banach, Jennifer L; Sampers, Imca; Van Haute, Sam; van der Fels-Klerx, H J Ine

    2015-07-23

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant's reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer's efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  4. Isolation of Biosurfactant–Producing Bacteria with Antimicrobial Activity against Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Siripun Sarin

    2011-01-01

    Full Text Available The aims of this research were to study biosurfactant producing bacteria isolated from soil and to determine their property and efficiency as biosurfactants in order to inhibit bacterial pathogens. The result showed that there were 8 bacterial isolates out of 136 isolates of the total biosurfactant producing bacteria screened that exhibited the diameter of clear zone more than 1.5 cm. in the oil spreading test. The highest potential of emulsifying activity (%EA24 of 54.4 and the maximum additive concentration, (%MAC of 24.2 was obtained from the fermentation broth of the G7 isolate which the G7 isolate was later identified as Pseudomonas fluorescens. Escherichia coli, Staphylococcus aureus and Psuedomonas aeruginosa were the tested bacterial pathogens that were most sensitive to the acid precipitated biosurfactant obtained from P. fluorescens G7 with the lowest minimum inhibitory concentration (MIC of 41.6 mg/ml and minimum bactericidal concentration (MBC of 41.6 mg/ml compared with the acid precipitated bisurfactants of the other isolates used in the antimicrobial activity test. The type of the separated crude biosurfactant produced by P. fluorescens G7 analyzed later by using the rhamose test, TLC and FT-IR techniques was rhamnolipid.

  5. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Directory of Open Access Journals (Sweden)

    Jennifer L. Banach

    2015-07-01

    Full Text Available The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  6. Long-Term Live Cell Imaging of Cell Migration: Effects of Pathogenic Fungi on Human Epithelial Cell Migration.

    Science.gov (United States)

    Wöllert, Torsten; Langford, George M

    2016-01-01

    Long-term live cell imaging was used in this study to determine the responses of human epithelial cells to pathogenic biofilms formed by Candida albicans. Epithelial cells of the skin represent the front line of defense against invasive pathogens such as C. albicans but under certain circumstances, especially when the host's immune system is compromised, the skin barrier is breached. The mechanisms by which the fungal pathogen penetrates the skin and invade the deeper layers are not fully understood. In this study we used keratinocytes grown in culture as an in vitro model system to determine changes in host cell migration and the actin cytoskeleton in response to virulence factors produced by biofilms of pathogenic C. albicans. It is clear that changes in epithelial cell migration are part of the response to virulence factors secreted by biofilms of C. albicans and the actin cytoskeleton is the downstream effector that mediates cell migration. Our goal is to understand the mechanism by which virulence factors hijack the signaling pathways of the actin cytoskeleton to alter cell migration and thereby invade host tissues. To understand the dynamic changes of the actin cytoskeleton during infection, we used long-term live cell imaging to obtain spatial and temporal information of actin filament dynamics and to identify signal transduction pathways that regulate the actin cytoskeleton and its associated proteins. Long-term live cell imaging was achieved using a high resolution, multi-mode epifluorescence microscope equipped with specialized light sources, high-speed cameras with high sensitivity detectors, and specific biocompatible fluorescent markers. In addition to the multi-mode epifluorescence microscope, a spinning disk confocal long-term live cell imaging system (Olympus CV1000) equipped with a stage incubator to create a stable in vitro environment for long-term real-time and time-lapse microscopy was used. Detailed descriptions of these two long-term live

  7. Signaling events in pathogen-induced macrophage foam cell formation.

    Science.gov (United States)

    Shaik-Dasthagirisaheb, Yazdani B; Mekasha, Samrawit; He, Xianbao; Gibson, Frank C; Ingalls, Robin R

    2016-08-01

    Macrophage foam cell formation is a key event in atherosclerosis. Several triggers induce low-density lipoprotein (LDL) uptake by macrophages to create foam cells, including infections with Porphyromonas gingivalis and Chlamydia pneumoniae, two pathogens that have been linked to atherosclerosis. While gene regulation during foam cell formation has been examined, comparative investigations to identify shared and specific pathogen-elicited molecular events relevant to foam cell formation are not well documented. We infected mouse bone marrow-derived macrophages with P. gingivalis or C. pneumoniae in the presence of LDL to induce foam cell formation, and examined gene expression using an atherosclerosis pathway targeted plate array. We found over 30 genes were significantly induced in response to both pathogens, including PPAR family members that are broadly important in atherosclerosis and matrix remodeling genes that may play a role in plaque development and stability. Six genes mainly involved in lipid transport were significantly downregulated. The response overall was remarkably similar and few genes were regulated in a pathogen-specific manner. Despite very divergent lifestyles, P. gingivalis and C. pneumoniae activate similar gene expression profiles during foam cell formation that may ultimately serve as targets for modulating infection-elicited foam cell burden, and progression of atherosclerosis.

  8. Comparative Analysis of Immune Cells Activation and Cytotoxicity upon Exposure Pathogen and Glycoconjugates

    Science.gov (United States)

    Saheb, Entsar; Tarasenko, Olga

    2010-04-01

    Peripheral mononuclear cells (PMNC) including macrophages are key players in the immune responses against pathogens. Any infection could be attenuated if PMNC would be activated and capable to kill pathogen on exposure. It was shown that glycoconjugates (GCs) play an important role in adhesion to, activation, and recognition of pathogens. Nitric oxide (NO) is a regulatory molecule released by immune cells against pathogens that include bacteria, protozoa, helminthes, and fungi. NO is a highly reactive and diffusible molecule that controls replication or intracellular killing of pathogens during infection and immune responses against infections caused by pathogens. Avirulent Bacillus anthracis Sterne spores were used as a model in our study. The purpose of this study was two-fold: A) to analyze PMNC activation through NO production and B) to determine the cytotoxicity effect based on lactate dehydrogenase (LDH) upon exposure to pathogen exerted by GCs. The latter were used "prior to," "during," and "following" PMNC exposure to pathogen in order to modulate immune responses to spores during phagocytosis. Post-phagocytosis study involved the assessment of NO and LDH release by macrophages upon exposure to spores. Results have shown that untreated PMNC released low levels of NO. However, in the presence of GCs, PMNC were activated and produced high levels of NO under all experimental conditions. In addition, the results showed that GC1, GC3 are capable of increasing PMNC activity as evidenced by higher NO levels under the "prior," "during" and "following" to pathogen exposure conditions. On the other hand, GCs were capable of controlling cytotoxicity and decreased LDH levels during phagocytosis of spores. Our findings suggest that GCs stimulate NO production by activating PMNC and decrease cytotoxicity caused by pathogens on PMNC.

  9. A novel cell subset:Interferon-producing killer dendritic cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Recent reports introduce a novel cell subset of DCs with antigenic phenotypes shared by both NK cells and B cells, but without surface markers of pDCs and T cells, appearing to be a chimera of NK cells and DCs, namely interferon-producing killer dendritic cells(IKDCs).IKDCs not only secret type I and type II interferons to recognize and kill tumor cells effectively, but also express MHC-II molecules to present antigens.Thus, IKDCs are considered as important immunosurveilance cells for tumors, providing a link between innate and adaptive immunity.

  10. Applying fluorescence microscopy to the investigation of the behavior of foodborne pathogens on produce

    Science.gov (United States)

    Brandl, Maria T.

    2009-05-01

    In the past decade, the development of new tools to better visualize microbes at the cellular scale has spurred a renaissance in the application of microscopy to the study of bacteria in their natural environment. This renewed interest in microscopy may be largely attributable to the advent of the confocal laser scanning microscope (CLSM) and to the discovery of the green fluorescent protein. This article provides information about the use of fluorescence microscopy combined with fluorescent labels such as GFP, DsRed, and DNA stains, with immunofluorescence, and with digital image analysis, to examine the behavior of bacteria and other microbes on plant surfaces. Some of the advantages and pitfalls of these methods will be described using practical examples derived from studies of the ecology of foodborne pathogens, namely Salmonella enterica and E. coli O157:H7, on fresh fruit and vegetables. Confocal microscopy has been a powerful approach to uncover some of the factors involved in the association of produce with epidemics caused by these human pathogens and their interaction with other microbes in their nonhost environment.

  11. Toxicity of hydrogen peroxide produced by electroplated coatings to pathogenic bacteria.

    Science.gov (United States)

    Zhao, Z H; Sakagami, Y; Osaka, T

    1998-05-01

    The ability of various electroplated coatings (cobalt, zinc, copper, and cobalt-containing alloys of nickel, zinc, chromium, etc.) to inhibit the growth of pathogenic bacteria (Gram-positive bacteria Enterococcus faecalis and methicillin-resistant Staphylococcus aureus and Gram-negative bacteria Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae) was determined by a drop-method antibacterial experiment. The amounts of H2O2 produced and metal ions dissolved from the surfaces of various electroplated coatings were measured and it was found that the inhibitory ability of coatings corresponded to the amounts of H2O2 produced. The more significant the inhibition of the coating to bacterial growth, the greater the amount of H2O2 production. In addition, the bacterial survival rates on the surfaces of coatings were almost zero when H2O2 was produced in amounts greater than 10(-6) mmol/cm2. However, the dominant concentrations of metal ions dissolved from coatings were outside of the bacterial lethal range.

  12. Contamination of knives and graters by bacterial foodborne pathogens during slicing and grating of produce.

    Science.gov (United States)

    Erickson, Marilyn C; Liao, Jean; Cannon, Jennifer L; Ortega, Ynes R

    2015-12-01

    Poor hygiene and improper food preparation practices in consumers' homes have previously been demonstrated as contributing to foodborne diseases. To address potential cross-contamination by kitchen utensils in the home, a series of studies was conducted to determine the extent to which the use of a knife or grater on fresh produce would lead to the utensil's contamination with Escherichia coli O157:H7 or Salmonella enterica. When shredding inoculated carrots (ca. 5.3 log CFU/carrot), all graters became contaminated and the number of E. coli O157:H7 present on the utensil was significantly greater than Salmonella (p cucumbers, and cantaloupes, the average prevalence of knife contamination by the two pathogens was 43%, 17%, 15%, 7%, and 3%, respectively. No significant increase in the incidence or level of contamination occurred on the utensils when residues were present (p > 0.05); however, subsequent contamination of 7 produce items processed with the contaminated utensils did occur. These results highlight the necessity of proper sanitization of these utensils when used in preparation of raw produce.

  13. Equivalent T cell epitope promiscuity in ecologically diverse human pathogens.

    Directory of Open Access Journals (Sweden)

    Kirsten E Wiens

    Full Text Available BACKGROUND: The HLA (human leukocyte antigen molecules that present pathogen-derived epitopes to T cells are highly diverse. Correspondingly, many pathogens such as HIV evolve epitope variants in order to evade immune recognition. In contrast, another persistent human pathogen, Mycobacterium tuberculosis, has highly conserved epitope sequences. This raises the question whether there is also a difference in the ability of these pathogens' epitopes to bind diverse HLA alleles, referred to as an epitope's binding promiscuity. To address this question, we compared the in silico HLA binding promiscuity of T cell epitopes from pathogens with distinct infection strategies and outcomes of human exposure. METHODS: We used computer algorithms to predict the binding affinity of experimentally-verified microbial epitope peptides to diverse HLA-DR, HLA-A and HLA-B alleles. We then analyzed binding promiscuity of epitopes derived from HIV and M. tuberculosis. We also analyzed promiscuity of epitopes from Streptococcus pyogenes, which is known to exhibit epitope diversity, and epitopes of Bacillus anthracis and Clostridium tetani toxins, as these bacteria do not depend on human hosts for their survival or replication, and their toxin antigens are highly immunogenic human vaccines. RESULTS: We found that B. anthracis and C. tetani epitopes were the most promiscuous of the group that we analyzed. However, there was no consistent difference or trend in promiscuity in epitopes contained in HIV, M. tuberculosis, and S. pyogenes. CONCLUSIONS: Our results show that human pathogens with distinct immune evasion strategies and epitope diversities exhibit equivalent levels of T cell epitope promiscuity. These results indicate that differences in epitope promiscuity do not account for the observed differences in epitope variation and conservation.

  14. How do filamentous pathogens deliver effector proteins into plant cells?

    Directory of Open Access Journals (Sweden)

    Benjamin Petre

    2014-02-01

    Full Text Available Fungal and oomycete plant parasites are among the most devastating pathogens of food crops. These microbes secrete effector proteins inside plant cells to manipulate host processes and facilitate colonization. How these effectors reach the host cytoplasm remains an unclear and debated area of plant research. In this article, we examine recent conflicting findings that have generated discussion in the field. We also highlight promising approaches based on studies of both parasite and host during infection. Ultimately, this knowledge may inform future broad spectrum strategies for protecting crops from such pathogens.

  15. How Do Filamentous Pathogens Deliver Effector Proteins into Plant Cells?

    Science.gov (United States)

    Petre, Benjamin; Kamoun, Sophien

    2014-01-01

    Fungal and oomycete plant parasites are among the most devastating pathogens of food crops. These microbes secrete effector proteins inside plant cells to manipulate host processes and facilitate colonization. How these effectors reach the host cytoplasm remains an unclear and debated area of plant research. In this article, we examine recent conflicting findings that have generated discussion in the field. We also highlight promising approaches based on studies of both parasite and host during infection. Ultimately, this knowledge may inform future broad spectrum strategies for protecting crops from such pathogens. PMID:24586116

  16. External lipid PI3P mediates entry of eukaryotic pathogen effectors into plant and animal host cells.

    Science.gov (United States)

    Kale, Shiv D; Gu, Biao; Capelluto, Daniel G S; Dou, Daolong; Feldman, Emily; Rumore, Amanda; Arredondo, Felipe D; Hanlon, Regina; Fudal, Isabelle; Rouxel, Thierry; Lawrence, Christopher B; Shan, Weixing; Tyler, Brett M

    2010-07-23

    Pathogens of plants and animals produce effector proteins that are transferred into the cytoplasm of host cells to suppress host defenses. One type of plant pathogens, oomycetes, produces effector proteins with N-terminal RXLR and dEER motifs that enable entry into host cells. We show here that effectors of another pathogen type, fungi, contain functional variants of the RXLR motif, and that the oomycete and fungal RXLR motifs enable binding to the phospholipid, phosphatidylinositol-3-phosphate (PI3P). We find that PI3P is abundant on the outer surface of plant cell plasma membranes and, furthermore, on some animal cells. All effectors could also enter human cells, suggesting that PI3P-mediated effector entry may be very widespread in plant, animal and human pathogenesis. Entry into both plant and animal cells involves lipid raft-mediated endocytosis. Blocking PI3P binding inhibited effector entry, suggesting new therapeutic avenues.

  17. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

    Science.gov (United States)

    Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

    2015-04-01

    Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems.

  18. Functional and pathogenic differences of Th1 and Th17 cells in experimental autoimmune encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Helena S Domingues

    Full Text Available BACKGROUND: There is consensus that experimental autoimmune encephalomyelitis (EAE can be mediated by myelin specific T cells of Th1 as well as of Th17 phenotype, but the contribution of either subset to the pathogenic process has remained controversial. In this report, we compare functional differences and pathogenic potential of "monoclonal" T cell lines that recognize myelin oligodendrocyte glycoprotein (MOG with the same transgenic TCR but are distinguished by an IFN-γ producing Th1-like and IL-17 producing Th17-like cytokine signature. METHODS AND FINDINGS: CD4+ T cell lines were derived from the transgenic mouse strain 2D2, which expresses a TCR recognizing MOG peptide 35-55 in the context of I-A(b. Adoptive transfer of Th1 cells into lymphopenic (Rag2⁻/⁻ recipients, predominantly induced "classic" paralytic EAE, whereas Th17 cells mediated "atypical" ataxic EAE in approximately 50% of the recipient animals. Combination of Th1 and Th17 cells potentiated the encephalitogenicity inducing classical EAE exclusively. Th1 and Th17 mediated EAE lesions differed in their composition but not in their localization within the CNS. While Th1 lesions contained IFN-γ, but no IL-17 producing T cells, the T cells in Th17 lesions showed plasticity, substantially converting to IFN-γ producing Th1-like cells. Th1 and Th17 cells differed drastically by their lytic potential. Th1 but not Th17 cells lysed autoantigen presenting astrocytes and fibroblasts in vitro in a contact-dependent manner. In contrast, Th17 cells acquired cytotoxic potential only after antigenic stimulation and conversion to IFN-γ producing Th1 phenotype. CONCLUSIONS: Our data demonstrate that both Th1 and Th17 lineages possess the ability to induce CNS autoimmunity but can function with complementary as well as differential pathogenic mechanisms. We propose that Th17-like cells producing IL-17 are required for the generation of atypical EAE whereas IFN-γ producing Th1 cells induce

  19. Pathogen Inactivation of red cells: challenges and opportunities

    Institute of Scientific and Technical Information of China (English)

    Stephen J. Wagner

    2006-01-01

    @@ Introduction Virus inactivation methods for blood have been explored as a means to further reduce the risk from tested agents and to decrease the risk of emerging or variant agents for whom no deferral or effective screening methods are available. Although inactivation methods promise to reduce transfusion-related infectious disease risk, these methods are not perfect. Most techniques for pathogen reduction will not kill bacterial spores, or inactivate bacterial endotoxin, prion protein, or certain non-enveloped viruses whose tightly packed capsid proteins prevent access of the virucidal agent to its nucleic acid target. In addition,various inactivation methods have been known to decrease blood cell yield, affect blood cell recovery or survival, and may pose risk to recipients or blood center workers. My presentation today will review two methods for pathogen inactivation of red cells.

  20. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  1. Invertebrate pathogenicity and toxin-producing potential of strains of Bacillus thuringiensis endemic to Antarctica.

    Science.gov (United States)

    Prabhakar, A; Bishop, A H

    2011-06-01

    Several strains of Bacillus thuringiensis were previously isolated from soil in Antarctica and appeared to have physiological adaptations to this cold, nutrient-poor environment. In spite of this they could produce abnormally large, parasporal crystals under laboratory conditions. Here, they have been further characterised for toxin genes and invertebrate pathogenicity. All of the strains were positive in PCR assays for the cry1Aa and cry2 genes. This was confirmed by sequence analysis and the parasporal crystals of all strains contained polypeptides of about 130kDa. This potential for lepidopteran toxicity was borne out in bioassays of purified δ-endotoxins against larvae of Pieris brassicae: the LD(50) values of B2408 (288μg) were comparable to that of the reference strain, HD-12 (201μg). There was no activity against the nematode Caenorhabditis elegans in spite of the fact that all strains appeared to possess the cry6 gene. PCR screening for genes encoding other nematode-toxic classes of toxins (Cry5, 4 and 21) was negative. B. thuringiensis has never previously been shown to be toxic to Collembola (springtails) but the purified δ-endotoxins of one of the Antarctic strains showed some activity against Folsomia candida and Seira domestica (224μg and 238μg, respectively). It seems unlikely that the level of toxicity demonstrated against springtails would support a pathogenic life-style in nature. All of the strains were positive for genes encoding Bacillus cereus-type enterotoxins. In the absence of higher insects and mammals the ecological value of retaining the toxic capability demonstrated here is uncertain.

  2. Cell signaling in the interaction between pathogenic bacteria and immune cells.

    Science.gov (United States)

    Yang, Hui; Liu, Yaxiong; Tang, Ruihua; Shao, Dongyan; Li, Jing; Li, Ji; Ye, Linjie; Jin, Mingliang; Huang, Qingsheng; Shi, Junling

    2015-06-01

    Cell signaling is an essential part in the complex system of communication that governs basic cellular activities and coordinates cell actions. The ability of cells to perceive and correctly respond to their microenvironment is essential for cell survival and basic biological function. In the defense from pathogenic bacteria, the immune cells exert their function through various signaling pathways. In this review, we will summarize recent findings on the role of cell signaling in the interaction between pathogenic bacteria and immune cells, focusing on neutrophils and macrophages, which are part of the innate immunity, and also T cells, which are components of the adaptive immune system.

  3. Pathogenic conversion of Foxp3+ T cells into TH17 cells in autoimmune arthritis.

    Science.gov (United States)

    Komatsu, Noriko; Okamoto, Kazuo; Sawa, Shinichiro; Nakashima, Tomoki; Oh-hora, Masatsugu; Kodama, Tatsuhiko; Tanaka, Sakae; Bluestone, Jeffrey A; Takayanagi, Hiroshi

    2014-01-01

    Autoimmune diseases often result from an imbalance between regulatory T (Treg) cells and interleukin-17 (IL-17)-producing T helper (TH17) cells; the origin of the latter cells remains largely unknown. Foxp3 is indispensable for the suppressive function of Treg cells, but the stability of Foxp3 has been under debate. Here we show that TH17 cells originating from Foxp3(+) T cells have a key role in the pathogenesis of autoimmune arthritis. Under arthritic conditions, CD25(lo)Foxp3(+)CD4(+) T cells lose Foxp3 expression (herein called exFoxp3 cells) and undergo transdifferentiation into TH17 cells. Fate mapping analysis showed that IL-17-expressing exFoxp3 T (exFoxp3 TH17) cells accumulated in inflamed joints. The conversion of Foxp3(+)CD4(+) T cells to TH17 cells was mediated by synovial fibroblast-derived IL-6. These exFoxp3 TH17 cells were more potent osteoclastogenic T cells than were naive CD4(+) T cell-derived TH17 cells. Notably, exFoxp3 TH17 cells were characterized by the expression of Sox4, chemokine (C-C motif) receptor 6 (CCR6), chemokine (C-C motif) ligand 20 (CCL20), IL-23 receptor (IL-23R) and receptor activator of NF-κB ligand (RANKL, also called TNFSF11). Adoptive transfer of autoreactive, antigen-experienced CD25(lo)Foxp3(+)CD4(+) T cells into mice followed by secondary immunization with collagen accelerated the onset and increased the severity of arthritis and was associated with the loss of Foxp3 expression in the majority of transferred T cells. We observed IL-17(+)Foxp3(+) T cells in the synovium of subjects with active rheumatoid arthritis (RA), which suggests that plastic Foxp3(+) T cells contribute to the pathogenesis of RA. These findings establish the pathological importance of Foxp3 instability in the generation of pathogenic TH17 cells in autoimmunity.

  4. Gluconacetobacter diazotrophicus, a sugar cane endosymbiont, produces a bacteriocin against Xanthomonas albilineans, a sugar cane pathogen.

    Science.gov (United States)

    Piñón, Dolores; Casas, Mario; Blanch, María; Fontaniella, Blanca; Blanco, Yolanda; Vicente, Carlos; Solas, María-Teresa; Legaz, María-Estrella

    2002-01-01

    Gluconacetobacter diazotrophicus in liquid culture secretes proteins into the medium. Both medium containing Gluconacetobacter protein and a solution of this protein after acetone precipitation appeared to inhibit the growth of Xanthomonas albilineans in solid culture. This apparent inhibition of bacterial growth has, in fact, been revealed to be lysis of bacterial cells, as demonstrated by transmission electron microscopy. Fractionation of the Gluconacetobacter protein mixture in size-exclusion chromatography reveals a main fraction with lysozyme-like activity which produces lysis of both living bacteria and isolated cell walls.

  5. Indoctrinating T cells to attack pathogens through homeschooling.

    Science.gov (United States)

    Parello, Caitlin S; Huseby, Eric S

    2015-06-01

    Adaptive immunity is predicated on the ability of the T cell repertoire to have pre-existing specificity for the universe of potential pathogens. Recent findings suggest that T cell receptor (TCR)-self-major histocompatibility protein (pMHC) interactions limit autoimmune responses while enhancing T cell response to foreign antigens. We review these findings here, placing them in context of the current understanding of how TCR-self-pMHC interactions regulate T cell activation thresholds, and suggest that TCR-self-pMHC interactions increase the efficiency of the T cell repertoire by giving a competitive advantage to peptide cross-reactive T cells. We propose that self-reactivity and peptide cross-reactivity are controlled by particular CDR3 sequence motifs, which would allow thymic selection to contribute to solving the feat of broad pathogen specificity by exporting T cells that are pre-screened by positive and negative selection for the ability to be 'moderately' peptide cross-reactive.

  6. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    NARCIS (Netherlands)

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles i

  7. Infection strategies of intestinal parasite pathogens and host cell responses

    Directory of Open Access Journals (Sweden)

    Bruno Martorell Di Genova

    2016-03-01

    Full Text Available Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica are important pathogenic intestinal parasites and are amongst the leading cause worldwide of diarrheal illness in humans. Diseases caused by these organisms, Giardiasis, Cryptosporidiosis and Amoebiasis, respectively, are characterized by self-limited diarrhea but can evolve to long-term complications. The cellular and molecular mechanisms underlying the pathogenesis of diarrhea associated with these tree pathogens are being unraveled, with knowledge of both the strategies explored by the parasites to establish infection and the methods evolved by hosts to avoid it. Special attention is being given to molecules participating in parasite-host interaction and in the mechanisms implicated in the diseases pathophysiologic processes. This review focuses on cell mechanisms that are modulated during infection, including gene transcription, cytoskeleton rearrangements, signal transduction pathways and cell death.

  8. Novel insights into host-fungal pathogen interactions derived from live-cell imaging.

    Science.gov (United States)

    Bain, Judith; Gow, Neil A R; Erwig, Lars-Peter

    2015-03-01

    The theoretical physicist and Nobel laureate Richard Feynman outlined in his 1959 lecture, "There's plenty of room at the bottom", the enormous possibility of producing and visualising things at smaller scales. The advent of advanced scanning and transmission electron microscopy and high-resolution microscopy has begun to open the door to visualise host-pathogen interactions at smaller scales, and spinning disc confocal and two-photon microscopy has improved our ability to study these events in real time in three dimensions. The aim of this review is to illustrate some of the advances in understanding host-fungal interactions that have been made in recent years in particular those relating to the interactions of live fungal pathogens with phagocytes. Dynamic imaging of host-pathogen interactions has recently revealed novel detail and unsuspected mechanistic insights, facilitating the dissection of the phagocytic process into its component parts. Here, we will highlight advances in our knowledge of host-fungal pathogen interactions, including the specific effects of fungal cell viability, cell wall composition and morphogenesis on the phagocytic process and try to define the relative contributions of neutrophils and macrophages to the clearance of fungal pathogens in vitro and the infected host.

  9. Mastitis Pathogens with High Virulence in a Mouse Model Produce a Distinct Cytokine Profile In Vivo

    Science.gov (United States)

    Johnzon, Carl-Fredrik; Artursson, Karin; Söderlund, Robert; Guss, Bengt; Rönnberg, Elin; Pejler, Gunnar

    2016-01-01

    Mastitis is a serious medical condition of dairy cattle. Here, we evaluated whether the degree of virulence of mastitis pathogens in a mouse model can be linked to the inflammatory response that they provoke. Clinical isolates of Staphylococcus aureus (S. aureus) (strain 556 and 392) and Escherichia coli (E. coli) (676 and 127), and laboratory control strains [8325-4 (S. aureus) and MG1655 (E. coli)], were injected i.p. into mice, followed by the assessment of clinical scores and inflammatory parameters. As judged by clinical scoring, E. coli 127 exhibited the largest degree of virulence among the strains. All bacterial strains induced neutrophil recruitment. However, whereas E. coli 127 induced high peritoneal levels of CXCL1, G-CSF, and CCL2, strikingly lower levels of these were induced by the less virulent bacterial strains. High concentrations of these compounds were also seen in blood samples taken from animals infected with E. coli 127, suggesting systemic inflammation. Moreover, the levels of CXCL1 and G-CSF, both in the peritoneal fluid and in plasma, correlated with clinical score. Together, these findings suggest that highly virulent clinical mastitis isolates produce a distinct cytokine profile that shows a close correlation with the severity of the bacterial infection. PMID:27713743

  10. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  11. Lasiolactols A and B Produced by the Grapevine Fungal Pathogen Lasiodiplodia mediterranea.

    Science.gov (United States)

    Andolfi, Anna; Basso, Sara; Giambra, Selene; Conigliaro, Gaetano; Lo Piccolo, Sandra; Alves, Artur; Burruano, Santella

    2016-04-01

    A strain of Lasiodiplodia mediterranea, a fungus associated with grapevine decline in Sicily, produced several metabolites in liquid medium. Two new dimeric γ-lactols, lasiolactols A and B (1 and 2), were characterized as (2S*,3S*,4R*,5R*,2'S*,3'S*,4'R*,5'R*)- and (2R*,3S*,4R*,5R*,2'R*,3'S*,4'R*,5'R*)-(5-(4-hydroxymethyl-3,5-dimethyl-tetrahydro-furan-2-yloxy)-2,4-dimethyl-tetrahydro-furan-3-yl]-methanols by IR, 1D- and 2D-NMR, and HR-ESI-MS. Other four metabolites were identified as botryosphaeriodiplodin, (5R)-5-hydroxylasiodiplodin, (-)-(1R,2R)-jasmonic acid, and (-)-(3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone (3 - 6, resp.). The absolute configuration (R) at hydroxylated secondary C-atom C(7) was also established for compound 3. The compounds 1 - 3, 5, and 6, tested for their phytotoxic activities to grapevine cv. Inzolia leaves at different concentrations (0.125, 0.25, 0.5, and 1 mg/ml) were phytotoxic and compound 5 showed the highest toxicity. All metabolites did not show in vitro antifungal activity against four plant pathogens.

  12. Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Sandra Mojsova

    2015-10-01

    Full Text Available The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1 isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua. One isolate had a broader antimicrobial activity. None of the isolates showed inhibitory activity against S. enteritidis, E. coli and Y. enterocolitica. The genes enterocin P, cytolysin and enterocin A were the most frequently detected structural genes among the PCR positive strains. No amplification was obtained in two strains E. faecalis-25 and E. faecalis-86. Three different genes were identified in some strains. With the exclusion of strains possessing a virulence factor, such as cytolysin, producers of more than one enterocins could be of a great technological potential as protective cultures in the cheese industry.

  13. Producing primate embryonic stem cells by somatic cell nuclear transfer.

    Science.gov (United States)

    Byrne, J A; Pedersen, D A; Clepper, L L; Nelson, M; Sanger, W G; Gokhale, S; Wolf, D P; Mitalipov, S M

    2007-11-22

    Derivation of embryonic stem (ES) cells genetically identical to a patient by somatic cell nuclear transfer (SCNT) holds the potential to cure or alleviate the symptoms of many degenerative diseases while circumventing concerns regarding rejection by the host immune system. However, the concept has only been achieved in the mouse, whereas inefficient reprogramming and poor embryonic development characterizes the results obtained in primates. Here, we used a modified SCNT approach to produce rhesus macaque blastocysts from adult skin fibroblasts, and successfully isolated two ES cell lines from these embryos. DNA analysis confirmed that nuclear DNA was identical to donor somatic cells and that mitochondrial DNA originated from oocytes. Both cell lines exhibited normal ES cell morphology, expressed key stem-cell markers, were transcriptionally similar to control ES cells and differentiated into multiple cell types in vitro and in vivo. Our results represent successful nuclear reprogramming of adult somatic cells into pluripotent ES cells and demonstrate proof-of-concept for therapeutic cloning in primates.

  14. Pathogen detection in produce using applications of immunomagnetic beads and biosensors

    Science.gov (United States)

    The presence of pathogenic bacteria is of increasing public health concerns. Rapid and sensitive tests to detect pathogens are required to keep the safety of food supply. In this chapter we summarized our previous investigations where we applied immunomagnetic-bead (IMB) capture and various biosen...

  15. Antagonistic activity of antibiotic producing Streptomyces sp. against fish and human pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Nazmul Hossain

    2014-04-01

    Full Text Available In this study, attempts were made to isolate Streptomyces sp. from soil samples of two different regions of Bangladesh and evaluate their antagonistic activity against fish and human pathogenic bacteria. A total of 10 isolates were identified as Streptomyces sp. based on several morphological, physiological and biochemical tests. Cross streak method was used to observe the antagonistic activity of the Streptomyces sp. isolates against different fish pathogens belonging to the genus Aeromonas, Pseudomonas and Edwardsiella and human clinical isolates belonging to the genus Klebsiella, Salmonella and Streptococcus. Seven Streptomyces sp. isolates showed antagonism against both fish and human pathogenic bacteria. Four isolates viz., N24, N26, N28 and N47 showed broad spectrum of antagonistic activity (80-100% against all genera of fish and human pathogenic bacteria. The isolate N49 exhibited highest spectrum of antagonism against all fish pathogens (90-100% but comparatively lower degree of antagonism against human pathogens (50-60%. Rest of the two isolates (N21 and N23 showed variability in their antagonism. Results showed that broad spectrum antibiotic(s could be developed from the isolates N24, N26, N28 and N47against several human and fish pathogens. The isolate N49 could be a potential source of antibiotic, especially for fish pathogenic bacteria.

  16. De novo identification of viral pathogens from cell culture hologenomes

    Directory of Open Access Journals (Sweden)

    Patowary Ashok

    2012-01-01

    Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

  17. Visualization of sialic acid produced on bacterial cell surfaces by lectin staining.

    Science.gov (United States)

    Kajiwara, Hitomi; Toda, Munetoyo; Mine, Toshiki; Nakada, Hiroshi; Wariishi, Hiroyuki; Yamamoto, Takeshi

    2010-01-01

    Oligosaccharides containing N-acetylneuraminic acid on the cell surface of some pathogenic bacteria are important for host-microbe interactions. N-acetylneuraminic acid (Neu5Ac) plays a major role in the pathogenicity of bacterial pathogens. For example, cell surface sialyloligosaccharide moieties of the human pathogen Haemophilus influenzae are involved in virulence and adhesion to host cells. In this study, we have established a method of visualizing Neu5Ac linked to a glycoconjugate on the bacterial cell surface based on lectin staining. Photobacterium damselae strain JT0160, known to produce a-2,6-sialyltransferase, was revealed to possess Neu5Ac by HPLC. Using the strain, a strong Sambucus sieboldiana lectin-binding signal was detected. The bacteria producing α-2,6-sialyltransferases could be divided into two groups: those with a lot of α-2,6-linked Neu5Ac on the cell surface and those with a little. In the present study, we developed a useful method for evaluating the relationship between Neu5Ac expression on the cell surface and the degree of virulence of marine bacteria.

  18. Bioreactor and methods for producing synchronous cells

    Science.gov (United States)

    Helmstetter, Charles E. (Inventor); Thornton, Maureen (Inventor); Gonda, Steve (Inventor)

    2005-01-01

    Apparatus and methods are directed to a perfusion culture system in which a rotating bioreactor is used to grow cells in a liquid culture medium, while these cells are attached to an adhesive-treated porous surface. As a result of this arrangement and its rotation, the attached cells divide, with one cell remaining attached to the substrate, while the other cell, a newborn cell is released. These newborn cells are of approximately the same age, that are collected upon leaving the bioreactor. The populations of newborn cells collected are of synchronous and are minimally, if at all, disturbed metabolically.

  19. Erythrophore cell response to food-associated pathogenic bacteria: implications for detection.

    Science.gov (United States)

    Hutchison, Janine R; Dukovcic, Stephanie R; Dierksen, Karen P; Carlyle, Calvin A; Caldwell, Bruce A; Trempy, Janine E

    2008-09-01

    Cell-based biosensors have been proposed for use as function-based detectors of toxic agents. We report the use of Betta splendens chromatophore cells, specifically erythrophore cells, for detection of food-associated pathogenic bacteria. Evaluation of erythrophore cell response, using Bacillus spp., has revealed that this response can distinguish pathogenic Bacillus cereus from a non-pathogenic B. cereus ΔplcR deletion mutant and a non-pathogenic Bacillus subtilis. Erythrophore cells were exposed to Salmonella enteritidis, Clostridium perfringens and Clostridium botulinum. Each bacterial pathogen elicited a response from erythrophore cells that was distinguished from the corresponding bacterial growth medium, and this observed response was unique for each bacterial pathogen. These findings suggest that erythrophore cell response has potential for use as a biosensor in the detection and toxicity assessment for food-associated pathogenic bacteria.

  20. Depletion of alloreactive T-cells in vitro using the proteasome inhibitor bortezomib preserves the immune response against pathogens.

    Science.gov (United States)

    Blanco, Belén; Sánchez-Abarca, Luis Ignacio; Caballero-Velázquez, Teresa; Santamaría, Carlos; Inogés, Susana; Pérez-Simón, José Antonio

    2011-10-01

    Current graft-versus-host disease (GVHD) inhibition approaches lead to abrogation of pathogen-specific T-cell responses. We propose an approach to inhibit GVHD without hampering immunity against pathogens: in vitro depletion of alloreactive T cells with the preoteasome inhibitor bortezomib. We show that PBMCs stimulated with allogeneic cells and treated with bortezomib greatly reduce their ability to produce IFN-γ when re-stimulated with the same allogeneic cells, but mainly preserve their ability to respond to citomegalovirus stimulation. Unlike in vivo administration of immunosuppressive drugs or other strategies of allodepletion, in vitro allodepletion with bortezomib maintains pathogen-specific T cells, representing a promising alternative for GVHD prophylaxis.

  1. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  2. Granule-Dependent Natural Killer Cell Cytotoxicity to Fungal Pathogens

    Science.gov (United States)

    Ogbomo, Henry; Mody, Christopher H.

    2017-01-01

    Natural killer (NK) cells kill or inhibit the growth of a number of fungi including Cryptococcus, Candida, Aspergillus, Rhizopus, and Paracoccidioides. Although many fungi are not dangerous, invasive fungal pathogens, such as Cryptococcus neoformans, cause life-threatening disease in individuals with impaired cell-mediated immunity. While there are similarities to cell-mediated killing of tumor cells, there are also important differences. Similar to tumor killing, NK cells directly kill fungi in a receptor-mediated and cytotoxic granule-dependent manner. Unlike tumor cell killing where multiple NK cell-activating receptors cooperate and signal events that mediate cytotoxicity, only the NKp30 receptor has been described to mediate signaling events that trigger the NK cell to mobilize its cytolytic payload to the site of interaction with C. neoformans and Candida albicans, subsequently leading to granule exocytosis and fungal killing. More recently, the NKp46 receptor was reported to bind Candida glabrata adhesins Epa1, 6, and 7 and directly mediate fungal clearance. A number of unanswered questions remain. For example, is only one NK cell-activating receptor sufficient for signaling leading to fungal killing? Are the signaling pathways activated by fungi similar to those activated by tumor cells during NK cell killing? How do the cytolytic granules traffic to the site of interaction with fungi, and how does this process compare with tumor killing? Recent insights into receptor use, intracellular signaling and cytolytic granule trafficking during NK cell-mediated fungal killing will be compared to tumor killing, and the implications for therapeutic approaches will be discussed. PMID:28123389

  3. Interspecies communication between pathogens and immune cells via bacterial membrane vesicles

    Directory of Open Access Journals (Sweden)

    Katerina S Jurkoshek

    2016-11-01

    Full Text Available The production of extracellular vesicles is a universal mechanism for intercellular communication that is conserved across kingdoms. Prokaryotes secrete 50–250 nm membrane vesicles (MVs in a manner that is regulated by environmental stress and is thought to promote survival. Since many types of host-derived stress are encountered during infection, this implies an important role for MV secretion in bacterial pathogenesis. Accordingly, MVs produced by gram-positive and gram-negative pathogens contain toxins, virulence factors, and other molecules that promote survival in the host. However, recent studies have also shown that bacterial MVs are enriched for molecules that stimulate innate and adaptive immune responses. As an example, MVs may serve multiple, important roles in regulating the host response to Mycobacterium tuberculosis (Mtb, an intracellular pathogen that infects lung macrophages and resides within modified phagosomes. Previously, we demonstrated that Mtb secretes MVs during infection that may regulate infected and uninfected immune cells. Our present data demonstrates that Mtb MVs inhibit the functions of macrophages and T cells, but promote MHC-II antigen presentation by dendritic cells. We conclude that bacterial MVs serve dual and opposing roles in the activation of and defense against host immune responses to Mtb and other bacterial pathogens. We also propose that MV secretion is a central mechanism for interspecies communication between bacteria and host cells during infection.

  4. Erythrophore cell response to food‐associated pathogenic bacteria: implications for detection

    Science.gov (United States)

    Hutchison, Janine R.; Dukovcic, Stephanie R.; Dierksen, Karen P.; Carlyle, Calvin A.; Caldwell, Bruce A.; Trempy, Janine E.

    2008-01-01

    Summary Cell‐based biosensors have been proposed for use as function‐based detectors of toxic agents. We report the use of Betta splendens chromatophore cells, specifically erythrophore cells, for detection of food‐associated pathogenic bacteria. Evaluation of erythrophore cell response, using Bacillus spp., has revealed that this response can distinguish pathogenic Bacillus cereus from a non‐pathogenic B. cereus ΔplcR deletion mutant and a non‐pathogenic Bacillus subtilis. Erythrophore cells were exposed to Salmonella enteritidis, Clostridium perfringens and Clostridium botulinum. Each bacterial pathogen elicited a response from erythrophore cells that was distinguished from the corresponding bacterial growth medium, and this observed response was unique for each bacterial pathogen. These findings suggest that erythrophore cell response has potential for use as a biosensor in the detection and toxicity assessment for food‐associated pathogenic bacteria. PMID:21261862

  5. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  6. IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases.

    Science.gov (United States)

    Shen, Ping; Roch, Toralf; Lampropoulou, Vicky; O'Connor, Richard A; Stervbo, Ulrik; Hilgenberg, Ellen; Ries, Stefanie; Dang, Van Duc; Jaimes, Yarúa; Daridon, Capucine; Li, Rui; Jouneau, Luc; Boudinot, Pierre; Wilantri, Siska; Sakwa, Imme; Miyazaki, Yusei; Leech, Melanie D; McPherson, Rhoanne C; Wirtz, Stefan; Neurath, Markus; Hoehlig, Kai; Meinl, Edgar; Grützkau, Andreas; Grün, Joachim R; Horn, Katharina; Kühl, Anja A; Dörner, Thomas; Bar-Or, Amit; Kaufmann, Stefan H E; Anderton, Stephen M; Fillatreau, Simon

    2014-03-20

    B lymphocytes have critical roles as positive and negative regulators of immunity. Their inhibitory function has been associated primarily with interleukin 10 (IL-10) because B-cell-derived IL-10 can protect against autoimmune disease and increase susceptibility to pathogens. Here we identify IL-35-producing B cells as key players in the negative regulation of immunity. Mice in which only B cells did not express IL-35 lost their ability to recover from the T-cell-mediated demyelinating autoimmune disease experimental autoimmune encephalomyelitis (EAE). In contrast, these mice displayed a markedly improved resistance to infection with the intracellular bacterial pathogen Salmonella enterica serovar Typhimurium as shown by their superior containment of the bacterial growth and their prolonged survival after primary infection, and upon secondary challenge, compared to control mice. The increased immunity found in mice lacking IL-35 production by B cells was associated with a higher activation of macrophages and inflammatory T cells, as well as an increased function of B cells as antigen-presenting cells (APCs). During Salmonella infection, IL-35- and IL-10-producing B cells corresponded to two largely distinct sets of surface-IgM(+)CD138(hi)TACI(+)CXCR4(+)CD1d(int)Tim1(int) plasma cells expressing the transcription factor Blimp1 (also known as Prdm1). During EAE, CD138(+) plasma cells were also the main source of B-cell-derived IL-35 and IL-10. Collectively, our data show the importance of IL-35-producing B cells in regulation of immunity and highlight IL-35 production by B cells as a potential therapeutic target for autoimmune and infectious diseases. This study reveals the central role of activated B cells, particularly plasma cells, and their production of cytokines in the regulation of immune responses in health and disease.

  7. Pathogenic functions of B cells in autoimmune diseases: IFN-γ production joins the criminal gang.

    Science.gov (United States)

    Fillatreau, Simon

    2015-04-01

    B-cell depletion therapy has emerged as a powerful strategy to intercept the progression of T-cell-mediated autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, or relapsing remitting multiple sclerosis. However, its mode of action remains incompletely defined, reflecting our incomplete understanding of the pathogenic functions of B cells in such pathologies. B cells can contribute to immune responses through the production of antibodies, presentation of antigen to T cells, and production of cytokines. In this issue of the European Journal of Immunology [Eur. J. Immunol. 2015. 45: 988-998], Olalekan et al. demonstrate that IFN-γ production by B cells is essential for the development of arthritis in mice. Lack of IFN-γ expression in B cells results in reduced autoimmune T-cell responses and autoantibody levels, impacting the arthritogenic reaction akin to that in B-cell depletion therapy. Together with other reports, the article by Olalekan et al. emphasizes the importance of cytokine-producing B cells in the pathogenesis of autoimmune diseases. In this commentary, I discuss how these findings shed new light on the roles of B cells as drivers of autoimmune pathogenesis, and how they more generally contribute to our understanding of the role of B cells in immunity.

  8. Induced pluripotent stem cell derived macrophages as a cellular system to study salmonella and other pathogens.

    Directory of Open Access Journals (Sweden)

    Christine Hale

    Full Text Available A number of pathogens, including several human-restricted organisms, persist and replicate within macrophages (Mφs as a key step in pathogenesis. The mechanisms underpinning such host-restricted intracellular adaptations are poorly understood, in part, due to a lack of appropriate model systems. Here we explore the potential of human induced pluripotent stem cell derived macrophages (iPSDMs to study such pathogen interactions. We show iPSDMs express a panel of established Mφ-specific markers, produce cytokines, and polarise into classical and alternative activation states in response to IFN-γ and IL-4 stimulation, respectively. iPSDMs also efficiently phagocytosed inactivated bacterial particles as well as live Salmonella Typhi and S. Typhimurium and were able to kill these pathogens. We conclude that iPSDMs can support productive Salmonella infection and propose this as a flexible system to study host/pathogen interactions. Furthermore, iPSDMs can provide a flexible and practical cellular platform for assessing host responses in multiple genetic backgrounds.

  9. Pathogenic T cells persist after reversal of autoimmune disease by immunosuppression with regulatory T cells.

    Science.gov (United States)

    Tu, Eric; Bourges, Dorothée; Gleeson, Paul A; Ang, Desmond K Y; van Driel, Ian R

    2013-05-01

    Autoimmune disease can be prevented with immunosuppressive agents; however, the effectiveness of these treatments in advanced stage of disease and the fate of pathogenic T cells following such treatments are not clear. In this study we demonstrate that a single dose of in vitro-induced Treg cells (iTreg cells) resulted in the functional repair and restitution of stomach tissue that had been severely damaged in advanced autoimmune gastritis. iTreg cells caused depletion or inactivation of autoreactive naïve T cells that were antigen inexperienced, however, autoreactive effector/memory T cells persisted in treated mice, resulting in residual cellular infiltrates within the repaired stomach tissue. The persisting autoreactive T cells were able to rapidly cause autoimmune disease if iTreg cells were removed. Similar data were obtained from mice treated continuously with corticosteroid, in that there was substantial restitution of the gastric mucosa; however, effector T cells persisted and rapidly caused pathology following drug removal. Therefore, iTreg cells or corticosteroid can suppress pathogenic autoreactive cells in advanced autoimmune disease, reversing tissue damage and improving tissue function. However, the persistence of pathogenic T cells represents a disease risk.

  10. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce.

    Science.gov (United States)

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile; Zhang, Jue; Fang, Jing

    2015-12-30

    Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  11. The Antibacterial Activity of Acetic Acid against Biofilm-Producing Pathogens of Relevance to Burns Patients.

    Directory of Open Access Journals (Sweden)

    Fenella D Halstead

    Full Text Available Localised infections, and burn wound sepsis are key concerns in the treatment of burns patients, and prevention of colonisation largely relies on biocides. Acetic acid has been shown to have good antibacterial activity against various planktonic organisms, however data is limited on efficacy, and few studies have been performed on biofilms.We sought to investigate the antibacterial activity of acetic acid against important burn wound colonising organisms growing planktonically and as biofilms.Laboratory experiments were performed to test the ability of acetic acid to inhibit growth of pathogens, inhibit the formation of biofilms, and eradicate pre-formed biofilms.Twenty-nine isolates of common wound-infecting pathogens were tested. Acetic acid was antibacterial against planktonic growth, with an minimum inhibitory concentration of 0.16-0.31% for all isolates, and was also able to prevent formation of biofilms (at 0.31%. Eradication of mature biofilms was observed for all isolates after three hours of exposure.This study provides evidence that acetic acid can inhibit growth of key burn wound pathogens when used at very dilute concentrations. Owing to current concerns of the reducing efficacy of systemic antibiotics, this novel biocide application offers great promise as a cheap and effective measure to treat infections in burns patients.

  12. Diplopimarane, a 20-nor-ent-pimarane produced by the oak pathogen Diplodia quercivora.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Basso, Sara; Linaldeddu, Benedetto T; Cimmino, Alessio; Scanu, Bruno; Deidda, Antonio; Tuzi, Angela; Evidente, Antonio

    2014-11-26

    In this study a new 20-nor-ent-pimarane, named diplopimarane, was isolated together with sphaeropsidins A (9) and C (10), and (+)-epiepoformin (11) from organic crude extracts of Diplodia quercivora, a recently described oak pathogen originally found on declining Quercus canariensis trees in Tunisia. Diplopimarane was characterized as (1S,2R)-2,8,8-trimethyl-2-vinyl-1,2,3,4,5,6,7,8-octahydrophenanthrene-1,9,10-triol by spectroscopic, X-ray, optical, and chemical methods. It exhibited a wide range of activities including remarkable phytotoxicity on nonhost plants such as tomato cuttings, moderate antifungal activity against important plant pathogens, and moderate zootoxicity against Artemia salina. Its derivatives (2-4 and 6) were also tested for their phytotoxic and zootoxic activities. All these derivatives proved to be active against A. salina at 200 μg/mL, while 2 and 6 were also active on tomato cuttings. The other secondary metabolites (9, 10, and 11) herein reported for D. quercivora exhibited phytotoxic, antifungal, and zootoxic activity. This is the first report on the secondary metabolites secreted in vitro by this oak pathogen that could be key components of its adaptative strategies.

  13. Microcystin-producing and non-producing cyanobacterial blooms collected from the Central India harbor potentially pathogenic Vibrio cholerae.

    Science.gov (United States)

    Chaturvedi, Prashant; Kumar Agrawal, Manish; Nath Bagchi, Suvendra

    2015-05-01

    On the basis of relative abundance, frequency and biovolume, the important value index ranks were assigned to individual cyanobacteria in phytoplankton samples collected from fourteen water resources of Central India. The mcyABDE genes were detected in all the blooms with Microcystis (-aeruginosa, -viridis, -panniformis, -botrys) as being the major constituent morphospecies. On the other hand, blooms composed of primarily Oscillatoria (-limosa,-agardhii, -laetevirens) along with Anabaena, Nostoc, Phormidium and Spirulina as sub-dominant forms exhibited quite a patchy distribution of one or the other mcy genes. Fifty percent of Microcystis- but none of the Oscillatoria dominant blooms produced microcystins-RR and desmethyl-RR at 0.03-0.41mgg(-1) bloom dry mass. Traces of dissolved microcystin was detected in lake water, which is well below the WHO guideline. Irrespective of cyanobacterial composition and microcystin production ability, during the study period 43-64% of the cyanobacterial bloom samples exhibited association of viable but nonculturable forms of Vibrio cholerae O1 and O139, as evident from amplification of the antigen genes. We believe that spread of endemic cholera is the major threat associated with harmful algal blooms.

  14. Composition of Mineral Produced by Dental Mesenchymal Stem Cells.

    Science.gov (United States)

    Volponi, A A; Gentleman, E; Fatscher, R; Pang, Y W Y; Gentleman, M M; Sharpe, P T

    2015-11-01

    Mesenchymal stem cells isolated from different dental tissues have been described to have osteogenic/odontogenic-like differentiation capacity, but little attention has been paid to the biochemical composition of the material that each produces. Here, we used Raman spectroscopy to analyze the mineralized materials produced in vitro by different dental cell populations, and we compared them with the biochemical composition of native dental tissues. We show that different dental stem cell populations produce materials that differ in their mineral and matrix composition and that these differ from those of native dental tissues. In vitro, BCMP (bone chip mass population), SCAP (stem cells from apical papilla), and SHED (stem cells from human-exfoliated deciduous teeth) cells produce a more highly mineralized matrix when compared with that produced by PDL (periodontal ligament), DPA (dental pulp adult), and GF (gingival fibroblast) cells. Principal component analyses of Raman spectra further demonstrated that the crystallinity and carbonate substitution environments in the material produced by each cell type varied, with DPA cells, for example, producing a more carbonate-substituted mineral and with SCAP, SHED, and GF cells creating a less crystalline material when compared with other dental stem cells and native tissues. These variations in mineral composition reveal intrinsic differences in the various cell populations, which may in turn affect their specific clinical applications.

  15. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  16. Common Cell Shape Evolution of Two Nasopharyngeal Pathogens.

    Science.gov (United States)

    Veyrier, Frédéric J; Biais, Nicolas; Morales, Pablo; Belkacem, Nouria; Guilhen, Cyril; Ranjeva, Sylvia; Sismeiro, Odile; Péhau-Arnaudet, Gérard; Rocha, Eduardo P; Werts, Catherine; Taha, Muhamed-Kheir; Boneca, Ivo G

    2015-07-01

    Respiratory infectious diseases are the third cause of worldwide death. The nasopharynx is the portal of entry and the ecological niche of many microorganisms, of which some are pathogenic to humans, such as Neisseria meningitidis and Moraxella catarrhalis. These microbes possess several surface structures that interact with the actors of the innate immune system. In our attempt to understand the past evolution of these bacteria and their adaption to the nasopharynx, we first studied differences in cell wall structure, one of the strongest immune-modulators. We were able to show that a modification of peptidoglycan (PG) composition (increased proportion of pentapeptides) and a cell shape change from rod to cocci had been selected for along the past evolution of N. meningitidis. Using genomic comparison across species, we correlated the emergence of the new cell shape (cocci) with the deletion, from the genome of N. meningitidis ancestor, of only one gene: yacF. Moreover, the reconstruction of this genetic deletion in a bacterium harboring the ancestral version of the locus together with the analysis of the PG structure, suggest that this gene is coordinating the transition from cell elongation to cell division. Accompanying the loss of yacF, the elongation machinery was also lost by several of the descendants leading to the change in the PG structure observed in N. meningitidis. Finally, the same evolution was observed for the ancestor of M. catarrhalis. This suggests a strong selection of these genetic events during the colonization of the nasopharynx. This selection may have been forced by the requirement of evolving permissive interaction with the immune system, the need to reduce the cellular surface exposed to immune attacks without reducing the intracellular storage capacity, or the necessity to better compete for adhesion to target cells.

  17. Comparative transcriptional analysis of homologous pathogenic and non-pathogenic Lawsonia intracellularis isolates in infected porcine cells.

    Directory of Open Access Journals (Sweden)

    Fabio A Vannucci

    Full Text Available Lawsonia intracellularis is the causative agent of proliferative enteropathy. This disease affects various animal species, including nonhuman primates, has been endemic in pigs, and is an emerging concern in horses. Non-pathogenic variants obtained through multiple passages in vitro do not induce disease, but bacterial isolates at low passage induce clinical and pathological changes. We hypothesize that genes differentially expressed between pathogenic (passage 10 and non-pathogenic (passage 60 L. intracellularis isolates encode potential bacterial virulence factors. The present study used high-throughput sequencing technology to characterize the transcriptional profiling of a pathogenic and a non-pathogenic homologous L. intracellularis variant during in vitro infection. A total of 401 genes were exclusively expressed by the pathogenic variant. Plasmid-encoded genes and those involved in membrane transporter (e.g. ATP-binding cassette, adaptation and stress response (e.g. transcriptional regulators were the categories mostly responsible for this wider transcriptional landscape. The entire gene repertoire of plasmid A was repressed in the non-pathogenic variant suggesting its relevant role in the virulence phenotype of the pathogenic variant. Of the 319 genes which were commonly expressed in both pathogenic and non-pathogenic variants, no significant difference was observed by comparing their normalized transcription levels (fold change±2; p<0.05. Unexpectedly, these genes demonstrated a positive correlation (r(2 = 0.81; p<0.05, indicating the involvement of gene silencing (switching off mechanisms to attenuate virulence properties of the pathogenic variant during multiple cell passages. Following the validation of these results by reverse transcriptase-quantitative PCR using ten selected genes, the present study represents the first report characterizing the transcriptional profile of L. intracellularis. The complexity of the virulence

  18. Effects of volatile organic compounds produced by Bacillus amyloliquefaciens on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum.

    Science.gov (United States)

    Raza, Waseem; Wang, Jichen; Wu, Yuncheng; Ling, Ning; Wei, Zhong; Huang, Qiwei; Shen, Qirong

    2016-09-01

    The production of volatile organic compounds (VOCs) by microbes is an important characteristic for their selection as biocontrol agents against plant pathogens. In this study, we identified the VOCs produced by the biocontrol strain Bacillus amyloliquefaciens T-5 and evaluated their impact on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum. The results showed that the VOCs of strain T-5 significantly inhibited the growth of R. solanacearum in agar medium and in soil. In addition, VOCs significantly inhibited the motility traits, root colonization, biofilm formation, and production of antioxidant enzymes and exopolysaccharides by R. solanacearum. However, no effect of VOCs on the production of hydrolytic enzymes by R. solanacearum was observed. The strain T-5 produced VOCs, including benzenes, ketones, aldehydes, alkanes, acids, and one furan and naphthalene compound; among those, 13 VOCs showed 1-10 % antibacterial activity against R. solanacearum in their produced amounts by T-5; however, the consortium of all VOCs produced on agar medium, in sterilized soil, and in natural soil showed 75, 62, and 85 % growth inhibition of R. solanacearum, respectively. The real-time PCR analysis further confirmed the results when the expression of different virulence- and metabolism-related genes in R. solanacearum cells was decreased after exposure to the VOCs of strain T-5. The results of this study clearly revealed the significance of VOCs in the control of plant pathogens. This information would help to better comprehend the microbial interactions mediated by VOCs in nature and to develop safer strategies to control plant disease.

  19. CCR2 defines in vivo development and homing of IL-23-driven GM-CSF-producing Th17 cells.

    Science.gov (United States)

    Kara, Ervin E; McKenzie, Duncan R; Bastow, Cameron R; Gregor, Carly E; Fenix, Kevin A; Ogunniyi, Abiodun D; Paton, James C; Mack, Matthias; Pombal, Diana R; Seillet, Cyrill; Dubois, Bénédicte; Liston, Adrian; MacDonald, Kelli P A; Belz, Gabrielle T; Smyth, Mark J; Hill, Geoffrey R; Comerford, Iain; McColl, Shaun R

    2015-10-29

    IL-17-producing helper T (Th17) cells are critical for host defense against extracellular pathogens but also drive numerous autoimmune diseases. Th17 cells that differ in their inflammatory potential have been described including IL-10-producing Th17 cells that are weak inducers of inflammation and highly inflammatory, IL-23-driven, GM-CSF/IFNγ-producing Th17 cells. However, their distinct developmental requirements, functions and trafficking mechanisms in vivo remain poorly understood. Here we identify a temporally regulated IL-23-dependent switch from CCR6 to CCR2 usage by developing Th17 cells that is critical for pathogenic Th17 cell-driven inflammation in experimental autoimmune encephalomyelitis (EAE). This switch defines a unique in vivo cell surface signature (CCR6(-)CCR2(+)) of GM-CSF/IFNγ-producing Th17 cells in EAE and experimental persistent extracellular bacterial infection, and in humans. Using this signature, we identify an IL-23/IL-1/IFNγ/TNFα/T-bet/Eomesodermin-driven circuit driving GM-CSF/IFNγ-producing Th17 cell formation in vivo. Thus, our data identify a unique cell surface signature, trafficking mechanism and T-cell intrinsic regulators of GM-CSF/IFNγ-producing Th17 cells.

  20. Virus-like particle of Macrobrachium rosenbergii nodavirus produced in Spodoptera frugiperda (Sf9) cells is distinctive from that produced in Escherichia coli.

    Science.gov (United States)

    Kueh, Chare Li; Yong, Chean Yeah; Masoomi Dezfooli, Seyedehsara; Bhassu, Subha; Tan, Soon Guan; Tan, Wen Siang

    2016-11-14

    Macrobrachium rosenbergii nodavirus (MrNV) is a virus native to giant freshwater prawn. Recombinant MrNV capsid protein has been produced in Escherichia coli, which self-assembled into virus-like particles (VLPs). However, this recombinant protein is unstable, degrading and forming heterogenous VLPs. In this study, MrNV capsid protein was produced in insect Spodoptera frugiperda (Sf9) cells through a baculovirus system. Dynamic light scattering (DLS) and transmission electron microscopy (TEM) revealed that the recombinant protein produced by the insect cells self-assembled into highly stable, homogenous VLPs each of approximately 40 nm in diameter. Enzyme-linked immunosorbent assay (ELISA) showed that the VLPs produced in Sf9 cells were highly antigenic and comparable to those produced in E. coli. In addition, the Sf9 produced VLPs were highly stable across a wide pH range (2-12). Interestingly, the Sf9 produced VLPs contained DNA of approximately 48 kilo base pairs and RNA molecules. This study is the first report on the production and characterization of MrNV VLPs produced in a eukaryotic system. The MrNV VLPs produced in Sf9 cells were about 10 nm bigger and had a uniform morphology compared with the VLPs produced in E. coli. The insect cell production system provides a good source of MrNV VLPs for structural and immunological studies as well as for host-pathogen interaction studies. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 2016.

  1. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    Directory of Open Access Journals (Sweden)

    Chotiah S

    2013-06-01

    Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

  2. Nanoscale biophysical properties of the cell surface galactosaminogalactan from the fungal pathogen Aspergillus fumigatus.

    Science.gov (United States)

    Beaussart, Audrey; El-Kirat-Chatel, Sofiane; Fontaine, Thierry; Latgé, Jean-Paul; Dufrêne, Yves F

    2015-09-28

    Many fungal pathogens produce cell surface polysaccharides that play essential roles in host-pathogen interactions. In Aspergillus fumigatus, the newly discovered polysaccharide galactosaminogalactan (GAG) mediates adherence to a variety of substrates through molecular mechanisms that are poorly understood. Here we use atomic force microscopy to unravel the localization and adhesion of GAG on living fungal cells. Using single-molecule imaging with tips bearing anti-GAG antibodies, we found that GAG is massively exposed on wild-type (WT) germ tubes, consistent with the notion that this glycopolymer is secreted by the mycelium of A. fumigatus, while it is lacking on WT resting conidia and on germ tubes from a mutant (Δuge3) deficient in GAG. Imaging germ tubes with tips bearing anti-β-glucan antibodies shows that exposure of β-glucan is strongly increased in the Δuge3 mutant, indicating that this polysaccharide is masked by GAG during hyphal growth. Single-cell force measurements show that expression of GAG on germ tubes promotes specific adhesion to pneumocytes and non-specific adhesion to hydrophobic substrates. These results provide a molecular foundation for the multifunctional adhesion properties of GAG, thus suggesting it could be used as a potential target in anti-adhesion therapy and immunotherapy. Our methodology represents a powerful approach for characterizing the nanoscale organization and adhesion of cell wall polysaccharides during fungal morphogenesis, thereby contributing to increase our understanding of their role in biofilm formation and immune responses.

  3. Pathogenic bacteria target NEDD8-conjugated cullins to hijack host-cell signaling pathways.

    Science.gov (United States)

    Jubelin, Grégory; Taieb, Frédéric; Duda, David M; Hsu, Yun; Samba-Louaka, Ascel; Nobe, Rika; Penary, Marie; Watrin, Claude; Nougayrède, Jean-Philippe; Schulman, Brenda A; Stebbins, C Erec; Oswald, Eric

    2010-09-30

    The cycle inhibiting factors (Cif), produced by pathogenic bacteria isolated from vertebrates and invertebrates, belong to a family of molecules called cyclomodulins that interfere with the eukaryotic cell cycle. Cif blocks the cell cycle at both the G₁/S and G₂/M transitions by inducing the stabilization of cyclin-dependent kinase inhibitors p21(waf1) and p27(kip1). Using yeast two-hybrid screens, we identified the ubiquitin-like protein NEDD8 as a target of Cif. Cif co-compartmentalized with NEDD8 in the host cell nucleus and induced accumulation of NEDD8-conjugated cullins. This accumulation occurred early after cell infection and correlated with that of p21 and p27. Co-immunoprecipitation revealed that Cif interacted with cullin-RING ubiquitin ligase complexes (CRLs) through binding with the neddylated forms of cullins 1, 2, 3, 4A and 4B subunits of CRL. Using an in vitro ubiquitylation assay, we demonstrate that Cif directly inhibits the neddylated CUL1-associated ubiquitin ligase activity. Consistent with this inhibition and the interaction of Cif with several neddylated cullins, we further observed that Cif modulates the cellular half-lives of various CRL targets, which might contribute to the pathogenic potential of diverse bacteria.

  4. Virulence-specific cell cycle and morphogenesis connections in pathogenic fungi.

    Science.gov (United States)

    Pérez-Martín, José; Bardetti, Paola; Castanheira, Sónia; de la Torre, Antonio; Tenorio-Gómez, María

    2016-09-01

    To initiate pathogenic development, pathogenic fungi respond to a set of inductive cues. Some of them are of an extracellular nature (environmental signals), while others are intracellular (developmental signals). These signals must be integrated into a single response whose major outcome is changes in the morphogenesis of the fungus. The regulation of the cell cycle is pivotal during these cellular differentiation steps; therefore, cell cycle regulation would likely provide control points for infectious development by fungal pathogens. Here, we provide clues to understanding how the control of the cell cycle is integrated with the morphogenesis program in pathogenic fungi, and we review current examples that support these connections.

  5. Purification and Structural Analysis of a Selective Toxin Fraction Produced by the Plant Pathogen Setosphaeria turcica

    Institute of Scientific and Technical Information of China (English)

    ZHANG Li-hui; DONG Jin-gao; WANG Chao-hua; LI Zheng-ping

    2007-01-01

    Thirteen fractions from the pathogenic plant fungus Setosphaeria turcica race 1 were separated and collected using high performance liquid chromatography (HPLC). Their toxic activities were assayed through leaf puncturing on corn differentials (OH43, OH43Htl, OH43Ht2, and OH43HtN), and the results revealed that eight fractions were toxic and fraction 6 was specifically toxic to OH43Htl, which could be taken as a gene-selective toxin fraction. Fraction 6 was finely purified via HPLC and condensed by freeze desiccation. Its chemical structure was analyzed with EI-MS, IR, HMBC, 1H-NMR, and two-dimensional NMR. The results suggested that fraction 6 contained an unsaturated double bond, carbonyl and methylene groups with molecular weight of 142.

  6. Biscopyran, a phytotoxic hexasubstituted pyranopyran produced by Biscogniauxia mediterranea, a fungus pathogen of cork oak.

    Science.gov (United States)

    Evidente, Antonio; Andolfi, Anna; Maddau, Lucia; Franceschini, Antonio; Marras, Francesco

    2005-04-01

    A new phytotoxic hexasubstituted pyranopyran, biscopyran (3), was isolated together with phenylacetic acid (2) and previously isolated 5-methylmellein (1) from the liquid culture filtrates of Biscogniauxiamediterranea, a major fungal pathogen involved in oak decline in Sardinia. Biscopyran was characterized by spectroscopic methods as a new (Z)-2-methoxy-1-[7-((Z)-2-methoxybut-2-enoyl)-3,4,5,6-tetramethyl-2H,7H-pyrano[2,3-b]pyran-2-yl]but-2-en-1-one. Biscopyran assayed at 0.26-0.026 mM concentration range caused epinasty on cork oak cuttings. On a nonhost plant, tomato, biscopyran caused wilting. Phenylacetic acid, assayed at the same concentration, was toxic to Q. suber, while on tomato cuttings it induced internal tissue collapse on the stem.

  7. Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria.

    Science.gov (United States)

    Raaijmakers, Jos M; Mazzola, Mark

    2012-01-01

    Soil- and plant-associated environments harbor numerous bacteria that produce antibiotic metabolites with specific or broad-spectrum activities against coexisting microorganisms. The function and ecological importance of antibiotics have long been assumed to yield a survival advantage to the producing bacteria in the highly competitive but resource-limited soil environments through direct suppression. Although specific antibiotics may enhance producer persistence when challenged by competitors or predators in soil habitats, at subinhibitory concentrations antibiotics exhibit a diversity of other roles in the life history of the producing bacteria. Many processes modulated by antibiotics may be inherently critical to the producing bacterium, such as the acquisition of substrates or initiation of developmental changes that will ensure survival under stressful conditions. Antibiotics may also have roles in more complex interactions, including in virulence on host plants or in shaping the outcomes of multitrophic interactions. The innate functions of antibiotics to producing bacteria in their native ecosystem are just beginning to emerge, but current knowledge already reveals a breadth of activities well beyond the historical perspective of antibiotics as weaponry in microbial conflicts.

  8. Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov

    Directory of Open Access Journals (Sweden)

    Sivam Visnuvinayagam

    2015-09-01

    Full Text Available Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18th(final passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

  9. Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov.

    Science.gov (United States)

    Visnuvinayagam, Sivam; Thangavel, K; Lalitha, N; Malmarugan, S; Sukumar, Kuppannan

    2015-01-01

    Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC) system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18(th)(final) passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

  10. IL-10-Producing Type 1 Regulatory T Cells and Allergy

    Institute of Scientific and Technical Information of China (English)

    Kui Wu; Yutian Bi; Kun Sun; Changzheng Wang

    2007-01-01

    As an important subset of regulatory T (Treg) cells, IL-10-producing type 1 regulatory T cells (Tr1), have some different features to thymic-derived naturally occurring CD4+CD25+Foxp3+ Treg cells(nTreg cells). Similar to nTreg cells, Tr1 also play important roles in the control of allergic inflammation in several ways. There is a fine balance between Tr1 and Th2 responses in healthy subjects. Skewing of allergic-specific effctor T cells to a Tr1 phenotype appears to be a critical event in successful allergen-specific immunotherapy and glucocorticoids and β2-agonists treatment. Tr1 suppress Th2 cells and effector cells of allergic inflammation, such as eosinophils, mast cells, basophils, through producing IL-10, and perhaps TGF-β. Understanding of Tr1 may be helpful in developing new strategies for treatment of allergic diseases.

  11. Chenopodolans A-C: phytotoxic furopyrans produced by Phoma chenopodiicola, a fungal pathogen of Chenopodium album.

    Science.gov (United States)

    Cimmino, Alessio; Andolfi, Anna; Zonno, Maria Chiara; Avolio, Fabiana; Berestetskiy, Alexander; Vurro, Maurizio; Evidente, Antonio

    2013-12-01

    Three tetrasubstituted furopyrans, named chenopodolans A-C, were isolated together with the well known fungal metabolite (-)-(R)-6-hydroxymellein from the liquid culture of Phoma chenopodiicola, a fungal pathogen proposed for the biological control of Chenopodium album, a common worldwide weed of arable crops. The structures of chenopodolans A-C were established by spectroscopic and chemical methods as 2-(3-methoxy-2,6-dimethyl-7aH-furo[2,3-b]pyran-4-yl)-butane-2,3-diol, 1-(3-methoxy-2,6-dimethyl-7aH-furo[2,3-b]pyran-4-yl)ethanol and 3-methoxy-2,6-dimethyl-4-(1-methylpropenyl)-7aH-furo[2,3-b]pyran, respectively. The absolute configuration R to the hydroxylated secondary carbon (C-11) of the side chain at C-4 of chenopodolan A was determined by applying an advanced Mosher's method. Assayed by leaf puncture on host and non-host weeds chenopodolans A and B, and the 11-O-acetylchenopodolan A showed a strong phytotoxicity. These results showed that the nature of the side chain attached to C-4 is an important feature for the phytotoxicity. A weak zootoxic activity was only showed by chenopodolan B.

  12. Pathogenicity of Exopolysaccharide-Producing Actinomyces oris Isolated from an Apical Abscess Lesion

    Science.gov (United States)

    2013-01-01

    rium (Anriany et al. 2001), Staphylococcus epidermidis (Vuong et al. 2004) and Vibrio cholerae (Wai et al. 1998). Considering the fact that ATCC...Wai SN, Mizunoe Y, Takade A, Kawabata S-I, Yoshida S-I (1998) Vibrio cholerae O1 strain TSI-4 produces the exo- polysaccharide materials that determine

  13. Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria

    NARCIS (Netherlands)

    Raaijmakers, J.M.; Mazzola, M.

    2012-01-01

    Soil- and plant-associated environments harbor numerous bacteria that produce antibiotic metabolites with specific or broad-spectrum activities against coexisting microorganisms. The function and ecological importance of antibiotics have long been assumed to yield a survival advantage to the produci

  14. Anti-adhesion activity of two biosurfactants produced by Bacillus spp. prevents biofilm formation of human bacterial pathogens.

    Science.gov (United States)

    Rivardo, F; Turner, R J; Allegrone, G; Ceri, H; Martinotti, M G

    2009-06-01

    In this work, two biosurfactant-producing strains, Bacillus subtilis and Bacillus licheniformis, have been characterized. Both strains were able to grow at high salinity conditions and produce biosurfactants up to 10% NaCl. Both extracted-enriched biosurfactants showed good surface tension reduction of water, from 72 to 26-30 mN/m, low critical micelle concentration, and high resistance to pH and salinity. The potential of the two lipopeptide biosurfactants at inhibiting biofilm adhesion of pathogenic bacteria was demonstrated by using the MBEC device. The two biosurfactants showed interesting specific anti-adhesion activity being able to inhibit selectively biofilm formation of two pathogenic strains. In particular, Escherichia coli CFT073 and Staphylococcus aureus ATCC 29213 biofilm formation was decreased of 97% and 90%, respectively. The V9T14 biosurfactant active on the Gram-negative strain was ineffective against the Gram-positive and the opposite for the V19T21. This activity was observed either by coating the polystyrene surface or by adding the biosurfactant to the inoculum. Two fractions from each purified biosurfactant, obtained by flash chromatography, fractions (I) and (II), showed that fraction (II), belonging to fengycin-like family, was responsible for the anti-adhesion activity against biofilm of both strains.

  15. Immunometabolic Regulation of Interleukin-17-Producing T Helper Cells: Uncoupling New Targets for Autoimmunity

    Science.gov (United States)

    Binger, Katrina J.; Côrte-Real, Beatriz F.; Kleinewietfeld, Markus

    2017-01-01

    Interleukin-17-producing T helper (Th17) cells are critical for the host defense of bacterial and fungal pathogens and also play a major role in driving pathogenic autoimmune responses. Recent studies have indicated that the generation of Th17 cells from naïve CD4+ T cells is coupled with massive cellular metabolic adaptations, necessary to cope with different energy and metabolite requirements associated with switching from a resting to proliferative state. Furthermore, Th17 cells have to secure these metabolic adaptations when facing nutrient-limiting environments, such as at the sites of inflammation. Accumulating data indicates that this metabolic reprogramming is significantly linked to the differentiation of T helper cells and, particularly, that the metabolic changes of Th17 cells and anti-inflammatory Forkhead box P3+ regulatory T cells are tightly and reciprocally regulated. Thus, a better understanding of these processes could offer potential new targets for therapeutic interventions for autoimmune diseases. In this mini-review, we will highlight some of the recent advances and discoveries in the field, with a particular focus on metabolic demands of Th17 cells and their implications for autoimmunity.

  16. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2004-2005 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2005-05-01

    In the spring of 2004 naturally produced smolts outmigrating from the Yakima River Basin were collected for the sixth year of pathogen screening. This component of the evaluation is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Since 1999 the Cle Elum Hatchery has been releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. In 1998 and 2000 through 2004 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. Of these pathogens, only R. salmoninarum was detected in very low levels in the naturally produced smolts outmigrating in 2004. To date, only bacterial pathogens have been detected and prevalences have been low. There have been small variations each year and these changes are attributed to normal fluctuations in prevalence. All of the pathogens detected are widely distributed in Washington State.

  17. Host cells and methods for producing isoprenyl alkanoates

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-12-01

    The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

  18. Cyclobotryoxide, a phytotoxic metabolite produced by the plurivorous pathogen Neofusicoccum australe.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Franceschini, Antonio; Serra, Salvatorica; Basso, Sara; Melck, Dominique; Evidente, Antonio

    2012-10-26

    Two isolates of Neofusicoccum australe belonging to ITS haplotypes H4 and H1 and associated with grapevine cordon dieback and branch dieback of Phoenicean juniper, respectively, have been shown to produce in vitro structurally different secondary metabolites. From the strain BOT48 of N. australe (haplotype H4) a new cyclohexenone oxide, namely, cyclobotryoxide, was isolated together with 3-methylcatechol and tyrosol. Cyclobotryoxide was characterized as (1S,5R,6S)-5-hydroxy-3-methoxy-4-methyl-7-oxabicyclo[4.1.0]hept-3-en-2-one by spectroscopic, optical, and chemical methods. The strain BL24 (haplotype H1) produced tyrosol along with botryosphaerone D and (3S,4S)-3,4,8-trihydroxy-6-methoxy-3,4-dihydro-1(2H)-naphthalenone. The metabolites obtained from both strains were tested at four concentrations on leaves of grapevine cv. Cannonau, holm oak, and cork oak by the leaf puncture assay. Cyclobotryoxide proved to be the most phytotoxic compound. Tyrosol and cyclobotryoxide were also tested on detached grapevine leaves at concentrations of 0.25 and 0.5 mg/mL. Only cyclobotryoxide was found to be active in this bioassay.

  19. Identification of volatile compounds produced by the bacterium Burkholderia tropica that inhibit the growth of fungal pathogens

    Science.gov (United States)

    Tenorio-Salgado, Silvia; Tinoco, Raunel; Vazquez-Duhalt, Rafael; Caballero-Mellado, Jesus; Perez-Rueda, Ernesto

    2013-01-01

    It has been documented that bacteria from the Burkholderia genera produce different kinds of compounds that inhibit plant pathogens, however in Burkholderia tropica, an endophytic diazotrophic and phosphate-solubilizing bacterium isolated from a wide diversity of plants, the capacity to produce antifungal compounds has not been evaluated. In order to expand our knowledge about Burkholderia tropica as a potential biological control agent, we analyzed 15 different strains of this bacterium to evaluate their capacities to inhibit the growth of four phytopathogenic fungi, Colletotrichum gloeosporioides, Fusarium culmorum, Fusarium oxysporum and Sclerotium rolffsi. Diverse analytical techniques, including plant root protection and dish plate growth assays and gas chromatography-mass spectroscopy showed that the fungal growth inhibition was intimately associated with the volatile compounds produced by B. tropica and, in particular, two bacterial strains (MTo293 and TTe203) exhibited the highest radial mycelial growth inhibition. Morphological changes associated with these compounds, such as disruption of fungal hyphae, were identified by using photomicrographic analysis. By using gas chromatography-mass spectroscopy technique, 18 volatile compounds involved in the growth inhibition mechanism were identified, including α-pinene and limonene. In addition, we found a high proportion of bacterial strains that produced siderophores during growth with different carbon sources, such as alanine and glutamic acid; however, their roles in the antagonism mechanism remain unclear. PMID:23680857

  20. Coinfection of tick cell lines has variable effects on replication of intracellular bacterial and viral pathogens.

    Science.gov (United States)

    Moniuszko, Anna; Rückert, Claudia; Alberdi, M Pilar; Barry, Gerald; Stevenson, Brian; Fazakerley, John K; Kohl, Alain; Bell-Sakyi, Lesley

    2014-06-01

    Ticks transmit various human and animal microbial pathogens and may harbour more than one pathogen simultaneously. Both viruses and bacteria can trigger, and may subsequently suppress, vertebrate host and arthropod vector anti-microbial responses. Microbial coinfection of ticks could lead to an advantage or disadvantage for one or more of the microorganisms. In this preliminary study, cell lines derived from the ticks Ixodes scapularis and Ixodes ricinus were infected sequentially with 2 arthropod-borne pathogens, Borrelia burgdorferi s.s., Ehrlichia ruminantium, or Semliki Forest virus (SFV), and the effect of coinfection on the replication of these pathogens was measured. Prior infection of tick cell cultures with the spirochaete B. burgdorferi enhanced subsequent replication of the rickettsial pathogen E. ruminantium whereas addition of spirochaetes to cells infected with E. ruminantium had no effect on growth of the latter. Both prior and subsequent presence of B. burgdorferi also had a positive effect on SFV replication. Presence of E. ruminantium or SFV had no measurable effect on B. burgdorferi growth. In tick cells infected first with E. ruminantium and then with SFV, virus replication was significantly higher across all time points measured (24, 48, 72h post infection), while presence of the virus had no detectable effect on bacterial growth. When cells were infected first with SFV and then with E. ruminantium, there was no effect on replication of either pathogen. The results of this preliminary study indicate that interplay does occur between different pathogens during infection of tick cells. Further study is needed to determine if this results from direct pathogen-pathogen interaction or from effects on host cell defences, and to determine if these observations also apply in vivo in ticks. If presence of one pathogen in the tick vector results in increased replication of another, this could have implications for disease transmission and incidence.

  1. [Influence of human gastrointestinal tract bacterial pathogens on host cell apoptosis].

    Science.gov (United States)

    Wronowska, Weronika; Godlewska, Renata; Jagusztyn-Krynicka, Elzbieta Katarzyna

    2005-01-01

    Several pathogenic bacteria are able to trigger apoptosis in the host cell, but the mechanisms by which it occurs differ, and the resulting pathology can take different courses. Induction and/or blockage of programmed cell death upon infection is a result of complex interaction of bacterial proteins with cellular proteins involved in signal transduction and apoptosis. In this review we focus on pro/anti-apoptotic activities exhibited by two enteric pathogens Salmonella enterica, Yersinia spp. and gastric pathogen Helicobacter pylori. We present current knowledge on how interaction between mammalian and bacterial cell relates to the molecular pathways of apoptosis, and what is the role of apoptosis in pathogenesis.

  2. The Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins

    Directory of Open Access Journals (Sweden)

    Andong eGong

    2015-10-01

    Full Text Available Aflatoxigenic Aspergillus fungi and associated aflatoxins are ubiquitous in the production and storage of food/feed commodities. Controlling these pests is a challenge. In this study, the Shewanella algae strain YM8 was found to produce volatiles that have strong antifungal activity against Aspergillus pathogens. Gas chromatography-mass spectrometry profiling revealed 15 volatile organic compounds (VOCs emitted from YM8, of which dimethyl trisulfide was the most abundant. We obtained authentic reference standards for six of the VOCs; these all significantly reduced mycelial growth and conidial germination in Aspergillus; dimethyl trisulfide and 2,4-bis(1,1-dimethylethyl-phenol showed the strongest inhibitory activity. YM8 completely inhibited Aspergillus growth and aflatoxin biosynthesis in maize and peanut samples stored at different water activity levels, and scanning electron microscopy revealed severely damaged conidia and a complete lack of mycelium development and conidiogenesis. YM8 also completely inhibited the growth of eight other agronomically important species of phytopathogenic fungi: A. parasiticus, A. niger, Alternaria alternate, Botrytis cinerea, Fusarium graminearum, Fusarium oxysporum, Monilinia fructicola, and Sclerotinia sclerotiorum. This study demonstrates the susceptibility of Aspergillus and other fungi to VOCs from marine bacteria and indicates a new strategy for effectively controlling these pathogens and the associated mycotoxin production in the field and during storage.

  3. Produced Water Treatment Using Microbial Fuel Cell Technology

    Energy Technology Data Exchange (ETDEWEB)

    Borole, A. P.; Campbell, R. [Campbell Applied Physics

    2011-05-20

    ORNL has developed a treatment for produced water using a combination of microbial fuel cells and electrosorption. A collaboration between Campbell Applied Physics and ORNL was initiated to further investigate development of the technology and apply it to treatment of field produced water. The project successfully demonstrated the potential of microbial fuel cells to generate electricity from organics in produced water. A steady voltage was continuously generated for several days using the system developed in this study. In addition to the extraction of electrical energy from the organic contaminants, use of the energy at the representative voltage was demonstrated for salts removal or desalination of the produced water. Thus, the technology has potential to remove organic as well as ionic contaminants with minimal energy input using this technology. This is a novel energy-efficient method to treat produced water. Funding to test the technology at larger scale is being pursued to enable application development.

  4. Chicken dendritic cells are susceptible to highly pathogenic avian influenza viruses which induce strong cytokine responses

    NARCIS (Netherlands)

    Vervelde, L.; Reemens, S.S.; Haarlem, van D.A.; Post, J.; Claassen, E.A.W.; Rebel, J.M.J.; Jansen, C.A.

    2013-01-01

    Infection with highly pathogenic avian influenza (HPAI) in birds and mammals is associated with severe pathology and increased mortality. We hypothesize that in contrast to low pathogenicity avian influenza (LPAI) infection, HPAI infection of chicken dendritic cells (DC) induces a cytokine deregulat

  5. Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

    2014-07-01

    In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL.

  6. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  7. An endophytic/pathogenic Phoma sp. from creosote bush producing biologically active volatile compounds having fuel potential.

    Science.gov (United States)

    Strobel, Gary; Singh, Sanjay K; Riyaz-Ul-Hassan, Syed; Mitchell, Angela M; Geary, Brad; Sears, Joe

    2011-07-01

    A Phoma sp. was isolated and characterized as endophytic and as a pathogen of Larrea tridentata (creosote bush) growing in the desert region of southern Utah, USA. This fungus produces a unique mixture of volatile organic compounds (VOCs), including a series of sesquiterpenoids, some alcohols and several reduced naphthalene derivatives. Trans-caryophyllene, a product in the fungal VOCs, was also noted in the VOCs of this pungent plant. The gases of Phoma sp. possess antifungal properties and is markedly similar to that of a methanolic extract of the host plant. Some of the test organisms with the greatest sensitivity to the Phoma sp. VOCs were Verticillium, Ceratocystis, Cercospora and Sclerotinia while those being the least sensitive were Trichoderma, Colletotrichum and Aspergillus. We discuss the possible involvement of VOC production by the fungus and its role in the biology/ecology of the fungus/plant/environmental relationship with implications for utilization as an energy source.

  8. High-virulence CMY-2- and CTX-M-2-producing avian pathogenic Escherichia coli strains isolated from commercial turkeys.

    Science.gov (United States)

    da Silva, Ketrin Cristina; Cunha, Marcos Paulo Vieira; Cerdeira, Louise; de Oliveira, Maria Gabriela Xavier; de Oliveira, Mirela Caroline Vilela; Gomes, Cleise Ribeiro; Lincopan, Nilton; Knöbl, Terezinha; Moreno, Andrea Micke

    2017-01-01

    This study reports the high-virulence phylogenetic backgrounds of CMY-2- and CTX-M-2-producing avian pathogenic Escherichia coli strains isolated from turkeys sent to slaughter and condemned by airsacculitis in Brazil. Among 300 air sac samples, seven E. coli strains produced plasmid-mediated CMY-2-type AmpC, of which three carried also the blaCTX-M-2 Extended Spectrum Beta-Lactamase encoding gene. Interestingly, the transfer of the blaCMY-2 gene was positive for three E. coli strains, being associated with the presence of IncI1 plasmids. The complete sequence of the representative pJB10 plasmid revealed that the blaCMY-2 gene was within a transposon-like element in the classical genetic environment consisting of tnpA-blaCMY-2-blc-sugE structure. This plasmid with 94-kb belonged to the sequence type (ST) 12 among IncI1 plasmids, which has been associated with the worldwide spread of blaCMY-2 among Salmonella enterica and E. coli. Furthermore, to the best of our knowledge, this is the first complete sequence of a CMY-2-encoding plasmid derived from an Escherichia coli isolated from food-producing animals in Latin America.

  9. LDS1-produced oxylipins are negative regulators of growth, conidiation and fumonisin synthesis in the fungal maize pathogen Fusarium verticillioides.

    Science.gov (United States)

    Scala, Valeria; Giorni, Paola; Cirlini, Martina; Ludovici, Matteo; Visentin, Ivan; Cardinale, Francesca; Fabbri, Anna A; Fanelli, Corrado; Reverberi, Massimo; Battilani, Paola; Galaverna, Gianni; Dall'Asta, Chiara

    2014-01-01

    Oxylipins are fatty acid-derived signaling compounds produced by all eukaryotes so far investigated; in mycotoxigenic fungi, they modulate toxin production and interactions with the host plants. Among the many enzymes responsible for oxylipin generation, Linoleate Diol Synthase 1 (LDS1) produces mainly 8-hydroperoxyoctadecenoic acid and subsequently different di-hydroxyoctadecenoic acids. In this study, we inactivated a copy of the putative LDS1 ortholog (acc. N. FVEG_09294.3) of Fusarium verticillioides, with the aim to investigate its influence on the oxylipin profile of the fungus, on its development, secondary metabolism and virulence. LC-MS/MS oxylipin profiling carried out on the selected mutant strain revealed significant quali-quantitative differences for several oxylipins when compared to the WT strain. The Fvlds1-deleted mutant grew better, produced more conidia, synthesized more fumonisins and infected maize cobs faster than the WT strain. We hypothesize that oxylipins may act as regulators of gene expression in the toxigenic plant pathogen F. verticillioides, in turn causing notable changes in its phenotype. These changes could relate to the ability of oxylipins to re-shape the transcriptional profile of F. verticillioides by inducing chromatin modifications and exerting a direct control on the transcription of secondary metabolism in fungi.

  10. Sequential necrotizing fasciitis caused by the monomicrobial pathogens Streptococcus equisimilis and extended-spectrum beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Endo, Akiko; Matsuoka, Ryosuke; Mizuno, Yasushi; Doi, Asako; Nishioka, Hiroaki

    2016-08-01

    Necrotizing fasciitis is a rapidly progressing bacterial infection of the superficial fascia and subcutaneous tissue that is associated with a high mortality rate and is caused by a single species of bacteria or polymicrobial organisms. Escherichia coli is rarely isolated from patients with monomicrobial disease. Further, there are few reports of extended-spectrum beta-lactamase (ESBL)-producing E. coli associated with necrotizing fasciitis. We report here our treatment of an 85-year-old man who was admitted because of necrotizing fasciitis of his right thigh. Streptococcus equisimilis was detected as a monomicrobial pathogen, and the infection was cured by amputation of the patient's right leg and the administration of antibiotics. However, 5 days after discontinuing antibiotic therapy, he developed necrotizing fasciitis on his right upper limb and died. ESBL-producing E. coli was the only bacterial species isolated from blood and skin cultures. This case demonstrates that ESBL-producing E. coli can cause monomicrobial necrotizing fasciitis, particularly during hospitalization and that a different bacterial species can cause disease shortly after a previous episode.

  11. Bacterial ‘Cell’ Phones: Do cell phones carry potential pathogens?

    Directory of Open Access Journals (Sweden)

    Kiran Chawla

    2009-05-01

    Full Text Available Cell phones are important companions for professionals especially health care workers (HCWs for better communication in hospital. The present study compared the nature of the growth of potentially pathogenic bacterial flora on cell phones in hospital and community. 75% cell phones from both the categories grew at least one potentially pathogenic organism. Cell phones from HCWs grew significantly more potential pathogens like MRSA (20%, Acinetobacter species (5%, Pseudomonas species (2.5% as compared to the non HCWs. 97.5% HCWs use their cell phone in the hospital, 57.5% never cleaned their cell phone and 20% admitted that they did not wash their hands before or after attending patients, although majority (77.5% knows that cell phones can have harmful colonization and act as vector for nosocomial infections. It is recommended, therefore, that cell phones in the hospital should be regularly decontaminated. Moreover, utmost emphasis needs to be paid to hand washing practices among HCWs.

  12. Coinfection of tick cell lines has variable effects on replication of intracellular bacterial and viral pathogens

    Science.gov (United States)

    Moniuszko, Anna; Rückert, Claudia; Alberdi, M. Pilar; Barry, Gerald; Stevenson, Brian; Fazakerley, John K.; Kohl, Alain; Bell-Sakyi, Lesley

    2014-01-01

    Ticks transmit various human and animal microbial pathogens and may harbour more than one pathogen simultaneously. Both viruses and bacteria can trigger, and may subsequently suppress, vertebrate host and arthropod vector anti-microbial responses. Microbial coinfection of ticks could lead to an advantage or disadvantage for one or more of the microorganisms. In this preliminary study, cell lines derived from the ticks Ixodes scapularis and Ixodes ricinus were infected sequentially with 2 arthropod-borne pathogens, Borrelia burgdorferi s.s., Ehrlichia ruminantium, or Semliki Forest virus (SFV), and the effect of coinfection on the replication of these pathogens was measured. Prior infection of tick cell cultures with the spirochaete B. burgdorferi enhanced subsequent replication of the rickettsial pathogen E. ruminantium whereas addition of spirochaetes to cells infected with E. ruminantium had no effect on growth of the latter. Both prior and subsequent presence of B. burgdorferi also had a positive effect on SFV replication. Presence of E. ruminantium or SFV had no measurable effect on B. burgdorferi growth. In tick cells infected first with E. ruminantium and then with SFV, virus replication was significantly higher across all time points measured (24, 48, 72 h post infection), while presence of the virus had no detectable effect on bacterial growth. When cells were infected first with SFV and then with E. ruminantium, there was no effect on replication of either pathogen. The results of this preliminary study indicate that interplay does occur between different pathogens during infection of tick cells. Further study is needed to determine if this results from direct pathogen–pathogen interaction or from effects on host cell defences, and to determine if these observations also apply in vivo in ticks. If presence of one pathogen in the tick vector results in increased replication of another, this could have implications for disease transmission and incidence

  13. First report of Pseudobodo sp, a new pathogen for a potential energy-producing algae: Chlorella vulgaris cultures.

    Directory of Open Access Journals (Sweden)

    Zhangran Chen

    Full Text Available Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4-5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant.

  14. Contact-independent cell death of human microglial cells due to pathogenic Naegleria fowleri trophozoites.

    Science.gov (United States)

    Kim, Jong-Hyun; Kim, Daesik; Shin, Ho-Joon

    2008-12-01

    Free-living Naegleria fowleri leads to a fatal infection known as primary amebic meningoencephalitis in humans. Previously, the target cell death could be induced by phagocytic activity of N. fowleri as a contact-dependent mechanism. However, in this study we investigated the target cell death under a non-contact system using a tissue-culture insert. The human microglial cells, U87MG cells, co-cultured with N. fowleri trophozoites for 30 min in a non-contact system showed morphological changes such as the cell membrane destruction and a reduction in the number. By fluorescence-activated cell sorter (FACS) analysis, U87MG cells co-cultured with N. fowleri trophozoites in a non-contact system showed a significant increase of apoptotic cells (16%) in comparison with that of the control or N. fowleri lysate. When U87MG cells were co-cultured with N. fowleri trophozoites in a non-contact system for 30 min, 2 hr, and 4 hr, the cytotoxicity of amebae against target cells was 40.5, 44.2, and 45.6%, respectively. By contrast, the cytotoxicity of non-pathogenic N. gruberi trophozoites was 10.2, 12.4, and 13.2%, respectively. These results suggest that the molecules released from N. fowleri in a contact-independent manner as well as phagocytosis in a contact-dependent manner may induce the host cell death.

  15. Plant cell wall-degrading enzymes and their secretion in plant-pathogenic fungi.

    Science.gov (United States)

    Kubicek, Christian P; Starr, Trevor L; Glass, N Louise

    2014-01-01

    Approximately a tenth of all described fungal species can cause diseases in plants. A common feature of this process is the necessity to pass through the plant cell wall, an important barrier against pathogen attack. To this end, fungi possess a diverse array of secreted enzymes to depolymerize the main structural polysaccharide components of the plant cell wall, i.e., cellulose, hemicellulose, and pectin. Recent advances in genomic and systems-level studies have begun to unravel this diversity and have pinpointed cell wall-degrading enzyme (CWDE) families that are specifically present or enhanced in plant-pathogenic fungi. In this review, we discuss differences between the CWDE arsenal of plant-pathogenic and non-plant-pathogenic fungi, highlight the importance of individual enzyme families for pathogenesis, illustrate the secretory pathway that transports CWDEs out of the fungal cell, and report the transcriptional regulation of expression of CWDE genes in both saprophytic and phytopathogenic fungi.

  16. Mast Cells Produce a Unique Chondroitin Sulfate Epitope.

    Science.gov (United States)

    Farrugia, Brooke L; Whitelock, John M; O'Grady, Robert; Caterson, Bruce; Lord, Megan S

    2016-02-01

    The granules of mast cells contain a myriad of mediators that are stored and protected by the sulfated glycosaminoglycan (GAG) chains that decorate proteoglycans. Whereas heparin is the GAG predominantly associated with mast cells, mast cell proteoglycans are also decorated with heparan sulfate and chondroitin sulfate (CS). This study investigated a unique CS structure produced by mast cells that was detected with the antibody clone 2B6 in the absence of chondroitinase ABC digestion. Mast cells in rodent tissue sections were characterized using toluidine blue, Leder stain and the presence of mast cell tryptase. The novel CS epitope was identified in rodent tissue sections and localized to cells that were morphologically similar to cells chemically identified as mast cells. The rodent mast cell-like line RBL-2H3 was also shown to express the novel CS epitope. This epitope co-localized with multiple CS proteoglycans in both rodent tissue and RBL-2H3 cultured cells. These findings suggest that the novel CS epitope that decorates mast cell proteoglycans may play a role in the way these chains are structured in mast cells.

  17. Human lysozyme peptidase resistance is perturbed by the anionic glycolipid biosurfactant rhamnolipid produced by the opportunistic pathogen Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Andersen, Kell K; Vad, Brian Stougaard; Scavenius, Carsten;

    2016-01-01

    Infection by the opportunistic pathogen Pseudomonas aeruginosa (PA) is accompanied by the secretion of virulence factors such as the secondary metabolite rhamnolipid (RL) as well as an array of bacterial enzymes, including the protease elastase. The human immune system tries to counter this via...... defensive proteins such as human lysozyme (HLZ). HLZ targets the bacterial cell wall but may also have other antimicrobial activities. The enzyme contains four disulfide bonds and shows high thermodynamic stability and resistance to proteolytic attack. Here we show that RL promotes HLZ degradation...... by several unrelated proteases, including the PA elastase and human proteases. This occurs although RL does not by itself denature HLZ. Nevertheless, RL binds in a sufficiently high stoichiometry (8 RL:1 HLZ) to neutralize the highly cationic surface of HLZ. The initial cleavage sites agree well...

  18. Renal erythropoietin-producing cells in health and disease

    Directory of Open Access Journals (Sweden)

    Tomokazu eSouma

    2015-06-01

    Full Text Available Erythropoietin (Epo is an indispensable erythropoietic hormone primarily produced from renal Epo-producing cells (REPs. Epo production in REPs is tightly regulated in a hypoxia-inducible manner to maintain tissue oxygen homeostasis. Insufficient Epo production by REPs causes renal anemia and anemia associated with chronic disorders. Recent studies have broadened our understanding of REPs from prototypic hypoxia-responsive cells to dynamic fibrogenic cells. In chronic kidney disease, REPs are the major source of scar-forming myofibroblasts and actively produce fibrogenic molecules, including inflammatory cytokines. Notably, myofibroblast-transformed REPs recover their original physiological properties after resolution of the disease insults, suggesting that renal anemia and fibrosis could be reversible to some extent. Therefore, understanding the plasticity of REPs will lead to the development of novel targeted therapeutics for both renal fibrosis and anemia. This review summarizes the regulatory mechanisms how hypoxia-inducible Epo gene expression is attained in health and disease conditions.

  19. Role of the Nfa1 protein in pathogenic Naegleria fowleri cocultured with CHO target cells.

    Science.gov (United States)

    Kang, Su-Yeon; Song, Kyoung-Ju; Jeong, Seok-Ryoul; Kim, Jong-Hyun; Park, Sun; Kim, Kyongmin; Kwon, Myung-Hee; Shin, Ho-Joon

    2005-07-01

    Naegleria fowleri, a free-living amoeba, exists as a virulent pathogen which causes fatal primary amoebic meningoencephalitis in experimental animals and humans. Using infected and immune mouse sera, we previously cloned an nfa1 gene from a cDNA library of N. fowleri by immunoscreening. The nfa1 gene (360 bp) produced a recombinant 13.1-kDa protein, and the Nfa1 protein showed pseudopodium-specific immunolocalization on a trophozoite of N. fowleri. In this study, the role of the Nfa1 protein as a cell contact mechanism of N. fowleri cocultured with target cells was observed by an immunofluorescence assay with an anti-Nfa1 polyclonal antibody. Using confocal microscopic findings, the Nfa1 protein was located on the pseudopodia of N. fowleri trophozoites. The Nfa1 protein in N. fowleri trophozoites cocultured with CHO target cells was also located on pseudopodia, as well as in a food cup formed as a phagocytic structure in close contact with target cells. The amount of nfa1 mRNA of N. fowleri was strongly increased 6 h after coculture.

  20. Pathogenic Transdifferentiation of Th17 Cells Contribute to Perpetuation of Rheumatoid Arthritis during Anti-TNF Treatment.

    Science.gov (United States)

    Andersson, Karin M E; Cavallini, Nicola Filluelo; Hu, Dan; Brisslert, Mikael; Cialic, Ron; Valadi, Hadi; Erlandsson, Malin C; Silfverswärd, Sofia; Pullerits, Rille; Kuchroo, Vijay K; Weiner, Howard L; Bokarewa, Maria I

    2015-06-04

    T-helper cells producing interleukin (IL)-17A and IL-17F cytokines (Th17 cells) are considered the source of autoimmunity in rheumatoid arthritis (RA). In this study, we characterized specific pathogenic features of Th17 cells in RA. By using nano-string technology, we analyzed transcription of 419 genes in the peripheral blood CCR6(+)CXCR3(-) CD4(+) cells of 14 RA patients and 6 healthy controls and identified 109 genes discriminating Th17 cells of RA patients from the controls. Th17 cells of RA patients had an aggressive pathogenic profile and in addition to signature cytokines IL-17, IL-23 and IL-21, and transcriptional regulators RAR-related orphan receptor gamma of T cells (RORγt) and Janus kinase 2 (JAK2), they produced high levels of IL-23R, C-C chemokine ligand type 20 (CCL20), granulocyte-monocyte colony-stimulating factor (GM-CSF ) and transcription factor Tbet required for synovial homing. We showed that Th17 cells are enriched with Helios-producing Foxp3- and IL2RA-deficient cells, indicating altered regulatory profile. The follicular T-helper (Tfh) cells presented a functional profile of adaptor molecules, transcriptional regulator Bcl-6 and B-cell activating cytokines IL-21, IL-31 and leukemia inhibitory factor (LIF ). We observed that anti-tumor necrosis factor (TNF) treatment had a limited effect on the transcription signature of Th17 cells. Patients in remission retained the machinery of receptors (IL-23R and IL-1R1), proinflammatory cytokines (IL-17F, IL-23, IL-21 and TNF ) and adaptor molecules (C-X-C chemokine receptor 5 [CXCR5] and cytotoxic T-lymphocyte-associated protein 4 [CTLA-4]), essential for efficient transdifferentiation and accumulation of Th17 cells. This study convincingly shows that the peripheral blood CCR6(+)CXCR3(-) CD4(+) cells of RA patients harbor pathogenic subsets of Th17 and Tfh cells, which may transdifferentiate from Tregs and contribute to perpetuation of the disease.

  1. Leber's hereditary optic neuropathy (LHON) pathogenic mutations induce mitochondrial-dependent apoptotic death in transmitochondrial cells incubated with galactose medium.

    Science.gov (United States)

    Ghelli, Anna; Zanna, Claudia; Porcelli, Anna Maria; Schapira, Anthony H V; Martinuzzi, Andrea; Carelli, Valerio; Rugolo, Michela

    2003-02-01

    Leber's hereditary optic neuropathy (LHON), a maternally inherited form of central vision loss, is associated with mitochondrial DNA pathogenic point mutations affecting different subunits of complex I. We here report that osteosarcoma-derived cytoplasmic hybrids (cybrid) cell lines harboring one of the three most frequent LHON pathogenic mutations, at positions 11778/ND4, 3460/ND1, and 14484/ND6, undergo cell death when galactose replaces glucose in the medium, contrary to control cybrids that maintain some growth capabilities. This is a well known way to produce a metabolic stress, forcing the cells to rely on the mitochondrial respiratory chain to produce ATP. We demonstrate that LHON cybrid cell death is apoptotic, showing chromatin condensation and nuclear DNA laddering. Moreover, we also document the mitochondrial involvement in the activation of the apoptotic cascade, as shown by the increased release of cytochrome c into the cytosol in LHON cybrid cells as compared with controls. Cybrids bearing the 3460/ND1 and 14484/ND6 mutations seemed more readily prone to undergo apoptosis as compared with the 11778/ND4 mutation. In conclusion, LHON cybrid cells forced by the reduced rate of glycolytic flux to utilize oxidative metabolism are sensitized to an apoptotic death through a mechanism involving mitochondria.

  2. Monitoring of Pathogen-Specific T-Cell Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

    Science.gov (United States)

    Fuji, Shigeo; Kapp, Markus; Einsele, Hermann

    2013-01-01

    The clinical outcome after allogeneic hematopoietic stem cell transplantation (HSCT) has been significantly improved during the last decades with regard to the reduction in organ failure, infection, and severe acute graft-versus-host disease. However, severe complications due to infectious diseases are still one of the major causes of morbidity and mortality after allogeneic HSCT, in particular in patients receiving haploidentical HSCT or cord blood transplant due to a slow and often incomplete immune reconstitution. In order to improve the immune control of pathogens without an increased risk of alloreactivity, adoptive immunotherapy using highly enriched pathogen-specific T cells offers a promising approach. In order to identify patients who are at high risk for infectious diseases, several monitoring assays have been developed with potential for the guidance of immunosuppressive drugs and adoptive immunotherapy in clinical practice. In this article, we aim to give a comprehensive overview regarding current developments of T-cell monitoring techniques focusing on T cells against viruses and fungi. In particular, we will focus on rather simple, fast, non-labor-intensive, cellular assays which could be integrated in routine clinical screening approaches. PMID:24062744

  3. Foodborne pathogens and microbiological characteristics of raw milk soft cheese produced and on retail sale in Brazil.

    Science.gov (United States)

    Moraes, Paula Mendonça; Viçosa, Gabriela Nogueira; Yamazi, Anderson Keizo; Ortolani, Maria Beatriz Tassinari; Nero, Luís Augusto

    2009-03-01

    The consumption of raw milk soft cheeses (RMSC), which are typically manufactured in small dairy farms under unsatisfactory hygiene conditions, is common in Brazil. Due to these production characteristics, this type of cheese is a potential carrier of pathogenic microorganisms, such as Listeria monocytogenes, Salmonella, and enterotoxin-producing Staphylococcus spp. Considering these characteristics, in this work, we aimed to detect the presence of these pathogenic microorganisms in RMC and to evaluate their microbiological quality. Fifty-five samples of this product were collected from different noninspected commercial establishments and submitted to the enumeration of mesophilic aerobes (MA), total coliforms (TC), Escherichia coli, and coagulase-positive staphylococci (CPS), and detection of L. monocytogenes and Salmonella spp. All analyzed samples were negative for Salmonella spp. and L. monocytogenes. All samples presented counts of MA higher than 10(6) colony forming units/g (CFU/g; range, 3.0x10(6) to 4.0x10(9)). TC were present at levels between 1.0x10(3) and 1.8x10(8) CFU/g, and E. coli between 1.0x10(2) and 3.5x10(6) CFU/g. CPS were detected in 17 (30.9%) samples at levels higher than 10(4) CFU/g. These results confirm the poor microbiological quality of raw milk used in the manufacturing of RMC samples, and also the inadequate production conditions. Therefore, the evaluation of microbiological safety and quality of these products must be constantly reported to alert the official agencies about the significance of proper inspection.

  4. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2001 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Pearsons, Todd N.; Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-01-01

    The change in pathogens prevalence to wild fish is probably the least studied ecological interaction associated with hatchery operations. In 1999, the Cle Elum Hatchery began releasing spring chinook smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to evaluate whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and monitored for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition, the fish were tested for Ceratomyxa shasta spores in 2001. Not all testing has been completed for every year, but to date, there have only been minimal changes in levels of the bacterial pathogens in the naturally produced smolts. At this point, due to the limited testing so far, these changes are attributed to normal fluctuation of prevalence.

  5. Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

    Directory of Open Access Journals (Sweden)

    García-Pérez Blanca Estela

    2012-10-01

    Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

  6. Localization and biosynthesis of polyamines in insulin-producing cells

    DEFF Research Database (Denmark)

    Hougaard, D M; Larsson, L I; Nielsen, Jens Høiriis

    1986-01-01

    Two recently developed fluorescence cytochemical methods, specific for spermidine and spermine, were used to localize polyamines in the endocrine pancreas. The polyamines were restricted to the insulin-producing beta-cells and were mainly associated with the secretory granules. Chemical polyamine...

  7. Dickeya dadantii, a plant pathogenic bacterium producing Cyt-like entomotoxins, causes septicemia in the pea aphid Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Denis Costechareyre

    Full Text Available Dickeya dadantii (syn. Erwinia chrysanthemi is a plant pathogenic bacteria that harbours a cluster of four horizontally-transferred, insect-specific toxin genes. It was recently shown to be capable of causing an acute infection in the pea aphid Acyrthosiphon pisum (Insecta: Hemiptera. The infection route of the pathogen, and the role and in vivo expression pattern of these toxins, remain unknown. Using bacterial numeration and immunolocalization, we investigated the kinetics and the pattern of infection of this phytopathogenic bacterium within its insect host. We compared infection by the wild-type strain and by the Cyt toxin-deficient mutant. D. dadantii was found to form dense clusters in many luminal parts of the aphid intestinal tract, including the stomach, from which it invaded internal tissues as early as day 1 post-infection. Septicemia occurred soon after, with the fat body being the main infected tissue, together with numerous early infections of the embryonic chains showing embryonic gut and fat body as the target organs. Generalized septicemia led to insect death when the bacterial load reached about 10(8 cfu. Some individual aphids regularly escaped infection, indicating an effective partial immune response to this bacteria. Cyt-defective mutants killed insects more slowly but were capable of localisation in any type of tissue. Cyt toxin expression appeared to be restricted to the digestive tract where it probably assisted in crossing over the first cell barrier and, thus, accelerating bacterial diffusion into the aphid haemocel. Finally, the presence of bacteria on the surface of leaves hosting infected aphids indicated that the insects could be vectors of the bacteria.

  8. Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

    Science.gov (United States)

    Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

    2016-04-01

    Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria.

  9. Cell-type-restricted anti-cytokine therapy: TNF inhibition from one pathogenic source.

    Science.gov (United States)

    Efimov, Grigory A; Kruglov, Andrei A; Khlopchatnikova, Zoya V; Rozov, Fedor N; Mokhonov, Vladislav V; Rose-John, Stefan; Scheller, Jürgen; Gordon, Siamon; Stacey, Martin; Drutskaya, Marina S; Tillib, Sergei V; Nedospasov, Sergei A

    2016-03-15

    Overexpression of TNF contributes to pathogenesis of multiple autoimmune diseases, accounting for a remarkable success of anti-TNF therapy. TNF is produced by a variety of cell types, and it can play either a beneficial or a deleterious role. In particular, in autoimmunity pathogenic TNF may be derived from restricted cellular sources. In this study we evaluated the feasibility of cell-type-restricted TNF inhibition in vivo. To this end, we engineered MYSTI (Myeloid-Specific TNF Inhibitor)--a recombinant bispecific antibody that binds to the F4/80 surface molecule on myeloid cells and to human TNF (hTNF). In macrophage cultures derived from TNF humanized mice MYSTI could capture the secreted hTNF, limiting its bioavailability. Additionally, as evaluated in TNF humanized mice, MYSTI was superior to an otherwise analogous systemic TNF inhibitor in protecting mice from lethal LPS/D-Galactosamine-induced hepatotoxicity. Our results suggest a novel and more specific approach to inhibiting TNF in pathologies primarily driven by macrophage-derived TNF.

  10. Isolation and characterization of renal erythropoietin-producing cells from genetically produced anemia mice.

    Directory of Open Access Journals (Sweden)

    Xiaoqing Pan

    Full Text Available Understanding the nature of renal erythropoietin-producing cells (REPs remains a central challenge for elucidating the mechanisms involved in hypoxia and/or anemia-induced erythropoietin (Epo production in adult mammals. Previous studies have shown that REPs are renal peritubular cells, but further details are lacking. Here, we describe an approach to isolate and characterize REPs. We bred mice bearing an Epo gene allele to which green fluorescent protein (GFP reporter cDNA was knocked-in (Epo(GFP with mice bearing an Epo gene allele lacking the 3' enhancer (Epo(Δ3'E. Mice harboring the mutant Epo(GFP/Δ3'E gene exhibited anemia (average Hematocrit 18% at 4 to 6 days after birth, and this perinatal anemia enabled us to identify and purify REPs based on GFP expression from the kidney. Light and confocal microscopy revealed that GFP immunostaining was confined to fibroblastic cells that reside in the peritubular interstitial space, confirming our previous observation in Epo-GFP transgenic reporter assays. Flow cytometry analyses revealed that the GFP fraction constitutes approximately 0.2% of the whole kidney cells and 63% of GFP-positive cells co-express CD73 (a marker for cortical fibroblasts and Epo-expressing cells in the kidney. Quantitative RT-PCR analyses confirmed that Epo expression was increased by approximately 100-fold in the purified population of REPs compared with that of the unsorted cells or CD73-positive fraction. Gene expression analyses showed enrichment of Hif2α and Hif3α mRNA in the purified population of REPs. The genetic approach described here provides a means to isolate a pure population of REPs, allowing the analysis of gene expression of a defined population of cells essential for Epo production in the kidney. This has provided evidence that positive regulation by HIF2α and negative regulation by HIF3α might be necessary for correct renal Epo induction.

  11. Comprehensive Profiling of GPCR Expression in Ghrelin-Producing Cells.

    Science.gov (United States)

    Koyama, Hiroyuki; Iwakura, Hiroshi; Dote, Katsuko; Bando, Mika; Hosoda, Hiroshi; Ariyasu, Hiroyuki; Kusakabe, Toru; Son, Choel; Hosoda, Kiminori; Akamizu, Takashi; Kangawa, Kenji; Nakao, Kazuwa

    2016-02-01

    To determine the comprehensive G protein-coupled receptor (GPCR) expression profile in ghrelin-producing cells and to elucidate the role of GPCR-mediated signaling in the regulation of ghrelin secretion, we determined GPCR expression profiles by RNA sequencing in the ghrelin-producing cell line MGN3-1 and analyzed the effects of ligands for highly expressed receptors on intracellular signaling and ghrelin secretion. Expression of selected GPCRs was confirmed in fluorescence-activated cell-sorted fluorescently tagged ghrelin-producing cells from ghrelin-promoter CreERT2/Rosa-CAG-LSL-ZsGreen1 mice. Expression levels of GPCRs previously suggested to regulate ghrelin secretion including adrenergic-β1 receptor, GPR81, oxytocin receptor, GPR120, and somatostatin receptor 2 were high in MGN3-1 cells. Consistent with previous reports, isoproterenol and oxytocin stimulated the Gs and Gq pathways, respectively, whereas lactate, palmitate, and somatostatin stimulated the Gi pathway, confirming the reliability of current assays. Among other highly expressed GPCRs, prostaglandin E receptor 4 agonist prostaglandin E2 significantly stimulated the Gs pathway and ghrelin secretion. Muscarine, the canonical agonist of cholinergic receptor muscarinic 4, stimulated both the Gq and Gi pathways. Although muscarine treatment alone did not affect ghrelin secretion, it did suppress forskolin-induced ghrelin secretion, suggesting that the cholinergic pathway may play a role in counterbalancing the stimulation of ghrelin by Gs (eg, by adrenaline). In addition, GPR142 ligand tryptophan stimulated ghrelin secretion. In conclusion, we determined the comprehensive expression profile of GPCRs in ghrelin-producing cells and identified two novel ghrelin regulators, prostaglandin E2 and tryptophan. These results will lead to a greater understanding of the physiology of ghrelin and facilitate the development of ghrelin-modulating drugs.

  12. Establishment of a new bovine leukosis virus producing cell line.

    Science.gov (United States)

    Beier, D; Riebe, R; Blankenstein, P; Starick, E; Bondzio, A; Marquardt, O

    2004-11-01

    Due to the prevalence of different bovine leukosis virus (BLV) species in the cattle population in Europe, problems may arise in the serological diagnosis of BLV infections. In addition, earlier investigations demonstrated that contamination of the BLV antigen-producing cell culture systems by bovine viral diarrhea virus (BVDV) may give rise to misinterpretation of serological test results after BVDV vaccination of cattle. By co-cultivation of peripheral leukocytes of a BLV-infected cow with a permanent sheep kidney cell line, a new BLV-producing cell line named PO714 was established. This line carries a BLV provirus of the Belgian species and has been tested to be free of a variety of possibly contaminating viruses and mycoplasms. Investigations of a panel of well-characterised sera by agar gel immunodiffusion (AGID) and capture ELISA (cELISA) tests using antigen prepared from this new cell line in comparison with antigen of the well-known cell line FLK/BLV yielded comparable results. False positive results caused by BVDV cross-reactions could be eliminated when tests were carried out with antigen derived from the new cell line.

  13. Arsenal of plant cell wall degrading enzymes reflects host preference among plant pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Bergstrom Gary C

    2011-02-01

    Full Text Available Abstract Background The discovery and development of novel plant cell wall degrading enzymes is a key step towards more efficient depolymerization of polysaccharides to fermentable sugars for the production of liquid transportation biofuels and other bioproducts. The industrial fungus Trichoderma reesei is known to be highly cellulolytic and is a major industrial microbial source for commercial cellulases, xylanases and other cell wall degrading enzymes. However, enzyme-prospecting research continues to identify opportunities to enhance the activity of T. reesei enzyme preparations by supplementing with enzymatic diversity from other microbes. The goal of this study was to evaluate the enzymatic potential of a broad range of plant pathogenic and non-pathogenic fungi for their ability to degrade plant biomass and isolated polysaccharides. Results Large-scale screening identified a range of hydrolytic activities among 348 unique isolates representing 156 species of plant pathogenic and non-pathogenic fungi. Hierarchical clustering was used to identify groups of species with similar hydrolytic profiles. Among moderately and highly active species, plant pathogenic species were found to be more active than non-pathogens on six of eight substrates tested, with no significant difference seen on the other two substrates. Among the pathogenic fungi, greater hydrolysis was seen when they were tested on biomass and hemicellulose derived from their host plants (commelinoid monocot or dicot. Although T. reesei has a hydrolytic profile that is highly active on cellulose and pretreated biomass, it was less active than some natural isolates of fungi when tested on xylans and untreated biomass. Conclusions Several highly active isolates of plant pathogenic fungi were identified, particularly when tested on xylans and untreated biomass. There were statistically significant preferences for biomass type reflecting the monocot or dicot host preference of the

  14. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development.

  15. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells.

    Science.gov (United States)

    Ortega, Alvaro D; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles is regulated in both space and time. Non-coding small RNAs (sRNAs) are post-transcriptional regulatory molecules that fine-tune important processes in bacterial physiology including cell envelope architecture, intermediate metabolism, bacterial communication, biofilm formation, and virulence. Recent studies have shown production of defined sRNA species by intracellular bacteria located inside eukaryotic cells. The molecules targeted by these sRNAs and their expression dynamics along the intracellular infection cycle remain, however, poorly characterized. Technical difficulties linked to the isolation of "intact" intracellular bacteria from infected host cells might explain why sRNA regulation in these specialized pathogens is still a largely unexplored field. Transition from the extracellular to the intracellular lifestyle provides an ideal scenario in which regulatory sRNAs are intended to participate; so much work must be done in this direction. This review focuses on sRNAs expressed by intracellular bacterial pathogens during the infection of eukaryotic cells, strategies used with these pathogens to identify sRNAs required for virulence, and the experimental technical challenges associated to this type of studies. We also discuss varied techniques for their potential application to study RNA regulation in intracellular bacterial infections.

  16. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    Directory of Open Access Journals (Sweden)

    Álvaro D. Ortega

    2014-11-01

    Full Text Available Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles is regulated in both space and time. Non-coding small RNAs (sRNAs are post-transcriptional regulatory molecules that fine-tune important processes in bacterial physiology including cell envelope architecture, intermediate metabolism, bacterial communication, biofilm formation and virulence. Recent studies have shown production of defined sRNA species by intracellular bacteria located inside eukaryotic cells. The molecules targeted by these sRNAs and their expression dynamics along the intracellular infection cycle remain, however, poorly characterized. Technical difficulties linked to the isolation of ‘intact’ intracellular bacteria from infected host cells might explain why sRNA regulation in these specialized pathogens is still a largely unexplored field. Transition from the extracellular to the intracellular lifestyle provides an ideal scenario in which regulatory sRNAs are intended to participate; so much work must be done in this direction. This review focuses on sRNAs expressed by intracellular bacterial pathogens during the infection of eukaryotic cells, strategies used with these pathogens to identify sRNAs required for virulence, and the experimental technical challenges associated to this type of studies. We also discuss varied techniques for their potential application to study RNA regulation in intracellular bacterial infections.

  17. T-Regulatory Cells as Part of Strategy of Immune Evasion by Pathogens.

    Science.gov (United States)

    Garib, F Yu; Rizopulu, A P

    2015-08-01

    Under physiological conditions, regulatory processes can suppress the immune response after elimination of a pathogen and restore homeostasis through the destruction and suppression of obsolete effector cells of the immune system. The main players in this process are T-regulatory cells (Tregs) and immature dendritic cells, which suppress the immune response by their own products and/or by inducing synthesis of immunosuppressive interleukins IL-10, IL-35, and transforming growth factor (TGF-β) by other cells. This mechanism is also used by widespread "successful" pathogens that are capable of chronically persisting in the human body - herpes virus, hepatitis viruses, human immunodeficiency virus, Mycobacterium tuberculosis, Helicobacter pylori, and others. During coevolution of microbial pathogens and the host immune system, the pathogens developed sophisticated strategies for evading the host defense, so-called immune evasion. In particular, molecular structures of pathogens during the interaction with dendritic cells via activating and inhibitory receptors can change intracellular signal transduction, resulting in block of maturation of dendritic cells. Immature dendritic cells become tolerogenic and cause differentiation of Tregs from the conventional T-cell CD4+. Microbial molecules can also react directly with Tregs through innate immune receptors. Costimulation of Toll-like receptor 5 (TLR5) by flagellin increases the expression of the transcription factor Foxp3, which increases the suppressive activity of Treg cells. From all evasion mechanisms, the induction of immunosuppression by Treg through IL-10, IL-35, and TGF-β appears most effective. This results in the suppression of inflammation and of adaptive immune responses against pathogens, optimizing the conditions for the survival of bacteria and viruses.

  18. The effects of microgravity and clinorotation on the interaction of plant cells with fungal pathogen

    Science.gov (United States)

    Nedukha, O.; Kordyum, E.; Leach, J.; Martyn, G.; Ryba-White, M.

    The influence of microgravity and slow horizontal clinorotation (2 rev/min), which partly mimics microgravity, on the interaction of plant cells of soybean roots to Phytophthora sojae and of potato minitubers to Phytophthora infestans was studied during the Space Shuttle Mission STS-87 and during clinorotation. Seedlings of soybean cultivar Williams 82 grown in spaceflight and at 1 g were untreated or inoculated with pathogen P. sojae; minitubers of potato (cv Adreta) grown at horizontal clinorotation and the vertical control also were untreated or inoculated with pathogen P. infestans. The methods of light microscopy, scanning and transmission electron microscopy, confocal microscopy and also cytochemistry for the determination of callose content and peroxydase activity were used in the experiments. Post-landing analysis of the meristem cells of soybean roots infected with P. sojae and post-clinorotation analysis of the parenchyma cells of potato minitubers cells infected with P. infestans showed more destroying symptoms in cells of plant-host, which were more extensive colonized relative to the controls exposed to the pathogen fungus. Infected cells of plants-host were divided in two types: cells of first type were completely destroyed and hyphae of pathogen fungus were into these cells or in intercellular spaces; cells of second type characterized by partly changed ultrastructure and a calcium sites were contained above in mentioned cells. These data suggest that root cells of soybean seedlings grown in microgravity and cells of potato minitubers grown at slow horizontal clinorotation are more susceptible to penetration of a fungal pathogen in comparison with the corresponding controls.

  19. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2002 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-05-01

    In 1999 the Cle Elem Hatchery began releasing spring chinook smolts into the upper Yakima River for restoration and supplementation. This project was designed to evaluate whether introduction of intensively reared hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and 130 smolts were collected in 2002 for monitoring for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition the fish were tested for Ceratomyxa shasta spores in 2000 and 2001 (a correction from the 2001 report). To date, the only changes have been in the levels the bacterial pathogens in the naturally produced smolts and they have been minimal. These changes are attributed to normal fluctuation of prevalence.

  20. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation Report 6 of 7, 2003-2004 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2004-05-01

    In 1999 the Cle Elum Hatchery began releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. In 1998 and 2000 through 2003 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. To date, only the bacterial pathogens have been detected and prevalences have been low. Prevalences have varied each year and these changes are attributed to normal fluctuation of prevalence. All of the pathogens detected are widely distributed in Washington State.

  1. Colonization of Arabidopsis roots by Pseudomonas fluorescens primes the plant to produce higher levels of ethylene upon pathogen infection

    NARCIS (Netherlands)

    Hase, S.; Pelt, J.A. van; Loon, L.C. van; Pieterse, C.M.J.

    2003-01-01

    Plants develop an enhanced defensive capacity against a broad spectrum of plant pathogens after colonization of the roots by selected strains of non-pathogenic, fluorescent Pseudomonas spp. In Arabidopsis thaliana, this rhizobacteria-induced systemic resistance (ISR) functions independently of salic

  2. Hijacking host cell highways: manipulation of the host actin cytoskeleton by obligate intracellular bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Punsiri M Colonne

    2016-09-01

    Full Text Available Intracellular bacterial pathogens replicate within eukaryotic cells and display unique adaptations that support key infection events including invasion, replication, immune evasion, and dissemination. From invasion to dissemination, all stages of the intracellular bacterial life cycle share the same three-dimensional cytosolic space containing the host cytoskeleton. For successful infection and replication, many pathogens hijack the cytoskeleton using effector proteins introduced into the host cytosol by specialized secretion systems. A subset of effectors contains eukaryotic-like motifs that mimic host proteins to exploit signaling and modify specific cytoskeletal components such as actin and microtubules. Cytoskeletal rearrangement promotes numerous events that are beneficial to the pathogen, including internalization of bacteria, subversion of cell intrinsic immunity, structural support for bacteria-containing vacuoles, altered vesicular trafficking, actin-dependent bacterial movement, and pathogen dissemination. This review highlights a diverse group of obligate intracellular bacterial pathogens that manipulate the host cytoskeleton to thrive within eukaryotic cells and discusses underlying molecular mechanisms that promote these dynamic host-pathogen interactions.

  3. Induction of programmed cell death in lily by the fungal pathogen Botrytis elliptica

    NARCIS (Netherlands)

    Baarlen, van P.; Staats, M.; Kan, van J.A.L.

    2004-01-01

    The genus Botrytis contains necrotrophic plant pathogens that have a wide host range (B. cinerea) or are specialized on a single host species, e.g. B. elliptica on lily. In this study, it was found that B. elliptica-induced cell death of lily displays hallmark features of animal programmed cell deat

  4. Invariant natural killer T cells: front line fighters in the war against pathogenic microbes.

    Science.gov (United States)

    Crosby, Catherine M; Kronenberg, Mitchell

    2016-08-01

    Invariant natural killer T (iNKT) cells constitute a unique subset of innate-like T cells that have been shown to have crucial roles in a variety of immune responses. iNKT cells are characterized by their expression of both NK cell markers and an invariant T cell receptor (TCR) α chain, which recognizes glycolipids presented by the MHC class I-like molecule CD1d. Despite having a limited antigen repertoire, the iNKT cell response can be very complex, and participate in both protective and harmful immune responses. The protective role of these cells against a variety of pathogens has been particularly well documented. Through the use of these pathogen models, our knowledge of the breadth of the iNKT cell response has been expanded. Specific iNKT cell antigens have been isolated from several different bacteria, from which iNKT cells are critical for protection in mouse models. These responses can be generated by direct, CD1d-mediated activation, or indirect, cytokine-mediated activation, or a combination of the two. This can lead to secretion of a variety of different Th1, Th2, or Th17 cytokines, which differentially impact the downstream immune response against these pathogens. This critical role is emphasized by the conservation of these cells between mice and humans, warranting further investigation into how iNKT cells participate in protective immune responses, with the ultimate goal of harnessing their potential for treatment.

  5. Pathogenic Acinetobacter: from the Cell Surface to Infinity and Beyond.

    Science.gov (United States)

    Weber, Brent S; Harding, Christian M; Feldman, Mario F

    2015-12-28

    The genus Acinetobacter encompasses multiple nosocomial opportunistic pathogens that are of increasing worldwide relevance because of their ability to survive exposure to various antimicrobial and sterilization agents. Among these, Acinetobacter baumannii, Acinetobacter nosocomialis, and Acinetobacter pittii are the most frequently isolated in hospitals around the world. Despite the growing incidence of multidrug-resistant Acinetobacter spp., little is known about the factors that contribute to pathogenesis. New strategies for treating and managing infections caused by multidrug-resistant Acinetobacter strains are urgently needed, and this requires a detailed understanding of the pathobiology of these organisms. In recent years, some virulence factors important for Acinetobacter colonization have started to emerge. In this review, we focus on several recently described virulence factors that act at the bacterial surface level, such as the capsule, O-linked protein glycosylation, and adhesins. Furthermore, we describe the current knowledge regarding the type II and type VI secretion systems present in these strains.

  6. Pathogen inactivation of human serum facilitates its clinical use for islet cell culture and subsequent transplantation.

    Science.gov (United States)

    Ståhle, Magnus U; Brandhorst, Daniel; Korsgren, Olle; Knutson, Folke

    2011-01-01

    Serum is regarded as an essential supplement to promote survival and growth of cells during culture. However, the potential risk of transmitting diseases disqualifies the use of serum for clinical cell therapy in most countries. Hence, most clinical cell therapy programs have replaced human serum with human serum albumin, which can result in inferior quality of released cell products. Photochemical treatment of different blood products utilizing Intercept® technology has been shown to inactivate a broad variety of pathogens of RNA and DNA origin. The present study assesses the feasibility of using pathogen-inactivated, blood group-compatible serum for use in human pancreatic islet culture. Isolated human islets were cultured at 37°C for 3-4 days in CMRL 1066 supplemented with 10% of either pathogen-inactivated or nontreated human serum. Islet quality assessment included glucose-stimulated insulin release (perifusion), ADP/ATP ratio, cytokine expression, and posttransplant function in diabetic nude mice. No differences were found between islets cultured in pathogen-inactivated or control serum regarding stimulated insulin release, intracellular insulin content, and ADP/ATP ratio. Whether media was supplemented with treated or nontreated serum, islet expression of IL-6, IL-8, MCP-1, or tissue factor was not affected. The final diabetes-reversal rate of mice receiving islets cultured in pathogen-inactivated or nontreated serum was 78% and 87%, respectively (NS). As reported here, pathogen-inactivated human serum does not affect viability or functional integrity of cultured human islets. The implementation of this technology for RNA- and DNA-based pathogen inactivation should enable reintroduction of human serum for clinical cell therapy.

  7. Pathogenic role of mast cells in experimental eosinophilic esophagitis

    OpenAIRE

    Niranjan, Rituraj; Mavi, Parm; Rayapudi, Madhavi; Dynda, Scott; Mishra, Anil

    2013-01-01

    Eosinophilic esophagitis (EoE) is a chronic allergic disease characterized by esophageal intraepithelial eosinophils, extracellular eosinophil granule deposition, induced mast cell accumulation, and epithelial cell hyperplasia. However, the processes involved in the development of a number of these characteristics are largely unknown. Herein, we tested the hypothesis whether induced mast cell accumulation in the esophagus has a role in promoting EoE pathogenesis. Accordingly, we induced exper...

  8. Soluble plantain fibre blocks adhesion and M-cell translocation of intestinal pathogens.

    Science.gov (United States)

    Roberts, Carol L; Keita, Asa V; Parsons, Bryony N; Prorok-Hamon, Maelle; Knight, Paul; Winstanley, Craig; O' Kennedy, Niamh; Söderholm, Johan D; Rhodes, Jonathan M; Campbell, Barry J

    2013-01-01

    Dietary fibres may have prebiotic effects mediated by promotion of beneficial bacteria. This study explores the possibility that soluble plant fibre may also improve health by inhibiting epithelial adhesion and translocation by pathogenic bacteria. We have focussed on soluble non-starch polysaccharide (NSP) from plantain bananas (Musa spp.) which previous studies showed to be particularly effective at blocking Escherichia coli epithelial adherence. In vitro and ex vivo studies assessed the ability of plantain NSP to inhibit epithelial cell adhesion and invasion of various bacterial pathogens, and to inhibit their translocation through microfold (M)-cells and human Peyer's patches mounted in Ussing chambers. Plantain NSP showed dose-related inhibition of epithelial adhesion and M-cell translocation by a range of pathogens. At 5mg/ml, a concentration readily achievable in the gut lumen, plantain NSP inhibited adhesion to Caco2 cells by Salmonella Typhimurium (85.0 ± 8.2%, PPlantain NSP also inhibited invasion of Caco2 cells by S. Typhimurium (80.2 ± 9.7%) and Sh. sonnei (46.7 ± 13.4%); PPlantain NSP, 5mg/ml, also inhibited translocation of S. Typhimurium and Sh. sonnei across M-cells by 73.3 ± 5.2% and 46.4 ± 7.7% respectively (Pplantain NSP (Pplantain fibre can block epithelial adhesion and M-cell translocation of intestinal pathogens. This represents an important novel mechanism by which soluble dietary fibres can promote intestinal health and prevent infective diarrhoea.

  9. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    Directory of Open Access Journals (Sweden)

    PURNIMA R. CHITLANGE

    2014-11-01

    Full Text Available Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check whether the cell phone act as a vector for transmission of various pathogens, a potential study was carried out in microbiology department of Shri Radhakisan Laxminarayan Toshniwal College of Science, Akola. Total 20 cell samples were screened. Two parameters were considered: College students and hospital staff. The isolated bacteria Staphylococcus aureus, E. coli, Pseudomonas sp., Bacillus subtilis, Aerobacter aerogenes, Salmonella, Shigella, Streptococci, P. vulgaris were identified on the basis of morphological and cultural characteristics. The main aim of present study was to check the contamination by bacterial pathogens on cell phones and also to check role of cell phone for transmission of pathogens from person to person or not.

  10. Parasitic worms stimulate host NADPH oxidases to produce reactive oxygen species that limit plant cell death and promote infection.

    Science.gov (United States)

    Siddique, Shahid; Matera, Christiane; Radakovic, Zoran S; Hasan, M Shamim; Gutbrod, Philipp; Rozanska, Elzbieta; Sobczak, Miroslaw; Torres, Miguel Angel; Grundler, Florian M W

    2014-04-08

    Plants and animals produce reactive oxygen species (ROS) in response to infection. In plants, ROS not only activate defense responses and promote cell death to limit the spread of pathogens but also restrict the amount of cell death in response to pathogen recognition. Plants also use hormones, such as salicylic acid, to mediate immune responses to infection. However, there are long-lasting biotrophic plant-pathogen interactions, such as the interaction between parasitic nematodes and plant roots during which defense responses are suppressed and root cells are reorganized to specific nurse cell systems. In plants, ROS are primarily generated by plasma membrane-localized NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidases, and loss of NADPH oxidase activity compromises immune responses and cell death. We found that infection of Arabidopsis thaliana by the parasitic nematode Heterodera schachtii activated the NADPH oxidases RbohD and RbohF to produce ROS, which was necessary to restrict infected plant cell death and promote nurse cell formation. RbohD- and RbohF-deficient plants exhibited larger regions of cell death in response to nematode infection, and nurse cell formation was greatly reduced. Genetic disruption of SID2, which is required for salicylic acid accumulation and immune activation in nematode-infected plants, led to the increased size of nematodes in RbohD- and RbohF-deficient plants, but did not decrease plant cell death. Thus, by stimulating NADPH oxidase-generated ROS, parasitic nematodes fine-tune the pattern of plant cell death during the destructive root invasion and may antagonize salicylic acid-induced defense responses during biotrophic life stages.

  11. Chemical- and pathogen-induced programmed cell death in plants

    NARCIS (Netherlands)

    Iakimova, E.T.; Atanassov, A.; Woltering, E.J.

    2005-01-01

    This review focuses on recent update in the understanding of programmed cell death regarding the differences and similarities between the diverse types of cell death in animal and plant systems and describes the morphological and some biochemical determinants. The role of PCD in plant development an

  12. Plasmablasts as migratory IgG-producing cells in the pathogenesis of neuromyelitis optica.

    Science.gov (United States)

    Chihara, Norio; Aranami, Toshimasa; Oki, Shinji; Matsuoka, Takako; Nakamura, Masakazu; Kishida, Hitaru; Yokoyama, Kazumasa; Kuroiwa, Yoshiyuki; Hattori, Nobutaka; Okamoto, Tomoko; Murata, Miho; Toda, Tatsushi; Miyake, Sachiko; Yamamura, Takashi

    2013-01-01

    Neuromyelitis optica (NMO) is an inflammatory disease characterized by recurrent attacks of optic neuritis and myelitis. It is generally accepted that autoantibodies against aquaporin 4 water channel protein play a pathogenic role in neuromyelitis optica. We have recently reported that plasmablasts are increased in the peripheral blood of this autoimmune disease, and are capable of producing autoantibodies against aquaporin 4. Here, we demonstrate that CD138(+)HLA-DR(+) plasmablasts, a subset of IgG-producing cells, are increased in the peripheral blood and are enriched among the cerebrospinal fluid (CSF) lymphocytes during the relapse of neuromyelitis optica. Notably, these CD138(+)HLA-DR(+) plasmablasts overexpress CXCR3, whose ligands are present in the cerebrospinal fluid during the relapse of neuromyelitis optica. These results led us to speculate that plasmablasts producing anti-aquaporin 4 autoantibodies might traffic toward the central nervous system (CNS). Furthermore, we performed single-cell sorting of plasmablasts from peripheral blood and CSF samples from NMO and sequenced the complementarity-determining regions (CDRs) of the IgG heavy chain expressed by the sorted plasmablast clones. There were high frequencies of mutations in the CDRs compared with framework regions, indicating that these plasmablast clones would represent a post-germinal center B-cell lineage. Consistent with the preceding results, the plasmablast clones from the peripheral blood shared the same CDR sequences with the clones from the CSF. These results indicate that IgG-producing plasmablasts, which are guided by helper T-cells, may migrate from the peripheral blood preferentially to the CSF. Since migratory plasmablasts could be involved in the inflammatory pathology of NMO, the B-cell subset and their migration might be an attractive therapeutic target.

  13. Plasmablasts as migratory IgG-producing cells in the pathogenesis of neuromyelitis optica.

    Directory of Open Access Journals (Sweden)

    Norio Chihara

    Full Text Available Neuromyelitis optica (NMO is an inflammatory disease characterized by recurrent attacks of optic neuritis and myelitis. It is generally accepted that autoantibodies against aquaporin 4 water channel protein play a pathogenic role in neuromyelitis optica. We have recently reported that plasmablasts are increased in the peripheral blood of this autoimmune disease, and are capable of producing autoantibodies against aquaporin 4. Here, we demonstrate that CD138(+HLA-DR(+ plasmablasts, a subset of IgG-producing cells, are increased in the peripheral blood and are enriched among the cerebrospinal fluid (CSF lymphocytes during the relapse of neuromyelitis optica. Notably, these CD138(+HLA-DR(+ plasmablasts overexpress CXCR3, whose ligands are present in the cerebrospinal fluid during the relapse of neuromyelitis optica. These results led us to speculate that plasmablasts producing anti-aquaporin 4 autoantibodies might traffic toward the central nervous system (CNS. Furthermore, we performed single-cell sorting of plasmablasts from peripheral blood and CSF samples from NMO and sequenced the complementarity-determining regions (CDRs of the IgG heavy chain expressed by the sorted plasmablast clones. There were high frequencies of mutations in the CDRs compared with framework regions, indicating that these plasmablast clones would represent a post-germinal center B-cell lineage. Consistent with the preceding results, the plasmablast clones from the peripheral blood shared the same CDR sequences with the clones from the CSF. These results indicate that IgG-producing plasmablasts, which are guided by helper T-cells, may migrate from the peripheral blood preferentially to the CSF. Since migratory plasmablasts could be involved in the inflammatory pathology of NMO, the B-cell subset and their migration might be an attractive therapeutic target.

  14. Biological Role of Paenilarvins, Iturin-Like Lipopeptide Secondary Metabolites Produced by the Honey Bee Pathogen Paenibacillus larvae

    Science.gov (United States)

    Gensel, Sebastian; Garcia-Gonzalez, Eva; Ebeling, Julia; Skobalj, Ranko; Kuthning, Anja; Süssmuth, Roderich D.

    2016-01-01

    The Gram-positive bacterium Paenibacillus larvae (P. larvae) is the causative agent of a deadly honey bee brood disease called American Foulbrood (AFB). AFB is a notifiable epizootic in most countries and, hence, P. larvae is of considerable relevance for veterinarians and apiculturists alike. Over the last decade, much progress has been made in the understanding of the (patho)biology of P. larvae. Recently, several non-ribosomally produced peptides (NRP) and peptide/polyketide (NRP/PK) hybrids produced by P. larvae were identified. Among these NRPs were iturin-like lipopeptides, the paenilarvins A-C. Iturins are known to exhibit strong anti-fungal activity; for some iturins, cytotoxic activity towards mammalian erythrocytes and human cancer cell lines are described. We here present our results on the analysis of the natural function of the paenilarvins during pathogenesis of P. larvae infections. We demonstrated production of paenilarvins in infected larvae. However, we could neither demonstrate cytotoxicity of paenilarvins towards cultured insect cells nor towards larvae in feeding assays. Accordingly, exposure bioassays performed with larvae infected by wild-type P. larvae and a knockout mutant of P. larvae lacking production of paenilarvins did not substantiate a role for the paenilarvins as virulence factor. Further experiments are necessary to analyze the relevance of the paenilarvins’ anti-fungal activity for P. larvae infections in the presence of fungal competitors in the larval midgut or cadaver. PMID:27760211

  15. Epigenetically Mediated Pathogenic Effects of Phenanthrene on Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Jing Liu

    2013-01-01

    Full Text Available Phenanthrene (Phe, a polycyclic aromatic hydrocarbon (PAH, is a major constituent of urban air pollution. There have been conflicting results regarding the role of other AhR ligands 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD and 6-formylindolo [3,2-b]carbazole (FICZ in modifying regulatory T cell populations (Treg or T helper (Th17 differentiation, and the effects of Phe have been understudied. We hypothesized that different chemical entities of PAH induce Treg to become either Th2 or Th17 effector T cells through epigenetic modification of FOXP3. To determine specific effects on T cell populations by phenanthrene, primary human Treg were treated with Phe, TCDD, or FICZ and assessed for function, gene expression, and phenotype. Methylation of CpG sites within the FOXP3 locus reduced FOXP3 expression, leading to impaired Treg function and conversion of Treg into a CD4+CD25lo Th2 phenotype in Phe-treated cells. Conversely, TCDD treatment led to epigenetic modification of IL-17A and conversion of Treg to Th17 T cells. These findings present a mechanism by which exposure to AhR-ligands mediates human T cell responses and begins to elucidate the relationship between environmental exposures, immune modulation, and initiation of human disease.

  16. Programmed Pathogen Sense and Destroy Circuits

    Science.gov (United States)

    2009-02-18

    detect the presence of pathogenic bacteria, report the identity of the pathogen with a coded output signal, and secrete specific bacteriocins /lysins...on the density of the pathogen. Figure 1. Fluorescence of receivers as a response to the pathogen density Bacteriocins are highly specific and...small portion (depending on the invasion dynamics) of the cells produces bacteriocins under stressful conditions, such as nutrient depletion

  17. Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Beatriz García

    2016-11-01

    Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

  18. Translational mini-review series on Th17 cells: are T helper 17 cells really pathogenic in autoimmunity?

    NARCIS (Netherlands)

    Koenders, M.I.; Berg, W.B. van den

    2010-01-01

    In this review the authors discuss the evidence for T helper type 17 (Th17) cells as pathogenic T cells in autoimmunity. Studies with cytokine-deficient mice or blocking of interleukin (IL)-17, IL-21 and IL-22 have resulted in a conflicting data set. Although in the experimental autoimmune encephalo

  19. Interleukin-7 and -15 maintain pathogenic memory Th17 cells in autoimmunity.

    Science.gov (United States)

    Chen, Yihe; Chauhan, Sunil K; Tan, Xuhua; Dana, Reza

    2017-02-01

    Th17 cells are principal mediators of many autoimmune conditions. Recently, memory Th17 cells have been revealed as crucial in mediating the chronicity of various refractory autoimmune disorders; however, the underlying mechanisms maintaining memory Th17 cells have remained elusive. Here, using a preclinical model of ocular autoimmune disease we show that both IL-7 and IL-15 are critical for maintaining pathogenic memory Th17 cells. Neutralization of these cytokines leads to substantial reduction of memory Th17 cells; both IL-7 and IL-15 provide survival signals via activating STAT5, and IL-15 provides additional proliferation signals via activating both STAT5 and Akt. Topical neutralization of ocular IL-7 or IL-15 effectively reduces memory Th17 cells at the inflammatory site and draining lymphoid tissues, while topical neutralization of IL-17 alone, the major pathogenic cytokine secreted by Th17 cells, does not diminish memory Th17 cells at the draining lymphoid tissues. Our results suggest that the effective removal of pathogenic memory Th17 cells via abolishing environmental IL-7 or IL-15 is likely to be a novel strategy in the treatment of autoimmune diseases.

  20. Direct interaction studies between Aspergillus fumigatus and Human immune cells; what have we learned about pathogenicity and host immunity?

    Directory of Open Access Journals (Sweden)

    Charles Oliver Morton

    2012-12-01

    Full Text Available Invasive aspergillosis is a significant threat to health and is a major cause of mortality in immunocompromised individuals. Understanding the interaction between the fungus and the immune system is important in determining how the immunocompetent host remain disease free. Several studies examining the direct interaction between Aspergillus fumigatus and purified innate immune cells have been conducted to measure the responses of both the host cells and the pathogen. It has been revealed that innate immune cells have different modes of action ranging from effective fungal killing by neutrophils to the less aggressive response of dendritic cells. Natural-killer cells do not phagocytose the fungus unlike the other innate immune cells mentioned but appear to mediate their antifungal effect through the release of gamma interferon. Transcriptional analysis of A. fumigatus interacting with these cells has indicated that it can adapt to the harsh microenvironment of the phagosome and produces toxins, ribotoxin and gliotoxin, that can induce cell death in the majority of innate immune cells. These data point towards potential novel antifungal treatments including the use of innate immune cells as antifungal vaccines.

  1. Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

    Directory of Open Access Journals (Sweden)

    Francesco Marras

    2011-01-01

    Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

  2. Insulin-producing cells from embryonic stem cells rescues hyperglycemia via intra-spleen migration.

    Science.gov (United States)

    Ren, Meng; Shang, Changzhen; Zhong, Xiaomei; Guo, Ruomi; Lao, Guojuan; Wang, Xiaoyi; Cheng, Hua; Min, Jun; Yan, Li; Shen, Jun

    2014-12-23

    Implantation of embryonic stem cells (ESC)-derived insulin-producing cells has been extensively investigated for treatment of diabetes in animal models. However, the in vivo behavior and migration of transplanted cells in diabetic models remains unclear. Here we investigated the location and migration of insulin-producing cells labeled with superparamagnetic iron oxide (SPIO) using a dynamic MRI tracking method. SPIO labeled cells showed hypointense signal under the kidney subcapsules of diabetic mice on MRI, and faded gradually over the visiting time. However, new hypointense signal appeared in the spleen 1 week after transplantation, and became obvious with the time prolongation. Further histological examination proved the immigrated cells were insulin and C-peptide positive cells which were evenly distributed throughout the spleen. These intra-spleen insulin-producing cells maintained their protective effects against hyperglycemia in vivo, and these effects were reversed upon spleen removal. Transplantation of insulin-producing cells through spleen acquired an earlier blood glucose control as compared with that through kidney subcapsules. In summary, our data demonstrate that insulin-producing cells transplanted through kidney subcapsules were not located in situ but migrated into spleen, and rescues hyperglycemia in diabetic models. MRI may provide a novel tracking method for preclinical cell transplantation therapy of diabetes continuously and non-invasively.

  3. Specificity, pathogenicity, and clinical value of antiendothelial cell antibodies

    NARCIS (Netherlands)

    Belizna, C; Tervaert, JWC

    1997-01-01

    Objective: To characterize the putative target antigens for antiendothelial cell antibodies (AECA), the possible pathophysiological role of AECA, and the clinical value of these antibodies as markers of disease activity, Methods: A structured literature search was done using Medline in combination w

  4. Protein Sialylation Regulates a Gene Expression Signature that Promotes Breast Cancer Cell Pathogenicity.

    Science.gov (United States)

    Kohnz, Rebecca A; Roberts, Lindsay S; DeTomaso, David; Bideyan, Lara; Yan, Peter; Bandyopadhyay, Sourav; Goga, Andrei; Yosef, Nir; Nomura, Daniel K

    2016-08-19

    Many mechanisms have been proposed for how heightened aerobic glycolytic metabolism fuels cancer pathogenicity, but there are still many unexplored pathways. Here, we have performed metabolomic profiling to map glucose incorporation into metabolic pathways upon transformation of mammary epithelial cells by 11 commonly mutated human oncogenes. We show that transformation of mammary epithelial cells by oncogenic stimuli commonly shunts glucose-derived carbons into synthesis of sialic acid, a hexosamine pathway metabolite that is converted to CMP-sialic acid by cytidine monophosphate N-acetylneuraminic acid synthase (CMAS) as a precursor to glycoprotein and glycolipid sialylation. We show that CMAS knockdown leads to elevations in intracellular sialic acid levels, a depletion of cellular sialylation, and alterations in the expression of many cancer-relevant genes to impair breast cancer pathogenicity. Our study reveals the heretofore unrecognized role of sialic acid metabolism and protein sialylation in regulating the expression of genes that maintain breast cancer pathogenicity.

  5. A rho GDP dissociation inhibitor produced by apoptotic T-cells inhibits growth of Mycobacterium tuberculosis.

    Science.gov (United States)

    Venkatasubramanian, Sambasivan; Dhiman, Rohan; Paidipally, Padmaja; Cheekatla, Satyanarayana S; Tripathi, Deepak; Welch, Elwyn; Tvinnereim, Amy R; Jones, Brenda; Theodorescu, Dan; Barnes, Peter F; Vankayalapati, Ramakrishna

    2015-02-01

    In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI), produced by apoptotic CD4(+)CD25(+) (85% Foxp3(+)) cells is responsible for this inhibition of M. tb growth in human macrophages and in mice. M. tb-expanded CD4(+C)D25(+)Foxp3(+)D4GDI(+) cells do not produce IL-10, TGF-β and IFN-γ. D4GDI inhibited growth of M. tb in MDMs by enhancing production of IL-1β, TNF-α and ROS, and by increasing apoptosis of M. tb-infected MDMs. D4GDI was concentrated at the site of disease in tuberculosis patients, with higher levels detected in pleural fluid than in serum. However, in response to M. tb, PBMC from tuberculosis patients produced less D4GDI than PBMC from persons with LTBI. M. tb-expanded CD4+CD25+ (85% Foxp3(+)) cells and D4GDI induced intracellular M. tb to express the dormancy survival regulator DosR and DosR-dependent genes, suggesting that D4GDI induces a non-replicating state in the pathogen. Our study provides the first evidence that a subpopulation of CD4(+)CD25(+) (85% Foxp3+) cells enhances immunity to M. tb, and that production of D4GDI by this subpopulation inhibits M. tb growth.

  6. A rho GDP dissociation inhibitor produced by apoptotic T-cells inhibits growth of Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Sambasivan Venkatasubramanian

    2015-02-01

    Full Text Available In this study, we found that a subpopulation of CD4(+CD25(+ (85% Foxp3(+ cells from persons with latent tuberculosis infection (LTBI inhibits growth of M. tuberculosis (M. tb in human monocyte-derived macrophages (MDMs. A soluble factor, Rho GDP dissociation inhibitor (D4GDI, produced by apoptotic CD4(+CD25(+ (85% Foxp3(+ cells is responsible for this inhibition of M. tb growth in human macrophages and in mice. M. tb-expanded CD4(+CD25(+Foxp3(+D4GDI(+ cells do not produce IL-10, TGF-β and IFN-γ. D4GDI inhibited growth of M. tb in MDMs by enhancing production of IL-1β, TNF-α and ROS, and by increasing apoptosis of M. tb-infected MDMs. D4GDI was concentrated at the site of disease in tuberculosis patients, with higher levels detected in pleural fluid than in serum. However, in response to M. tb, PBMC from tuberculosis patients produced less D4GDI than PBMC from persons with LTBI. M. tb-expanded CD4+CD25+ (85% Foxp3(+ cells and D4GDI induced intracellular M. tb to express the dormancy survival regulator DosR and DosR-dependent genes, suggesting that D4GDI induces a non-replicating state in the pathogen. Our study provides the first evidence that a subpopulation of CD4(+CD25(+ (85% Foxp3+ cells enhances immunity to M. tb, and that production of D4GDI by this subpopulation inhibits M. tb growth.

  7. In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

    Science.gov (United States)

    Lew, Y Y; Michalak, T I

    2001-02-01

    Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

  8. Human B cells produce chemokine CXCL10 in the presence of Mycobacterium tuberculosis specific T cells

    DEFF Research Database (Denmark)

    Hoff, Soren T; Salman, Ahmed M; Ruhwald, Morten

    2015-01-01

    BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment....... A candidate for such regulation could be the chemokine CXCL10. CXCL10 is mainly produced by human monocytes, but a few reports have also found CXCL10 production by human B cells. The objective of this study was to investigate CXCL10 production by human B cells in response to in vitro stimulation with Mtb...... antigens. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed human blood samples from 30 volunteer donors using multiparameter flow cytometry, and identified a subgroup of B cells producing CXCL10 in response to in vitro stimulation with antigens. T cells did not produce CXCL10, but CXCL10 production by B cells...

  9. Differentiation of dermis-derived multipotent cells into insulin-producing pancreatic cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Chun-Meng Shi; Tian-Min Cheng

    2004-01-01

    AIM: To observe the plasticity of whether dermis-derived multipotent cells to differentiate into insulin-producing pancreatic cells in vitro.METHODS: A donal population of dermis-derived multipotent stem cells (DMCs) from newborn rat with the capacity to produce osteocytes, chondrocytes, adipocytes and neurons was used. The gene expression of cultured DMCs was assessed by DNA microarray using rat RGU34A gene expression probe arrays. DMCs were further cultured in the presence of insulin complex components (Insulintransferrin-selenium, ITS) to observe whether DMCs could be induced into insulin-producing pancreatic cells in vitro.RESULTS: DNA microarray analysis showed that cultured DMCs simultaneously expressed several genes associated with pancreatic cell, neural cell, epithelial cell and hepatocyte,widening its transcriptomic repertoire. When cultured in the specific induction medium containing ITS for pancreatic cells, DMCs differentiated into epithelioid cells that were positive for insulin detected by immunohistochemistry.CONCLUSION: Our data indicate that dermal multipotent cells may serve as a source of stem/progenitor cells for insulin-producing pancreatic cells.

  10. Microbes produce nanobacteria-like structures, avoiding cell entombment

    Science.gov (United States)

    Bontognali, Tomaso R. R.; Vasconcelos, Crisógono; Warthmann, Rolf J.; Dupraz, Christophe; Bernasconi, Stefano M.; McKenzie, Judith A.

    2008-08-01

    Microsedimentary structures referred to as nanobacteria-likeparticles were described from modern carbonate environments,where they form in close spatial association with sulfate-reducingbacteria (SRB). However, the exact mechanism of their formation,as well as their paleontological significance, remains controversial.Here we report on an investigation of microbe-mineral interactionsin experimentally produced carbonate globules. The experimentswere carried out under anoxic conditions at 30 °C with Desulfovibriobrasiliensis, a SRB known to mediate dolomite formation. Weobserved that extracellular polymeric substances (EPS) secretedby the microbial community play a key role in the mineralizationprocess. Nanobacteria-like particles represent the early stageof carbonate nucleation within the EPS, which progressivelyevolve to larger globules displaying a grainy texture. We excludedthe possibilities that these structures are fossils of nanobacteria,dissolution surfaces, or artifacts created during sample preparation.D. brasiliensis cells are predominantly located outside of theEPS aggregates where mineral growth takes place. As a result,they remain mobile and are rarely entombed within the mineral.This self-preservation behavior may not be limited to D. brasiliensis.Other microbes may produce, or may have produced during thegeological past, biogenic minerals through a similar process.Mineralization within EPS explains why microbial relics arenot necessarily present in biogenic carbonates.

  11. Interleukin 10 modulation of pathogenic Th17 cells during fatal alphavirus encephalomyelitis.

    Science.gov (United States)

    Kulcsar, Kirsten A; Baxter, Victoria K; Greene, Ivorlyne P; Griffin, Diane E

    2014-11-11

    Mosquito-borne alphaviruses are important causes of epidemic encephalomyelitis. Neuronal cell death during fatal alphavirus encephalomyelitis is immune-mediated; however, the types of cells involved and their regulation have not been determined. We show that the virus-induced inflammatory response was accompanied by production of the regulatory cytokine IL-10, and in the absence of IL-10, paralytic disease occurred earlier and mice died faster. To determine the reason for accelerated disease in the absence of IL-10, immune responses in the CNS of IL-10(-/-) and wild-type (WT) mice were compared. There were no differences in the amounts of brain inflammation or peak virus replication; however, IL-10(-/-) animals had accelerated and increased infiltration of CD4(+)IL-17A(+) and CD4(+)IL-17A(+)IFNγ(+) cells compared with WT animals. Th17 cells infiltrating the brain demonstrated a pathogenic phenotype with the expression of the transcription factor, Tbet, and the production of granzyme B, IL-22, and GM-CSF, with greater production of GM-CSF in IL-10(-/-) mice. Therefore, in fatal alphavirus encephalomyelitis, pathogenic Th17 cells enter the CNS at the onset of neurologic disease and, in the absence of IL-10, appear earlier, develop into Th1/Th17 cells more often, and have greater production of GM-CSF. This study demonstrates a role for pathogenic Th17 cells in fatal viral encephalitis.

  12. Emerging functions as host cell factors - an encyclopedia of annexin-pathogen interactions.

    Science.gov (United States)

    Kuehnl, Alexander; Musiol, Agnes; Raabe, Carsten A; Rescher, Ursula

    2016-10-01

    Emerging infectious diseases and drug-resistant infectious agents call for the development of innovative antimicrobial strategies. With pathogenicity now considered to arise from the complex and bi-directional interplay between a microbe and the host, host cell factor targeting has emerged as a promising approach that might overcome the limitations of classical antimicrobial drug development and could open up novel and efficient therapeutic strategies. Interaction with and modulation of host cell membranes is a recurrent theme in the host-microbe relationship. In this review, we provide an overview of what is currently known about the role of the Ca2+ dependent, membrane-binding annexin protein family in pathogen-host interactions, and discuss their emerging functions as host cell derived auxiliary proteins in microbe-host interactions and host cell targets.

  13. The Influence of T Cell Development on Pathogen Specificity and Autoreactivity

    Science.gov (United States)

    Košmrlj, Andrej; Kardar, Mehran; Chakraborty, Arup K.

    2012-10-01

    T cells orchestrate adaptive immune responses upon activation. T cell activation requires sufficiently strong binding of T cell receptors on their surface to short peptides derived from foreign proteins bound to protein products of the major histocompatibility (MHC) gene products, which are displayed on the surface of antigen presenting cells. T cells can also interact with peptide-MHC complexes, where the peptide is derived from host (self) proteins. A diverse repertoire of relatively self-tolerant T cell receptors is selected in the thymus. We study a model, computationally and analytically, to describe how thymic selection shapes the repertoire of T cell receptors, such that T cell receptor recognition of pathogenic peptides is both specific and degenerate. We also discuss the escape probability of autoimmune T cells from the thymus.

  14. The influence of T cell development on pathogen specificity and autoreactivity

    CERN Document Server

    Kosmrlj, Andrej; Chakraborty, Arup K

    2012-01-01

    T cells orchestrate adaptive immune responses upon activation. T cell activation requires sufficiently strong binding of T cell receptors on their surface to short peptides derived from foreign proteins bound to protein products of the major histocompatibility (MHC) gene products, which are displayed on the surface of antigen presenting cells. T cells can also interact with peptide-MHC complexes, where the peptide is derived from host (self) proteins. A diverse repertoire of relatively self-tolerant T cell receptors is selected in the thymus. We study a model, computationally and analytically, to describe how thymic selection shapes the repertoire of T cell receptors, such that T cell receptor recognition of pathogenic peptides is both specific and degenerate. We also discuss the escape probability of autoimmune T cells from the thymus.

  15. Protein Sialylation Regulates a Gene Expression Signature that Promotes Breast Cancer Cell Pathogenicity

    OpenAIRE

    Kohnz, Rebecca A.; Roberts, Lindsay S; DeTomaso, David; Bideyan, Lara; Yan, Peter; Bandyopadhyay, Sourav; Goga, Andrei; Yosef, Nir; Daniel K Nomura

    2016-01-01

    Many mechanisms have been proposed for how heightened aerobic glycolytic metabolism fuels cancer pathogenicity, but there are still many unexplored pathways. Here, we have performed metabolomic profiling to map glucose incorporation into metabolic pathways upon transformation of mammary epithelial cells by 11 commonly mutated human oncogenes. We show that transformation of mammary epithelial cells by oncogenic stimuli commonly shunts glucose-derived carbons into synthesis of sialic acid, a he...

  16. Human Beta Cells Produce and Release Serotonin to Inhibit Glucagon Secretion from Alpha Cells

    OpenAIRE

    Joana Almaça; Judith Molina; Danusa Menegaz; Pronin, Alexey N.; Alejandro Tamayo; Vladlen Slepak; Per-Olof Berggren; Alejandro Caicedo

    2016-01-01

    In the pancreatic islet, serotonin is an autocrine signal increasing beta cell mass during metabolic challenges such as those associated with pregnancy or high-fat diet. It is still unclear whether serotonin is relevant for regular islet physiology and hormone secretion. Here, we show that human beta cells produce and secrete serotonin when stimulated with increases in glucose concentration. Serotonin secretion from beta cells decreases cyclic AMP (cAMP) levels in neighboring alpha cells via ...

  17. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    Directory of Open Access Journals (Sweden)

    Kempf Volkhard AJ

    2011-04-01

    Full Text Available Abstract Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA, the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (VirB/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  18. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae.

    Science.gov (United States)

    Franz, Bettina; Kempf, Volkhard A J

    2011-04-13

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  19. Response of tomato wilt pathogen Ralstonia solanacearum to the volatile organic compounds produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9.

    Science.gov (United States)

    Raza, Waseem; Ling, Ning; Yang, Liudong; Huang, Qiwei; Shen, Qirong

    2016-04-22

    It is important to study the response of plant pathogens to the antibiosis traits of biocontrol microbes to design the efficient biocontrol strategies. In this study, we evaluated the role of volatile organic compounds (VOCs) produced by a biocontrol strain Bacillus amyloliquefaciens SQR-9 on the growth and virulence traits of tomato wilt pathogen Ralstonia solanacearum (RS). The VOCs of SQR-9 significantly inhibited the growth of RS on agar medium and in soil. In addition, the VOCs significantly inhibited the motility traits, production of antioxidant enzymes and exopolysaccharides, biofilm formation and tomato root colonization by RS. The strain SQR-9 produced 22 VOCs, but only nine VOCs showed 1-11% antibacterial activity against RS in their corresponding amounts; however, the consortium of all VOCs showed 70% growth inhibition of RS. The proteomics analysis showed that the VOCs of SQR-9 downregulated RS proteins related to the antioxidant activity, virulence, carbohydrate and amino acid metabolism, protein folding and translation, while the proteins involved in the ABC transporter system, amino acid synthesis, detoxification of aldehydes and ketones, methylation, protein translation and folding, and energy transfer were upregulated. This study describes the significance and effectiveness of VOCs produced by a biocontrol strain against tomato wilt pathogen.

  20. Altered T-cell responses by the periodontal pathogen Porphyromonas gingivalis.

    Directory of Open Access Journals (Sweden)

    Hazem Khalaf

    Full Text Available Several studies support an association between the chronic inflammatory diseases periodontitis and atherosclerosis with a crucial role for the periodontal pathogen Porphyromonas gingivalis. However, the interplay between this pathogen and the adaptive immune system, including T-cells, is sparsely investigated. Here we used Jurkat T-cells to determine the effects of P. gingivalis on T-cell-mediated adaptive immune responses. We show that viable P. gingivalis targets IL-2 expression at the protein level. Initial cellular events, including ROS production and [Ca(2+](i, were elevated in response to P. gingivalis, but AP-1 and NF-κB activity dropped below basal levels and T-cells were unable to sustain stable IL-2 accumulation. IL-2 was partially restored by Leupeptin, but not by Cathepsin B Inhibitor, indicating an involvement of Rgp proteinases in the suppression of IL-2 accumulation. This was further confirmed by purified Rgp that caused a dose-dependent decrease in IL-2 levels. These results provide new insights of how this periodontal pathogen evades the host adaptive immune system by inhibiting IL-2 accumulation and thus attenuating T-cell proliferation and cellular communication.

  1. Pathogenic CD8 T cells in Multiple Sclerosis and its experimental models

    Directory of Open Access Journals (Sweden)

    Eric S. Huseby

    2012-03-01

    Full Text Available A growing body of evidence suggests that autoreactive CD8 T cells contribute to the disease process in Multiple Sclerosis (MS. Lymphocytes in MS plaques are biased toward the CD8 lineage, and MS patients harbor CD8 T cells specific for multiple central nervous system (CNS antigens. Currently, there are relatively few experimental model systems available to study these pathogenic CD8 T cells in vivo. However, the few studies that have been done characterizing the mechanisms used by CD8 T cells to induce CNS autoimmunity indicate that several of the paradigms of how CD4 T cells mediate CNS autoimmunity do not hold true for CD8 T cells or for patients with MS. Thus, myelin-specific CD4 T cells are likely to be one of several important mechanisms that drive CNS disease in MS patients. The focus of this review is to highlight the current models of pathogenic CNS-reactive CD8 T cells and the molecular mechanisms these lymphocytes use when causing CNS inflammation and damage. Understanding how CNS-reactive CD8 T cells escape tolerance induction and induce CNS autoimmunity is critical to our ability to propose and test new therapies for MS.

  2. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    Directory of Open Access Journals (Sweden)

    Boomsma Jacobus J

    2010-12-01

    Full Text Available Abstract Background Leaf-cutting (attine ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. Results We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21% of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Conclusions Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to

  3. Candicidin-producing Streptomyces support leaf-cutting ants to protect their fungus garden against the pathogenic fungus Escovopsis

    OpenAIRE

    Haeder, Susanne; Wirth, Rainer; Herz, Hubert; Spiteller, Dieter

    2009-01-01

    Leaf-cutting ants such as Acromyrmex octospinosus live in obligate symbiosis with fungi of the genus Leucoagaricus, which they grow with harvested leaf material. The symbiotic fungi, in turn, serve as a major food source for the ants. This mutualistic relation is disturbed by the specialized pathogenic fungus Escovopsis sp., which can overcome Leucoagaricus sp. and thus destroy the ant colony. Microbial symbionts of leaf-cutting ants have been suggested to protect the fungus garden against Es...

  4. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  5. The modular nature of dendritic cell responses to commensal and pathogenic fungi.

    Directory of Open Access Journals (Sweden)

    Lisa Rizzetto

    Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

  6. Tolerance checkpoint bypass permits emergence of pathogenic T cells to neuromyelitis optica autoantigen aquaporin-4

    Science.gov (United States)

    Sagan, Sharon A.; Winger, Ryan C.; Cruz-Herranz, Andrés; Nelson, Patricia A.; Hagberg, Sarah; Miller, Corey N.; Spencer, Collin M.; Ho, Peggy P.; Bennett, Jeffrey L.; Levy, Michael; Levin, Marc H.; Verkman, Alan S.; Steinman, Lawrence; Green, Ari J.; Anderson, Mark S.; Sobel, Raymond A.; Zamvil, Scott S.

    2016-01-01

    Aquaporin-4 (AQP4)-specific T cells are expanded in neuromyelitis optica (NMO) patients and exhibit Th17 polarization. However, their pathogenic role in CNS autoimmune inflammatory disease is unclear. Although multiple AQP4 T-cell epitopes have been identified in WT C57BL/6 mice, we observed that neither immunization with those determinants nor transfer of donor T cells targeting them caused CNS autoimmune disease in recipient mice. In contrast, robust proliferation was observed following immunization of AQP4-deficient (AQP4−/−) mice with AQP4 peptide (p) 135–153 or p201–220, peptides predicted to contain I-Ab–restricted T-cell epitopes but not identified in WT mice. In comparison with WT mice, AQP4−/− mice used unique T-cell receptor repertoires for recognition of these two AQP4 epitopes. Donor T cells specific for either determinant from AQP4−/−, but not WT, mice induced paralysis in recipient WT and B-cell–deficient mice. AQP4-specific Th17-polarized cells induced more severe disease than Th1-polarized cells. Clinical signs were associated with opticospinal infiltrates of T cells and monocytes. Fluorescent-labeled donor T cells were detected in CNS lesions. Visual system involvement was evident by changes in optical coherence tomography. Fine mapping of AQP4 p201–220 and p135–153 epitopes identified peptides within p201–220 but not p135–153, which induced clinical disease in 40% of WT mice by direct immunization. Our results provide a foundation to evaluate how AQP4-specific T cells contribute to AQP4-targeted CNS autoimmunity (ATCA) and suggest that pathogenic AQP4-specific T-cell responses are normally restrained by central tolerance, which may be relevant to understanding development of AQP4-reactive T cells in NMO. PMID:27940915

  7. Interleukin 35-Producing B Cells (i35-Breg): A New Mediator of Regulatory B-Cell Functions in CNS Autoimmune Diseases.

    Science.gov (United States)

    Egwuagu, Charles E; Yu, Cheng-Rong

    2015-01-01

    Neuroinflammation contributes to neuronal deficits in neurodegenerative CNS (central nervous system) autoimmune diseases, such as multiple sclerosis and uveitis. The major goal of most treatment modalities for CNS autoimmune diseases is to limit inflammatory responses in the CNS; immune-suppressive drugs are the therapy of choice. However, lifelong immunosuppression increases the occurrence of infections, nephrotoxicity, malignancies, cataractogenesis, and glaucoma, which can greatly impair quality of life for the patient. Biologics that target pathogenic T cells is an alternative approach that is gaining wide acceptance as indicated by the popularity of a variety of Food and Drug Administration (FDA)-approved anti-inflammatory compounds and humanized antibodies such as Zenapax, Etanercept, Remicade, anti-ICAM, rapamycin, or tacrolimus. B cells are also potential therapeutic targets because they provide costimulatory signals that activate pathogenic T cells and secrete cytokines that promote autoimmune pathology. B cells also produce autoreactive antibodies implicated in several organ-specific and systemic autoimmune diseases including lupus erythematosus, Graves' disease, and Hashimoto's thyroiditis. On the other hand, recent studies have led to the discovery of several regulatory B-cell (Breg) populations that suppress immune responses and autoimmune diseases. In this review, we present a brief overview of Breg phenotypes and in particular, the newly discovered IL35-producing regulatory B cell (i35-Breg). We discuss the critical roles played by i35-Bregs in regulating autoimmune diseases and the potential use of adoptive Breg therapy in CNS autoimmune diseases.

  8. Insulin-producing cells generated from dedifferentiated human pancreatic beta cells expanded in vitro.

    Directory of Open Access Journals (Sweden)

    Holger A Russ

    Full Text Available BACKGROUND: Expansion of beta cells from the limited number of adult human islet donors is an attractive prospect for increasing cell availability for cell therapy of diabetes. However, attempts at expanding human islet cells in tissue culture result in loss of beta-cell phenotype. Using a lineage-tracing approach we provided evidence for massive proliferation of beta-cell-derived (BCD cells within these cultures. Expansion involves dedifferentiation resembling epithelial-mesenchymal transition (EMT. Epigenetic analyses indicate that key beta-cell genes maintain open chromatin structure in expanded BCD cells, although they are not transcribed. Here we investigated whether BCD cells can be redifferentiated into beta-like cells. METHODOLOGY/PRINCIPAL FINDING: Redifferentiation conditions were screened by following activation of an insulin-DsRed2 reporter gene. Redifferentiated cells were characterized for gene expression, insulin content and secretion assays, and presence of secretory vesicles by electron microscopy. BCD cells were induced to redifferentiate by a combination of soluble factors. The redifferentiated cells expressed beta-cell genes, stored insulin in typical secretory vesicles, and released it in response to glucose. The redifferentiation process involved mesenchymal-epithelial transition, as judged by changes in gene expression. Moreover, inhibition of the EMT effector SLUG (SNAI2 using shRNA resulted in stimulation of redifferentiation. Lineage-traced cells also gave rise at a low rate to cells expressing other islet hormones, suggesting transition of BCD cells through an islet progenitor-like stage during redifferentiation. CONCLUSIONS/SIGNIFICANCE: These findings demonstrate for the first time that expanded dedifferentiated beta cells can be induced to redifferentiate in culture. The findings suggest that ex-vivo expansion of adult human islet cells is a promising approach for generation of insulin-producing cells for

  9. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    KAUST Repository

    Alsalah, Dhafer

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  10. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce.

    Science.gov (United States)

    Alsalah, Dhafer; Al-Jassim, Nada; Timraz, Kenda; Hong, Pei-Ying

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10(-4). However, the annual risk arising from P. aeruginosa was 9.55 × 10(-4), slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  11. Plantaricin A, a peptide pheromone produced by Lactobacillus plantarum, permeabilizes the cell membrane of both normal and cancerous lymphocytes and neuronal cells.

    Science.gov (United States)

    Sand, Sverre L; Oppegård, Camilla; Ohara, Shinya; Iijima, Toshio; Naderi, Soheil; Blomhoff, Heidi K; Nissen-Meyer, Jon; Sand, Olav

    2010-07-01

    Antimicrobial peptides produced by multicellular organisms protect against pathogenic microorganisms, whereas such peptides produced by bacteria provide an ecological advantage over competitors. Certain antimicrobial peptides of metazoan origin are also toxic to eukaryotic cells, with preference for a variety of cancerous cells. Plantaricin A (PlnA) is a peptide pheromone with membrane permeabilizing strain-specific antibacterial activity, produced by Lactobacillus plantarum C11. Recently, we have reported that PlnA also permeabilizes cancerous rat pituitary cells (GH(4) cells), whereas normal rat anterior pituitary cells are resistant. To investigate if preferential effect on cancerous cells is a general feature of PlnA, we have studied effects of the peptide on normal and cancerous lymphocytes and neuronal cells. Normal human B and T cells, Reh cells (from human B cell leukemia), and Jurkat cells (from human T cell leukemia) were studied by flow cytometry to detect morphological changes (scatter) and viability (propidium iodide uptake), and by patch clamp recordings to monitor membrane conductance. Ca(2+) imaging based on a combination of fluo-4 and fura-red was used to monitor PlnA-induced membrane permeabilization in normal rat cortical neurons and glial cells, PC12 cells (from a rat adrenal chromaffin tumor), and murine N2A cells (from a spinal cord tumor). All the tested cell types were affected by 10-100 microM PlnA, whereas concentrations below 10 microM had no significant effect. We conclude that normal and cancerous lymphocytes and neuronal cells show similar sensitivity to PlnA.

  12. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  13. AM3 modulates dendritic cell pathogen recognition capabilities by targeting DC-SIGN.

    Science.gov (United States)

    Serrano-Gómez, Diego; Martínez-Nuñez, Rocío T; Sierra-Filardi, Elena; Izquierdo, Nuria; Colmenares, María; Pla, Jesús; Rivas, Luis; Martinez-Picado, Javier; Jimenez-Barbero, Jesús; Alonso-Lebrero, José Luis; González, Salvador; Corbí, Angel L

    2007-07-01

    AM3 (Inmunoferon) is an orally effective immunomodulator that influences the regulatory and effector functions of the immune system whose molecular mechanisms of action are mostly unknown. We hypothesized that the polysaccharide moiety of AM3 (IF-S) might affect immune responses by modulating the lectin-dependent pathogen recognition abilities of human dendritic cells. IF-S inhibited binding of viral, fungal, and parasite pathogens by human monocyte-derived dendritic cells in a dose-dependent manner. IF-S specifically impaired the pathogen recognition capabilities of DC-SIGN, as it reduced the attachment of Candida, Aspergillus, and Leishmania to DC-SIGN transfectants. IF-S also inhibited the interaction of DC-SIGN with both its cellular counterreceptor (intercellular adhesion molecule 3) and the human immunodeficiency virus (HIV) type 1 gp120 protein and blocked the DC-SIGN-dependent capture of HIV virions and the HIV trans-infection capability of DC-SIGN transfectants. IF-S promoted DC-SIGN internalization in DCs without affecting mannose receptor expression, and (1)D saturation transfer difference nuclear magnetic resonance demonstrated that IF-S directly interacts with DC-SIGN on the cell surface. Therefore, the polysaccharide moiety of AM3 directly influences pathogen recognition by dendritic cells by interacting with DC-SIGN. Our results indicate that DC-SIGN is the target for an immunomodulator and imply that the adjuvant and immunomodulatory actions of AM3 are mediated, at least in part, by alteration of the DC-SIGN functional activities.

  14. A temperature-responsive network links cell shape and virulence traits in a primary fungal pathogen.

    Directory of Open Access Journals (Sweden)

    Sinem Beyhan

    2013-07-01

    Full Text Available Survival at host temperature is a critical trait for pathogenic microbes of humans. Thermally dimorphic fungal pathogens, including Histoplasma capsulatum, are soil fungi that undergo dramatic changes in cell shape and virulence gene expression in response to host temperature. How these organisms link changes in temperature to both morphologic development and expression of virulence traits is unknown. Here we elucidate a temperature-responsive transcriptional network in H. capsulatum, which switches from a filamentous form in the environment to a pathogenic yeast form at body temperature. The circuit is driven by three highly conserved factors, Ryp1, Ryp2, and Ryp3, that are required for yeast-phase growth at 37°C. Ryp factors belong to distinct families of proteins that control developmental transitions in fungi: Ryp1 is a member of the WOPR family of transcription factors, and Ryp2 and Ryp3 are both members of the Velvet family of proteins whose molecular function is unknown. Here we provide the first evidence that these WOPR and Velvet proteins interact, and that Velvet proteins associate with DNA to drive gene expression. Using genome-wide chromatin immunoprecipitation studies, we determine that Ryp1, Ryp2, and Ryp3 associate with a large common set of genomic loci that includes known virulence genes, indicating that the Ryp factors directly control genes required for pathogenicity in addition to their role in regulating cell morphology. We further dissect the Ryp regulatory circuit by determining that a fourth transcription factor, which we name Ryp4, is required for yeast-phase growth and gene expression, associates with DNA, and displays interdependent regulation with Ryp1, Ryp2, and Ryp3. Finally, we define cis-acting motifs that recruit the Ryp factors to their interwoven network of temperature-responsive target genes. Taken together, our results reveal a positive feedback circuit that directs a broad transcriptional switch between

  15. Carbon metabolism of enterobacterial human pathogens growing in epithelial colorectal adenocarcinoma (Caco-2 cells.

    Directory of Open Access Journals (Sweden)

    Andreas Götz

    Full Text Available Analysis of the genome sequences of the major human bacterial pathogens has provided a large amount of information concerning their metabolic potential. However, our knowledge of the actual metabolic pathways and metabolite fluxes occurring in these pathogens under infection conditions is still limited. In this study, we analysed the intracellular carbon metabolism of enteroinvasive Escherichia coli (EIEC HN280 and EIEC 4608-58 and Salmonella enterica Serovar Typhimurium (Stm 14028 replicating in epithelial colorectal adenocarcinoma cells (Caco-2. To this aim, we supplied [U-(13C(6]glucose to Caco-2 cells infected with the bacterial strains or mutants thereof impaired in the uptake of glucose, mannose and/or glucose 6-phosphate. The (13C-isotopologue patterns of protein-derived amino acids from the bacteria and the host cells were then determined by mass spectrometry. The data showed that EIEC HN280 growing in the cytosol of the host cells, as well as Stm 14028 replicating in the Salmonella-containing vacuole (SCV utilised glucose, but not glucose 6-phosphate, other phosphorylated carbohydrates, gluconate or fatty acids as major carbon substrates. EIEC 4608-58 used C(3-compound(s in addition to glucose as carbon source. The labelling patterns reflected strain-dependent carbon flux via glycolysis and/or the Entner-Doudoroff pathway, the pentose phosphate pathway, the TCA cycle and anapleurotic reactions between PEP and oxaloacetate. Mutants of all three strains impaired in the uptake of glucose switched to C(3-substrate(s accompanied by an increased uptake of amino acids (and possibly also other anabolic monomers from the host cell. Surprisingly, the metabolism of the host cells, as judged by the efficiency of (13C-incorporation into host cell amino acids, was not significantly affected by the infection with either of these intracellular pathogens.

  16. Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

    Science.gov (United States)

    Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

    2014-11-01

    The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

  17. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  18. Memory CD4+ T cells are required for optimal NK cell effector functions against the opportunistic fungal pathogen Pneumocystis murina.

    Science.gov (United States)

    Kelly, Michelle N; Zheng, Mingquan; Ruan, Sanbao; Kolls, Jay; D'Souza, Alain; Shellito, Judd E

    2013-01-01

    Little is known about the role of NK cells or their interplay with other immune cells during opportunistic infections. Using our murine model of Pneumocystis pneumonia, we found that loss of NK cells during immunosuppression results in substantial Pneumocystis lung burden. During early infection of C57B/6 CD4(+) T cell-depleted mice, there were significantly fewer NK cells in the lung tissue compared with CD4(+) T cell-intact animals, and the NK cells present demonstrated decreased upregulation of the activation marker NKp46 and production of the effector cytokine, IFN-γ. Furthermore, coincubation studies revealed a significant increase in fungal killing when NK cells were combined with CD4(+) T cells compared with either cell alone, which was coincident with a significant increase in perforin production by NK cells. Finally, however, we found through adoptive transfer that memory CD4(+) T cells are required for significant NK cell upregulation of the activation marker NK group 2D and production of IFN-γ, granzyme B, and perforin during Pneumocystis infection. To the best of our knowledge, this study is the first to demonstrate a role for NK cells in immunity to Pneumocystis pneumonia, as well as to establish a functional relationship between CD4(+) T cells and NK cells in the host response to an opportunistic fungal pathogen.

  19. Lights, camera and action: vertebrate skin sets the stage for immune cell interaction with arthropod-vectored pathogens

    Directory of Open Access Journals (Sweden)

    Shu Zhen eChong

    2013-09-01

    Full Text Available Despite increasing studies targeted at host-pathogen interactions, vector-borne diseases remain one of the largest economic health burdens worldwide. Such diseases are vectored by hematophagous arthropods that deposit pathogens into the vertebrate host’s skin during a blood meal. These pathogens spend a substantial amount of time in the skin that allows for interaction with cutaneous immune cells, suggesting a window of opportunity for development of vaccine strategies. In particular, the recent availability of intravital imaging approaches has provided further insights into immune cell behavior in living tissues. Here, we discuss how such intravital imaging studies have contributed to our knowledge of cutaneous immune cell behavior and specifically, towards pathogen and tissue trauma from the arthropod bite. We also suggest future imaging approaches that may aid in better understanding of the complex interplay between arthropod-vectored pathogens and cutaneous immunity that could lead to improved therapeutic strategies.

  20. Mouse endometrial stromal cells produce basement-membrane components

    DEFF Research Database (Denmark)

    Wewer, U M; Damjanov, A; Weiss, J;

    1986-01-01

    During mouse pregnancy, uterine stromal cells transform into morphologically distinct decidual cells under the influence of the implanting embryo and a proper hormonal environment. Mechanical stimulation of hormonally primed uterine stromal cells leads to the same morphologic alterations. The dec...

  1. The properties of lectins and cells surface biopolymers of non-pathogenic corynebacteria

    Directory of Open Access Journals (Sweden)

    Sashschuk E. V.

    2011-02-01

    Full Text Available Aim. To study lectin properties of non-pathogenic corynebacteria cells and preparations of their surface biopolymers (SBP, extracted by SDS. Methods. SBP were extracted from intact cells by 0.15 M solution of NaCl contains 1 % SDS. Protein content was determined using Lowry method, carbohydrates – with anthrone method. Electrophoresis was performed in SDS-PAGE according to Lemmli. Hemagglutinating activity (HAA was studied using rabbit erythrocytes. The lectin carbohydrate specificity was determined by reaction of inhibition of hemagglutination. Results. Electrophoretic set of SBP preparations contained the proteins and carbohydrates biopolymers with molecular mass of 10.0–120.0 kDa which did not possess HAA. After extraction of SBP the corynebacteria cells remained viable and have HAA higher than intact cells (64–2048 units. The hemagglutinins of the majority of corynebacteria strains after treatment of cells with SDS exhibited the highest affinity to the bovine submandibular gland mucin and N-acetylneuraminic acid. Conclusions. The examined non-pathogenic strains of corynebacteria were found to contain the lectins, associated with internal layers of a cell wall, which showed a predominant specificity to sialic acids.

  2. Chenopodolin: a phytotoxic unrearranged ent-pimaradiene diterpene produced by Phoma chenopodicola, a fungal pathogen for Chenopodium album biocontrol.

    Science.gov (United States)

    Cimmino, Alessio; Andolfi, Anna; Zonno, Maria C; Avolio, Fabiana; Santini, Antonello; Tuzi, Angela; Berestetskyi, Alexander; Vurro, Maurizio; Evidente, Antonio

    2013-07-26

    A new phytotoxic unrearranged ent-pimaradiene diterpene, named chenopodolin, was isolated from the liquid culture of Phoma chenopodicola, a fungal pathogen proposed for the biological control of Chenopodium album, a common worldwide weed of arable crops such as sugar beet and maize. The structure of chenopodolin was established by spectroscopic, X-ray, and chemical methods as (1S,2S,3S,4S,5S,9R,10S,12S,13S)-1,12-acetoxy-2,3-hydroxy-6-oxopimara-7(8),15-dien-18-oic acid 2,18-lactone. At a concentration of 2 mg/mL, the toxin caused necrotic lesions on Mercurialis annua, Cirsium arvense, and Setaria viride. Five derivatives were prepared by chemical modification of chenopodolin functionalities, and some structure-activity relationships are discussed.

  3. Diplopyrone, a new phytotoxic tetrahydropyranpyran-2-one produced by Diplodia mutila, a fungus pathogen of cork oak.

    Science.gov (United States)

    Evidente, Antonio; Maddau, Lucia; Spanu, Emanuela; Franceschini, Antonio; Lazzaroni, Silvia; Motta, Andrea

    2003-02-01

    A new phytotoxic monosubstituted tetrahydropyranpyran-2-one, named diplopyrone (1), was isolated from the liquid culture filtrates of Diplodia mutila, a plant pathogenic fungus causing a form of canker disease of cork oak (Quercus suber). Diplopyrone was characterized, using spectroscopic and chemical methods, as 6-[(1S)-1-hydroxyethyl]-2,4a,6,8a-tetrahydropyran[3,2-b]pyran-2-one. The absolute stereochemistry of the chiral secondary hydroxylated carbon (C-9), determined by application of Mosher's method, proved to be S. Diplopyrone assayed at a 0.01-0.1 mg/mL concentration range caused necrosis and wilting on cork oak cuttings. On a nonhost plant, tomato, diplopyrone caused brown discoloration or stewing on the stem.

  4. Adhesion to the yeast cell surface as a mechanism for trapping pathogenic bacteria by Saccharomyces probiotics.

    Science.gov (United States)

    Tiago, F C P; Martins, F S; Souza, E L S; Pimenta, P F P; Araujo, H R C; Castro, I M; Brandão, R L; Nicoli, Jacques R

    2012-09-01

    Recently, much attention has been given to the use of probiotics as an adjuvant for the prevention or treatment of gastrointestinal pathology. The great advantage of therapy with probiotics is that they have few side effects such as selection of resistant bacteria or disturbance of the intestinal microbiota, which occur when antibiotics are used. Adhesion of pathogenic bacteria onto the surface of probiotics instead of onto intestinal receptors could explain part of the probiotic effect. Thus, this study evaluated the adhesion of pathogenic bacteria onto the cell wall of Saccharomyces boulardii and Saccharomyces cerevisiae strains UFMG 905, W303 and BY4741. To understand the mechanism of adhesion of pathogens to yeast, cell-wall mutants of the parental strain of Saccharomyces cerevisiae BY4741 were used because of the difficulty of mutating polyploid yeast, as is the case for Saccharomyces cerevisiae and Saccharomyces boulardii. The tests of adhesion showed that, among 11 enteropathogenic bacteria tested, only Escherichia coli, Salmonella Typhimurium and Salmonella Typhi adhered to the surface of Saccharomyces boulardii, Saccharomyces cerevisiae UFMG 905 and Saccharomyces cerevisiae BY4741. The presence of mannose, and to some extent bile salts, inhibited this adhesion, which was not dependent on yeast viability. Among 44 cell-wall mutants of Saccharomyces cerevisiae BY4741, five lost the ability to fix the bacteria. Electron microscopy showed that the phenomenon of yeast-bacteria adhesion occurred both in vitro and in vivo (in the digestive tract of dixenic mice). In conclusion, some pathogenic bacteria were captured on the surface of Saccharomyces boulardii, Saccharomyces cerevisiae UFMG 905 and Saccharomyces cerevisiae BY4741, thus preventing their adhesion to specific receptors on the intestinal epithelium and their subsequent invasion of the host.

  5. Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells

    Directory of Open Access Journals (Sweden)

    Szu-Hsiu Liu

    2012-01-01

    Full Text Available Embryonic stem (ES cells are a potential source of a variety of differentiated cells for cell therapy, drug discovery, and toxicology screening. Here, we present an efficacy strategy for the differentiation of mouse ES cells into insulin-producing cells (IPCs by a two-step differentiation protocol comprising of (i the formation of definitive endoderm in monolayer culture by activin A, and (ii this monolayer endoderm being induced to differentiate into IPCs by nicotinamide, insulin, and laminin. Differentiated cells can be obtained within approximately 7 days. The differentiation IPCs combined application of RT-PCR, ELISA, and immunofluorescence to characterize phenotypic and functional properties. In our study, we demonstrated that IPCs produced pancreatic transcription factors, endocrine progenitor marker, definitive endoderm, pancreatic β-cell markers, and Langerhans α and δ cells. The IPCs released insulin in a manner that was dose dependent upon the amount of glucose added. These techniques may be able to be applied to human ES cells, which would have very important ramifications for treating human disease.

  6. T cell memory. Skin-resident memory CD8⁺ T cells trigger a state of tissue-wide pathogen alert.

    Science.gov (United States)

    Ariotti, Silvia; Hogenbirk, Marc A; Dijkgraaf, Feline E; Visser, Lindy L; Hoekstra, Mirjam E; Song, Ji-Ying; Jacobs, Heinz; Haanen, John B; Schumacher, Ton N

    2014-10-03

    After an infection, pathogen-specific tissue-resident memory T cells (T(RM) cells) persist in nonlymphoid tissues to provide rapid control upon reinfection, and vaccination strategies that create T(RM) cell pools at sites of pathogen entry are therefore attractive. However, it is not well understood how T(RM) cells provide such pathogen protection. Here, we demonstrate that activated T(RM) cells in mouse skin profoundly alter the local tissue environment by inducing a number of broadly active antiviral and antibacterial genes. This "pathogen alert" allows skin T(RM) cells to protect against an antigenically unrelated virus. These data describe a mechanism by which tissue-resident memory CD8(+) T cells protect previously infected sites that is rapid, amplifies the activation of a small number of cells into an organ-wide response, and has the capacity to control escape variants.

  7. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells.

    Science.gov (United States)

    Rezania, Alireza; Bruin, Jennifer E; Arora, Payal; Rubin, Allison; Batushansky, Irina; Asadi, Ali; O'Dwyer, Shannon; Quiskamp, Nina; Mojibian, Majid; Albrecht, Tobias; Yang, Yu Hsuan Carol; Johnson, James D; Kieffer, Timothy J

    2014-11-01

    Transplantation of pancreatic progenitors or insulin-secreting cells derived from human embryonic stem cells (hESCs) has been proposed as a therapy for diabetes. We describe a seven-stage protocol that efficiently converts hESCs into insulin-producing cells. Stage (S) 7 cells expressed key markers of mature pancreatic beta cells, including MAFA, and displayed glucose-stimulated insulin secretion similar to that of human islets during static incubations in vitro. Additional characterization using single-cell imaging and dynamic glucose stimulation assays revealed similarities but also notable differences between S7 insulin-secreting cells and primary human beta cells. Nevertheless, S7 cells rapidly reversed diabetes in mice within 40 days, roughly four times faster than pancreatic progenitors. Therefore, although S7 cells are not fully equivalent to mature beta cells, their capacity for glucose-responsive insulin secretion and rapid reversal of diabetes in vivo makes them a promising alternative to pancreatic progenitor cells or cadaveric islets for the treatment of diabetes.

  8. Fibroblastic reticular cells from lymph nodes attenuate T cell expansion by producing nitric oxide.

    Directory of Open Access Journals (Sweden)

    Stefanie Siegert

    Full Text Available Adaptive immune responses are initiated when T cells encounter antigen on dendritic cells (DC in T zones of secondary lymphoid organs. T zones contain a 3-dimensional scaffold of fibroblastic reticular cells (FRC but currently it is unclear how FRC influence T cell activation. Here we report that FRC lines and ex vivo FRC inhibit T cell proliferation but not differentiation. FRC share this feature with fibroblasts from non-lymphoid tissues as well as mesenchymal stromal cells. We identified FRC as strong source of nitric oxide (NO thereby directly dampening T cell expansion as well as reducing the T cell priming capacity of DC. The expression of inducible nitric oxide synthase (iNOS was up-regulated in a subset of FRC by both DC-signals as well as interferon-γ produced by primed CD8+ T cells. Importantly, iNOS expression was induced during viral infection in vivo in both LN FRC and DC. As a consequence, the primary T cell response was found to be exaggerated in Inos(-/- mice. Our findings highlight that in addition to their established positive roles in T cell responses FRC and DC cooperate in a negative feedback loop to attenuate T cell expansion during acute inflammation.

  9. CD103+ Conventional Dendritic Cells Are Critical for TLR7/9-Dependent Host Defense against Histoplasma capsulatum, an Endemic Fungal Pathogen of Humans.

    Directory of Open Access Journals (Sweden)

    Nancy Van Prooyen

    2016-07-01

    Full Text Available Innate immune cells shape the host response to microbial pathogens. Here we elucidate critical differences in the molecular response of macrophages vs. dendritic cells (DCs to Histoplasma capsulatum, an intracellular fungal pathogen of humans. It has long been known that macrophages are permissive for Histoplasma growth and succumb to infection, whereas DCs restrict fungal growth and survive infection. We used murine macrophages and DCs to identify host pathways that influence fungal proliferation and host-cell viability. Transcriptional profiling experiments revealed that DCs produced a strong Type I interferon (IFN-I response to infection with Histoplasma yeasts. Toll-like receptors 7 and 9 (TLR7/9, which recognize nucleic acids, were required for IFN-I production and restriction of fungal growth in DCs, but mutation of TLR7/9 had no effect on the outcome of macrophage infection. Moreover, TLR7/9 were essential for the ability of infected DCs to elicit production of the critical cytokine IFNγ from primed CD4+ T cells in vitro, indicating the role of this pathway in T cell activation. In a mouse model of infection, TLR7/9 were required for optimal production of IFN-I and IFNγ, host survival, and restriction of cerebral fungal burden. These data demonstrate the critical role of this pathway in eliciting an appropriate adaptive immune response in the host. Finally, although other fungal pathogens have been shown to elicit IFN-I in mouse models, the specific host cell responsible for producing IFN-I has not been elucidated. We found that CD103+ conventional DCs were the major producer of IFN-I in the lungs of wild-type mice infected with Histoplasma. Mice deficient in this DC subtype displayed reduced IFN-I production in vivo. These data reveal a previously unknown role for CD103+ conventional DCs and uncover the pivotal function of these cells in modulating the host immune response to endemic fungi.

  10. Induction of autoantibody-producing cells after the coculture of haptenated and normal human mononuclear leukocytes.

    Science.gov (United States)

    Pisko, E J; Foster, S L; Turner, R A

    1981-10-01

    The coculture of normal human peripheral blood mononuclear leukocytes (PBL) and autologous mononuclear leukocytes coupled to the trinitrophenyl (TNP) hapten (TNP-PBL) was found to induce a polyclonal activation of antibody-producing cells. The polyclonal activation of antibody-producing cells was demonstrated by detecting the induction of cells producing antibody to sheep red blood cells using a complement-dependent, direct, hemolytic plaque-forming cell (PFC) assay. A ratio of four normal to one haptenated mononuclear leukocyte was found to be optimal for inducing the polyclonal activation of antibody-producing cell in these cultures. The plaque-forming cells assay in these experiments utilized monolayers of indicator red cells. Further evidence for the polyclonal induction of antibody-producing cells by TNP-PBL was provided by demonstrating PFC on monolayers of not only sheep red blood cells, but also autologous human red cells, bromelain-treated autologous red cells, TNP-coupled human and sheep red cells, and human autologous red cells coupled to human heat-aggregated IgG with chromic chloride. Thus cells secreting antibody to TNP, human red cells, and human IgG were induced. Anti-IgG and anti-human red cell-producing cells were first detected on Day 2 of culture and were still present on Day 9. Mononuclear leukocytes altered by chemical haptenation polyclonally stimulate normal mononuclear leukocytes to become antibody-producing cells. This polyclonal stimulation of antibody-producing cells includes cells producing antibodies to human IgG and human autologous red blood cells suggesting that autoantibody-producing cells are induced.

  11. Analysis of the cell surface layer ultrastructure of the oral pathogen Tannerella forsythia.

    Science.gov (United States)

    Sekot, Gerhard; Posch, Gerald; Oh, Yoo Jin; Zayni, Sonja; Mayer, Harald F; Pum, Dietmar; Messner, Paul; Hinterdorfer, Peter; Schäffer, Christina

    2012-06-01

    The Gram-negative oral pathogen Tannerella forsythia is decorated with a 2D crystalline surface (S-) layer, with two different S-layer glycoprotein species being present. Prompted by the predicted virulence potential of the S-layer, this study focused on the analysis of the arrangement of the individual S-layer glycoproteins by a combination of microscopic, genetic, and biochemical analyses. The two S-layer genes are transcribed into mRNA and expressed into protein in equal amounts. The S-layer was investigated on intact bacterial cells by transmission electron microscopy, by immune fluorescence microscopy, and by atomic force microscopy. The analyses of wild-type cells revealed a distinct square S-layer lattice with an overall lattice constant of 10.1 ± 0.7 nm. In contrast, a blurred lattice with a lattice constant of 9.0 nm was found on S-layer single-mutant cells. This together with in vitro self-assembly studies using purified (glyco)protein species indicated their increased structural flexibility after self-assembly and/or impaired self-assembly capability. In conjunction with TEM analyses of thin-sectioned cells, this study demonstrates the unusual case that two S-layer glycoproteins are co-assembled into a single S-layer. Additionally, flagella and pilus-like structures were observed on T. forsythia cells, which might impact the pathogenicity of this bacterium.

  12. Pathogen-Associated Molecular Patterns Induced Crosstalk between Dendritic Cells, T Helper Cells, and Natural Killer Helper Cells Can Improve Dendritic Cell Vaccination.

    Science.gov (United States)

    Oth, Tammy; Vanderlocht, Joris; Van Elssen, Catharina H M J; Bos, Gerard M J; Germeraad, Wilfred T V

    2016-01-01

    A coordinated cellular interplay is of crucial importance in both host defense against pathogens and malignantly transformed cells. The various interactions of Dendritic Cells (DC), Natural Killer (NK) cells, and T helper (Th) cells can be influenced by a variety of pathogen-associated molecular patterns (PAMPs) and will lead to enhanced CD8(+) effector T cell responses. Specific Pattern Recognition Receptor (PRR) triggering during maturation enables DC to enhance Th1 as well as NK helper cell responses. This effect is correlated with the amount of IL-12p70 released by DC. Activated NK cells are able to amplify the proinflammatory cytokine profile of DC via the release of IFN-γ. The knowledge on how PAMP recognition can modulate the DC is of importance for the design and definition of appropriate therapeutic cancer vaccines. In this review we will discuss the potential role of specific PAMP-matured DC in optimizing therapeutic DC-based vaccines, as some of these DC are efficiently activating Th1, NK cells, and cytotoxic T cells. Moreover, to optimize these vaccines, also the inhibitory effects of tumor-derived suppressive factors, for example, on the NK-DC crosstalk, should be taken into account. Finally, the suppressive role of the tumor microenvironment in vaccination efficacy and some proposals to overcome this by using combination therapies will be described.

  13. Pathogenic Fungi Regulate Immunity by Inducing Neutrophilic Myeloid-Derived Suppressor Cells

    Science.gov (United States)

    Rieber, Nikolaus; Singh, Anurag; Öz, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N.; Weber, Alexander N.R.; Handgretinger, Rupert; Krappmann, Sven; Liese, Johannes; Engeholm, Maik; Schüle, Rebecca; Salih, Helmut Rainer; Marodi, Laszlo; Speckmann, Carsten; Grimbacher, Bodo; Ruland, Jürgen; Brown, Gordon D.; Beilhack, Andreas; Loeffler, Juergen; Hartl, Dominik

    2015-01-01

    Summary Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically, pathogenic fungi induce neutrophilic MDSCs through the pattern recognition receptor Dectin-1 and its downstream adaptor protein CARD9. Fungal MDSC induction is further dependent on pathways downstream of Dectin-1 signaling, notably reactive oxygen species (ROS) generation as well as caspase-8 activity and interleukin-1 (IL-1) production. Additionally, exogenous IL-1β induces MDSCs to comparable levels observed during C. albicans infection. Adoptive transfer and survival experiments show that MDSCs are protective during invasive C. albicans infection, but not A. fumigatus infection. These studies define an innate immune mechanism by which pathogenic fungi regulate host defense. PMID:25771792

  14. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2015-01-01

    Mucosal-associated invariant T (MAIT) cells express a semi-invariant T cell receptor (TCR) that detects microbial metabolites presented by the nonpolymorphic major histocompatibility complex (MHC)-like molecule MR1. The highly conserved nature of MR1 in conjunction with biased MAIT TCRα chain usage...... is widely thought to indicate limited ligand presentation and discrimination within a pattern-like recognition system. Here, we evaluated the TCR repertoire of MAIT cells responsive to three classes of microbes. Substantial diversity and heterogeneity were apparent across the functional MAIT cell repertoire...... with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

  15. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2014-01-01

    Mucosal-associated invariant T (MAIT) cells express a semi-invariant T cell receptor (TCR) that detects microbial metabolites presented by the nonpolymorphic major histocompatibility complex (MHC)-like molecule MR1. The highly conserved nature of MR1 in conjunction with biased MAIT TCRα chain usage...... is widely thought to indicate limited ligand presentation and discrimination within a pattern-like recognition system. Here, we evaluated the TCR repertoire of MAIT cells responsive to three classes of microbes. Substantial diversity and heterogeneity were apparent across the functional MAIT cell repertoire...... with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

  16. Human Liver Cells Expressing Albumin and Mesenchymal Characteristics Give Rise to Insulin-Producing Cells

    Directory of Open Access Journals (Sweden)

    Irit Meivar-Levy

    2011-01-01

    Full Text Available Activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients. Transcription factors-induced liver-to-pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro. However, human-derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized. It is yet unknown whether hepatic-like stem cells or rather adult liver cells give rise to insulin-producing cells. Using an in vitro experimental system, we demonstrate that proliferating adherent human liver cells acquire mesenchymal-like characteristics and a considerable level of cellular plasticity. However, using a lineage-tracing approach, we demonstrate that insulin-producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers. Taken together, our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity, which could be exploited in regenerative medicine approaches.

  17. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

    2010-07-09

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  18. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage.

    Science.gov (United States)

    Gold, Marielle C; McLaren, James E; Reistetter, Joseph A; Smyk-Pearson, Sue; Ladell, Kristin; Swarbrick, Gwendolyn M; Yu, Yik Y L; Hansen, Ted H; Lund, Ole; Nielsen, Morten; Gerritsen, Bram; Kesmir, Can; Miles, John J; Lewinsohn, Deborah A; Price, David A; Lewinsohn, David M

    2014-07-28

    Mucosal-associated invariant T (MAIT) cells express a semi-invariant T cell receptor (TCR) that detects microbial metabolites presented by the nonpolymorphic major histocompatibility complex (MHC)-like molecule MR1. The highly conserved nature of MR1 in conjunction with biased MAIT TCRα chain usage is widely thought to indicate limited ligand presentation and discrimination within a pattern-like recognition system. Here, we evaluated the TCR repertoire of MAIT cells responsive to three classes of microbes. Substantial diversity and heterogeneity were apparent across the functional MAIT cell repertoire as a whole, especially for TCRβ chain sequences. Moreover, different pathogen-specific responses were characterized by distinct TCR usage, both between and within individuals, suggesting that MAIT cell adaptation was a direct consequence of exposure to various exogenous MR1-restricted epitopes. In line with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped by microbial exposure.

  19. Human Epithelial Cells Discriminate between Commensal and Pathogenic Interactions with Candida albicans.

    Science.gov (United States)

    Rast, Timothy J; Kullas, Amy L; Southern, Peter J; Davis, Dana A

    2016-01-01

    The commensal fungus, Candida albicans, can cause life-threatening infections in at risk individuals. C. albicans colonizes mucosal surfaces of most people, adhering to and interacting with epithelial cells. At low concentrations, C. albicans is not pathogenic nor does it cause epithelial cell damage in vitro; at high concentrations, C. albicans causes mucosal infections and kills epithelial cells in vitro. Here we show that while there are quantitative dose-dependent differences in exposed epithelial cell populations, these reflect a fundamental qualitative difference in host cell response to C. albicans. Using transcriptional profiling experiments and real time PCR, we found that wild-type C. albicans induce dose-dependent responses from a FaDu epithelial cell line. However, real time PCR and Western blot analysis using a high dose of various C. albicans strains demonstrated that these dose-dependent responses are associated with ability to promote host cell damage. Our studies support the idea that epithelial cells play a key role in the immune system by monitoring the microbial community at mucosal surfaces and initiating defensive responses when this community is dysfunctional. This places epithelial cells at a pivotal position in the interaction with C. albicans as epithelial cells themselves promote C. albicans stimulated damage.

  20. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Donghui Zhang; Wei Jiang; Meng Liu; Xin Sui; Xiaolei Yin; Song Chen; Yan Shi; Hongkui Deng

    2009-01-01

    Human pluripotent stem cells represent a potentially unlimited source of functional pancreatic endocrine lineage cells. Here we report a highly efficient approach to induce human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells to differentiate into mature insulin-producing cells in a chemical-defined culture system. The differentiated human ES cells obtained by this approach comprised nearly 25% insulin-positive cells as assayed by flow cytometry analysis, which released insulin/C-peptide in response to glucose stimuli in a manner comparable to that of adult human islets. Most of these insulin-producing cells co-expressed mature β cell-specific markers such as NKX6-1 and PDX1, indicating a similar gene expression pattern to adult islet β cells in vivo. In this study, we also demonstrated that EGF facilitates the expansion of PDX1-positive pancreatic progenitors. Moreover, our protocol also succeeded in efficiently inducing human iPS cells to differentiate into insulin-producing cells. Therefore, this work not only provides a new model to study the mechanism of human pancreatic specialization and maturation in vitro, but also enhances the possibility of utilizing patient-specific iPS cells for the treatment of diabetes.

  1. Relationship of blood and milk cell counts with mastitic pathogens in Murrah buffaloes

    Directory of Open Access Journals (Sweden)

    C. Singh

    2010-02-01

    Full Text Available The present study was undertaken to see the effect of mastitic pathogens on the blood and milk counts of Murrah buffaloes. Milk and blood samples were collected from 9 mastitic Murrah buffaloes. The total leucocyte Counts (TLC and Differential leucocyte counts (DLC in blood were within normal range and there was a non-significant change in blood counts irrespective of different mastitic pathogens. Normal milk quarter samples had significantly (P<0.01 less Somatic cell counts (SCC. Lymphocytes were significantly higher in normal milk samples, whereas infected samples had a significant increase (P<0.01 in milk neutrophils. S. aureus infected buffaloes had maximum milk SCC, followed by E. coli and S. agalactiae. Influx of neutrophils in the buffalo mammary gland was maximum for S. agalactiae, followed by E.cli and S. aureus. The study indicated that level of mastitis had no affect on blood counts but it influenced the milk SCC of normal quarters.

  2. Secondary Lymphoid Organ Homing Phenotype of Human Myeloid Dendritic Cells Disrupted by an Intracellular Oral Pathogen

    Science.gov (United States)

    Miles, Brodie; Zakhary, Ibrahim; El-Awady, Ahmed; Scisci, Elizabeth; Carrion, Julio; O'Neill, John C.; Rawlings, Aaron; Stern, J. Kobi; Susin, Cristiano

    2014-01-01

    Several intracellular pathogens, including a key etiological agent of chronic periodontitis, Porphyromonas gingivalis, infect blood myeloid dendritic cells (mDCs). This infection results in pathogen dissemination to distant inflammatory sites (i.e., pathogen trafficking). The alteration in chemokine-chemokine receptor expression that contributes to this pathogen trafficking function, particularly toward sites of neovascularization in humans, is unclear. To investigate this, we utilized human monocyte-derived DCs (MoDCs) and primary endothelial cells in vitro, combined with ex vivo-isolated blood mDCs and serum from chronic periodontitis subjects and healthy controls. Our results, using conditional fimbria mutants of P. gingivalis, show that P. gingivalis infection of MoDCs induces an angiogenic migratory profile. This profile is enhanced by expression of DC-SIGN on MoDCs and minor mfa-1 fimbriae on P. gingivalis and is evidenced by robust upregulation of CXCR4, but not secondary lymphoid organ (SLO)-homing CCR7. This disruption of SLO-homing capacity in response to respective chemokines closely matches surface expression of CXCR4 and CCR7 and is consistent with directed MoDC migration through an endothelial monolayer. Ex vivo-isolated mDCs from the blood of chronic periodontitis subjects, but not healthy controls, expressed a similar migratory profile; moreover, sera from chronic periodontitis subjects expressed elevated levels of CXCL12. Overall, we conclude that P. gingivalis actively “commandeers” DCs by reprogramming the chemokine receptor profile, thus disrupting SLO homing, while driving migration toward inflammatory vascular sites. PMID:24126519

  3. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  4. Cloning, characterization and anion inhibition study of a β-class carbonic anhydrase from the caries producing pathogen Streptococcus mutans.

    Science.gov (United States)

    Dedeoglu, Nurcan; De Luca, Viviana; Isik, Semra; Yildirim, Hatice; Kockar, Feray; Capasso, Clemente; Supuran, Claudiu T

    2015-07-01

    The oral pathogenic bacterium involved in human dental caries formation Streptococcus mutans, encodes for two carbonic anhydrase (CA, EC 4.2.1.1) one belonging to the α- and the other one to the β-class. This last enzyme (SmuCA) has been cloned, characterized and investigated for its inhibition profile with a major class of CA inhibitors, the inorganic anions. Here we show that SmuCA has a good catalytic activity for the CO2 hydration reaction, with kcat 4.2×10(5)s(-1) and kcat/Km of 5.8×10(7)M(-1)×s(-1), being inhibited by cyanate, carbonate, stannate, divannadate and diethyldithiocarbamate in the submillimolar range (KIs of 0.30-0.64mM) and more efficiently by sulfamide, sulfamate, phenylboronic acid and phenylarsonic acid (KIs of 15-46μM). The anion inhibition profile of the S. mutans enzyme is very different from other α- and β-CAs investigated earlier. Identification of effective inhibitors of this new enzyme may lead to pharmacological tools useful for understanding the role of S. mutans CAs in dental caries formation, and eventually the development of pharmacological agents with a new mechanism of antibacterial action.

  5. Urease genes in non-O157 Shiga toxin-producing Escherichia coli : mostly silent but valuable markers for pathogenicity

    NARCIS (Netherlands)

    Friedrich, A W; Lukas, R; Mellmann, A; Köck, R; Zhang, W; Mathys, W; Bielaszewska, M; Karch, H

    2006-01-01

    The distribution of ureC was investigated among 294 Escherichia coli isolates, comprising 72 strains from the E. coli standard reference collection (ECOR), 62 strains from the diarrhoeagenic E. coli (DEC) collection, and 160 clinical isolates of Shiga toxin-producing E. coli (STEC). The ureC gene wa

  6. Fusarium praegraminearum sp. nov. is a novel nivalenol mycotoxin-producing head blight pathogen from New Zealand

    Science.gov (United States)

    We report on the molecular and morphological characterization of a novel B-type trichothecene toxin-producing species (i.e., B clade) recovered from litter in a maize field near Wellington, New Zealand, which is described as Fusarium praegraminearum sp. nov. This species was initially identified as ...

  7. Probiotic Properties of Lactobacillus crispatus 2,029: Homeostatic Interaction with Cervicovaginal Epithelial Cells and Antagonistic Activity to Genitourinary Pathogens.

    Science.gov (United States)

    Abramov, Vyacheslav; Khlebnikov, Valentin; Kosarev, Igor; Bairamova, Guldana; Vasilenko, Raisa; Suzina, Natalia; Machulin, Andrey; Sakulin, Vadim; Kulikova, Natalia; Vasilenko, Nadezhda; Karlyshev, Andrey; Uversky, Vladimir; Chikindas, Michael L; Melnikov, Vyacheslav

    2014-12-01

    Lactobacillus crispatus 2029 isolated upon investigation of vaginal lactobacilli of healthy women of reproductive age was selected as a probiotic candidate. The aim of the present study was elucidation of the role of L. crispatus 2029 in resistance of the female reproductive tract to genitourinary pathogens using cervicovaginal epithelial model. Lactobacillus crispatus 2029 has surface layers (S-layers), which completely surround cells as the outermost component of their envelope. S-layers are responsible for the adhesion of lactobacilli on the surface of cervicovaginal epithelial cells. Study of interactions between L. crispatus 2029 and a type IV collagen, a major molecular component of epithelial cell extracellular matrix, showed that 125I-labeled type IV collagen binds to lactobacilli with high affinity (Kd = (8.0 ± 0.7) × 10(-10) M). Lactobacillus crispatus 2029 consistently colonized epithelial cells. There were no toxicity, epithelial damage and apoptosis after 24 h of colonization. Electronic microscope images demonstrated intimate association between L. crispatus 2029 and epithelial cells. Upon binding to epithelial cells, lactobacilli were recognized by toll-like 2/6 receptors. Lactobacillus crispatus induced NF-κB activation in epithelial cells and did not induce expression of innate immunity mediators IL-8, IL-1β, IL-1α and TNF-α. Lactobacillus crispatus 2029 inhibited IL-8 production in epithelial cells induced by MALP-2 and increased production of anti-inflammatory cytokine IL-6, maintaining the homeostasis of female reproductive tract. Lactobacillus crispatus 2029 produced H2O2 and provided wide spectrum of antagonistic activity increasing colonization resistance to urinary tract infections by bacterial vaginosis and vulvovaginal candidiasis associated agents.

  8. [Construction of cDNA infectious clones of EV71 highly-pathogenic and cell-culture-adapted strains].

    Science.gov (United States)

    Zhang, Yong-xin; Li, Xiao-yu; Huang, Yu-ming; Zhou, Yong-dong; Bi, Sheng-li; Cen, Shan

    2014-11-01

    The highly-pathogenic EV71 strain is the primary cause of mortality in hand-foot-and-mouth disease (HFMD) associated with neurological symptoms, for which no clinically effective drugs or vaccines exist. This study aimed to construct infectious cDNA clones of the EV71 highly-pathogenic strain and the cell-culture adapted strain using a reverse genetics approach. The genomic RNAs of EV71 parent strains were used as the templates for RT-PCR amplification, and then the PCR products that overlapped the full-length genome were connected into the pBR322 vector to produce infectious clones of pEV71 (HP) and pEV71 (CCA), respectively. The results showed that the HP strain propagated much more quickly than the CCA strain. The rescued viruses derived from the infectious clones not only maintained their consistency with their parent strains in terms of genomic sequences, but also retained their respective biological phenotypes. This research will contribute to our understanding of EV71 pathogenesis and the development of novel vaccines against HFMD.

  9. Osteogenic Cells Derived From Embryonic Stem Cells Produced Bone Nodules in Three-Dimensional Scaffolds

    Directory of Open Access Journals (Sweden)

    Chaudhry G. R.

    2004-01-01

    Full Text Available An approach for 3D bone tissue generation from embryonic stem (ES cells was investigated. The ES cells were induced to differentiate into osteogenic precursors, capable of proliferating and subsequently differentiating into bone-forming cells. The differentiated cells and the seeded scaffolds were characterized using von Kossa and Alizarin Red staining, electron microscopy, and RT-PCR analysis. The results demonstrated that ES-derived bone-forming cells attached to and colonized the biocompatible and biodegradable scaffolds. Furthermore, these cells produced bone nodules when grown for 3–4 weeks in mineralization medium containing ascorbic acid and beta-glycerophosphate both in tissue culture plates and in scaffolds. The differentiated cells also expressed osteospecific markers when grown both in the culture plates and in 3D scaffolds. Osteogenic cells expressed alkaline phosphatase, osteocalcin, and osteopontin, but not an ES cell-specific marker, oct-4. These findings suggest that ES cell can be used for in vitro tissue engineering and cultivation of graftable skeletal structures.

  10. Imbalance between IL-17A-Producing Cells and Regulatory T Cells during Ischemic Stroke

    Directory of Open Access Journals (Sweden)

    Yuehua Hu

    2014-01-01

    Full Text Available Immune responses and inflammation are key elements in the pathogenesis of ischemic stroke (IS. Although the involvement of IL-17A in IS has been demonstrated using animal models, the involvement of IL-17A and IL-17-secreting T cell subsets in IS patients has not been verified, and whether the balance of Treg/IL-17-secreting T cells is altered in IS patients remains unknown. In the present study, we demonstrated that the proportion of peripheral Tregs and the levels of IL-10 and TGF-β were reduced in patients with IS compared with controls using flow cytometry (FCM, real-time PCR, and ELISA assays. However, the proportions of Th17 and γδ T cells, the primary IL-17A-secreting cells, increased dramatically, and these effects were accompanied by increases in the levels of IL-17A, IL-23, IL-6, and IL-1β in IS patients. These studies suggest that the increase in IL-17A-producing cells and decrease in Treg cells might contribute to the pathogenesis of IS. Manipulating the balance between Tregs and IL-17A-producing cells might be helpful for the treatment of IS.

  11. Probiotics-pathogen interactions elicit differential regulation of cutaneous immune responses in epidermal cells of Atlantic cod Gadus morhua.

    Science.gov (United States)

    Lazado, Carlo C; Caipang, Christopher Marlowe A

    2014-01-01

    Little is known on the cutaneous immune responses during probiotics-pathogen interactions in fish. Thus, this study employed Atlantic cod primary epidermal (EP) cell cultures as a model to understand this interaction. The probiotics-pathogen interactions in the EP cell cultures were elucidated using Vibrio anguillarum 2133 (VA) as the pathogen and two host-derived bacteria (GP21 and GP12) as the probiotics. There was a regional size difference on the EP cells; i.e., EP cells from the dorsal region were significantly larger than the EP cells at the ventral side. VA significantly decreased viability of EP cells. In the presence of probiotics, this inhibition was mitigated. The probiotics reduced VA-induced cellular apoptosis and the probiotics-pathogen interactions influenced cellular myeloperoxidase activity during the latter stage of co-incubation. The probiotics-pathogen interactions triggered differential regulation of immune-related genes and the effects of the interaction were dependent on the region where the cells were isolated and the length of the co-incubation period. In most cases, the presence of probiotics alone showed no significant change on the mRNA level of immune genes in the EP cells but triggered immunostimulatory activity when incubated with VA. This study showed that the virulence of VA in EP cells could be modulated by host-derived probiotics and the immunomodulatory characteristics of the two candidate probionts advanced their immune-related probiotic potential.

  12. Multipotent stem cells isolated from the adult mouse retina are capable of producing functional photoreceptor cells.

    Science.gov (United States)

    Li, Tianqing; Lewallen, Michelle; Chen, Shuyi; Yu, Wei; Zhang, Nian; Xie, Ting

    2013-06-01

    Various stem cell types have been tested for their potential application in treating photoreceptor degenerative diseases, such as retinitis pigmentosa (RP) and age-related macular degeneration (AMD). Only embryonic stem cells (ESCs) have so far been shown to generate functional photoreceptor cells restoring light response of photoreceptor-deficient mice, but there is still some concern of tumor formation. In this study, we have successfully cultured Nestin(+)Sox2(+)Pax6(+) multipotent retinal stem cells (RSCs) from the adult mouse retina, which are capable of producing functional photoreceptor cells that restore the light response of photoreceptor-deficient rd1 mutant mice following transplantation. After they have been expanded for over 35 passages in the presence of FGF and EGF, the cultured RSCs still maintain stable proliferation and differentiation potential. Under proper differentiation conditions, they can differentiate into all the major retinal cell types found in the adult retina. More importantly, they can efficiently differentiate into photoreceptor cells under optimized differentiation conditions. Following transplantation into the subretinal space of slowly degenerating rd7 mutant eyes, RSC-derived photoreceptor cells integrate into the retina, morphologically resembling endogenous photoreceptors and forming synapases with resident retinal neurons. When transplanted into eyes of photoreceptor-deficient rd1 mutant mice, a RP model, RSC-derived photoreceptors can partially restore light response, indicating that those RSC-derived photoreceptors are functional. Finally, there is no evidence for tumor formation in the photoreceptor-transplanted eyes. Therefore, this study has demonstrated that RSCs isolated from the adult retina have the potential of producing functional photoreceptor cells that can potentially restore lost vision caused by loss of photoreceptor cells in RP and AMD.

  13. Multipotent stem cells isolated from the adult mouse retina are capable of producing functional photoreceptor cells

    Institute of Scientific and Technical Information of China (English)

    Tianqing Li; Michelle Lewallen; Shuyi Chen; Wei Yu; Nian Zhang; Ting Xie

    2013-01-01

    Various stem cell types have been tested for their potential application in treating photoreceptor degenerative diseases,such as retinitis pigmentosa (RP) and age-related macular degeneration (AMD).Only embryonic stem cells (ESCs) have so far been shown to generate functional photoreceptor cells restoring light response of photoreceptordeficient mice,but there is still some concern of tumor formation.In this study,we have successfully cultured Nestin+Sox2+Pax6+ multipotent retinal stem cells (RSCs) from the adult mouse retina,which are capable of producing functional photoreceptor cells that restore the light response of photoreceptor-deficient rd1 mutant mice following transplantation.After they have been expanded for over 35 passages in the presence of FGF and EGF,the cultured RSCs still maintain stable proliferation and differentiation potential.Under proper differentiation conditions,they can differentiate into all the major retinal cell types found in the adult retina.More importantly,they can efficiently differentiate into photoreceptor cells under optimized differentiation conditions.Following transplantation into the subretinal space of slowly degenerating rd7 mutant eyes,RSC-derived photoreceptor cells integrate into the retina,morphologically resembling endogenous photoreceptors and forming synapases with resident retinal neurons.When transplanted into eyes of photoreceptor-deficient rd1 mutant mice,a RP model,RSC-derived photoreceptors can partially restore light response,indicating that those RSC-derived photoreceptors are functional.Finally,there is no evidence for tumor formation in the photoreceptor-transplanted eyes.Therefore,this study has demonstrated that RSCs isolated from the adult retina have the potential of producing functional photoreceptor cells that can potentially restore lost vision caused by loss of photoreceptor cells in RP and AMD.

  14. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

    Directory of Open Access Journals (Sweden)

    Nudelman Irina

    2010-10-01

    Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

  15. Expression of Factor X in BHK-21 Cells Promotes Low Pathogenic Influenza Viruses Replication

    Directory of Open Access Journals (Sweden)

    Shahla Shahsavandi

    2015-01-01

    Full Text Available A cDNA clone for factor 10 (FX isolated from chicken embryo inserted into the mammalian cell expression vector pCDNA3.1 was transfected into the baby hamster kidney (BHK-21 cell line. The generated BHK-21 cells with inducible expression of FX were used to investigate the efficacy of the serine transmembrane protease to proteolytic activation of influenza virus hemagglutinin (HA with monobasic cleavage site. Data showed that the BHK-21/FX stably expressed FX after ten serial passages. The cells could proteolytically cleave the HA of low pathogenic avian influenza virus at multiplicity of infection 0.01. Growth kinetics of the virus on BHK-21/FX, BHK-21, and MDCK cells were evaluated by titrations of virus particles in each culture supernatant. Efficient multicycle viral replication was markedly detected in the cell at subsequent passages. Virus titration demonstrated that BHK-21/FX cell supported high-titer growth of the virus in which the viral titer is comparable to the virus grown in BHK-21 or MDCK cells with TPCK-trypsin. The results indicate potential application for the BHK-21/FX in influenza virus replication procedure and related studies.

  16. Cytokine-producing T cell subsets in human leishmaniasis

    DEFF Research Database (Denmark)

    Kemp, Kåre

    2000-01-01

    Leishmania specific Th1/Th2 cells have been identified in humans as well as in mice. There is a correlation between the clinical outcome of the infection and the cytokine response profile. Generally, the production of Th2 cytokines leads to severe infection, whereas the production of Th1 cytokine...... cells mutually down-regulate each other. However, the presence of antigen specific regulatory T cell subsets may provide an environment that allows the presence of both Th1 and Th2 cells....

  17. Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital

    Directory of Open Access Journals (Sweden)

    J B Sarma

    2011-01-01

    Full Text Available Purpose: A study was carried out in an Indian teaching hospital in 2009 to detect the rate of surgical site infections (SSI and peripheral vascular access site infections. Materials and Methods: The study was a point-prevalence study involving over 300 patients. The presence of infection was determined according to the CDC criteria. Swabs were taken from the infected sites and identification and sensitivity were carried out using VITEK® 2 automated system. Characterisation of β-lactamase was carried out at ARRML, Colindale, London. Results: The rate of SSI was 15% for the clean and clean-contaminated categories while that for the dirty contaminated category was 85% (NNIS risk index 0. Cultures yielded definite or probable pathogens from 64% (9/14 of the patients with SSI. In 1/3 rd of the cultures, Staphylococcus aureus was grown and the rest had Enterobacteriaceae, either extended-spectrum β-lactamase (ESBL producers or Amp-C hyperproducers and, alarmingly, three isolates were positive for newly recognised New Delhi metallo-β-lactamase-1 (NDM-1. In medicine, 87% (n = 99 of the patients had a peripheral IV access device, 55% developed associated phlebitis/infection and, in seven, probable pathogens were isolated (Candida species and Escherichia coli producing ESBL and NDM-1, respectively, Staphylococcus aureus and Enterococcus faecium. All ESBL and metallo-β-lactamase producers were resistant to multiple classes of antimicrobials, the latter being sensitive only to colistin and tigecycline. The study also found that all post-operative patients were on antibiotics, 92% on IV [213 defined daily doses (DDD/100 post-op patients] limited mainly to the third-generation cephalosporins (26% and aminoglycosides (24% and imidazole derivatives (30%. In medicine, 83% (n = 82 were on IV antibiotics (123 DDD/100 bed-days, limited mainly to the third-generation cephalosporins (74%. Conclusion: Indiscriminate use of antibiotics is a major problem

  18. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Nathan T Reem

    2016-05-01

    Full Text Available The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity and function remains unclear. Modifications of cell wall composition can induce plant responses known as Cell Wall Integrity control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, increased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant cell wall integrity, which contributes to plant resistance to necrotrophic pathogens.

  19. Islet Brain 1 Protects Insulin Producing Cells against Lipotoxicity.

    Science.gov (United States)

    Brajkovic, Saška; Ferdaoussi, Mourad; Pawlowski, Valérie; Ezanno, Hélène; Plaisance, Valérie; Zmuda, Erik; Hai, Tsonwin; Annicotte, Jean-Sébastien; Waeber, Gérard; Abderrahmani, Amar

    2016-01-01

    Chronic intake of saturated free fatty acids is associated with diabetes and may contribute to the impairment of functional beta cell mass. Mitogen activated protein kinase 8 interacting protein 1 also called islet brain 1 (IB1) is a candidate gene for diabetes that is required for beta cell survival and glucose-induced insulin secretion (GSIS). In this study we investigated whether IB1 expression is required for preserving beta cell survival and function in response to palmitate. Chronic exposure of MIN6 and isolated rat islets cells to palmitate led to reduction of the IB1 mRNA and protein content. Diminution of IB1 mRNA and protein level relied on the inducible cAMP early repressor activity and proteasome-mediated degradation, respectively. Suppression of IB1 level mimicked the harmful effects of palmitate on the beta cell survival and GSIS. Conversely, ectopic expression of IB1 counteracted the deleterious effects of palmitate on the beta cell survival and insulin secretion. These findings highlight the importance in preserving the IB1 content for protecting beta cell against lipotoxicity in diabetes.

  20. Probing host pathogen cross-talk by transcriptional profiling of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages.

    Directory of Open Access Journals (Sweden)

    Ludovic Tailleux

    Full Text Available BACKGROUND: Transcriptional profiling using microarrays provides a unique opportunity to decipher host pathogen cross-talk on the global level. Here, for the first time, we have been able to investigate gene expression changes in both Mycobacterium tuberculosis, a major human pathogen, and its human host cells, macrophages and dendritic cells. METHODOLOGY/PRINCIPAL FINDINGS: In addition to common responses, we could identify eukaryotic and microbial transcriptional signatures that are specific to the cell type involved in the infection process. In particular M. tuberculosis shows a marked stress response when inside dendritic cells, which is in accordance with the low permissivity of these specialized phagocytes to the tubercle bacillus and to other pathogens. In contrast, the mycobacterial transcriptome inside macrophages reflects that of replicating bacteria. On the host cell side, differential responses to infection in macrophages and dendritic cells were identified in genes involved in oxidative stress, intracellular vesicle trafficking and phagosome acidification. CONCLUSIONS/SIGNIFICANCE: This study provides the proof of principle that probing the host and the microbe transcriptomes simultaneously is a valuable means to accessing unique information on host pathogen interactions. Our results also underline the extraordinary plasticity of host cell and pathogen responses to infection, and provide a solid framework to further understand the complex mechanisms involved in immunity to M. tuberculosis and in mycobacterial adaptation to different intracellular environments.

  1. Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads.

    Science.gov (United States)

    Beyer, Marco; Pogoda, Friederike; Pallez, Marine; Lazic, Joëlle; Hoffmann, Lucien; Pasquali, Matias

    2014-07-16

    Fusarium species are fungal plant pathogens producing toxic secondary metabolites such as deoxynivalenol (DON), 15-acetyl-deoxynivalenol (15AcDON) and nivalenol (NIV). In Luxembourg, the Fusarium species composition isolated from symptomatic winter wheat heads was dominated by Fusarium graminearum sensu stricto strains (genetic 15AcDON chemotype) between the years 2009 and 2012, except for 2011, when Fusarium culmorum strains (genetic NIV chemotype) dominated the pathogen complex. Previous reports indicated that F. graminearum sensu stricto (genetic 15AcDON chemotype) was also most frequently isolated from randomly sampled winter wheat kernels including symptomatic as well as asymptomatic kernels in 2007 and 2008. The annual precipitation (average of 10 weather stations scattered across the country) decreased continuously from 924.31mm in 2007 over 917.15mm in 2008, to 843.38mm in 2009, 736.24mm in 2010, and 575.09mm in 2011. In 2012, the annual precipitation increased again to 854.70mm. Hardly any precipitation was recorded around the time of wheat anthesis in the years 2010 and 2011, whereas precipitation levels >50mm within the week preceding anthesis plus the week post anthesis were observed in the other years. The shift to genetic NIV chemotype F. culmorum strains in 2011 was accompanied by a very minor elevation of average NIV contents (2.9ngg(-1)) in the grain. Our data suggest that high NIV levels in Luxembourgish winter wheat are at present rather unlikely, because the indigenous F. culmorum strains with the genetic NIV chemotype seem to be outcompeted under humid in vivo conditions by F. graminearum DON producing strains on the one hand and seem to be inhibited - even though to a lower extent than DON producing strains - under dry in vivo conditions on the other hand.

  2. An atypical CD8 T-cell response to Chlamydia muridarum genital tract infections includes T cells that produce interleukin-13.

    Science.gov (United States)

    Johnson, Raymond M; Kerr, Micah S; Slaven, James E

    2014-06-01

    Chlamydia trachomatis urogenital serovars D-K are intracellular bacterial pathogens that replicate almost exclusively in human reproductive tract epithelium. In the C. muridarum mouse model for human Chlamydia genital tract infections CD4 T helper type 1 cell responses mediate protective immunity while CD8 T-cell responses have been associated with scarring and infertility. Scarring mediated by CD8 T cells requires production of tumour necrosis factor-α (TNF-α); however, TNF-α is associated with protective immunity mediated by CD4 T cells. The latter result suggests that TNF-α in-and-of itself may not be the sole determining factor in immunopathology. CD8 T cells mediating immunopathology presumably do something in addition to producing TNF-α that is detrimental during resolution of genital tract infections. To investigate the mechanism underlying CD8 immunopathology we attempted to isolate Chlamydia-specific CD8 T-cell clones from mice that self-cleared genital tract infections. They could not be derived with antigen-pulsed irradiated naive splenocytes; instead derivation required use of irradiated immune splenocyte antigen-presenting cells. The Chlamydia-specific CD8 T-cell clones had relatively low cell surface CD8 levels and the majority were not restricted by MHC class Ia molecules. They did not express Plac8, and had varying abilities to terminate Chlamydia replication in epithelial cells. Two of the five CD8 clones produced interleukin-13 (IL-13) in addition to IL-2, TNF-α, IL-10 and interferon-γ. IL-13-producing Chlamydia-specific CD8 T cells may contribute to immunopathology during C. muridarum genital tract infections based on known roles of TNF-α and IL-13 in scar formation.

  3. Cloned calves produced by nuclear transfer from cultured cumulus cells

    Institute of Scientific and Technical Information of China (English)

    AN; Xiaorong(安晓荣); GOU; Kemian(苟克勉); ZHU; Shien(朱士恩); GUAN; Hong(关宏); HOU; Jian(侯健); LIN; Aixing(林爱星); ZENG; Shenming(曾申明); TIAN; Jianhui(田见辉); CHEN; Yongfu(陈永福)

    2002-01-01

    Short-term cultured cumulus cell lines (1-5BCC) derived from 5 individual cows were used in nuclear transfer (NT) and 1188 enucleated bovine oocytes matured in vitro were used as nuclear recipients. A total of 931 (78.4%) cloned embryos were reconstructed, of which 763 (82%) cleaved, 627 (67.3%) developed to 8-cell stage, and 275 (29.5%) reached blastocyst stage. The average cell number of blastocysts was 124±24.5 (n=20). In this study, the effects of donor cell sources, serum starvation of donor cells, time interval from fusion to activation (IFA) were also tested on cloning efficiency. These results showed that blastocyst rates of embryos reconstructed from 5 different individuals cells were significantly different among them (14.1%, 45.2%, 27.3%, 34.3%, vs 1.5%, P0.05); and that blastocyst rate (20.3%) of the group with fusion/activation interval of 2-3 h, was significantly lower than that of the 3-6 h groups (31.0%), while not significantly different among 3-4 h (P < 0.05), 4-5 h, and 5-6 h groups (P ≥ 0.05). Sixty-three thawed NT blastocysts were transferred to 31 recipient cows, of which 4 pregnancies were established and two cloned calves were given birth. These results indicate that serum starvation of cumulus cells is not a key factor for successful bovine cloning, while IFA treatment and sources of donor cells have effects on cloning efficiency.

  4. Producing fully ES cell-derived mice from eight-cell stage embryo injections.

    Science.gov (United States)

    DeChiara, Thomas M; Poueymirou, William T; Auerbach, Wojtek; Frendewey, David; Yancopoulos, George D; Valenzuela, David M

    2010-01-01

    In conventional methods for the generation of genetically modified mice, gene-targeted embryonic stem (ES) cells are injected into blastocyst-stage embryos or are aggregated with morula-stage embryos, which are then transferred to the uterus of a surrogate mother. F0 generation mice born from the embryos are chimeras composed of genetic contributions from both the modified ES cells and the recipient embryos. Obtaining a mouse strain that carries the gene-targeted mutation requires breeding the chimeras to transmit the ES cell genetic component through the germ line to the next (F1) generation (germ line transmission, GLT). To skip the chimera stage, we developed the VelociMouse method, in which injection of genetically modified ES cells into eight-cell embryos followed by maturation to the blastocyst stage and transfer to a surrogate mother produces F0 generation mice that are fully derived from the injected ES cells and exhibit a 100% GLT efficiency. The method is simple and flexible. Both male and female ES cells can be introduced into the eight-cell embryo by any method of injection or aggregation and using all ES cell and host embryo combinations from inbred, hybrid, and outbred genetic backgrounds. The VelociMouse method provides several unique opportunities for shortening project timelines and reducing mouse husbandry costs. First, as VelociMice exhibit 100% GLT, there is no need to test cross chimeras to establish GLT. Second, because the VelociMouse method permits efficient production of ES cell-derived mice from female ES cells, XO ES cell subclones, identified by screening for spontaneous loss of the Y chromosome, can be used to generate F0 females that can be bred with isogenic F0 males derived from the original targeted ES cell clone to obtain homozygous mutant mice in the F1 generation. Third, as VelociMice are genetically identical to the ES cells from which they were derived, the VelociMouse method opens up myriad possibilities for creating mice with

  5. VIGOR OF PLANTLET FROM MICROPLANTLET TREATED BY FILTRATE AND CELL SUSPENSION OF SOME ISOLATES OF BACILLUS AND RESISTANCE TO BANANA WILT PATHOGEN AFTER ACCLIMATIZATION

    Directory of Open Access Journals (Sweden)

    Hadi wiyono

    2013-08-01

    Full Text Available Blood Disease Bacterium (BDB and Fusarium oxysporum f.sp. cubense (FOC is a couple wilt pathogen  of  banana.  These pathogens are the most important constraint in cultivation of banana in Indonesia.  In the integrated control strategy of the disease, the use of healthy seedlings produced from tissue culture technique is recommended.  The seedling produced by tissue culture technique however leads to lower vigor and susceptibility to the disease due to the aseptic work in vitro causing the beneficial bacterial endophytic to be eliminated. Therefore, the utility of the beneficial endophytic bacteria should be studied for recovering the vigor and resistance of the seedling.     Three isolates of endophytic Bacillus (B04, B05, B10 have been effective as growth promoter of microplantlet and antagonist of BDB and FOC in vitro.   Here then, this article reports the study results of the vigor of the plantlet (treated microplantlet by filtrate or cell suspension of the Bacillus after 3 months in acclimatization. The results were similar to the previous results on microplantlet in vitro, that Bacillus isolates B04, B05, and B10 were capable of promoting the growth and inducing the resistance to wilt pathogens on banana plantlets.  The treatments with bacterial cell inoculums were more effective than those bacterial filtrate. Isolate B10 was most potential followed by B05 and B04 respectively.

  6. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae.

  7. PDX1-engineered embryonic stem cell-derived insulin producing cells regulate hyperglycemia in diabetic mice

    Directory of Open Access Journals (Sweden)

    Raikwar Sudhanshu P

    2012-10-01

    Full Text Available Abstract Background Type 1 diabetes can be treated by the transplantation of cadaveric whole pancreata or isolated pancreatic islets. However, this form of treatment is hampered by the chronic shortage of cadaveric donors. Embryonic stem (ES cell-derived insulin producing cells (IPCs offer a potentially novel source of unlimited cells for transplantation to treat type 1 and possibly type 2 diabetes. However, thus far, the lack of a reliable protocol for efficient differentiation of ES cells into IPCs has hindered the clinical exploitation of these cells. Methods To efficiently generate IPCs using ES cells, we have developed a double transgenic ES cell line R1Pdx1AcGFP/RIP-Luc that constitutively expresses pancreatic β-cell-specific transcription factor pancreatic and duodenal homeobox gene 1 (Pdx1 as well as rat insulin promoter (RIP driven luciferase reporter. We have established several protocols for the reproducible differentiation of ES cells into IPCs. The differentiation of ES cells into IPCs was monitored by immunostaining as well as real-time quantitative RT-PCR for pancreatic β-cell-specific markers. Pancreatic β-cell specific RIP became transcriptionally active following the differentiation of ES cells into IPCs and induced the expression of the luciferase reporter. Glucose stimulated insulin secretion by the ES cell-derived IPCs was measured by ELISA. Further, we have investigated the therapeutic efficacy of ES cell-derived IPCs to correct hyperglycemia in syngeneic streptozotocin (STZ-treated diabetic mice. The long term fate of the transplanted IPCs co-expressing luciferase in syngeneic STZ-induced diabetic mice was monitored by real time noninvasive in vivo bioluminescence imaging (BLI. Results We have recently demonstrated that spontaneous in vivo differentiation of R1Pdx1AcGFP/RIP-Luc ES cell-derived pancreatic endoderm-like cells (PELCs into IPCs corrects hyperglycemia in diabetic mice. Here, we investigated whether R1Pdx1Ac

  8. Lutein, a Natural Carotenoid, Induces α-1,3-Glucan Accumulation on the Cell Wall Surface of Fungal Plant Pathogens

    Directory of Open Access Journals (Sweden)

    Junnosuke Otaka

    2016-07-01

    Full Text Available α-1,3-Glucan, a component of the fungal cell wall, is a refractory polysaccharide for most plants. Previously, we showed that various fungal plant pathogens masked their cell wall surfaces with α-1,3-glucan to evade plant immunity. This surface accumulation of α-1,3-glucan was infection specific, suggesting that plant factors might induce its production in fungi. Through immunofluorescence observations of fungal cell walls, we found that carrot (Daucus carota extract induced the accumulation of α-1,3-glucan on germlings in Colletotrichum fioriniae, a polyphagous fungal pathogen that causes anthracnose disease in various dicot plants. Bioassay-guided fractionation of carrot leaf extract successfully identified two active substances that caused α-1,3-glucan accumulation in this fungus: lutein, a carotenoid widely distributed in plants, and stigmasterol, a plant-specific membrane component. Lutein, which had a greater effect on C. fioriniae, also induced α-1,3-glucan accumulation in other Colletotrichum species and in the phylogenetically distant rice pathogen Cochliobolus miyabeanus, but not in the rice pathogen Magnaporthe oryzae belonging to the same phylogenetic subclass as Colletotrichum. Our results suggested that fungal plant pathogens reorganize their cell wall components in response to specific plant-derived compounds, which these pathogens may encounter during infection.

  9. TNFα Promotes Th17 Cell Differentiation through IL-6 and IL-1β Produced by Monocytes in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Yingxia Zheng

    2014-01-01

    Full Text Available TNFα plays an important role in autoimmune pathogenesis and is the main therapeutic target of rheumatoid arthritis. However, its underlying mechanism is not completely understood. In this study, we described that Th17 cells were accumulated in synovial fluid, which was attributable to TNFα aberrantly produced in rheumatoid synovium. Interestingly, TNFα cannot induce IL-17 production of CD4+ T cells directly, but through the monocytes high levels of IL-1β and IL-6 in a TNFRI and TNFRII dependent manner from the active RA patients are produced. TNFα was shown to enhance the phosphorylation level of STAT3 and the expression level of transcription factor RORC of CD4+ T cells when cultured with CD14+ monocytes. Treatment with an approved TNFα blocking antibody showed marked reduction in the levels of IL-6, IL-1β, and IL-17 and the expression level of STAT3 phosphorylation in relation to Th17 cell differentiation in patients with rheumatoid arthritis. The study provides new evidence supporting the critical role of TNFα in the pathogenic Th17 cell differentiation in rheumatoid arthritis.

  10. The Hagfish Gland Thread Cell: A Fiber-Producing Cell Involved in Predator Defense

    Directory of Open Access Journals (Sweden)

    Douglas S. Fudge

    2016-05-01

    Full Text Available Fibers are ubiquitous in biology, and include tensile materials produced by specialized glands (such as silks, extracellular fibrils that reinforce exoskeletons and connective tissues (such as chitin and collagen, as well as intracellular filaments that make up the metazoan cytoskeleton (such as F-actin, microtubules, and intermediate filaments. Hagfish gland thread cells are unique in that they produce a high aspect ratio fiber from cytoskeletal building blocks within the confines of their cytoplasm. These threads are elaborately coiled into structures that readily unravel when they are ejected into seawater from the slime glands. In this review we summarize what is currently known about the structure and function of gland thread cells and we speculate about the mechanism that these cells use to produce a mechanically robust fiber that is almost one hundred thousand times longer than it is wide. We propose that a key feature of this mechanism involves the unidirectional rotation of the cell’s nucleus, which would serve to twist disorganized filaments into a coherent thread and impart a torsional stress on the thread that would both facilitate coiling and drive energetic unravelling in seawater.

  11. Analysis of immune cells within the healthy oral mucosa of specific pathogen-free cats.

    Science.gov (United States)

    Arzi, B; Murphy, B; Baumgarth, N; Vapniarsky, N; Nemec, A; Naydan, D K; Cox, D P; Verstraete, F J M

    2011-02-01

    The oral mucosa is an important interface for host-environment interactions. Based on previous studies, it is generally accepted that the cellular compartments of the oral immune system comprise organized mucosal-associated lymphoid tissues as well as diffusely and focally distributed T- and to lesser extent B-lymphocytes, oral mucosal Langerhans cells (OMLC), macrophages and mast cells. However, a comprehensive quantification of the cellular elements in the oral mucous membranes of the cat has not been reported. The aim of this study was to provide a comprehensive analysis of the immune cell compartments in the oral mucous membranes and anatomically related tissues of healthy cats. Multiple biopsies of the oral mucous membranes and related tissues were obtained from four specific pathogen-free cats for histological and immunohistochemical assessment of lymphocyte subsets, OMLC, macrophages and mast cells. T-lymphocyte subsets, OMLC, mast cells and macrophages were present in varying frequencies among the tissue compartments of the feline oral cavity. B-lymphocytes were not identified in any of the examined tissues except the tonsils and mandibular lymph nodes. Lymphocytic aggregates (follicles) were found in the palatoglossal folds and the gingiva. We describe the topographical distribution of various leucocyte subsets in the normal healthy feline oral mucosa, and demonstrate regional differences in the distribution of these cells.

  12. Aspergillus Cell Wall Melanin Blocks LC3-Associated Phagocytosis to Promote Pathogenicity.

    Science.gov (United States)

    Akoumianaki, Tonia; Kyrmizi, Irene; Valsecchi, Isabel; Gresnigt, Mark S; Samonis, George; Drakos, Elias; Boumpas, Dimitrios; Muszkieta, Laetitia; Prevost, Marie-Christine; Kontoyiannis, Dimitrios P; Chavakis, Triantafyllos; Netea, Mihai G; van de Veerdonk, Frank L; Brakhage, Axel A; El-Benna, Jamel; Beauvais, Anne; Latge, Jean-Paul; Chamilos, Georgios

    2016-01-13

    Concealing pathogen-associated molecular patterns (PAMPs) is a principal strategy used by fungi to avoid immune recognition. Surface exposure of PAMPs during germination can leave the pathogen vulnerable. Accordingly, β-glucan surface exposure during Aspergillus fumigatus germination activates an Atg5-dependent autophagy pathway termed LC3-associated phagocytosis (LAP), which promotes fungal killing. We found that LAP activation also requires the genetic, biochemical or biological (germination) removal of A. fumigatus cell wall melanin. The attenuated virulence of melanin-deficient A. fumigatus is restored in Atg5-deficient macrophages and in mice upon conditional inactivation of Atg5 in hematopoietic cells. Mechanistically, Aspergillus melanin inhibits NADPH oxidase-dependent activation of LAP by excluding the p22phox subunit from the phagosome. Thus, two events that occur concomitantly during germination of airborne fungi, surface exposure of PAMPs and melanin removal, are necessary for LAP activation and fungal killing. LAP blockade is a general property of melanin pigments, a finding with broad physiological implications.

  13. The plant cell nucleus: a true arena for the fight between plants and pathogens.

    Science.gov (United States)

    Deslandes, Laurent; Rivas, Susana

    2011-01-01

    Communication between the cytoplasm and the nucleus is a fundamental feature shared by both plant and animal cells. Cellular factors involved in the transport of macromolecules through the nuclear envelope, including nucleoporins, importins and Ran-GTP related components, are conserved among a variety of eukaryotic systems. Interestingly, mutations in these nuclear components compromise resistance signalling, illustrating the importance of nucleocytoplasmic trafficking in plant innate immunity. Indeed, spatial restriction of defence regulators by the nuclear envelope and stimulus-induced nuclear translocation constitute an important level of defence-associated gene regulation in plants. A significant number of effectors from different microbial pathogens are targeted to the plant cell nucleus. In addition, key host factors, including resistance proteins, immunity components, transcription factors and transcriptional regulators shuttle between the cytoplasm and the nucleus, and their level of nuclear accumulation determines the output of the defence response, further confirming the crucial role played by the nucleus during the interaction between plants and pathogens. Here, we discuss recent findings that situate the nucleus at the frontline of the mutual recognition between plants and invading microbes.

  14. Pathogen-Specific Effects of Quantitative Trait Loci Affecting Clinical Mastitis and Somatic Cell Count in Danish Holstein Cattle

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, Jørn Rind;

    2008-01-01

    The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

  15. Method for detection of a few pathogenic bacteria and determination of live versus dead cells

    Science.gov (United States)

    Horikawa, Shin; Chen, I.-Hsuan; Du, Songtao; Liu, Yuzhe; Wikle, Howard C.; Suh, Sang-Jin; Barbaree, James M.; Chin, Bryan A.

    2016-05-01

    This paper presents a method for detection of a few pathogenic bacteria and determination of live versus dead cells. The method combines wireless phage-coated magnetoelastic (ME) biosensors and a surface-scanning dectector, enabling real-time monitoring of the growth of specific bacteria in a nutrient broth. The ME biosensor used in this investigation is composed of a strip-shaped ME resonator upon which an engineered bacteriophage is coated to capture a pathogen of interest. E2 phage with high binding affinity for Salmonella Typhimurium was used as a model study. The specificity of E2 phage has been reported to be 1 in 105 background bacteria. The phage-coated ME biosensors were first exposed to a low-concentration Salmonella suspension to capture roughly 300 cells on the sensor surface. When the growth of Salmonella in the broth occurs, the mass of the biosensor increases, which results in a decrease in the biosensor's resonant frequency. Monitoring of this mass- induced resonant frequency change allows for real-time detection of the presence of Salmonella. Detection of a few bacteria is also possible by growing them to a sufficient number. The surface-scanning detector was used to measure resonant frequency changes of 25 biosensors sequentially in an automated manner as a function of time. This methodology offers direct, real-time detection, quantification, and viability determination of specific bacteria. The rate of the sensor's resonant frequency change was found to be largely dependent on the number of initially bound cells and the efficiency of cell growth.

  16. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  17. Integrating Wind And Solar With Hydrogen Producing Fuel Cells

    NARCIS (Netherlands)

    Hemmes, K.

    2007-01-01

    The often proposed solution for the fluctuating wind energy supply is the conversion of the surplus of wind energy into hydrogen by means of electrolysis. In this paper a patented alternative is proposed consisting of the integration of wind turbines with internal reforming fuel-cells, capable of co

  18. Evaluation of major types of Shiga toxin 2E-producing Escherichia coli bacteria present in food, pigs, and the environment as potential pathogens for humans.

    Science.gov (United States)

    Beutin, Lothar; Krüger, Ulrike; Krause, Gladys; Miko, Angelika; Martin, Annett; Strauch, Eckhard

    2008-08-01

    Shiga toxin 2e (Stx2e)-producing strains from food (n = 36), slaughtered pigs (n = 25), the environment (n = 21), diseased pigs (n = 19), and humans (n = 9) were investigated for production of Stx2e by enzyme-linked immunosorbent assay, for virulence markers by PCR, and for their serotypes to evaluate their role as potential human pathogens. Stx2e production was low in 64% of all 110 strains. Stx2e production was inducible by mitomycin C but differed considerably between strains. Analysis by nucleotide sequencing and transcription of stx(2e) genes in high- and low-Stx2e-producing strains showed that toxin production correlated with transcription rates of stx(2e) genes. DNA sequences specific for the int, Q, dam, and S genes of the stx(2e) bacteriophage P27 were found in 109 strains, indicating cryptic P27-like prophages, although 102 of these were not complete for all genes tested. Genes encoding intimin (eae), enterohemorrhagic Escherichia coli hemolysin (ehx), or other stx(1) or stx(2) variants were not found, whereas genes for heat-stable enterotoxins STI, STII, or EAST1 were present in 54.5% of the strains. Seven major serotypes that were associated with diseased pigs (O138:H14, O139:H1, and O141:H4) or with slaughter pigs, food, and the environment (O8:H4, O8:H9, O100:H30, and O101:H9) accounted for 60% of all Stx2e strains. The human Stx2e isolates did not belong to these major serotypes of Stx2e strains, and high production of Stx2e in human strains was not related to diarrheal disease. The results from this study and other studies do not point to Stx2e as a pathogenicity factor for diarrhea and hemolytic uremic syndrome in humans.

  19. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk;

    1988-01-01

    Cross-culture contamination of cell lines propagated in continuous culture is a frequent event and particularly difficult to resolve in cells expressing similar phenotypes. We demonstrate that DNA-DNA hybridization to blotted endonuclease-digested cell DNA effectively detects cross-culture...... the effective use of gene probes to control the origin of cell cultures....... contamination to monitor inter-species as well as intra-species cross contamination. An insulin-producing cell-line, Clone-16, originally cloned from a human fetal endocrine pancreatic cell line did not produce human c-peptide as anticipated. DNA from these cells showed no hybridization to the human ALU...

  20. Tissue specific localization of root infection by fungal pathogens: role of root border cells.

    Science.gov (United States)

    Gunawardena, Uvini; Hawes, Martha C

    2002-11-01

    When roots of pea seedlings were inoculated uniformly with spores of Nectria haematocca or other pea pathogenic fungi, more than 90% developed lesions in the region of elongation within 3 days. More mature regions of most roots as well as the tip showed no visible signs of infection. Yet, microscopic observation revealed that 'mantles,' comprised of fungal hyphae intermeshed with populations of border cells, covered the tips of most roots. After physical detachment of the mantle, the underlying tip of most roots was found to be free of infection. Mantle-covered root tips did not respond to invasion of their border cells by activation of known defense genes unless there was invasion of the tip itself, as revealed by the presence of a lesion. Concomitant with the activation of defense genes was the induction of a cell-wall degrading enzyme whose expression is a marker for renewed production of border cells. Mantle formation did not occur in response to nonpathogens. The data are consistent with the hypothesis that border cells serve as a host-specific 'decoy' that protects root meristems by inhibiting fungal infection of the root tip.

  1. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  2. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens.

    Science.gov (United States)

    Reem, Nathan T; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A; Bellincampi, Daniela; Zabotina, Olga A

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens.

  3. Divergent CD4+ T memory stem cell dynamics in pathogenic and nonpathogenic simian immunodeficiency virus infections.

    Science.gov (United States)

    Cartwright, Emily K; McGary, Colleen S; Cervasi, Barbara; Micci, Luca; Lawson, Benton; Elliott, Sarah T C; Collman, Ronald G; Bosinger, Steven E; Paiardini, Mirko; Vanderford, Thomas H; Chahroudi, Ann; Silvestri, Guido

    2014-05-15

    Recent studies have identified a subset of memory T cells with stem cell-like properties (T(SCM)) that include increased longevity and proliferative potential. In this study, we examined the dynamics of CD4(+) T(SCM) during pathogenic SIV infection of rhesus macaques (RM) and nonpathogenic SIV infection of sooty mangabeys (SM). Whereas SIV-infected RM show selective numeric preservation of CD4(+) T(SCM), SIV infection induced a complex perturbation of these cells defined by depletion of CD4(+)CCR5(+) T(SCM), increased rates of CD4(+) T(SCM) proliferation, and high levels of direct virus infection. The increased rates of CD4(+) T(SCM) proliferation in SIV-infected RM correlated inversely with the levels of central memory CD4(+) T cells. In contrast, nonpathogenic SIV infection of SM evidenced preservation of both CD4(+) T(SCM) and CD4(+) central memory T cells, with normal levels of CD4(+) T(SCM) proliferation, and lack of selective depletion of CD4(+)CCR5(+) T(SCM). Importantly, SIV DNA was below the detectable limit in CD4(+) T(SCM) from 8 of 10 SIV-infected SM. We propose that increased proliferation and infection of CD4(+) T(SCM) may contribute to the pathogenesis of SIV infection in RM.

  4. Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

    Science.gov (United States)

    Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

    2016-02-01

    Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7–10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

  5. Microscopic examination and cytokine expression of bone marrow-derived dendritic cells following exposure to low pathogenic avian ionfluenza

    Science.gov (United States)

    Dendritic cells (DC) function as professional antigen presenting cells, and act as sentinels of the immune system. They are a part of the primary immune response to pathogens and help bridge the innate and adaptive immune responses. They are believed to migrate from bone marrow into the blood stre...

  6. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other importan

  7. High prevalence of extended-spectrum β-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India

    Directory of Open Access Journals (Sweden)

    Pathak A

    2012-04-01

    Full Text Available Ashish Pathak1,2, Yogyata Marothi3, Vandana Kekre4, Kalpana Mahadik5, Ragini Macaden6, Cecilia Stålsby Lundborg11Division of Global Health, Department of Public Health Sciences, Karolinska Institutet, Stockholm, Sweden; 2Department of Pediatrics, 3Department of Microbiology, 4Department of Medicine, 5Department of Obstetrics and Gynecology, RD Gardi Medical College, Ujjain, India; 6St Johns Research Institute, Bangalore, IndiaBackground: Recent reports of the rapid evolution of bacterial resistance in India require urgent antibiotic stewardship programs. This study aimed to define the magnitude and pattern of resistance of bacterial pathogens to guide empirical therapy.Methods: We prospectively collected consecutive, clinically significant, and nonduplicate bacterial isolates from each patient from two hospitals in Ujjain, India. The antibiotic susceptibility of the bacteria was tested using a disc diffusion method as recommended by the Clinical and Laboratory Standards Institute.Results: A total of 716 pathogens were isolated from 2568 patients (median age, 25 years; range, 0 days to 92 years. Gram-negative infections were predominant (62%. The isolated pathogens included Staphylococcus aureus (n = 221; 31%, Escherichia coli (n = 149; 21%, Pseudomonas aeruginosa (n = 127; 18%, and Klebsiella pneumoniae (n = 107; 15%. Common diagnoses included abscesses (56%, urinary tract infections (14%, blood stream infections (10%, pneumonia (10%, and vaginal infections (10%. In E. coli isolates, 69% (95% confidence interval [CI] 61.6–76.6 were extended-spectrum β-lactamase (ESBL producers and 41% (95% CI 31.6–50.5 of K. pneumoniae isolates were ESBL producers. These isolates had a high resistance to fluoroquinolones and β-lactams, except for imipenem and piperacillin-tazobactam. Salmonella typhi remained sensitive to third-generation cephalosporins. Methicillin-resistant S. aureus (MRSA constituted 30% of all S. aureus isolates and showed resistance

  8. Progress in amorphous silicon solar cells produced by reactive sputtering

    Science.gov (United States)

    Moustakas, T. D.

    The photovoltaic properties of reactively sputtered amorphous silicon are reviewed and it is shown that efficient PIN solar cells can be fabricated by the method of sputtering. The photovoltaic properties of the intrinsic films correlate with their structural and compositional inhomogeneities. Hydrogen incorporation and small levels of phosphorus and boron impurities also affect the photovoltaic properties through reduction of residual dangling bond related defects and modification of their occupation. The optical and transport properties of the doped P and N-films were found to depend sensitively on the amount of hydrogen and boron or phosphorus incorporation into the films as well as on their degree of crystallinity. Combination of the best intrinsic and doped films leads to PIN solar cell structures generating J(sc) of 13 mA/sq cm and V(oc) of between 0.85 to 0.95 volts. The efficiency of these devices, 5 to 6 percent, is limited by the low FF, typically about 50 percent. As a further test to the potential of this technology efficient tandem solar cell structures were fabricated, and device design concepts, such as the incorporation of optically reflective back contacts were tested.

  9. TIR-only protein RBA1 recognizes a pathogen effector to regulate cell death in Arabidopsis

    Science.gov (United States)

    Anderson, Ryan G.; Cherkis, Karen A.; Law, Terry F.; Liu, Qingli L.; Machius, Mischa; Nimchuk, Zachary L.; Yang, Li; Chung, Eui-Hwan; El Kasmi, Farid; Hyunh, Michael; Sondek, John E.; Dangl, Jeffery L.

    2017-01-01

    Detection of pathogens by plants is mediated by intracellular nucleotide-binding site leucine-rich repeat (NLR) receptor proteins. NLR proteins are defined by their stereotypical multidomain structure: an N-terminal Toll–interleukin receptor (TIR) or coiled-coil (CC) domain, a central nucleotide-binding (NB) domain, and a C-terminal leucine-rich repeat (LRR). The plant innate immune system contains a limited NLR repertoire that functions to recognize all potential pathogens. We isolated Response to the bacterial type III effector protein HopBA1 (RBA1), a gene that encodes a TIR-only protein lacking all other canonical NLR domains. RBA1 is sufficient to trigger cell death in response to HopBA1. We generated a crystal structure for HopBA1 and found that it has similarity to a class of proteins that includes esterases, the heme-binding protein ChaN, and an uncharacterized domain of Pasteurella multocida toxin. Self-association, coimmunoprecipitation with HopBA1, and function of RBA1 require two previously identified TIR–TIR dimerization interfaces. Although previously described as distinct in other TIR proteins, in RBA1 neither of these interfaces is sufficient when the other is disrupted. These data suggest that oligomerization of RBA1 is required for function. Our identification of RBA1 demonstrates that “truncated” NLRs can function as pathogen sensors, expanding our understanding of both receptor architecture and the mechanism of activation in the plant immune system. PMID:28137883

  10. Noncanonical dendritic cell differentiation and survival driven by a bacteremic pathogen

    Science.gov (United States)

    Miles, Brodie; Scisci, Elizabeth; Carrion, Julio; Sabino, Gregory J.; Genco, Caroline A.; Cutler, Christopher W.

    2013-01-01

    Maintenance of blood DC homeostasis is essential to preventing autoimmunity while controlling chronic infection. However, the ability of bacteremic pathogens to directly regulate blood DC homeostasis has not been defined. One such bacteremic pathogen, Porphyromonas gingivalis, is shown by our group to survive within mDCs under aerobic conditions and therein, metastasize from its oral mucosal niche. This is accompanied by expansion of the blood mDC pool in vivo, independently of canonical DC poietins. We presently know little of how this bacteremic pathogen causes blood DC expansion and the pathophysiological significance. This work shows that optimum differentiation of MoDCs from primary human monocytes, with or without GM-CSF/IL-4, is dependent on infection with P. gingivalis strains expressing the DC-SIGN ligand mfa-1. DC differentiation is lost when DC-SIGN is blocked with its ligand HIV gp120 or knocked out by siRNA gene silencing. Thus, we have identified a novel, noncanonical pathway of DC differentiation. We term these PDDCs and show that PDDCs are bona fide DCs, based on phenotype and phagocytic activity when immature and the ability to up-regulate accessory molecules and stimulate allo-CD4+ T cell proliferation when matured. The latter is dependent on the P. gingivalis strain used to initially “educate” PDDCs. Moreover, we show that P. gingivalis-infected, conventional MoDCs become resistant to apoptosis and inflammatory pyroptosis, as determined by levels of Annexin V and caspase-8, -3/7, and -1. Taken together, we provide new insights into how a relatively asymptomatic bacteremia may influence immune homeostasis and promote chronic inflammation. PMID:23729500

  11. Toxicity and antibacterial assessment of chitosan-coated silver nanoparticles on human pathogens and macrophage cells

    Directory of Open Access Journals (Sweden)

    Jena P

    2012-04-01

    Full Text Available Prajna Jena1, Soumitra Mohanty1, Rojee Mallick1, Biju Jacob2, Avinash Sonawane11School of Biotechnology, KIIT University, Bhubaneswar, Orissa, India; 2Center for Innovation, Technopark Technology Business Incubator, Bangalore, Karnataka, IndiaBackground: Pathogenic bacteria are able to develop various strategies to counteract the bactericidal action of antibiotics. Silver nanoparticles (AgNPs have emerged as a potential alternative to conventional antibiotics because of their potent antimicrobial properties. The purpose of this study was to synthesize chitosan-stabilized AgNPs (CS-AgNPs and test for their cytotoxic, genotoxic, macrophage cell uptake, antibacterial, and antibiofilm activities.Methods: AgNPs were synthesized using chitosan as both a stabilizing and a reducing agent. Antibacterial activity was determined by colony-forming unit assay and scanning electron microscopy. Genotoxic and cytotoxic activity were determined by DNA fragmentation, comet, and MTT [3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide] assays. Cellular uptake and intracellular antibacterial activity were tested on macrophages.Results: CS-AgNPs exhibited potent antibacterial activity against different human pathogens and also impeded bacterial biofilm formation. Scanning electron microscopy analysis indicated that CS-AgNPs kill bacteria by disrupting the cell membrane. CS-AgNPs showed no significant cytotoxic or DNA damage effect on macrophages at the bactericidal dose. Propidium iodide staining indicated active endocytosis of CS-AgNPs resulting in reduced intracellular bacterial survival in macrophages.Conclusion: The present study concludes that at a specific dose, chitosan-based AgNPs kill bacteria without harming the host cells, thus representing a potential template for the design of antibacterial agents to decrease bacterial colonization and to overcome the problem of drug resistance.Keywords: chitosan-silver nanoparticles, antibiofilm, cytotoxicity

  12. Relationship between mastitis causative pathogens and somatic cell counts in milk of dairy cows

    Directory of Open Access Journals (Sweden)

    Sharaf Eldeen Idriss

    2013-12-01

    Full Text Available Milk somatic cell count is a key component of national and international regulation for milk quality and an indicator of udder health and of the prevalence of clinical and subclinical mastitis in dairy herds. The objective of this study was to evaluate the presence of mastitis pathogens in milk samples differed by somatic cell count (SCC in microbiologically positive samples. Also frequency of distribution of samples differed by SCC were studied in non infected samples as well. The milk samples were collected from individual quarters from the dairy farms located in Nitra region with problematic udder health of herd for SCC and bacteriological analysis. Totally, 390 milk samples were examined, and 288 (73.85% positive milk samples were detected. Four SCC groups of samples (400×103 /ml were used to identify presence of microorganisms in positive samples. The most frequently isolated pathogens in samples with high SCC >400×103 /ml according to year were Coagulase-negative Staphylococci (29.11 % in 2012, followed by Staphylococcus aureus (28.0% in 2010, yeasts (24.05% in 2012, Escherichia coli (22.78% in 2012, Bacillus sp. (20% in 2010 and Pseudomonas aerugenosa (11.88% in 2011. Coagulase-negative Staphylococci (66.67% were the predominantly identified in the samples with low SCC <100×103 cells/ml, followed by Bacillus spp (50%, Entrococcus spp. (33.33% and Staphylococcus aureus (16.67% and E. coli (16.67%. The results of this study indicated that the SCC of individual milk samples corresponded with the health status of the udder of dairy cows represented by presence of mastitis microorganisms in milk. However, the contamination of milk samples could be also connected with low SCC. On the ohter side the samples with high SCC were found out without presence of microorganism. The further study is needed to identify the reason of high SCC in milk from negative samples.

  13. Application of dielectric spectroscopy for monitoring high cell density in monoclonal antibody producing CHO cell cultivations.

    Science.gov (United States)

    Párta, László; Zalai, Dénes; Borbély, Sándor; Putics, Akos

    2014-02-01

    The application of dielectric spectroscopy was frequently investigated as an on-line cell culture monitoring tool; however, it still requires supportive data and experience in order to become a robust technique. In this study, dielectric spectroscopy was used to predict viable cell density (VCD) at industrially relevant high levels in concentrated fed-batch culture of Chinese hamster ovary cells producing a monoclonal antibody for pharmaceutical purposes. For on-line dielectric spectroscopy measurements, capacitance was scanned within a wide range of frequency values (100-19,490 kHz) in six parallel cell cultivation batches. Prior to detailed mathematical analysis of the collected data, principal component analysis (PCA) was applied to compare dielectric behavior of the cultivations. PCA analysis resulted in detecting measurement disturbances. By using the measured spectroscopic data, partial least squares regression (PLS), Cole-Cole, and linear modeling were applied and compared in order to predict VCD. The Cole-Cole and the PLS model provided reliable prediction over the entire cultivation including both the early and decline phases of cell growth, while the linear model failed to estimate VCD in the later, declining cultivation phase. In regards to the measurement error sensitivity, remarkable differences were shown among PLS, Cole-Cole, and linear modeling. VCD prediction accuracy could be improved in the runs with measurement disturbances by first derivative pre-treatment in PLS and by parameter optimization of the Cole-Cole modeling.

  14. Arabidopsis EDS1 connects pathogen effector recognition to cell compartment-specific immune responses.

    Science.gov (United States)

    Heidrich, Katharina; Wirthmueller, Lennart; Tasset, Céline; Pouzet, Cécile; Deslandes, Laurent; Parker, Jane E

    2011-12-01

    Pathogen effectors are intercepted by plant intracellular nucleotide binding-leucine-rich repeat (NB-LRR) receptors. However, processes linking receptor activation to downstream defenses remain obscure. Nucleo-cytoplasmic basal resistance regulator EDS1 (ENHANCED DISEASE SUSCEPTIBILITY1) is indispensible for immunity mediated by TIR (Toll-interleukin-1 receptor)-NB-LRR receptors. We show that Arabidopsis EDS1 molecularly connects TIR-NB-LRR disease resistance protein RPS4 recognition of bacterial effector AvrRps4 to defense pathways. RPS4-EDS1 and AvrRps4-EDS1 complexes are detected inside nuclei of living tobacco cells after transient coexpression and in Arabidopsis soluble leaf extracts after resistance activation. Forced AvrRps4 localization to the host cytoplasm or nucleus reveals cell compartment-specific RPS4-EDS1 defense branches. Although nuclear processes restrict bacterial growth, programmed cell death and transcriptional resistance reinforcement require nucleo-cytoplasmic coordination. Thus, EDS1 behaves as an effector target and activated TIR-NB-LRR signal transducer for defenses across cell compartments.

  15. Electrochemically Produced Graphene for Microporous Layers in Fuel Cells.

    Science.gov (United States)

    Najafabadi, Amin Taheri; Leeuwner, Magrieta J; Wilkinson, David P; Gyenge, Előd L

    2016-07-01

    The microporous layer (MPL) is a key cathodic component in proton exchange membrane fuel cells owing to its beneficial influence on two-phase mass transfer. However, its performance is highly dependent on material properties such as morphology, porous structure, and electrical resistance. To improve water management and performance, electrochemically exfoliated graphene (EGN) microsheets are considered as an alternative to the conventional carbon black (CB) MPLs. The EGN-based MPLs decrease the kinetic overpotential and the Ohmic potential loss, whereas the addition of CB to form a composite EGN+CB MPL improves the mass-transport limiting current density drastically. This is reflected by increases of approximately 30 and 70 % in peak power densities at 100 % relative humidity (RH) compared with those for CB- and EGN-only MPLs, respectively. The composite EGN+CB MPL also retains the superior performance at a cathode RH of 20 %, whereas the CB MPL shows significant performance loss.

  16. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytongenes single cells

    DEFF Research Database (Denmark)

    Nielsen, Dennis Sandris; Cho, Gyu-Sung; Hanak, Alexander

    2010-01-01

    A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins...... unaffected after 5 h of co-culturing and after 8 h 50% of the cells still maintained pHi = 7. Higher concentrations of lactic acid were produced in liquid compared to a solid surface, and the different response of EGDe and N53-1 to the activities of the two L. plantarum strains probably reflect higher...... and/or bacteriocin-producing LAB as “natural” food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure...

  17. Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

    Directory of Open Access Journals (Sweden)

    Soares-Silveira Alda

    2002-07-01

    Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

  18. Serine protease espP subtype alpha, but not beta or gamma, of Shiga toxin-producing Escherichia coli is associated with highly pathogenic serogroups.

    Science.gov (United States)

    Khan, Abdul Basit; Naim, Asma; Orth, Dorothea; Grif, Katharina; Mohsin, Mashkoor; Prager, Rita; Dierich, Manfred P; Würzner, Reinhard

    2009-04-01

    Besides Shiga toxins (Stx), Stx-producing Escherichia coli (STEC) harbour several other putative virulence factors, including the serine protease EspP. We have investigated 214 STEC strains from Austria belonging to 61 different serotypes from humans, animals, and food for the presence of this serine protease gene and have determined the espP subtypes and their association with clinical outcome. espP was detected in 121 (57%) out of 214 strains. Sixty-five of 68 strains (96%) of non-sorbitol-fermenting (NSF) O157:H7/NM (NM, non-motile) were positive for espP, while none of 8 SF E. coli O157:NM isolates contained this gene. All 9 strains of serotype O145:NM and 17 of 21 strains (81%) of serotype O26:H11/NM were positive for espP. Nineteen STEC serogroups including O103 and O111 serogroups--considered to be highly pathogenic--were completely negative for espP. Only 5 of 12 strains isolated from patients suffering from haemolytic uraemic syndrome (HUS) were espP-positive (all serogroup NSF O157) as well as 28 of 39 strains from patients with bloody diarrhoea, 40 of 63 strains from patients with non-bloody diarrhoea, and 15 of 19 strains from asymptomatic patients. In O157:H7/NM, O26:H11/NM, and O145:NM only espP subtype alpha was found, whereas in most of the other non-O157 serogroups, subtypes beta and gamma were found. Subtype delta was not detected in our strain collection. Regarding the espP subtypes, only subtype alpha, but not beta and gamma, were found in HUS patients. Moreover, we could demonstrate that espP, and in particular subtype alpha, is associated with highly pathogenic serogroups.

  19. Origin of Matrix-Producing Cells That Contribute to Aortic Fibrosis in Hypertension.

    Science.gov (United States)

    Wu, Jing; Montaniel, Kim Ramil C; Saleh, Mohamed A; Xiao, Liang; Chen, Wei; Owens, Gary K; Humphrey, Jay D; Majesky, Mark W; Paik, David T; Hatzopoulos, Antonis K; Madhur, Meena S; Harrison, David G

    2016-02-01

    Various hypertensive stimuli lead to exuberant adventitial collagen deposition in large arteries, exacerbating blood pressure elevation and end-organ damage. Collagen production is generally attributed to resident fibroblasts; however, other cells, including resident and bone marrow-derived stem cell antigen positive (Sca-1(+)) cells and endothelial and vascular smooth muscle cells, can produce collagen and contribute to vascular stiffening. Using flow cytometry and immunofluorescence, we found that adventitial Sca-1(+) progenitor cells begin to produce collagen and acquire a fibroblast-like phenotype in hypertension. We also found that bone marrow-derived cells represent more than half of the matrix-producing cells in hypertension, and that one-third of these are Sca-1(+). Cell sorting and lineage-tracing studies showed that cells of endothelial origin contribute to no more than one fourth of adventitial collagen I(+) cells, whereas those of vascular smooth muscle lineage do not contribute. Our findings indicate that Sca-1(+) progenitor cells and bone marrow-derived infiltrating fibrocytes are major sources of arterial fibrosis in hypertension. Endothelial to mesenchymal transition likely also contributes, albeit to a lesser extent and pre-existing resident fibroblasts represent a minority of aortic collagen-producing cells in hypertension. This study shows that vascular stiffening represents a complex process involving recruitment and transformation of multiple cells types that ultimately elaborate adventitial extracellular matrix.

  20. The Irish Potato Famine Pathogen Phytophthora infestans Translocates the CRN8 Kinase into Host Plant Cells

    Science.gov (United States)

    van Damme, Mireille; Bozkurt, Tolga O.; Cakir, Cahid; Schornack, Sebastian; Sklenar, Jan; Jones, Alexandra M. E.; Kamoun, Sophien

    2012-01-01

    Phytopathogenic oomycetes, such as Phytophthora infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection. We describe CRN8, a host-translocated effector of P. infestans that has kinase activity in planta. CRN8 is a modular protein of the CRN effector family. The C-terminus of CRN8 localizes to the host nucleus and triggers cell death when the protein is expressed in planta. Cell death induction by CRN8 is dependent on its localization to the plant nucleus, which requires a functional nuclear localization signal (NLS). The C-terminal sequence of CRN8 has similarity to a serine/threonine RD kinase domain. We demonstrated that CRN8 is a functional RD kinase and that its auto-phosphorylation is dependent on an intact catalytic site. Co-immunoprecipitation experiments revealed that CRN8 forms a dimer or multimer. Heterologous expression of CRN8 in planta resulted in enhanced virulence by P. infestans. In contrast, in planta expression of the dominant-negative CRN8R469A;D470A resulted in reduced P. infestans infection, further implicating CRN8 in virulence. Overall, our results indicate that similar to animal parasites, plant pathogens also translocate biochemically active kinase effectors inside host cells. PMID:22927814

  1. The Irish potato famine pathogen Phytophthora infestans translocates the CRN8 kinase into host plant cells.

    Directory of Open Access Journals (Sweden)

    Mireille van Damme

    Full Text Available Phytopathogenic oomycetes, such as Phytophthora infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection. We describe CRN8, a host-translocated effector of P. infestans that has kinase activity in planta. CRN8 is a modular protein of the CRN effector family. The C-terminus of CRN8 localizes to the host nucleus and triggers cell death when the protein is expressed in planta. Cell death induction by CRN8 is dependent on its localization to the plant nucleus, which requires a functional nuclear localization signal (NLS. The C-terminal sequence of CRN8 has similarity to a serine/threonine RD kinase domain. We demonstrated that CRN8 is a functional RD kinase and that its auto-phosphorylation is dependent on an intact catalytic site. Co-immunoprecipitation experiments revealed that CRN8 forms a dimer or multimer. Heterologous expression of CRN8 in planta resulted in enhanced virulence by P. infestans. In contrast, in planta expression of the dominant-negative CRN8(R469A;D470A resulted in reduced P. infestans infection, further implicating CRN8 in virulence. Overall, our results indicate that similar to animal parasites, plant pathogens also translocate biochemically active kinase effectors inside host cells.

  2. The Irish potato famine pathogen Phytophthora infestans translocates the CRN8 kinase into host plant cells.

    Science.gov (United States)

    van Damme, Mireille; Bozkurt, Tolga O; Cakir, Cahid; Schornack, Sebastian; Sklenar, Jan; Jones, Alexandra M E; Kamoun, Sophien

    2012-01-01

    Phytopathogenic oomycetes, such as Phytophthora infestans, secrete an arsenal of effector proteins that modulate plant innate immunity to enable infection. We describe CRN8, a host-translocated effector of P. infestans that has kinase activity in planta. CRN8 is a modular protein of the CRN effector family. The C-terminus of CRN8 localizes to the host nucleus and triggers cell death when the protein is expressed in planta. Cell death induction by CRN8 is dependent on its localization to the plant nucleus, which requires a functional nuclear localization signal (NLS). The C-terminal sequence of CRN8 has similarity to a serine/threonine RD kinase domain. We demonstrated that CRN8 is a functional RD kinase and that its auto-phosphorylation is dependent on an intact catalytic site. Co-immunoprecipitation experiments revealed that CRN8 forms a dimer or multimer. Heterologous expression of CRN8 in planta resulted in enhanced virulence by P. infestans. In contrast, in planta expression of the dominant-negative CRN8(R469A;D470A) resulted in reduced P. infestans infection, further implicating CRN8 in virulence. Overall, our results indicate that similar to animal parasites, plant pathogens also translocate biochemically active kinase effectors inside host cells.

  3. A Cytosine Methytransferase Modulates the Cell Envelope Stress Response in the Cholera Pathogen

    Science.gov (United States)

    Chao, Michael C.; Zhu, Shijia; Kimura, Satoshi; Davis, Brigid M.; Schadt, Eric E.; Fang, Gang; Waldor, Matthew K.

    2015-01-01

    DNA methylation is a key epigenetic regulator in all domains of life, yet the effects of most bacterial DNA methyltransferases on cellular processes are largely undefined. Here, we used diverse techniques, including bisulfite sequencing, transcriptomics, and transposon insertion site sequencing to extensively characterize a 5-methylcytosine (5mC) methyltransferase, VchM, in the cholera pathogen, Vibrio cholerae. We have comprehensively defined VchM’s DNA targets, its genetic interactions and the gene networks that it regulates. Although VchM is a relatively new component of the V. cholerae genome, it is required for optimal V. cholerae growth in vitro and during infection. Unexpectedly, the usually essential σE cell envelope stress pathway is dispensable in ∆vchM V. cholerae, likely due to its lower activation in this mutant and the capacity for VchM methylation to limit expression of some cell envelope modifying genes. Our work illuminates how an acquired DNA methyltransferase can become integrated within complex cell circuits to control critical housekeeping processes. PMID:26588462

  4. Enhancement of insulin-producing cell differentiation from embryonic stem cells using pax4-nucleofection method

    Institute of Scientific and Technical Information of China (English)

    Han-Tso Lin; Hung-Hai Ku; Chung-Lan Kao; Kun-Hsiung Lee; Yuh-Lih Chang; Shih-Hwa Chiou; Fu-Ting Tsai; Tung-Hu Tsai; Dey-Chyi Sheu; Larry LT Ho

    2007-01-01

    AIM: To enhance the differentiation of insulin producing cell (IPC) ability from embryonic stem (ES) cells in vitro.METHODS: Four-day embryoid body (EB)-formatted ES cells were dissociated as single cells for the followed plasmid DNA delivery. The use of Nucleofector- Electroporator (Amaxa biosystems, Germany) in combination with medium-contained G418 provided a high efficiency of gene delivery for advanced selection. Neucleofected cells were plated on the top of fibronectin coated Petri dishes. Addition of Ly294002 and raised the glucose in medium at 24 h before examination.The differentiation status of these cells was monitored by semi-quantitative PCR (SQ-PCR) detection of the expression of relative genes, such as oct-4, sox-17, foxa2, mixl1, pdx-1, insulin 1, glucagons and somatostatin. The percentage of IPC population on d 18 of the experiment was investigated by immunohistochemistry (IHC), and the content/secretion of insulin was estimated by ELISA assay. The mice with severe combined immunodeficiency disease (SCID) pretreated with streptozotocin (STZ) were used to eliminate plasma glucose restoration after pax4+ ES implantation.RESULTS: A high efficiency of gene delivery was demonstrated when neucleofection was used in the present study; approximately 70% cells showed DsRed expression 2 d after neucleofection. By selection of medium-contained G418, the percentage of DsRed expressing cells kept high till the end of study. The pancreatic differentiation seemed to be accelerated by pax4 nucleofection. When compared to the group of cells with mock control, foxa2, mixl1, pdx1, higher insulin and somatostatin levels were detected by SQ-PCR 4 d after nucleofection in the group of pax4 expressing plasmid delivery. Approximately 55% of neucleofected cells showed insulin expression 18 d after neucleofection, and only 18% of cells showed insulin expression in mock control. The disturbance was shown by nucleofected pax4 RNAi vector; only 8% of cells expressed insulin 18

  5. The glycoprotein and the matrix protein of rabies virus affect pathogenicity by regulating viral replication and facilitating cell-to-cell spread.

    Science.gov (United States)

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J; Dietzschold, Bernhard

    2008-03-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant increase in the pathogenicity of the SN strain bearing the RV G from the pathogenic SB strain. Moreover, the pathogenicity was further increased when both G and M from SB were introduced into SN. Interestingly, the replacement of the G or M gene or both in SN by the corresponding genes of SB was associated with a significant decrease in the rate of viral replication and viral RNA synthesis. In addition, a chimeric SN virus bearing both the M and G genes from SB exhibited more efficient cell-to-cell spread than a chimeric SN virus in which only the G gene was replaced. Together, these data indicate that both G and M play an important role in RV pathogenesis by regulating virus replication and facilitating cell-to-cell spread.

  6. Does the Presence of Detached Root Border Cells of Zea mays Alter the Activity of the Pathogenic Nematode Meloidogyne incognita?

    Science.gov (United States)

    Rodger, S; Bengough, A G; Griffiths, B S; Stubbs, V; Young, I M

    2003-09-01

    ABSTRACT The root-knot nematode Meloidogyne incognita is a major pathogen of a range of important crops. Currently, control is typically achieved by the use of nematicides. However, recent work suggests that manipulating the ability of roots to slough off border cells, which then act as a decoy to the nematode, can significantly decrease damage to the roots. We investigated the attractiveness of border cells to M. incognita and the response of the nematode to border cells in close proximity. We found very limited attraction, in that nematodes did not preferentially alter direction to move toward the border cells, but a large and significant increase in nematode speed was observed once they were in the immediate vicinity of border cells. We discuss the results in the context of physical and biological mechanisms in relation to the control of pathogenic nematodes.

  7. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Directory of Open Access Journals (Sweden)

    Daniel A. Rappolee

    2012-12-01

    Full Text Available Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  8. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development.

    Science.gov (United States)

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-01-01

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK) which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK) that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  9. Atypical and classical memory B cells produce Plasmodium falciparum neutralizing antibodies

    DEFF Research Database (Denmark)

    Muellenbeck, Matthias F; Ueberheide, Beatrix; Amulic, Borko

    2013-01-01

    . We show at the single cell level that natural Pf infection induces the development of classical memory B cells (CM) and atypical memory B cells (AtM) that produce broadly neutralizing antibodies against blood stage Pf parasites. CM and AtM contribute to anti-Pf serum IgG production, but only AtM show...

  10. Interleukin 17-Producing γδT Cells Increased in Patients with Active Pulmonary Tuberculosis

    Institute of Scientific and Technical Information of China (English)

    Meiyu Peng; Zhaohua Wang; Chunyan Yao; Lina Jiang; Qili Jin; Jing Wang; Baiqing Li

    2008-01-01

    Although it has been known that y8 T cells may play an important role in the immune response to infection of Mycobacterium tuberculosis (M. tb), the mechanisms by which the T8 T cells participate in the innate and/or acquired immunity to tuberculosis (TB) have not been full elucidated. In the present study, 27 patients with active pulmonary TB and 16 healthy donors (HD) were performed. We found that proportion of IL-17-producing cells among lymphocyte was similar between TB patients and HD, whereas the proportions of γδ T cells in IL-17- producing cells (59.2%) and IL-17-producing cells in γδ T cells (19.4%) in peripheral blood were markedly increased in TB patients when compared to those in HD (43.9% and 7.7%, respectively). In addition, the proportions of IFN-γ-producing γδ T cells in TB patients were obviously lower than that in HD. Upon re-stimulated with M. tb heat-treated antigen (M. tb-HAg) in vitro, fewer IL-17-producing γδ T cells were generated from HD and TB patients, whereas IFN-γ-producing γδ T cells were increased in TB patients compared to that in HD. Our findings in TB patients and healthy human were consistent with other murine investigation that the IL-17- producing γδ T cells were main source of IL-17 in mouse model of BCG infection, suggesting that γδ T cells might be involved in the formation of tubercular granuloma in pulmonary TB patients, but need further identification. Cellular & Molecular Immunology. 2008;5(3):203-208.

  11. Antibacterial activity of Green Seaweed Caulerpa racemosa from Takalar Waters against pathogenic bacteria promoting ice-ice diseases in the agar-producing red algae Gracilaria verrucosa.

    OpenAIRE

    Zainuddin, Elmi Nurhaidah; Anshary, Hilal; Huyyirnah; Hiola, Ridha

    2012-01-01

    The Ice-ice disease caused by bacterial pathogens which attack the algae tissue resulted white and brittle of seaweed thallus on red seaweed Gracilaria verrucosa farming. Study of antibacterial activity of green seaweed Caulerpa racemosa against the pathogens has been done using method include isolation of bacteria, pathogenicity test with Koch's postulates method, characterization of ice-ice bacteria, extraction of Caulerpa racemosa, and antibacterial test by agar diffusion method. The res...

  12. Divergent roles of Salmonella pathogenicity island 2 and metabolic traits during interaction of S. enterica serovar typhimurium with host cells.

    Directory of Open Access Journals (Sweden)

    Stefanie U Hölzer

    Full Text Available The molecular mechanisms of virulence of the gastrointestinal pathogen Salmonella enterica are commonly studied using cell culture models of infection. In this work, we performed a direct comparison of the interaction of S. enterica serovar Typhimurium (S. Typhimurium with the non-polarized epithelial cell line HeLa, the polarized cell lines CaCo2, T84 and MDCK, and macrophage-like RAW264.7 cells. The ability of S. Typhimurium wild-type and previously characterized auxotrophic mutant strains to enter host cells, survive and proliferate within mammalian cells and deploy the Salmonella Pathogenicity Island 2-encoded type III secretion system (SPI2-T3SS was quantified. We found that the entry of S. Typhimurium into polarized cells was much more efficient than entry into non-polarized cells or phagocytic uptake. While SPI2-T3SS dependent intracellular proliferation was observed in HeLa and RAW cells, the intracellular replication in polarized cells was highly restricted and not affected by defective SPI2-T3SS. The contribution of aromatic amino acid metabolism and purine biosynthesis to intracellular proliferation was distinct in the various cell lines investigated. These observations indicate that the virulence phenotypes of S. Typhimurium are significantly affected by the cell culture model applied.

  13. Producing recombinant therapeutic glycoproteins with enhanced sialylation using CHO-gmt4 glycosylation mutant cells

    Science.gov (United States)

    Goh, John SY; Liu, Yingwei; Chan, Kah Fai; Wan, Corrine; Teo, Gavin; Zhang, Peiqing; Zhang, Yuanxing; Song, Zhiwei

    2014-01-01

    Recombinant glycoprotein drugs require proper glycosylation for optimal therapeutic efficacy. Glycoprotein therapeutics are rapidly removed from circulation and have reduced efficacy if they are poorly sialylated. Ricinus communis agglutinin-I (RCA-I) was found highly toxic to wild-type CHO-K1 cells and all the mutants that survived RCA-I treatment contained a dysfunctional N-acetylglucosaminyltransferase I (GnT I) gene. These mutants are named CHO-gmt4 cells. Interestingly, upon restoration of GnT I, the sialylation of a model glycoprotein, erythropoietin, produced in CHO-gmt4 cells was shown to be superior to that produced in wild-type CHO-K1 cells. This addendum summarizes the applicability of this cell line, from transient to stable expression of the recombinant protein, and from a lab scale to an industrial scale perfusion bioreactor. In addition, CHO-gmt4 cells can be used to produce glycoproteins with mannose-terminated N-glycans. Recombinant glucocerebrosidase produced by CHO-gmt4 cells will not require glycan remodeling and may be directly used to treat patients with Gaucher disease. CHO-gmt4 cells can also be used to produce other glycoprotein therapeutics which target cells expressing mannose receptors. PMID:24911584

  14. NLRP3 Inflammasome Activation in THP-1 Target Cells Triggered by Pathogenic Naegleria fowleri.

    Science.gov (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Yoo, Jong-Kyun; Kang, Heekyoung; Seong, Gi-Sang; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2016-09-01

    Naegleria fowleri, known as the brain-eating amoeba, causes acute primary amoebic meningoencephalitis. During swimming and other recreational water activities, N. fowleri trophozoites penetrate the nasal mucosa and invade the olfactory bulbs, resulting in intense inflammatory reactions in the forebrain tissue. To investigate what kinds of inflammasome molecules are expressed in target cells due to N. fowleri infection, human macrophage cells (THP-1 cells) were cocultured with N. fowleri trophozoites in a noncontact system, and consequently, interleukin-1β (IL-1β) production was estimated. Caspase-1 activation and IL-1β production from THP-1 cells by Western blotting and the culture supernatant by enzyme-linked immunosorbent assay analysis were observed at 3 h after cocultivation. In addition, the increased expression of ASC and NLRP3, which make up an inflammasome complex, was also observed at 3 h after cocultivation. To confirm the caspase-1 activation and IL-1β production via the NLRP3 inflammasome in THP-1 cells triggered by N. fowleri trophozoites, THP-1 cells were pretreated with several inhibitors. The inhibition assay showed that CA-074 (a cathepsin B inhibitor), glybenclamide (an NLRP3 molecule inhibitor), and N-benzyloxycarbony-Val-Ala-Asp(O-methyl)-fluoromethylketone (Z-VAD-FMK; a caspase-1 inhibitor) reduced the levels of caspase-1 activation and IL-1β production from THP-1 cells. This study suggests that N. fowleri infection induces the NLRP3 inflammasome, which activates caspase-1 and subsequently produces IL-1β, thus resulting in inflammation.

  15. Perforin-2 is essential for intracellular defense of parenchymal cells and phagocytes against pathogenic bacteria.

    Science.gov (United States)

    McCormack, Ryan M; de Armas, Lesley R; Shiratsuchi, Motoaki; Fiorentino, Desiree G; Olsson, Melissa L; Lichtenheld, Mathias G; Morales, Alejo; Lyapichev, Kirill; Gonzalez, Louis E; Strbo, Natasa; Sukumar, Neelima; Stojadinovic, Olivera; Plano, Gregory V; Munson, George P; Tomic-Canic, Marjana; Kirsner, Robert S; Russell, David G; Podack, Eckhard R

    2015-09-24

    Perforin-2 (MPEG1) is a pore-forming, antibacterial protein with broad-spectrum activity. Perforin-2 is expressed constitutively in phagocytes and inducibly in parenchymal, tissue-forming cells. In vitro, Perforin-2 prevents the intracellular replication and proliferation of bacterial pathogens in these cells. Perforin-2 knockout mice are unable to control the systemic dissemination of methicillin-resistant Staphylococcus aureus (MRSA) or Salmonella typhimurium and perish shortly after epicutaneous or orogastric infection respectively. In contrast, Perforin-2-sufficient littermates clear the infection. Perforin-2 is a transmembrane protein of cytosolic vesicles -derived from multiple organelles- that translocate to and fuse with bacterium containing vesicles. Subsequently, Perforin-2 polymerizes and forms large clusters of 100 Å pores in the bacterial surface with Perforin-2 cleavage products present in bacteria. Perforin-2 is also required for the bactericidal activity of reactive oxygen and nitrogen species and hydrolytic enzymes. Perforin-2 constitutes a novel and apparently essential bactericidal effector molecule of the innate immune system.

  16. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Directory of Open Access Journals (Sweden)

    Andrew S Brown

    2016-06-01

    Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  17. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Science.gov (United States)

    Brown, Andrew S; Yang, Chao; Fung, Ka Yee; Bachem, Annabell; Bourges, Dorothée; Bedoui, Sammy; Hartland, Elizabeth L; van Driel, Ian R

    2016-06-01

    Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC), which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  18. Identification of an ISR-related metabolite produced by Pseudomonas chlororaphis O6 against the wildfire pathogen pseudomonas syringae pv.tabaci in tobacco.

    Science.gov (United States)

    Park, Myung Ryeol; Kim, Young Cheol; Park, Ju Yeon; Han, Song Hee; Kim, Kil Yong; Lee, Sun Woo; Kim, In Seon

    2008-10-01

    Pseudomonas chlororaphis O6 exhibits induced systemic resistance (ISR) against P. syringae pv. tabaci in tobacco. To identify one of the ISR metabolites, O6 cultures were extracted with organic solvents, and the organic extracts were subjected to column chromatography followed by spectroscopy analyses. The ISR bioassay-guided fractionation was carried out for isolation of the metabolite. Highresolution mass spectrometric analysis of the metabolite found C(9)H(9)O(3)N with an exact mass of 179.0582. LC/MS analysis in positive mode showed an (M+H)(+) peak at m/zeta 180. Nuclear magnetic resonance ((1)H, (13)C) analyses identified all protons and carbons of the metabolite. Based on the spectroscopy data, the metabolite was identified 4-(aminocarbonyl) phenylacetate (4-ACPA). 4-ACPA applied at 68.0 mM exhibited ISR activity at a level similar 1.0 mM salicylic acid. This is the first report to identify an ISR metabolite produced by P. chlororaphis O6 against the wildfire pathogen P. syringae pv. tabaci in tobacco.

  19. Effects of TFAR19 gene on the in vivo biorheological properties and pathogenicity of mouse erythroleukemia cell line MEL

    Institute of Scientific and Technical Information of China (English)

    GU Li; TANG ZhiYu; HE DongQi; KA WeiBo; SUN DaGong; WEN ZongYao

    2007-01-01

    After injecting VP16, MEL cells and MEL-TF19 cells into the body of mice, with those injected with the same dose of saline as the control group, we observed the mice for their blood pictures, histological changes of the liver and spleen, and the hemorhelogical indexes within 4 weeks. The results indicated that after injecting MEL cells, the mice entered into a pathological status similar to erythroleukemia, which had the following exhibitions: the tissue structures of the liver and spleen were damaged, a mass of proerythroblasts, basophil erythroblasts and polychromatophilic erythroblasts could be observed on the smears of the bone marrow and spleen, and the deformability and orientation ability of erythrocytes were both depressed. The pathogenicity of MEL-TF19 cells carrying TFAR19 gene was obviously lower than that of MEL cells, and the MEL-TF19 cells even lost their faintish pathogenicity under the apoptosis-inducing effect of the chemotherapeutic reagent. The outcome from the animal experiments suggests that the TFAR19 gene suppresses the pathogenicity of MEL cells to the mice, and the effect may be better exerted with the synergy of the chemotherapeutic reagent.

  20. Effects of TFAR19 gene on the in vivo biorheological properties and pathogenicity of mouse erythroleukemia cell line MEL

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    After injecting VP16, MEL cells and MEL-TF19 cells into the body of mice, with those injected with the same dose of saline as the control group, we observed the mice for their blood pictures, histological changes of the liver and spleen, and the hemorhelogical indexes within 4 weeks. The results indicated that after injecting MEL cells, the mice entered into a pathological status similar to erythroleukemia, which had the following exhibitions: the tissue structures of the liver and spleen were damaged, a mass of proerythroblasts, basophil erythroblasts and polychromatophilic erythroblasts could be observed on the smears of the bone marrow and spleen, and the deformability and orientation ability of erythrocytes were both depressed. The pathogenicity of MEL-TF19 cells carrying TFAR19 gene was obviously lower than that of MEL cells, and the MEL-TF19 cells even lost their faintish pathogenicity under the apop-tosis-inducing effect of the chemotherapeutic reagent. The outcome from the animal experiments suggests that the TFAR19 gene suppresses the pathogenicity of MEL cells to the mice, and the effect may be better exerted with the synergy of the chemotherapeutic reagent.

  1. A novel IL-10-producing innate lymphoid cells (ILC10) in a contact hypersensitivity mouse model

    Science.gov (United States)

    Kim, Hyuk Soon; Jang, Jong-Hwa; Lee, Min Bum; Jung, In Duk; Park, Yeong-Min; Kim, Young Mi; Choi, Wahn Soo

    2016-01-01

    The immunoregulatory cytokine Interleukin 10 (IL-10) protein is produced by various cells during the course of inflammatory disorders. Mainly, it downregulates pro-inflammatory cytokines, antigen presentation, and helper T cell activation. In this study, we show that the ratio of IL-10-producing cells was significantly increased in lineage negative (i.e., not T, B, or leukocyte cell lineages) cells than in lineage positive cells in lymphoid and peripheral tissues. We further observed that IL-10-producing innate lymphoid cells (ILCs), here called firstly ILC10, were increased in number in oxazolone-induced contact hypersensitivity (CHS) mice. In detail, IL-10-producing lineage negative cells were elevated in the axillary, inguinal lymph node, and ear tissues of CHS mice. Notably, the cells expressed classical ILC marker proteins such as CD45, CD127, and Sca-1. Altogether, our findings suggest for the first time that ILC10s are present in various physiological settings and could be involved in numerous immune responses as regulatory cells. [BMB Reports 2016; 49(5): 293-296] PMID:26949018

  2. An experimental and theoretical approach to the study of the photoacoustic signal produced by cancer cells

    Directory of Open Access Journals (Sweden)

    Rafael Pérez Solano

    2012-03-01

    Full Text Available The distinctive spectral absorption characteristics of cancer cells make photoacoustic techniques useful for detection in vitro and in vivo. Here we report on our evaluation of the photoacoustic signal produced by a series of monolayers of different cell lines in vitro. Only the melanoma cell line HS936 produced a detectable photoacoustic signal in which amplitude was dependent on the number of cells. This finding appears to be related to the amount of melanin available in these cells. Other cell lines (i.e. HL60, SK-Mel-1, T47D, Hela, HT29 and PC12 exhibited values similar to a precursor of melanin (tyrosinase, but failed to produce sufficient melanin to generate a photoacoustic signal that could be distinguished from background noise. To better understand this phenomenon, we determined a formula for the time-domain photoacoustic wave equation for a monolayer of cells in a non-viscous fluid on the thermoelastic regime. The theoretical results showed that the amplitude and profile of the photoacoustic signal generated by a cell monolayer depended upon the number and distribution of the cells and the location of the point of detection. These findings help to provide a better understanding of the factors involved in the generation of a photoacoustic signal produced by different cells in vitro and in vivo.

  3. A comparison of somatic cell count and antimicrobial susceptibility of subclinical mastitis pathogens in organic and conventional dairy herds

    OpenAIRE

    Boutet, Philippe; Detilleux, Johann; Motkin, Michel; Deliege, M.; PIRAUX, E.; Depinois, A.; Debliquy, P.; Mainil, Jacques; Czaplicki, G.; Lekeux, Pierre

    2005-01-01

    A comparison of somatic cell count and antimicrobial susceptibility of subclinical mastitis pathogens in organic and conventional dairy herds.Bovine subclinical mastitis is the most important disease affecting dairy cows. The fluctuating increase in somatic cell count (SCC) that occurs causes major economic losses in dairy industry. This comparative study between conventional and organic dairy herds was conducted in the aim to better characterize which consequences might have different manage...

  4. Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

    Directory of Open Access Journals (Sweden)

    Katja Kriebel

    Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

  5. A novel hemagglutinin protein produced in bacteria protects chickens against H5N1 highly pathogenic avian influenza viruses by inducing H5 subtype-specific neutralizing antibodies

    Science.gov (United States)

    Sączyńska, Violetta; Romanik, Agnieszka; Florys, Katarzyna; Cecuda-Adamczewska, Violetta; Kęsik-Brodacka, Małgorzata; Śmietanka, Krzysztof; Olszewska, Monika; Domańska-Blicharz, Katarzyna; Minta, Zenon; Szewczyk, Bogusław; Płucienniczak, Grażyna; Płucienniczak, Andrzej

    2017-01-01

    The highly pathogenic (HP) H5N1 avian influenza viruses (AIVs) cause a mortality rate of up to 100% in infected chickens and pose a permanent pandemic threat. Attempts to obtain effective vaccines against H5N1 HPAIVs have focused on hemagglutinin (HA), an immunodominant viral antigen capable of eliciting neutralizing antibodies. The vast majority of vaccine projects have been performed using eukaryotic expression systems. In contrast, we used a bacterial expression system to produce vaccine HA protein (bacterial HA) according to our own design. The HA protein with the sequence of the H5N1 HPAIV strain was efficiently expressed in Escherichia coli, recovered in the form of inclusion bodies and refolded by dilution between two chromatographic purification steps. Antigenicity studies showed that the resulting antigen, referred to as rH5-E. coli, preserves conformational epitopes targeted by antibodies specific for H5-subtype HAs, inhibiting hemagglutination and/or neutralizing influenza viruses in vitro. The proper conformation of this protein and its ability to form functional oligomers were confirmed by a hemagglutination test. Consistent with the biochemical characteristics, prime-boost immunizations with adjuvanted rH5-E. coli protected 100% and 70% of specific pathogen-free, layer-type chickens against challenge with homologous and heterologous H5N1 HPAIVs, respectively. The observed protection was related to the positivity in the FluAC H5 test (IDVet) but not to hemagglutination-inhibiting antibody titers. Due to full protection, the effective contact transmission of the homologous challenge virus did not occur. Survivors from both challenges did not or only transiently shed the viruses, as established by viral RNA detection in oropharyngeal and cloacal swabs. Our results demonstrate that vaccination with rH5-E. coli could confer control of H5N1 HPAIV infection and transmission rates in chicken flocks, accompanied by reduced virus shedding. Moreover, the role of

  6. Regulatory network modelling of iron acquisition by a fungal pathogen in contact with epithelial cells

    Directory of Open Access Journals (Sweden)

    Guthke Reinhard

    2010-11-01

    Full Text Available Abstract Background Reverse engineering of gene regulatory networks can be used to predict regulatory interactions of an organism faced with environmental changes, but can prove problematic, especially when focusing on complicated multi-factorial processes. Candida albicans is a major human fungal pathogen. During the infection process, this fungus is able to adapt to conditions of very low iron availability. Such adaptation is an important virulence attribute of virtually all pathogenic microbes. Understanding the regulation of iron acquisition genes will extend our knowledge of the complex regulatory changes during the infection process and might identify new potential drug targets. Thus, there is a need for efficient modelling approaches predicting key regulatory events of iron acquisition genes during the infection process. Results This study deals with the regulation of C. albicans iron uptake genes during adhesion to and invasion into human oral epithelial cells. A reverse engineering strategy is presented, which is able to infer regulatory networks on the basis of gene expression data, making use of relevant selection criteria such as sparseness and robustness. An exhaustive use of available knowledge from different data sources improved the network prediction. The predicted regulatory network proposes a number of new target genes for the transcriptional regulators Rim101, Hap3, Sef1 and Tup1. Furthermore, the molecular mode of action for Tup1 is clarified. Finally, regulatory interactions between the transcription factors themselves are proposed. This study presents a model describing how C. albicans may regulate iron acquisition during contact with and invasion of human oral epithelial cells. There is evidence that some of the proposed regulatory interactions might also occur during oral infection. Conclusions This study focuses on a typical problem in Systems Biology where an interesting biological phenomenon is studied using a small

  7. Quantitative studies of the gastrin-producing cells of the human antrum. A methodological study

    DEFF Research Database (Denmark)

    Nielsen, H O; Halken, S; Lorentzen, M

    1980-01-01

    The antral gastrin-producing cells (G-cells) have been identified by the indirect immunoperoxidase technique in two antrum preparations removed due to a recurrent duodenal and gastric ulcer. Morphometric principles were applied to the G-cells with determination of their volume density, numerical....... A method for estimating the total G-cell population and the total G-cell volume in the antrum was developed. In the antrum removed due to a gastric ulcer the number of G-cells was 190 x 10(6) and their total volume 176 mm3....

  8. Endovascular Method for Transplantation of Insulin-Producing Cells to the Pancreas Parenchyma in Swine

    OpenAIRE

    Lundberg, J.; Stone-Elander, S.; Zhang, X. -M; Korsgren, Olle; Jonsson, S; Holmin, S.

    2014-01-01

    Insulin-producing cells are transplanted by portal vein injection as an alternative to pancreas transplantation in both clinical and preclinical trials. Two of the main limitations of portal vein transplantation are the prompt activation of the innate immunity and concomitant loss of islets and a small but significant risk of portal vein thrombosis. Furthermore, to mimic physiological release, the insulin-producing cells should instead be located in the pancreas. The trans-vessel wall approac...

  9. Cellular therapies based on stem cells and their insulin-producing surrogates: a 2015 reality check.

    Science.gov (United States)

    Giannoukakis, Nick; Trucco, Massimo

    2015-05-01

    Stem cell technology has recently gained a substantial amount of interest as one method to create a potentially limitless supply of transplantable insulin-producing cells to treat, and possibly cure diabetes mellitus. In this review, we summarize the state-of-the art of stem cell technology and list the potential sources of stem cells that have been shown to be useful as insulin-expressing surrogates. We also discuss the milestones that have been reached and those that remain to be addressed to generate bona fide beta cell-similar, insulin-producing surrogates. The caveats, limitations, and realistic expectations are also considered for current and future technology. In spite of the tremendous technical advances realized in the past decade, especially in the field of reprogramming adult somatic cells to become stem cells, the state-of-the art still relies on lengthy and cumbersome in vitro culture methods that yield cell populations that are not particularly glucose-responsive when transplanted into diabetic hosts. Despite the current impediments toward clinical translation, including the potential for immune rejection, the availability of technology to generate patient-specific reprogrammable stem cells has, and will be critical for, important insights into the genetics, epigenetics, biology, and physiology of insulin-producing cells in normal and pathologic states. This knowledge could accelerate the time to reach the desired breakthrough for safe and efficacious beta cell surrogates.

  10. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    Energy Technology Data Exchange (ETDEWEB)

    Su, Xin; Guan, Wuqiang; Yu, Yong-Chun; Fu, Yinghui, E-mail: fuyh@fudan.edu.cn

    2014-07-18

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1{sup +} or nestin{sup +} stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU{sup +} cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU{sup +} cells, very few are mash1{sup +} or nestin{sup +} stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1{sup +} microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition.

  11. Inhibitory Effects of Gallic Acid Isolated from Caesalpinia mimosoides Lamk on Cholangiocarcinoma Cell Lines and Foodborne Pathogenic Bacteria.

    Science.gov (United States)

    Rattanata, Narintorn; Klaynongsruang, Sompong; Daduang, Sakda; Tavichakorntrakool, Ratree; Limpaiboon, Temduang; Lekphrom, Ratsami; Boonsiri, Patcharee; Daduang, Jureerut

    2016-01-01

    Gallic acid was isolated from Caesalpinia mimosoides Lamk and the structure s identified based on spectroscopic analysis and comparison with authentic compound. In this study we compared the ability of natural gallic acid (nGA) and commercial gallic acid (cGA) to inhibit the proliferation of cholangiocarcinoma cell lines (M213, M214) and foodborne pathogenic bacteria (Salmonella spp. and Plesiomonas shigelloides). Both nGA and cGA had the same inhibitory effects on cell proliferation by inducing apoptosis of cholangiocarcinoma cell lines. In addition, nGA inhibited growth of foodborne pathogenic bacteria in the same manner as cGA. Our results suggest that nGA from Caesalpinia mimosoides Lamk is a potential anticancer and antibacterial compound. However, in vivo studies are needed to elucidate the specific mechanisms involved.

  12. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Science.gov (United States)

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  13. Interleukin 4-producing CD4+ T cells in the skin of cats with allergic dermatitis.

    Science.gov (United States)

    Roosje, P J; Dean, G A; Willemse, T; Rutten, V P M G; Thepen, T

    2002-03-01

    Lesional skin of cats with allergic dermatitis has a cellular infiltrate and a CD4/CD8 ratio comparable to that in humans with atopic dermatitis. CD4+ helper T cells and in particular cells belonging to the Th2 subset play an important role in disease pathogenesis in humans. We investigated the cytokine pattern of CD4+ T cells in situ, with special emphasis on the putative presence of cells producing interleukin 4 (IL4), in cats with allergic dermatitis. Immunohistochemical procedures were used to determine that CD4+ T cells in lesional and nonlesional skin of cats with allergic dermatitis can produce IL4, as occurs in humans. Lesional and nonlesional skin of cats with allergic dermatitis had significantly more IL4+ T cells (P = 0.001) than did skin of healthy control cats. Double staining indicated that all IL4+ cells were positive for pan-T or CD4 markers. Double labeling for mast cell chymase and IL4 stained primarily different cells. Western blotting demonstrated cross-reactivity between the antibody against human IL4 and a feline recombinant IL4. These results indicate that IL4 is primarily produced by CD4+ T cells and is also present in clinically uninvolved skin, indicating a role in the pathogenesis of allergic dermatitis in cats.

  14. A Modified Method of Insulin Producing Cells’ Generation from Bone Marrow-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Paweł Czubak

    2014-01-01

    Full Text Available Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells’ transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs. In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs. We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors’ concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

  15. C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

    Directory of Open Access Journals (Sweden)

    Ning Ma

    Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

  16. Identification of a cross-reactive HLA-DRB1*0301-restricted CD4 T cell response directed against cholesterol-binding cytolysins from two different pathogens.

    Science.gov (United States)

    Paschen, Annette; Song, Mingxia; Schenk, Simone; Janda, Jozef; Nguyen, Xuan Duc; Osen, Wolfram; Schadendorf, Dirk; Geginat, Gernot

    2006-07-01

    Cholesterol-binding cytolysins constitute an evolutionarily conserved family of pore-forming proteins expressed by different gram-positive pathogens. Listeriolysin O, one well-characterized member of the cytolysin family, is also known to induce specific CD4 and CD8 T cell responses upon infection of mice with Listeria monocytogenes. Here we describe an HLA-DRB1*0301-restricted listeriolysin O-derived T cell epitope that is conserved among several members of the cytolysin family. An HLA-DRB1*0301-restricted CD4+ T cell line, established from spleen lymphocytes of L. monocytogenes-infected HLA-DRB1*0301-transgenic mice, cross-reacted with a homologous peptide from perfringolysin O, a cytolysin expressed by Clostridium perfringens. Ex vivo analysis of infected mice revealed an even broader cross-reaction of T cells with homologous peptides derived from perfringolysin O, streptolysin O, and cereolysin O. Interestingly, a cross-reactive memory CD4+ T cell response against the homologous peptides derived from listeriolysin O and perfringolysin O could also be detected in the blood from healthy HLA-DRB1*0301+ human donors. Remarkably, this response was even present in donors who did not exhibit a memory T cell reactivity against a second, non-conserved HLA-DRB1*0301-restricted LLO-derived CD4 T cell epitope, suggesting that cytolysin-producing bacteria other than L. monocytogenes can stimulate a cross-reactive cytolysin-specific immunity.

  17. Thymoproteasomes produce unique peptide motifs for positive selection of CD8(+) T cells.

    Science.gov (United States)

    Sasaki, Katsuhiro; Takada, Kensuke; Ohte, Yuki; Kondo, Hiroyuki; Sorimachi, Hiroyuki; Tanaka, Keiji; Takahama, Yousuke; Murata, Shigeo

    2015-01-01

    Positive selection in the thymus provides low-affinity T-cell receptor (TCR) engagement to support the development of potentially useful self-major histocompatibility complex class I (MHC-I)-restricted T cells. Optimal positive selection of CD8(+) T cells requires cortical thymic epithelial cells that express β5t-containing thymoproteasomes (tCPs). However, how tCPs govern positive selection is unclear. Here we show that the tCPs produce unique cleavage motifs in digested peptides and in MHC-I-associated peptides. Interestingly, MHC-I-associated peptides carrying these tCP-dependent motifs are enriched with low-affinity TCR ligands that efficiently induce the positive selection of functionally competent CD8(+) T cells in antigen-specific TCR-transgenic models. These results suggest that tCPs contribute to the positive selection of CD8(+) T cells by preferentially producing low-affinity TCR ligand peptides.

  18. Detection of PIVKA II produced by human hepatoma cells in nude mice.

    Science.gov (United States)

    Kohda, H; Ono, M; Sekiya, C; Ohta, H; Ohhira, M; Ohhira, M; Yoshida, Y; Ikeda, N; Namiki, M

    1991-03-01

    A novel experimental nude mouse model, which is useful for investigation of the mechanisms of PIVKA II synthesis, was established by inoculation with PIVKA II-producing human hepatoma cells (huH-1). We have found markedly elevated levels of PIVKA II in the plasma of nude mice transplanted with huH-1 cells and increased PIVKA II content in huH-1 tumor tissues. Whereas we have not found detectable level of PIVKA II neither in the plasma nor in tumor tissues of nude mice transplanted different human hepatoma cells (HLF) which is not producing PIVKA II. Histology of the tumor tissues produced by huH-1 cells revealed a thick trabecular pattern with blood spaces.

  19. Visualization and identification of IL-7 producing cells in reporter mice.

    Directory of Open Access Journals (Sweden)

    Renata I Mazzucchelli

    Full Text Available Interleukin-7 (IL-7 is required for lymphocyte development and homeostasis although the actual sites of IL-7 production have never been clearly identified. We produced a bacterial artificial chromosome (BAC transgenic mouse expressing ECFP in the Il7 locus. The construct lacked a signal peptide and ECFP (enhanced cyan fluorescent protein accumulated inside IL-7-producing stromal cells in thoracic thymus, cervical thymus and bone marrow. In thymus, an extensive reticular network of IL-7-containing processes extended from cortical and medullary epithelial cells, closely contacting thymocytes. Central memory CD8 T cells, which require IL-7 and home to bone marrow, physically associated with IL-7-producing cells as we demonstrate by intravital imaging.

  20. Deciphering the responses of root border-like cells of Arabidopsis and flax to pathogen-derived elicitors.

    Science.gov (United States)

    Plancot, Barbara; Santaella, Catherine; Jaber, Rim; Kiefer-Meyer, Marie Christine; Follet-Gueye, Marie-Laure; Leprince, Jérôme; Gattin, Isabelle; Souc, Céline; Driouich, Azeddine; Vicré-Gibouin, Maïté

    2013-12-01

    Plant pathogens including fungi and bacteria cause many of the most serious crop diseases. The plant innate immune response is triggered upon recognition of microbe-associated molecular patterns (MAMPs) such as flagellin22 and peptidoglycan. To date, very little is known of MAMP-mediated responses in roots. Root border cells are cells that originate from root caps and are released individually into the rhizosphere. Root tips of Arabidopsis (Arabidopsis thaliana) and flax (Linum usitatissimum) release cells known as "border-like cells." Whereas root border cells of pea (Pisum sativum) are clearly involved in defense against fungal pathogens, the function of border-like cells remains to be established. In this study, we have investigated the responses of root border-like cells of Arabidopsis and flax to flagellin22 and peptidoglycan. We found that both MAMPs triggered a rapid oxidative burst in root border-like cells of both species. The production of reactive oxygen species was accompanied by modifications in the cell wall distribution of extensin epitopes. Extensins are hydroxyproline-rich glycoproteins that can be cross linked by hydrogen peroxide to enhance the mechanical strength of the cell wall. In addition, both MAMPs also caused deposition of callose, a well-known marker of MAMP-elicited defense. Furthermore, flagellin22 induced the overexpression of genes involved in the plant immune response in root border-like cells of Arabidopsis. Our findings demonstrate that root border-like cells of flax and Arabidopsis are able to perceive an elicitation and activate defense responses. We also show that cell wall extensin is involved in the innate immunity response of root border-like cells.

  1. SCR96, a small cysteine-rich secretory protein of Phytophthora cactorum, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance.

    Science.gov (United States)

    Chen, Xiao-Ren; Li, Yan-Peng; Li, Qi-Yuan; Xing, Yu-Ping; Liu, Bei-Bei; Tong, Yun-Hui; Xu, Jing-You

    2016-05-01

    Peptides and small molecules produced by both the plant pathogen Phytophthora and host plants in the apoplastic space mediate the relationship between the interplaying organisms. Various Phytophthora apoplastic effectors, including small cysteine-rich (SCR) secretory proteins, have been identified, but their roles during interaction remain to be determined. Here, we identified an SCR effector encoded by scr96, one of three novel genes encoding SCR proteins in P. cactorum with similarity to the P. cactorum phytotoxic protein PcF. Together with the other two genes, scr96 was transcriptionally induced throughout the developmental and infection stages of the pathogen. These genes triggered plant cell death (PCD) in the Solanaceae, including Nicotiana benthamiana and tomato. The scr96 gene did not show single nucleotide polymorphisms in a collection of P. cactorum isolates from different countries and host plants, suggesting that its role is essential and non-redundant during infection. Homologues of SCR96 were identified only in oomycetes, but not in fungi and other organisms. A stable protoplast transformation protocol was adapted for P. cactorum using green fluorescent protein as a marker. The silencing of scr96 in P. cactorum caused gene-silenced transformants to lose their pathogenicity on host plants and these transformants were significantly more sensitive to oxidative stress. Transient expression of scr96 partially recovered the virulence of gene-silenced transformants on plants. Overall, our results indicate that the P. cactorum scr96 gene encodes an important virulence factor that not only causes PCD in host plants, but is also important for pathogenicity and oxidative stress tolerance.

  2. Staphylococcus aureus produces membrane-derived vesicles that induce host cell death.

    Directory of Open Access Journals (Sweden)

    Mamata Gurung

    Full Text Available Gram-negative bacteria produce outer membrane vesicles that play a role in the delivery of virulence factors to host cells. However, little is known about the membrane-derived vesicles (MVs produced by gram-positive bacteria. The present study examined the production of MVs from Staphylococcus aureus and investigated the delivery of MVs to host cells and subsequent cytotoxicity. Four S. aureus strains tested, two type strains and two clinical isolates, produced spherical nanovesicles during in vitro culture. MVs were also produced during in vivo infection of a clinical S. aureus isolate in a mouse pneumonia model. Proteomic analysis showed that 143 different proteins were identified in the S. aureus-derived MVs. S. aureus MVs were interacted with the plasma membrane of host cells via a cholesterol-rich membrane microdomain and then delivered their component protein A to host cells within 30 min. Intact S. aureus MVs induced apoptosis of HEp-2 cells in a dose-dependent manner, whereas lysed MVs neither delivered their component into the cytosol of host cells nor induced cytotoxicity. In conclusion, this study is the first report that S. aureus MVs are an important vehicle for delivery of bacterial effector molecules to host cells.

  3. Pathogen recognition by Toll-like receptor 2 activates Weibel-Palade body exocytosis in human aortic endothelial cells.

    Science.gov (United States)

    Into, Takeshi; Kanno, Yosuke; Dohkan, Jun-ichi; Nakashima, Misako; Inomata, Megumi; Shibata, Ken-ichiro; Lowenstein, Charles J; Matsushita, Kenji

    2007-03-16

    The endothelial cell-specific granule Weibel-Palade body releases vasoactive substances capable of modulating vascular inflammation. Although innate recognition of pathogens by Toll-like receptors (TLRs) is thought to play a crucial role in promotion of inflammatory responses, the molecular basis for early-phase responses of endothelial cells to bacterial pathogens has not fully been understood. We here report that human aortic endothelial cells respond to bacterial lipoteichoic acid (LTA) and synthetic bacterial lipopeptides, but not lipopolysaccharide or peptidoglycan, to induce Weibel-Palade body exocytosis, accompanied by release or externalization of the storage components von Willebrand factor and P-selectin. LTA could activate rapid Weibel-Palade body exocytosis through a TLR2- and MyD88-dependent mechanism without de novo protein synthesis. This process was at least mediated through MyD88-dependent phosphorylation and activation of phospholipase Cgamma. Moreover, LTA activated interleukin-1 receptor-associated kinase-1-dependent delayed exocytosis with de novo protein synthesis and phospholipase Cgamma-dependent activation of the NF-kappaB pathway. Increased TLR2 expression by transfection or interferon-gamma treatment increased TLR2-mediated Weibel-Palade body exocytosis, whereas reduced TLR2 expression under laminar flow decreased the response. Thus, we propose a novel role for TLR2 in induction of a primary proinflammatory event in aortic endothelial cells through Weibel-Palade body exocytosis, which may be an important step for linking innate recognition of bacterial pathogens to vascular inflammation.

  4. Vitamin A Impairs the Reprogramming of Tregs into IL-17-Producing Cells during Intestinal Inflammation

    Science.gov (United States)

    Tejón, Gabriela; Manríquez, Valeria; De Calisto, Jaime; Flores-Santibáñez, Felipe; Hidalgo, Yessia; Crisóstomo, Natalia; Fernández, Dominique; Sauma, Daniela; Mora, J. Rodrigo; Bono, María R.; Rosemblatt, Mario

    2015-01-01

    Maintaining the identity of Foxp3+ regulatory T cells (Tregs) is critical for controlling immune responses in the gut, where an imbalance between Tregs and T effector cells has been linked to inflammatory bowel disease. Accumulating evidence suggests that Tregs can convert into Th17 cells and acquire an inflammatory phenotype. In this study, we used an adoptive transfer model of Ag-specific T cells to study the contribution of different factors to the reprogramming of in vitro-generated Treg cells (iTreg) into IL-17-producing cells in a mouse model of gut inflammation in vivo. Our results show that intestinal inflammation induces the reprogramming of iTreg cells into IL-17-producing cells and that vitamin A restrains reprogramming in the gut. We also demonstrate that the presence of IL-2 during the in vitro generation of iTreg cells confers resistance to Th17 conversion but that IL-2 and retinoic acid (RA) cooperate to maintain Foxp3 expression following stimulation under Th17-polarizing conditions. Additionally, although IL-2 and RA differentially regulate the expression of different Treg cell suppressive markers, Treg cells generated under different polarizing conditions present similar suppressive capacity. PMID:26583087

  5. In vitro pancreas duodenal homeobox-1 enhances the differentiation of pancreatic ductal epithelial cells into insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To observe whether pancreatic and duodenal homeobox factor-1 enhances the differentiation of pancreatic ductal epithelial cells into insulin-producing cells in vitro.METHODS: Rat pancreatic tissue was submitted to digestion by collegenase, ductal epithelial cells were separated by density gradient centrifugation and then cultured in RPMI1640 medium with 10% fetal bovine serum. After 3-5 passages, the cells were incubated in a six-well plate for 24 h before transfection of recombination plasmid XIHbox8VP16. Lightcycler quantitative real-time RT-PCR was used to detect the expression of PDX-1 and insulin mRNA in pancreatic epithelial cells. The expression of PDX-1 and insulin protein was analyzed by Western blotting. Insulin secretion was detected by radioimmunoassay. Insulinproducing cells were detected by dithizone-staining.RESULTS: XIHbox8 mRNA was expressed in pancreatic ductal epithelial cells. PDX-1 and insulin mRNA as well as PDX-1 and insulin protein were significantly increased in the transfected group. The production and insulin secretion of insulin-producing cells differentiated from pancreatic ductal epithelial cells were higher than those of the untransfected cells in vitro with a significant difference (1.32 ± 0.43 vs 3.48 ± 0.81, P < 0.01 at 5.6 mmol/L; 4.86 ± 1.15 vs 10.25 ± 1.32, P < 0.01 at 16.7 mmol/L).CONCLUSION: PDX-1 can differentiate rat pancreatic ductal epithelial cells into insulin-producing cells in vitro.In vitro PDX-1 transfection is a valuable strategy for increasing the source of insulin-producing cells.

  6. Retinoic acid primes human dendritic cells to induce gut-homing, IL-10-producing regulatory T cells

    NARCIS (Netherlands)

    Bakdash, G.; Vogelpoel, L.T.; Capel, T.M. van; Kapsenberg, M.L.; Jong, E.C. de

    2015-01-01

    The vitamin A metabolite all-trans retinoic acid (RA) is an important determinant of intestinal immunity. RA primes dendritic cells (DCs) to express CD103 and produce RA themselves, which induces the gut-homing receptors alpha4beta7 and CCR9 on T cells and amplifies transforming growth factor (TGF)-

  7. Pathogenic Mechanism of Mouse Brain Damage Caused by Oral Infection with Shiga Toxin-Producing Escherichia coli O157:H7

    Science.gov (United States)

    Kita, Eiji; Yunou, Yoshihisa; Kurioka, Takaaki; Harada, Hiroko; Yoshikawa, Shinji; Mikasa, Keiichi; Higashi, Nobutaka

    2000-01-01

    In a previous study, we showed that infection with Shiga toxin (Stx)-producing Escherichia coli O157:H7 (strain SmrN-9) caused neurologic symptoms in malnourished mice with positive immunoreactions of Stx2 in brain tissues. The present study explores the mechanism of how Stx injures the vascular endothelium to enter the central nervous system in mice. Oral infection with strain SmrN-9 elicited a tumor necrosis factor alpha (TNF-α) response in the blood as early as 2 days after infection, while Stx was first detected at 3 days postinfection. In the brain, TNF-α was detected at day 3, and its quantity was increased over the next 3 days. Frozen sections of the brains from moribound mice contained high numbers of apoptotic cells. Glycolipids recognized by an anti-Gb3 monoclonal antibody were extracted from the brain, and purified Stx2 was able to bind to the glycolipids. In human umbilical vascular endothelial cells (HUVEC) cultured with fluorescein-labeled Stx2 (100 ng/ml), TNF-α (20 U/ml) significantly facilitated the intracellular compartmentalization of fluorescence during 24 h of incubation, suggesting the enhanced intracellular processing of Stx2. Consequently, higher levels of apoptosis in HUVEC were found at 48 h. Short-term exposure of HUVEC to Stx2 abrogated their apoptotic response to subsequent incubation with TNF-α alone or TNF-α and Stx2. In contrast, primary exposure of HUVEC to TNF-α followed by exposure to Stx2 alone or TNF-α and Stx2 induced apoptosis at the same level as obtained after 48-h incubation with these two agents. These results suggest that the rapid production of circulating TNF-α after infection induces a state of competence in vascular endothelial cells to undergo apoptosis, which would be finally achieved by subsequent elevation of Stx in the blood. In this synergistic action, target cells must be first exposed to TNF-α. Such cell injury may be a prerequisite to brain damage after infection with Stx-producing E. coli O157:H7

  8. Liver dendritic cells present bacterial antigens and produce cytokines upon Salmonella encounter.

    Science.gov (United States)

    Johansson, Cecilia; Wick, Mary Jo

    2004-02-15

    The capacity of murine liver dendritic cells (DC) to present bacterial Ags and produce cytokines after encounter with Salmonella was studied. Freshly isolated, nonparenchymal liver CD11c(+) cells had heterogeneous expression of MHC class II and CD11b and a low level of CD40 and CD86 expression. Characterization of liver DC subsets revealed that CD8alpha(-)CD4(-) double negative cells constituted the majority of liver CD11c(+) ( approximately 85%) with few cells expressing CD8alpha or CD4. Flow cytometry analysis of freshly isolated CD11c(+) cells enriched from the liver and cocultured with Salmonella expressing green fluorescent protein (GFP) showed that CD11c(+) MHC class II(high) cells had a greater capacity to internalize Salmonella relative to CD11c(+) MHC class II(low) cells. Moreover, both CD8alpha(-) and CD8alpha(+) liver DC internalized bacteria with similar efficiency after both in vitro and in vivo infection. CD11c(+) cells enriched from the liver could also process Salmonella for peptide presentation on MHC class I and class II to primary, Ag-specific T cells after internalization requiring actin cytoskeletal rearrangements. Flow cytometry analysis of liver CD11c(+) cells infected with Salmonella expressing GFP showed that both CD8alpha(-) and CD8alpha(+) DC produced IL-12p40 and TNF-alpha. The majority of cytokine-positive cells did not contain bacteria (GFP(-)) whereas only a minor fraction of cytokine-positive cells were GFP(+). Furthermore, only approximately 30-50% of liver DC containing bacteria (GFP(+)) produced cytokines. Thus, liver DC can internalize and process Salmonella for peptide presentation to CD4(+) and CD8(+) T cells and elicit proinflammatory cytokine production upon Salmonella encounter, suggesting that DC in the liver may contribute to immunity against hepatotropic bacteria.

  9. From the regulatory functions of B cells to the identification of cytokine-producing plasma cell subsets.

    Science.gov (United States)

    Dang, Van Duc; Hilgenberg, Ellen; Ries, Stefanie; Shen, Ping; Fillatreau, Simon

    2014-06-01

    B lymphocytes have a unique role as antibody-producing cells. Antibodies are key mediators of humoral immunity against infections, and are thought to account for the protection afforded by successful vaccines. B cells can also secrete cytokines and subsequently regulate immune responses mediated by T and innate cells. Remarkably, recent studies identified plasma blasts/plasma cells as the main types of activated B cells producing the cytokines interleukin (IL)-10, IL-35, tumor necrosis factor (TNF)-α, IL-17, and GM-CSF in various contexts in mice. Here, we discuss these observations, which suggest the existence of various subsets of plasma blast/plasma cells distinguishable through their cytokine expression pattern.

  10. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  11. Fusion of proinsulin-producing bone marrow-derived cells with hepatocytes in diabetes.

    Science.gov (United States)

    Fujimiya, Mineko; Kojima, Hideto; Ichinose, Masumi; Arai, Ryohachi; Kimura, Hiroshi; Kashiwagi, Atsunori; Chan, Lawrence

    2007-03-06

    We previously reported that diabetes in mice is associated with the appearance of proinsulin-producing (Proins-P) cells in the liver. It was unclear, however, whether these Proins-P bone marrow-derived cells (BMDC) merely transit through the liver or undergo fusion with hepatocytes, normally an extremely rare event. In this study, we found that, in diabetes, BMDC in the liver produce not only Proins but also TNF-alpha, suggesting that diabetes reprograms gene expression in BMDC, turning on "inappropriate" genes. Bone marrow transplantation using genetically marked donor and recipient mice showed that fusion occurs between Proins-P BMDC and hepatocytes. Cell fusion is further supported by the presence of the Y chromosome in Proins-P cells in female mice that received male bone marrow transplantation cells. Morphologically, Proins-P fusion cells are albumin-producing hepatocytes that constitute approximately 2.5% of the liver section area 5 months after diabetes induction. An extensive search failed to reveal any fusion cells in nondiabetic mice. Thus, diabetes causes fusion between Proins-P BMDC and hepatocytes in vivo, an observation that has implications for the pathophysiology of diabetes as well as the fundamental biology of heterotypic cell fusion.

  12. Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells

    Science.gov (United States)

    Zalzman, Michal; Gupta, Sanjeev; Giri, Ranjit K.; Berkovich, Irina; Sappal, Baljit S.; Karnieli, Ohad; Zern, Mark A.; Fleischer, Norman; Efrat, Shimon

    2003-06-01

    Beta-cell replacement is considered to be the most promising approach for treatment of type 1 diabetes. Its application on a large scale is hindered by a shortage of cells for transplantation. Activation of insulin expression, storage, and regulated secretion in stem/progenitor cells offers novel ways to overcome this shortage. We explored whether fetal human progenitor liver cells (FH) could be induced to differentiate into insulin-producing cells after expression of the pancreatic duodenal homeobox 1 (Pdx1) gene, which is a key regulator of pancreatic development and insulin expression in beta cells. FH cells possess a considerable replication capacity, and this was further extended by introduction of the gene for the catalytic subunit of human telomerase. Immortalized FH cells expressing Pdx1 activated multiple beta-cell genes, produced and stored considerable amounts of insulin, and released insulin in a regulated manner in response to glucose. When transplanted into hyperglycemic immunodeficient mice, the cells restored and maintained euglycemia for prolonged periods. Quantitation of human C-peptide in the mouse serum confirmed that the glycemia was normalized by the transplanted human cells. This approach offers the potential of a novel source of cells for transplantation into patients with type 1 diabetes.

  13. In vitro cultivation of human fetal pancreatic ductal stem cells and their differentiation into insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Zhong-Xiang Yao; Mao-Lin Qin; Jian-Jun Liu; Xing-Shu Chen; De-Shan Zhou

    2004-01-01

    AIM: To isolate, culture and identify the human fetal pancreatic ductal stem cells in vitro, and to observe the potency of these multipotential cells differentiation into insulin-producing cells.METHODS: The human fetal pancreas was digested by 1 g/L collagease type Ⅳ and then 2.5 g/L trypsin was used to isolate the pancreatic ducta stem cells, followed by culture in serum-free, glucose-free DMEM media with some additional chemical substrates in vitro (according to the different Stage). The cells were induced by glucose-free (control),5 mmol/L, 17.8 mmol/L and 25 mmol/L glucose, respectively.The cell types of differentiated cells were identified using immunocytochemical staining.RESULTS: The shape of human fetal pancreatic ductal stem cells culturedin vitro was firstly fusiform in the first 2 wk,and became monolayer and cobblestone pattern after another 3 to 4 wk. After induced and differentiated by the glucose of different concentrations for another 1 to 2 wk,the cells formed the pancreatic islet-like structures. The identification and potency of these cells were then identified by using the pancreatic ductal stem cell marker, cytokeratin-19 (CK-19), pancreatic β cell marker, insulin and pancreatic α cell marker, glucagons with immunocytochemical staining.At the end of the second week, 95.2% of the cells were positive for CK-19 immunoreactivity. Up to 22.7% of the cells induced by glucose were positive for insulin immunoreactivity, and less than 3.8% of the cells were positive for glucagon immunoreactivity in pancreatic isletlike structures. The positive ratio of immunoreactive staining was dependent on the concentration of glucose, and it was observed that the 17.8 mmol/L glucose stimulated effectively to produce insulin- and glucagons-producing cells.CONCLUSION: The human fetal pancreatic ductal stem cells are capable of proliferation in vitro. These cells have multidifferentiation potential and can be induced by glucose and differentiated into insulin-producing

  14. Programmed cell death in barley aleurone cells is not directly stimulated by reactive oxygen species produced in response to gibberellin.

    Science.gov (United States)

    Aoki, Nozomi; Ishibashi, Yushi; Kai, Kyohei; Tomokiyo, Reisa; Yuasa, Takashi; Iwaya-Inoue, Mari

    2014-05-01

    The cereal aleurone layer is a secretory tissue that produces enzymes to hydrolyze the starchy endosperm during germination. We recently demonstrated that reactive oxygen species (ROS), produced in response to gibberellins (GA), promoted GAMyb expression, which induces α-amylase expression in barley aleurone cells. On the other hand, ROS levels increase during programmed cell death (PCD) in barley aleurone cells, and GAMyb is involved in PCD of these cells. In this study, we investigated whether the ROS produced in response to GA regulate PCD directly by using mutants of Slender1 (SLN1), a DELLA protein that negatively regulates GA signaling. The wild-type, the sln1c mutant (which exhibits gibberellin-type signaling even in the absence of GA), and the Sln1d mutant (which is gibberellin-insensitive with respect to α-amylase production) all produced ROS in response to GA, suggesting that ROS production in aleurone cells in response to GA is independent of GA signaling through this DELLA protein. Exogenous GA promoted PCD in the wild-type. PCD in sln1c was induced even without exogenous GA (and so without induction of ROS), whereas PCD in Sln1d was not induced in the presence of exogenous GA, even though the ROS content increased significantly in response to GA. These results suggest that PCD in barley aleurone cells is not directly stimulated by ROS produced in response to GA but is regulated by GA signaling through DELLA protein.

  15. The Chinese highly pathogenic porcine reproductive and respiratory syndrome virus infection suppresses Th17 cells response in vivo.

    Science.gov (United States)

    Zhang, Long; Zhou, Lei; Ge, Xinna; Guo, Xin; Han, Jun; Yang, Hanchun

    2016-06-30

    Porcine reproductive and respiratory syndrome virus (PRRSV) has been shown to immunomodulate innate and adaptive immunity of pigs. The Chinese highly pathogenic PRRSV (HP-PRRSV) infection causes severe bacterial secondary infection in pigs. However, the mechanism in relation to the bacterial secondary infection induced by HP-PRRSV remains unknown. In the present study, Th17 cells response in peripheral blood, lungs, spleens and lymph nodes of piglets were analyzed, and bacterial loads in lungs of piglets were examined upon HP-PRRSV infection. Meanwhile the changes of CD4(+) and CD8(+) T cells in peripheral blood of the inoculated piglets were analyzed. The results showed that HP-PRRSV-inoculated piglets exhibited a suppressed Th17 cells response in peripheral blood and a reduced number of Th17 cells in lungs, and higher bacterial loads in lungs, compared with low pathogenic PRRSV. Moreover, HP-PRRSV obviously resulted in severe depletion of porcine T cells in peripheral blood at the early stage of infection. These findings indicate that HP-PRRSV infection suppresses the response of Th17 cells that play an important role in combating bacterial infections, suggesting a possible correlation between the suppression of Th17 cells response in vivo and bacterial secondary infection induced by HP-PRRSV. Our present study adds a novel insight into better understanding of the pathogenesis of the Chinese HP-PRRSV.

  16. Blockade of CD47 ameliorates autoimmune inflammation in CNS by suppressing IL-1-triggered infiltration of pathogenic Th17 cells.

    Science.gov (United States)

    Gao, Qiangguo; Zhang, Yi; Han, Chaofeng; Hu, Xiang; Zhang, Hua; Xu, Xiongfei; Tian, Jun; Liu, Yiqi; Ding, Yuanyuan; Liu, Juan; Wang, Chunmei; Guo, Zhenhong; Yang, Yongguang; Cao, Xuetao

    2016-05-01

    The migration of Th17 cells into central nervous system (CNS) tissue is the key pathogenic step in experimental autoimmune encephalomyelitis (EAE) model. However, the mechanism underlying the pathogenic Th17 cell migration remains elusive. Here we report that blockade of CD47 with CD47-Fc fusion protein is effective in preventing and curing EAE by impairing infiltration of Th17 cells into CNS. However, CD47 deficiency does not directly impair the migration of Th17 cells. Mechanistic studies showed that CD47 deficiency inhibited degradation of inducible nitric oxide synthase (iNOS) in proteasome of macrophages by Src activation and led to the increased nitric oxide (NO) production. Then NO suppressed inflammasome activation-induced IL-1β production. This lower IL-1β reduces the expression of IL-1R1 and migration-related chemokine receptors on CD47(-/-) Th17 cells, inhibiting the ability of Th17 cells to infiltrate into the CNS of CD47(-/-) mice and therefore suppressing EAE development. In vivo administration of exogenous IL-1β indeed promoted the infiltration CD47(-/-) Th17 cells into CNS and antagonized the protective role of CD47 deficiency in EAE pathogenesis. Our results demonstrate a potential preventive and therapeutic application of CD47 blockade in controlling EAE development.

  17. Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

    Directory of Open Access Journals (Sweden)

    Juliana Branco Novo

    2012-01-01

    Full Text Available Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher’s patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr− cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa and secreted (63–69 kDa form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources.

  18. B cells produce less IL-10, IL-6 and TNF-α in myasthenia gravis.

    Science.gov (United States)

    Yilmaz, Vuslat; Oflazer, Piraye; Aysal, Fikret; Parman, Yeşim G; Direskeneli, Haner; Deymeer, Feza; Saruhan-Direskeneli, Güher

    2015-06-01

    B cells from myasthenia gravis (MG) patients with autoantibodies (Aab) against acetylcholine receptor (AChR), muscle-specific kinase (MuSK) or with no detectable Aab were investigated as cytokine producing cells in this study. B cells were evaluated for memory phenotypes and expressions of IL-10, IL-6 and IL-12A. Induced productions of IL-10, IL-6, IL-12p40, TNF-α and LT from isolated B cells in vitro were measured by immunoassays. MG patients receiving immunosuppressive treatment had higher proportions of memory B cells compared with healthy controls and untreated patients. With CD40 stimulation MG patients produced significantly lower levels of IL-10, IL-6. With CD40 and B cell receptor stimulation of B cells, TNF-α production also decreased in addition to these cytokines. The lower levels of these cytokine productions were not related to treatment. Our results confirm a disturbance of B cell subpopulations in MG subgroups on immunosuppressive treatment. B cell derived IL-10, IL-6 and TNF-α are down-regulated in MG, irrespective of different antibody productions. Ineffective cytokine production by B cells may be a susceptibility factor in dysregulation of autoimmune Aab production.

  19. Conventional NK cells can produce IL-22 and promote host defense in Klebsiella pneumoniae pneumonia.

    Science.gov (United States)

    Xu, Xin; Weiss, Ido D; Zhang, Hongwei H; Singh, Satya P; Wynn, Thomas A; Wilson, Mark S; Farber, Joshua M

    2014-02-15

    It was reported that host defense against pulmonary Klebsiella pneumoniae infection requires IL-22, which was proposed to be of T cell origin. Supporting a role for IL-22, we found that Il22(-/-) mice had decreased survival compared with wild-type mice after intratracheal infection with K. pneumoniae. Surprisingly, however, Rag2(-/-) mice did not differ from wild-type mice in survival or levels of IL-22 in the lungs postinfection with K. pneumoniae. In contrast, K. pneumoniae-infected Rag2(-/-)Il2rg(-/-) mice failed to produce IL-22. These data suggested a possible role for NK cells or other innate lymphoid cells in host defense and production of IL-22. Unlike NK cell-like innate lymphoid cells that produce IL-22 and display a surface phenotype of NK1.1(-)NKp46(+)CCR6(+), lung NK cells showed the conventional phenotype, NK1.1(+)NKp46(+)CCR6(-). Mice depleted of NK cells using anti-asialo GM1 showed decreased survival and higher lung bacterial counts, as well as increased dissemination of K. pneumoniae to blood and liver, compared with control-treated mice. NK cell depletion also led to decreased production of IL-22 in the lung. Within 1 d postinfection, although there was no increase in the number of lung NK cells, a subset of lung NK cells became competent to produce IL-22, and such cells were found in both wild-type and Rag2(-/-) mice. Our data suggest that, during pulmonary infection of mice with K. pneumoniae, conventional NK cells are required for optimal host defense, which includes the production of IL-22.

  20. Distribution and lateral mobility of DC-SIGN on immature dendritic cells--implications for pathogen uptake.

    Science.gov (United States)

    Neumann, Aaron K; Thompson, Nancy L; Jacobson, Ken

    2008-03-01

    The receptor C-type lectin DC-SIGN (CD209) is expressed by immature dendritic cells, functioning as an antigen capture receptor and cell adhesion molecule. Various microbes, including HIV-1, can exploit binding to DC-SIGN to gain entry to dendritic cells. DC-SIGN forms discrete nanoscale clusters on immature dendritic cells that are thought to be important for viral binding. We confirmed that these DC-SIGN clusters also exist both in live dendritic cells and in cell lines that ectopically express DC-SIGN. Moreover, DC-SIGN has an unusual polarized lateral distribution in the plasma membrane of dendritic cells and other cells: the receptor is preferentially localized to the leading edge of the dendritic cell lamellipod and largely excluded from the ventral plasma membrane. Colocalization of DC-SIGN clusters with endocytic activity demonstrated that surface DC-SIGN clusters are enriched near the leading edge, whereas endocytosis of these clusters occurred preferentially at lamellar sites posterior to the leading edge. Therefore, we predicted that DC-SIGN clusters move from the leading edge to zones of internalization. Two modes of lateral mobility were evident from the trajectories of DC-SIGN clusters at the leading edge, directed and non-directed mobility. Clusters with directed mobility moved in a highly linear fashion from the leading edge to rearward locations in the lamella at remarkably high velocity (1420+/-260 nm/second). Based on these data, we propose that DC-SIGN clusters move from the leading edge--where the dendritic cell is likely to encounter pathogens in tissue--to a medial lamellar site where clusters enter the cell via endocytosis. Immature dendritic cells may acquire and internalize HIV and other pathogens by this process.

  1. In vitro cell cultures obtained from different explants of Corylus avellana produce Taxol and taxanes

    Directory of Open Access Journals (Sweden)

    Cavalli Francesca

    2006-12-01

    Full Text Available Abstract Background Taxol is an effective antineoplastic agent, originally extracted from the bark of Taxus brevifolia with a low yield. Many attempts have been made to produce Taxol by chemical synthesis, semi-synthesis and plant tissue cultures. However, to date, the availability of this compound is not sufficient to satisfy the commercial requirements. The aim of the present work was to produce suspension cell cultures from plants not belonging to Taxus genus and to verify whether they produced Taxol and taxanes. For this purpose different explants of hazel (Corylus avellana species were used to optimize the protocol for inducing in vitro callus, an undifferentiated tissue from which suspension cell cultures were established. Results Calli were successfully induced from stems, leaves and seeds grown in various hormone concentrations and combinations. The most suitable callus to establish suspension cell cultures was obtained from seeds. Media recovered from suspension cell cultures contained taxanes, and showed antiproliferative activity on human tumour cells. Taxol, 10-deacetyltaxol and 10-deacetylbaccatin III were the main taxanes identified. The level of Taxol recovered from the media of hazel cultures was similar to that found in yew cultures. Moreover, the production of taxanes in hazel cell cultures increased when elicitors were used. Conclusion Here we show that hazel cell cultures produce Taxol and taxanes under controlled conditions. This result suggests that hazel possesses the enzymes for Taxol production, which until now was considered to be a pathway particular to Taxus genus. The main benefit of producing taxanes through hazel cell cultures is that hazel is widely available, grows at a much faster rate in vivo, and is easier to cultivate in vitro than yew. In addition, the production of callus directly from hazel seeds shortens the culture time and minimizes the probability of contamination. Therefore, hazel could become a

  2. A cell sorting protocol for selecting high-producing sub-populations of Sf9 and High Five™ cells.

    Science.gov (United States)

    Vidigal, João; Dias, Mafalda M; Fernandes, Fabiana; Patrone, Marco; Bispo, Cláudia; Andrade, Cláudia; Gardner, Rui; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

    2013-12-01

    Insect cell lines such as Sf9 and High Five™ have been widely used to produce recombinant proteins mostly by the lytic baculovirus vector system. We have recently established an expression platform in Sf9 cells using a fluorescence-based recombinase mediated cassette exchange (RMCE) strategy which has similar development timelines but avoids baculovirus infection. To expedite cell engineering efforts, a robust fluorescence-activated cell sorting (FACS) protocol optimized for insect cells was developed here. The standard sorting conditions used for mammalian cells proved to be unsuitable, resulting in post-sorting viabilities below 10% for both cell lines. We found that the extreme sensitivity to the shear stress displayed by Sf9 and High Five™ cells was the limiting factor, and using Pluronic F-68 in the cell suspension could increase post-sorting viabilities in a dose dependent manner. The newly developed protocol was then used to sort stable populations of both cell lines tagged with a DsRed-expressing cassette. Before sorting, the average fluorescence intensity of the Sf9 cell population was 3-fold higher than that of the High Five™ cell population. By enriching with the 10% strongest DsRed-fluorescent cells, the productivity of both cell populations could be successfully improved. The established sorting protocol potentiates the use of RMCE technology for recombinant protein production in insect cells.

  3. Complement component C5a permits the coexistence of pathogenic Th17 cells and type I IFN in lupus.

    Science.gov (United States)

    Pawaria, Sudesh; Ramani, Kritika; Maers, Kelly; Liu, Youhua; Kane, Lawrence P; Levesque, Marc C; Biswas, Partha S

    2014-10-01

    Systemic lupus erythematosus (SLE) is a type I IFN (IFN-I)-driven autoimmune disorder with exaggerated B and Th cell responses. Th17 cells, a recently identified Th cell subset, have been strongly implicated in the pathogenesis of SLE. Because IFN-I suppresses the generation and expansion of Th17 cells in an IL-27-dependent manner, it is unclear how pathogenic Th17 cells are generated in SLE in the presence of an environment characterized by high IFN-I levels. In this study, we showed that activation of c5aR on murine macrophages blocked IFN-I-mediated IL-27 production, thus permitting the development of Th17 cells. C5aR activation on IFN-I-responsive macrophages inhibits IRF-1-mediated transactivation of IL-27 gene expression via the PI3K/Akt pathway. Consistently, C5aR-deficient mice exhibited increased IL-27 expression and fewer Th17 cells and consequently developed reduced lupus nephritis in comparison with wild-type mice. In support of these findings in mice, we found that C5a inhibited IFN-I-induced IL-27 production from macrophages of lupus subjects. Moreover, the level of serum C5a correlated with Th17 frequency in peripheral blood. Collectively, these data indicate an essential role for C5a in the generation of pathogenic Th17 responses in SLE. Thus, therapeutic strategies to block C5aR activation may be beneficial for controlling pathogenic Th17-mediated inflammation in SLE.

  4. Host cell capable of producing enzymes useful for degradation of lignocellulosic material

    Science.gov (United States)

    Los, Alrik Pieter; Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Damveld, Robbertus Antonius

    2015-08-18

    The invention relates to a host cell comprising at least four different heterologous polynucleotides chosen from the group of polynucleotides encoding cellulases, hemicellulases and pectinases, wherein the host cell is capable of producing the at least four different enzymes chosen from the group of cellulases, hemicellulases and pectinases, wherein the host cell is a filamentous fungus and is capable of secretion of the at least four different enzymes. This host cell can suitably be used for the production of an enzyme composition that can be used in a process for the saccharification of cellulosic material.

  5. Within Host Evolution Selects for a Dominant Genotype of Mycobacterium tuberculosis while T Cells Increase Pathogen Genetic Diversity

    Science.gov (United States)

    Copin, Richard; Louie, Eddie; Escuyer, Vincent; Gagneux, Sebastien; Palmer, Guy H.

    2016-01-01

    Molecular epidemiological assessments, drug treatment optimization, and development of immunological interventions all depend on understanding pathogen adaptation and genetic variation, which differ for specific pathogens. Mycobacterium tuberculosis is an exceptionally successful human pathogen, yet beyond knowledge that this bacterium has low overall genomic variation but acquires drug resistance mutations, little is known of the factors that drive its population genomic characteristics. Here, we compared the genetic diversity of the bacteria that established infection to the bacterial populations obtained from infected tissues during murine M. tuberculosis pulmonary infection and human disseminated M. bovis BCG infection. We found that new mutations accumulate during in vitro culture, but that in vivo, purifying selection against new mutations dominates, indicating that M. tuberculosis follows a dominant lineage model of evolution. Comparing bacterial populations passaged in T cell-deficient and immunocompetent mice, we found that the presence of T cells is associated with an increase in the diversity of the M. tuberculosis genome. Together, our findings put M. tuberculosis genetic evolution in a new perspective and clarify the impact of T cells on sequence diversity of M. tuberculosis. PMID:27973588

  6. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells.

    Directory of Open Access Journals (Sweden)

    Tania S Quiroz

    Full Text Available The availability of the complete genome sequence of several Salmonella enterica serovars has revealed the presence of unstable genetic elements in these bacteria, such as pathogenicity islands and prophages. This is the case of Salmonella enterica serovar Enteritidis (S. Enteritidis, a bacterium that causes gastroenteritis in humans and systemic infection in mice. The whole genome sequence analysis for S. Enteritidis unveiled the presence of several genetic regions that are absent in other Salmonella serovars. These regions have been denominated "regions of difference" (ROD. In this study we show that ROD21, one of such regions, behaves as an unstable pathogenicity island. We observed that ROD21 undergoes spontaneous excision by two independent recombination events, either under laboratory growth conditions or during infection of murine cells. Importantly, we also found that one type of excision occurred at higher rates when S. Enteritidis was residing inside murine phagocytic cells. These data suggest that ROD21 is an unstable pathogenicity island, whose frequency of excision depends on the environmental conditions found inside phagocytic cells.

  7. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells.

    Science.gov (United States)

    Quiroz, Tania S; Nieto, Pamela A; Tobar, Hugo E; Salazar-Echegarai, Francisco J; Lizana, Rodrigo J; Quezada, Carolina P; Santiviago, Carlos A; Araya, Daniela V; Riedel, Claudia A; Kalergis, Alexis M; Bueno, Susan M

    2011-01-01

    The availability of the complete genome sequence of several Salmonella enterica serovars has revealed the presence of unstable genetic elements in these bacteria, such as pathogenicity islands and prophages. This is the case of Salmonella enterica serovar Enteritidis (S. Enteritidis), a bacterium that causes gastroenteritis in humans and systemic infection in mice. The whole genome sequence analysis for S. Enteritidis unveiled the presence of several genetic regions that are absent in other Salmonella serovars. These regions have been denominated "regions of difference" (ROD). In this study we show that ROD21, one of such regions, behaves as an unstable pathogenicity island. We observed that ROD21 undergoes spontaneous excision by two independent recombination events, either under laboratory growth conditions or during infection of murine cells. Importantly, we also found that one type of excision occurred at higher rates when S. Enteritidis was residing inside murine phagocytic cells. These data suggest that ROD21 is an unstable pathogenicity island, whose frequency of excision depends on the environmental conditions found inside phagocytic cells.

  8. Cells that emerge from embryonic explants produce fibers of type IV collagen.

    Science.gov (United States)

    Chen, J M; Little, C D

    1985-10-01

    Double immunofluorescence staining experiments designed to examine the synthesis and deposition of collagen types I and IV in cultured explants of embryonic mouse lung revealed the presence of connective tissue-like fibers that were immunoreactive with anti-type IV collagen antibodies. This observation is contrary to the widely accepted belief that type IV collagen is found only in sheet-like arrangements beneath epithelia or as a sheath-like layer enveloping bundles of nerve or muscle cells. The extracellular matrix produced by cells that migrate from embryonic mouse lung rudiments in vitro was examined by double indirect immunofluorescence microscopy. Affinity-purified monospecific polyclonal antibodies were used to examine cells after growth on glass or native collagen substrata. The data show that embryonic mesenchymal cells can produce organized fibers of type IV collagen that are not contained within a basement membrane, and that embryonic epithelial cells deposit fibers and strands of type IV collagen beneath their basal surface when grown on glass; however, when grown on a rat tail collagen substratum the epithelial cells produce a fine meshwork. To our knowledge this work represents the first report that type IV collagen can be organized by cells into a fibrous extracellular matrix that is not a basement membrane.

  9. Hox6 genes modulate in vitro differentiation of mESCs to insulin-producing cells.

    Science.gov (United States)

    Larsen, Brian M; Marty-Santos, Leilani; Newman, Micaleah; Lukacs, Derek T; Spence, Jason R; Wellik, Deneen M

    2016-10-01

    The differentiation of glucose-responsive, insulin-producing cells from ESCs in vitro is promising as a cellular therapy for the treatment of diabetes, a devastating and common disease. Pancreatic β-cells are derived from the endoderm in vivo and therefore most current protocols attempt to generate a pure population of first endoderm, then pancreas epithelium, and finally insulin-producing cells. Despite this, differentiation protocols result in mixed populations of cells that are often poorly defined, but also contain mesoderm. Using an in vitro mESC-to-β cell differentiation protocol, we show that expression of region-specific Hox genes is induced. We also show that the loss of function of the Hox6 paralogous group, genes expressed only in the mesenchyme of the pancreas (not epithelium), affect the differentiation of insulin-producing cells in vitro. This work is consistent with the important role for these mesoderm-specific factors in vivo and highlights contribution of supporting mesenchymal cells in in vitro differentiation.

  10. Virion Structure of Black Queen Cell Virus, a Common Honeybee Pathogen

    Science.gov (United States)

    Spurny, Radovan; Přidal, Antonín; Pálková, Lenka; Kiem, Hoa Khanh Tran; de Miranda, Joachim R.

    2017-01-01

    ABSTRACT Viral diseases are a major threat to honeybee (Apis mellifera) populations worldwide and therefore an important factor in reliable crop pollination and food security. Black queen cell virus (BQCV) is the etiological agent of a fatal disease of honeybee queen larvae and pupae. The virus belongs to the genus Triatovirus from the family Dicistroviridae, which is part of the order Picornavirales. Here we present a crystal structure of BQCV determined to a resolution of 3.4 Å. The virion is formed by 60 copies of each of the major capsid proteins VP1, VP2, and VP3; however, there is no density corresponding to a 75-residue-long minor capsid protein VP4 encoded by the BQCV genome. We show that the VP4 subunits are present in the crystallized virions that are infectious. This aspect of the BQCV virion is similar to that of the previously characterized triatoma virus and supports the recent establishment of the separate genus Triatovirus within the family Dicistroviridae. The C terminus of VP1 and CD loops of capsid proteins VP1 and VP3 of BQCV form 34-Å-tall finger-like protrusions at the virion surface. The protrusions are larger than those of related dicistroviruses. IMPORTANCE The western honeybee is the most important pollinator of all, and it is required to sustain the agricultural production and biodiversity of wild flowering plants. However, honeybee populations worldwide are suffering from virus infections that cause colony losses. One of the most common, and least known, honeybee pathogens is black queen cell virus (BQCV), which at high titers causes queen larvae and pupae to turn black and die. Here we present the three-dimensional virion structure of BQCV, determined by X-ray crystallography. The structure of BQCV reveals large protrusions on the virion surface. Capsid protein VP1 of BQCV does not contain a hydrophobic pocket. Therefore, the BQCV virion structure provides evidence that capsid-binding antiviral compounds that can prevent the

  11. Liver sinusoidal endothelial cells induce immunosuppressive IL-10-producing Th1 cells via the Notch pathway.

    Science.gov (United States)

    Neumann, Katrin; Rudolph, Christine; Neumann, Christian; Janke, Marko; Amsen, Derk; Scheffold, Alexander

    2015-07-01

    Under homeostasis, liver sinusoidal endothelial cells (LSECs) shift intrahepatic T-cell responses towards tolerance. However, the role of LSECs in the regulation of T-cell-induced liver inflammation is less clear. Here, we studied the capacity of LSECs to modulate pro-inflammatory Th1-cell differentiation in mice. Using in vitro co-culture systems and subsequent cytokine analysis, we showed that LSECs induced high amounts of the anti-inflammatory cytokine IL-10 in developing Th1 cells. These LSEC-stimulated Th1 cells had no pro-inflammatory capacity in vivo but instead actively suppressed an inflammatory Th1-cell-induced delayed-type hypersensitivity reaction. Blockage of IL-10 signaling in vivo inhibited immunosuppressive activity of LSEC-stimulated Th1 cells. We identified the Notch pathway as a mechanism how LSECs trigger IL-10 expression in Th1 cells. LSECs expressed high levels of the Delta-like and Jagged family of Notch ligands and induced expression of the Notch target genes hes-1 and deltex-1 in Th1 cells. Blockade of Notch signaling selectively inhibited IL-10 induction in Th1 cells by LSECs. Our findings suggest that LSEC-induced IL-10 expression in Th1 cells via the Notch pathway may contribute to the control of hepatic inflammatory immune responses by induction of a self-regulatory mechanism in pro-inflammatory Th1 cells.

  12. Immobilized gellan sulfate surface for cell adhesion and multiplication: development of cell-hybrid biomaterials using self-produced fibronectin.

    Science.gov (United States)

    Miyamoto, Keiichi; Kanemoto, Akiko; Hashimoto, Kenichi; Tokita, Masayuki; Komai, Takashi

    2002-04-08

    A new concept for cell-hybrid biomaterial is proposed in which human unbilical vein endothelial cells (HUVEC) are adhered to an immobilized gellan sulfate (GS) surface. Extra domain A containing fibronectin (EDA(+)FN) released from HUVEC is necessary for cell adhesion and multiplication. The material design in this study is based on these self-released cell adhesion proteins. The interaction between GS and EDA(+)FN was evaluated using the affinity constant (KA); the value obtained was 1.03x10(8) (M(-1)). These results suggest that the adhesion of HUVEC to GS may be supported by the adhesion of EDA(+)FN to GS. We also found that this new material adheres to HUVEC, allowing the reintroduction of EDA(+)FN, which is self-produced by the cell. This material is relatively easy to produce, not requiring the usual coating of adhesion proteins in pretreatment.

  13. [A case of alpha-cell nesidioblastosis and hyperplasia with multiple glucagon-producing endocrine cell tumor of the pancreas].

    Science.gov (United States)

    Kang, Huapyong; Kim, Sewha; Lim, Tae Seop; Lee, Hye Won; Choi, Heun; Kang, Chang Moo; Kim, Ho Guen; Bang, Seungmin

    2014-04-01

    Nesidioblastosis is a term used to describe pathologic overgrowth of pancreatic islet cells. It also means maldistribution of islet cells within the ductules of exocrine pancreas. Generally, nesidioblastosis occurs in beta-cell and causes neonatal hyperinsulinemic hypoglycemia or adult noninsulinoma pancreatogenous hypoglycemia syndrome. Alpha-cell nesidioblastosis and hyperplasia is an extremely rare disorder. It often accompanies glucagon-producing marco- and mircoadenoma without typical glucagonoma syndrome. A 35-year-old female was referred to our hospital with recurrent acute pancreatitis. On radiologic studies, 1.5 cm sized mass was noted in pancreas tail. Cytological evaluation with EUS-fine-needle aspiration suggested serous cystadenoma. She received distal pancreatectomy. The histologic examination revealed a 1.7 cm sized neuroendocrine tumor positive for immunohistochemical staining with glucagon antibody. Multiple glucagon-producing micro endocrine cell tumors were scattered next to the main tumor. Additionally, diffuse hyperplasia of pancreatic islets and ectopic proliferation of islet cells in centroacinar area, findings compatible to nesidioblastosis, were seen. These hyperplasia and almost all nesidioblastic cells were positive for glucagon immunochemistry. Even though serum glucagon level still remained higher than the reference value, she has been followed-up without any evidence of recurrence or hormone related symptoms. Herein, we report a case of alpha-cell nesidioblastosis and hyperplasia combined with glucagon-producing neuroendocrine tumor with literature review.

  14. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

    LENUS (Irish Health Repository)

    Sibartie, Shomik

    2009-01-01

    BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

  15. Correlation between standard plate count and somatic cell count milk quality results for Wisconsin dairy producers.

    Science.gov (United States)

    Borneman, Darand L; Ingham, Steve

    2014-05-01

    The objective of this study was to determine if a correlation exists between standard plate count (SPC) and somatic cell count (SCC) monthly reported results for Wisconsin dairy producers. Such a correlation may indicate that Wisconsin producers effectively controlling sanitation and milk temperature (reflected in low SPC) also have implemented good herd health management practices (reflected in low SCC). The SPC and SCC results for all grade A and B dairy producers who submitted results to the Wisconsin Department of Agriculture, Trade, and Consumer Protection, in each month of 2012 were analyzed. Grade A producer SPC results were less dispersed than grade B producer SPC results. Regression analysis showed a highly significant correlation between SPC and SCC, but the R(2) value was very small (0.02-0.03), suggesting that many other factors, besides SCC, influence SPC. Average SCC (across 12 mo) for grade A and B producers decreased with an increase in the number of monthly SPC results (out of 12) that were ≤ 25,000 cfu/mL. A chi-squared test of independence showed that the proportion of monthly SCC results >250,000 cells/mL varied significantly depending on whether the corresponding SPC result was ≤ 25,000 or >25,000 cfu/mL. This significant difference occurred in all months of 2012 for grade A and B producers. The results suggest that a generally consistent level of skill exists across dairy production practices affecting SPC and SCC.

  16. Platelet Lysates Produced from Expired Platelet Concentrates Support Growth and Osteogenic Differentiation of Mesenchymal Stem Cells

    OpenAIRE

    Sandra Mjoll Jonsdottir-Buch; Ramona Lieder; Olafur Eysteinn Sigurjonsson

    2013-01-01

    BACKGROUND: Mesenchymal stem cells are promising candidates in regenerative cell therapy. Conventional culture methods involve the use of animal substances, specifically fetal bovine serum as growth supplement. Since the use of animal-derived products is undesirable for human applications, platelet lysates produced from human platelets are an attractive alternative. This is especially true if platelet lysates from already approved transfusion units at blood banks can be utilized. The purpose ...

  17. Chinese Experts Successfully Produced Transgenic Animals from Haploid Embryonic Stem Cells

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Individual animals produced by haploid stem cells are ideal models for studying recessive genes. Hap- loid stem cells not only can maintain haploidy, but also are capable of replicating themselves infinitely. Modified genes can be passed on to future generations through genetic engineering of haploid embryonic stem cells, which thus avoids the germlinechimerism caused by other transgenic methods and greatly im- proves the analysis efficiency of the function of gene modification. However, natural haploids are only re- stricted to germline cells in mammals. Currently in mammals, only the embryonic stem cells in rats and mice can be used as the carrier of gene modification, but the embryonic stem cells of other mammals, in- eluding primates, cannot guarantee germline transmission, which has seriously hindered the establishment of disease models by using these species.

  18. A Rapid Culture Technique Produces Functional Dendritic-Like Cells from Human Acute Myeloid Leukemia Cell Lines

    Directory of Open Access Journals (Sweden)

    Jian Ning

    2011-01-01

    Full Text Available Most anti-cancer immunotherapeutic strategies involving dendritic cells (DC as vaccines rely upon the adoptive transfer of DC loaded with exogenous tumour-peptides. This study utilized human acute myeloid leukemia (AML cells as progenitors from which functional dendritic-like antigen presenting cells (DLC were generated, that constitutively express tumour antigens for recognition by CD8+ T cells. DLC were generated from AML cell lines KG-1 and MUTZ-3 using rapid culture techniques and appropriate cytokines. DLC were evaluated for their cell-surface phenotype, antigen uptake and ability to stimulate allogeneic responder cell proliferation, and production of IFN-γ; compared with DC derived from normal human PBMC donors. KG-1 and MUTZ-3 DLC increased expression of CD80, CD83, CD86, and HLA-DR, and MUTZ-3 DLC downregulated CD14 and expressed CD1a. Importantly, both KG-1 and MUTZ-3-derived DLC promoted proliferation of allogeneic responder cells more efficiently than unmodified cells; neither cells incorporated FITC-labeled dextran, but both stimulated IFN-γ production from responding allogeneic CD8+ T cells. Control DC produced from PBMC using the FastDC culture also expressed high levels of critical cell surface ligands and demonstrated good APC function. This paper indicates that functional DLC can be cultured from the AML cell lines KG-1 and MUTZ-3, and FastDC culture generates functional KG-1 DLC.

  19. High-throughput sorting of the highest producing cell via a transiently protein-anchored system.

    Directory of Open Access Journals (Sweden)

    Kuo-Hsiang Chuang

    Full Text Available Developing a high-throughput method for the effecient selection of the highest producing cell is very important for the production of recombinant protein drugs. Here, we developed a novel transiently protein-anchored system coupled with fluorescence activated cell sorting (FACS for the efficient selection of the highest producing cell. A furin cleavage peptide (RAKR was used to join a human anti-epithelial growth factor antibody (αEGFR Ab and the extracellular-transmembrane-cytosolic domains of the mouse B7-1 antigen (B7. The furin inhibitor can transiently switch secreted αEGFR Ab into a membrane-anchored form. After cell sorting, the level of membrane αEGFR Ab-RAKR-B7 is proportional to the amount of secreted αEGFR Ab in the medium. We further selected 23 αEGFR Ab expressing cells and demonstrated a high correlation (R2 = 0.9165 between the secretion level and surface expression levels of αEGFR Ab. These results suggested that the novel transiently protein-anchored system can easily and efficiently select the highest producing cells, reducing the cost for the production of biopharmaceuticals.

  20. Effect of Acteoside as a Cell Protector to Produce a Cloned Dog

    Science.gov (United States)

    Kim, Keun Jung; Kim, Eun Young; Kim, Dong-hee; Lee, Bo Myeong; Han, Kil Woo; Park, Kang-Sun; Lee, Kyung-Bon; Kim, Min Kyu

    2016-01-01

    Somatic cell nuclear transfer (SCNT) is a well-known laboratory technique. The principle of the SCNT involves the reprogramming a somatic nucleus by injecting a somatic cell into a recipient oocyte whose nucleus has been removed. Therefore, the nucleus donor cells are considered as a crucial factor in SCNT. Cell cycle synchronization of nucleus donor cells at G0/G1 stage can be induced by contact inhibition or serum starvation. In this study, acteoside, a phenylpropanoid glycoside compound, was investigated to determine whether it is applicable for inducing cell cycle synchronization, cytoprotection, and improving SCNT efficiency in canine fetal fibroblasts. Primary canine fetal fibroblasts were treated with acteoside (10, 30, 50 μM) for various time periods (24, 48 and 72 hours). Cell cycle synchronization at G0/G1 stage did not differ significantly with the method of induction: acteoside treatment, contact inhibition or serum starvation. However, of these three treatments, serum starvation resulted in significantly increased level of reactive oxygen species (ROS) (99.5 ± 0.3%) and apoptosis. The results also revealed that acteoside reduced ROS and apoptosis processes including necrosis in canine fetal fibroblasts, and improved the cell survival. Canine fetal fibroblasts treated with acteoside were successfully arrested at the G0/G1 stage. Moreover, the reconstructed embryos using nucleus donor cells treated with acteoside produced a healthy cloned dog, but not the embryos produced using nucleus donor cells subjected to contact inhibition. In conclusion, acteoside induced cell cycle synchronization of nucleus donor cells would be an alternative method to improve the efficiency of canine SCNT because of its cytoprotective effects. PMID:27428333

  1. De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts

    Directory of Open Access Journals (Sweden)

    Yi-Ju Chen

    2014-03-01

    Full Text Available The ability to interconvert terminally differentiated cells could serve as a powerful tool for cell-based treatment of degenerative diseases, including diabetes mellitus. To determine which, if any, adult tissues are competent to activate an islet β cell program, we performed an in vivo screen by expressing three β cell “reprogramming factors” in a wide spectrum of tissues. We report that transient intestinal expression of these factors—Pdx1, MafA, and Ngn3 (PMN—promotes rapid conversion of intestinal crypt cells into endocrine cells, which coalesce into “neoislets” below the crypt base. Neoislet cells express insulin and show ultrastructural features of β cells. Importantly, intestinal neoislets are glucose-responsive and able to ameliorate hyperglycemia in diabetic mice. Moreover, PMN expression in human intestinal “organoids” stimulates the conversion of intestinal epithelial cells into β-like cells. Our results thus demonstrate that the intestine is an accessible and abundant source of functional insulin-producing cells.

  2. Bone Marrow Homing Enriches Stem Cells Responsible for Neogenesis of Insulin-Producing Cells, While Radiation Decreases Homing Efficiency.

    Science.gov (United States)

    Goldenberg-Cohen, Nitza; Iskovich, Svetlana; Askenasy, Nadir

    2015-10-01

    Small-sized adult bone marrow cells isolated by counterflow centrifugal elutriation and depleted of lineage markers (Fr25lin(-)) have the capacity to differentiate into insulin-producing cells and stabilize glycemic control. This study assessed competitive migration of syngeneic stem cells to the bone marrow and islets in a murine model of chemical diabetes. VLA-4 is expressed in ∼ 25% of these cells, whereas CXCR4 is not detected, however, it is transcriptionally upregulated (6-fold). The possibility to enrich stem cells by a bone marrow homing (BM-H) functional assay was assessed in sequential transplants. Fr25lin(-) cells labeled with PKH26 were grafted into primary myeloablated recipients, and mitotically quiescent Fr25lin(-)PKH(bright) cells were sorted from the bone marrow after 2 days. The contribution of bone marrow-homed stem cells was remarkably higher in secondary recipients compared to freshly elutriated cells. The therapeutic efficacy was further increased by omission of irradiation in the secondary recipients, showing a 25-fold enrichment of islet-reconstituting cells by the bone marrow homing assay. Donor cells identified by the green fluorescent protein (GFP) and a genomic marker in sex-mismatched transplants upregulated PDX-1 and produced proinsulin, affirming the capacity of BM-H cells to convert in the injured islets. There was no evidence of transcriptional priming of freshly elutriated subsets to express PDX-1, insulin, and other markers of endocrine progenitors, indicating that the bone marrow harbors stem cells with versatile differentiation capacity. Affinity to the bone marrow can be used to enrich stem cells for pancreatic regeneration, and reciprocally, conditioning reduces the competitive incorporation in the injured islets.

  3. Genetic correlations between pathogen-specific mastitis and somatic cell count in Danish Holsteins

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Mark, Thomas; Madsen, P.;

    2009-01-01

    _170) or 300 d (LASCC_300) after calving, and the mastitis traits were unspecific mastitis (all mastitis treatments, both clinical and subclinical, regardless of the causative pathogen) and mastitis caused by either Streptococcus dysgalactiae, Escherichia coli, coagulase-negative staphylococci (CNS......, especially for Strep. uberis, Strep. dysgalactiae, and CNS and, to a lesser extent, for Staph. aureus and E. coli. Data recording should preferably be improved, and economic weights for the pathogen-specific mastitis traits should be estimated before implementing an udder health index that includes pathogen....... uberis, and E. coli (r(a) = 0.54 to 0.69) and were lowest for Staph. aureus mastitis (r(a) = 0.44). The genetic correlation between LASCC_300 and the mastitis traits were generally smaller (r(a) = 0.47 to 0.69). Caution should be taken when interpreting the results, however, because some posterior...

  4. Application of an enzyme-labeled antigen method for visualizing plasma cells producing antibodies against Strep A, a carbohydrate antigen of Streptococcus pyogenes, in recurrent tonsillitis.

    Science.gov (United States)

    Onouchi, Takanori; Mizutani, Yasuyoshi; Shiogama, Kazuya; Inada, Ken-ichi; Okada, Tatsuyoshi; Naito, Kensei; Tsutsumi, Yutaka

    2015-01-01

    Streptococcus pyogenes is the main causative pathogen of recurrent tonsillitis. Histologically, lesions of recurrent tonsillitis contain numerous plasma cells. Strep A is an antigenic carbohydrate molecule on the cell wall of S. pyogenes. As expected, plasma cells in subjects with recurrent tonsillitis secrete antibodies against Strep A. The enzyme-labeled antigen method is a novel histochemical technique that visualizes specific antibody-producing cells in tissue sections by employing a biotin-labeled antigen as a probe. The purpose of the present study was to visualize plasma cells producing antibodies reactive with Strep A in recurrent tonsillitis. Firstly, the lymph nodes of rats immunized with boiled S. pyogenes were paraformaldehyde-fixed and specific plasma cells localized in frozen sections with biotinylated Strep A. Secondly, an enzyme-labeled antigen method was used on human tonsil surgically removed from 12 patients with recurrent tonsillitis. S. pyogenes genomes were PCR-detected in all 12 specimens. The emm genotypes belonged to emm12 in nine specimens and emm1 in three. Plasma cells producing anti-Strep A antibodies were demonstrated in prefixed frozen sections of rat lymph nodes, 8/12 human specimens from patients with recurrent tonsillitis but not in two control tonsils. In human tonsils, Strep A-reactive plasma cells were observed within the reticular squamous mucosa and just below the mucosa, and the specific antibodies belonged to either IgA or IgG classes. Our technique is effective in visualizing immunocytes producing specific antibodies against the bacterial carbohydrate antigen, and is thus a novel histochemical tool for analyzing immune reactions in infectious disorders.

  5. Eugenol alters the integrity of cell membrane and acts against the nosocomial pathogen Proteus mirabilis.

    Science.gov (United States)

    Devi, K Pandima; Sakthivel, R; Nisha, S Arif; Suganthy, N; Pandian, S Karutha

    2013-03-01

    Eugenol, a member of the phenylpropanoids class of chemical compounds, is a clear to pale yellow oily liquid extracted from certain essential oils especially from clove oil, nutmeg, cinnamon, and bay leaf. The antibacterial activity of eugenol and its mechanism of bactericidal action against Proteus mirabilis were evaluated. Treatment with eugenol at their minimum inhibitory concentration [0.125 % (v/v)] and minimum bactericidal concentration [0.25 % (v/v)] reduced the viability and resulted in complete inhibition of P. mirabilis. A strong bactericidal effect on P. mirabilis was also evident, as eugenol inactivated the bacterial population within 30 min exposure. Chemo-attractant property and the observance of highest antibacterial activity at alkaline pH suggest that eugenol can work more effectively when given in vivo. Eugenol inhibits the virulence factors produced by P. mirabilis as observed by swimming motility, swarming behavior and urease activity. It interacts with cellular membrane of P. mirabilis and makes it highly permeable, forming nonspecific pores on plasma membrane, which in turn directs the release of 260 nm absorbing materials and uptake of more crystal violet from the medium into the cells. SDS-polyacrylamide gel, scanning electron microscopy and Fourier transform infrared analysis further proves the disruptive action of eugenol on the plasma membrane of P. mirabilis. The findings reveal that eugenol shows an excellent bactericidal activity against P. mirabilis by altering the integrity of cell membrane.

  6. T4-like coliphage ΦKAZ14 virulent to pathogenic and extended spectrum β-lactamase-producing Escherichia coli of poultry origin

    Institute of Scientific and Technical Information of China (English)

    Kaikabo; Adamu; Ahmad; Abdulkarim; Sabo; Mohanmmed; Faridah; Abas; Sieo; Chin; Chin

    2015-01-01

    <正>Dear Editor,Bacteriophages(otherwise called phages)are a type of virus that infect bacteria.This viral type has found useful applications in the control of bacterial pathogens in foods and food processing environments.In addition,phages may be useful to prevent colonization and shedding of bacteria into the surrounding environment.

  7. The Role of 2,4-diacetylphloroglucinol- and phenazine-1-carboxylic acid-producing Pseudomonas spp. in Natural Protection of Wheat from Soilborne Pathogens

    Science.gov (United States)

    Fluorescent Pseudomonas isolated from the rhizosphere of diverse plants have been studied as biocontrol agents of soilborne pathogens worldwide. Certain strains of these bacteria are capable of exerting a variety of mechanisms of plant growth promotion and protection, including the production of the...

  8. Platelet lysates produced from expired platelet concentrates support growth and osteogenic differentiation of mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Sandra Mjoll Jonsdottir-Buch

    Full Text Available BACKGROUND: Mesenchymal stem cells are promising candidates in regenerative cell therapy. Conventional culture methods involve the use of animal substances, specifically fetal bovine serum as growth supplement. Since the use of animal-derived products is undesirable for human applications, platelet lysates produced from human platelets are an attractive alternative. This is especially true if platelet lysates from already approved transfusion units at blood banks can be utilized. The purpose of this study was to produce human platelet lysates from expired, blood bank-approved platelet concentrates and evaluate their use as growth supplement in the culture of mesenchymal stem cells. METHODOLOGY/PRINCIPAL FINDINGS: In this study, bone marrow-derived mesenchymal stem cells were cultured with one of three culture supplements; fetal bovine serum, lysates from freshly prepared human platelet concentrates, or lysates from expired human platelet concentrates. The effects of these platelet-derived culture supplements on basic mesenchymal stem cell characteristics were evaluated. All cultures maintained the typical mesenchymal stem cell surface marker expression, trilineage differentiation potential, and the ability to suppress in vitro immune responses. However, mesenchymal stem cells supplemented with platelet lysates proliferated faster than traditionally cultured cells and increased the expression of the osteogenic marker gene RUNX-2; yet no difference between the use of fresh and expired platelet concentrates was observed. CONCLUSION/SIGNIFICANCE: Our findings suggest that human platelet lysates produced from expired platelet concentrates can be used as an alternative to fetal bovine serum for mesenchymal stem cell culture to the same extent as lysates from fresh platelets.

  9. Automated analysis of food-borne pathogens using a novel microbial cell culture, sensing and classification system.

    Science.gov (United States)

    Xiang, Kun; Li, Yinglei; Ford, William; Land, Walker; Schaffer, J David; Congdon, Robert; Zhang, Jing; Sadik, Omowunmi

    2016-02-21

    We hereby report the design and implementation of an Autonomous Microbial Cell Culture and Classification (AMC(3)) system for rapid detection of food pathogens. Traditional food testing methods require multistep procedures and long incubation period, and are thus prone to human error. AMC(3) introduces a "one click approach" to the detection and classification of pathogenic bacteria. Once the cultured materials are prepared, all operations are automatic. AMC(3) is an integrated sensor array platform in a microbial fuel cell system composed of a multi-potentiostat, an automated data collection system (Python program, Yocto Maxi-coupler electromechanical relay module) and a powerful classification program. The classification scheme consists of Probabilistic Neural Network (PNN), Support Vector Machines (SVM) and General Regression Neural Network (GRNN) oracle-based system. Differential Pulse Voltammetry (DPV) is performed on standard samples or unknown samples. Then, using preset feature extractions and quality control, accepted data are analyzed by the intelligent classification system. In a typical use, thirty-two extracted features were analyzed to correctly classify the following pathogens: Escherichia coli ATCC#25922, Escherichia coli ATCC#11775, and Staphylococcus epidermidis ATCC#12228. 85.4% accuracy range was recorded for unknown samples, and within a shorter time period than the industry standard of 24 hours.

  10. The immunity-related GTPases in mammals: a fast-evolving cell-autonomous resistance system against intracellular pathogens.

    Science.gov (United States)

    Hunn, Julia P; Feng, Carl G; Sher, Alan; Howard, Jonathan C

    2011-02-01

    The immunity-related GTPases (IRGs) belong to the family of large, interferon-inducible GTPases and constitute a cell-autonomous resistance system essential for the control of vacuolar pathogens like Toxoplasma gondii in mice. Recent results demonstrated that numerous IRG members accumulate collaboratively at the parasitophorous vacuole of invading T. gondii leading to the destruction of the vacuole and the parasite and subsequent necrotic host cell death. Complex regulatory interactions between different IRG proteins are necessary for these processes. Disturbance of this finely balanced system, e.g., by single genetic deficiency for the important negative regulator Irgm1 or the autophagic regulator Atg5, leads to spontaneous activation of the effector IRG proteins when induced by IFNγ. This activation has cytotoxic consequences resulting in a severe lymphopenia, macrophage defects, and failure of the adaptive immune system in Irgm1-deficient mice. However, alternative functions in phagosome maturation and induction of autophagy have been proposed for Irgm1. The IRG system has been studied primarily in mice, but IRG genes are present throughout the mammalian lineage. Interestingly, the number, type, and diversity of genes present differ greatly even between closely related species, probably reflecting intimate host-pathogen coevolution driven by an armed race between the IRG resistance proteins and pathogen virulence factors. IRG proteins are targets for polymorphic T. gondii virulence factors, and genetic variation in the IRG system between different mouse strains correlates with resistance and susceptibility to virulent T. gondii strains.

  11. MicroRNA-146a expresses in interleukin-17 producing T cells in rheumatoid arthritis patients

    Directory of Open Access Journals (Sweden)

    Niimoto Takuya

    2010-09-01

    Full Text Available Abstract Background Interleukin (IL-17 is an important factor in rheumatoid arthritis (RA pathogenesis. MicroRNA (miRNAs are a family of non coding RNAs and associated with human diseases including RA. The purpose of this study is to identify the miRNAs in the differentiation of IL-17 producing cells, and analyze their expression pattern in the peripheral blood mononuclear cells (PBMC and synovium from RA patients. Methods IL-17 producing cells were expanded from CD4+T cell. MiRNA microarray was performed to identify the miRNAs in the differentiation of IL-17 producing cells. Quantitative polymerase chain reaction was performed to examine the expression patterns of the identified miRNAs in the PBMC and synovium from RA and osteoarthritis (OA patients. Double staining combining in situ hybridization and immunohistochemistry of IL-17 was performed to analyze the expression pattern of identified miRNA in the synovium. Results Six miRNAs, let-7a, miR-26, miR-146a/b, miR-150, and miR-155 were significantly up regulated in the IL-17 producing T cells. The expression of miR-146a and IL-17 was higher than in PBMC in the patients with low score of Larsen grade and short disease duration. MiR-146a intensely expressed in RA synovium in comparison to OA. MiR-146a expressed intensely in the synovium with hyperplasia and high expression of IL-17 from the patients with high disease activity. Double staining revealed that miR-146a expressed in IL-17 expressing cells. Conclusion These results indicated that miR-146a was associated with IL-17 expression in the PBMC and synovium in RA patients. There is the possibility that miR-146a participates in the IL-17 expression.

  12. ASSOCIATION BETWEEN SPORULATION AND CELL-WALL DEGRADING ENZYMES IN THE WHEAT PATHOGEN MYCOSPHAERELLA GRAMINICOLA.

    Science.gov (United States)

    Ors, M; Siah, A; Randoux, B; Selim, S; Couleaud, G; Maumene, C; Reignault, Ph; Halama, P

    2015-01-01

    Mycosphaerella graminicola is a hemibiotrophic fungus that causes Septoria tritici blotch (STB), one of the most serious foliar diseases of wheat. STB can occur with a wide range of disease levels on the host, which depend not only on the pathogenicity of fungal strains, but also on the resistance of host cultivars. Here, we investigated the association between the disease level and fungal cell-wall degrading enzyme and protease activities in three wheat cultivars differing in their resistance levels against M. graminicola. The experiments were carried out in the greenhouse using artificial inoculations with the M. graminicola strain T01193. Disease symptoms scored at 21-day post-inoculation (dpi) were significantly higher on the susceptible and moderately resistant cultivars, Alixan and Premio (48% and 42% of diseased leaf area, respectively), than in the resistant one, Altigo (28% of diseased leaf area). Regarding sporulation, the rate of pycnidial density was significantly higher on Alixan (2.9) compared to Premio and Altigo (1.1 and 1.0, respectively). Further biochemical investigations revealed, by 17 dpi, significant fungal beta-1,4-endoxylanase, beta-1,4-endoglucanase and protease activities, whose amounts increased according to the pycnidial density recorded on the infected leaves. At 21 dpi, the amounts of these activities were significantly higher on Alixan compared to Premio and Altigo (0.36 U/mg, 0.63 U/mg and 2.70 mU/mg total proteins on Alixan, 0.09 U/mg, 0.19 U/mg and 0.72 mU/mg total proteins on Premio and 0.05 U/mg, 0.15 U/mg and 0.52 mU/mg total proteins on Altigo for beta-1,4-endoxylanase, beta-1,4-endoglucanase and protease activities, respectively). These results confirm the importance of CWDE and protease activities in the process of fungal sporulation during the necrotrophic phase of M. graminicola.

  13. Cinacalcet for hypercalcemia caused by pulmonary squamous cell carcinoma producing parathyroid hormone-related Peptide

    NARCIS (Netherlands)

    Bech, A.; Smolders, K.; Telting, D.; Boer, H. de

    2012-01-01

    BACKGROUND: Current treatments for hypercalcemia caused by lung cell carcinomas producing parathyroid hormone-related peptide (PTH-rp) have limited efficacy, probably because of their lack of effect on PTH-rp secretion. In this case study we explored the efficacy of the calcimimetic cinacalcet as su

  14. Bet-hedging in bacteriocin producing Escherichia coli populations: the single cell perspective

    Science.gov (United States)

    Bayramoglu, Bihter; Toubiana, David; van Vliet, Simon; Inglis, R. Fredrik; Shnerb, Nadav; Gillor, Osnat

    2017-02-01

    Production of public goods in biological systems is often a collaborative effort that may be detrimental to the producers. It is therefore sustainable only if a small fraction of the population shoulders the cost while the majority reap the benefits. We modelled this scenario using Escherichia coli populations producing colicins, an antibiotic that kills producer cells’ close relatives. Colicin expression is a costly trait, and it has been proposed that only a small fraction of the population actively expresses the antibiotic. Colicinogenic populations were followed at the single-cell level using time-lapse microscopy, and showed two distinct, albeit dynamic, subpopulations: the majority silenced colicin expression, while a small fraction of elongated, slow-growing cells formed colicin-expressing hotspots, placing a significant burden on expressers. Moreover, monitoring lineages of individual colicinogenic cells showed stochastic switching between expressers and non-expressers. Hence, colicin expressers may be engaged in risk-reducing strategies—or bet-hedging—as they balance the cost of colicin production with the need to repel competitors. To test the bet-hedging strategy in colicin-mediated interactions, competitions between colicin-sensitive and producer cells were simulated using a numerical model, demonstrating a finely balanced expression range that is essential to sustaining the colicinogenic population.

  15. IL-17 produced by Paneth cells drives TNF-induced shock.

    NARCIS (Netherlands)

    Takahashi, N.; Laere, I. van; Rycke, R de; Cauwels, A.; Joosten, L.A.B.; Lubberts, E.; Berg, W.B. van den; Libert, C.

    2008-01-01

    Tumor necrosis factor (TNF) has very potent antitumor activity, but it also provokes a systemic inflammatory response syndrome that leads to shock, organ failure, and death. Here, we demonstrate that interleukin (IL)-17, a proinflammatory cytokine known to be produced mainly by activated T cells, ha

  16. Bet-hedging in bacteriocin producing Escherichia coli populations: the single cell perspective

    Science.gov (United States)

    Bayramoglu, Bihter; Toubiana, David; van Vliet, Simon; Inglis, R. Fredrik; Shnerb, Nadav; Gillor, Osnat

    2017-01-01

    Production of public goods in biological systems is often a collaborative effort that may be detrimental to the producers. It is therefore sustainable only if a small fraction of the population shoulders the cost while the majority reap the benefits. We modelled this scenario using Escherichia coli populations producing colicins, an antibiotic that kills producer cells’ close relatives. Colicin expression is a costly trait, and it has been proposed that only a small fraction of the population actively expresses the antibiotic. Colicinogenic populations were followed at the single-cell level using time-lapse microscopy, and showed two distinct, albeit dynamic, subpopulations: the majority silenced colicin expression, while a small fraction of elongated, slow-growing cells formed colicin-expressing hotspots, placing a significant burden on expressers. Moreover, monitoring lineages of individual colicinogenic cells showed stochastic switching between expressers and non-expressers. Hence, colicin expressers may be engaged in risk-reducing strategies—or bet-hedging—as they balance the cost of colicin production with the need to repel competitors. To test the bet-hedging strategy in colicin-mediated interactions, competitions between colicin-sensitive and producer cells were simulated using a numerical model, demonstrating a finely balanced expression range that is essential to sustaining the colicinogenic population. PMID:28165017

  17. ANGPTL4 is produced by entero-endocrine cells in the human intestinal tract

    NARCIS (Netherlands)

    Alex, S.; Lichtenstein, L.L.; Dijk, W.; Mensink, R.P.; Tan, N.S.; Kersten, A.H.

    2014-01-01

    Gut hormones produced by entero-endocrine cells (EEC) located throughout the gastrointestinal tract play a major role in the regulation of glucose and energy homeostasis. Angiopoietin-like 4 (ANGPTL4, also referred to as fasting induced adipose factor) is a secreted factor involved in regulation of

  18. Reactive oxygen species-dependent necroptosis in Jurkat T cells induced by pathogenic free-living Naegleria fowleri.

    Science.gov (United States)

    Song, K-J; Jang, Y S; Lee, Y A; Kim, K A; Lee, S K; Shin, M H

    2011-07-01

    Naegleria fowleri, a free-living amoeba, is the causative pathogen of primary amoebic meningoencephalitis in humans and experimental mice. N. fowleri is capable of destroying tissues and host cells through lytic necrosis. However, the mechanism by which N. fowleri induces host cell death is unknown. Electron microscopy indicated that incubation of Jurkat T cells with N. fowleri trophozoites induced necrotic morphology of the Jurkat T cells. N. fowleri also induced cytoskeletal protein cleavage, extensive poly (ADP-ribose) polymerase hydrolysis and lactate dehydrogenase (LDH) release. Although no activation of caspase-3 was observed in Jurkat T cells co-incubated with amoebae, intracellular reactive oxygen species (ROS) were strongly generated by NADPH oxidase (NOX). Pretreating cells with necroptosis inhibitor necrostatin-1 or NOX inhibitor diphenyleneiodonium chloride (DPI) strongly inhibited amoeba-induced ROS generation and Jurkat cell death, whereas pan-caspase inhibitor z-VAD-fmk did not. N. fowleri-derived secretory products (NfSP) strongly induced intracellular ROS generation and cell death. Necroptotic effects of NfSP were effectively inhibited by pretreating NfSP with proteinase K. Moreover, NfSP-induced LDH release and intracellular ROS accumulation were inhibited by pretreating Jurkat T cells with DPI or necrostatin-1. These results suggest that N. fowleri induces ROS-dependent necroptosis in Jurkat T cells.

  19. Protection against collagen-induced arthritis in mice afforded by the parasitic worm product, ES-62, is associated with restoration of the levels of interleukin-10-producing B cells and reduced plasma cell infiltration of the joints.

    Science.gov (United States)

    Rodgers, David T; Pineda, Miguel A; McGrath, Mairi A; Al-Riyami, Lamyaa; Harnett, William; Harnett, Margaret M

    2014-03-01

    We have previously reported that ES-62, a molecule secreted by the parasitic filarial nematode Acanthocheilonema viteae, protects mice from developing collagen-induced arthritis (CIA). Together with increasing evidence that worm infection may protect against autoimmune conditions, this raises the possibility that ES-62 may have therapeutic potential in rheumatoid arthritis and hence, it is important to fully understand its mechanism of action. To this end, we have established to date that ES-62 protection in CIA is associated with suppressed T helper type 1 (Th1)/Th17 responses, reduced collagen-specific IgG2a antibodies and increased interleukin-10 (IL-10) production by splenocytes. IL-10-producing regulatory B cells have been proposed to suppress pathogenic Th1/Th17 responses in CIA: interestingly therefore, although the levels of IL-10-producing B cells were decreased in the spleens of mice with CIA, ES-62 was found to restore these to the levels found in naive mice. In addition, exposure to ES-62 decreased effector B-cell, particularly plasma cell, infiltration of the joints, and such infiltrating B cells showed dramatically reduced levels of Toll-like receptor 4 and the activation markers, CD80 and CD86. Collectively, this induction of hyporesponsiveness of effector B-cell responses, in the context of the resetting of the levels of IL-10-producing B cells, is suggestive of a modulation of the balance between effector and regulatory B-cell responses that may contribute to ES-62-mediated suppression of CIA-associated inflammation and inhibition of production of pathogenic collagen-specific IgG2a antibodies.

  20. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Shogo [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Research Fellow of the Japan Society for the Promotion of Science, Tokyo (Japan); Nagasawa, Ayumi; Masuda, Yuya; Tsunematsu, Tetsuya [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Hayasaka, Koji; Matsuno, Kazuhiko; Shimizu, Chikara [Division of Laboratory and Transfusion Medicine, Hokkaido University Hospital, Sapporo (Japan); Ozaki, Yukio [Department of Clinical and Laboratory Medicine, Faculty of Medicine, University of Yamanashi (Japan); Moriyama, Takanori, E-mail: moriyama@hs.hokuda.ac.jp [Medical Laboratory Science, Faculty of Health Sciences, Hokkaido University, Sapporo (Japan)

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer It has been thought that BDNF is not produced in the megakaryocytic lineage. Black-Right-Pointing-Pointer MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. Black-Right-Pointing-Pointer BDNF accelerates proliferation of MEG-01 in an autocrine manner. Black-Right-Pointing-Pointer BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  1. Isolation and characterization of cytotoxic effector cells and antibody producing cells from human intestine.

    Science.gov (United States)

    MacDermott, R P

    1985-01-01

    We have examined the ability of intestinal and peripheral blood mononuclear cells isolated from patients with inflammatory bowel disease to mediate killing against cell line targets in spontaneous, antibody-dependent, lectin-induced, and interferon-induced cell-mediated cytotoxicity assays, as well as responsiveness in the allogeneic mixed leukocyte reaction, and effector capabilities in cell-mediated lympholysis. IMC were poor mediators of spontaneous or antibody-dependent cellular cytotoxicity with cell line cells as targets (in comparison to normal PBMC, but were capable of killing antibody coated chicken red blood cells. Although IMC were capable of responding to allogeneic cell surface antigens in the mixed leukocyte reaction, they did not exhibit effector function in cell-mediated lympholysis. Mitogenic lectins induced cell-mediated cytotoxicity by isolated intestinal mononuclear cells from controls and patients. HFIF induces cytotoxicity by control but not inflammatory bowel disease intestinal cells. Pokeweed mitogen was the lectin which induced the greatest amount of killing against human cell line targets. We therefore speculate that exogenous agents, or endogenous factors released during viral infection, could play a role in inducing cell mediated cytotoxic damage to the intestine in inflammatory bowel disease patients. In addition, the functional differences between IMC and PBMC indicate that intestinal MNC may have unique cell capabilities which must be better understood prior to the delineation of immunopathologic events in solid organ tissues. We have also examined the secretion of IgA, IgM, and IgG by isolated human IMC, human bone marrow MNC from rib specimens, and PBMC from patients with CD, UC, SLE, or Henoch-Schoenlein purpura (HSP). Control IMC exhibited high spontaneous secretion of IgA, while intestinal MNC from UC and CD patients exhibited only modest increases in IgA secretion. PBMC from patients with CD, UC, SLE, or HSP exhibited markedly

  2. Dendritic cells produce macrophage inflammatory protein-1 gamma, a new member of the CC chemokine family.

    Science.gov (United States)

    Mohamadzadeh, M; Poltorak, A N; Bergstressor, P R; Beutler, B; Takashima, A

    1996-05-01

    Langerhans cells (LC) are skin-specific members of the dendritic cell (DC) family. DC are unique among APC for their capacity to activate immunologically naive T cells, but little is known about their chemotactic recruitment of T cells. We now report that LC produce macrophage inflammatory protein-1 gamma (MIP-1 gamma), a newly identified CC chemokine. MIP-1 gamma mRNA was detected in epidermal cells freshly procured from BALB/c mice, and depletion of I-A+ epidermal cells (i.e., LC) abrogated that expression. MIP-1 gamma mRNA was detected in the XS52 LC-like DC line as well as by 4F7+ splenic DC and granulocyte-macrophage CSF-propagated bone marrow DC. XS52 DC culture supernatants contained 9 and 10.5 kDa immunoreactivities with anti-MIP-1 gamma Abs. We observed in Boyden chamber assays that 1) XS52 DC supernatant (added to the lower chambers) induced significant migration by splenic T cells; 2) this migration was blocked by the addition of anti-MIP-1 gamma in the lower chambers or by rMIP-1 gamma in the upper chambers; and 3) comparable migration occurred in both CD4+ and CD8+ T cells and in both activated and nonactivated T cells. We conclude that mouse DC (including LC) have the capacity to elaborate the novel CC chemokine MIP-1 gamma, suggesting the active participation of DC in recruiting T cells before activation.

  3. Human umbilical cord mesenchymal stem cells derived from Wharton's jelly differentiate into insulin-producing cells in vitro

    Institute of Scientific and Technical Information of China (English)

    WANG Hong-wu; LIN Li-min; HE Hong-yan; YOU Fang; LI Wei-zhong; HUANG Tian-hua; MA Gui-xia; MA Lian

    2011-01-01

    Background Islet transplantation is an effective way of reversing type Ⅰ diabetes. However, islet transplantation is hampered by issues such as immune rejection and shortage of donor islets. Mesenchymal stem cells can differentiate into insulin-producing cells. However, the potential of human umbilical cord mesenchymal stem cells (huMSCs) to become insulin-producing cells remains undetermined.Methods We isolated and induced cultured huMSCs under islet cell culture conditions. The response of huMSCs were monitored under an inverted phase contrast microscope. Immunocytochemical and immunofluorescence staining methods were used to measure insulin and glucagon protein levels. Reverse transcription-polymerase chain reaction (RT-PCR) was performed to detect gene expression of human insulin and PDX-1. Dithizone-staining was employed to determine the zinc contents in huMSCs. Insulin secretion was also evaluated through radioimmunoassay.Results HuMSCs induced by nicotinamide and β-mercaptoethanol or by neurogenic differentiation 1 gene (NeuroD1)transfection gradually changed morphology from typically elongated fibroblast-shaped cells to round cells. They had a tendency to form clusters. Immunocytochemical studies showed positive expression of human insulin and glucagon in these cells in response to induction. RT-PCR experiments found that huMSCs expressed insulin and PDX-1 genes following induction and dithizone stained the cytoplasm of huMSCs a brownish red color after induction. Insulin secretion in induced huMSCs was significantly elevated compared with the control group (t=6.183, P<0.05).Conclusions HuMSCs are able to differentiate into insulin-producing cells in vitro. The potential use of huMSCs in βcell replacement therapy of diabetes needs to be studied further.

  4. Gas-liquid interfacial plasmas producing reactive species for cell membrane permeabilization

    Science.gov (United States)

    Kaneko, Toshiro; Sasaki, Shota; Takashima, Keisuke; Kanzaki, Makoto

    2017-01-01

    Gas-liquid interfacial atmospheric-pressure plasma jets (GLI-APPJ) are used medically for plasma-induced cell-membrane permeabilization. In an attempt to identify the dominant factors induced by GLI-APPJ responsible for enhancing cell-membrane permeability, the concentration and distribution of plasma-produced reactive species in the gas and liquid phase regions are measured. These reactive species are classified in terms of their life-span: long-lived (e.g., H2O2), short-lived (e.g., O2•−), and extremely-short-lived (e.g., •OH). The concentration of plasma-produced •OHaq in the liquid phase region decreases with an increase in solution thickness (plasma-induced cell-membrane permeabilization is found to decay markedly as the thickness of the solution increases. Furthermore, the horizontally center-localized distribution of •OHaq, resulting from the center-peaked distribution of •OH in the gas phase region, corresponds with the distribution of the permeabilized cells upon APPJ irradiation, whereas the overall plasma-produced oxidizing species such as H2O2aq in solution exhibit a doughnut-shaped horizontal distribution. These results suggest that •OHaq is likely one of the dominant factors responsible for plasma-induced cell-membrane permeabilization. PMID:28163376

  5. Human amnion epithelial cells can be induced to differentiate into functional insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Yanan Hou; Qin Huang; Tianjin Liu; Lihe Guo

    2008-01-01

    Pancreatic islet transplantation has demonstrated that long-term insulin independence may be achieved in patients suffering from diabetes mellitus type 1. However, limited availability of islet tissue means that new sources of insulinproducing cells that are responsive to glucose are required. Here, we show that human amnion epithelial cells (HAEC) can be induced to differentiate into functional insulinproducing cells in vitro. After induction of differentiation, HAEC expressed multiple pancreatic --cell genes, including insulin, pancreas duodenum homeobox-1, paired box gene 6,NK2 transcription factor-related locus 2, Islet 1, glucokinase,and glucose transporter-2, and released C-peptide in a glucose-regulated manner in response to other extracellular stimulations. The transplantation of induced HAEC into streptozotocin-induced diabetic C57 mice reversed hyperglycemia, restored body weight, and maintained euglycemia for 30 d. These findings indicated that HAEC may be a new source for cell replacement therapy in type 1 diabetes.

  6. Phosphorus-Based Dendrimer ABP Treats Neuroinflammation by Promoting IL-10-Producing CD4(+) T Cells.

    Science.gov (United States)

    Hayder, Myriam; Varilh, Marjorie; Turrin, Cédric-Olivier; Saoudi, Abdelhadi; Caminade, Anne-Marie; Poupot, Rémy; Liblau, Roland S

    2015-11-09

    Dendrimers are polyfunctional nano-objects of perfectly defined structure that can provide innovative alternatives for the treatment of chronic inflammatory diseases, including multiple sclerosis (MS). To investigate the efficiency of a recently described amino-bis(methylene phosphonate)-capped ABP dendrimer as a potential drug candidate for MS, we used the classical mouse model of MOG35-55-induced experimental autoimmune encephalomyelitis (EAE). Our study provides evidence that the ABP dendrimer prevents the development of EAE and inhibits the progression of established disease with a comparable therapeutic benefit as the approved treatment Fingolimod. We also show that the ABP dendrimer redirects the pathogenic myelin-specific CD4(+) T cell response toward IL-10 production.

  7. In vitro cell quality of buffy coat platelets in additive solution treated with pathogen reduction technology

    DEFF Research Database (Denmark)

    Ostrowski, Sisse R; Bochsen, Louise; Salado-Jimena, José A

    2010-01-01

    Pathogen reduction technologies (PRTs) may induce storage lesion in platelet (PLT) concentrates. To investigate this, buffy coat PLTs (BCPs) in PLT additive solution (AS; SSP+) with or without Mirasol PRT (CaridianBCT Biotechnologies) were assessed by quality control tests and four-color flow...

  8. Shale gas produced water treatment using innovative microbial capacitive desalination cell.

    Science.gov (United States)

    Stoll, Zachary A; Forrestal, Casey; Ren, Zhiyong Jason; Xu, Pei

    2015-01-01

    The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization-a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input.

  9. Subcultured odontogenic epithelial cells in combination with dental mesenchymal cells produce enamel-dentin-like complex structures.

    Science.gov (United States)

    Honda, M J; Shinohara, Y; Hata, K I; Ueda, M

    2007-01-01

    We showed in a previous study that odontogenic epithelial cells can be selectively cultured from the enamel organ in serum-free medium and expanded using feeder layers of 3T3-J2 cells. The subcultured odontogenic epithelial cells retain the capacity for ameloblast-related gene expression, as shown by semiquantitative RT-PCR. The purpose of the present study was to evaluate the potential of subcultured odontogenic epithelial cells to form tooth structures in cell-polymer constructs maintained in vivo. Enamel organs from 6-month-old porcine third molars were dissociated into single odontogenic epithelial cells and subcultured on feeder layers of 3T3-J2 cells. Amelogenin expression was detected in the subcultured odontogenic epithelial cells by immunostaining and Western blotting. The subcultured odontogenic epithelial cells were seeded onto collagen sponge scaffolds in combination with fresh dental mesenchymal cells, and transplanted into athymic rats. After 4 weeks, enamel-dentin-like complex structures were present in the implanted constructs. These results show that our culture system produced differentiating ameloblast-like cells that were able to secrete amelogenin proteins and form enamel-like tissues in vivo. This application of the subculturing technique provides a foundation for further tooth-tissue engineering and for improving our understanding of ameloblast biology.

  10. Regeneration of insulin-producing pancreatic cells using a volatile bioactive compound and human teeth.

    Science.gov (United States)

    Okada, Mio; Imai, Toshio; Yaegaki, Ken; Ishkitiev, Nikolay; Tanaka, Tomoko

    2014-10-30

    Transplantation of insulin (INS)-secreting cells differentiated in vitro from stem cells promises a safer and easier treatment of severe diabetes mellitus. A volatile bioactive compound, hydrogen sulfide (H2S), promotes cell differentiation; human tooth-pulp stem cells undergo hepatic differentiation. The aim of this study is to develop a novel protocol using H2S to enhance pancreatic differentiation from the CD117(+) cell fraction of human tooth pulp. During the differentiation, the cells were exposed to 0.1 ng ml(-1) H2S. Immunocytochemistry, RT-PCR, determination of INS c-peptide content and flow cytometry of pancreatically related markers were carried out. Expression of WNT and the PI3K/AKT signaling pathway were also determined by PCR array. After differentiation, INS, glucagon (GCG), somatostatin (SST) and pancreatic polypeptide (PPY) were positive when examined by immunofluorescence. INS and GCG were also determined flow-cytometrically. Only the cells expressing INS increased after H2S exposure. The number of cells expressing GCG was significantly decreased. Genes involved in canonical WNT and the WNT/calcium pathways were highly expressed after H2S exposure. H2S accelerated INS synthesis and secretion by regenerated INS-producing cells from human teeth. All signaling pathway functions of the PI3K-AKT pathway were extremely activated by H2S exposure. The matured INS-producing cells originating in human teeth were increased by H2S in order to control blood-glucose level.

  11. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  12. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  13. Pan-European resistance monitoring programmes encompassing food-borne bacteria and target pathogens of food-producing and companion animals.

    Science.gov (United States)

    de Jong, A; Thomas, V; Klein, U; Marion, H; Moyaert, H; Simjee, S; Vallé, M

    2013-05-01

    Antimicrobial resistance is a concern both for animal and human health. Veterinary programmes monitoring resistance of animal and zoonotic pathogens are therefore essential. Various European countries have implemented national surveillance programmes, particularly for zoonotic and commensal bacteria, and the European Food Safety Authority (EFSA) is compiling the data. However, harmonisation is identified as a weakness and an essential need in order to compare data across countries. Comparisons of resistance monitoring data among national programmes are hampered by differences between programmes, such as sampling and testing methodology, and different epidemiological cut-off values or clinical breakpoints. Moreover, only very few valid data are available regarding target pathogens both of farm and companion animals. The European Animal Health Study Centre (CEESA) attempts to fill these gaps. The resistance monitoring programmes of CEESA have been a collaboration of veterinary pharmaceutical companies for over a decade and include two different projects: the European Antimicrobial Susceptibility Surveillance in Animals (EASSA) programme, which collects food-borne bacteria at slaughter from healthy animals, and the pathogen programmes that collect first-intention target pathogens from acutely diseased animals. The latter comprises three subprogrammes: VetPath; MycoPath; and ComPath. All CEESA projects include uniform sample collection and bacterial identification to species level in various European Union (EU) member states. A central laboratory conducts quantitative susceptibility testing to antimicrobial agents either important in human medicine or commonly used in veterinary medicine. This 'methodology harmonisation' allows easy comparisons among EU member states and makes the CEESA programmes invaluable to address food safety and antibiotic efficacy.

  14. Gleevec, an Abl family inhibitor, produces a profound change in cell shape and migration.

    Directory of Open Access Journals (Sweden)

    Zaozao Chen

    Full Text Available The issue of how contractility and adhesion are related to cell shape and migration pattern remains largely unresolved. In this paper we report that Gleevec (Imatinib, an Abl family kinase inhibitor, produces a profound change in the shape and migration of rat bladder tumor cells (NBTII plated on collagen-coated substrates. Cells treated with Gleevec adopt a highly spread D-shape and migrate more rapidly with greater persistence. Accompanying this more spread state is an increase in integrin-mediated adhesion coupled with increases in the size and number of discrete adhesions. In addition, both total internal reflection fluorescence microscopy (TIRFM and interference reflection microscopy (IRM revealed a band of small punctate adhesions with rapid turnover near the cell leading margin. These changes led to an increase in global cell-substrate adhesion strength, as assessed by laminar flow experiments. Gleevec-treated cells have greater RhoA activity which, via myosin activation, led to an increase in the magnitude of total traction force applied to the substrate. These chemical and physical alterations upon Gleevec treatment produce the dramatic change in morphology and migration that is observed.

  15. Establishment of a mouse Sertoli cell line producing rat androgen-binding protein (ABP).

    Science.gov (United States)

    Ducray, A; Bloquel, M; Hess, K; Hammond, G L; Gérard, H; Gérard, A

    1998-01-01

    The ultimate goal of this study was to compare the fate of rat testicular germ cells cocultured with mouse Sertoli cells that either do or do not produce rat androgen-binding protein (ABP). As a first step, we stably transfected a rat ABP expression construct into an immortalized mouse Sertoli cell line (TM4), which does not produce ABP when growing on plastic without hormones. The transfection of the pRc/CMV- rat ABP cDNA expression vector containing a neomycin resistance gene was made by either the liposome method (Dotap) or by polyethyleneimine transfection (PEI) into TM4 cell cultures. Neomycin-resistant clones were selected by adding Geneticin to the culture medium for 3 weeks. Analysis of over 25 clones revealed the presence of recombinant rat ABP when cell extracts and culture media were probed with a rabbit polyclonal antibody raised against rat testicular ABP, indicating the translation and secretion of a protein similar to rat testicular ABP. Transfected TM4 cells maintain the secretion of rat ABP for more than 40 days, with immunopositive rat ABP localized within cytoplasmic granules in the Golgi region and along cytoplasmic processes in TM4 transfected with either vector. Electron microscopic study revealed a higher development of cytoplasmic organelles involved in protein secretion.

  16. Improved cytotoxic effects of Salmonella-producing cytosine deaminase in tumour cells

    Science.gov (United States)

    Mesa-Pereira, Beatriz; Medina, Carlos; Camacho, Eva María; Flores, Amando; Santero, Eduardo

    2015-01-01

    In order to increase the cytotoxic activity of a Salmonella strain carrying a salicylate-inducible expression system that controls cytosine deaminase production, we have modified both, the vector and the producer bacterium. First, the translation rates of the expression module containing the Escherichia coli codA gene cloned under the control of the Pm promoter have been improved by using the T7 phage gene 10 ribosome binding site sequence and replacing the original GUG start codon by AUG. Second, to increase the time span in which cytosine deaminase may be produced by the bacteria in the presence of 5-fluorocytosine, a 5-fluorouracyl resistant Salmonella strain has been constructed by deleting its upp gene sequence. This new Salmonella strain shows increased cytosine deaminase activity and, after infecting tumour cell cultures, increased cytotoxic and bystander effects under standard induction conditions. In addition, we have generated a purD mutation in the producer strain to control its intracellular proliferation by the presence of adenine and avoid the intrinsic Salmonella cell death induction. This strategy allows the analysis and comparison of the cytotoxic effects of cytosine deaminase produced by different Salmonella strains in tumour cell cultures. PMID:25227763

  17. Primary B-cell deficiencies reveal a link between human IL-17-producing CD4 T-cell homeostasis and B-cell differentiation.

    Directory of Open Access Journals (Sweden)

    Rita R Barbosa

    Full Text Available IL-17 is a pro-inflammatory cytokine implicated in autoimmune and inflammatory conditions. The development/survival of IL-17-producing CD4 T cells (Th17 share critical cues with B-cell differentiation and the circulating follicular T helper subset was recently shown to be enriched in Th17 cells able to help B-cell differentiation. We investigated a putative link between Th17-cell homeostasis and B cells by studying the Th17-cell compartment in primary B-cell immunodeficiencies. Common Variable Immunodeficiency Disorders (CVID, defined by defects in B-cell differentiation into plasma and memory B cells, are frequently associated with autoimmune and inflammatory manifestations but we found no relationship between these and Th17-cell frequency. In fact, CVID patients showed a decrease in Th17-cell frequency in parallel with the expansion of activated non-differentiated B cells (CD21(lowCD38(low. Moreover, Congenital Agammaglobulinemia patients, lacking B cells due to impaired early B-cell development, had a severe reduction of circulating Th17 cells. Finally, we found a direct correlation in healthy individuals between circulating Th17-cell frequency and both switched-memory B cells and serum BAFF levels, a crucial cytokine for B-cell survival. Overall, our data support a relationship between Th17-cell homeostasis and B-cell maturation, with implications for the understanding of the pathogenesis of inflammatory/autoimmune diseases and the physiology of B-cell depleting therapies.

  18. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Directory of Open Access Journals (Sweden)

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  19. Impact of Cell-free Supernatant of Lactic Acid Bacteria on Putrescine and Other Polyamine Formation by Foodborne Pathogens in Ornithine Decarboxylase Broth.

    Science.gov (United States)

    Ozogul, Fatih; Tabanelli, Giulia; Toy, Nurten; Gardini, Fausto

    2015-06-24

    Conversion of ornithine to putrescine by Salmonella Paratyphi A, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli was investigated in ornithine decarboxylase broth (ODB) using cell-free supernatants (CFSs) obtained from Leuconostoc mesenterodies subsp. cremoris, Pediococcus acidilactici, Lactococcus lactis subsp. lactis, Streptococcus thermophilus. Two groups of cell-free supernatants (25 or 50%) and control (only ODB) were prepared to investigate putrescine (PUT) and other polyamine formation by foodborne pathogens (FBPs). Significant differences (p < 0.05) were observed among the species for each amine. All of the CFSs reduced the formation of PUT by ≥65%. The production of cadaverine (CAD) was scarcely affected by the presence of CFSs, with the exception of the samples inoculated with L. monocytogenes. The variation in polyamine was found with respect to the control samples. Spermidine (SPD) was produced in lower amount in many samples, especially in Gram-negative FBPs, whereas spermine (SPN) increased drastically in the major part of the samples concerning the control. Histamine (HIS) was characterized by a marked concentration decrease in all of the samples, and tyramine (TYR) was accumulated in very low concentrations in the controls. Therefore, the ability of bacteria to produce certain biogenic amines such as HIS, TYR, PUT, and CAD has been studied to assess their risk and prevent their formation in food products. The results obtained from this study concluded that the lactic acid bacteria (LAB) strains with non-decarboxylase activity are capable of avoiding or limiting biogenic amine formation by FBP.

  20. Anti-proliferative effect of fungal taxol extracted from Cladosporium oxysporum against human pathogenic bacteria and human colon cancer cell line HCT 15

    Science.gov (United States)

    Gokul Raj, K.; Manikandan, R.; Arulvasu, C.; Pandi, M.

    2015-03-01

    Cladosporium oxysporum a new taxol producing endophytic fungus was identified and production of taxol were characterized using UV-visible spectroscopy (UV-vis), high-performance liquid chromatography (HPLC), infrared (IR) nuclear magnetic resonance spectroscopy (NMR (13C and 1H)) and liquid chromatography-mass spectrometry (LC-MS). The taxol biosynthetic gene (dbat) was evaluated for new taxol producing fungus. Antibacterial activity against six different human pathogenic bacteria was done by agar well diffusion method. The anticancer efficacy of isolated fungal taxol were also evaluated in human colon cancer cell HCT 15 by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), cytotoxicity and nuclear morphology analysis. The isolated fungal taxol showed positive towards biosynthetic gene (dbat) and effective against both Gram positive as well as Gram negative. The fungal taxol suppress growth of cancer cell line HCT 15 with an IC50 value of 3.5 μM concentration by 24 h treatment. Thus, the result reveals that C. oxysporum could be a potential alternative source for production of taxol and have antibacterial as well as anticancer properties with possible clinical applications.

  1. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1

    Directory of Open Access Journals (Sweden)

    Amir Allahverdi

    2015-07-01

    Full Text Available Objective: Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1 is a master regulator gene required for embryonic development of the pancreas and is crucial for normal pancreatic islets activities in adults. Materials and Methods: We induced the over-expression of the PDX1 gene in human bone marrow MSCs (BM-MSCs by Lenti-PDX1 in order to generate IPCs. Next, we examine the ability of the cells by measuring insulin/c-peptide production and INSULIN and PDX1 gene expressions. Results: After transduction, MSCs changed their morphology at day 5 and gradually differentiated into IPCs. INSULIN and PDX1 expressions were confirmed by real time polymerase chain reaction (RT-PCR and immunostaining. IPC secreted insulin and C-peptide in the media that contained different glucose concentrations. Conclusion: MSCs differentiated into IPCs by genetic manipulation. Our result showed that lentiviral vectors could deliver PDX1 gene to MSCs and induce pancreatic differentiation.

  2. Role of thyrotropin-releasing hormone in prolactin-producing cell models.

    Science.gov (United States)

    Kanasaki, Haruhiko; Oride, Aki; Mijiddorj, Tselmeg; Kyo, Satoru

    2015-12-01

    Thyrotropin-releasing hormone (TRH) is a hypothalamic hypophysiotropic neuropeptide that was named for its ability to stimulate the release of thyroid-stimulating hormone in mammals. It later became apparent that it exerts a number of species-dependent hypophysiotropic activities that regulate other pituitary hormones. TRH also regulates the synthesis and release of prolactin, although whether it is a physiological regulator of prolactin that remains unclear. Occupation of the Gq protein-coupled TRH receptor in the prolactin-producing lactotroph increases the turnover of inositol, which in turn activates the protein kinase C pathway and the release of Ca(2+) from storage sites. TRH-induced signaling events also include the activation of extracellular signal-regulated kinase (ERK) and induction of MAP kinase phosphatase, an inactivator of activated ERK. TRH stimulates prolactin synthesis through the activation of ERK, whereas prolactin release occurs via elevation of intracellular Ca(2+). We have been investigating the role of TRH in a pituitary prolactin-producing cell model. Rat pituitary somatolactotroph GH3 cells, which produce and release both prolactin and growth hormone (GH), are widely used as a model for the study of prolactin- and GH-secreting cells. In this review, we describe the general action of TRH as a hypophysiotropic factor in vertebrates and focus on the role of TRH in prolactin synthesis using GH3 cells.

  3. B-cell infiltration and frequency of cytokine producing cells differ between localized and disseminated human cutaneous leishmaniases

    Directory of Open Access Journals (Sweden)

    MGS Vieira

    2002-10-01

    Full Text Available Biopsies from human localized cutaneous lesions (LCL n = 7 or disseminated lesions (DL n = 8 cases were characterized according to cellular infiltration,frequency of cytokine (IFN-g, TNF-alpha or iNOS enzyme producing cells. LCL, the most usual form of the disease with usually one or two lesions, exhibits extensive tissue damage. DL is a rare form with widespread lesions throughout the body; exhibiting poor parasite containment but less tissue damage. We demonstrated that LCL lesions exhibit higher frequency of B lymphocytes and a higher intensity of IFN-gamma expression. In both forms of the disease CD8+ were found in higher frequency than CD4+ T cells. Frequency of TNF-alpha and iNOS producing cells, as well as the frequency of CD68+ macrophages, did not differ between LCL and DL. Our findings reinforce the link between an efficient control of parasite and tissue damage, implicating higher frequency of IFN-gamma producing cells, as well as its possible counteraction by infiltrated B cells and hence possible humoral immune response in situ.

  4. Dopamine favors expansion of glucocorticoid-resistant IL-17-producing T cells in multiple sclerosis.

    Science.gov (United States)

    Ferreira, Thais B; Barros, Priscila O; Teixeira, Bruna; Cassano, Tatiane; Centurião, Newton; Kasahara, Taissa M; Hygino, Joana; Vasconcelos, Claudia Cristina F; Filho, Helcio Alvarenga; Alvarenga, Regina; Wing, Ana Cristina; Andrade, Regis M; Andrade, Arnaldo F; Bento, Cleonice A M

    2014-10-01

    Dopamine (DA) is a neurotransmitter produced mainly in the central nervous system (CNS) that has immunomodulatory actions on T cells. As the multiple sclerosis (MS) has long been regarded as an autoimmune disease of CNS mediated by T cells, the objective of this study was to evaluate the impact of DA on in vitro functional status of T cells from relapsing-remitting (RR)-MS patients. Peripheral T-cells from RR-MS patients were activated by mitogens and cell proliferation and cytokine production were assayed by [(3)H]-thymidine uptake and ELISA, respectively. Our results demonstrated that DA enhanced in vitro T cell proliferation and Th17-related cytokines in MS-derived cell cultures. In addition, this catecholamine reduced Treg-related cytokines (IL-10 and TGF-β) release by activated CD4(+) T cells. These DA-induced effects on T cells were mainly dependent on IL-6 production by both polyclonally-activated CD4(+) T cells and LPS-stimulated monocytes. Furthermore, the production of IL-17 and IL-6 by MS-derived T cells was directly related with neurological disability (EDSS score), and the release of these cytokines was less sensitive to glucocorticoid inhibition in MS patients than in control group, mainly after DA addition. In conclusion, our data suggest that DA amplifies glucocorticoid-resistant Th17 phenotype in MS patients, and this phenomenon could be, at least in part, due to its ability to induce IL-6 production by monocytes and CD4(+) T cells.

  5. Interactions between rye (Secale cereale) root border cells (RBCs) and pathogenic and nonpathogenic rhizosphere strains of Fusarium culmorum.

    Science.gov (United States)

    Jaroszuk-Sciseł, Jolanta; Kurek, Ewa; Rodzik, Beata; Winiarczyk, Krystyna

    2009-10-01

    Interactions of rye (Secale cereale) root border cells (RBCs), generated during plant growth and surrounding the root cap, with nonpathogenic rhizosphere Fusarium culmorum isolates: DEMFc2 (PGPF) and DEMFc5 (DRMO), and a pathogenic strain DEMFc37 were studied in test tube experiments. The effect of water-suspended RBCs released from the rye root cap on the rate of macroconidia germination and hyphae (mycelial) growth of F. culmorum strains was also examined. It was found that root caps of 3-d-old rye seedlings (with the root length of 20mm) were surrounded with a layer of RBCs generated in a number specific for this plant species of 1980+/-30. Introduction of the macroconidia of the tested F. culmorum strains into the root zone of 3-d-old seedlings resulted, after 3d of incubation, in the formation of mantle-like structures only in the rhizosphere of plants inoculated with the pathogenic DEMFc37 strain. The macroconidia were suspended in (1) water, (2) a water mixture with root caps deprived of RBCs, (3) Martin medium, (4) malt extract broth, and (5) a water mixture with rye RBCs, and their percentage germination was determined during 96-h incubation at 20 degrees C. Germination of the macroconidia of all the tested F. culmorum strains suspended in the rich growth media (Martin and malt extract broth) and in the mixture with RBCs was significantly speeded up. While only an average of 16.6 % of macroconidia suspended in water germinated after 96-h incubation, more than 90 % of those suspended in the growth media or in the mixture with RBCs germinated after 24h of incubation. In all the treatments, the highest rate of macroconidia germination was found in suspensions of the pathogenic strain and the lowest in macroconidial suspensions of the PGPF strain. The stimulatory effect of RBCs was not specific to the pathogenic strain. Nevertheless, microscopic observation revealed that it was only in the suspension containing a mixture of rye RBCs and macroconidia of the

  6. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Directory of Open Access Journals (Sweden)

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  7. Identification of peptides from human pathogens able to cross-activate an HIV-1-gag-specific CD4+ T cell clone.

    Science.gov (United States)

    Venturini, Sara; Allicotti, Gina; Zhao, Yindong; Simon, Richard; Burton, Dennis R; Pinilla, Clemencia; Poignard, Pascal

    2006-01-01

    Antigen recognition by T cells is degenerate both at the MHC and the TCR level. In this study, we analyzed the cross-reactivity of a human HIV-1 gag p24-specific CD4(+) T cell clone obtained from an HIV-1-seronegative donor using a positional scanning synthetic combinatorial peptide library (PS-SCL)-based biometrical analysis. A number of decapeptides able to activate the HIV-1 gag-specific clone were identified and shown to correspond to sequences found in other human pathogens. Two of these peptides activated the T cell clone with the same stimulatory potency as the original HIV-1 gag p24 peptide. These findings show that an HIV-1-specific human T helper clone can react efficiently with peptides from other pathogens and suggest that cellular immune responses identified as being specific for one human pathogen (HIV-1) could arise from exposure to other pathogens.

  8. Method of producing ceramic distribution members for solid state electrolyte cells

    Science.gov (United States)

    Clark, Douglas J. (Inventor); Galica, Leo M. (Inventor); Losey, Robert W. (Inventor); Suitor, Jerry W. (Inventor)

    1995-01-01

    A solid state electrolyte cells apparatus and method of producing is disclosed. The apparatus can be used for separating oxygen from an oxygen-containing feedstock or as a fuel cell for reacting fluids. Cells can be stacked so that fluids can be introduced and removed from the apparatus through ceramic distribution members having ports designed for distributing the fluids in parallel flow to and from each cell. The distribution members can also serve as electrodes to membranes or as membrane members between electrodes, The distribution member design does not contain any horizontal internal ports which allows the member to be thin. A method of tape casting in combination with an embossing method allows intricate radial ribs and bosses to be formed on each distribution member. The bosses serve as seals for the ports and allow the distribution members to be made without any horizontal internal ports.

  9. Acetylcholine regulates pancreastatin secretion from the human pancreastatin-producing cell line (QGP-1N).

    Science.gov (United States)

    Funakoshi, A; Tateishi, K; Tsuru, M; Jimi, A; Wakasugi, H; Kono, A

    1991-07-01

    Studies were made of pancreastatin (PST) secretion from a human PST-producing cell line (QGP-1N) in response to various secretagogues. Cells with immunoreactivity for PST were observed in monolayer cultures of QGP-1N cells. Carbachol stimulated PST secretion and the intracellular Ca2+ mobilization concentration dependently in the range of 10(-6)-10(-4) M. The PST secretion and Ca2+ mobilization induced by carbachol were inhibited by atropine. The calcium ionophore (A23187) stimulated PST secretion. However, cholecystokinin and gastrin-releasing peptide did not stimulate either PST secretion or Ca2+ mobilization. Secretin also did not stimulate PST secretion. The glucose concentration in the culture medium had no effect on PST secretion. These results suggest that PST secretion is mainly regulated by acetylcholine through a muscarinic receptor, and that an increase in intracellular Ca2+ plays an important role in stimulus-secretion coupling in QGP-1N cells.

  10. Comparative analysis of hydrogen-producing bacteria and its immobilized cells for characteristics of hydrogen production

    Institute of Scientific and Technical Information of China (English)

    王相晶; 任南琪; 向文胜; 王爱杰; 林明; 郭婉茜

    2003-01-01

    A strain of hydrogen producing bacteria was immobilized by polyvinyl alcohol-boric acid method,with the addition of a small amount of calcium alginate. The immobilized cells were insensitive to the presence of traces of O2. Moreover, the immobilized cells increased both the evolution rate and the yield of hydrogen production. Batch experiments with a medium containing 10 g/L glucose demonstrated the yields of hydrogen production by the immobilized and free cells were 2.14 mol/mol glucose and 1.69 mol/mol glucose, respectively.In continuous cultures atmedium retention time of 2. 0 h, the yield and the evolution rate of hydrogen producmedium retention time of 6. 0 h, the yield and the evolution rate of hydrogen production by free cells were only 1.75 mol/mol glucose and 362.9ml/(L·h),respectively.

  11. ADAM12 produced by tumor cells rather than stromal cells accelerates breast tumor progression

    DEFF Research Database (Denmark)

    Frohlich, Camilla; Nehammer, Camilla; Albrechtsen, Reidar;

    2011-01-01

    hypothesized, however, that the tumor-associated stroma may stimulate ADAM12 expression in tumor cells, based on the fact that TGF-ß1 stimulates ADAM12 expression and is a well-known growth factor released from tumor-associated stroma. TGF-ß1 stimulation of ADAM12-negative Lewis lung tumor cells induced ADAM12...... synthesis, and growth of these cells in vivo induced a >200-fold increase in ADAM12 expression. Our observation that ADAM12 expression is significantly higher in the terminal duct lobular units (TDLUs) adjacent to human breast carcinoma compared with TDLUs found in normal breast tissue supports our......Expression of ADAM12 is low in most normal tissues, but is markedly increased in numerous human cancers, including breast carcinomas. We have previously shown that overexpression of ADAM12 accelerates tumor progression in a mouse model of breast cancer (PyMT). In the present study, we found...

  12. [INTERCONNECTION BETWEEN CELL MICROVESICULAR TRANSPORT AND PATHOGENS PERSISTENCE IN VITRO AND IN VIVO].

    Science.gov (United States)

    Miller, G G; Mukhachev, A Ya; Bykovsky, A F

    2015-01-01

    This review presents an information and proof evidence toward to the role of microvesicles, originating from the different sources pro- and eucaryotes in the initiation and development of persistence of several human and animal pathogens. Also an information about another properties of microvesicles, as well as the reference of role in the different somatic pathology, intercellular interaction and in the intracellular transport of biologically active macromolecules as well as life origin and evolutionary events.

  13. Cell Biosensors: Rapid Detection and Identification of Pathogens Using FTIR Microspectroscopic Spectra

    Science.gov (United States)

    2010-04-01

    camera , which allows capture of visible microscopic images from the same region that is interrogated via FTIR. Analysis was performed at 2 cm -1...and coxsackie virus (b) triggered significant transient upregulation of TNF, and IL8 genes, however HSV-1 delayed IL8 mRNA expression. The IL8...Pathogens Using FTIR Microspectroscopic Spectra RTO-MP-HFM-182 29 - 11 REFERENCES [1] Juckem LK, Boehme KW, Feire AL, Compton T (2008) Differential

  14. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    OpenAIRE

    Andresen Heiko; Gabig-Ciminska Magdalena; Albers Joerg; Hintsche Rainer; Enfors Sven-Olof

    2004-01-01

    Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor sin...

  15. [Cloning goat producing human lactoferrin with genetically modified donor cells selected by single or dual markers].

    Science.gov (United States)

    An, Liyou; Yuan, Yuguo; Yu, Baoli; Yang, Tingjia; Cheng, Yong

    2012-12-01

    We compared the efficiency of cloning goat using human lactoferrin (hLF) with genetically modified donor cells marked by single (Neo(r)) or double (Neo(r)/GFP) markers. Single marker expression vector (pBLC14) or dual markers expression vector (pAPLM) was delivered to goat fetal fibroblasts (GFF), and then the transgenic GFF was used as donor cells to produce transgenic goats. Respectively, 58.8% (20/34) and 86.7% (26/30) resistant cell lines confirmed the transgenic integration by PCR. Moreover, pAPLM cells lines were subcultured with several passages, only 20% (6/30) cell lines was observed fluorescence from each cell during the cell passage. Somatic cell nuclear transfer using the donor cells harbouring pBLC14 or pAPLM construct, resulting in a total of 806 reconstructed embryos, a pregnancy rate at 35 d (53.8%, 39.1%) and 60 d (26.9%, 21.7%), and an offspring birth rate (1.9%, 1.4%) with 5 and 7 newborn cloned goats, respectively. Transgene was confirmed by PCR and southern-blot in all cloned offspring. There were no significant differences at the reconstructed embryo fusion rates, pregnancy rates and the birth rate (P > 0.05) between single and double markers groups. The Neo(r)/GFP double markers could improve the reliability for accurately and efficiently selecting the genetically modified donor cells. No adverse effect was observed on the efficiency of transgenic goat production by SCNT using somatic cells transfected with double (Neo(r)/GFP) markers vector.

  16. Embryonic stem-like cells derived from in vitro produced bovine blastocysts

    Directory of Open Access Journals (Sweden)

    Erika Regina Leal de Freitas

    2011-06-01

    Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.

  17. Birth of viable female dogs produced by somatic cell nuclear transfer.

    Science.gov (United States)

    Jang, G; Kim, M K; Oh, H J; Hossein, M S; Fibrianto, Y H; Hong, S G; Park, J E; Kim, J J; Kim, H J; Kang, S K; Kim, D Y; Lee, B C

    2007-03-15

    Since the only viable cloned offspring born in dogs was a male, the purpose of the present study was to produce female puppies by somatic cell nuclear transfer (SCNT). Adult ear fibroblasts from a 2-month-old female Afghan hound were isolated and used as donor cells. In vivo-matured canine oocytes surgically collected (approximately 72h after ovulation) from the oviducts of 23 donors were used for SCNT. After removal of the cumulus cells, oocytes were enucleated, microinjected, fused with a donor cell, and activated. A total of 167 reconstructed SCNT embryos were surgically transferred (Day 0) into the oviducts of 12 recipient bitches (average 13.9 embryos/recipient, range 6-22) with spontaneous, synchronous estrous cycles. Three pregnancies were detected by ultrasonography on Day 23, maintained to term, and three healthy female puppies (520, 460, and 520g), were delivered by Caesarean section on Day 60. These puppies were phenotypically and genotypically identical to the cell donor. In conclusion, we have provided the first demonstration that female dogs can be produced by nuclear transfer of ear fibroblasts into enucleated canine oocytes.

  18. Volatile and non-volatile monoterpenes produced by elicitor-stimulated Cupressus lusitanica cultured cells.

    Science.gov (United States)

    De Alwis, Ransika; Fujita, Koki; Ashitani, Tatsuya; Kuroda, Ken'ichi

    2009-05-01

    Elicitor treatment initiates defense responses in cultured Cupressus lusitanica cells. In order to investigate the defense mechanism with a yeast extract elicitor, we carried out solid-phase microextraction coupled with gas chromatography for monoterpene analysis. Ten hydrocarbon monoterpenes, including high amounts of sabinene and limonene, were detected in the gas phase of the elicitor-treated cell cultures. Six oxidized monoterpenes including beta-thujaplicin were also detected in the ether extract of the cells and the medium. Time-course profiles of volatile monoterpenes showed that one group of hydrocarbon monoterpenes was maximized on the second day after elicitation, while the other group was maximized on the third day. There were no oxidized monoterpenes that are structurally related to sabinene and limonene in the gas phase or cell extracts, suggesting that these compounds are produced exclusively for emission. Other monoterpenes, which are produced during later stages of elicitation, are metabolized into more complex compounds such as oxidized monoterpenes, including beta-thujaplicin. Although terpinolene synthase was the principal monoterpene synthase in these cell cultures, terpinolene was detected only as a minor compound in the gas phase. The time course for terpinolene synthase activity coincided with beta-thujaplicin biosynthesis. Thus, most of the terpinolene is metabolized rapidly to oxidized terpenes such as beta-thujaplicin rather than emitted.

  19. Bacterial Pathogens Induce Abscess Formation by CD4+ T-Cell Activation via the CD28–B7-2 Costimulatory Pathway

    OpenAIRE

    2000-01-01

    Abscesses are a classic host response to infection by many pathogenic bacteria. The immunopathogenesis of this tissue response to infection has not been fully elucidated. Previous studies have suggested that T cells are involved in the pathologic process, but the role of these cells remains unclear. To delineate the mechanism by which T cells mediate abscess formation associated with intra-abdominal sepsis, the role of T-cell activation and the contribution of antigen-presenting cells via CD2...

  20. Teratomas produced from human pluripotent stem cells xenografted into immunodeficient mice - a histopathology atlas

    Science.gov (United States)

    Damjanov, Ivan; Andrews, Peter W.

    2017-01-01

    This atlas illustrates the microscopic features of tumors produced from human pluripotent stem cells (hPSCs) xenografted into immunosuppressed mice, according to the generally accepted protocols for performing this teratoma assay of stem cell pluripotency. Microphotographs depict various hematoxylin and eosin (H&E) stained tissues derived from all three embryonic germ layers (ectoderm, mesoderm and endoderm). The appearance of persistent hPSC in teratomas is also described with special emphasis on the morphogenesis of embryoid bodies and yolk sac components surrounding them. The use of immunohistochemistry for analyzing hPSC-derived teratomas is also illustrated. PMID:28000905

  1. Bench to batch: advances in plant cell culture for producing useful products.

    Science.gov (United States)

    Weathers, Pamela J; Towler, Melissa J; Xu, Jianfeng

    2010-02-01

    Despite significant efforts over nearly 30 years, only a few products produced by in vitro plant cultures have been commercialized. Some new advances in culture methods and metabolic biochemistry have improved the useful potential of plant cell cultures. This review will provide references to recent relevant reviews along with a critical analysis of the latest improvements in plant cell culture, co-cultures, and disposable reactors for production of small secondary product molecules, transgenic proteins, and other products. Some case studies for specific products or production systems are used to illustrate principles.

  2. HCV Specific IL-21 Producing T Cells but Not IL-17A Producing T Cells Are Associated with HCV Viral Control in HIV/HCV Coinfection

    Science.gov (United States)

    MacParland, Sonya A.; Fadel, Saleh M.; Mihajlovic, Vesna; Fawaz, Ali; Kim, Connie; Rahman, A. K. M. Nur-ur; Liu, Jun; Kaul, Rupert; Kovacs, Colin; Grebely, Jason; Dore, Gregory J.; Wong, David K.; Ostrowski, Mario A.

    2016-01-01

    Background Decreased hepatitis C virus (HCV) clearance, faster cirrhosis progression and higher HCV RNA levels are associated with Human Immunodeficiency virus (HIV) coinfection. The CD4+ T helper cytokines interleukin (IL)-21 and IL-17A are associated with virus control and inflammation, respectively, both important in HCV and HIV disease progression. Here, we examined how antigen-specific production of these cytokines during HCV mono and HIV/HCV coinfection was associated with HCV virus control. Methods We measured HCV-specific IL-21 and IL-17A production by transwell cytokine secretion assay in PBMCs from monoinfected and coinfected individuals. Viral control was determined by plasma HCV RNA levels. Results In acutely infected individuals, those able to establish transient/complete HCV viral control tended to have stronger HCV-specific IL-21-production than non-controllers. HCV-specific IL-21 production also correlated with HCV viral decline in acute infection. Significantly stronger HCV-specific IL-21 production was detected in HAART-treated coinfected individuals. HCV-specific IL-17A production was not associated with lower plasma HCV RNA levels in acute or chronic HCV infection and responses were stronger in HIV coinfection. HCV-specific IL-21/ IL-17A responses did not correlate with microbial translocation or fibrosis. Exogenous IL-21 treatment of HCV-specific CD8+ T cells from monoinfected individuals enhanced their function although CD8+ T cells from coinfected individuals were somewhat refractory to the effects of IL-21. Conclusions These data show that HCV-specific IL-21 and IL-17A-producing T cells are induced in HIV/HCV coinfection. In early HIV/HCV coinfection, IL-21 may contribute to viral control, and may represent a novel tool to enhance acute HCV clearance in HIV/HCV coinfected individuals. PMID:27124305

  3. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines.

    Science.gov (United States)

    Fossiez, F; Djossou, O; Chomarat, P; Flores-Romo, L; Ait-Yahia, S; Maat, C; Pin, J J; Garrone, P; Garcia, E; Saeland, S; Blanchard, D; Gaillard, C; Das Mahapatra, B; Rouvier, E; Golstein, P; Banchereau, J; Lebecque, S

    1996-06-01

    Analysis of the cDNA encoding murine interleukin (IL) 17 (cytotoxic T lymphocyte associated antigen 8) predicted a secreted protein sharing 57% amino acid identity with the protein predicted from ORF13, an open reading frame of Herpesvirus saimiri. Here we report on the cloning of human IL-17 (hIL-17), the human counterpart of murine IL-17. hIL-17 is a glycoprotein of 155 amino acids secreted as an homodimer by activated memory CD4+ T cells. Although devoid of direct effects on cells of hematopoietic origin, hIL-17 and the product of its viral counterpart, ORF13, stimulate epithelial, endothelial, and fibroblastic cells to secrete cytokines such as IL-6, IL-8, and granulocyte-colony-stimulating factor, as well as prostaglandin E2. Furthermore, when cultured in the presence of hIL-17, fibroblasts could sustain the proliferation of CD34+ hematopoietic progenitors and their preferential maturation into neutrophils. These observations suggest that hIL-17 may constitute (a) an early initiator of the T cell-dependent inflammmatory reaction; and (b) an element of the cytokine network that bridges the immune system to hematopoiesis.

  4. [Selection of retroviral vector producing cell lines and gene transfer into hematopoietic cells].

    Science.gov (United States)

    Bagnis, C; Mannoni, P

    1996-04-01

    Transduction and expression of a transgene in hematopoietic stem cells with retroviral vectors still remain major challenges for gene therapy in blood disorders. Use of an easily detectable gene marker, such as the nlsLacZ, at the laboratory and clinical levels, provides a powerful approach of these two combined problems.

  5. Cinacalcet for Hypercalcemia Caused by Pulmonary Squamous Cell Carcinoma Producing Parathyroid Hormone-Related Peptide

    Directory of Open Access Journals (Sweden)

    Anneke Bech

    2012-01-01

    Full Text Available Background: Current treatments for hypercalcemia caused by lung cell carcinomas producing parathyroid hormone-related peptide (PTH-rp have limited efficacy, probably because of their lack of effect on PTH-rp secretion. In this case study we explored the efficacy of the calcimimetic cinacalcet as suppressor of PTH-rp production. Patient: A 57-year-old male with severe and recurrent hypercalcemia induced by a PTH-rp-producing squamous cell lung carcinoma, stage cT4N3M1b, poorly responding to standard treatments. Results: Serum PTH-rp levels were not affected by saline, calcitonin or zoledronate. PTH-rp decreased during chemotherapy and cinacalcet monotherapy. The combination of chemotherapy plus cinacalcet was most effective in rapidly reducing serum calcium and PTH-rp. Conclusion: This case study is the first to suggest that cinacalcet may be of value in some cases of PTH-rp-dependent hypercalcemia. Corroborative evidence is needed.

  6. Cinacalcet for Hypercalcemia Caused by Pulmonary Squamous Cell Carcinoma Producing Parathyroid Hormone-Related Peptide

    Science.gov (United States)

    Bech, Anneke; Smolders, Koen; Telting, Darryl; de Boer, Hans

    2012-01-01

    Background Current treatments for hypercalcemia caused by lung cell carcinomas producing parathyroid hormone-related peptide (PTH-rp) have limited efficacy, probably because of their lack of effect on PTH-rp secretion. In this case study we explored the efficacy of the calcimimetic cinacalcet as suppressor of PTH-rp production. Patient A 57-year-old male with severe and recurrent hypercalcemia induced by a PTH-rp-producing squamous cell lung carcinoma, stage cT4N3M1b, poorly responding to standard treatments. Results Serum PTH-rp levels were not affected by saline, calcitonin or zoledronate. PTH-rp decreased during chemotherapy and cinacalcet monotherapy. The combination of chemotherapy plus cinacalcet was most effective in rapidly reducing serum calcium and PTH-rp. Conclusion This case study is the first to suggest that cinacalcet may be of value in some cases of PTH-rp-dependent hypercalcemia. Corroborative evidence is needed. PMID:22379470

  7. New cell line development for antibody-producing Chinese hamster ovary cells using split green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Kim Yeon-Gu

    2012-05-01

    Full Text Available Abstract Background The establishment of high producer is an important issue in Chinese hamster ovary (CHO cell culture considering increased heterogeneity by the random integration of a transfected foreign gene and the altered position of the integrated gene. Fluorescence-activated cell sorting (FACS-based cell line development is an efficient strategy for the selection of CHO cells in high therapeutic protein production. Results An internal ribosome entry site (IRES was introduced for using two green fluorescence protein (GFP fragments as a reporter to both antibody chains, the heavy chain and the light chain. The cells co-transfected with two GFP fragments showed the emission of green fluorescence by the reconstitution of split GFP. The FACS-sorted pool with GFP expression had a higher specific antibody productivity (qAb than that of the unsorted pool. The qAb was highly correlated with the fluorescence intensity with a high correlation coefficient, evidenced from the analysis of median GFP and qAb in individual selected clones. Conclusions This study proved that the fragment complementation for split GFP could be an efficient indication for antibody production on the basis of high correlation of qAb with reconstitution of GFP. Taken together, we developed an efficient FACS-based screening method for high antibody-producing CHO cells with the benefits of the split GFP system.

  8. Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

    Energy Technology Data Exchange (ETDEWEB)

    Lea, P.J.; Pawlowski, A.; Persad, S.D.; Menon, I.A.; Haberman, H.F.

    1988-01-01

    Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells.

  9. Removal of Cadmium and Zinc from Soil using Immobilized Cell of Biosurfactant Producing Bacteria

    Directory of Open Access Journals (Sweden)

    Charoon Sarin

    2010-07-01

    Full Text Available Immobilized biosurfactant producing bacteria (Bacillus subtilis TP8 and Pseudomonas fluorescens G7 were assessed for survival in heavy metal contaminated soil and for their ability to remove cadmium and zinc from contaminated soil. P. fluorescens G7 was considered to be a good candidate for bioremediation of heavy metals because of its high minimum inhibitory concentrations (MIC for each heavy metal and because of the obviously increased numbers of cell surviving after incubation in the heavy metal contaminated soil up to 4 weeks. The results of soil remediation showed that approximately 19% of Zn and 16.7% of Cd could be removed by this immobilized biosurfactant producing bacteria after incubation for 2 weeks. The results confirm the potential applicability of the immobilized biosurfactant producing bacteria for heavy metal bioremediation.

  10. Removal of Cadmium and Zinc from Soil using Immobilized Cell of Biosurfactant Producing Bacteria

    OpenAIRE

    Charoon Sarin; Siripun Sarin

    2010-01-01

    Immobilized biosurfactant producing bacteria (Bacillus subtilis TP8 and Pseudomonas fluorescens G7) were assessed for survival in heavy metal contaminated soil and for their ability to remove cadmium and zinc from contaminated soil. P. fluorescens G7 was considered to be a good candidate for bioremediation of heavy metals because of its high minimum inhibitory concentrations (MIC) for each heavy metal and because of the obviously increased numbers of cell surviving after incubation in the hea...

  11. Human tolerogenic dendritic cells produce IL-35 in the absence of other IL-12 family members.

    Science.gov (United States)

    Dixon, Karen O; van der Kooij, Sandra W; Vignali, Dario A A; van Kooten, Cees

    2015-06-01

    IL-35 is a cytokine of the IL-12 family, existing as a heterodimer of IL-12p35 and Ebi3. IL-35 has anti-inflammatory properties and is produced by regulatory T cells in humans and mice, where it is required for optimal suppression of immune responses. Distinct from other IL-12 cytokines, the expression of IL-35 has not been described in antigen-presenting cells. In view of the immune-regulatory properties of IL-35, we investigated the expression, regulation, and function of IL-12p35 and Ebi3 in human monocyte-derived dendritic cells and tolerogenic DCs (tolDCs). These tolDCs do not produce IL-12p70 or the homodimer IL-12p40. We demonstrate that tolDCs completely lack transcriptional expression of IL-12p40. However, tolDCs maintain mRNA expression of IL-12p35 and Ebi3. Using intracellular flow cytometry and Western blot analysis, we show that tolDCs produce Ebi3 and IL-12p35, and both can be enhanced upon stimulation with IFN-γ, LPS, or CD40L. tolDCs supernatants have the capacity to suppress T-cell activation. Using IL12A silencing, we demonstrate that IL-12p35 is required for tolDCs to reach their full suppressive potential. Taken together, our results indicate that tolDCs produce IL-35, providing an additional novel mechanism by which tolDCs elicit their tolerogenic potential.

  12. Mesorhizobium loti Produces nodPQ-Dependent Sulfated Cell Surface Polysaccharides▿

    OpenAIRE

    Townsend, Guy E.; Forsberg, Lennart S.; Keating, David H.

    2006-01-01

    Leguminous plants and bacteria from the family Rhizobiaceae form a symbiotic relationship, which culminates in novel plant structures called root nodules. The indeterminate symbiosis that forms between Sinorhizobium meliloti and alfalfa requires biosynthesis of Nod factor, a β-1,4-linked lipochitooligosaccharide that contains an essential 6-O-sulfate modification. S. meliloti also produces sulfated cell surface polysaccharides, such as lipopolysaccharide (LPS). The physiological function of s...

  13. Dendritic cell function and pathogen-specific T cell immunity are inhibited in mice administered levonorgestrel prior to intranasal Chlamydia trachomatis infection

    Science.gov (United States)

    Quispe Calla, Nirk E.; Vicetti Miguel, Rodolfo D.; Mei, Ao; Fan, Shumin; Gilmore, Jocelyn R.; Cherpes, Thomas L.

    2016-01-01

    The growing popularity of levonorgestrel (LNG)-releasing intra-uterine systems for long-acting reversible contraception provides strong impetus to define immunomodulatory properties of this exogenous progestin. In initial in vitro studies herein, we found LNG significantly impaired activation of human dendritic cell (DCs) and their capacity to promote allogeneic T cell proliferation. In follow-up studies in a murine model of intranasal Chlamydia trachomatis infection, we analogously found that LNG treatment prior to infection dramatically reduced CD40 expression in DCs isolated from draining lymph nodes at 2 days post infection (dpi). At 12 dpi, we also detected significantly fewer CD4+ and CD8+ T cells in the lungs of LNG-treated mice. This inhibition of DC activation and T cell expansion in LNG-treated mice also delayed chlamydial clearance and the resolution of pulmonary inflammation. Conversely, administering agonist anti-CD40 monoclonal antibody to LNG-treated mice at 1 dpi restored lung T cell numbers and chlamydial burden at 12 dpi to levels seen in infected controls. Together, these studies reveal that LNG suppresses DC activation and function, and inhibits formation of pathogen-specific T cell immunity. They also highlight the need for studies that define in vivo effects of LNG use on human host response to microbial pathogens. PMID:27892938

  14. The myosin motor domain-containing chitin synthase PdChsVII is required for development, cell wall integrity and virulence in the citrus postharvest pathogen Penicillium digitatum.

    Science.gov (United States)

    Gandía, Mónica; Harries, Eleonora; Marcos, Jose F

    2014-06-01

    Chitin is an essential component of the fungal cell wall and a potential target in the development of new antifungal compounds, due to its presence in fungi and not in plants or vertebrates. Chitin synthase genes (chs) constitute a complex family in filamentous fungi and are involved in fungal development, morphogenesis, pathogenesis and virulence. In this study, additional chs genes in the citrus postharvest pathogen Penicillium digitatum have been identified. Comparative analyses included each PdChs in each one of the classes I to VII previously established, and support the grouping of these into three divisions. Disruption of the gene coding PdChsVII, which contains a short version of a myosin motor domain, has been achieved by using Agrobacterium tumefaciens-mediated transformation and revealed its role in the life cycle of the fungus. Disruption strains were viable but showed reduced growth and conidia production. Moreover, Pdchs mutants developed morphological defects as balloon-like enlarged cells and increased chitin content, indicative of an altered cell wall structure. Gene disruption also increased susceptibility to antifungal compounds such as calcofluor white (CFW), sodium dodecyl sulfate (SDS), hydroxide peroxide (H2O2) and commercial fungicides, but significantly no change was observed in the sensitivity to antifungal peptides. The PdchsVII mutants were able to infect citrus fruit and produced tissue maceration, although had reduced virulence and most importantly were greatly impaired in the production of visible mycelium and conidia on the fruit.

  15. Cell recycled culture of succinic acid-producing Anaerobiospirillum succiniciproducens using an internal membrane filtration system.

    Science.gov (United States)

    Lee, Pyung-Cheon; Lee, Sang-Yup; Chang, Ho-Nam

    2008-07-01

    Cell recycled culture of succinic acid-producing Anaerobiospirillum succiniciproducens was anaerobically carried out using an internal membrane filter module in order to examine the physiological response of A. succiniciproducens to a high-cell-density environment. The optimal growth of A. succiniciproducens and its enhanced succinic acid productivity were observed under CO2-rich conditions, established by adding NaHCO3 and Na2CO3, in the cell recycled system. A. succiniciproducens grew up to 6.50 g-DCW/l, the highest cell concentration obtained so far, in cell recycled cultures. The cells did not change their morphology, which is known to be easily changed in unfavorable or stress environments. The maximum productivity of succinic acid was about 3.3 g/l/h, which is 3.3 times higher than those obtained in batch cultures. These results can serve as a guide for designing highly efficient cell recycled systems for succinic acid at a commercial level.

  16. Electroendocytosis is driven by the binding of electrochemically produced protons to the cell's surface.

    Directory of Open Access Journals (Sweden)

    Nadav Ben-Dov

    Full Text Available Electroendocytosis involves the exposure of cells to pulsed low electric field and is emerging as a complementary method to electroporation for the incorporation of macromolecules into cells. The present study explores the underlying mechanism of electroendocytosis and its dependence on electrochemical byproducts formed at the electrode interface. Cell suspensions were exposed to pulsed low electric field in a partitioned device where cells are spatially restricted relative to the electrodes. The cellular uptake of dextran-FITC was analyzed by flow cytometery and visualized by confocal microscopy. We first show that uptake occurs only in cells adjacent to the anode. The enhanced uptake near the anode is found to depend on electric current density rather than on electric field strength, in the range of 5 to 65 V/cm. Electrochemically produced oxidative species that impose intracellular oxidative stress, do not play any role in the stimulated uptake. An inverse dependence is found between electrically induced uptake and the solution's buffer capacity. Electroendocytosis can be mimicked by chemically acidifying the extracellular solution which promotes the enhanced uptake of dextran polymers and the uptake of plasmid DNA. Electrochemical production of protons at the anode interface is responsible for inducing uptake of macromolecules into cells exposed to a pulsed low electric field. Expanding the understanding of the mechanism involved in electric fields induced drug-delivery into cells, is expected to contribute to clinical therapy applications in the future.

  17. Antiviral activity produced by an IPNV-carrier EPC cell culture confers resistance to VHSV infection.

    Science.gov (United States)

    Jurado, María Teresa; García-Valtanen, Pablo; Estepa, Amparo; Perez, Luis

    2013-10-25

    Infectious pancreatic necrosis virus (IPNV), a fish birnavirus, can establish a persistent infection on epithelioma papulosum cyprinid (EPC) cells producing a carrier state where a small fraction of IPNV-infected cells is maintained in the culture after continuous subculture. The EPC(IPNV) cells are resistant to challenge with IPNV as well as to challenge with viral hemorrhagic septicemia virus (VHSV), a rhabdovirus. In this work, the antiviral effect of the IPNV carrier culture conditioned medium (EPC(IPNV)-CM) was tested and analyzed in detail. EPC cells treated with the carrier culture supernatant become protected against VHSV challenge. Size-fractionation by filtration and acid and heat treatment showed that the IPNV persistently infected cells release an acid-resistant soluble factor in the molecular weight fraction bellow 50 kDa. The capacity of the EPC(IPNV)-CM to induce cytokine genes in EPC cells was also determined by real-time RT-PCR. We found that there is a positive correlation between up-regulation of mx gene expression in EPC cells treated with EPC(IPNV)-CM and protection against VHSV challenge. Our findings indicate that the control of IPNV multiplication in the carrier culture as well as the interference with rhabdovirus replication are connected to the production and release of an antiviral (interferon-like) factor to the medium.

  18. Splenic Stromal Cells from Aged Mice Produce Higher Levels of IL-6 Compared to Young Mice

    Science.gov (United States)

    Park, Jihyun; Miyakawa, Takuya; Shiokawa, Aya; Nakajima-Adachi, Haruyo; Hachimura, Satoshi

    2014-01-01

    Inflamm-aging indicates the chronic inflammatory state resulting from increased secretion of proinflammatory cytokines and mediators such as IL-6 in the elderly. Our principle objective was to identify cell types that were affected with aging concerning IL-6 secretion in the murine model. We compared IL-6 production in spleen cells from both young and aged mice and isolated several types of cells from spleen and investigated IL-6 mRNA expression and protein production. IL-6 protein productions in cultured stromal cells from aged mice spleen were significantly high compared to young mice upon LPS stimulation. IL-6 mRNA expression level of freshly isolated stromal cells from aged mice was high compared to young mice. Furthermore, stromal cells of aged mice highly expressed IL-6 mRNA after LPS injection in vivo. These results suggest that stromal cells play a role in producing IL-6 in aged mice and imply that they contribute to the chronic inflammatory condition in the elderly. PMID:24729663

  19. Characteristics of calves produced with sperm sexed by flow cytometry/cell sorting.

    Science.gov (United States)

    Tubman, L M; Brink, Z; Suh, T K; Seidel, G E

    2004-04-01

    The objectives of this study were to determine whether calves produced by sexed sperm differed from controls and to what extent the sex ratio of calves was altered by the sexing procedure. Data were collected from 1,169 calves produced from sperm sexed by flow cytometry/cell sorting after staining with Hoechst 33342, and 793 calves produced from control sperm during breeding trials between 1997 and 2001. Least squares ANOVA were completed using factors of treatment (sexed vs. control sperm), 19 management groups from 13 field trials, and calf sex. Responses analyzed include gestation length, birth weight, calving ease, calf vigor, weaning weight, abortion rate, and death rates (neonatal and through weaning). No significant difference was observed for any response due to treatment or treatment interactions (P > 0.10). Therefore, calves produced from sexed sperm grew and developed normally both pre- and postnatally. A neurological disorder was observed in four control calves and one sexed calf from one farm. No gross anatomical abnormalities were reported for any calves in the study. Differences were observed for all responses among management groups (P Flow cytometry/cell sorting can be used to preselect sex of calves safely with approximately 90% accuracy.

  20. High numbers of IL-2-producing CD8+ T cells during viral infection: correlation with stable memory development

    DEFF Research Database (Denmark)

    Kristensen, Nanna Ny; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    2002-01-01

    Using infections with lymphocytic choriomeningitis virus (LCMV) and vesicular stomatitis virus in mice as model systems, we have investigated the ability of antigen-primed CD8+ T cells generated in the context of viral infections to produce IL-2. Our results indicate that acute immunizing infection...... normally leads to generation of high numbers of IL-2-producing antigen-specific CD8+ T cells. By costaining for IL-2 and IFN-gamma intracellularly, we found that IL-2-producing cells predominantly constitute a subset of cells also producing IFN-gamma. Comparison of the kinetics of generation revealed...

  1. Distribution of Nitric Oxide-Producing Cells along Spinal Cord in Urodeles

    Directory of Open Access Journals (Sweden)

    Mayada A Mahmoud

    2014-09-01

    Full Text Available Nitric oxide is a unique neurotransmitter, which participates in many physiological and pathological processes in the organism. There are little data about the neuronal nitric oxide synthase immunoreactivity in the spinal cord of amphibians. In this respect, the present study aims to investigate the distribution of nitric oxide producing cells in the spinal cord of urodele and to find out the possibility of a functional locomotory role to this neurotransmitter. The results of the present study demonstrate a specific pattern of NADPH-d labeling in the selected amphibian model throughout the spinal cord length as NADPH-d-producing cells and fibres were present in almost all segments of the spinal cord of the salamander investigated. However, their number, cytological characteristics and labeling intensity varied significantly. It was noticed that the NO-producing cells (NO-PC were accumulated in the ventral side of certain segments in the spinal cord corresponding to the brachial and sacral plexuses. In addition, the number of NO-PC was found to be increased also at the beginning of the tail and this could be due to the fact that salamanders are tetrapods having bimodal locomotion, namely swimming and walking.

  2. Hepatitis E Virus Produced from Cell Culture Has a Lipid Envelope.

    Directory of Open Access Journals (Sweden)

    Ying Qi

    Full Text Available The absence of a productive cell culture system hampered detailed analysis of the structure and protein composition of the hepatitis E virion. In this study, hepatitis E virus from a robust HEV cell culture system and from the feces of infected monkeys at the peak of virus excretion was purified by ultra-centrifugation. The common feature of the two samples after ultracentrifugation was that the ORF2 protein mainly remained in the top fractions. The ORF2 protein from cell culture system was glycosylated, with an apparent molecular weight of 88 kDa, and was not infectious in PLC/PRF/5 cells. The ORF2 protein in this fraction can bind to and protect HEV RNA from digestion by RNase A. The RNA-ORF2 product has a similar sedimentation coefficient to the virus from feces. The viral RNA in the cell culture supernatant was mainly in the fraction of 1.15 g/cm3 but that from the feces was mainly in the fraction of 1.21 g/cm3. Both were infectious in PLC/PRF/5 cells. And the fraction in the middle of the gradient (1.06 g/cm3 from the cell culture supernatant,but not that from the feces, also has ORF2 protein and HEV RNA but was not infectious in PLC/PRF/5.The infectious RNA-rich fraction from the cell culture contained ORF3 protein and lipid but the corresponding fraction from feces had no lipid and little ORF3 protein. The lipid on the surface of the virus has no effect on its binding to cells but the ORF3 protein interferes with binding. The result suggests that most of the secreted ORF2 protein is not associated with HEV RNA and that hepatitis E virus produced in cell culture differs in structure from the virus found in feces in that it has a lipid envelope.

  3. Murine hematopoietic progenitor cells produce IL-6 in response to IgE.

    Science.gov (United States)

    Schneider, E; Salachas, F; Lemoine, F M; Arnould, A; Machavoine, F; Ploemacher, R E; Dy, M

    1995-04-01

    Similarly to interleukin-3 (IL-3), IgE is capable of inducing IL-6 production by murine bone marrow cells (BMC). IgE responder cells do not belong to the mature bone marrow compartment but coenrich with hematopoietic progenitors in the low-density fraction of a discontinuous Ficoll gradient. A significant enhancement of IL-6 production is observed after a 4-hour stimulation, reaching a maximum between 24 and 48 hours and is preceded by increased mRNA expression. The effect of IgE on IL-6 production is not mediated by IL-3 since it is not modified by anti-IL-3 antibodies. Upon a 4-hour exposure to IgE or IL-3, a similar percentage of progenitor-enriched BMC expresses IL-6 mRNA (3.9 and 5.4%, respectively, as determined by in situ hybridization), which is not further increased by a combination of both stimuli. IgE and IL-3 responder cells also cannot be distinguished on the basis of size, internal structure, and rhodamine (Rh) retention. The BMC sorted in the most fluorescent Rhbright subset (approximately 0.2% of total BMC) produce 30- to 40-fold more IL-6 than unfractionated cells and are similarly enriched for CFU-cells (CFU-C). The most primitive cells concentrated in the Rhdull fraction do not express this biological activity. The sorted Rhbright population does not contain mature mast cells/basophils or monocytes, and IL-6 is not produced in response to Fc epsilon RI cross-linkage after presensitization with IgE.

  4. Plasticity of Ectomesenchymal Stem Cells and its Ability of Producing Tissue Engineering Tooth by Recombining with Dental Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    Yan JIN; Liu-Yu BAO; Yi-Jing WANG; Hui-Xia HE

    2005-01-01

    @@ 1 Introduction Recently, it has been found that human dental pulp stem cells could generate dentin-pulp complex-like structures in nude mice, but studies on tissue engineering tooth-like structures by cultured human dental epithelial and mesenchymal stem cells are still reported rarely. Ectomesenchyme is an unique structure of vertebrates embryo compose of postmigratory cephalic neural crest cells(NCC) and its derivatives. The aim of the present study was to identify and isolate the ectomesenchymal stem cells(EMSC) and to demonstrate that EMSCs have the ability of plasticity both in vivo and in vitro. The further interesting was to evaluate the role of EMSC in producing of a tissue engineering tooth together with odontogenic epithelium.

  5. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Shruti Dave

    2014-01-01

    Full Text Available The pathophysiology of type 1 diabetes mellitus (T1DM is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs offer a promising possibility that deserves to be explored further. MSCs are multipotent, nonhematopoietic progenitors. They have been explored as an treatment option in tissue regeneration as well as potential of in vitro transdifferentiation into insulin-secreting cells. Thus, the major therapeutic goals for T1DM have been achieved in this way. The regenerative capabilities of MSCs have been a driving force to initiate studies testing their therapeutic effectiveness; their immunomodulatory properties have been equally exciting; which would appear capable of disabling immune dysregulation that leads to β-cell destruction in T1DM. Furthermore, MSCs can be cultured under specially defined conditions, their transdifferentiation can be directed toward the β-cell phenotype, and the formation of insulin-producing cells (IPCs can be targeted. To date, the role of MSCs-derived IPC in T1DM-a unique approach with some positive findings-have been unexplored, but it is still in its very early phase. In this study, a new approach of MSCs-derived IPCs, as a potential therapeutic benefit for T1DM in experimental animal models as well as in humans has been summarized.

  6. Analysis of the role of the LH92_11085 gene of a biofilm hyper-producing Acinetobacter baumannii strain on biofilm formation and attachment to eukaryotic cells.

    Science.gov (United States)

    Álvarez-Fraga, Laura; Pérez, Astrid; Rumbo-Feal, Soraya; Merino, María; Vallejo, Juan Andrés; Ohneck, Emily J; Edelmann, Richard E; Beceiro, Alejandro; Vázquez-Ucha, Juan C; Valle, Jaione; Actis, Luis A; Bou, Germán; Poza, Margarita

    2016-05-18

    Acinetobacter baumannii is a nosocomial pathogen that has a considerable ability to survive in the hospital environment partly due to its capacity to form biofilms. The first step in the process of establishing an infection is adherence of the bacteria to target cells. Chaperone-usher pili assembly systems are involved in pilus biogenesis pathways that play an important role in adhesion to host cells and tissues as well as medically relevant surfaces. After screening a collection of strains, a biofilm hyper-producing A. baumannii strain (MAR002) was selected to describe potential targets involved in pathogenicity. MAR002 showed a remarkable ability to form biofilm and attach to A549 human alveolar epithelial cells. Analysis of MAR002 using transmission electron microscopy (TEM) showed a significant presence of pili on the bacterial surface. Putative protein-coding genes involved in pili formation were identified based on the newly sequenced genome of MAR002 strain (JRHB01000001/2 or NZ_JRHB01000001/2). As assessed by qRT-PCR, the gene LH92_11085, belonging to the operon LH92_11070-11085, is overexpressed (ca. 25-fold more) in biofilm-associated cells compared to exponential planktonic cells. In the present work we investigate the role of this gene on the MAR002 biofilm phenotype. Scanning electron microscopy (SEM) and biofilm assays showed that inactivation of LH92_11085 gene significantly reduced bacterial attachment to A549 cells and biofilm formation on plastic, respectively. TEM analysis of the LH92_11085 mutant showed the absence of long pili formations normally present in the wild-type. These observations indicate the potential role this LH92_11085 gene could play in the pathobiology of A baumannii.

  7. Shale gas produced water treatment using innovative microbial capacitive desalination cell

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, Zachary A. [New Mexico State University, Las Cruces, NM 88003 (United States); Forrestal, Casey [University of Colorado Boulder, Boulder, CO 80309 (United States); Ren, Zhiyong Jason, E-mail: jason.ren@colorado.edu [University of Colorado Boulder, Boulder, CO 80309 (United States); Xu, Pei, E-mail: wxpei@hotmail.com [New Mexico State University, Las Cruces, NM 88003 (United States)

    2015-02-11

    Highlights: • Actual shale gas produced water was treated with no external energy input. • Biodegradation of organics generated stable voltages for desalination. • On average, 36 mg TDS per g activated carbon was removed in 1 h. • A maximum organic removal rate of 6.4 mg DOC per hour was achieved in the reactor. - Abstract: The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization—a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input.

  8. Combinatorial plasma polymerization approach to produce thin films for testing cell proliferation.

    Science.gov (United States)

    Antonini, V; Torrengo, S; Marocchi, L; Minati, L; Dalla Serra, M; Bao, G; Speranza, G

    2014-01-01

    Plasma enhanced physical vapor depositions are extensively used to fabricate substrates for cell culture applications. One peculiarity of the plasma processes is the possibility to deposit thin films with reproducible chemical and physical properties. In the present work, a combinatorial plasma polymerization process was used to deposit thin carbon based films to promote cell adhesion, in the interest of testing cell proliferation as a function of the substrate chemical properties. Peculiarity of the combinatorial approach is the possibility to produce in just one deposition experiment, a set of surfaces of varying chemical moieties by changing the precursor composition. A full characterization of the chemical, physical and thermodynamic properties was performed for each set of the synthesized surfaces. X-ray photoelectron spectroscopy was used to measure the concentration of carboxyl, hydroxyl and amine functional groups on the substrate surfaces. A perfect linear trend between polar groups' density and precursors' concentration was found. Further analyses reveled that also contact angles and the correspondent surface energies of all deposited thin films are linearly dependent on the precursor concentration. To test the influence of the surface composition on the cell adhesion and proliferation, two cancer cell lines were utilized. The cell viability was assessed after 24 h and 48 h of cell culture. Experiments show that we are able to control the cell adhesion and proliferation by properly changing the thin film deposition conditions i.e. the concentration and the kind of chemical moiety on the substrate surface. The results also highlight that physical and chemical factors of biomaterial surface, including surface hydrophobicity and free energy, chemical composition, and topography, can altered cell attachment.

  9. Polymorphous silicon thin films produced in dusty plasmas: application to solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Roca i Cabarrocas, Pere; Chaabane, N; Kharchenko, A V; Tchakarov, S [Laboratoire de Physique des Interfaces et des Couches Minces (UMR 7647), Ecole Polytechnique, 91128 Palaiseau Cedex (France)

    2004-12-01

    We summarize our current understanding of the optimization of PIN solar cells produced by plasma enhanced chemical vapour deposition from silane-hydrogen mixtures. To increase the deposition rate, the discharge is operated under plasma conditions close to powder formation, where silicon nanocrystals contribute to the deposition of so-called polymorphous silicon thin films. We show that the increase in deposition rate can be achieved via an accurate control of the plasma parameters. However, this also results in a highly defective interface in the solar cells due to the bombardment of the P-layer by positively charged nanocrystals during the deposition of the I-layer. We show that decreasing the ion energy by increasing the total pressure or by using silane-helium mixtures allows us to increase both the deposition rate and the solar cells efficiency, as required for cost effective thin film photovoltaics.

  10. Polymorphous silicon thin films produced in dusty plasmas: application to solar cells

    Science.gov (United States)

    Cabarrocas, Pere Roca i.; Chaâbane, N.; Kharchenko, A. V.; Tchakarov, S.

    2004-12-01

    We summarize our current understanding of the optimization of PIN solar cells produced by plasma enhanced chemical vapour deposition from silane hydrogen mixtures. To increase the deposition rate, the discharge is operated under plasma conditions close to powder formation, where silicon nanocrystals contribute to the deposition of so-called polymorphous silicon thin films. We show that the increase in deposition rate can be achieved via an accurate control of the plasma parameters. However, this also results in a highly defective interface in the solar cells due to the bombardment of the P-layer by positively charged nanocrystals during the deposition of the I-layer. We show that decreasing the ion energy by increasing the total pressure or by using silane helium mixtures allows us to increase both the deposition rate and the solar cells efficiency, as required for cost effective thin film photovoltaics.

  11. Human IDO-competent, long-lived immunoregulatory dendritic cells induced by intracellular pathogen, and their fate in humanized mice

    Science.gov (United States)

    Tyagi, Rajeev K.; Miles, Brodie; Parmar, Rajesh; Garg, Neeraj K.; Dalai, Sarat K.; Baban, Babak; Cutler, Christopher W.

    2017-01-01

    Targeting of myeloid-dendritic cell receptor DC-SIGN by numerous chronic infectious agents, including Porphyromonas gingivalis, is shown to drive-differentiation of monocytes into dysfunctional mDCs. These mDCs exhibit alterations of their fine-tuned homeostatic function and contribute to dysregulated immune-responses. Here, we utilize P. gingivalis mutant strains to show that pathogen-differentiated mDCs from primary human-monocytes display anti-apoptotic profile, exhibited by elevated phosphorylated-Foxo1, phosphorylated-Akt1, and decreased Bim-expression. This results in an overall inhibition of DC-apoptosis. Direct stimulation of complex component CD40 on DCs leads to activation of Akt1, suggesting CD40 involvement in anti-apoptotic effects observed. Further, these DCs drove dampened CD8+ T-cell and Th1/Th17 effector-responses while inducing CD25+Foxp3+CD127− Tregs. In vitro Treg induction was mediated by DC expression of indoleamine 2,3-dioxygenase, and was confirmed in IDO-KO mouse model. Pathogen-infected & CMFDA-labeled MoDCs long-lasting survival was confirmed in a huMoDC reconstituted humanized mice. In conclusion, our data implicate PDDCs as an important target for resolution of chronic infection. PMID:28198424

  12. Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

    Science.gov (United States)

    Lamont-Friedrich, Stephanie J.; Michl, Thomas D.; Giles, Carla; Griesser, Hans J.; Coad, Bryan R.

    2016-07-01

    The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata. Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others.

  13. Human iPS cell-derived insulin producing cells form vascularized organoids under the kidney capsules of diabetic mice.

    Directory of Open Access Journals (Sweden)

    Sudhanshu P Raikwar

    Full Text Available Type 1 diabetes (T1D is caused by autoimmune disease that leads to the destruction of pancreatic β-cells. Transplantation of cadaveric pancreatic organs or pancreatic islets can restore normal physiology. However, there is a chronic shortage of cadaveric organs, limiting the treatment of the majority of patients on the pancreas transplantation waiting list. Here, we hypothesized that human iPS cells can be directly differentiated into insulin producing cells (IPCs capable of secreting insulin. Using a series of pancreatic growth factors, we successfully generated iPS cells derived IPCs. Furthermore, to investigate the capability of these cells to secrete insulin in vivo, the differentiated cells were transplanted under the kidney capsules of diabetic immunodeficient mice. Serum glucose levels gradually declined to either normal or near normal levels over 150 days, suggesting that the IPCs were secreting insulin. In addition, using MRI, a 3D organoid appeared as a white patch on the transplanted kidneys but not on the control kidneys. These organoids showed neo-vascularization and stained positive for insulin and glucagon. All together, these data show that a pancreatic organ can be created in vivo providing evidence that iPS cells might be a novel option for the treatment of T1D.

  14. Drinking water purification by electrosynthesis of hydrogen peroxide in a power-producing PEM fuel cell.

    Science.gov (United States)

    Li, Winton; Bonakdarpour, Arman; Gyenge, Előd; Wilkinson, David P

    2013-11-01

    The industrial anthraquinone auto-oxidation process produces most of the world's supply of hydrogen peroxide. For applications that require small amounts of H2 O2 or have economically difficult transportation means, an alternate, on-site H2 O2 production method is needed. Advanced drinking water purification technologies use neutral-pH H2 O2 in combination with UV treatment to reach the desired water purity targets. To produce neutral H2 O2 on-site and on-demand for drinking water purification, the electroreduction of oxygen at the cathode of a proton exchange membrane (PEM) fuel cell operated in either electrolysis (power consuming) or fuel cell (power generating) mode could be a possible solution. The work presented here focuses on the H2 /O2 fuel cell mode to produce H2 O2 . The fuel cell reactor is operated with a continuous flow of carrier water through the cathode to remove the product H2 O2 . The impact of the cobalt-carbon composite cathode catalyst loading, Teflon content in the cathode gas diffusion layer, and cathode carrier water flowrate on the production of H2 O2 are examined. H2 O2 production rates of up to 200 μmol h(-1)  cmgeometric (-2) are achieved using a continuous flow of carrier water operating at 30 % current efficiency. Operation times of more than 24 h have shown consistent H2 O2 and power production, with no degradation of the cobalt catalyst.

  15. Putative porcine embryonic stem cell lines derived from aggregated four-celled cloned embryos produced by oocyte bisection cloning.

    Science.gov (United States)

    Siriboon, Chawalit; Lin, Yu-Hsuan; Kere, Michel; Chen, Chun-Da; Chen, Lih-Ren; Chen, Chien-Hong; Tu, Ching-Fu; Lo, Neng-Wen; Ju, Jyh-Cherng

    2015-01-01

    We attempted to isolate ES cell lines using inner cell masses from high-quality cloned porcine blastocysts. After being seeded onto feeders, embryos had better (P cloned embryos (62.8, 42.6 and 12.8% vs. 76.2, 55.2 and 26.2%, respectively) compared to the non-aggregated group (41.6, 23.4 and 3.9%). Effects of feeder types (STO vs. MEF) and serum sources (FBS vs. KSR) on extraction of cloned embryo-derived porcine ES cells were examined. More (17.1%) ntES cell lines over Passage 3 were generated in the MEF/KSR group. However, ntES cells cultured in