WorldWideScience

Sample records for cells produce pathogenic

  1. IL-10 produced by iTreg cells controls colitis and pathogenic ex-iTreg cells during immunotherapy1

    OpenAIRE

    Schmitt, Erica G.; Haribhai, Dipica; Williams, Jason B; Aggarwal, Praful; Jia, Shuang; Charbonnier, Louis-Marie; Yan, Ke; Lorier, Rachel; Turner, Amy; Ziegelbauer, Jennifer; Georgiev, Peter; Simpson, Pippa; Salzman, Nita H.; Hessner, Martin J.; Broeckel, Ulrich

    2012-01-01

    “Natural” regulatory T (nTreg) cells that express the transcription factor Foxp3 and produce IL-10 are required for systemic immunological tolerance. “Induced” Treg (iTreg) cells are non-redundant and essential for tolerance at mucosal surfaces, yet their mechanisms of suppression and stability are unknown. We investigated the role of iTreg cell-produced IL-10 and iTreg cell fate in a treatment model of inflammatory bowel disease. Colitis was induced in Rag1−/− mice by the adoptive transfer o...

  2. Generation of IL-23 producing dendritic cells (DCs by airborne fungi regulates fungal pathogenicity via the induction of T(H-17 responses.

    Directory of Open Access Journals (Sweden)

    Georgios Chamilos

    Full Text Available Interleukin-17 (IL-17 producing T helper cells (T(H-17 comprise a newly recognized T cell subset with an emerging role in adaptive immunity to a variety of fungi. Whether different airborne fungi trigger a common signaling pathway for T(H-17 induction, and whether this ability is related to the inherent pathogenic behavior of each fungus is currently unknown. Here we show that, as opposed to primary pathogenic fungi (Histoplasma capsulatum, opportunistic fungal pathogens (Aspergillus and Rhizopus trigger a common innate sensing pathway in human dendritic cells (DCs that results in robust production of IL-23 and drives T(H-17 responses. This response requires activation of dectin-1 by the fungal cell wall polysaccharide b-glucan that is selectively exposed during the invasive growth of opportunistic fungi. Notably, unmasking of b-glucan in the cell wall of a mutant of Histoplasma not only abrogates the pathogenicity of this fungus, but also triggers the induction of IL-23 producing DCs. Thus, b-glucan exposure in the fungal cell wall is essential for the induction of IL-23/T(H-17 axis and may represent a key factor that regulates protective immunity to opportunistic but not pathogenic fungi.

  3. Loss of IL-17-producing CD8 T cells during late chronic stage of pathogenic simian immunodeficiency virus infection.

    Science.gov (United States)

    Nigam, Pragati; Kwa, Suefen; Velu, Vijayakumar; Amara, Rama Rao

    2011-01-15

    Progressive disease caused by pathogenic SIV/HIV infections is marked by systemic hyperimmune activation, immune dysregulation, and profound depletion of CD4(+) T cells in lymphoid and gastrointestinal mucosal tissues. IL-17 is important for protective immunity against extracellular bacterial infections at mucosa and for maintenance of mucosal barrier. Although IL-17-secreting CD4 (Th17) and CD8 (Tc17) T cells have been reported, very little is known about the latter subset for any infectious disease. In this study, we characterized the anatomical distribution, phenotype, and functional quality of Tc17 and Th17 cells in healthy (SIV-) and SIV+ rhesus macaques. In healthy macaques, Tc17 and Th17 cells were present in all lymphoid and gastrointestinal tissues studied with predominance in small intestine. About 50% of these cells coexpressed TNF-α and IL-2. Notably, ∼50% of Tc17 cells also expressed the co-inhibitory molecule CTLA-4, and only a minority (<20%) expressed granzyme B suggesting that these cells possess more of a regulatory than cytotoxic phenotype. After SIV infection, unlike Th17 cells, Tc17 cells were not depleted during the acute phase of infection. However, the frequency of Tc17 cells in SIV-infected macaques with AIDS was lower compared with that in healthy macaques demonstrating the loss of these cells during end-stage disease. Antiretroviral therapy partially restored the frequency of Tc17 and Th17 cells in the colorectal mucosa. Depletion of Tc17 cells was not observed in colorectal mucosa of chronically infected SIV+ sooty mangabeys. In conclusion, our results suggest a role for Tc17 cells in regulating disease progression during pathogenic SIV infection. PMID:21148794

  4. The vascular plant-pathogenic bacterium Ralstonia solanacearum produces biofilms required for its virulence on the surfaces of tomato cells adjacent to intercellular spaces.

    Science.gov (United States)

    Mori, Yuka; Inoue, Kanako; Ikeda, Kenichi; Nakayashiki, Hitoshi; Higashimoto, Chikaki; Ohnishi, Kouhei; Kiba, Akinori; Hikichi, Yasufumi

    2016-08-01

    The mechanism of colonization of intercellular spaces by the soil-borne and vascular plant-pathogenic bacterium Ralstonia solanacearum strain OE1-1 after invasion into host plants remains unclear. To analyse the behaviour of OE1-1 cells in intercellular spaces, tomato leaves with the lower epidermis layers excised after infiltration with OE1-1 were observed under a scanning electron microscope. OE1-1 cells formed microcolonies on the surfaces of tomato cells adjacent to intercellular spaces, and then aggregated surrounded by an extracellular matrix, forming mature biofilm structures. Furthermore, OE1-1 cells produced mushroom-type biofilms when incubated in fluids of apoplasts including intercellular spaces, but not xylem fluids from tomato plants. This is the first report of biofilm formation by R. solanacearum on host plant cells after invasion into intercellular spaces and mushroom-type biofilms produced by R. solanacearum in vitro. Sugar application led to enhanced biofilm formation by OE1-1. Mutation of lecM encoding a lectin, RS-IIL, which reportedly exhibits affinity for these sugars, led to a significant decrease in biofilm formation. Colonization in intercellular spaces was significantly decreased in the lecM mutant, leading to a loss of virulence on tomato plants. Complementation of the lecM mutant with native lecM resulted in the recovery of mushroom-type biofilms and virulence on tomato plants. Together, our findings indicate that OE1-1 produces mature biofilms on the surfaces of tomato cells after invasion into intercellular spaces. RS-IIL may contribute to biofilm formation by OE1-1, which is required for OE1-1 virulence. PMID:26609568

  5. Contamination of fresh produce with human pathogens: sources and solutions

    Science.gov (United States)

    Since 1991 there have been several outbreaks of foodborne illnesses associated with the presence of human pathogens on fresh and fresh-cut fruits and vegetables. These outbreaks have led to increased concern about the prevalence of pathogens in the environment and the vulnerability of fresh produce...

  6. Interleukin-7 produced by intestinal epithelial cells in response to Citrobacter rodentium infection plays a major role in innate immunity against this pathogen.

    Science.gov (United States)

    Zhang, Wei; Du, Jiang-Yuan; Yu, Qing; Jin, Jun-O

    2015-08-01

    Interleukin-7 (IL-7) engages multiple mechanisms to overcome chronic viral infections, but the role of IL-7 in bacterial infections, especially enteric bacterial infections, remains unclear. Here we characterized the previously unexplored role of IL-7 in the innate immune response to the attaching and effacing bacterium Citrobacter rodentium. C. rodentium infection induced IL-7 production from intestinal epithelial cells (IECs). IL-7 production from IECs in response to C. rodentium was dependent on gamma interferon (IFN-γ)-producing NK1.1(+) cells and IL-12. Treatment with anti-IL-7Rα antibody during C. rodentium infection resulted in a higher bacterial burden, enhanced intestinal damage, and greater weight loss and mortality than observed with the control IgG treatment. IEC-produced IL-7 was only essential for protective immunity against C. rodentium during the first 6 days after infection. An impaired bacterial clearance upon IL-7Rα blockade was associated with a significant decrease in macrophage accumulation and activation in the colon. Moreover, C. rodentium-induced expansion and activation of intestinal CD4(+) lymphoid tissue inducer (LTi) cells was completely abrogated by IL-7Rα blockade. Collectively, these data demonstrate that IL-7 is produced by IECs in response to C. rodentium infection and plays a critical role in the protective immunity against this intestinal attaching and effacing bacterium.

  7. Study of the induced systemic resistance of plants: molecular aspects of the interaction between plant cells and amphiphilic elicitors produced by non-pathogenic rhizobacteria

    OpenAIRE

    Henry, Guillaume

    2013-01-01

    Some non pathogenic rhizobacteria could locally interact with plants, leading to the stimulation of a primed protection state in the host plant. Upon subsequent pathogen attack, this priming state allows an accelerated activation of defense responses extending to all organs of the plant. Fundamental as well as applied research about this induced systemic resistance (ISR) has been tremendously boosted in the past decades, driven by its evident potential for biological control of plant diseases...

  8. Human commensals producing a novel antibiotic impair pathogen colonization.

    Science.gov (United States)

    Zipperer, Alexander; Konnerth, Martin C; Laux, Claudia; Berscheid, Anne; Janek, Daniela; Weidenmaier, Christopher; Burian, Marc; Schilling, Nadine A; Slavetinsky, Christoph; Marschal, Matthias; Willmann, Matthias; Kalbacher, Hubert; Schittek, Birgit; Brötz-Oesterhelt, Heike; Grond, Stephanie; Peschel, Andreas; Krismer, Bernhard

    2016-07-28

    The vast majority of systemic bacterial infections are caused by facultative, often antibiotic-resistant, pathogens colonizing human body surfaces. Nasal carriage of Staphylococcus aureus predisposes to invasive infection, but the mechanisms that permit or interfere with pathogen colonization are largely unknown. Whereas soil microbes are known to compete by production of antibiotics, such processes have rarely been reported for human microbiota. We show that nasal Staphylococcus lugdunensis strains produce lugdunin, a novel thiazolidine-containing cyclic peptide antibiotic that prohibits colonization by S. aureus, and a rare example of a non-ribosomally synthesized bioactive compound from human-associated bacteria. Lugdunin is bactericidal against major pathogens, effective in animal models, and not prone to causing development of resistance in S. aureus. Notably, human nasal colonization by S. lugdunensis was associated with a significantly reduced S. aureus carriage rate, suggesting that lugdunin or lugdunin-producing commensal bacteria could be valuable for preventing staphylococcal infections. Moreover, human microbiota should be considered as a source for new antibiotics. PMID:27466123

  9. Incidence of Bacteriocins Produced by Food-Related Lactic Acid Bacteria Active towards Oral Pathogens

    Directory of Open Access Journals (Sweden)

    Konstantinos Papadimitriou

    2013-02-01

    Full Text Available In the present study we investigated the incidence of bacteriocins produced by 236 lactic acid bacteria (LAB food isolates against pathogenic or opportunistic pathogenic oral bacteria. This set of LAB contained several strains (≥17% producing bacteriocins active against food-related bacteria. Interestingly only Streptococcus macedonicus ACA-DC 198 was able to inhibit the growth of Streptococcus oralis, Streptococcus sanguinis and Streptococcus gordonii, while Lactobacillus fermentum ACA-DC 179 and Lactobacillus plantarun ACA-DC 269 produced bacteriocins solely against Streptococcus oralis. Thus, the percentage of strains that were found to produce bacteriocins against oral bacteria was ~1.3%. The rarity of bacteriocins active against oral LAB pathogens produced by food-related LAB was unexpected given their close phylogenetic relationship. Nevertheless, when tested in inhibition assays, the potency of the bacteriocin(s of S. macedonicus ACA-DC 198 against the three oral streptococci was high. Fourier-transform infrared spectroscopy combined with principal component analysis revealed that exposure of the target cells to the antimicrobial compounds caused major alterations of key cellular constituents. Our findings indicate that bacteriocins produced by food-related LAB against oral LAB may be rare, but deserve further investigation since, when discovered, they can be effective antimicrobials.

  10. Hemolysin, Protease, and EPS Producing Pathogenic Aeromonas hydrophila Strain An4 Shows Antibacterial Activity against Marine Bacterial Fish Pathogens

    Directory of Open Access Journals (Sweden)

    Anju Pandey

    2010-01-01

    Full Text Available A pathogenic Aeromonas hydrophila strain An4 was isolated from marine catfish and characterized with reference to its proteolytic and hemolytic activity along with SDS-PAGE profile (sodium dodecyl sulphate-Polyacrylamide gel electrophoresis of ECPs (extracellular proteins showing hemolysin (approximately 50 kDa. Agar well diffusion assay using crude cell extract of the bacterial isolate clearly demonstrated antibacterial activity against indicator pathogenic bacteria, Staphylococcus arlettae strain An1, Acinetobacter sp. strain An2, Vibrio parahaemolyticus strain An3, and Alteromonas aurentia SE3 showing inhibitory zone >10 mm well comparable to common antibiotics. Further GC-MS analysis of crude cell extract revealed several metabolites, namely, phenolics, pyrrolo-pyrazines, pyrrolo-pyridine, and butylated hydroxytoluene (well-known antimicrobials. Characterization of EPS using FTIR indicated presence of several protein-related amine and amide groups along with peaks corresponding to carboxylic and phenyl rings which may be attributed to its virulent and antibacterial properties, respectively. Besides hemolysin, EPS, and protease, Aeromonas hydrophila strain An4 also produced several antibacterial metabolites.

  11. Bacteriocin activity against various pathogens produced by Pediococcus pentosaceus VJ13 isolated from Idly batter.

    Science.gov (United States)

    Vidhyasagar, Venkatasubramanian; Jeevaratnam, Kadirvelu

    2013-11-01

    Bacteriocins, an antimicrobial peptide, is known to have wide spectrum antimicrobial activity against various pathogens. Because they are easily digested in the intestine, they are considered as safe and are widely used as food preservatives. Hence their purification and characterization have attracted considerable attraction, especially for those having activity against human pathogens. In this study, the bacteriocin produced by Pediococcus pentosaceus VJ13 was precipitated with cold acetone and purified by gel permeation chromatography and hydrophobic interaction chromatography. The bacteriocin exhibited antimicrobial activity against various pathogens, like Mycobacterium smegmatis, Klebsiella pneumonia, Clostridium perfringens and Staphylococcus epidermidis. The activity of bacteriocin was lost completely after treatment with protease, which revealed its proteinaceous nature. The bacteriocin was stable up to 100°C and exhibited antilisterial property which is a characteristic feature of class IIa bacteriocins. It was active within the pH range of 2-8 and stable against various chemicals and denaturants. Tricine SDS-PAGE revealed its molecular weight to be 4.0 kDa, where the corresponding activity against Listeria monocytogenes was also noted. Treatment of L. monocytogenes with bacteriocin decreased the viable cell count, and scanning electron microscope analysis revealed membrane pore formation that resulted in the release of intracellular content, suggesting its bactericidal effect.

  12. Bioactive Secondary Metabolites Produced by the Oak Pathogen Diplodia corticola.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Cimmino, Alessio; D'Amico, Wanda; Scanu, Bruno; Evidente, Marco; Tuzi, Angela; Evidente, Antonio

    2016-01-13

    Three new lactones and a new fatty acid ester, named sapinofuranones C and D, diplopyrone B, and diplobifuranylone C, respectively, were isolated from Diplodia corticola, together with sphaeropsidins A and C, diplopyrone, diplobifuranylones A and B, diplofuranone A, and the (S,S)-enantiomer of sapinofuranone B. Sapinofuranones C and D, diplopyrone B, and diplobifuranylone C were characterized as (5S)-5-((1,S-1,6-dihydroxyhexa-2,4-dienyl)-dihydrofuran-2-one, 4,5-dihydroxy-deca-6,8-dienoic acid methyl ester, (5S)-5-hydroxy-6-(penta-1,3-dienyl)-5,6-dihydro-pyran-2-one, and 5'-((1R)-1-hydroxyethyl)-2',5'-dihydro-2H-[2,2']bifuranyl-5-one by spectroscopic and chemical methods, respectively. The relative configuration of sapinofuranone C was assigned by X-ray diffraction analysis, whereas its absolute configuration was determined by applying the advanced Mosher's method to its 11-O-p-bromobenzoyl derivative. The same method was used to assign the absolute configuration to C-5 of diplopyrone B and to that of the hydroxyethyl of the side chain of diplobifuranylone C, respectively. The metabolites isolated were tested at 1 mg/mL on leaves of cork oak, grapevine cv. 'Cannonau', and tomato using the leaf puncture assay. They were also tested on tomato cuttings at 0.2, 0.1, and 0.05 mg/mL. Each compound was tested for zootoxic activity on Artemia salina L. larvae. The efficacy of sapinofuranone C and diplopyrone B on three plant pathogens, namely, Athelia rolfsii, Fusarium avenaceum, and Phytophthora nicotianae was also evaluated. In all phytotoxic assays only diplopyrone B was found to be active. It also showed strong inhibition on the vegetative growth of A. rolfsii and P. nicotianae. All metabolites were inactive in the assay performed for the zootoxic activity (A. salina) even at the highest concentration used (200 μg/mL). Diplopyrone B showed a promising antioomycete activity for the control of Phytophthora spp. also taking into account the absence of zootoxic activity.

  13. Bioactive Secondary Metabolites Produced by the Oak Pathogen Diplodia corticola.

    Science.gov (United States)

    Masi, Marco; Maddau, Lucia; Linaldeddu, Benedetto Teodoro; Cimmino, Alessio; D'Amico, Wanda; Scanu, Bruno; Evidente, Marco; Tuzi, Angela; Evidente, Antonio

    2016-01-13

    Three new lactones and a new fatty acid ester, named sapinofuranones C and D, diplopyrone B, and diplobifuranylone C, respectively, were isolated from Diplodia corticola, together with sphaeropsidins A and C, diplopyrone, diplobifuranylones A and B, diplofuranone A, and the (S,S)-enantiomer of sapinofuranone B. Sapinofuranones C and D, diplopyrone B, and diplobifuranylone C were characterized as (5S)-5-((1,S-1,6-dihydroxyhexa-2,4-dienyl)-dihydrofuran-2-one, 4,5-dihydroxy-deca-6,8-dienoic acid methyl ester, (5S)-5-hydroxy-6-(penta-1,3-dienyl)-5,6-dihydro-pyran-2-one, and 5'-((1R)-1-hydroxyethyl)-2',5'-dihydro-2H-[2,2']bifuranyl-5-one by spectroscopic and chemical methods, respectively. The relative configuration of sapinofuranone C was assigned by X-ray diffraction analysis, whereas its absolute configuration was determined by applying the advanced Mosher's method to its 11-O-p-bromobenzoyl derivative. The same method was used to assign the absolute configuration to C-5 of diplopyrone B and to that of the hydroxyethyl of the side chain of diplobifuranylone C, respectively. The metabolites isolated were tested at 1 mg/mL on leaves of cork oak, grapevine cv. 'Cannonau', and tomato using the leaf puncture assay. They were also tested on tomato cuttings at 0.2, 0.1, and 0.05 mg/mL. Each compound was tested for zootoxic activity on Artemia salina L. larvae. The efficacy of sapinofuranone C and diplopyrone B on three plant pathogens, namely, Athelia rolfsii, Fusarium avenaceum, and Phytophthora nicotianae was also evaluated. In all phytotoxic assays only diplopyrone B was found to be active. It also showed strong inhibition on the vegetative growth of A. rolfsii and P. nicotianae. All metabolites were inactive in the assay performed for the zootoxic activity (A. salina) even at the highest concentration used (200 μg/mL). Diplopyrone B showed a promising antioomycete activity for the control of Phytophthora spp. also taking into account the absence of zootoxic activity

  14. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Directory of Open Access Journals (Sweden)

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  15. Pathogenic memory type Th2 cells in allergic inflammation.

    Science.gov (United States)

    Endo, Yusuke; Hirahara, Kiyoshi; Yagi, Ryoji; Tumes, Damon J; Nakayama, Toshinori

    2014-02-01

    Immunological memory is a hallmark of adaptive immunity. Memory CD4 T helper (Th) cells are central to acquired immunity, and vaccines for infectious diseases are developed based on this concept. However, memory Th cells also play a critical role in the pathogenesis of various chronic inflammatory diseases, including asthma. We refer to these populations as 'pathogenic memory Th cells.' Here, we review recent developments highlighting the functions and characteristics of several pathogenic memory type Th2 cell subsets in allergic inflammation. Also discussed are the similarities and differences between pathogenic memory Th2 cells and recently identified type 2 innate lymphoid cells (ILC2), focusing on cytokine production and phenotypic profiles.

  16. Most Common Foodborne Pathogens and Mycotoxins on Fresh Produce: A Review of Recent Outbreaks.

    Science.gov (United States)

    Yeni, F; Yavaş, S; Alpas, H; Soyer, Y

    2016-07-01

    Every year millions of people are affected and thousands of them die due to infections and intoxication as a result of foodborne outbreaks, which also cause billions of dollars' worth of damage, public health problems, and agricultural product loss. A considerable portion of these outbreaks is related to fresh produce and caused by foodborne pathogens on fresh produce and mycotoxins. Escherichia coli O104:H4 outbreak, occurred in Germany in 2011, has attracted a great attention on foodborne outbreaks caused by contaminated fresh produce, and especially the vulnerability and gaps in the early warning and notification networks in the surveillance systems in all around the world. In the frame of this paper, we reviewed the most common foodborne pathogens on fresh produce, traceback investigations of the outbreaks caused by these pathogens, and lastly international early warning and notification systems, including PulseNet International and Rapid Alert System for Food and Feed, aiming to detect foodborne outbreaks. PMID:26583913

  17. Mast cells: multitalented facilitators of protection against bacterial pathogens

    Science.gov (United States)

    Trivedi, Nikita H; Guentzel, M Neal; Rodriguez, Annette R; Yu, Jieh-Juen; Forsthuber, Thomas G; Arulanandam, Bernard P

    2014-01-01

    Mast cells are crucial effector cells evoking immune responses against bacterial pathogens. The positioning of mast cells at the host–environment interface, and the multitude of pathogen-recognition receptors and preformed mediator granules make these cells potentially the earliest to respond to an invading pathogen. In this review, the authors summarize the receptors used by mast cells to recognize invading bacteria and discuss the function of immune mediators released by mast cells in control of bacterial infection. The interaction of mast cells with other immune cells, including macrophages, dendritic cells and T cells, to induce protective immunity is highlighted. The authors also discuss mast cell-based vaccine strategies and the potential application in control of bacterial disease. PMID:23390944

  18. [Helper T cell paradigm: Th17 and regulatory T cells involved in autoimmune inflammatory disorders, pathogen defense and allergic diseases].

    Science.gov (United States)

    Noma, Takeshi

    2010-01-01

    The helper T cell paradigm, divided into two distinct subsets, Th1 and Th2 cells, characterized by distinct cytokine and functions, has been expanded to IL-17-producing Th17 cells. Th1 cells producing IFN-γ are involved in delayed-type hypersensitivity, effective in intracellular pathogens defense, while Th2 cells secrete IL-4, IL-5, IL-13 and IL-25 and has a central role in IgE production, eosinophilic inflammation, and the protection for helminthic parasite infection. Th17 cell lineages, expressing IL-17 family of cytokines and IL-23-mediated functions on T cells, plays a role in immune response to fungi and extracellular pathogens and autoimmune inflammatory disorders. Th17 cells are required the combination of IL-6 and TGF-β and the transcription factors, RORC2/RORgt (mice) and STAT3 for differentiation, and produce IL-17, IL-22, IL-17F, IL-21 and CCL20. FOXP3+ regulatory T (Treg) cells produce TGF-β and IL-10, which regulate effector T cells, and thus maintain peripheral tolerance. Four functionally unique CD4+ T cells, including the regulatory T (Treg) cells are now involved in the regulation of immune responses to pathogens, self-antigens and allergens. Any defect in the entire CD4+T cell population might results in human diseases. In this review, the biology of Th17 cells and Treg cells and their role in immune diseases are presented.

  19. Producing Insulin from Neural Cells

    OpenAIRE

    Yuichi Hori; Xueying Gu; Xiaodong Xie; Kim, Seung K.

    2005-01-01

    BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals t...

  20. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    NARCIS (Netherlands)

    Banach, J.L.; Sampers, I.; Haute, van S.; Fels, van der H.J.

    2015-01-01

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water dis

  1. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater

    OpenAIRE

    Eelco Franz; Christiaan Veenman; Hoek, Angela H.A.M. van; Ana de Roda Husman; Hetty Blaak

    2015-01-01

    To assess public health risks from environmental exposure to Extended-Spectrum β-Lactamases (ESBL)-producing bacteria, it is necessary to have insight in the proportion of relative harmless commensal variants and potentially pathogenic ones (which may directly cause disease). In the current study, 170 ESBL-producing E. coli from Dutch wastewater (n = 82) and surface water (n = 88) were characterized with respect to ESBL-genotype, phylogenetic group, resistance phenotype and virulence markers ...

  2. Antimicrobial peptides targeting Gram-negative pathogens, produced and delivered by lactic acid bacteria.

    Science.gov (United States)

    Volzing, Katherine; Borrero, Juan; Sadowsky, Michael J; Kaznessis, Yiannis N

    2013-11-15

    We present results of tests with recombinant Lactococcus lactis that produce and secrete heterologous antimicrobial peptides with activity against Gram-negative pathogenic Escherichia coli and Salmonella . In an initial screening, the activities of numerous candidate antimicrobial peptides, made by solid state synthesis, were assessed against several indicator pathogenic E. coli and Salmonella strains. Peptides A3APO and Alyteserin were selected as top performers based on high antimicrobial activity against the pathogens tested and on significantly lower antimicrobial activity against L. lactis . Expression cassettes containing the signal peptide of the protein Usp45 fused to the codon-optimized sequence of mature A3APO and Alyteserin were cloned under the control of a nisin-inducible promoter PnisA and transformed into L. lactis IL1403. The resulting recombinant strains were induced to express and secrete both peptides. A3APO- and Alyteserin-containing supernatants from these recombinant L. lactis inhibited the growth of pathogenic E. coli and Salmonella by up to 20-fold, while maintaining the host's viability. This system may serve as a model for the production and delivery of antimicrobial peptides by lactic acid bacteria to target Gram-negative pathogenic bacteria populations.

  3. Enteric Pathogen Survival Varies Substantially in Irrigation Water from Belgian Lettuce Producers

    Directory of Open Access Journals (Sweden)

    Inge Van Der Linden

    2014-09-01

    Full Text Available It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water temperature and chemical water quality was evaluated, and the survival tests were also performed in water samples from which the resident aquatic microbiota had previously been eliminated by filter sterilization. The pathogen’s survival differed greatly in the different irrigation waters. Three water samples contained nutrients to support important growth of the pathogens, and another enabled weaker growth. However, for all, growth was only observed in the samples that did not contain the resident aquatic microbiota. In the original waters with their specific water biota, pathogen levels declined. The same survival tendencies existed in water of 4 °C and 20 °C, although always more expressed at 20 °C. Low water temperatures resulted in longer pathogen survival. Remarkably, the survival capacity of two E. coli 0157:H7 strains differed, while Salmonella Thompson and Salmonella Typhimurium behaved similarly. The pathogens were also transferred to detached lettuce leaves, while suspended in two of the water samples or in a buffer. The effect of the water sample on the pathogen’s fitness was also reproduced on the leaves when stored at 100% relative humidity. Inoculation of the suspension in buffer or in one of the water samples enabled epiphytic growth and survival, while the pathogen level in the other water sample decreased once loaded on the leaves. Our results show that irrigation waters from different origin may have a different capacity to transmit

  4. Extended spectrum beta lactamase producing Proteus penneri: A rare missed pathogen?

    Directory of Open Access Journals (Sweden)

    Anita Pandey

    2014-01-01

    Full Text Available Indole negative Proteus species are invariably incorrectly identified as Proteus mirabilis, often missing out isolates of Proteus penneri. We report a case of extended spectrum beta lactamase producing and multidrug-resistant P. penneri isolated from pus from pressure sore of a patient of road traffic accident. Correct and rapid isolation and identification of such resistant pathogen are important as they are significant nosocomial threat.

  5. Toxins Produced by Valsa mali var. mali and Their Relationship with Pathogenicity

    Directory of Open Access Journals (Sweden)

    Caixia Wang

    2014-03-01

    Full Text Available Valsa mali var. mali (Vmm, the causal agent of apple tree canker disease, produces various toxic compounds, including protocatechuic acid, p-hydroxybenzoic acid, p-hydroxyacetophenone, 3-(p-hydroxyphenylpropanoic acid and phloroglucinol. Here, we examined the relationship between toxin production and the pathogenicity of Vmm strains and determined their bioactivities in several assays, for further elucidating the pathogenesis mechanisms of Vmm and for developing new procedures to control this disease. The toxins were quantified with the high performance liquid chromatography (HPLC method, and the results showed that the strain with attenuated virulence produced low levels of toxins with only three to four kinds of compounds being detectable. In contrast, higher amounts of toxins were produced by the more aggressive strain, and all five compounds were detected. This indicated a significant correlation between the pathogenicity of Vmm strains and their ability to produce toxins. However, this correlation only existed in planta, but not in vitro. During the infection of Vmm, protocatechuic acid was first detected at three days post inoculation (dpi, and the others at seven or 11 dpi. In addition, all compounds produced noticeable symptoms on host plants at concentrations of 2.5 to 40 mmol/L, with protocatechuic acid being the most effective compound, whereas 3-(p-hydroxyphenylpropanoic acid or p-hydroxybenzoic acid were the most active compounds on non-host plants.

  6. Single-molecule analysis of the major glycopolymers of pathogenic and non-pathogenic yeast cells

    Science.gov (United States)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Alsteens, David; Sarazin, Aurore; Jouault, Thierry; Dufrêne, Yves F.

    2013-05-01

    Most microbes are coated with carbohydrates that show remarkable structural variability and play a crucial role in mediating microbial-host interactions. Understanding the functions of cell wall glycoconjugates requires detailed knowledge of their molecular organization, diversity and heterogeneity. Here we use atomic force microscopy (AFM) with tips bearing specific probes (lectins, antibodies) to analyze the major glycopolymers of pathogenic and non-pathogenic yeast cells at molecular resolution. We show that non-ubiquitous β-1,2-mannans are largely exposed on the surface of native cells from pathogenic Candida albicans and C. glabrata, the former species displaying the highest glycopolymer density and extensions. We also find that chitin, a major component of the inner layer of the yeast cell wall, is much more abundant in C. albicans. These differences in molecular properties, further supported by flow cytometry measurements, may play an important role in strengthening cell wall mechanics and immune interactions. This study demonstrates that single-molecule AFM, combined with immunological and fluorescence methods, is a powerful platform in fungal glycobiology for probing the density, distribution and extension of specific cell wall glycoconjugates. In nanomedicine, we anticipate that this new form of AFM-based nanoglycobiology will contribute to the development of sugar-based drugs, immunotherapeutics, vaccines and diagnostics.

  7. Comparative Analysis of Immune Cells Activation and Cytotoxicity upon Exposure Pathogen and Glycoconjugates

    Science.gov (United States)

    Saheb, Entsar; Tarasenko, Olga

    2010-04-01

    Peripheral mononuclear cells (PMNC) including macrophages are key players in the immune responses against pathogens. Any infection could be attenuated if PMNC would be activated and capable to kill pathogen on exposure. It was shown that glycoconjugates (GCs) play an important role in adhesion to, activation, and recognition of pathogens. Nitric oxide (NO) is a regulatory molecule released by immune cells against pathogens that include bacteria, protozoa, helminthes, and fungi. NO is a highly reactive and diffusible molecule that controls replication or intracellular killing of pathogens during infection and immune responses against infections caused by pathogens. Avirulent Bacillus anthracis Sterne spores were used as a model in our study. The purpose of this study was two-fold: A) to analyze PMNC activation through NO production and B) to determine the cytotoxicity effect based on lactate dehydrogenase (LDH) upon exposure to pathogen exerted by GCs. The latter were used "prior to," "during," and "following" PMNC exposure to pathogen in order to modulate immune responses to spores during phagocytosis. Post-phagocytosis study involved the assessment of NO and LDH release by macrophages upon exposure to spores. Results have shown that untreated PMNC released low levels of NO. However, in the presence of GCs, PMNC were activated and produced high levels of NO under all experimental conditions. In addition, the results showed that GC1, GC3 are capable of increasing PMNC activity as evidenced by higher NO levels under the "prior," "during" and "following" to pathogen exposure conditions. On the other hand, GCs were capable of controlling cytotoxicity and decreased LDH levels during phagocytosis of spores. Our findings suggest that GCs stimulate NO production by activating PMNC and decrease cytotoxicity caused by pathogens on PMNC.

  8. Indoctrinating T cells to attack pathogens through homeschooling

    OpenAIRE

    Parello, Caitlin S.; Huseby, Eric S.

    2015-01-01

    Adaptive immunity is predicated on the ability of the T cell repertoire to have pre-existing specificity for the universe of potential pathogens. Recent findings suggest that TCR-self-pMHC interactions limit autoimmune responses while enhancing T cell response to foreign antigens. We review these findings here, placing them in context of the current understanding of how TCR-self-pMHC interactions regulate T cell activation thresholds, and suggest that TCR-self-pMHC interactions increase the e...

  9. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water.

    Science.gov (United States)

    Banach, Jennifer L; Sampers, Imca; Van Haute, Sam; van der Fels-Klerx, H J Ine

    2015-07-23

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant's reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer's efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  10. Isolation of Biosurfactant–Producing Bacteria with Antimicrobial Activity against Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Siripun Sarin

    2011-01-01

    Full Text Available The aims of this research were to study biosurfactant producing bacteria isolated from soil and to determine their property and efficiency as biosurfactants in order to inhibit bacterial pathogens. The result showed that there were 8 bacterial isolates out of 136 isolates of the total biosurfactant producing bacteria screened that exhibited the diameter of clear zone more than 1.5 cm. in the oil spreading test. The highest potential of emulsifying activity (%EA24 of 54.4 and the maximum additive concentration, (%MAC of 24.2 was obtained from the fermentation broth of the G7 isolate which the G7 isolate was later identified as Pseudomonas fluorescens. Escherichia coli, Staphylococcus aureus and Psuedomonas aeruginosa were the tested bacterial pathogens that were most sensitive to the acid precipitated biosurfactant obtained from P. fluorescens G7 with the lowest minimum inhibitory concentration (MIC of 41.6 mg/ml and minimum bactericidal concentration (MBC of 41.6 mg/ml compared with the acid precipitated bisurfactants of the other isolates used in the antimicrobial activity test. The type of the separated crude biosurfactant produced by P. fluorescens G7 analyzed later by using the rhamose test, TLC and FT-IR techniques was rhamnolipid.

  11. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Directory of Open Access Journals (Sweden)

    Jennifer L. Banach

    2015-07-01

    Full Text Available The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  12. Single-Cell Genomics Unveils Critical Regulators of Th17 Cell Pathogenicity.

    Science.gov (United States)

    Gaublomme, Jellert T; Yosef, Nir; Lee, Youjin; Gertner, Rona S; Yang, Li V; Wu, Chuan; Pandolfi, Pier Paolo; Mak, Tak; Satija, Rahul; Shalek, Alex K; Kuchroo, Vijay K; Park, Hongkun; Regev, Aviv

    2015-12-01

    Extensive cellular heterogeneity exists within specific immune-cell subtypes classified as a single lineage, but its molecular underpinnings are rarely characterized at a genomic scale. Here, we use single-cell RNA-seq to investigate the molecular mechanisms governing heterogeneity and pathogenicity of Th17 cells isolated from the central nervous system (CNS) and lymph nodes (LN) at the peak of autoimmune encephalomyelitis (EAE) or differentiated in vitro under either pathogenic or non-pathogenic polarization conditions. Computational analysis relates a spectrum of cellular states in vivo to in-vitro-differentiated Th17 cells and unveils genes governing pathogenicity and disease susceptibility. Using knockout mice, we validate four new genes: Gpr65, Plzp, Toso, and Cd5l (in a companion paper). Cellular heterogeneity thus informs Th17 function in autoimmunity and can identify targets for selective suppression of pathogenic Th17 cells while potentially sparing non-pathogenic tissue-protective ones. PMID:26607794

  13. A novel cell subset:Interferon-producing killer dendritic cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Recent reports introduce a novel cell subset of DCs with antigenic phenotypes shared by both NK cells and B cells, but without surface markers of pDCs and T cells, appearing to be a chimera of NK cells and DCs, namely interferon-producing killer dendritic cells(IKDCs).IKDCs not only secret type I and type II interferons to recognize and kill tumor cells effectively, but also express MHC-II molecules to present antigens.Thus, IKDCs are considered as important immunosurveilance cells for tumors, providing a link between innate and adaptive immunity.

  14. A novel cell subset: Interferon-producing killer dendritic cells

    Institute of Scientific and Technical Information of China (English)

    WANG JiongKun; XING FeiYue

    2008-01-01

    Recent reports introduce a novel cell subset of DCs with antigenic phenotypes shared by both NK cells and B cells, but without surface markers of pDCs and T cells, appearing to be a chimera of NK cells and DCs, namely interferon-producing killer dendritic cells (IKDCs). IKDCs not only secret type Ⅰ and type Ⅱ interferons to recognize and kill tumor cells effectively, but also express MHC-Ⅱ molecules to present antigens. Thus, IKDCs are considered as important immunosurveilance cells for tumors, providing a link between innate and adaptive immunity.

  15. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Science.gov (United States)

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  16. Contamination of knives and graters by bacterial foodborne pathogens during slicing and grating of produce.

    Science.gov (United States)

    Erickson, Marilyn C; Liao, Jean; Cannon, Jennifer L; Ortega, Ynes R

    2015-12-01

    Poor hygiene and improper food preparation practices in consumers' homes have previously been demonstrated as contributing to foodborne diseases. To address potential cross-contamination by kitchen utensils in the home, a series of studies was conducted to determine the extent to which the use of a knife or grater on fresh produce would lead to the utensil's contamination with Escherichia coli O157:H7 or Salmonella enterica. When shredding inoculated carrots (ca. 5.3 log CFU/carrot), all graters became contaminated and the number of E. coli O157:H7 present on the utensil was significantly greater than Salmonella (p Contamination of knives after slicing inoculated produce (4.9-5.4 log CFU/produce item) could only be detected by enrichment culture. After slicing tomatoes, honeydew melons, strawberries, cucumbers, and cantaloupes, the average prevalence of knife contamination by the two pathogens was 43%, 17%, 15%, 7%, and 3%, respectively. No significant increase in the incidence or level of contamination occurred on the utensils when residues were present (p > 0.05); however, subsequent contamination of 7 produce items processed with the contaminated utensils did occur. These results highlight the necessity of proper sanitization of these utensils when used in preparation of raw produce.

  17. Pathogen Inactivation of red cells: challenges and opportunities

    Institute of Scientific and Technical Information of China (English)

    Stephen J. Wagner

    2006-01-01

    @@ Introduction Virus inactivation methods for blood have been explored as a means to further reduce the risk from tested agents and to decrease the risk of emerging or variant agents for whom no deferral or effective screening methods are available. Although inactivation methods promise to reduce transfusion-related infectious disease risk, these methods are not perfect. Most techniques for pathogen reduction will not kill bacterial spores, or inactivate bacterial endotoxin, prion protein, or certain non-enveloped viruses whose tightly packed capsid proteins prevent access of the virucidal agent to its nucleic acid target. In addition,various inactivation methods have been known to decrease blood cell yield, affect blood cell recovery or survival, and may pose risk to recipients or blood center workers. My presentation today will review two methods for pathogen inactivation of red cells.

  18. Indoctrinating T cells to attack pathogens through homeschooling.

    Science.gov (United States)

    Parello, Caitlin S; Huseby, Eric S

    2015-06-01

    Adaptive immunity is predicated on the ability of the T cell repertoire to have pre-existing specificity for the universe of potential pathogens. Recent findings suggest that T cell receptor (TCR)-self-major histocompatibility protein (pMHC) interactions limit autoimmune responses while enhancing T cell response to foreign antigens. We review these findings here, placing them in context of the current understanding of how TCR-self-pMHC interactions regulate T cell activation thresholds, and suggest that TCR-self-pMHC interactions increase the efficiency of the T cell repertoire by giving a competitive advantage to peptide cross-reactive T cells. We propose that self-reactivity and peptide cross-reactivity are controlled by particular CDR3 sequence motifs, which would allow thymic selection to contribute to solving the feat of broad pathogen specificity by exporting T cells that are pre-screened by positive and negative selection for the ability to be 'moderately' peptide cross-reactive. PMID:25979654

  19. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    NARCIS (Netherlands)

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles i

  20. Infection strategies of intestinal parasite pathogens and host cell responses

    Directory of Open Access Journals (Sweden)

    Bruno Martorell Di Genova

    2016-03-01

    Full Text Available Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica are important pathogenic intestinal parasites and are amongst the leading cause worldwide of diarrheal illness in humans. Diseases caused by these organisms, Giardiasis, Cryptosporidiosis and Amoebiasis, respectively, are characterized by self-limited diarrhea but can evolve to long-term complications. The cellular and molecular mechanisms underlying the pathogenesis of diarrhea associated with these tree pathogens are being unraveled, with knowledge of both the strategies explored by the parasites to establish infection and the methods evolved by hosts to avoid it. Special attention is being given to molecules participating in parasite-host interaction and in the mechanisms implicated in the diseases pathophysiologic processes. This review focuses on cell mechanisms that are modulated during infection, including gene transcription, cytoskeleton rearrangements, signal transduction pathways and cell death.

  1. Infection Strategies of Intestinal Parasite Pathogens and Host Cell Responses.

    Science.gov (United States)

    Di Genova, Bruno M; Tonelli, Renata R

    2016-01-01

    Giardia lamblia, Cryptosporidium sp., and Entamoeba histolytica are important pathogenic intestinal parasites and are amongst the leading causes worldwide of diarrheal illness in humans. Diseases caused by these organisms, giardiasis, cryptosporidiosis, and amoebiasis, respectively, are characterized by self-limited diarrhea but can evolve to long-term complications. The cellular and molecular mechanisms underlying the pathogenesis of diarrhea associated with these three pathogens are being unraveled, with knowledge of both the strategies explored by the parasites to establish infection and the methods evolved by hosts to avoid it. Special attention is being given to molecules participating in parasite-host interaction and in the mechanisms implicated in the diseases' pathophysiologic processes. This review focuses on cell mechanisms that are modulated during infection, including gene transcription, cytoskeleton rearrangements, signal transduction pathways, and cell death. PMID:26973630

  2. TLR4-dependent hepcidin expression by myeloid cells in response to bacterial pathogens

    OpenAIRE

    Peyssonnaux, Carole; Zinkernagel, Annelies S.; Datta, Vivekanand; Lauth, Xavier; Johnson, Randall S; Nizet, Victor

    2006-01-01

    Hepcidin is an antimicrobial peptide secreted by the liver during inflammation that plays a central role in mammalian iron homeostasis. Here we demonstrate the endogenous expression of hepcidin by macrophages and neutrophils in vitro and in vivo. These myeloid cell types produced hepcidin in response to bacterial pathogens in a toll-like receptor 4 (TLR4)-dependent fashion. Conversely, bacterial stimulation of macrophages triggered a TLR4-dependent reduction in the iron exporter ferroportin. ...

  3. Novel insights into host-fungal pathogen interactions derived from live-cell imaging.

    Science.gov (United States)

    Bain, Judith; Gow, Neil A R; Erwig, Lars-Peter

    2015-03-01

    The theoretical physicist and Nobel laureate Richard Feynman outlined in his 1959 lecture, "There's plenty of room at the bottom", the enormous possibility of producing and visualising things at smaller scales. The advent of advanced scanning and transmission electron microscopy and high-resolution microscopy has begun to open the door to visualise host-pathogen interactions at smaller scales, and spinning disc confocal and two-photon microscopy has improved our ability to study these events in real time in three dimensions. The aim of this review is to illustrate some of the advances in understanding host-fungal interactions that have been made in recent years in particular those relating to the interactions of live fungal pathogens with phagocytes. Dynamic imaging of host-pathogen interactions has recently revealed novel detail and unsuspected mechanistic insights, facilitating the dissection of the phagocytic process into its component parts. Here, we will highlight advances in our knowledge of host-fungal pathogen interactions, including the specific effects of fungal cell viability, cell wall composition and morphogenesis on the phagocytic process and try to define the relative contributions of neutrophils and macrophages to the clearance of fungal pathogens in vitro and the infected host.

  4. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

    Science.gov (United States)

    Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

    2015-04-01

    Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems.

  5. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Directory of Open Access Journals (Sweden)

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  6. Invertebrate pathogenicity and toxin-producing potential of strains of Bacillus thuringiensis endemic to Antarctica.

    Science.gov (United States)

    Prabhakar, A; Bishop, A H

    2011-06-01

    Several strains of Bacillus thuringiensis were previously isolated from soil in Antarctica and appeared to have physiological adaptations to this cold, nutrient-poor environment. In spite of this they could produce abnormally large, parasporal crystals under laboratory conditions. Here, they have been further characterised for toxin genes and invertebrate pathogenicity. All of the strains were positive in PCR assays for the cry1Aa and cry2 genes. This was confirmed by sequence analysis and the parasporal crystals of all strains contained polypeptides of about 130kDa. This potential for lepidopteran toxicity was borne out in bioassays of purified δ-endotoxins against larvae of Pieris brassicae: the LD(50) values of B2408 (288μg) were comparable to that of the reference strain, HD-12 (201μg). There was no activity against the nematode Caenorhabditis elegans in spite of the fact that all strains appeared to possess the cry6 gene. PCR screening for genes encoding other nematode-toxic classes of toxins (Cry5, 4 and 21) was negative. B. thuringiensis has never previously been shown to be toxic to Collembola (springtails) but the purified δ-endotoxins of one of the Antarctic strains showed some activity against Folsomia candida and Seira domestica (224μg and 238μg, respectively). It seems unlikely that the level of toxicity demonstrated against springtails would support a pathogenic life-style in nature. All of the strains were positive for genes encoding Bacillus cereus-type enterotoxins. In the absence of higher insects and mammals the ecological value of retaining the toxic capability demonstrated here is uncertain. PMID:21457716

  7. De novo identification of viral pathogens from cell culture hologenomes

    Directory of Open Access Journals (Sweden)

    Patowary Ashok

    2012-01-01

    Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

  8. Secreted and immunogenic proteins produced by the honeybee bacterial pathogen, Paenibacillus larvae.

    Science.gov (United States)

    Antúnez, Karina; Anido, Matilde; Evans, Jay D; Zunino, Pablo

    2010-03-24

    American Foulbrood is a severe disease affecting larvae of honeybee Apis mellifera, causing significant decrease in the honeybee population, beekeeping industries and agricultural production. In spite of its importance, little is known about the virulence factors secreted by Paenibacillus larvae during larval infection. The aim of the present work was to perform a first approach to the identification and characterization of P. larvae secretome. P. larvae secreted proteins were analyzed by SDS-PAGE and identified by MALDI-TOF. Protein toxicity was evaluated using an experimental model based on feeding of A. mellifera larvae and immunogenicity was evaluated by Western blot, using an antiserum raised against cells and spores of P. larvae. Ten different proteins were identified among P. larvae secreted proteins, including proteins involved in transcription, metabolism, translation, cell envelope, transport, protein folding, degradation of polysaccharides and motility. Although most of these proteins are cytosolic, many of them have been previously detected in the extracellular medium of different Bacillus spp. cultures and have been related to virulence. The secreted proteins resulted highly toxic and immunogenic when larvae were exposed using an experimental model. This is the first description of proteins secreted by the honeybee pathogen P. larvae. This information may be relevant for the elucidation of bacterial pathogenesis mechanisms. PMID:19781868

  9. Mastitis Pathogens with High Virulence in a Mouse Model Produce a Distinct Cytokine Profile In Vivo

    Science.gov (United States)

    Johnzon, Carl-Fredrik; Artursson, Karin; Söderlund, Robert; Guss, Bengt; Rönnberg, Elin; Pejler, Gunnar

    2016-01-01

    Mastitis is a serious medical condition of dairy cattle. Here, we evaluated whether the degree of virulence of mastitis pathogens in a mouse model can be linked to the inflammatory response that they provoke. Clinical isolates of Staphylococcus aureus (S. aureus) (strain 556 and 392) and Escherichia coli (E. coli) (676 and 127), and laboratory control strains [8325-4 (S. aureus) and MG1655 (E. coli)], were injected i.p. into mice, followed by the assessment of clinical scores and inflammatory parameters. As judged by clinical scoring, E. coli 127 exhibited the largest degree of virulence among the strains. All bacterial strains induced neutrophil recruitment. However, whereas E. coli 127 induced high peritoneal levels of CXCL1, G-CSF, and CCL2, strikingly lower levels of these were induced by the less virulent bacterial strains. High concentrations of these compounds were also seen in blood samples taken from animals infected with E. coli 127, suggesting systemic inflammation. Moreover, the levels of CXCL1 and G-CSF, both in the peritoneal fluid and in plasma, correlated with clinical score. Together, these findings suggest that highly virulent clinical mastitis isolates produce a distinct cytokine profile that shows a close correlation with the severity of the bacterial infection. PMID:27713743

  10. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  11. Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Sandra Mojsova

    2015-10-01

    Full Text Available The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1 isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua. One isolate had a broader antimicrobial activity. None of the isolates showed inhibitory activity against S. enteritidis, E. coli and Y. enterocolitica. The genes enterocin P, cytolysin and enterocin A were the most frequently detected structural genes among the PCR positive strains. No amplification was obtained in two strains E. faecalis-25 and E. faecalis-86. Three different genes were identified in some strains. With the exclusion of strains possessing a virulence factor, such as cytolysin, producers of more than one enterocins could be of a great technological potential as protective cultures in the cheese industry.

  12. Lasiolactols A and B Produced by the Grapevine Fungal Pathogen Lasiodiplodia mediterranea.

    Science.gov (United States)

    Andolfi, Anna; Basso, Sara; Giambra, Selene; Conigliaro, Gaetano; Lo Piccolo, Sandra; Alves, Artur; Burruano, Santella

    2016-04-01

    A strain of Lasiodiplodia mediterranea, a fungus associated with grapevine decline in Sicily, produced several metabolites in liquid medium. Two new dimeric γ-lactols, lasiolactols A and B (1 and 2), were characterized as (2S*,3S*,4R*,5R*,2'S*,3'S*,4'R*,5'R*)- and (2R*,3S*,4R*,5R*,2'R*,3'S*,4'R*,5'R*)-(5-(4-hydroxymethyl-3,5-dimethyl-tetrahydro-furan-2-yloxy)-2,4-dimethyl-tetrahydro-furan-3-yl]-methanols by IR, 1D- and 2D-NMR, and HR-ESI-MS. Other four metabolites were identified as botryosphaeriodiplodin, (5R)-5-hydroxylasiodiplodin, (-)-(1R,2R)-jasmonic acid, and (-)-(3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone (3 - 6, resp.). The absolute configuration (R) at hydroxylated secondary C-atom C(7) was also established for compound 3. The compounds 1 - 3, 5, and 6, tested for their phytotoxic activities to grapevine cv. Inzolia leaves at different concentrations (0.125, 0.25, 0.5, and 1 mg/ml) were phytotoxic and compound 5 showed the highest toxicity. All metabolites did not show in vitro antifungal activity against four plant pathogens. PMID:26938016

  13. Transcriptional Profiling of Th2 Cells Identifies Pathogenic Features Associated with Asthma.

    Science.gov (United States)

    Seumois, Grégory; Zapardiel-Gonzalo, Jose; White, Brandie; Singh, Divya; Schulten, Veronique; Dillon, Myles; Hinz, Denize; Broide, David H; Sette, Alessandro; Peters, Bjoern; Vijayanand, Pandurangan

    2016-07-15

    Allergic asthma and rhinitis are two common chronic allergic diseases that affect the lungs and nose, respectively. Both diseases share clinical and pathological features characteristic of excessive allergen-induced type 2 inflammation, orchestrated by memory CD4(+) T cells that produce type 2 cytokines (Th2 cells). However, a large majority of subjects with allergic rhinitis do not develop asthma, suggesting divergence in disease mechanisms. Because Th2 cells play a pathogenic role in both these diseases and are also present in healthy nonallergic subjects, we performed global transcriptional profiling to determine whether there are qualitative differences in Th2 cells from subjects with allergic asthma, rhinitis, and healthy controls. Th2 cells from asthmatic subjects expressed higher levels of several genes that promote their survival as well as alter their metabolic pathways to favor persistence at sites of allergic inflammation. In addition, genes that enhanced Th2 polarization and Th2 cytokine production were also upregulated in asthma. Several genes that oppose T cell activation were downregulated in asthma, suggesting enhanced activation potential of Th2 cells from asthmatic subjects. Many novel genes with poorly defined functions were also differentially expressed in asthma. Thus, our transcriptomic analysis of circulating Th2 cells has identified several molecules that are likely to confer pathogenic features to Th2 cells that are either unique or common to both asthma and rhinitis. PMID:27271570

  14. Cell wall integrity signalling in human pathogenic fungi.

    Science.gov (United States)

    Dichtl, Karl; Samantaray, Sweta; Wagener, Johannes

    2016-09-01

    Fungi are surrounded by a rigid structure, the fungal cell wall. Its plasticity and composition depend on active regulation of the underlying biosynthesis and restructuring processes. This involves specialised signalling pathways that control gene expression and activities of biosynthetic enzymes. The cell wall integrity (CWI) pathway is the central signalling cascade required for the adaptation to a wide spectrum of cell wall perturbing conditions, including heat, oxidative stress and antifungals. In the recent years, great efforts were made to analyse the CWI pathway of diverse fungi. It turned out that the CWI signalling cascade is mostly conserved in the fungal kingdom. In this review, we summarise as well as compare the current knowledge on the canonical CWI pathway in the human pathogenic fungi Candida albicans, Candida glabrata, Aspergillus fumigatus and Cryptococcus neoformans. Understanding the differences and similarities in the stress responses of these organisms could become a key to improving existing or developing new antifungal therapies. PMID:27155139

  15. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  16. Bioreactor and methods for producing synchronous cells

    Science.gov (United States)

    Helmstetter, Charles E. (Inventor); Thornton, Maureen (Inventor); Gonda, Steve (Inventor)

    2005-01-01

    Apparatus and methods are directed to a perfusion culture system in which a rotating bioreactor is used to grow cells in a liquid culture medium, while these cells are attached to an adhesive-treated porous surface. As a result of this arrangement and its rotation, the attached cells divide, with one cell remaining attached to the substrate, while the other cell, a newborn cell is released. These newborn cells are of approximately the same age, that are collected upon leaving the bioreactor. The populations of newborn cells collected are of synchronous and are minimally, if at all, disturbed metabolically.

  17. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  18. Pathogenic functions of B cells in autoimmune diseases: IFN-γ production joins the criminal gang.

    Science.gov (United States)

    Fillatreau, Simon

    2015-04-01

    B-cell depletion therapy has emerged as a powerful strategy to intercept the progression of T-cell-mediated autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, or relapsing remitting multiple sclerosis. However, its mode of action remains incompletely defined, reflecting our incomplete understanding of the pathogenic functions of B cells in such pathologies. B cells can contribute to immune responses through the production of antibodies, presentation of antigen to T cells, and production of cytokines. In this issue of the European Journal of Immunology [Eur. J. Immunol. 2015. 45: 988-998], Olalekan et al. demonstrate that IFN-γ production by B cells is essential for the development of arthritis in mice. Lack of IFN-γ expression in B cells results in reduced autoimmune T-cell responses and autoantibody levels, impacting the arthritogenic reaction akin to that in B-cell depletion therapy. Together with other reports, the article by Olalekan et al. emphasizes the importance of cytokine-producing B cells in the pathogenesis of autoimmune diseases. In this commentary, I discuss how these findings shed new light on the roles of B cells as drivers of autoimmune pathogenesis, and how they more generally contribute to our understanding of the role of B cells in immunity.

  19. Coronatine inhibits stomatal closure and delays hypersensitive response cell death induced by nonhost bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    2013-02-01

    Full Text Available Pseudomonas syringae is the most widespread bacterial pathogen in plants. Several strains of P. syringae produce a phytotoxin, coronatine (COR, which acts as a jasmonic acid mimic and inhibits plant defense responses and contributes to disease symptom development. In this study, we found that COR inhibits early defense responses during nonhost disease resistance. Stomatal closure induced by a nonhost pathogen, P. syringae pv. tabaci, was disrupted by COR in tomato epidermal peels. In addition, nonhost HR cell death triggered by P. syringae pv. tabaci on tomato was remarkably delayed when COR was supplemented along with P. syringae pv. tabaci inoculation. Using isochorismate synthase (ICS-silenced tomato plants and transcript profiles of genes in SA- and JA-related defense pathways, we show that COR suppresses SA-mediated defense during nonhost resistance.

  20. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  1. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells

    OpenAIRE

    Qilin Yu; Jianrong Li; Yueqi Zhang; Yufan Wang; Lu Liu; Mingchun Li

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxici...

  2. IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases.

    Science.gov (United States)

    Shen, Ping; Roch, Toralf; Lampropoulou, Vicky; O'Connor, Richard A; Stervbo, Ulrik; Hilgenberg, Ellen; Ries, Stefanie; Dang, Van Duc; Jaimes, Yarúa; Daridon, Capucine; Li, Rui; Jouneau, Luc; Boudinot, Pierre; Wilantri, Siska; Sakwa, Imme; Miyazaki, Yusei; Leech, Melanie D; McPherson, Rhoanne C; Wirtz, Stefan; Neurath, Markus; Hoehlig, Kai; Meinl, Edgar; Grützkau, Andreas; Grün, Joachim R; Horn, Katharina; Kühl, Anja A; Dörner, Thomas; Bar-Or, Amit; Kaufmann, Stefan H E; Anderton, Stephen M; Fillatreau, Simon

    2014-03-20

    B lymphocytes have critical roles as positive and negative regulators of immunity. Their inhibitory function has been associated primarily with interleukin 10 (IL-10) because B-cell-derived IL-10 can protect against autoimmune disease and increase susceptibility to pathogens. Here we identify IL-35-producing B cells as key players in the negative regulation of immunity. Mice in which only B cells did not express IL-35 lost their ability to recover from the T-cell-mediated demyelinating autoimmune disease experimental autoimmune encephalomyelitis (EAE). In contrast, these mice displayed a markedly improved resistance to infection with the intracellular bacterial pathogen Salmonella enterica serovar Typhimurium as shown by their superior containment of the bacterial growth and their prolonged survival after primary infection, and upon secondary challenge, compared to control mice. The increased immunity found in mice lacking IL-35 production by B cells was associated with a higher activation of macrophages and inflammatory T cells, as well as an increased function of B cells as antigen-presenting cells (APCs). During Salmonella infection, IL-35- and IL-10-producing B cells corresponded to two largely distinct sets of surface-IgM(+)CD138(hi)TACI(+)CXCR4(+)CD1d(int)Tim1(int) plasma cells expressing the transcription factor Blimp1 (also known as Prdm1). During EAE, CD138(+) plasma cells were also the main source of B-cell-derived IL-35 and IL-10. Collectively, our data show the importance of IL-35-producing B cells in regulation of immunity and highlight IL-35 production by B cells as a potential therapeutic target for autoimmune and infectious diseases. This study reveals the central role of activated B cells, particularly plasma cells, and their production of cytokines in the regulation of immune responses in health and disease.

  3. Potential Pathogenicity and Host Range of Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates from Healthy Poultry ▿

    OpenAIRE

    Bortolaia, Valeria; Larsen, Jesper; Damborg, Peter; Guardabassi, Luca

    2011-01-01

    Thirty of 33 epidemiologically unrelated extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolates from healthy poultry lacked the virulence genes commonly associated with human-pathogenic strains. The main zoonotic risk is associated with the broad host range of avian E. coli belonging to sequence type complex 10 and of IncN and IncI1 plasmids carrying blaCTX-M or blaSHV.

  4. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    OpenAIRE

    2013-01-01

    Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates con...

  5. Exposure to the paralytic shellfish toxin producer Alexandrium catenella increases the susceptibility of the oyster Crassostrea gigas to pathogenic vibrios.

    OpenAIRE

    Celina Abi-Khalil; Carmen Lopez-Joven; Eric Abadie; Veronique Savar; Zouher Amzil; Mohamed Laabir; Jean-Luc Rolland

    2016-01-01

    International audience The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France), we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs), was concomitant with the accumulation of PSTs in oyster flesh and the occurrenc...

  6. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce.

    Science.gov (United States)

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile; Zhang, Jue; Fang, Jing

    2015-12-30

    Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  7. The Intracellular Pathogen Rhodococcus equi Produces a Catecholate Siderophore Required for Saprophytic Growth▿

    OpenAIRE

    Miranda-CasoLuengo, Raúl; Prescott, John F.; Vázquez-Boland, José A.; Meijer, Wim G.

    2007-01-01

    Little is known about the iron acquisition systems of the soilborne facultative intracellular pathogen Rhodococcus equi. We previously reported that expression of iupABC, encoding a putative siderophore ABC transporter system, is iron regulated and required for growth at low iron concentrations. Here we show that disruption of iupA leads to the concomitant accumulation of catecholates and a chromophore with absorption maxima at 341 and 528 nm during growth under iron-replete conditions. In co...

  8. Nanoscale biophysical properties of the cell surface galactosaminogalactan from the fungal pathogen Aspergillus fumigatus.

    Science.gov (United States)

    Beaussart, Audrey; El-Kirat-Chatel, Sofiane; Fontaine, Thierry; Latgé, Jean-Paul; Dufrêne, Yves F

    2015-09-28

    Many fungal pathogens produce cell surface polysaccharides that play essential roles in host-pathogen interactions. In Aspergillus fumigatus, the newly discovered polysaccharide galactosaminogalactan (GAG) mediates adherence to a variety of substrates through molecular mechanisms that are poorly understood. Here we use atomic force microscopy to unravel the localization and adhesion of GAG on living fungal cells. Using single-molecule imaging with tips bearing anti-GAG antibodies, we found that GAG is massively exposed on wild-type (WT) germ tubes, consistent with the notion that this glycopolymer is secreted by the mycelium of A. fumigatus, while it is lacking on WT resting conidia and on germ tubes from a mutant (Δuge3) deficient in GAG. Imaging germ tubes with tips bearing anti-β-glucan antibodies shows that exposure of β-glucan is strongly increased in the Δuge3 mutant, indicating that this polysaccharide is masked by GAG during hyphal growth. Single-cell force measurements show that expression of GAG on germ tubes promotes specific adhesion to pneumocytes and non-specific adhesion to hydrophobic substrates. These results provide a molecular foundation for the multifunctional adhesion properties of GAG, thus suggesting it could be used as a potential target in anti-adhesion therapy and immunotherapy. Our methodology represents a powerful approach for characterizing the nanoscale organization and adhesion of cell wall polysaccharides during fungal morphogenesis, thereby contributing to increase our understanding of their role in biofilm formation and immune responses.

  9. Effects of volatile organic compounds produced by Bacillus amyloliquefaciens on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum.

    Science.gov (United States)

    Raza, Waseem; Wang, Jichen; Wu, Yuncheng; Ling, Ning; Wei, Zhong; Huang, Qiwei; Shen, Qirong

    2016-09-01

    The production of volatile organic compounds (VOCs) by microbes is an important characteristic for their selection as biocontrol agents against plant pathogens. In this study, we identified the VOCs produced by the biocontrol strain Bacillus amyloliquefaciens T-5 and evaluated their impact on the growth and virulence traits of tomato bacterial wilt pathogen Ralstonia solanacearum. The results showed that the VOCs of strain T-5 significantly inhibited the growth of R. solanacearum in agar medium and in soil. In addition, VOCs significantly inhibited the motility traits, root colonization, biofilm formation, and production of antioxidant enzymes and exopolysaccharides by R. solanacearum. However, no effect of VOCs on the production of hydrolytic enzymes by R. solanacearum was observed. The strain T-5 produced VOCs, including benzenes, ketones, aldehydes, alkanes, acids, and one furan and naphthalene compound; among those, 13 VOCs showed 1-10 % antibacterial activity against R. solanacearum in their produced amounts by T-5; however, the consortium of all VOCs produced on agar medium, in sterilized soil, and in natural soil showed 75, 62, and 85 % growth inhibition of R. solanacearum, respectively. The real-time PCR analysis further confirmed the results when the expression of different virulence- and metabolism-related genes in R. solanacearum cells was decreased after exposure to the VOCs of strain T-5. The results of this study clearly revealed the significance of VOCs in the control of plant pathogens. This information would help to better comprehend the microbial interactions mediated by VOCs in nature and to develop safer strategies to control plant disease. PMID:27183998

  10. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells

    Science.gov (United States)

    Yu, Qilin; Li, Jianrong; Zhang, Yueqi; Wang, Yufan; Liu, Lu; Li, Mingchun

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxicity to the tested pathogens, Candida albicans and Pseudomonas aeruginosa, the nanoparticles strongly inhibited pathogenic biofilm formation and invasion to dental pulp stem cells (DPSCs). Further investigations revealed that AuNPs abundantly bound to the pathogen cells, which likely contributed to their inhibitory effect on biofilm formation and invasion. Moreover, treatment of AuNPs led to activation of immune response-related genes in DPSCs, which may enhance the activity of host immune system against the pathogens. Zeta potential analysis and polyethylene glycol (PEG)/polyethyleneimine (PEI) coating tests further showed that the interaction between pathogen cells and AuNPs is associated with electrostatic attractions. Our findings shed novel light on the application of nanomaterials in fighting against clinical pathogens, and imply that the traditional growth inhibition test is not the only way to evaluate the drug effect during the screening of antimicrobial agents. PMID:27220400

  11. Inhibition of gold nanoparticles (AuNPs) on pathogenic biofilm formation and invasion to host cells.

    Science.gov (United States)

    Yu, Qilin; Li, Jianrong; Zhang, Yueqi; Wang, Yufan; Liu, Lu; Li, Mingchun

    2016-01-01

    Owing to the growing infectious diseases caused by eukaryotic and prokaryotic pathogens, it is urgent to develop novel antimicrobial agents against clinical pathogenic infections. Biofilm formation and invasion into the host cells are vital processes during pathogenic colonization and infection. In this study, we tested the inhibitory effect of Au nanoparticles (AuNPs) on pathogenic growth, biofilm formation and invasion. Interestingly, although the synthesized AuNPs had no significant toxicity to the tested pathogens, Candida albicans and Pseudomonas aeruginosa, the nanoparticles strongly inhibited pathogenic biofilm formation and invasion to dental pulp stem cells (DPSCs). Further investigations revealed that AuNPs abundantly bound to the pathogen cells, which likely contributed to their inhibitory effect on biofilm formation and invasion. Moreover, treatment of AuNPs led to activation of immune response-related genes in DPSCs, which may enhance the activity of host immune system against the pathogens. Zeta potential analysis and polyethylene glycol (PEG)/polyethyleneimine (PEI) coating tests further showed that the interaction between pathogen cells and AuNPs is associated with electrostatic attractions. Our findings shed novel light on the application of nanomaterials in fighting against clinical pathogens, and imply that the traditional growth inhibition test is not the only way to evaluate the drug effect during the screening of antimicrobial agents. PMID:27220400

  12. CCR2 defines in vivo development and homing of IL-23-driven GM-CSF-producing Th17 cells.

    Science.gov (United States)

    Kara, Ervin E; McKenzie, Duncan R; Bastow, Cameron R; Gregor, Carly E; Fenix, Kevin A; Ogunniyi, Abiodun D; Paton, James C; Mack, Matthias; Pombal, Diana R; Seillet, Cyrill; Dubois, Bénédicte; Liston, Adrian; MacDonald, Kelli P A; Belz, Gabrielle T; Smyth, Mark J; Hill, Geoffrey R; Comerford, Iain; McColl, Shaun R

    2015-01-01

    IL-17-producing helper T (Th17) cells are critical for host defense against extracellular pathogens but also drive numerous autoimmune diseases. Th17 cells that differ in their inflammatory potential have been described including IL-10-producing Th17 cells that are weak inducers of inflammation and highly inflammatory, IL-23-driven, GM-CSF/IFNγ-producing Th17 cells. However, their distinct developmental requirements, functions and trafficking mechanisms in vivo remain poorly understood. Here we identify a temporally regulated IL-23-dependent switch from CCR6 to CCR2 usage by developing Th17 cells that is critical for pathogenic Th17 cell-driven inflammation in experimental autoimmune encephalomyelitis (EAE). This switch defines a unique in vivo cell surface signature (CCR6(-)CCR2(+)) of GM-CSF/IFNγ-producing Th17 cells in EAE and experimental persistent extracellular bacterial infection, and in humans. Using this signature, we identify an IL-23/IL-1/IFNγ/TNFα/T-bet/Eomesodermin-driven circuit driving GM-CSF/IFNγ-producing Th17 cell formation in vivo. Thus, our data identify a unique cell surface signature, trafficking mechanism and T-cell intrinsic regulators of GM-CSF/IFNγ-producing Th17 cells. PMID:26511769

  13. Photodynamic pathogen inactivation in red cell concentrates with the silicon phthalocyanine Pc 4

    Science.gov (United States)

    Ben-Hur, Ehud; Chan, Wai-Shun; Yim, Zachary; Zuk, Maria M.; Dayal, Vinay; Roth, Nathan; Heldman, Eli; Lazlo, A.; Valeri, C. R.; Horowitz, Bernard

    2000-03-01

    The silicon phthalocyanine Pc 4, a photosensitizer activated with red light, has been studied for pathogen inactivation in red blood cell concentrates (RBCC). Pc 4 targets the envelope of pathogenic viruses such as HIV. To protect RBC during the process two main approaches are used: 1) Inclusion of quenches of reactive oxygen species produced during treatment. Tocopherol succinate was found to be most effective for this purpose. 2) Formulation of Pc 4, a lipophilic compound, in liposomes that reduce its binding to RBC but not to viruses. As a light source we used a light emitting diode array emitting at 660-680 nm. An efficient mixing device ensures homogeneous light exposure during treatment of intact RBCC. Treatment of RBCC with 5 (mu) M Pc 4 a d light results in the inactivation of >= 5.5 log10 HIV, >= 6.6 log10 VSV, and >= 5 log10 of PRV and BVDV. Parasites that can be transmitted by blood transfusion are even more sensitive than viruses. Following treatment, RBCC can be stored for 28 days at 4 degrees C with hemolysis below 1 percent. Baboon RBC circulate with an acceptable 24 hour recovery and half-life. Genetic toxicological studies of Pc 4 with or without light exposure are negative. We conclude that a process using Pc 4 and red light can potentially reduce the risk of transmitting pathogens in RBCC used for transfusion.

  14. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    Directory of Open Access Journals (Sweden)

    Chotiah S

    2013-06-01

    Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

  15. Plant cell wall dynamics and wall-related susceptibility in plant–pathogen interactions

    OpenAIRE

    Bellincampi, Daniela; Cervone, Felice; Lionetti, Vincenzo

    2014-01-01

    The cell wall is a dynamic structure that often determines the outcome of the interactions between plants and pathogens. It is a barrier that pathogens need to breach to colonize the plant tissue. While fungal necrotrophs extensively destroy the integrity of the cell wall through the combined action of degrading enzymes, biotrophic fungi require a more localized and controlled degradation of the cell wall in order to keep the host cells alive and utilize their feeding structures. Also bacteri...

  16. Plant cell wall dynamics and wall-related susceptibility in plant-pathogen interactions

    OpenAIRE

    Daniela eBellincampi; Felice eCervone; Vincenzo eLionetti

    2014-01-01

    The cell wall is a dynamic structure that often determines the outcome of the interactions between plants and pathogens. It is a barrier that pathogens need to breach to colonize the plant tissue. While fungal necrotrophs extensively destroy the integrity of the cell wall through the combined action of degrading enzymes, biotrophic fungi require a more localized and controlled degradation of the cell wall in order to keep the host cells alive and utilize their feeding structures. Also bacteri...

  17. Antitumor Immunity Produced by the Liver Kupffer Cells, NK Cells, NKT Cells, and CD8+ CD122+ T Cells

    OpenAIRE

    Shuhji Seki; Hiroyuki Nakashima; Masahiro Nakashima; Manabu Kinoshita

    2011-01-01

    Mouse and human livers contain innate immune leukocytes, NK cells, NKT cells, and macrophage-lineage Kupffer cells. Various bacterial components, including Toll-like receptor (TLR) ligands and an NKT cell ligand ( α -galactocylceramide), activate liver Kupffer cells, which produce IL-1, IL-6, IL-12, and TNF. IL-12 activates hepatic NK cells and NKT cells to produce IFN- γ , which further activates hepatic T cells, in turn activating phagocytosis and cytokine production by Kupffer cells in a p...

  18. Biscopyran, a phytotoxic hexasubstituted pyranopyran produced by Biscogniauxia mediterranea, a fungus pathogen of cork oak.

    Science.gov (United States)

    Evidente, Antonio; Andolfi, Anna; Maddau, Lucia; Franceschini, Antonio; Marras, Francesco

    2005-04-01

    A new phytotoxic hexasubstituted pyranopyran, biscopyran (3), was isolated together with phenylacetic acid (2) and previously isolated 5-methylmellein (1) from the liquid culture filtrates of Biscogniauxiamediterranea, a major fungal pathogen involved in oak decline in Sardinia. Biscopyran was characterized by spectroscopic methods as a new (Z)-2-methoxy-1-[7-((Z)-2-methoxybut-2-enoyl)-3,4,5,6-tetramethyl-2H,7H-pyrano[2,3-b]pyran-2-yl]but-2-en-1-one. Biscopyran assayed at 0.26-0.026 mM concentration range caused epinasty on cork oak cuttings. On a nonhost plant, tomato, biscopyran caused wilting. Phenylacetic acid, assayed at the same concentration, was toxic to Q. suber, while on tomato cuttings it induced internal tissue collapse on the stem.

  19. Purification and Structural Analysis of a Selective Toxin Fraction Produced by the Plant Pathogen Setosphaeria turcica

    Institute of Scientific and Technical Information of China (English)

    ZHANG Li-hui; DONG Jin-gao; WANG Chao-hua; LI Zheng-ping

    2007-01-01

    Thirteen fractions from the pathogenic plant fungus Setosphaeria turcica race 1 were separated and collected using high performance liquid chromatography (HPLC). Their toxic activities were assayed through leaf puncturing on corn differentials (OH43, OH43Htl, OH43Ht2, and OH43HtN), and the results revealed that eight fractions were toxic and fraction 6 was specifically toxic to OH43Htl, which could be taken as a gene-selective toxin fraction. Fraction 6 was finely purified via HPLC and condensed by freeze desiccation. Its chemical structure was analyzed with EI-MS, IR, HMBC, 1H-NMR, and two-dimensional NMR. The results suggested that fraction 6 contained an unsaturated double bond, carbonyl and methylene groups with molecular weight of 142.

  20. Extrapancreatic insulin-producing cells in multiple organs in diabetes

    OpenAIRE

    Kojima, Hideto; Fujimiya, Mineko; Matsumura, Kazuhiro; Nakahara, Tamio; Hara, Manami; Chan, Lawrence

    2004-01-01

    Insulin-producing cells normally occur only in the pancreas and thymus. Surprisingly, we found widespread insulin mRNA and protein expression in different diabetic mouse and rat models, including streptozotocin-treated mice and rats, ob/ob mice, and mice fed high-fat diets. We detected in diabetic mice proinsulin- and insulin-positive cells in the liver, adipose tissue, spleen, bone marrow, and thymus; many cells also produced glucagon, somatostatin, and pancreatic polypeptide. By in situ nuc...

  1. IL-10-producing type 1 regulatory T cells and allergy.

    Science.gov (United States)

    Wu, Kui; Bi, Yutian; Sun, Kun; Wang, Changzheng

    2007-08-01

    As an important subset of regulatory T (Treg) cells, IL-10-producing type 1 regulatory T cells (Tr1), have some different features to thymic-derived naturally occurring CD4+CD25+Foxp3+ Treg cells(nTreg cells). Similar to nTreg cells, Tr1 also play important roles in the control of allergic inflammation in several ways. There is a fine balance between Tr1 and Th2 responses in healthy subjects. Skewing of allergic-specific effector T cells to a Tr1 phenotype appears to be a critical event in successful allergen-specific immunotherapy and glucocorticoids and beta2-agonists treatment. Tr1 suppress Th2 cells and effector cells of allergic inflammation, such as eosinophils, mast cells, basophils, through producing IL-10, and perhaps TGF-beta. Understanding of Tr1 may be helpful in developing new strategies for treatment of allergic diseases. PMID:17764617

  2. IL-10-Producing Type 1 Regulatory T Cells and Allergy

    Institute of Scientific and Technical Information of China (English)

    Kui Wu; Yutian Bi; Kun Sun; Changzheng Wang

    2007-01-01

    As an important subset of regulatory T (Treg) cells, IL-10-producing type 1 regulatory T cells (Tr1), have some different features to thymic-derived naturally occurring CD4+CD25+Foxp3+ Treg cells(nTreg cells). Similar to nTreg cells, Tr1 also play important roles in the control of allergic inflammation in several ways. There is a fine balance between Tr1 and Th2 responses in healthy subjects. Skewing of allergic-specific effctor T cells to a Tr1 phenotype appears to be a critical event in successful allergen-specific immunotherapy and glucocorticoids and β2-agonists treatment. Tr1 suppress Th2 cells and effector cells of allergic inflammation, such as eosinophils, mast cells, basophils, through producing IL-10, and perhaps TGF-β. Understanding of Tr1 may be helpful in developing new strategies for treatment of allergic diseases.

  3. Coinfection of tick cell lines has variable effects on replication of intracellular bacterial and viral pathogens.

    Science.gov (United States)

    Moniuszko, Anna; Rückert, Claudia; Alberdi, M Pilar; Barry, Gerald; Stevenson, Brian; Fazakerley, John K; Kohl, Alain; Bell-Sakyi, Lesley

    2014-06-01

    Ticks transmit various human and animal microbial pathogens and may harbour more than one pathogen simultaneously. Both viruses and bacteria can trigger, and may subsequently suppress, vertebrate host and arthropod vector anti-microbial responses. Microbial coinfection of ticks could lead to an advantage or disadvantage for one or more of the microorganisms. In this preliminary study, cell lines derived from the ticks Ixodes scapularis and Ixodes ricinus were infected sequentially with 2 arthropod-borne pathogens, Borrelia burgdorferi s.s., Ehrlichia ruminantium, or Semliki Forest virus (SFV), and the effect of coinfection on the replication of these pathogens was measured. Prior infection of tick cell cultures with the spirochaete B. burgdorferi enhanced subsequent replication of the rickettsial pathogen E. ruminantium whereas addition of spirochaetes to cells infected with E. ruminantium had no effect on growth of the latter. Both prior and subsequent presence of B. burgdorferi also had a positive effect on SFV replication. Presence of E. ruminantium or SFV had no measurable effect on B. burgdorferi growth. In tick cells infected first with E. ruminantium and then with SFV, virus replication was significantly higher across all time points measured (24, 48, 72h post infection), while presence of the virus had no detectable effect on bacterial growth. When cells were infected first with SFV and then with E. ruminantium, there was no effect on replication of either pathogen. The results of this preliminary study indicate that interplay does occur between different pathogens during infection of tick cells. Further study is needed to determine if this results from direct pathogen-pathogen interaction or from effects on host cell defences, and to determine if these observations also apply in vivo in ticks. If presence of one pathogen in the tick vector results in increased replication of another, this could have implications for disease transmission and incidence.

  4. Combining biocontrol with chlorine dioxide and other intervention technologies for inactivation of foodborne pathogens on produce

    Science.gov (United States)

    Produce contamination incited by Salmonella enterica, Escherichia coli O157:H7 and Listeria monocytogenes are of considerable importance to food safety. Post-harvest intervention measures can reduce or eliminate contamination and enhance food safety. In this reserach, the effectiveness of biocontr...

  5. Enteric human pathogens associated with fresh produce: sources, transport and ecology.

    Science.gov (United States)

    The consumption of fresh fruits and vegetables has been growing in the United States and other western countries due to their health benefits and the year-round availability of many produce commodities. However, the increase in consumption has correlated with an increase in foodborne outbreaks asso...

  6. Characterization of the interferon-producing cell in mice infected with Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Silvia Stockinger

    2009-03-01

    Full Text Available Production of type I interferons (IFN-I, mainly IFNalpha and IFNbeta is a hallmark of innate immune responses to all classes of pathogens. When viral infection spreads to lymphoid organs, the majority of systemic IFN-I is produced by a specialized "interferon-producing cell" (IPC that has been shown to belong to the lineage of plasmacytoid dendritic cells (pDC. It is unclear whether production of systemic IFN-I is generally attributable to pDC irrespective of the nature of the infecting pathogen. We have addressed this question by studying infections of mice with the intracellular bacterium Listeria monocytogenes. Protective innate immunity against this pathogen is weakened by IFN-I activity. In mice infected with L. monocytogenes, systemic IFN-I was amplified via IFN-beta, the IFN-I receptor (IFNAR, and transcription factor interferon regulatory factor 7 (IRF7, a molecular circuitry usually characteristic of non-pDC producers. Synthesis of serum IFN-I did not require TLR9. In contrast, in vitro-differentiated pDC infected with L. monocytogenes needed TLR9 to transcribe IFN-I mRNA. Consistent with the assumption that pDC are not the producers of systemic IFN-I, conditional ablation of the IFN-I receptor in mice showed that most systemic IFN-I is produced by myeloid cells. Furthermore, results obtained with FACS-purified splenic cell populations from infected mice confirmed the assumption that a cell type with surface antigens characteristic of macrophages and not of pDC is responsible for bulk IFN-I synthesis. The amount of IFN-I produced in the investigated mouse lines was inversely correlated to the resistance to lethal infection. Based on these data, we propose that the engagement of pDC, the mode of IFN-I mobilization, as well as the shaping of the antimicrobial innate immune response by IFN-I differ between intracellular pathogens.

  7. Chicken dendritic cells are susceptible to highly pathogenic avian influenza viruses which induce strong cytokine responses

    NARCIS (Netherlands)

    Vervelde, L.; Reemens, S.S.; Haarlem, van D.A.; Post, J.; Claassen, E.A.W.; Rebel, J.M.J.; Jansen, C.A.

    2013-01-01

    Infection with highly pathogenic avian influenza (HPAI) in birds and mammals is associated with severe pathology and increased mortality. We hypothesize that in contrast to low pathogenicity avian influenza (LPAI) infection, HPAI infection of chicken dendritic cells (DC) induces a cytokine deregulat

  8. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2004-2005 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2005-05-01

    In the spring of 2004 naturally produced smolts outmigrating from the Yakima River Basin were collected for the sixth year of pathogen screening. This component of the evaluation is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Since 1999 the Cle Elum Hatchery has been releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. In 1998 and 2000 through 2004 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. Of these pathogens, only R. salmoninarum was detected in very low levels in the naturally produced smolts outmigrating in 2004. To date, only bacterial pathogens have been detected and prevalences have been low. There have been small variations each year and these changes are attributed to normal fluctuations in prevalence. All of the pathogens detected are widely distributed in Washington State.

  9. mTOR regulation of lymphoid cells in immunity to pathogens

    Directory of Open Access Journals (Sweden)

    Rachael eKeating

    2016-05-01

    Full Text Available Immunity to pathogens exists as a fine balance between promoting activation and expansion of effector cells, while simultaneously limiting normal and aberrant responses. These seemingly opposing functions are kept in check by immune regulators. The mechanistic target of rapamycin (mTOR is a serine/threonine kinase that senses nutrient availability and in turn, regulates cell metabolism, growth, and survival accordingly. mTOR plays a pivotal role in facilitating immune defense against invading pathogens by regulating the differentiation, activation, and effector functions of lymphoid cells. Here we focus on the emerging and sometimes contradictory roles of mTOR in orchestrating lymphoid cell-mediated host immune responses to pathogens. A thorough understanding of how mTOR impacts lymphoid cells in pathogen defense will provide the necessary base for developing therapeutic interventions for infectious diseases.

  10. mTOR Regulation of Lymphoid Cells in Immunity to Pathogens.

    Science.gov (United States)

    Keating, Rachael; McGargill, Maureen Ann

    2016-01-01

    Immunity to pathogens exists as a fine balance between promoting activation and expansion of effector cells, while simultaneously limiting normal and aberrant responses. These seemingly opposing functions are kept in check by immune regulators. The mechanistic target of rapamycin (mTOR) is a serine/threonine kinase that senses nutrient availability and, in turn, regulates cell metabolism, growth, and survival accordingly. mTOR plays a pivotal role in facilitating immune defense against invading pathogens by regulating the differentiation, activation, and effector functions of lymphoid cells. Here, we focus on the emerging and sometimes contradictory roles of mTOR in orchestrating lymphoid cell-mediated host immune responses to pathogens. A thorough understanding of how mTOR impacts lymphoid cells in pathogen defense will provide the necessary base for developing therapeutic interventions for infectious diseases. PMID:27242787

  11. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  12. Draft Genome Sequence of Pseudomonas fluorescens LMG 5329, a White Line-Inducing Principle-Producing Bioindicator for the Mushroom Pathogen Pseudomonas tolaasii

    OpenAIRE

    Ghequire, Maarten G.K.; Rokni-Zadeh, Hassan; Zarrineh, Peyman; De Mot, René

    2013-01-01

    Pseudomonas tolaasii, the causative agent of Agaricus bisporus brown blotch disease, can be identified by the white line reaction, occurring upon confrontation of the tolaasin-producing mushroom pathogen with “Pseudomonas reactans,” producing the lipopeptide white line-inducing principle (WLIP). The draft genome sequence of the WLIP-producing indicator Pseudomonas fluorescens strain LMG 5329 is reported here.

  13. RNA structures that resist degradation by Xrn1 produce a pathogenic Dengue virus RNA.

    Science.gov (United States)

    Chapman, Erich G; Moon, Stephanie L; Wilusz, Jeffrey; Kieft, Jeffrey S

    2014-01-01

    Dengue virus is a growing global health threat. Dengue and other flaviviruses commandeer the host cell's RNA degradation machinery to generate the small flaviviral RNA (sfRNA), a noncoding RNA that induces cytopathicity and pathogenesis. Host cell exonuclease Xrn1 likely loads on the 5' end of viral genomic RNA and degrades processively through ∼10 kB of RNA, halting near the 3' end of the viral RNA. The surviving RNA is the sfRNA. We interrogated the architecture of the complete Dengue 2 sfRNA, identifying five independently-folded RNA structures, two of which quantitatively confer Xrn1 resistance. We developed an assay for real-time monitoring of Xrn1 resistance that we used with mutagenesis and RNA folding experiments to show that Xrn1-resistant RNAs adopt a specific fold organized around a three-way junction. Disrupting the junction's fold eliminates the buildup of disease-related sfRNAs in human cells infected with a flavivirus, directly linking RNA structure to sfRNA production. DOI: http://dx.doi.org/10.7554/eLife.01892.001. PMID:24692447

  14. Coinfection of tick cell lines has variable effects on replication of intracellular bacterial and viral pathogens

    Science.gov (United States)

    Moniuszko, Anna; Rückert, Claudia; Alberdi, M. Pilar; Barry, Gerald; Stevenson, Brian; Fazakerley, John K.; Kohl, Alain; Bell-Sakyi, Lesley

    2014-01-01

    Ticks transmit various human and animal microbial pathogens and may harbour more than one pathogen simultaneously. Both viruses and bacteria can trigger, and may subsequently suppress, vertebrate host and arthropod vector anti-microbial responses. Microbial coinfection of ticks could lead to an advantage or disadvantage for one or more of the microorganisms. In this preliminary study, cell lines derived from the ticks Ixodes scapularis and Ixodes ricinus were infected sequentially with 2 arthropod-borne pathogens, Borrelia burgdorferi s.s., Ehrlichia ruminantium, or Semliki Forest virus (SFV), and the effect of coinfection on the replication of these pathogens was measured. Prior infection of tick cell cultures with the spirochaete B. burgdorferi enhanced subsequent replication of the rickettsial pathogen E. ruminantium whereas addition of spirochaetes to cells infected with E. ruminantium had no effect on growth of the latter. Both prior and subsequent presence of B. burgdorferi also had a positive effect on SFV replication. Presence of E. ruminantium or SFV had no measurable effect on B. burgdorferi growth. In tick cells infected first with E. ruminantium and then with SFV, virus replication was significantly higher across all time points measured (24, 48, 72 h post infection), while presence of the virus had no detectable effect on bacterial growth. When cells were infected first with SFV and then with E. ruminantium, there was no effect on replication of either pathogen. The results of this preliminary study indicate that interplay does occur between different pathogens during infection of tick cells. Further study is needed to determine if this results from direct pathogen–pathogen interaction or from effects on host cell defences, and to determine if these observations also apply in vivo in ticks. If presence of one pathogen in the tick vector results in increased replication of another, this could have implications for disease transmission and incidence

  15. Contact-independent cell death of human microglial cells due to pathogenic Naegleria fowleri trophozoites.

    Science.gov (United States)

    Kim, Jong-Hyun; Kim, Daesik; Shin, Ho-Joon

    2008-12-01

    Free-living Naegleria fowleri leads to a fatal infection known as primary amebic meningoencephalitis in humans. Previously, the target cell death could be induced by phagocytic activity of N. fowleri as a contact-dependent mechanism. However, in this study we investigated the target cell death under a non-contact system using a tissue-culture insert. The human microglial cells, U87MG cells, co-cultured with N. fowleri trophozoites for 30 min in a non-contact system showed morphological changes such as the cell membrane destruction and a reduction in the number. By fluorescence-activated cell sorter (FACS) analysis, U87MG cells co-cultured with N. fowleri trophozoites in a non-contact system showed a significant increase of apoptotic cells (16%) in comparison with that of the control or N. fowleri lysate. When U87MG cells were co-cultured with N. fowleri trophozoites in a non-contact system for 30 min, 2 hr, and 4 hr, the cytotoxicity of amebae against target cells was 40.5, 44.2, and 45.6%, respectively. By contrast, the cytotoxicity of non-pathogenic N. gruberi trophozoites was 10.2, 12.4, and 13.2%, respectively. These results suggest that the molecules released from N. fowleri in a contact-independent manner as well as phagocytosis in a contact-dependent manner may induce the host cell death.

  16. Development of disease preventive method using radiated pathogenic microorganisms, cell lines and animals

    International Nuclear Information System (INIS)

    The effects of radiation were investigated on pathogenic plasmid aiming at a development of a method to induce mutagenesis in plasmid DNA by radiation. To construct an experimental system which allows to detect a plasmid-segregated cell, kanamycin-resistant casette was inserted into pX02, a capsule plasmid in Bacillus anthracis to produce acpA:: Kmr by homologous recombination. This plasmid is thought available for analyzing the rate of plasmid segregation caused by radiation. Next, developments of detection and determination methods for various cytokines were attempted by RT-PCR method with an aim to investigate the expression changes of cytokine mRNA in calf immunocytes by radiation. In calf peripheral monocytes and alveolar macrophages, expressions of cytokine mRNAs such as IL-4, IFNα and GM-CSF mRNA as well as IL-1α, IL-1β, IL-2 and IL-6 were detected by RT-PCR method. (M.N.)

  17. Host cells and methods for producing isoprenyl alkanoates

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-12-01

    The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

  18. The Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins

    Directory of Open Access Journals (Sweden)

    Andong eGong

    2015-10-01

    Full Text Available Aflatoxigenic Aspergillus fungi and associated aflatoxins are ubiquitous in the production and storage of food/feed commodities. Controlling these pests is a challenge. In this study, the Shewanella algae strain YM8 was found to produce volatiles that have strong antifungal activity against Aspergillus pathogens. Gas chromatography-mass spectrometry profiling revealed 15 volatile organic compounds (VOCs emitted from YM8, of which dimethyl trisulfide was the most abundant. We obtained authentic reference standards for six of the VOCs; these all significantly reduced mycelial growth and conidial germination in Aspergillus; dimethyl trisulfide and 2,4-bis(1,1-dimethylethyl-phenol showed the strongest inhibitory activity. YM8 completely inhibited Aspergillus growth and aflatoxin biosynthesis in maize and peanut samples stored at different water activity levels, and scanning electron microscopy revealed severely damaged conidia and a complete lack of mycelium development and conidiogenesis. YM8 also completely inhibited the growth of eight other agronomically important species of phytopathogenic fungi: A. parasiticus, A. niger, Alternaria alternate, Botrytis cinerea, Fusarium graminearum, Fusarium oxysporum, Monilinia fructicola, and Sclerotinia sclerotiorum. This study demonstrates the susceptibility of Aspergillus and other fungi to VOCs from marine bacteria and indicates a new strategy for effectively controlling these pathogens and the associated mycotoxin production in the field and during storage.

  19. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios.

    Science.gov (United States)

    Abi-Khalil, Celina; Lopez-Joven, Carmen; Abadie, Eric; Savar, Veronique; Amzil, Zouher; Laabir, Mohamed; Rolland, Jean-Luc

    2016-01-01

    The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France), we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs), was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events. PMID:26784228

  20. Exposure to the Paralytic Shellfish Toxin Producer Alexandrium catenella Increases the Susceptibility of the Oyster Crassostrea gigas to Pathogenic Vibrios

    Directory of Open Access Journals (Sweden)

    Celina Abi-Khalil

    2016-01-01

    Full Text Available The multifactorial etiology of massive Crassostrea gigas summer mortalities results from complex interactions between oysters, opportunistic pathogens and environmental factors. In a field survey conducted in 2014 in the Mediterranean Thau Lagoon (France, we evidenced that the development of the toxic dinoflagellate Alexandrium catenella, which produces paralytic shellfish toxins (PSTs, was concomitant with the accumulation of PSTs in oyster flesh and the occurrence of C. gigas mortalities. In order to investigate the possible role of toxic algae in this complex disease, we experimentally infected C. gigas oyster juveniles with Vibrio tasmaniensis strain LGP32, a strain associated with oyster summer mortalities, after oysters were exposed to Alexandrium catenella. Exposure of oysters to A. catenella significantly increased the susceptibility of oysters to V. tasmaniensis LGP32. On the contrary, exposure to the non-toxic dinoflagellate Alexandrium tamarense or to the haptophyte Tisochrysis lutea used as a foraging alga did not increase susceptibility to V. tasmaniensis LGP32. This study shows for the first time that A. catenella increases the susceptibility of Crassostrea gigas to pathogenic vibrios. Therefore, in addition to complex environmental factors explaining the mass mortalities of bivalve mollusks, feeding on neurotoxic dinoflagellates should now be considered as an environmental factor that potentially increases the severity of oyster mortality events.

  1. Hydrogen Peroxide Produced by Oral Streptococci Induces Macrophage Cell Death

    OpenAIRE

    Okahashi, Nobuo; Nakata, Masanobu; Sumitomo, Tomoko; Terao, Yutaka; Kawabata, Shigetada

    2013-01-01

    Hydrogen peroxide (H2O2) produced by members of the mitis group of oral streptococci plays important roles in microbial communities such as oral biofilms. Although the cytotoxicity of H2O2 has been widely recognized, the effects of H2O2 produced by oral streptococci on host defense systems remain unknown. In the present study, we investigated the effect of H2O2 produced by Streptococcus oralis on human macrophage cell death. Infection by S. oralis was found to stimulate cell death of a THP-1 ...

  2. Role of the Nfa1 protein in pathogenic Naegleria fowleri cocultured with CHO target cells.

    Science.gov (United States)

    Kang, Su-Yeon; Song, Kyoung-Ju; Jeong, Seok-Ryoul; Kim, Jong-Hyun; Park, Sun; Kim, Kyongmin; Kwon, Myung-Hee; Shin, Ho-Joon

    2005-07-01

    Naegleria fowleri, a free-living amoeba, exists as a virulent pathogen which causes fatal primary amoebic meningoencephalitis in experimental animals and humans. Using infected and immune mouse sera, we previously cloned an nfa1 gene from a cDNA library of N. fowleri by immunoscreening. The nfa1 gene (360 bp) produced a recombinant 13.1-kDa protein, and the Nfa1 protein showed pseudopodium-specific immunolocalization on a trophozoite of N. fowleri. In this study, the role of the Nfa1 protein as a cell contact mechanism of N. fowleri cocultured with target cells was observed by an immunofluorescence assay with an anti-Nfa1 polyclonal antibody. Using confocal microscopic findings, the Nfa1 protein was located on the pseudopodia of N. fowleri trophozoites. The Nfa1 protein in N. fowleri trophozoites cocultured with CHO target cells was also located on pseudopodia, as well as in a food cup formed as a phagocytic structure in close contact with target cells. The amount of nfa1 mRNA of N. fowleri was strongly increased 6 h after coculture.

  3. Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

    Science.gov (United States)

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

    2014-07-01

    In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL. PMID:24768282

  4. Produced Water Treatment Using Microbial Fuel Cell Technology

    Energy Technology Data Exchange (ETDEWEB)

    Borole, A. P.; Campbell, R. [Campbell Applied Physics

    2011-05-20

    ORNL has developed a treatment for produced water using a combination of microbial fuel cells and electrosorption. A collaboration between Campbell Applied Physics and ORNL was initiated to further investigate development of the technology and apply it to treatment of field produced water. The project successfully demonstrated the potential of microbial fuel cells to generate electricity from organics in produced water. A steady voltage was continuously generated for several days using the system developed in this study. In addition to the extraction of electrical energy from the organic contaminants, use of the energy at the representative voltage was demonstrated for salts removal or desalination of the produced water. Thus, the technology has potential to remove organic as well as ionic contaminants with minimal energy input using this technology. This is a novel energy-efficient method to treat produced water. Funding to test the technology at larger scale is being pursued to enable application development.

  5. Leber's hereditary optic neuropathy (LHON) pathogenic mutations induce mitochondrial-dependent apoptotic death in transmitochondrial cells incubated with galactose medium.

    Science.gov (United States)

    Ghelli, Anna; Zanna, Claudia; Porcelli, Anna Maria; Schapira, Anthony H V; Martinuzzi, Andrea; Carelli, Valerio; Rugolo, Michela

    2003-02-01

    Leber's hereditary optic neuropathy (LHON), a maternally inherited form of central vision loss, is associated with mitochondrial DNA pathogenic point mutations affecting different subunits of complex I. We here report that osteosarcoma-derived cytoplasmic hybrids (cybrid) cell lines harboring one of the three most frequent LHON pathogenic mutations, at positions 11778/ND4, 3460/ND1, and 14484/ND6, undergo cell death when galactose replaces glucose in the medium, contrary to control cybrids that maintain some growth capabilities. This is a well known way to produce a metabolic stress, forcing the cells to rely on the mitochondrial respiratory chain to produce ATP. We demonstrate that LHON cybrid cell death is apoptotic, showing chromatin condensation and nuclear DNA laddering. Moreover, we also document the mitochondrial involvement in the activation of the apoptotic cascade, as shown by the increased release of cytochrome c into the cytosol in LHON cybrid cells as compared with controls. Cybrids bearing the 3460/ND1 and 14484/ND6 mutations seemed more readily prone to undergo apoptosis as compared with the 11778/ND4 mutation. In conclusion, LHON cybrid cells forced by the reduced rate of glycolytic flux to utilize oxidative metabolism are sensitized to an apoptotic death through a mechanism involving mitochondria.

  6. Sequential necrotizing fasciitis caused by the monomicrobial pathogens Streptococcus equisimilis and extended-spectrum beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Endo, Akiko; Matsuoka, Ryosuke; Mizuno, Yasushi; Doi, Asako; Nishioka, Hiroaki

    2016-08-01

    Necrotizing fasciitis is a rapidly progressing bacterial infection of the superficial fascia and subcutaneous tissue that is associated with a high mortality rate and is caused by a single species of bacteria or polymicrobial organisms. Escherichia coli is rarely isolated from patients with monomicrobial disease. Further, there are few reports of extended-spectrum beta-lactamase (ESBL)-producing E. coli associated with necrotizing fasciitis. We report here our treatment of an 85-year-old man who was admitted because of necrotizing fasciitis of his right thigh. Streptococcus equisimilis was detected as a monomicrobial pathogen, and the infection was cured by amputation of the patient's right leg and the administration of antibiotics. However, 5 days after discontinuing antibiotic therapy, he developed necrotizing fasciitis on his right upper limb and died. ESBL-producing E. coli was the only bacterial species isolated from blood and skin cultures. This case demonstrates that ESBL-producing E. coli can cause monomicrobial necrotizing fasciitis, particularly during hospitalization and that a different bacterial species can cause disease shortly after a previous episode. PMID:26912298

  7. First report of Pseudobodo sp, a new pathogen for a potential energy-producing algae: Chlorella vulgaris cultures.

    Directory of Open Access Journals (Sweden)

    Zhangran Chen

    Full Text Available Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4-5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant.

  8. Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

    Directory of Open Access Journals (Sweden)

    García-Pérez Blanca Estela

    2012-10-01

    Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

  9. Jasmonate ZIM-domain (JAZ protein regulates host and nonhost pathogen-induced cell death in tomato and Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Yasuhiro Ishiga

    Full Text Available The nonhost-specific phytotoxin coronatine (COR produced by several pathovars of Pseudomonas syringae functions as a jasmonic acid-isoleucine (JA-Ile mimic and contributes to disease development by suppressing plant defense responses and inducing reactive oxygen species in chloroplast. It has been shown that the F-box protein CORONATINE INSENSITIVE 1 (COI1 is the receptor for COR and JA-Ile. JASMONATE ZIM DOMAIN (JAZ proteins act as negative regulators for JA signaling in Arabidopsis. However, the physiological significance of JAZ proteins in P. syringae disease development and nonhost pathogen-induced hypersensitive response (HR cell death is not completely understood. In this study, we identified JAZ genes from tomato, a host plant for P. syringae pv. tomato DC3000 (Pst DC3000, and examined their expression profiles in response to COR and pathogens. Most JAZ genes were induced by COR treatment or inoculation with COR-producing Pst DC3000, but not by the COR-defective mutant DB29. Tomato SlJAZ2, SlJAZ6 and SlJAZ7 interacted with SlCOI1 in a COR-dependent manner. Using virus-induced gene silencing (VIGS, we demonstrated that SlJAZ2, SlJAZ6 and SlJAZ7 have no effect on COR-induced chlorosis in tomato and Nicotiana benthamiana. However, SlJAZ2-, SlJAZ6- and SlJAZ7-silenced tomato plants showed enhanced disease-associated cell death to Pst DC3000. Furthermore, we found delayed HR cell death in response to the nonhost pathogen Pst T1 or a pathogen-associated molecular pattern (PAMP, INF1, in SlJAZ2- and SlJAZ6-silenced N. benthamiana. These results suggest that tomato JAZ proteins regulate the progression of cell death during host and nonhost interactions.

  10. Renal erythropoietin-producing cells in health and disease

    Directory of Open Access Journals (Sweden)

    Tomokazu eSouma

    2015-06-01

    Full Text Available Erythropoietin (Epo is an indispensable erythropoietic hormone primarily produced from renal Epo-producing cells (REPs. Epo production in REPs is tightly regulated in a hypoxia-inducible manner to maintain tissue oxygen homeostasis. Insufficient Epo production by REPs causes renal anemia and anemia associated with chronic disorders. Recent studies have broadened our understanding of REPs from prototypic hypoxia-responsive cells to dynamic fibrogenic cells. In chronic kidney disease, REPs are the major source of scar-forming myofibroblasts and actively produce fibrogenic molecules, including inflammatory cytokines. Notably, myofibroblast-transformed REPs recover their original physiological properties after resolution of the disease insults, suggesting that renal anemia and fibrosis could be reversible to some extent. Therefore, understanding the plasticity of REPs will lead to the development of novel targeted therapeutics for both renal fibrosis and anemia. This review summarizes the regulatory mechanisms how hypoxia-inducible Epo gene expression is attained in health and disease conditions.

  11. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    Directory of Open Access Journals (Sweden)

    Álvaro D. Ortega

    2014-11-01

    Full Text Available Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles is regulated in both space and time. Non-coding small RNAs (sRNAs are post-transcriptional regulatory molecules that fine-tune important processes in bacterial physiology including cell envelope architecture, intermediate metabolism, bacterial communication, biofilm formation and virulence. Recent studies have shown production of defined sRNA species by intracellular bacteria located inside eukaryotic cells. The molecules targeted by these sRNAs and their expression dynamics along the intracellular infection cycle remain, however, poorly characterized. Technical difficulties linked to the isolation of ‘intact’ intracellular bacteria from infected host cells might explain why sRNA regulation in these specialized pathogens is still a largely unexplored field. Transition from the extracellular to the intracellular lifestyle provides an ideal scenario in which regulatory sRNAs are intended to participate; so much work must be done in this direction. This review focuses on sRNAs expressed by intracellular bacterial pathogens during the infection of eukaryotic cells, strategies used with these pathogens to identify sRNAs required for virulence, and the experimental technical challenges associated to this type of studies. We also discuss varied techniques for their potential application to study RNA regulation in intracellular bacterial infections.

  12. Foodborne pathogens and microbiological characteristics of raw milk soft cheese produced and on retail sale in Brazil.

    Science.gov (United States)

    Moraes, Paula Mendonça; Viçosa, Gabriela Nogueira; Yamazi, Anderson Keizo; Ortolani, Maria Beatriz Tassinari; Nero, Luís Augusto

    2009-03-01

    The consumption of raw milk soft cheeses (RMSC), which are typically manufactured in small dairy farms under unsatisfactory hygiene conditions, is common in Brazil. Due to these production characteristics, this type of cheese is a potential carrier of pathogenic microorganisms, such as Listeria monocytogenes, Salmonella, and enterotoxin-producing Staphylococcus spp. Considering these characteristics, in this work, we aimed to detect the presence of these pathogenic microorganisms in RMC and to evaluate their microbiological quality. Fifty-five samples of this product were collected from different noninspected commercial establishments and submitted to the enumeration of mesophilic aerobes (MA), total coliforms (TC), Escherichia coli, and coagulase-positive staphylococci (CPS), and detection of L. monocytogenes and Salmonella spp. All analyzed samples were negative for Salmonella spp. and L. monocytogenes. All samples presented counts of MA higher than 10(6) colony forming units/g (CFU/g; range, 3.0x10(6) to 4.0x10(9)). TC were present at levels between 1.0x10(3) and 1.8x10(8) CFU/g, and E. coli between 1.0x10(2) and 3.5x10(6) CFU/g. CPS were detected in 17 (30.9%) samples at levels higher than 10(4) CFU/g. These results confirm the poor microbiological quality of raw milk used in the manufacturing of RMC samples, and also the inadequate production conditions. Therefore, the evaluation of microbiological safety and quality of these products must be constantly reported to alert the official agencies about the significance of proper inspection.

  13. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2001 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Pearsons, Todd N.; Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-01-01

    The change in pathogens prevalence to wild fish is probably the least studied ecological interaction associated with hatchery operations. In 1999, the Cle Elum Hatchery began releasing spring chinook smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to evaluate whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and monitored for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition, the fish were tested for Ceratomyxa shasta spores in 2001. Not all testing has been completed for every year, but to date, there have only been minimal changes in levels of the bacterial pathogens in the naturally produced smolts. At this point, due to the limited testing so far, these changes are attributed to normal fluctuation of prevalence.

  14. Dickeya dadantii, a plant pathogenic bacterium producing Cyt-like entomotoxins, causes septicemia in the pea aphid Acyrthosiphon pisum.

    Directory of Open Access Journals (Sweden)

    Denis Costechareyre

    Full Text Available Dickeya dadantii (syn. Erwinia chrysanthemi is a plant pathogenic bacteria that harbours a cluster of four horizontally-transferred, insect-specific toxin genes. It was recently shown to be capable of causing an acute infection in the pea aphid Acyrthosiphon pisum (Insecta: Hemiptera. The infection route of the pathogen, and the role and in vivo expression pattern of these toxins, remain unknown. Using bacterial numeration and immunolocalization, we investigated the kinetics and the pattern of infection of this phytopathogenic bacterium within its insect host. We compared infection by the wild-type strain and by the Cyt toxin-deficient mutant. D. dadantii was found to form dense clusters in many luminal parts of the aphid intestinal tract, including the stomach, from which it invaded internal tissues as early as day 1 post-infection. Septicemia occurred soon after, with the fat body being the main infected tissue, together with numerous early infections of the embryonic chains showing embryonic gut and fat body as the target organs. Generalized septicemia led to insect death when the bacterial load reached about 10(8 cfu. Some individual aphids regularly escaped infection, indicating an effective partial immune response to this bacteria. Cyt-defective mutants killed insects more slowly but were capable of localisation in any type of tissue. Cyt toxin expression appeared to be restricted to the digestive tract where it probably assisted in crossing over the first cell barrier and, thus, accelerating bacterial diffusion into the aphid haemocel. Finally, the presence of bacteria on the surface of leaves hosting infected aphids indicated that the insects could be vectors of the bacteria.

  15. Localization and biosynthesis of polyamines in insulin-producing cells

    DEFF Research Database (Denmark)

    Hougaard, D M; Larsson, L I; Nielsen, Jens Høiriis

    1986-01-01

    Two recently developed fluorescence cytochemical methods, specific for spermidine and spermine, were used to localize polyamines in the endocrine pancreas. The polyamines were restricted to the insulin-producing beta-cells and were mainly associated with the secretory granules. Chemical polyamine...

  16. Hydrogen peroxide produced by oral Streptococci induces macrophage cell death.

    Directory of Open Access Journals (Sweden)

    Nobuo Okahashi

    Full Text Available Hydrogen peroxide (H2O2 produced by members of the mitis group of oral streptococci plays important roles in microbial communities such as oral biofilms. Although the cytotoxicity of H2O2 has been widely recognized, the effects of H2O2 produced by oral streptococci on host defense systems remain unknown. In the present study, we investigated the effect of H2O2 produced by Streptococcus oralis on human macrophage cell death. Infection by S. oralis was found to stimulate cell death of a THP-1 human macrophage cell line at multiplicities of infection greater than 100. Catalase, an enzyme that catalyzes the decomposition of H2O2, inhibited the cytotoxic effect of S. oralis. S. oralis deletion mutants lacking the spxB gene, which encodes pyruvate oxidase, and are therefore deficient in H2O2 production, showed reduced cytotoxicity toward THP-1 macrophages. Furthermore, H2O2 alone was capable of inducing cell death. The cytotoxic effect seemed to be independent of inflammatory responses, because H2O2 was not a potent stimulator of tumor necrosis factor-α production in macrophages. These results indicate that streptococcal H2O2 plays a role as a cytotoxin, and is implicated in the cell death of infected human macrophages.

  17. CD4(+)B220(+)TCRγδ(+) T cells produce IL-17 in lupus-prone MRL/lpr mice.

    Science.gov (United States)

    Qiu, Feng; Li, Tingting; Zhang, Kui; Wan, Jun; Qi, Xiaokun

    2016-09-01

    Systemic lupus erythematosus is an autoimmune disease with comprehensive immune cell disorders. Recent studies suggested that pro-inflammatory cytokine IL-17 plays important role in lupus, leaving the cellular sources and their pathogenic and physiologic characters largely unknown. In the current study, by using lupus-prone MRL/lpr mice, we demonstrated that Th17 response prevails in lupus disease regarding significantly accumulated serum IL-17, increased IL-17-producing splenocytes, and elevated phospho-STAT3 in CD4(+) T cells. Intracellular staining revealed that unusual CD4(+)B220(+) T cells are major IL-17-producing cells, whereas conventional CD4(+)B220(-) T cells are major IFN-γ-producing cells. Subsequent studies showed that CD4(+)B220(+) cells contains both αβ and γδ T cells in the spleen and thymus of MRL/lpr mice. Further study showed that around 60% of γδ T cells in MRL/lpr mice co-express both B220 and CD4 on their surface, and are the major RORγt(+) cells in MRL/lpr mice. Finally, CD4(+)B220(+) T cells alone do not proliferate, but could enhance the proliferation and IFN-γ-production of conventional CD4(+)B220(-) T cells. Our findings suggest the pathogenic role of unusual CD4(+)B220(+) T cells in lupus disease in MRL/lpr mice according to their IL-17-producing ability and stimulatory function for conventional CD4(+)B220(-) T cells. PMID:27235595

  18. Chemical- and pathogen-induced programmed cell death in plants

    NARCIS (Netherlands)

    Iakimova, E.T.; Atanassov, A.; Woltering, E.J.

    2005-01-01

    This review focuses on recent update in the understanding of programmed cell death regarding the differences and similarities between the diverse types of cell death in animal and plant systems and describes the morphological and some biochemical determinants. The role of PCD in plant development an

  19. Isolation and characterization of renal erythropoietin-producing cells from genetically produced anemia mice.

    Directory of Open Access Journals (Sweden)

    Xiaoqing Pan

    Full Text Available Understanding the nature of renal erythropoietin-producing cells (REPs remains a central challenge for elucidating the mechanisms involved in hypoxia and/or anemia-induced erythropoietin (Epo production in adult mammals. Previous studies have shown that REPs are renal peritubular cells, but further details are lacking. Here, we describe an approach to isolate and characterize REPs. We bred mice bearing an Epo gene allele to which green fluorescent protein (GFP reporter cDNA was knocked-in (Epo(GFP with mice bearing an Epo gene allele lacking the 3' enhancer (Epo(Δ3'E. Mice harboring the mutant Epo(GFP/Δ3'E gene exhibited anemia (average Hematocrit 18% at 4 to 6 days after birth, and this perinatal anemia enabled us to identify and purify REPs based on GFP expression from the kidney. Light and confocal microscopy revealed that GFP immunostaining was confined to fibroblastic cells that reside in the peritubular interstitial space, confirming our previous observation in Epo-GFP transgenic reporter assays. Flow cytometry analyses revealed that the GFP fraction constitutes approximately 0.2% of the whole kidney cells and 63% of GFP-positive cells co-express CD73 (a marker for cortical fibroblasts and Epo-expressing cells in the kidney. Quantitative RT-PCR analyses confirmed that Epo expression was increased by approximately 100-fold in the purified population of REPs compared with that of the unsorted cells or CD73-positive fraction. Gene expression analyses showed enrichment of Hif2α and Hif3α mRNA in the purified population of REPs. The genetic approach described here provides a means to isolate a pure population of REPs, allowing the analysis of gene expression of a defined population of cells essential for Epo production in the kidney. This has provided evidence that positive regulation by HIF2α and negative regulation by HIF3α might be necessary for correct renal Epo induction.

  20. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development. PMID:25044543

  1. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Science.gov (United States)

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development.

  2. TH17 cells in autoimmunity and immunodeficiency: protective or pathogenic?

    Directory of Open Access Journals (Sweden)

    Ashish eMarwaha

    2012-06-01

    Full Text Available In 2005 a newly discovered T helper cell subset that secreted interleukin (IL-17 became the center of attention in immunology. Initial studies painted Th17 cells as the culprit for destruction caused in many different autoimmune and auto-inflammatory diseases. Subsequently, the discovery of patients with primary immunodeficiencies in the IL-17 pathway taught us that Th17 cells have a critical role in defense against certain fungal and bacterial infections. Moreover, the paradoxical exacerbation of Crohn’s disease in the clinical trials of a Secukiumab (AIN457, a fully human neutralizing antibody to IL-17A, has cast into doubt a universal pro-inflammatory and harmful role for Th17 cells. Evidence now suggests that depending on the environment Th17 cell can alter their differentiation program, ultimately giving rise to either protective or pro-inflammatory cells. In this review will summarize the evidence from patients with immunodeficiencies, autoimmune, or auto-inflammatory disease that teaches us how the pro-inflammatory versus protective function of Th17 cells varies within the context of different human diseases.

  3. The role of the secondary cell walls in plant resistance to pathogens

    Directory of Open Access Journals (Sweden)

    Eva eMiedes

    2014-08-01

    Full Text Available Plant resistance to pathogens relies on a complex network of constitutive and inducible defensive barriers. The plant cell wall is one of the barriers that pathogens need to overcome to successfully colonize plant tissues. The traditional view of the plant cell wall as a passive barrier has evolved to a concept that considers the wall as a dynamic structure that regulates both constitutive and inducible defence mechanisms, and as a source of signalling molecules that trigger immune responses. The secondary cell walls of plants also represent a carbon-neutral feedstock (lignocellulosic biomass for the production of biofuels and biomaterials. Therefore, engineering plants with improved secondary cell wall characteristics is an interesting strategy to ease the processing of lignocellulosic biomass in the biorefinery. However, modification of the integrity of the cell wall by impairment of proteins required for its biosynthesis or remodelling may impact the plants resistance to pathogens. This review summarizes our understanding of the role of the plant cell wall in pathogen resistance with a focus on the contribution of lignin to this biological process.

  4. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation Report 6 of 7, 2003-2004 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2004-05-01

    In 1999 the Cle Elum Hatchery began releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. In 1998 and 2000 through 2003 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. To date, only the bacterial pathogens have been detected and prevalences have been low. Prevalences have varied each year and these changes are attributed to normal fluctuation of prevalence. All of the pathogens detected are widely distributed in Washington State.

  5. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2002 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2003-05-01

    In 1999 the Cle Elem Hatchery began releasing spring chinook smolts into the upper Yakima River for restoration and supplementation. This project was designed to evaluate whether introduction of intensively reared hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Approximately 200 smolts were collected at the Chandler smolt collection facility on the lower Yakima River during 1998, 2000 and 2001 and 130 smolts were collected in 2002 for monitoring for specific pathogens. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. In addition the fish were tested for Ceratomyxa shasta spores in 2000 and 2001 (a correction from the 2001 report). To date, the only changes have been in the levels the bacterial pathogens in the naturally produced smolts and they have been minimal. These changes are attributed to normal fluctuation of prevalence.

  6. Epigenetically Mediated Pathogenic Effects of Phenanthrene on Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Jing Liu

    2013-01-01

    Full Text Available Phenanthrene (Phe, a polycyclic aromatic hydrocarbon (PAH, is a major constituent of urban air pollution. There have been conflicting results regarding the role of other AhR ligands 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD and 6-formylindolo [3,2-b]carbazole (FICZ in modifying regulatory T cell populations (Treg or T helper (Th17 differentiation, and the effects of Phe have been understudied. We hypothesized that different chemical entities of PAH induce Treg to become either Th2 or Th17 effector T cells through epigenetic modification of FOXP3. To determine specific effects on T cell populations by phenanthrene, primary human Treg were treated with Phe, TCDD, or FICZ and assessed for function, gene expression, and phenotype. Methylation of CpG sites within the FOXP3 locus reduced FOXP3 expression, leading to impaired Treg function and conversion of Treg into a CD4+CD25lo Th2 phenotype in Phe-treated cells. Conversely, TCDD treatment led to epigenetic modification of IL-17A and conversion of Treg to Th17 T cells. These findings present a mechanism by which exposure to AhR-ligands mediates human T cell responses and begins to elucidate the relationship between environmental exposures, immune modulation, and initiation of human disease.

  7. Colonization of Arabidopsis roots by Pseudomonas fluorescens primes the plant to produce higher levels of ethylene upon pathogen infection

    NARCIS (Netherlands)

    Hase, S.; Pelt, J.A. van; Loon, L.C. van; Pieterse, C.M.J.

    2003-01-01

    Plants develop an enhanced defensive capacity against a broad spectrum of plant pathogens after colonization of the roots by selected strains of non-pathogenic, fluorescent Pseudomonas spp. In Arabidopsis thaliana, this rhizobacteria-induced systemic resistance (ISR) functions independently of salic

  8. Insulin Producing Cells Derived from Embryonic Stem Cells: Are We There Yet?

    OpenAIRE

    Raikwar, Sudhanshu P.; Zavazava, Nicholas

    2009-01-01

    Derivation of insulin producing cells (IPCs) from embryonic stem (ES) cells provides a potentially innovative form of treatment for type 1 diabetes. Here, we discuss the current state of the art, unique challenges and future directions on generating IPCs.

  9. 黄瓜黑星病菌致病机理的研究Ⅲ细胞壁降解酶和毒素对寄主超微结构的影响及其协同作用%PATHOGENIC MECHANISM OF SCAB OF CUCUMBER CAUSED BY Cladosporium cucumerinum Ⅲ EFFECTS AND SYNERGISM OF CELL WALL-DEGRADING ENZYMES ANDTOXIN PRODUCED BY C. cucumerinum ON ULTRASTRUCTURE OF CUCUMBER

    Institute of Scientific and Technical Information of China (English)

    李宝聚; 周长力; 赵奎华; 李凤云; 黄国坤

    2001-01-01

    本文通过透射电镜和扫描电镜观察,初步明确了果胶酶、纤维素酶及毒素对黄瓜叶组织超微结构的影响。在致病过程中,3种致病因子起着各自独立又相互联系的作用。3种致病因子对寄主超微结构的影响中,纤维素酶分解细胞壁能力最强,毒素对细胞质膜的作用最大,3种致病因子均可造成质壁分离,液泡、内质网受损。而叶绿体的被膜、片层结构主要被纤维素酶降解,线粒体的被膜主要被果胶酶降解,3种致病因子均能使叶绿体、线粒体内部空泡化。在分解叶表皮的过程中,所研究的3种致病因子首先是果胶酶降解果胶层,然后是纤维素酶、果胶酶、毒素对栅栏组织的分解,最后是纤维素酶、毒素作用于薄壁细胞壁,毒素、纤维素酶、果胶酶协同作用于细胞内部组织。%The effects of the cellulase, pectinase and toxin produced by Cladosporium cucumerinum on the leaf cell of cucumber were studied by TEM and SEM. The results indicated that the three pathogenic factors played independent and symplastic roles. The cellulase and pectinase played leading roles respectively in decomposition of cell wall and plasma membrane. The three factors could all result in plasmolysis and damage vacuoles and endoplasmic reticulum. Chloroplast envelope and lamellae structure were mainly digested by cellulase, whiles, mitochondrion envelope was chiefly digested by the pectinase. Each of the three factors could cause vacuolation in chloroplast and mitochondria. During the process of breach up the structure of epidermis of leaf, the cellulase acted on reticulate region, then the pectinase dissolved pectic layer.Following this, palisade tissue was damaged by the cellulase, pectinase and toxin. Finally,parenchyma was destroyed by cellulase and toxin,successively.

  10. Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

    Directory of Open Access Journals (Sweden)

    Francesco Marras

    2011-01-01

    Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

  11. Human granulosa-luteal cells initiate an innate immune response to pathogen-associated molecules.

    Science.gov (United States)

    Ibrahim, Laila A; Kramer, Joseph M; Williams, R Stan; Bromfield, John J

    2016-10-01

    The microenvironment of the ovarian follicle is key to the developmental success of the oocyte. Minor changes within the follicular microenvironment can significantly disrupt oocyte development, compromising the formation of competent embryos and reducing fertility. Previously described as a sterile environment, the ovarian follicle of women has been shown to contain colonizing bacterial strains, whereas in domestic species, pathogen-associated molecules are concentrated in the follicular fluid of animals with uterine infection. The aim of this study is to determine whether human granulosa-luteal cells mount an innate immune response to pathogen-associated molecules, potentially disrupting the microenvironment of the ovarian follicle. Human granulosa-luteal cells were collected from patients undergoing assisted reproduction. Cells were cultured in the presence of pathogen-associated molecules (LPS, FSL-1 and Pam3CSK4) for 24h. Supernatants and total RNA were collected for assessment by PCR and ELISA. Granulosa-luteal cells were shown to express the molecular machinery required to respond to a range of pathogen-associated molecules. Expression of TLR4 varied up to 15-fold between individual patients. Granulosa-luteal cells increased the expression of the inflammatory mediators IL1B, IL6 and CXCL8 in the presence of the TLR4 agonist E. coli LPS. Similarly, the TLR2/6 ligand, FSL-1, increased the expression of IL6 and CXCL8. Although no detectable changes in CYP19A1 or STAR expression were observed in granulosa-luteal cells following challenge, a significant reduction in progesterone secretion was measured after treatment with FSL-1. These findings demonstrate the ability of human granulosa-luteal cells to respond to pathogen-associated molecules and generate an innate immune response. PMID:27512120

  12. Insulin-producing Surrogate β-cells From Embryonic Stem Cells: Are We There Yet?

    OpenAIRE

    Naujok, Ortwin; Burns, Chris; Jones, Peter M; Lenzen, Sigurd

    2011-01-01

    Embryonic stem cells (ESCs) harbor the potential to generate every cell type of the body by differentiation. The use of hESCs holds great promise for potential cell replacement therapies for degenerative diseases including diabetes mellitus. The recently discovered induced pluripotent stem cells (iPSCs) exhibit immense potential for regenerative medicine as they allow the generation of autologous cells tailored to the patients' immune system. Research for insulin-producing surrogate cells fro...

  13. Derivation of Insulin-Producing Beta-Cells from Human Pluripotent Stem Cells

    OpenAIRE

    Schiesser, Jacqueline V.; Micallef, Suzanne J.; Hawes, Susan; Elefanty, Andrew G.; Stanley, Edouard G.

    2014-01-01

    Human embryonic stem cells have been advanced as a source of insulin-producing cells that could potentially replace cadaveric-derived islets in the treatment of type 1 diabetes. To this end, protocols have been developed that promote the formation of pancreatic progenitors and endocrine cells from human pluripotent stem cells, encompassing both embryonic stem cells and induced pluripotent stem cells. In this review, we examine these methods and place them in the context of the developmental a...

  14. Plasmablasts as migratory IgG-producing cells in the pathogenesis of neuromyelitis optica.

    Science.gov (United States)

    Chihara, Norio; Aranami, Toshimasa; Oki, Shinji; Matsuoka, Takako; Nakamura, Masakazu; Kishida, Hitaru; Yokoyama, Kazumasa; Kuroiwa, Yoshiyuki; Hattori, Nobutaka; Okamoto, Tomoko; Murata, Miho; Toda, Tatsushi; Miyake, Sachiko; Yamamura, Takashi

    2013-01-01

    Neuromyelitis optica (NMO) is an inflammatory disease characterized by recurrent attacks of optic neuritis and myelitis. It is generally accepted that autoantibodies against aquaporin 4 water channel protein play a pathogenic role in neuromyelitis optica. We have recently reported that plasmablasts are increased in the peripheral blood of this autoimmune disease, and are capable of producing autoantibodies against aquaporin 4. Here, we demonstrate that CD138(+)HLA-DR(+) plasmablasts, a subset of IgG-producing cells, are increased in the peripheral blood and are enriched among the cerebrospinal fluid (CSF) lymphocytes during the relapse of neuromyelitis optica. Notably, these CD138(+)HLA-DR(+) plasmablasts overexpress CXCR3, whose ligands are present in the cerebrospinal fluid during the relapse of neuromyelitis optica. These results led us to speculate that plasmablasts producing anti-aquaporin 4 autoantibodies might traffic toward the central nervous system (CNS). Furthermore, we performed single-cell sorting of plasmablasts from peripheral blood and CSF samples from NMO and sequenced the complementarity-determining regions (CDRs) of the IgG heavy chain expressed by the sorted plasmablast clones. There were high frequencies of mutations in the CDRs compared with framework regions, indicating that these plasmablast clones would represent a post-germinal center B-cell lineage. Consistent with the preceding results, the plasmablast clones from the peripheral blood shared the same CDR sequences with the clones from the CSF. These results indicate that IgG-producing plasmablasts, which are guided by helper T-cells, may migrate from the peripheral blood preferentially to the CSF. Since migratory plasmablasts could be involved in the inflammatory pathology of NMO, the B-cell subset and their migration might be an attractive therapeutic target.

  15. Biological Role of Paenilarvins, Iturin-Like Lipopeptide Secondary Metabolites Produced by the Honey Bee Pathogen Paenibacillus larvae

    Science.gov (United States)

    Gensel, Sebastian; Garcia-Gonzalez, Eva; Ebeling, Julia; Skobalj, Ranko; Kuthning, Anja; Süssmuth, Roderich D.

    2016-01-01

    The Gram-positive bacterium Paenibacillus larvae (P. larvae) is the causative agent of a deadly honey bee brood disease called American Foulbrood (AFB). AFB is a notifiable epizootic in most countries and, hence, P. larvae is of considerable relevance for veterinarians and apiculturists alike. Over the last decade, much progress has been made in the understanding of the (patho)biology of P. larvae. Recently, several non-ribosomally produced peptides (NRP) and peptide/polyketide (NRP/PK) hybrids produced by P. larvae were identified. Among these NRPs were iturin-like lipopeptides, the paenilarvins A-C. Iturins are known to exhibit strong anti-fungal activity; for some iturins, cytotoxic activity towards mammalian erythrocytes and human cancer cell lines are described. We here present our results on the analysis of the natural function of the paenilarvins during pathogenesis of P. larvae infections. We demonstrated production of paenilarvins in infected larvae. However, we could neither demonstrate cytotoxicity of paenilarvins towards cultured insect cells nor towards larvae in feeding assays. Accordingly, exposure bioassays performed with larvae infected by wild-type P. larvae and a knockout mutant of P. larvae lacking production of paenilarvins did not substantiate a role for the paenilarvins as virulence factor. Further experiments are necessary to analyze the relevance of the paenilarvins’ anti-fungal activity for P. larvae infections in the presence of fungal competitors in the larval midgut or cadaver. PMID:27760211

  16. Characterization of xenoantiserum produced against B cell acute lymphoblastic leukemia cell line

    Directory of Open Access Journals (Sweden)

    Akagi,Tadaatsu

    1982-10-01

    Full Text Available Antiserum was produced in white rabbit by intravenously injecting living cells of a B cell acute lymphoblastic leukemia (ALL line (BALL-1. The reactivity of the antiserum against various lymphoid cell lines was examined by membrane immunofluorescence after appropriate absorption. Serum absorbed with non-T, non-B (NALL-1 and T-ALL (TALL-1 cells recognized B cell antigens distinct from Ia-like antigens on both normal and neoplastic B cells. After further absorption with tonsillar cells or normal B cell line (KO-HL-3, it reacted only with BALL-1 cells and did not react with other leukemia/lymphoma and normal B cell lines. The serum absorbed with tonsillar cells reacted only with BALL-1 and some B cell lines. Thus we were able to obtain antisera with specificity to B cell antigen, B-ALL antigen, and B cell line antigen.

  17. Emerging functions as host cell factors - an encyclopedia of annexin-pathogen interactions.

    Science.gov (United States)

    Kuehnl, Alexander; Musiol, Agnes; Raabe, Carsten A; Rescher, Ursula

    2016-10-01

    Emerging infectious diseases and drug-resistant infectious agents call for the development of innovative antimicrobial strategies. With pathogenicity now considered to arise from the complex and bi-directional interplay between a microbe and the host, host cell factor targeting has emerged as a promising approach that might overcome the limitations of classical antimicrobial drug development and could open up novel and efficient therapeutic strategies. Interaction with and modulation of host cell membranes is a recurrent theme in the host-microbe relationship. In this review, we provide an overview of what is currently known about the role of the Ca2+ dependent, membrane-binding annexin protein family in pathogen-host interactions, and discuss their emerging functions as host cell derived auxiliary proteins in microbe-host interactions and host cell targets.

  18. The Influence of T Cell Development on Pathogen Specificity and Autoreactivity

    Science.gov (United States)

    Košmrlj, Andrej; Kardar, Mehran; Chakraborty, Arup K.

    2012-10-01

    T cells orchestrate adaptive immune responses upon activation. T cell activation requires sufficiently strong binding of T cell receptors on their surface to short peptides derived from foreign proteins bound to protein products of the major histocompatibility (MHC) gene products, which are displayed on the surface of antigen presenting cells. T cells can also interact with peptide-MHC complexes, where the peptide is derived from host (self) proteins. A diverse repertoire of relatively self-tolerant T cell receptors is selected in the thymus. We study a model, computationally and analytically, to describe how thymic selection shapes the repertoire of T cell receptors, such that T cell receptor recognition of pathogenic peptides is both specific and degenerate. We also discuss the escape probability of autoimmune T cells from the thymus.

  19. The influence of T cell development on pathogen specificity and autoreactivity

    CERN Document Server

    Kosmrlj, Andrej; Chakraborty, Arup K

    2012-01-01

    T cells orchestrate adaptive immune responses upon activation. T cell activation requires sufficiently strong binding of T cell receptors on their surface to short peptides derived from foreign proteins bound to protein products of the major histocompatibility (MHC) gene products, which are displayed on the surface of antigen presenting cells. T cells can also interact with peptide-MHC complexes, where the peptide is derived from host (self) proteins. A diverse repertoire of relatively self-tolerant T cell receptors is selected in the thymus. We study a model, computationally and analytically, to describe how thymic selection shapes the repertoire of T cell receptors, such that T cell receptor recognition of pathogenic peptides is both specific and degenerate. We also discuss the escape probability of autoimmune T cells from the thymus.

  20. Pathogenic Fungi Regulate Immunity by Inducing Neutrophilic Myeloid-Derived Suppressor Cells

    OpenAIRE

    Rieber, Nikolaus; Singh, Anurag; ÖZ, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N.; Weber, Alexander N.R.; Handgretinger, Rupert; Krappmann, Sven

    2015-01-01

    Summary Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically...

  1. Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

    Science.gov (United States)

    Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

    2016-02-01

    Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. PMID:26771167

  2. [Investigation of antitumorigenic effects of food-borne non-pathogenic and pathogenic Salmonella enterica strains on MEF, DU145 and HeLa cell lines].

    Science.gov (United States)

    Altıntaş Kazar, Gamze; Şen, Ece

    2016-07-01

    Basic applications in cancer therapy may fail to eradicate cancer cells completely, they can show toxic affects to healthy cells and development of resistance to antitumor agents may increase tendency to metastasis. Bacterial therapies have the advantage of specific targetting of tumors by selective toxicity, responsiveness to external signals, self-propelling capacity, and the sense of microenvironment. The most interest on the bacterial cancer therapy is about Salmonella spp. with a special emphasis of S.Typhimurium. The aim of this study was to investigate the antitumorigenic effects of food-borne non-pathogenic and pathogenic Salmonella enterica strains on different cell cultures. Non-pathogenic Salmonella Enteriditis (A17) and pathogenic Salmonella Telaviv (A22) strains isolated from chicken carcasses which were put on the market in Edirne province (located at Thrace region of Turkey), and Salmonella Typhimurium ATCC 14028 strain were used in the study. ATCC-derived MEF (mouse embryonic fibroblasts), DU145 (human prostate cancer cells), and HeLa (human cervical cancer cells) cell lines were cocultivated with Salmonella strains of MOI (Multiplicity of infection; number of bacteria:number of cell) of 1000:1, 100:1, 10:1, 1:1, 0.1:1. The cell viability was measured by colorimetric MTT cytotoxicity assay, the percentage of apoptosis was assessed by Tali® Apoptosis Assay-Annexin V Alexa Fluor® 488 kit (Invitrogen, Molecular Probes, Life Technologies, USA), and the caspase-3 activity was determined by colorimetric protease ApoTarget™ kit (Invitrogen, BioSource International, USA). It was shown that non-pathogenic S.Enteriditis (A17) decreased cell viability approximately to 70%, wheras patogenic S.Telaviv (A22) and standart S.Typhimurium ATCC 14028 strains reduced cell viability approximately to 80%. Adversely, it was also observed that pathogenic S.Telaviv (A22) strain induces apoptosis more effectively than non-pathogenic S.Enteriditis (A17) and S

  3. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae.

    Science.gov (United States)

    Franz, Bettina; Kempf, Volkhard A J

    2011-04-13

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  4. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    Directory of Open Access Journals (Sweden)

    Kempf Volkhard AJ

    2011-04-01

    Full Text Available Abstract Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA, the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (VirB/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  5. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae.

    Science.gov (United States)

    Franz, Bettina; Kempf, Volkhard A J

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  6. Mapping epigenetic changes to the host cell genome induced by Burkholderia pseudomallei reveals pathogen-specific and pathogen-generic signatures of infection

    Science.gov (United States)

    Cizmeci, Deniz; Dempster, Emma L.; Champion, Olivia L.; Wagley, Sariqa; Akman, Ozgur E.; Prior, Joann L.; Soyer, Orkun S.; Mill, Jonathan; Titball, Richard W.

    2016-01-01

    The potential for epigenetic changes in host cells following microbial infection has been widely suggested, but few examples have been reported. We assessed genome-wide patterns of DNA methylation in human macrophage-like U937 cells following infection with Burkholderia pseudomallei, an intracellular bacterial pathogen and the causative agent of human melioidosis. Our analyses revealed significant changes in host cell DNA methylation, at multiple CpG sites in the host cell genome, following infection. Infection induced differentially methylated probes (iDMPs) showing the greatest changes in DNA methylation were found to be in the vicinity of genes involved in inflammatory responses, intracellular signalling, apoptosis and pathogen-induced signalling. A comparison of our data with reported methylome changes in cells infected with M. tuberculosis revealed commonality of differentially methylated genes, including genes involved in T cell responses (BCL11B, FOXO1, KIF13B, PAWR, SOX4, SYK), actin cytoskeleton organisation (ACTR3, CDC42BPA, DTNBP1, FERMT2, PRKCZ, RAC1), and cytokine production (FOXP1, IRF8, MR1). Overall our findings show that pathogenic-specific and pathogen-common changes in the methylome occur following infection. PMID:27484700

  7. A rho GDP dissociation inhibitor produced by apoptotic T-cells inhibits growth of Mycobacterium tuberculosis.

    Science.gov (United States)

    Venkatasubramanian, Sambasivan; Dhiman, Rohan; Paidipally, Padmaja; Cheekatla, Satyanarayana S; Tripathi, Deepak; Welch, Elwyn; Tvinnereim, Amy R; Jones, Brenda; Theodorescu, Dan; Barnes, Peter F; Vankayalapati, Ramakrishna

    2015-02-01

    In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI), produced by apoptotic CD4(+)CD25(+) (85% Foxp3(+)) cells is responsible for this inhibition of M. tb growth in human macrophages and in mice. M. tb-expanded CD4(+C)D25(+)Foxp3(+)D4GDI(+) cells do not produce IL-10, TGF-β and IFN-γ. D4GDI inhibited growth of M. tb in MDMs by enhancing production of IL-1β, TNF-α and ROS, and by increasing apoptosis of M. tb-infected MDMs. D4GDI was concentrated at the site of disease in tuberculosis patients, with higher levels detected in pleural fluid than in serum. However, in response to M. tb, PBMC from tuberculosis patients produced less D4GDI than PBMC from persons with LTBI. M. tb-expanded CD4+CD25+ (85% Foxp3(+)) cells and D4GDI induced intracellular M. tb to express the dormancy survival regulator DosR and DosR-dependent genes, suggesting that D4GDI induces a non-replicating state in the pathogen. Our study provides the first evidence that a subpopulation of CD4(+)CD25(+) (85% Foxp3+) cells enhances immunity to M. tb, and that production of D4GDI by this subpopulation inhibits M. tb growth.

  8. Conversion of mature human beta-cells into glucagon-producing alpha-cells

    NARCIS (Netherlands)

    Spijker, H.S.; Ravelli, R.B.; Mommaas-Kienhuis, A.M.; van Apeldoorn, A.A.; Engelse, M.A.; Zaldumbide, A.; Bonner-Weir, S.; Rabelink, T.J.; Hoeben, R.C.; Clevers, H.; Mummery, C.L.; Carlotti, F.; de Koning, E.

    2013-01-01

    Conversion of one terminally differentiated cell type into another (or transdifferentiation) usually requires the forced expression of key transcription factors. We examined the plasticity of human insulin-producing beta-cells in a model of islet cell aggregate formation. Here, we show that primary

  9. Differentiation of dermis-derived multipotent cells into insulin-producing pancreatic cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Chun-Meng Shi; Tian-Min Cheng

    2004-01-01

    AIM: To observe the plasticity of whether dermis-derived multipotent cells to differentiate into insulin-producing pancreatic cells in vitro.METHODS: A donal population of dermis-derived multipotent stem cells (DMCs) from newborn rat with the capacity to produce osteocytes, chondrocytes, adipocytes and neurons was used. The gene expression of cultured DMCs was assessed by DNA microarray using rat RGU34A gene expression probe arrays. DMCs were further cultured in the presence of insulin complex components (Insulintransferrin-selenium, ITS) to observe whether DMCs could be induced into insulin-producing pancreatic cells in vitro.RESULTS: DNA microarray analysis showed that cultured DMCs simultaneously expressed several genes associated with pancreatic cell, neural cell, epithelial cell and hepatocyte,widening its transcriptomic repertoire. When cultured in the specific induction medium containing ITS for pancreatic cells, DMCs differentiated into epithelioid cells that were positive for insulin detected by immunohistochemistry.CONCLUSION: Our data indicate that dermal multipotent cells may serve as a source of stem/progenitor cells for insulin-producing pancreatic cells.

  10. Antitumor Immunity Produced by the Liver Kupffer Cells, NK Cells, NKT Cells, and CD8+ CD122+ T Cells

    Directory of Open Access Journals (Sweden)

    Shuhji Seki

    2011-01-01

    Full Text Available Mouse and human livers contain innate immune leukocytes, NK cells, NKT cells, and macrophage-lineage Kupffer cells. Various bacterial components, including Toll-like receptor (TLR ligands and an NKT cell ligand (α-galactocylceramide, activate liver Kupffer cells, which produce IL-1, IL-6, IL-12, and TNF. IL-12 activates hepatic NK cells and NKT cells to produce IFN-γ, which further activates hepatic T cells, in turn activating phagocytosis and cytokine production by Kupffer cells in a positive feedback loop. These immunological events are essentially evoked to protect the host from bacterial and viral infections; however, these events also contribute to antitumor and antimetastatic immunity in the liver by activated liver NK cells and NKT cells. Bystander CD8+CD122+ T cells, and tumor-specific memory CD8+T cells, are also induced in the liver by α-galactocylceramide. Furthermore, adoptive transfer experiments have revealed that activated liver lymphocytes may migrate to other organs to inhibit tumor growth, such as the lungs and kidneys. The immunological mechanism underlying the development of hepatocellular carcinoma in cirrhotic livers in hepatitis C patients and liver innate immunity as a double-edged sword (hepatocyte injury/regeneration, septic shock, autoimmune disease, etc. are also discussed.

  11. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    Science.gov (United States)

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. PMID:26251043

  12. Microbes produce nanobacteria-like structures, avoiding cell entombment

    Science.gov (United States)

    Bontognali, Tomaso R. R.; Vasconcelos, Crisógono; Warthmann, Rolf J.; Dupraz, Christophe; Bernasconi, Stefano M.; McKenzie, Judith A.

    2008-08-01

    Microsedimentary structures referred to as nanobacteria-likeparticles were described from modern carbonate environments,where they form in close spatial association with sulfate-reducingbacteria (SRB). However, the exact mechanism of their formation,as well as their paleontological significance, remains controversial.Here we report on an investigation of microbe-mineral interactionsin experimentally produced carbonate globules. The experimentswere carried out under anoxic conditions at 30 °C with Desulfovibriobrasiliensis, a SRB known to mediate dolomite formation. Weobserved that extracellular polymeric substances (EPS) secretedby the microbial community play a key role in the mineralizationprocess. Nanobacteria-like particles represent the early stageof carbonate nucleation within the EPS, which progressivelyevolve to larger globules displaying a grainy texture. We excludedthe possibilities that these structures are fossils of nanobacteria,dissolution surfaces, or artifacts created during sample preparation.D. brasiliensis cells are predominantly located outside of theEPS aggregates where mineral growth takes place. As a result,they remain mobile and are rarely entombed within the mineral.This self-preservation behavior may not be limited to D. brasiliensis.Other microbes may produce, or may have produced during thegeological past, biogenic minerals through a similar process.Mineralization within EPS explains why microbial relics arenot necessarily present in biogenic carbonates.

  13. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  14. Extension of Shelf Life and Control of Human Pathogens in Produce by Antimicrobial Edible Films and Coatings

    Science.gov (United States)

    This chapter provides general information about edible films and coatings, and their use with fruits and vegetables to control human pathogens. It reviews potential antimicrobial phytochemicals used in edible films and coatings, and summarizes methods for measuring the antimicrobial activity and ph...

  15. Adult Stem Cells as a Renewable Source of Insulin-Producing Cells

    OpenAIRE

    Jun, Hee-Sook; Park, Eun-Young

    2009-01-01

    Diabetes mellitus is a metabolic disorder resulting from an inadequate mass of insulin-producing pancreatic beta cells. The replacement or restoration of damaged beta cells would be considered the optimal therapeutic options. Islet transplantation seems to be a promising approach for replacement therapy; however, the main obstacle is the shortage of organ donors. As mature beta cells have been shown to be difficult to expand in vitro, regeneration of beta cells from embryonic or adult stem ce...

  16. The modular nature of dendritic cell responses to commensal and pathogenic fungi.

    Directory of Open Access Journals (Sweden)

    Lisa Rizzetto

    Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

  17. Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

    Directory of Open Access Journals (Sweden)

    Sophie Coudeyras

    2008-01-01

    Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

  18. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  19. A modified method of insulin producing cells' generation from bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Czubak, Paweł; Bojarska-Junak, Agnieszka; Tabarkiewicz, Jacek; Putowski, Lechosław

    2014-01-01

    Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells' transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs). In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs). We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors' concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells. PMID:25405207

  20. Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

    Science.gov (United States)

    Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

    2014-11-01

    The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

  1. Memory CD4+ T cells are required for optimal NK cell effector functions against the opportunistic fungal pathogen Pneumocystis murina.

    Science.gov (United States)

    Kelly, Michelle N; Zheng, Mingquan; Ruan, Sanbao; Kolls, Jay; D'Souza, Alain; Shellito, Judd E

    2013-01-01

    Little is known about the role of NK cells or their interplay with other immune cells during opportunistic infections. Using our murine model of Pneumocystis pneumonia, we found that loss of NK cells during immunosuppression results in substantial Pneumocystis lung burden. During early infection of C57B/6 CD4(+) T cell-depleted mice, there were significantly fewer NK cells in the lung tissue compared with CD4(+) T cell-intact animals, and the NK cells present demonstrated decreased upregulation of the activation marker NKp46 and production of the effector cytokine, IFN-γ. Furthermore, coincubation studies revealed a significant increase in fungal killing when NK cells were combined with CD4(+) T cells compared with either cell alone, which was coincident with a significant increase in perforin production by NK cells. Finally, however, we found through adoptive transfer that memory CD4(+) T cells are required for significant NK cell upregulation of the activation marker NK group 2D and production of IFN-γ, granzyme B, and perforin during Pneumocystis infection. To the best of our knowledge, this study is the first to demonstrate a role for NK cells in immunity to Pneumocystis pneumonia, as well as to establish a functional relationship between CD4(+) T cells and NK cells in the host response to an opportunistic fungal pathogen.

  2. Candidate Effector Proteins of the Rust Pathogen Melampsora larici-populina Target Diverse Plant Cell Compartments.

    Science.gov (United States)

    Petre, Benjamin; Saunders, Diane G O; Sklenar, Jan; Lorrain, Cécile; Win, Joe; Duplessis, Sébastien; Kamoun, Sophien

    2015-06-01

    Rust fungi are devastating crop pathogens that deliver effector proteins into infected tissues to modulate plant functions and promote parasitic growth. The genome of the poplar leaf rust fungus Melampsora larici-populina revealed a large catalog of secreted proteins, some of which have been considered candidate effectors. Unraveling how these proteins function in host cells is a key to understanding pathogenicity mechanisms and developing resistant plants. In this study, we used an effectoromics pipeline to select, clone, and express 20 candidate effectors in Nicotiana benthamiana leaf cells to determine their subcellular localization and identify the plant proteins they interact with. Confocal microscopy revealed that six candidate effectors target the nucleus, nucleoli, chloroplasts, mitochondria, and discrete cellular bodies. We also used coimmunoprecipitation (coIP) and mass spectrometry to identify 606 N. benthamiana proteins that associate with the candidate effectors. Five candidate effectors specifically associated with a small set of plant proteins that may represent biologically relevant interactors. We confirmed the interaction between the candidate effector MLP124017 and TOPLESS-related protein 4 from poplar by in planta coIP. Altogether, our data enable us to validate effector proteins from M. larici-populina and reveal that these proteins may target multiple compartments and processes in plant cells. It also shows that N. benthamiana can be a powerful heterologous system to study effectors of obligate biotrophic pathogens.

  3. Lights, camera and action: vertebrate skin sets the stage for immune cell interaction with arthropod-vectored pathogens

    Directory of Open Access Journals (Sweden)

    Shu Zhen eChong

    2013-09-01

    Full Text Available Despite increasing studies targeted at host-pathogen interactions, vector-borne diseases remain one of the largest economic health burdens worldwide. Such diseases are vectored by hematophagous arthropods that deposit pathogens into the vertebrate host’s skin during a blood meal. These pathogens spend a substantial amount of time in the skin that allows for interaction with cutaneous immune cells, suggesting a window of opportunity for development of vaccine strategies. In particular, the recent availability of intravital imaging approaches has provided further insights into immune cell behavior in living tissues. Here, we discuss how such intravital imaging studies have contributed to our knowledge of cutaneous immune cell behavior and specifically, towards pathogen and tissue trauma from the arthropod bite. We also suggest future imaging approaches that may aid in better understanding of the complex interplay between arthropod-vectored pathogens and cutaneous immunity that could lead to improved therapeutic strategies.

  4. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  5. Culture of human cell lines by a pathogen-inactivated human platelet lysate.

    Science.gov (United States)

    Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L

    2016-08-01

    Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety. PMID:25944665

  6. The properties of lectins and cells surface biopolymers of non-pathogenic corynebacteria

    Directory of Open Access Journals (Sweden)

    Sashschuk E. V.

    2011-02-01

    Full Text Available Aim. To study lectin properties of non-pathogenic corynebacteria cells and preparations of their surface biopolymers (SBP, extracted by SDS. Methods. SBP were extracted from intact cells by 0.15 M solution of NaCl contains 1 % SDS. Protein content was determined using Lowry method, carbohydrates – with anthrone method. Electrophoresis was performed in SDS-PAGE according to Lemmli. Hemagglutinating activity (HAA was studied using rabbit erythrocytes. The lectin carbohydrate specificity was determined by reaction of inhibition of hemagglutination. Results. Electrophoretic set of SBP preparations contained the proteins and carbohydrates biopolymers with molecular mass of 10.0–120.0 kDa which did not possess HAA. After extraction of SBP the corynebacteria cells remained viable and have HAA higher than intact cells (64–2048 units. The hemagglutinins of the majority of corynebacteria strains after treatment of cells with SDS exhibited the highest affinity to the bovine submandibular gland mucin and N-acetylneuraminic acid. Conclusions. The examined non-pathogenic strains of corynebacteria were found to contain the lectins, associated with internal layers of a cell wall, which showed a predominant specificity to sialic acids.

  7. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    Directory of Open Access Journals (Sweden)

    Boomsma Jacobus J

    2010-12-01

    Full Text Available Abstract Background Leaf-cutting (attine ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. Results We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21% of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Conclusions Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to

  8. Comparison of the pathogen species-specific immune response in udder derived cell types and their models.

    Science.gov (United States)

    Günther, Juliane; Koy, Mirja; Berthold, Anne; Schuberth, Hans-Joachim; Seyfert, Hans-Martin

    2016-01-01

    The outcome of an udder infection (mastitis) largely depends on the species of the invading pathogen. Gram-negative pathogens, such as Escherichia coli often elicit acute clinical mastitis while Gram-positive pathogens, such as Staphylococcus aureus tend to cause milder subclinical inflammations. It is unclear which type of the immune competent cells residing in the udder governs the pathogen species-specific physiology of mastitis and which established cell lines might provide suitable models. We therefore profiled the pathogen species-specific immune response of different cell types derived from udder and blood. Primary cultures of bovine mammary epithelial cells (pbMEC), mammary derived fibroblasts (pbMFC), and bovine monocyte-derived macrophages (boMdM) were challenged with heat-killed E. coli, S. aureus and S. uberis mastitis pathogens and their immune response was scaled against the response of established models for MEC (bovine MAC-T) and macrophages (murine RAW 264.7). Only E. coli provoked a full scale immune reaction in pbMEC, fibroblasts and MAC-T cells, as indicated by induced cytokine and chemokine expression and NF-κB activation. Weak reactions were induced by S. aureus and none by S. uberis challenges. In contrast, both models for macrophages (boMdM and RAW 264.7) reacted strongly against all the three pathogens accompanied by strong activation of NF-κB factors. Hence, the established cell models MAC-T and RAW 264.7 properly reflected key aspects of the pathogen species-specific immune response of the respective parental cell type. Our data imply that the pathogen species-specific physiology of mastitis likely relates to the respective response of MEC rather to that of professional immune cells. PMID:26830914

  9. Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

    OpenAIRE

    Wong, Rebecca S. Y.

    2011-01-01

    Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs) from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering ...

  10. Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Rebecca S. Y. Wong

    2011-01-01

    Full Text Available Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects.

  11. Insulin-producing cells generated from dedifferentiated human pancreatic beta cells expanded in vitro.

    Directory of Open Access Journals (Sweden)

    Holger A Russ

    Full Text Available BACKGROUND: Expansion of beta cells from the limited number of adult human islet donors is an attractive prospect for increasing cell availability for cell therapy of diabetes. However, attempts at expanding human islet cells in tissue culture result in loss of beta-cell phenotype. Using a lineage-tracing approach we provided evidence for massive proliferation of beta-cell-derived (BCD cells within these cultures. Expansion involves dedifferentiation resembling epithelial-mesenchymal transition (EMT. Epigenetic analyses indicate that key beta-cell genes maintain open chromatin structure in expanded BCD cells, although they are not transcribed. Here we investigated whether BCD cells can be redifferentiated into beta-like cells. METHODOLOGY/PRINCIPAL FINDING: Redifferentiation conditions were screened by following activation of an insulin-DsRed2 reporter gene. Redifferentiated cells were characterized for gene expression, insulin content and secretion assays, and presence of secretory vesicles by electron microscopy. BCD cells were induced to redifferentiate by a combination of soluble factors. The redifferentiated cells expressed beta-cell genes, stored insulin in typical secretory vesicles, and released it in response to glucose. The redifferentiation process involved mesenchymal-epithelial transition, as judged by changes in gene expression. Moreover, inhibition of the EMT effector SLUG (SNAI2 using shRNA resulted in stimulation of redifferentiation. Lineage-traced cells also gave rise at a low rate to cells expressing other islet hormones, suggesting transition of BCD cells through an islet progenitor-like stage during redifferentiation. CONCLUSIONS/SIGNIFICANCE: These findings demonstrate for the first time that expanded dedifferentiated beta cells can be induced to redifferentiate in culture. The findings suggest that ex-vivo expansion of adult human islet cells is a promising approach for generation of insulin-producing cells for

  12. Human B cells produce chemokine CXCL10 in the presence of Mycobacterium tuberculosis specific T cells

    DEFF Research Database (Denmark)

    Hoff, Soren T; Salman, Ahmed M; Ruhwald, Morten;

    2015-01-01

    BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment. A candid......BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment...... appeared to be mediated via IFN-γ and dependent on contact with antigen-specific T cells recognizing the antigen. CONCLUSION: Human B cells are able to produce CXCL10 in an IFN-γ and T cell contact-dependent manner. The present findings suggest a possible mechanism through which B cells in part may...

  13. Intracellular periodontal pathogen exploits recycling pathway to exit from infected cells.

    Science.gov (United States)

    Takeuchi, Hiroki; Takada, Akihiko; Kuboniwa, Masae; Amano, Atsuo

    2016-07-01

    Although human gingival epithelium prevents intrusions by periodontal bacteria, Porphyromonas gingivalis, the most well-known periodontal pathogen, is able to invade gingival epithelial cells and pass through the epithelial barrier into deeper tissues. We previously reported that intracellular P. gingivalis exits from gingival epithelial cells via a recycling pathway. However, the underlying molecular process remains unknown. In the present study, we found that the pathogen localized in early endosomes recruits VAMP2 and Rab4A. VAMP2 was found to be specifically localized in early endosomes, although its localization remained unclear in mammalian cells. A single transmembrane domain of VAMP2 was found to be necessary and sufficient for localizing in early endosomes containing P. gingivalis in gingival epithelial cells. VAMP2 forms a complex with EXOC2/Sec5 and EXOC3/Sec6, whereas Rab4A mediates dissociation of the EXOC complex followed by recruitment of RUFY1/Rabip4, Rab4A effector, and Rab14. Depletion of VAMP2 or Rab4A resulted in accumulation of bacteria in early endosomes and disturbed bacterial exit from infected cells. It is suggested that these novel dynamics allow P. gingivalis to exploit fast recycling pathways promoting further bacterial penetration of gingival tissues.

  14. Functional heterogeneity in CD4+ T cell responses against a bacterial pathogen

    Directory of Open Access Journals (Sweden)

    Ashley eViehmann Milam

    2015-12-01

    Full Text Available To investigate how CD4+ T cells function against a bacterial pathogen, we generated a Listeria monocytogenes-specific CD4+ T cell model. In this system, two TCRtg mouse lines, LLO56 and LLO118 recognize the same immunodominant epitope (LLO190-205 of Listeria monocytogenes and have identical in vitro responses. However, in vivo LLO56 and LLO118 display vastly different responses during both primary and secondary infection. LLO118 dominates in the primary response and in providing CD8 T cell help. LLO56 predominates in the secondary response. We have also shown that both specific (TCR-mediated and nonspecific stimuli (bypassing the TCR elicit distinct responses from the two transgenics, leading us to conclude that the strength of self-pMHC signaling during development tightly dictates the cell’s future response in the periphery. Herein, we review our findings in this transfer system, focusing on the contribution of the immunomodulatory molecule CD5 and the importance of self-interaction in peripheral maintenance of the cell. We also discuss the manner in which individual TCR affinities to foreign and self-pMHC contribute to the outcome of an immune response; our assertion is that there exists a spectrum of possible T cell responses to recognition of cognate antigen during infection, adding immense diversity to the immune system’s response to pathogens.

  15. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    KAUST Repository

    Alsalah, Dhafer

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  16. Pathogenic Fungi Regulate Immunity by Inducing Neutrophilic Myeloid-Derived Suppressor Cells

    Science.gov (United States)

    Rieber, Nikolaus; Singh, Anurag; Öz, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N.; Weber, Alexander N.R.; Handgretinger, Rupert; Krappmann, Sven; Liese, Johannes; Engeholm, Maik; Schüle, Rebecca; Salih, Helmut Rainer; Marodi, Laszlo; Speckmann, Carsten; Grimbacher, Bodo; Ruland, Jürgen; Brown, Gordon D.; Beilhack, Andreas; Loeffler, Juergen; Hartl, Dominik

    2015-01-01

    Summary Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically, pathogenic fungi induce neutrophilic MDSCs through the pattern recognition receptor Dectin-1 and its downstream adaptor protein CARD9. Fungal MDSC induction is further dependent on pathways downstream of Dectin-1 signaling, notably reactive oxygen species (ROS) generation as well as caspase-8 activity and interleukin-1 (IL-1) production. Additionally, exogenous IL-1β induces MDSCs to comparable levels observed during C. albicans infection. Adoptive transfer and survival experiments show that MDSCs are protective during invasive C. albicans infection, but not A. fumigatus infection. These studies define an innate immune mechanism by which pathogenic fungi regulate host defense. PMID:25771792

  17. Pathogenic fungi regulate immunity by inducing neutrophilic myeloid-derived suppressor cells.

    Science.gov (United States)

    Rieber, Nikolaus; Singh, Anurag; Öz, Hasan; Carevic, Melanie; Bouzani, Maria; Amich, Jorge; Ost, Michael; Ye, Zhiyong; Ballbach, Marlene; Schäfer, Iris; Mezger, Markus; Klimosch, Sascha N; Weber, Alexander N R; Handgretinger, Rupert; Krappmann, Sven; Liese, Johannes; Engeholm, Maik; Schüle, Rebecca; Salih, Helmut Rainer; Marodi, Laszlo; Speckmann, Carsten; Grimbacher, Bodo; Ruland, Jürgen; Brown, Gordon D; Beilhack, Andreas; Loeffler, Juergen; Hartl, Dominik

    2015-04-01

    Despite continuous contact with fungi, immunocompetent individuals rarely develop pro-inflammatory antifungal immune responses. The underlying tolerogenic mechanisms are incompletely understood. Using both mouse models and human patients, we show that infection with the human pathogenic fungi Aspergillus fumigatus and Candida albicans induces a distinct subset of neutrophilic myeloid-derived suppressor cells (MDSCs), which functionally suppress T and NK cell responses. Mechanistically, pathogenic fungi induce neutrophilic MDSCs through the pattern recognition receptor Dectin-1 and its downstream adaptor protein CARD9. Fungal MDSC induction is further dependent on pathways downstream of Dectin-1 signaling, notably reactive oxygen species (ROS) generation as well as caspase-8 activity and interleukin-1 (IL-1) production. Additionally, exogenous IL-1β induces MDSCs to comparable levels observed during C. albicans infection. Adoptive transfer and survival experiments show that MDSCs are protective during invasive C. albicans infection, but not A. fumigatus infection. These studies define an innate immune mechanism by which pathogenic fungi regulate host defense. PMID:25771792

  18. Human Epithelial Cells Discriminate between Commensal and Pathogenic Interactions with Candida albicans.

    Science.gov (United States)

    Rast, Timothy J; Kullas, Amy L; Southern, Peter J; Davis, Dana A

    2016-01-01

    The commensal fungus, Candida albicans, can cause life-threatening infections in at risk individuals. C. albicans colonizes mucosal surfaces of most people, adhering to and interacting with epithelial cells. At low concentrations, C. albicans is not pathogenic nor does it cause epithelial cell damage in vitro; at high concentrations, C. albicans causes mucosal infections and kills epithelial cells in vitro. Here we show that while there are quantitative dose-dependent differences in exposed epithelial cell populations, these reflect a fundamental qualitative difference in host cell response to C. albicans. Using transcriptional profiling experiments and real time PCR, we found that wild-type C. albicans induce dose-dependent responses from a FaDu epithelial cell line. However, real time PCR and Western blot analysis using a high dose of various C. albicans strains demonstrated that these dose-dependent responses are associated with ability to promote host cell damage. Our studies support the idea that epithelial cells play a key role in the immune system by monitoring the microbial community at mucosal surfaces and initiating defensive responses when this community is dysfunctional. This places epithelial cells at a pivotal position in the interaction with C. albicans as epithelial cells themselves promote C. albicans stimulated damage.

  19. Activity of 2,4-Di-tert-butylphenol produced by a strain of Streptomyces mutabilis isolated from a Saharan soil against Candida albicans and other pathogenic fungi.

    Science.gov (United States)

    Belghit, S; Driche, E H; Bijani, C; Zitouni, A; Sabaou, N; Badji, B; Mathieu, F

    2016-06-01

    In a search for new antifungal antibiotics active against Candida albicans and others pathogenic fungi, a strain of actinobacteria, designated G61, was isolated from a Saharan soil and tested for its activity against these microorganisms. The analysis of its 16S rDNA sequence showed a similarity level of 100% with Streptomyces mutabilis NBRC 12800(T). The highest anticandidal activities produced by the strain G61 were obtained on Bennett medium in the fourth day of incubation. The active product, extracted by n-butanol, contained one bioactive spot detected on thin layer chromatography plates. It was purified by HPLC and its chemical structure was determined by spectroscopic analyses as 2,4-Di-tert-butylphenol. The minimum inhibitory concentrations (MIC) of this product against several strains of pathogenic microorganisms are interesting. PMID:27107984

  20. Differentiation of stem cells into insulin-producing cells under the influence of nanostructural polyoxometalates.

    Science.gov (United States)

    Bâlici, Ştefana; Şuşman, Sergiu; Rusu, Dan; Nicula, Gheorghe Zsolt; Soriţău, Olga; Rusu, Mariana; Biris, Alexandru S; Matei, Horea

    2016-03-01

    Two polyoxometalates (POMs) with W were synthesized by a two-step, self-assembling method. They were used for stimulation of mesenchymal stem cell differentiation into insulin-producing cells. The nanocompounds (tris(vanadyl)-substituted tungsto-antimonate(III) anions [POM1] and tris-butyltin-21-tungsto-9-antimonate(III) anions [POM2]) were characterized by analytical techniques, including ultraviolet-visible, Fourier transform infrared, nuclear magnetic resonance spectroscopy, and transmission electron microscopy. We found that these polyoxotungstates, with 2-4 nm diameters, did not present toxic effects at the tested concentrations. In vitro, POM1 stimulated differentiation of a greater number of dithizone-positive cells (also organized in clusters) than the second nanocompound (POM2). Based on our in vitro studies, we have concluded that both the POMs tested had significant biological activity acting as active stimuli for differentiation of stem cells into insulin-producing cells. PMID:26397720

  1. Relationship of blood and milk cell counts with mastitic pathogens in Murrah buffaloes

    Directory of Open Access Journals (Sweden)

    C. Singh

    2010-02-01

    Full Text Available The present study was undertaken to see the effect of mastitic pathogens on the blood and milk counts of Murrah buffaloes. Milk and blood samples were collected from 9 mastitic Murrah buffaloes. The total leucocyte Counts (TLC and Differential leucocyte counts (DLC in blood were within normal range and there was a non-significant change in blood counts irrespective of different mastitic pathogens. Normal milk quarter samples had significantly (P<0.01 less Somatic cell counts (SCC. Lymphocytes were significantly higher in normal milk samples, whereas infected samples had a significant increase (P<0.01 in milk neutrophils. S. aureus infected buffaloes had maximum milk SCC, followed by E. coli and S. agalactiae. Influx of neutrophils in the buffalo mammary gland was maximum for S. agalactiae, followed by E.cli and S. aureus. The study indicated that level of mastitis had no affect on blood counts but it influenced the milk SCC of normal quarters.

  2. Inactivation of plant-pathogenic fungus Colletotrichum acutatum with natural plant-produced photosensitizers under solar radiation.

    Science.gov (United States)

    Fracarolli, Letícia; Rodrigues, Gabriela B; Pereira, Ana C; Massola Júnior, Nelson S; Silva-Junior, Geraldo José; Bachmann, Luciano; Wainwright, Mark; Bastos, Jairo Kenupp; Braga, Gilberto U L

    2016-09-01

    The increasing tolerance to currently used fungicides and the need for environmentally friendly antimicrobial approaches have stimulated the development of novel strategies to control plant-pathogenic fungi such as antimicrobial phototreatment (APT). We investigated the in vitro APT of the plant-pathogenic fungus Colletotrichum acutatum with furocoumarins and coumarins and solar radiation. The compounds used were: furocoumarins 8-methoxypsoralen (8-MOP) and 5,8-dimethoxypsoralen (isopimpinellin), coumarins 2H-chromen-2-one (coumarin), 7-hydroxycoumarin, 5,7-dimethoxycoumarin (citropten) and a mixture (3:1) of 7-methoxycoumarin and 5,7-dimethoxycoumarin. APT of conidia with crude extracts from 'Tahiti' acid lime, red and white grapefruit were also performed. Pure compounds were tested at 50μM concentration and mixtures and extracts at 12.5mgL(-1). The C. acutatum conidia suspension with or without the compounds was exposed to solar radiation for 1h. In addition, the effects of APT on the leaves of the plant host Citrus sinensis were determined. APT with 8-MOP was the most effective treatment, killing 100% of the conidia followed by the mixture of two coumarins and isopimpinellin that killed 99% and 64% of the conidia, respectively. APT with the extracts killed from 20% to 70% of the conidia, and the extract from 'Tahiti' lime was the most effective. No damage to sweet orange leaves was observed after APT with any of the compounds or extracts. PMID:27434699

  3. Towards the molecular characterization of the stable producer phenotype of recombinant antibody-producing NS0 myeloma cells

    OpenAIRE

    Prieto, Y.; Rojas, L.; Hinojosa, L.; González, I.; Aguiar, D.; de la Luz, K.; Castillo, A.; Pérez, R.

    2011-01-01

    The loss of heterologous protein expression is one of the major problems faced by industrial cell line developers and has been reported by several authors. Therefore, the understanding of the mechanisms involved in the generation of stable and high producer cell lines is a critical issue, especially for those processes based on long term continuous cultures. We characterized two recombinant NS0 myeloma cell lines expressing Nimotuzumab, a humanized anti-human epidermal growth factor receptor ...

  4. Scanning electron microscopy as a tool for the analysis of colony architecture produced by phenotypic switching of a human pathogenic yeast Candida tropicalis

    International Nuclear Information System (INIS)

    Candida tropicalis has been identified as one of the most prevalent pathogenic yeast species of the Candida-non-albicans group. Phenotypic switching is a biological phenomenon related to the occurrence of spontaneous emergence of colonies with different morphologies that provides variability within colonizing populations in order to adapt to different environments. Currently, studies of the microstructure of switching variant colonies are not subject of extensive research. SEM analysis was used to verify the architecture of whole Candida colonies. The strain 49/07 exhibited a hemispherical shape character, while the strain 335/07 showed a volcano shape with mycelated-edge colony. The ring switch variant is characterized by a highly wrinkled centre and an irregular periphery. The rough phenotype exhibited a three-dimensional architecture and was characterized by the presence of deep central and peripheral depressions areas. The ultrastructural analysis also allowed the observation of the arrangement of individual cells within the colonies. The whole smooth colony consisted entirely of yeast cells. Differently, aerial filaments were found all around the colony periphery of the volcano shape colony. For this colony type the mycelated-edge consisted mainly of hyphae, although yeast cells are also seen. The ring and rough colonies phenotypes comprised mainly yeast cells with the presence of extracellular material connecting neighbouring cells. This study has shown that SEM can be used effectively to examine the microarchitecture of colonies morphotypes of the yeast C. tropicalis and further our understanding of switching event in this pathogen.

  5. Adaptive response to starvation in the fish pathogen Flavobacterium columnare: cell viability and ultrastructural changes

    Directory of Open Access Journals (Sweden)

    Arias Covadonga R

    2012-11-01

    Full Text Available Abstract Background The ecology of columnaris disease, caused by Flavobacterium columnare, is poorly understood despite the economic losses that this disease inflicts on aquaculture farms worldwide. Currently, the natural reservoir for this pathogen is unknown but limited data have shown its ability to survive in water for extended periods of time. The objective of this study was to describe the ultrastructural changes that F. columnare cells undergo under starvation conditions. Four genetically distinct strains of this pathogen were monitored for 14 days in media without nutrients. Culturability and cell viability was assessed throughout the study. In addition, cell morphology and ultrastructure was analyzed using light microscopy, scanning electron microscopy, and transmission electron microscopy. Revival of starved cells under different nutrient conditions and the virulence potential of the starved cells were also investigated. Results Starvation induced unique and consistent morphological changes in all strains studied. Cells maintained their length and did not transition into a shortened, coccus shape as observed in many other Gram negative bacteria. Flavobacterium columnare cells modified their shape by morphing into coiled forms that comprised more than 80% of all the cells after 2 weeks of starvation. Coiled cells remained culturable as determined by using a dilution to extinction strategy. Statistically significant differences in cell viability were found between strains although all were able to survive in absence of nutrients for at least 14 days. In later stages of starvation, an extracellular matrix was observed covering the coiled cells. A difference in growth curves between fresh and starved cultures was evident when cultures were 3-months old but not when cultures were starved for only 1 month. Revival of starved cultures under different nutrients revealed that cells return back to their original elongated rod shape upon

  6. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  7. Stem-Cell-Triggered Immunity Safeguards Cytokinin Enriched Plant Shoot Apexes from Pathogen Infection

    Directory of Open Access Journals (Sweden)

    Thomas eDandekar

    2014-10-01

    Full Text Available Intricate mechanisms discriminate between friends and foes in plants. Plant organs deploy overlapping and distinct protection strategies. Despite vulnerability to a plethora of pathogens, the growing tips of plants grow bacteria free. The shoot apical meristem (SAM is among three stem cells niches, a self-renewable reservoir for the future organogenesis of leaf, stem and flowers. How plants safeguard this high value growth target from infections was not known until now. Recent reports find the stem cell secreted 12-amino acid peptide CLV3p (CLAVATA3 peptide is perceived by FLS2 (FLAGELLIN SENSING 2 receptor and activates the transcription of immunity and defense marker genes. No infection in the SAM of wild type plants and bacterial infection in clv3 and fls2 mutants illustrate this natural protection against infections. Cytokinins are enriched in the SAM and regulate meristem activities by their involvement in stem cell signaling networks. Auxin mediates plant susceptibility to pathogen infections while cytokinins boost plant immunity. Here, in addition to the stem-cell-triggered immunity we also highlight a potential link between cytokinin signaling and CLV3p mediated immune response in the SAM.

  8. B cells contribute to heterogeneity of IL-17 producing cells in rheumatoid arthritis and healthy controls.

    Directory of Open Access Journals (Sweden)

    Paul Martin Schlegel

    Full Text Available Secretion of the proinflammatory cytokine Interleukin-17A (IL-17A is the hallmark of a unique lineage of CD4 T cells designated Th17 cells, which may play a crucial role in the pathogenesis of rheumatoid arthritis (RA and many autoimmune diseases. Recently, IL-17-producing cells other than T cells have been described, including diverse innate immune cells. Here, we show that the cellular sources of IL-17A in RA include a significant number of non-T cells. Multicolour fluorescence analysis of IL-17-expressing peripheral blood mononuclear cells (PBMC revealed larger proportions of IL-17(+CD3(- non-T cells in RA patients than in healthy controls (constitutive, 13.6% vs. 8.4%, and after stimulation with PMA/ionomycin 17.4% vs. 7.9% p < 0.001 in both cases. The source of IL-17 included CD3(-CD56(+ NK cells, CD3(-CD14(+ myeloid cells as well as the expected CD3(+CD4(+ Th17 cells and surprisingly a substantial number of CD3(-CD19(+ B cells. The presence of IL-17A-expressing B cells was confirmed by specific PCR of peripheral MACS-sorted CD19(+ B cells, as well as by the analysis of different EBV-transformed B cell lines. Here we report for the first time that in addition to Th17 cells and different innate immune cells B cells also contribute to the IL-17A found in RA patients and healthy controls.

  9. Mouse endometrial stromal cells produce basement-membrane components

    DEFF Research Database (Denmark)

    Wewer, U M; Damjanov, A; Weiss, J;

    1986-01-01

    During mouse pregnancy, uterine stromal cells transform into morphologically distinct decidual cells under the influence of the implanting embryo and a proper hormonal environment. Mechanical stimulation of hormonally primed uterine stromal cells leads to the same morphologic alterations. The dec...

  10. [Construction of cDNA infectious clones of EV71 highly-pathogenic and cell-culture-adapted strains].

    Science.gov (United States)

    Zhang, Yong-xin; Li, Xiao-yu; Huang, Yu-ming; Zhou, Yong-dong; Bi, Sheng-li; Cen, Shan

    2014-11-01

    The highly-pathogenic EV71 strain is the primary cause of mortality in hand-foot-and-mouth disease (HFMD) associated with neurological symptoms, for which no clinically effective drugs or vaccines exist. This study aimed to construct infectious cDNA clones of the EV71 highly-pathogenic strain and the cell-culture adapted strain using a reverse genetics approach. The genomic RNAs of EV71 parent strains were used as the templates for RT-PCR amplification, and then the PCR products that overlapped the full-length genome were connected into the pBR322 vector to produce infectious clones of pEV71 (HP) and pEV71 (CCA), respectively. The results showed that the HP strain propagated much more quickly than the CCA strain. The rescued viruses derived from the infectious clones not only maintained their consistency with their parent strains in terms of genomic sequences, but also retained their respective biological phenotypes. This research will contribute to our understanding of EV71 pathogenesis and the development of novel vaccines against HFMD.

  11. Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells

    Directory of Open Access Journals (Sweden)

    Szu-Hsiu Liu

    2012-01-01

    Full Text Available Embryonic stem (ES cells are a potential source of a variety of differentiated cells for cell therapy, drug discovery, and toxicology screening. Here, we present an efficacy strategy for the differentiation of mouse ES cells into insulin-producing cells (IPCs by a two-step differentiation protocol comprising of (i the formation of definitive endoderm in monolayer culture by activin A, and (ii this monolayer endoderm being induced to differentiate into IPCs by nicotinamide, insulin, and laminin. Differentiated cells can be obtained within approximately 7 days. The differentiation IPCs combined application of RT-PCR, ELISA, and immunofluorescence to characterize phenotypic and functional properties. In our study, we demonstrated that IPCs produced pancreatic transcription factors, endocrine progenitor marker, definitive endoderm, pancreatic β-cell markers, and Langerhans α and δ cells. The IPCs released insulin in a manner that was dose dependent upon the amount of glucose added. These techniques may be able to be applied to human ES cells, which would have very important ramifications for treating human disease.

  12. Diplopyrone, a new phytotoxic tetrahydropyranpyran-2-one produced by Diplodia mutila, a fungus pathogen of cork oak.

    Science.gov (United States)

    Evidente, Antonio; Maddau, Lucia; Spanu, Emanuela; Franceschini, Antonio; Lazzaroni, Silvia; Motta, Andrea

    2003-02-01

    A new phytotoxic monosubstituted tetrahydropyranpyran-2-one, named diplopyrone (1), was isolated from the liquid culture filtrates of Diplodia mutila, a plant pathogenic fungus causing a form of canker disease of cork oak (Quercus suber). Diplopyrone was characterized, using spectroscopic and chemical methods, as 6-[(1S)-1-hydroxyethyl]-2,4a,6,8a-tetrahydropyran[3,2-b]pyran-2-one. The absolute stereochemistry of the chiral secondary hydroxylated carbon (C-9), determined by application of Mosher's method, proved to be S. Diplopyrone assayed at a 0.01-0.1 mg/mL concentration range caused necrosis and wilting on cork oak cuttings. On a nonhost plant, tomato, diplopyrone caused brown discoloration or stewing on the stem.

  13. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells.

    Science.gov (United States)

    Rezania, Alireza; Bruin, Jennifer E; Arora, Payal; Rubin, Allison; Batushansky, Irina; Asadi, Ali; O'Dwyer, Shannon; Quiskamp, Nina; Mojibian, Majid; Albrecht, Tobias; Yang, Yu Hsuan Carol; Johnson, James D; Kieffer, Timothy J

    2014-11-01

    Transplantation of pancreatic progenitors or insulin-secreting cells derived from human embryonic stem cells (hESCs) has been proposed as a therapy for diabetes. We describe a seven-stage protocol that efficiently converts hESCs into insulin-producing cells. Stage (S) 7 cells expressed key markers of mature pancreatic beta cells, including MAFA, and displayed glucose-stimulated insulin secretion similar to that of human islets during static incubations in vitro. Additional characterization using single-cell imaging and dynamic glucose stimulation assays revealed similarities but also notable differences between S7 insulin-secreting cells and primary human beta cells. Nevertheless, S7 cells rapidly reversed diabetes in mice within 40 days, roughly four times faster than pancreatic progenitors. Therefore, although S7 cells are not fully equivalent to mature beta cells, their capacity for glucose-responsive insulin secretion and rapid reversal of diabetes in vivo makes them a promising alternative to pancreatic progenitor cells or cadaveric islets for the treatment of diabetes.

  14. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

    Directory of Open Access Journals (Sweden)

    Nudelman Irina

    2010-10-01

    Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

  15. Expression of Factor X in BHK-21 Cells Promotes Low Pathogenic Influenza Viruses Replication

    Directory of Open Access Journals (Sweden)

    Shahla Shahsavandi

    2015-01-01

    Full Text Available A cDNA clone for factor 10 (FX isolated from chicken embryo inserted into the mammalian cell expression vector pCDNA3.1 was transfected into the baby hamster kidney (BHK-21 cell line. The generated BHK-21 cells with inducible expression of FX were used to investigate the efficacy of the serine transmembrane protease to proteolytic activation of influenza virus hemagglutinin (HA with monobasic cleavage site. Data showed that the BHK-21/FX stably expressed FX after ten serial passages. The cells could proteolytically cleave the HA of low pathogenic avian influenza virus at multiplicity of infection 0.01. Growth kinetics of the virus on BHK-21/FX, BHK-21, and MDCK cells were evaluated by titrations of virus particles in each culture supernatant. Efficient multicycle viral replication was markedly detected in the cell at subsequent passages. Virus titration demonstrated that BHK-21/FX cell supported high-titer growth of the virus in which the viral titer is comparable to the virus grown in BHK-21 or MDCK cells with TPCK-trypsin. The results indicate potential application for the BHK-21/FX in influenza virus replication procedure and related studies.

  16. Expression of Factor X in BHK-21 Cells Promotes Low Pathogenic Influenza Viruses Replication.

    Science.gov (United States)

    Shahsavandi, Shahla; Ebrahimi, Mohammad Majid; Masoudi, Shahin; Izadi, Hasan

    2015-01-01

    A cDNA clone for factor 10 (FX) isolated from chicken embryo inserted into the mammalian cell expression vector pCDNA3.1 was transfected into the baby hamster kidney (BHK-21) cell line. The generated BHK-21 cells with inducible expression of FX were used to investigate the efficacy of the serine transmembrane protease to proteolytic activation of influenza virus hemagglutinin (HA) with monobasic cleavage site. Data showed that the BHK-21/FX stably expressed FX after ten serial passages. The cells could proteolytically cleave the HA of low pathogenic avian influenza virus at multiplicity of infection 0.01. Growth kinetics of the virus on BHK-21/FX, BHK-21, and MDCK cells were evaluated by titrations of virus particles in each culture supernatant. Efficient multicycle viral replication was markedly detected in the cell at subsequent passages. Virus titration demonstrated that BHK-21/FX cell supported high-titer growth of the virus in which the viral titer is comparable to the virus grown in BHK-21 or MDCK cells with TPCK-trypsin. The results indicate potential application for the BHK-21/FX in influenza virus replication procedure and related studies.

  17. Programmed Cell Death and Postharvest Deterioration of Horticultural Produce

    NARCIS (Netherlands)

    Woltering, E.J.; Iakimova, E.T.

    2010-01-01

    Programmed cell death (PCD) is a process where cells or tissues are broken down in an orderly and predictable manner, whereby nutrients are re-used by other cells, tissues or plant parts. The process of (petal) senescence shows many similarities to autophagic PCD in animal cells including a massive

  18. The majority of murine γδ T cells at the maternal-fetal interface in pregnancy produce IL-17.

    Science.gov (United States)

    Pinget, Gabriela V; Corpuz, Theresa M; Stolp, Jessica; Lousberg, Erin L; Diener, Kerrilyn R; Robertson, Sarah A; Sprent, Jonathan; Webster, Kylie E

    2016-08-01

    Compared with lymphoid tissues, the immune cell compartment at mucosal sites is enriched with T cells bearing the γδ T-cell receptor (TCR). The female reproductive tract, along with the placenta and uterine decidua during pregnancy, are populated by γδ T cells predominantly expressing the invariant Vγ6(+)Vδ1(+) receptor. Surprisingly little is understood about the function of these cells. We found that the majority of γδ T cells in the non-pregnant uterus, pregnant uterus, decidua and placenta of mice express the transcription factor RORγt and produce interleukin-17 (IL-17). In contrast, IFNγ-producing γδ T cells were markedly reduced in gestational tissues compared with uterine-draining lymph nodes and spleen. Both uterine-resident invariant Vγ6(+) and Vγ4(+) γδ T cells which are more typically found in lymphoid tissues and circulating blood, were found to express IL-17. Vγ4(+) γδ T cells were particularly enriched in the placenta, suggesting a pregnancy-specific recruitment or expansion of these cells. A small increase in IL-17-producing γδ T cells was observed in allogeneic compared with syngeneic pregnancy, suggesting a contribution to regulating the maternal response to paternally-derived alloantigens. However, their high proportions also in non-pregnant uteri and gestational tissues of syngeneic pregnancy imply a role in the prevention of intrauterine infection or quality control of fetal development. These data suggest the need for a more rigorous evaluation of the role of IL-17 in sustaining normal pregnancy, particularly as emerging data points to a pathogenic role for IL-17 in pre-eclampsia, pre-term birth, miscarriage and maternal immune activation-induced behavioral abnormalities in offspring. PMID:27241697

  19. Induction of autoantibody-producing cells after the coculture of haptenated and normal human mononuclear leukocytes.

    Science.gov (United States)

    Pisko, E J; Foster, S L; Turner, R A

    1981-10-01

    The coculture of normal human peripheral blood mononuclear leukocytes (PBL) and autologous mononuclear leukocytes coupled to the trinitrophenyl (TNP) hapten (TNP-PBL) was found to induce a polyclonal activation of antibody-producing cells. The polyclonal activation of antibody-producing cells was demonstrated by detecting the induction of cells producing antibody to sheep red blood cells using a complement-dependent, direct, hemolytic plaque-forming cell (PFC) assay. A ratio of four normal to one haptenated mononuclear leukocyte was found to be optimal for inducing the polyclonal activation of antibody-producing cell in these cultures. The plaque-forming cells assay in these experiments utilized monolayers of indicator red cells. Further evidence for the polyclonal induction of antibody-producing cells by TNP-PBL was provided by demonstrating PFC on monolayers of not only sheep red blood cells, but also autologous human red cells, bromelain-treated autologous red cells, TNP-coupled human and sheep red cells, and human autologous red cells coupled to human heat-aggregated IgG with chromic chloride. Thus cells secreting antibody to TNP, human red cells, and human IgG were induced. Anti-IgG and anti-human red cell-producing cells were first detected on Day 2 of culture and were still present on Day 9. Mononuclear leukocytes altered by chemical haptenation polyclonally stimulate normal mononuclear leukocytes to become antibody-producing cells. This polyclonal stimulation of antibody-producing cells includes cells producing antibodies to human IgG and human autologous red blood cells suggesting that autoantibody-producing cells are induced.

  20. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Donghui Zhang; Wei Jiang; Meng Liu; Xin Sui; Xiaolei Yin; Song Chen; Yan Shi; Hongkui Deng

    2009-01-01

    Human pluripotent stem cells represent a potentially unlimited source of functional pancreatic endocrine lineage cells. Here we report a highly efficient approach to induce human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells to differentiate into mature insulin-producing cells in a chemical-defined culture system. The differentiated human ES cells obtained by this approach comprised nearly 25% insulin-positive cells as assayed by flow cytometry analysis, which released insulin/C-peptide in response to glucose stimuli in a manner comparable to that of adult human islets. Most of these insulin-producing cells co-expressed mature β cell-specific markers such as NKX6-1 and PDX1, indicating a similar gene expression pattern to adult islet β cells in vivo. In this study, we also demonstrated that EGF facilitates the expansion of PDX1-positive pancreatic progenitors. Moreover, our protocol also succeeded in efficiently inducing human iPS cells to differentiate into insulin-producing cells. Therefore, this work not only provides a new model to study the mechanism of human pancreatic specialization and maturation in vitro, but also enhances the possibility of utilizing patient-specific iPS cells for the treatment of diabetes.

  1. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    International Nuclear Information System (INIS)

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  2. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

    2010-07-09

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  3. Human Liver Cells Expressing Albumin and Mesenchymal Characteristics Give Rise to Insulin-Producing Cells

    Directory of Open Access Journals (Sweden)

    Irit Meivar-Levy

    2011-01-01

    Full Text Available Activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients. Transcription factors-induced liver-to-pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro. However, human-derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized. It is yet unknown whether hepatic-like stem cells or rather adult liver cells give rise to insulin-producing cells. Using an in vitro experimental system, we demonstrate that proliferating adherent human liver cells acquire mesenchymal-like characteristics and a considerable level of cellular plasticity. However, using a lineage-tracing approach, we demonstrate that insulin-producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers. Taken together, our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity, which could be exploited in regenerative medicine approaches.

  4. Capnocytophaga canimorsus: a human pathogen feeding at the surface of epithelial cells and phagocytes.

    Directory of Open Access Journals (Sweden)

    Manuela Mally

    Full Text Available Capnocytophaga canimorsus, a commensal bacterium of the canine oral flora, has been repeatedly isolated since 1976 from severe human infections transmitted by dog bites. Here, we show that C. canimorsus exhibits robust growth when it is in direct contact with mammalian cells, including phagocytes. This property was found to be dependent on a surface-exposed sialidase allowing C. canimorsus to utilize internal aminosugars of glycan chains from host cell glycoproteins. Although sialidase probably evolved to sustain commensalism, by releasing carbohydrates from mucosal surfaces, it also contributed to bacterial persistence in a murine infection model: the wild type, but not the sialidase-deficient mutant, grew and persisted, both when infected singly or in competition. This study reveals an example of pathogenic bacteria feeding on mammalian cells, including phagocytes by deglycosylation of host glycans, and it illustrates how the adaptation of a commensal to its ecological niche in the host, here the dog's oral cavity, contributes to being a potential pathogen.

  5. Proinflammatory GM-CSF-producing B cells in multiple sclerosis and B cell depletion therapy.

    Science.gov (United States)

    Li, Rui; Rezk, Ayman; Miyazaki, Yusei; Hilgenberg, Ellen; Touil, Hanane; Shen, Ping; Moore, Craig S; Michel, Laure; Althekair, Faisal; Rajasekharan, Sathy; Gommerman, Jennifer L; Prat, Alexandre; Fillatreau, Simon; Bar-Or, Amit

    2015-10-21

    B cells are not limited to producing protective antibodies; they also perform additional functions relevant to both health and disease. However, the relative contribution of functionally distinct B cell subsets in human disease, the signals that regulate the balance between such subsets, and which of these subsets underlie the benefits of B cell depletion therapy (BCDT) are only partially elucidated. We describe a proinflammatory, granulocyte macrophage-colony stimulating factor (GM-CSF)-expressing human memory B cell subset that is increased in frequency and more readily induced in multiple sclerosis (MS) patients compared to healthy controls. In vitro, GM-CSF-expressing B cells efficiently activated myeloid cells in a GM-CSF-dependent manner, and in vivo, BCDT resulted in a GM-CSF-dependent decrease in proinflammatory myeloid responses of MS patients. A signal transducer and activator of transcription 5 (STAT5)- and STAT6-dependent mechanism was required for B cell GM-CSF production and reciprocally regulated the generation of regulatory IL-10-expressing B cells. STAT5/6 signaling was enhanced in B cells of untreated MS patients compared with healthy controls, and B cells reemerging in patients after BCDT normalized their STAT5/6 signaling as well as their GM-CSF/IL-10 cytokine secretion ratios. The diminished proinflammatory myeloid cell responses observed after BCDT persisted even as new B cells reconstituted. These data implicate a proinflammatory B cell/myeloid cell axis in disease and underscore the rationale for selective targeting of distinct B cell populations in MS and other human autoimmune diseases. PMID:26491076

  6. A genome-wide transcriptional analysis of producer and non-producer NS0 myeloma cell lines.

    Science.gov (United States)

    Khoo, Soo Hean Gary; Falciani, Francesco; Al-Rubeai, Mohamed

    2007-06-01

    'Genome-wide' or 'global' gene expression profiling provides a powerful approach to the characterization of a cell's transcriptional state. Such technology has been used in animal cell culture to create genome-wide snapshots of transcriptional activity in response to environmental factors or cellular triggers under bioprocessing conditions. Furthermore, it allows us to have a fundamental understanding of genetic mechanisms involved in recombinant protein production. One such mechanism adversely affecting the growth of recombinant bacteria is the increased metabolic burden resulting from the maintenance of plasmid copy number and heterologous protein expression. There have also been some reports on the effect of metabolic burden in mammalian cell systems. In the present study, we have used a mouse array representing 6400 genes to assess the expression profile of a WT (wild-type) mouse plasmacytoma cell line, NS0 WT, and a GS (glutamine synthetase)-NS0 6A1-100 cell line expressing chimaeric monoclonal antibody. The producer cells did not exhibit a slower growth as the result of any metabolic burden, but showed differences in metabolic activity. Gene expression profiling revealed that the producer cell line was selected for a higher expression of chromosomal genes, genes for zinc-finger proteins as well as cell-cycle-related events. On the other hand, protein synthesis is greater and ribosomal genes were more expressed in the WT cells. A possible shift from expressing antigen presenting proteins to recombinant protein could also be seen. Hence, gene expression profiling suggests that the effect of the metabolic burden in slowing growth can be mostly negated in producer cell lines by careful clonal selection, where stable transfected cells are selected for both high productivity as well as high growth rates. PMID:17223793

  7. Stem cells as probabilistic self-producing entities.

    Science.gov (United States)

    Ramalho-Santos, Miguel

    2004-09-01

    Stem cells have the capacity both to self-renew and to give rise to differentiated progeny, and are vital to the organization of multicellular organisms. Stem cells raise a number of fundamental questions regarding lineage restriction and cellular differentiation, and they hold enormous promise for cell-based therapies. Here I propose a theoretical framework for stem cell biology based on the concepts of autopoiesis (self-production) and complementarity. I argue that stem cells are pivotal in the self-production of the organism and that we need complementary approaches to understand their probabilistic behavior. I discuss how this framework generates testable hypotheses regarding stem-cell functions. PMID:15351971

  8. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens

    Directory of Open Access Journals (Sweden)

    Nathan T Reem

    2016-05-01

    Full Text Available The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity and function remains unclear. Modifications of cell wall composition can induce plant responses known as Cell Wall Integrity control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, increased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant cell wall integrity, which contributes to plant resistance to necrotrophic pathogens.

  9. The Plant Pathogen Pantoea ananatis Produces N-Acylhomoserine Lactone and Causes Center Rot Disease of Onion by Quorum Sensing▿

    OpenAIRE

    Morohoshi, Tomohiro; Nakamura, Yuta; Yamazaki, Go; Ishida, Akio; Kato, Norihiro; Ikeda, Tsukasa

    2007-01-01

    A number of gram-negative bacteria have a quorum-sensing system and produce N-acyl-l-homoserine lactone (AHL) that they use them as a quorum-sensing signal molecule. Pantoea ananatis is reported as a common colonist of wheat heads at ripening and causes center rot of onion. In this study, we demonstrated that P. ananatis SK-1 produced two AHLs, N-hexanoyl-l-homoserine lactone (C6-HSL) and N-(3-oxohexanoyl)-l-homoserine lactone (3-oxo-C6-HSL). We cloned the AHL-synthase gene (eanI) and AHL-rec...

  10. Probing host pathogen cross-talk by transcriptional profiling of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages.

    Directory of Open Access Journals (Sweden)

    Ludovic Tailleux

    Full Text Available BACKGROUND: Transcriptional profiling using microarrays provides a unique opportunity to decipher host pathogen cross-talk on the global level. Here, for the first time, we have been able to investigate gene expression changes in both Mycobacterium tuberculosis, a major human pathogen, and its human host cells, macrophages and dendritic cells. METHODOLOGY/PRINCIPAL FINDINGS: In addition to common responses, we could identify eukaryotic and microbial transcriptional signatures that are specific to the cell type involved in the infection process. In particular M. tuberculosis shows a marked stress response when inside dendritic cells, which is in accordance with the low permissivity of these specialized phagocytes to the tubercle bacillus and to other pathogens. In contrast, the mycobacterial transcriptome inside macrophages reflects that of replicating bacteria. On the host cell side, differential responses to infection in macrophages and dendritic cells were identified in genes involved in oxidative stress, intracellular vesicle trafficking and phagosome acidification. CONCLUSIONS/SIGNIFICANCE: This study provides the proof of principle that probing the host and the microbe transcriptomes simultaneously is a valuable means to accessing unique information on host pathogen interactions. Our results also underline the extraordinary plasticity of host cell and pathogen responses to infection, and provide a solid framework to further understand the complex mechanisms involved in immunity to M. tuberculosis and in mycobacterial adaptation to different intracellular environments.

  11. In vitro neuroprotective action of recombinant rat erythropoietin produced by astrocyte cell lines and comparative studies with erythropoietin produced by Chinese hamster ovary cells

    OpenAIRE

    Masuda, Seiji; Kada, Emi; Nagao, Masaya; Sasaki, Ryuzo

    1999-01-01

    In the central nervous system, astrocytes produce erythropoietin (Epo) and neurons express its receptor. To examine whether or not the brain Epo protects the in vitro cultured neurons from glutamate-induced cell death, we established rat astrocyte cell lines containing the plasmid for production of recombinant rat Epo. Epo partially purified from the culture medium showed a neuroprotective effect similar to that of rat Epo produced by Chinese hamster ovary (CHO) cells. Comparison was made in ...

  12. Pathogen-Specific Effects of Quantitative Trait Loci Affecting Clinical Mastitis and Somatic Cell Count in Danish Holstein Cattle

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, Jørn Rind;

    2008-01-01

    The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

  13. Urease genes in non-O157 Shiga toxin-producing Escherichia coli : mostly silent but valuable markers for pathogenicity

    NARCIS (Netherlands)

    Friedrich, A W; Lukas, R; Mellmann, A; Köck, R; Zhang, W; Mathys, W; Bielaszewska, M; Karch, H

    2006-01-01

    The distribution of ureC was investigated among 294 Escherichia coli isolates, comprising 72 strains from the E. coli standard reference collection (ECOR), 62 strains from the diarrhoeagenic E. coli (DEC) collection, and 160 clinical isolates of Shiga toxin-producing E. coli (STEC). The ureC gene wa

  14. Fusarium praegraminearum sp. nov. is a novel nivalenol mycotoxin-producing head blight pathogen from New Zealand

    Science.gov (United States)

    We report on the molecular and morphological characterization of a novel B-type trichothecene toxin-producing species (i.e., B clade) recovered from litter in a maize field near Wellington, New Zealand, which is described as Fusarium praegraminearum sp. nov. This species was initially identified as ...

  15. Influence of Additives on the Yield and Pathogenicity of Conidia Produced by Solid State Cultivation of an Isaria javanica Isolate.

    Science.gov (United States)

    Kim, Jeong Jun; Xie, Ling; Han, Ji Hee; Lee, Sang Yeob

    2014-12-01

    Recently, the Q biotype of tobacco whitefly has been recognized as the most hazardous strain of Bemisia tabaci worldwide, because of its increased resistance to some insecticide groups. As an alternative control agent, we selected an Isaria javanica isolate as a candidate for the development of a mycopesticide against the Q biotype of sweet potato whitefly. To select optimal mass production media for solid-state fermentation, we compared the production yield and virulence of conidia between 2 substrates (barley and brown rice), and we also compared the effects of various additives on conidia production and virulence. Barley was a better substrate for conidia production, producing 3.43 × 10(10) conidia/g, compared with 3.05 × 10(10) conidia/g for brown rice. The addition of 2% CaCO3 + 2% CaSO4 to barley significantly increased conidia production. Addition of yeast extract, casein, or gluten also improved conidia production on barley. Gluten addition (3% and 1.32%) to brown rice improved conidia production by 14 and 6 times, respectively, relative to brown rice without additives. Conidia cultivated on barley produced a mortality rate of 62% in the sweet potato whitefly after 4-day treatment, compared with 53% for conidia cultivated on brown rice. The amendment of solid substrate cultivation with additives changed the virulence of the conidia produced; the median lethal time (LT50) was shorter for conidia produced on barley and brown rice with added yeast extract (1.32% and 3%, respectively), KNO3 (0.6% and 1%), or gluten (1.32% and 3%) compared with conidia produced on substrates without additives. PMID:25606006

  16. Lutein, a Natural Carotenoid, Induces α-1,3-Glucan Accumulation on the Cell Wall Surface of Fungal Plant Pathogens.

    Science.gov (United States)

    Otaka, Junnosuke; Seo, Shigemi; Nishimura, Marie

    2016-01-01

    α-1,3-Glucan, a component of the fungal cell wall, is a refractory polysaccharide for most plants. Previously, we showed that various fungal plant pathogens masked their cell wall surfaces with α-1,3-glucan to evade plant immunity. This surface accumulation of α-1,3-glucan was infection specific, suggesting that plant factors might induce its production in fungi. Through immunofluorescence observations of fungal cell walls, we found that carrot (Daucus carota) extract induced the accumulation of α-1,3-glucan on germlings in Colletotrichum fioriniae, a polyphagous fungal pathogen that causes anthracnose disease in various dicot plants. Bioassay-guided fractionation of carrot leaf extract successfully identified two active substances that caused α-1,3-glucan accumulation in this fungus: lutein, a carotenoid widely distributed in plants, and stigmasterol, a plant-specific membrane component. Lutein, which had a greater effect on C. fioriniae, also induced α-1,3-glucan accumulation in other Colletotrichum species and in the phylogenetically distant rice pathogen Cochliobolus miyabeanus, but not in the rice pathogen Magnaporthe oryzae belonging to the same phylogenetic subclass as Colletotrichum. Our results suggested that fungal plant pathogens reorganize their cell wall components in response to specific plant-derived compounds, which these pathogens may encounter during infection. PMID:27483218

  17. Multipotent stem cells isolated from the adult mouse retina are capable of producing functional photoreceptor cells

    Institute of Scientific and Technical Information of China (English)

    Tianqing Li; Michelle Lewallen; Shuyi Chen; Wei Yu; Nian Zhang; Ting Xie

    2013-01-01

    Various stem cell types have been tested for their potential application in treating photoreceptor degenerative diseases,such as retinitis pigmentosa (RP) and age-related macular degeneration (AMD).Only embryonic stem cells (ESCs) have so far been shown to generate functional photoreceptor cells restoring light response of photoreceptordeficient mice,but there is still some concern of tumor formation.In this study,we have successfully cultured Nestin+Sox2+Pax6+ multipotent retinal stem cells (RSCs) from the adult mouse retina,which are capable of producing functional photoreceptor cells that restore the light response of photoreceptor-deficient rd1 mutant mice following transplantation.After they have been expanded for over 35 passages in the presence of FGF and EGF,the cultured RSCs still maintain stable proliferation and differentiation potential.Under proper differentiation conditions,they can differentiate into all the major retinal cell types found in the adult retina.More importantly,they can efficiently differentiate into photoreceptor cells under optimized differentiation conditions.Following transplantation into the subretinal space of slowly degenerating rd7 mutant eyes,RSC-derived photoreceptor cells integrate into the retina,morphologically resembling endogenous photoreceptors and forming synapases with resident retinal neurons.When transplanted into eyes of photoreceptor-deficient rd1 mutant mice,a RP model,RSC-derived photoreceptors can partially restore light response,indicating that those RSC-derived photoreceptors are functional.Finally,there is no evidence for tumor formation in the photoreceptor-transplanted eyes.Therefore,this study has demonstrated that RSCs isolated from the adult retina have the potential of producing functional photoreceptor cells that can potentially restore lost vision caused by loss of photoreceptor cells in RP and AMD.

  18. From pathogens to microbiota: How Drosophila intestinal stem cells react to gut microbes.

    Science.gov (United States)

    Bonfini, Alessandro; Liu, Xi; Buchon, Nicolas

    2016-11-01

    The intestine acts as one of the interfaces between an organism and its external environment. As the primary digestive organ, it is constantly exposed to a multitude of stresses as it processes and absorbs nutrients. Among these is the recurring damage induced by ingested pathogenic and commensal microorganisms. Both the bacterial activity and immune response itself can result in the loss of epithelial cells, which subsequently requires replacement. In the Drosophila midgut, this regenerative role is fulfilled by intestinal stem cells (ISCs). Microbes not only trigger cell loss and replacement, but also modify intestinal and whole organism physiology, thus modulating ISC activity. Regulation of ISCs is integrated through a complex network of signaling pathways initiated by other gut cell populations, including enterocytes, enteroblasts, enteroendocrine and visceral muscles cells. The gut also receives signals from circulating immune cells, the hemocytes, to properly respond against infection. This review summarizes the types of gut microbes found in Drosophila, mechanisms for their elimination, and provides an integrated view of the signaling pathways that regulate tissue renewal in the midgut. PMID:26855015

  19. VIGOR OF PLANTLET FROM MICROPLANTLET TREATED BY FILTRATE AND CELL SUSPENSION OF SOME ISOLATES OF BACILLUS AND RESISTANCE TO BANANA WILT PATHOGEN AFTER ACCLIMATIZATION

    Directory of Open Access Journals (Sweden)

    Hadi wiyono

    2013-08-01

    Full Text Available Blood Disease Bacterium (BDB and Fusarium oxysporum f.sp. cubense (FOC is a couple wilt pathogen  of  banana.  These pathogens are the most important constraint in cultivation of banana in Indonesia.  In the integrated control strategy of the disease, the use of healthy seedlings produced from tissue culture technique is recommended.  The seedling produced by tissue culture technique however leads to lower vigor and susceptibility to the disease due to the aseptic work in vitro causing the beneficial bacterial endophytic to be eliminated. Therefore, the utility of the beneficial endophytic bacteria should be studied for recovering the vigor and resistance of the seedling.     Three isolates of endophytic Bacillus (B04, B05, B10 have been effective as growth promoter of microplantlet and antagonist of BDB and FOC in vitro.   Here then, this article reports the study results of the vigor of the plantlet (treated microplantlet by filtrate or cell suspension of the Bacillus after 3 months in acclimatization. The results were similar to the previous results on microplantlet in vitro, that Bacillus isolates B04, B05, and B10 were capable of promoting the growth and inducing the resistance to wilt pathogens on banana plantlets.  The treatments with bacterial cell inoculums were more effective than those bacterial filtrate. Isolate B10 was most potential followed by B05 and B04 respectively.

  20. Detection of human adenoviruses in organic fresh produce using molecular and cell culture-based methods.

    Science.gov (United States)

    Marti, Elisabet; Barardi, Célia Regina Monte

    2016-08-01

    The consumption of organic fresh produce has increased in recent years due to consumer demand for healthy foods without chemical additives. However, the number of foodborne outbreaks associated with fresh produce has also increased. Contamination of food with enteric viruses is a major concern because the viruses have a low infectious dose and high persistence in the environment. Human adenovirus (HAdV) has been proposed as a good marker of faecal contamination. Therefore, the aim of this study was to evaluate the efficiency of the plaque assay (PA), real time PCR (qPCR) and integrated cell culture-RT-qPCR (ICC-RT-qPCR) for the recovery of HAdV from artificially and naturally contaminated fresh produce. Organic lettuce, strawberries and green onions were selected because these fresh products are frequently associated with foodborne outbreaks. The virus extraction efficiencies from artificially contaminated samples varied from 2.8% to 32.8% depending on the food matrix and the quantification method used. Although the HAdV recoveries determined by qPCR were higher than those determined by PA and ICC-RT-qPCR, PA was defined as the most reproducible method. The qPCR assays were more sensitive than the PA and ICC-RT-qPCR assays; however, this technique alone did not provide information about the viability of the pathogen. ICC-RT-qPCR was more sensitive than PA for detecting infectious particles in fresh produce samples. HAdV genome copies were detected in 93.3% of the analysed naturally contaminated samples, attesting to the common faecal contamination of the fresh produce tested. However, only 33.3% of the total samples were positive for infectious HAdV particles based on ICC-RT-qPCR. In conclusion, this study reported that HAdV can be an efficient viral marker for fresh produce contamination. Good detection of infectious HAdV was obtained with the ICC-RT-qPCR and PA assays. Thus, we suggest that the ICC-RT-qPCR and PA assays should be considered when quantitative

  1. Detection of human adenoviruses in organic fresh produce using molecular and cell culture-based methods.

    Science.gov (United States)

    Marti, Elisabet; Barardi, Célia Regina Monte

    2016-08-01

    The consumption of organic fresh produce has increased in recent years due to consumer demand for healthy foods without chemical additives. However, the number of foodborne outbreaks associated with fresh produce has also increased. Contamination of food with enteric viruses is a major concern because the viruses have a low infectious dose and high persistence in the environment. Human adenovirus (HAdV) has been proposed as a good marker of faecal contamination. Therefore, the aim of this study was to evaluate the efficiency of the plaque assay (PA), real time PCR (qPCR) and integrated cell culture-RT-qPCR (ICC-RT-qPCR) for the recovery of HAdV from artificially and naturally contaminated fresh produce. Organic lettuce, strawberries and green onions were selected because these fresh products are frequently associated with foodborne outbreaks. The virus extraction efficiencies from artificially contaminated samples varied from 2.8% to 32.8% depending on the food matrix and the quantification method used. Although the HAdV recoveries determined by qPCR were higher than those determined by PA and ICC-RT-qPCR, PA was defined as the most reproducible method. The qPCR assays were more sensitive than the PA and ICC-RT-qPCR assays; however, this technique alone did not provide information about the viability of the pathogen. ICC-RT-qPCR was more sensitive than PA for detecting infectious particles in fresh produce samples. HAdV genome copies were detected in 93.3% of the analysed naturally contaminated samples, attesting to the common faecal contamination of the fresh produce tested. However, only 33.3% of the total samples were positive for infectious HAdV particles based on ICC-RT-qPCR. In conclusion, this study reported that HAdV can be an efficient viral marker for fresh produce contamination. Good detection of infectious HAdV was obtained with the ICC-RT-qPCR and PA assays. Thus, we suggest that the ICC-RT-qPCR and PA assays should be considered when quantitative

  2. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae

    OpenAIRE

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D.; Genersch, Elke

    2014-01-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been ...

  3. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage

    Science.gov (United States)

    Jin, Xiao-Lu; Shen, Xiao-Ge; Sun, Li-Ping; Wu, Li-Ming; Wei, Jiang-Qin; Marcucci, Maria Cristina; Hu, Fu-Liang; Liu, Jian-Xin

    2016-01-01

    Chinese propolis (CP), an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T), we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS), heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA) did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis. PMID:27433029

  4. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1

    OpenAIRE

    Amir Allahverdi; Saied Abroun; Arefeh Jafarian; Masoud Soleimani; Mohammad Taghikhani; Fatemeh Eskandari

    2015-01-01

    Objective: Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs) in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs) are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1) is a master regulator gene required for embryonic development of...

  5. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  6. Method for detection of a few pathogenic bacteria and determination of live versus dead cells

    Science.gov (United States)

    Horikawa, Shin; Chen, I.-Hsuan; Du, Songtao; Liu, Yuzhe; Wikle, Howard C.; Suh, Sang-Jin; Barbaree, James M.; Chin, Bryan A.

    2016-05-01

    This paper presents a method for detection of a few pathogenic bacteria and determination of live versus dead cells. The method combines wireless phage-coated magnetoelastic (ME) biosensors and a surface-scanning dectector, enabling real-time monitoring of the growth of specific bacteria in a nutrient broth. The ME biosensor used in this investigation is composed of a strip-shaped ME resonator upon which an engineered bacteriophage is coated to capture a pathogen of interest. E2 phage with high binding affinity for Salmonella Typhimurium was used as a model study. The specificity of E2 phage has been reported to be 1 in 105 background bacteria. The phage-coated ME biosensors were first exposed to a low-concentration Salmonella suspension to capture roughly 300 cells on the sensor surface. When the growth of Salmonella in the broth occurs, the mass of the biosensor increases, which results in a decrease in the biosensor's resonant frequency. Monitoring of this mass- induced resonant frequency change allows for real-time detection of the presence of Salmonella. Detection of a few bacteria is also possible by growing them to a sufficient number. The surface-scanning detector was used to measure resonant frequency changes of 25 biosensors sequentially in an automated manner as a function of time. This methodology offers direct, real-time detection, quantification, and viability determination of specific bacteria. The rate of the sensor's resonant frequency change was found to be largely dependent on the number of initially bound cells and the efficiency of cell growth.

  7. Search for MicroRNAs Expressed by Intracellular Bacterial Pathogens in Infected Mammalian Cells

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A.; Xet-Mull, Ana M.; Sisk, Dana M.; Smith, Kristen L. Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H.; Tobin, David M.; Cullen, Bryan R.

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin. PMID:25184567

  8. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  9. Targeting insulin-producing beta cells for regenerative therapy.

    Science.gov (United States)

    Migliorini, Adriana; Roscioni, Sara S; Lickert, Heiko

    2016-09-01

    Pancreatic beta cells differ in terms of glucose responsiveness, insulin secretion and proliferative capacity; however, the molecular pathways that regulate this cellular heterogeneity are unknown. We have identified the Wnt-planar cell polarity (PCP) effector Flattop (FLTP) as a biomarker that identifies mature beta cells in the islets of Langerhans. Interestingly, three-dimensional architecture and Wnt-PCP ligands are sufficient to trigger mouse and human beta cell maturation. These results highlight the fact that novel biomarkers shed light on the long-standing mystery of beta cell heterogeneity and identify the Wnt-PCP pathway as triggering beta cell maturation. Understanding heterogeneity in the islets of Langerhans might allow targeting of beta cell subpopulations for regenerative therapy and provide building principles for stem cell-derived islets. This review summarises a presentation given at the 'Can we make a better beta cell?' symposium at the 2015 annual meeting of the EASD. It is accompanied by two other reviews on topics from this symposium (by Amin Ardestani and Kathrin Maedler, DOI: 10.1007/s00125-016-3892-9 , and by Harry Heimberg and colleagues, DOI: 10.1007/s00125-016-3879-6 ) and a commentary by the Session Chair, Shanta Persaud (DOI: 10.1007/s00125-016-3870-2 ). PMID:27412250

  10. Transcriptomic Crosstalk between Fungal Invasive Pathogens and Their Host Cells: Opportunities and Challenges for Next-Generation Sequencing Methods

    OpenAIRE

    Francisco J Enguita; Costa, Marina C.; Ana Marisa Fusco-Almeida; Maria José Mendes-Giannini; Ana Lúcia Leitão

    2016-01-01

    Fungal invasive infections are an increasing health problem. The intrinsic complexity of pathogenic fungi and the unmet clinical need for new and more effective treatments requires a detailed knowledge of the infection process. During infection, fungal pathogens are able to trigger a specific transcriptional program in their host cells. The detailed knowledge of this transcriptional program will allow for a better understanding of the infection process and consequently will help in the future...

  11. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens

    Science.gov (United States)

    Reem, Nathan T.; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A.; Bellincampi, Daniela; Zabotina, Olga A.

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens. PMID:27242834

  12. Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

    Science.gov (United States)

    Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

    2016-02-01

    Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7–10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

  13. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  14. Tissue specific localization of root infection by fungal pathogens: role of root border cells.

    Science.gov (United States)

    Gunawardena, Uvini; Hawes, Martha C

    2002-11-01

    When roots of pea seedlings were inoculated uniformly with spores of Nectria haematocca or other pea pathogenic fungi, more than 90% developed lesions in the region of elongation within 3 days. More mature regions of most roots as well as the tip showed no visible signs of infection. Yet, microscopic observation revealed that 'mantles,' comprised of fungal hyphae intermeshed with populations of border cells, covered the tips of most roots. After physical detachment of the mantle, the underlying tip of most roots was found to be free of infection. Mantle-covered root tips did not respond to invasion of their border cells by activation of known defense genes unless there was invasion of the tip itself, as revealed by the presence of a lesion. Concomitant with the activation of defense genes was the induction of a cell-wall degrading enzyme whose expression is a marker for renewed production of border cells. Mantle formation did not occur in response to nonpathogens. The data are consistent with the hypothesis that border cells serve as a host-specific 'decoy' that protects root meristems by inhibiting fungal infection of the root tip.

  15. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens.

    Science.gov (United States)

    Reem, Nathan T; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A; Bellincampi, Daniela; Zabotina, Olga A

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens.

  16. Decreased Polysaccharide Feruloylation Compromises Plant Cell Wall Integrity and Increases Susceptibility to Necrotrophic Fungal Pathogens.

    Science.gov (United States)

    Reem, Nathan T; Pogorelko, Gennady; Lionetti, Vincenzo; Chambers, Lauran; Held, Michael A; Bellincampi, Daniela; Zabotina, Olga A

    2016-01-01

    The complexity of cell wall composition and structure determines the strength, flexibility, and function of the primary cell wall in plants. However, the contribution of the various components to cell wall integrity (CWI) and function remains unclear. Modifications of cell wall composition can induce plant responses known as CWI control. In this study, we used transgenic expression of the fungal feruloyl esterase AnFAE to examine the effect of post-synthetic modification of Arabidopsis and Brachypodium cell walls. Transgenic Arabidopsis plants expressing AnFAE showed a significant reduction of monomeric ferulic acid, decreased amounts of wall-associated extensins, and increased susceptibility to Botrytis cinerea, compared with wild type. Transgenic Brachypodium showed reductions in monomeric and dimeric ferulic acids and increased susceptibility to Bipolaris sorokiniana. Upon infection, transgenic Arabidopsis and Brachypodium plants also showed increased expression of several defense-related genes compared with wild type. These results demonstrate a role, in both monocot and dicot plants, of polysaccharide feruloylation in plant CWI, which contributes to plant resistance to necrotrophic pathogens. PMID:27242834

  17. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other importan

  18. Resistance to cereal rusts at the plant cell wall - what can we learn from other host-pathogen systems?

    NARCIS (Netherlands)

    Collins, N.C.; Niks, R.E.; Schulze-Lefert, P.

    2007-01-01

    The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of pr

  19. The plant pathogen Pantoea ananatis produces N-acylhomoserine lactone and causes center rot disease of onion by quorum sensing.

    Science.gov (United States)

    Morohoshi, Tomohiro; Nakamura, Yuta; Yamazaki, Go; Ishida, Akio; Kato, Norihiro; Ikeda, Tsukasa

    2007-11-01

    A number of gram-negative bacteria have a quorum-sensing system and produce N-acyl-l-homoserine lactone (AHL) that they use them as a quorum-sensing signal molecule. Pantoea ananatis is reported as a common colonist of wheat heads at ripening and causes center rot of onion. In this study, we demonstrated that P. ananatis SK-1 produced two AHLs, N-hexanoyl-l-homoserine lactone (C6-HSL) and N-(3-oxohexanoyl)-l-homoserine lactone (3-oxo-C6-HSL). We cloned the AHL-synthase gene (eanI) and AHL-receptor gene (eanR) and revealed that the deduced amino acid sequence of EanI/EanR showed high identity to those of EsaI/EsaR from P. stewartii. EanR repressed the ean box sequence and the addition of AHLs resulted in derepression of ean box. Inactivation of the chromosomal eanI gene in SK-1 caused disruption of exopolysaccharide (EPS) biosynthesis, biofilm formation, and infection of onion leaves, which were recovered by adding exogenous 3-oxo-C6-HSL. These results demonstrated that the quorum-sensing system involved the biosynthesis of EPS, biofilm formation, and infection of onion leaves in P. ananatis SK-1. PMID:17827290

  20. Islet Brain 1 Protects Insulin Producing Cells against Lipotoxicity.

    Science.gov (United States)

    Brajkovic, Saška; Ferdaoussi, Mourad; Pawlowski, Valérie; Ezanno, Hélène; Plaisance, Valérie; Zmuda, Erik; Hai, Tsonwin; Annicotte, Jean-Sébastien; Waeber, Gérard; Abderrahmani, Amar

    2016-01-01

    Chronic intake of saturated free fatty acids is associated with diabetes and may contribute to the impairment of functional beta cell mass. Mitogen activated protein kinase 8 interacting protein 1 also called islet brain 1 (IB1) is a candidate gene for diabetes that is required for beta cell survival and glucose-induced insulin secretion (GSIS). In this study we investigated whether IB1 expression is required for preserving beta cell survival and function in response to palmitate. Chronic exposure of MIN6 and isolated rat islets cells to palmitate led to reduction of the IB1 mRNA and protein content. Diminution of IB1 mRNA and protein level relied on the inducible cAMP early repressor activity and proteasome-mediated degradation, respectively. Suppression of IB1 level mimicked the harmful effects of palmitate on the beta cell survival and GSIS. Conversely, ectopic expression of IB1 counteracted the deleterious effects of palmitate on the beta cell survival and insulin secretion. These findings highlight the importance in preserving the IB1 content for protecting beta cell against lipotoxicity in diabetes.

  1. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk;

    1988-01-01

    -culture contamination to monitor inter-species as well as intra-species cross contamination. An insulin-producing cell-line, Clone-16, originally cloned from a human fetal endocrine pancreatic cell line did not produce human c-peptide as anticipated. DNA from these cells showed no hybridization to the human ALU...

  2. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae. PMID:26922490

  3. Toxicity and antibacterial assessment of chitosan-coated silver nanoparticles on human pathogens and macrophage cells

    Directory of Open Access Journals (Sweden)

    Jena P

    2012-04-01

    Full Text Available Prajna Jena1, Soumitra Mohanty1, Rojee Mallick1, Biju Jacob2, Avinash Sonawane11School of Biotechnology, KIIT University, Bhubaneswar, Orissa, India; 2Center for Innovation, Technopark Technology Business Incubator, Bangalore, Karnataka, IndiaBackground: Pathogenic bacteria are able to develop various strategies to counteract the bactericidal action of antibiotics. Silver nanoparticles (AgNPs have emerged as a potential alternative to conventional antibiotics because of their potent antimicrobial properties. The purpose of this study was to synthesize chitosan-stabilized AgNPs (CS-AgNPs and test for their cytotoxic, genotoxic, macrophage cell uptake, antibacterial, and antibiofilm activities.Methods: AgNPs were synthesized using chitosan as both a stabilizing and a reducing agent. Antibacterial activity was determined by colony-forming unit assay and scanning electron microscopy. Genotoxic and cytotoxic activity were determined by DNA fragmentation, comet, and MTT [3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide] assays. Cellular uptake and intracellular antibacterial activity were tested on macrophages.Results: CS-AgNPs exhibited potent antibacterial activity against different human pathogens and also impeded bacterial biofilm formation. Scanning electron microscopy analysis indicated that CS-AgNPs kill bacteria by disrupting the cell membrane. CS-AgNPs showed no significant cytotoxic or DNA damage effect on macrophages at the bactericidal dose. Propidium iodide staining indicated active endocytosis of CS-AgNPs resulting in reduced intracellular bacterial survival in macrophages.Conclusion: The present study concludes that at a specific dose, chitosan-based AgNPs kill bacteria without harming the host cells, thus representing a potential template for the design of antibacterial agents to decrease bacterial colonization and to overcome the problem of drug resistance.Keywords: chitosan-silver nanoparticles, antibiofilm, cytotoxicity

  4. Relationship between mastitis causative pathogens and somatic cell counts in milk of dairy cows

    Directory of Open Access Journals (Sweden)

    Sharaf Eldeen Idriss

    2013-12-01

    Full Text Available Milk somatic cell count is a key component of national and international regulation for milk quality and an indicator of udder health and of the prevalence of clinical and subclinical mastitis in dairy herds. The objective of this study was to evaluate the presence of mastitis pathogens in milk samples differed by somatic cell count (SCC in microbiologically positive samples. Also frequency of distribution of samples differed by SCC were studied in non infected samples as well. The milk samples were collected from individual quarters from the dairy farms located in Nitra region with problematic udder health of herd for SCC and bacteriological analysis. Totally, 390 milk samples were examined, and 288 (73.85% positive milk samples were detected. Four SCC groups of samples (400×103 /ml were used to identify presence of microorganisms in positive samples. The most frequently isolated pathogens in samples with high SCC >400×103 /ml according to year were Coagulase-negative Staphylococci (29.11 % in 2012, followed by Staphylococcus aureus (28.0% in 2010, yeasts (24.05% in 2012, Escherichia coli (22.78% in 2012, Bacillus sp. (20% in 2010 and Pseudomonas aerugenosa (11.88% in 2011. Coagulase-negative Staphylococci (66.67% were the predominantly identified in the samples with low SCC <100×103 cells/ml, followed by Bacillus spp (50%, Entrococcus spp. (33.33% and Staphylococcus aureus (16.67% and E. coli (16.67%. The results of this study indicated that the SCC of individual milk samples corresponded with the health status of the udder of dairy cows represented by presence of mastitis microorganisms in milk. However, the contamination of milk samples could be also connected with low SCC. On the ohter side the samples with high SCC were found out without presence of microorganism. The further study is needed to identify the reason of high SCC in milk from negative samples.

  5. Cloned calves produced by nuclear transfer from cultured cumulus cells

    Institute of Scientific and Technical Information of China (English)

    AN; Xiaorong(安晓荣); GOU; Kemian(苟克勉); ZHU; Shien(朱士恩); GUAN; Hong(关宏); HOU; Jian(侯健); LIN; Aixing(林爱星); ZENG; Shenming(曾申明); TIAN; Jianhui(田见辉); CHEN; Yongfu(陈永福)

    2002-01-01

    Short-term cultured cumulus cell lines (1-5BCC) derived from 5 individual cows were used in nuclear transfer (NT) and 1188 enucleated bovine oocytes matured in vitro were used as nuclear recipients. A total of 931 (78.4%) cloned embryos were reconstructed, of which 763 (82%) cleaved, 627 (67.3%) developed to 8-cell stage, and 275 (29.5%) reached blastocyst stage. The average cell number of blastocysts was 124±24.5 (n=20). In this study, the effects of donor cell sources, serum starvation of donor cells, time interval from fusion to activation (IFA) were also tested on cloning efficiency. These results showed that blastocyst rates of embryos reconstructed from 5 different individuals cells were significantly different among them (14.1%, 45.2%, 27.3%, 34.3%, vs 1.5%, P0.05); and that blastocyst rate (20.3%) of the group with fusion/activation interval of 2-3 h, was significantly lower than that of the 3-6 h groups (31.0%), while not significantly different among 3-4 h (P < 0.05), 4-5 h, and 5-6 h groups (P ≥ 0.05). Sixty-three thawed NT blastocysts were transferred to 31 recipient cows, of which 4 pregnancies were established and two cloned calves were given birth. These results indicate that serum starvation of cumulus cells is not a key factor for successful bovine cloning, while IFA treatment and sources of donor cells have effects on cloning efficiency.

  6. The Hagfish Gland Thread Cell: A Fiber-Producing Cell Involved in Predator Defense

    Directory of Open Access Journals (Sweden)

    Douglas S. Fudge

    2016-05-01

    Full Text Available Fibers are ubiquitous in biology, and include tensile materials produced by specialized glands (such as silks, extracellular fibrils that reinforce exoskeletons and connective tissues (such as chitin and collagen, as well as intracellular filaments that make up the metazoan cytoskeleton (such as F-actin, microtubules, and intermediate filaments. Hagfish gland thread cells are unique in that they produce a high aspect ratio fiber from cytoskeletal building blocks within the confines of their cytoplasm. These threads are elaborately coiled into structures that readily unravel when they are ejected into seawater from the slime glands. In this review we summarize what is currently known about the structure and function of gland thread cells and we speculate about the mechanism that these cells use to produce a mechanically robust fiber that is almost one hundred thousand times longer than it is wide. We propose that a key feature of this mechanism involves the unidirectional rotation of the cell’s nucleus, which would serve to twist disorganized filaments into a coherent thread and impart a torsional stress on the thread that would both facilitate coiling and drive energetic unravelling in seawater.

  7. Arabidopsis EDS1 connects pathogen effector recognition to cell compartment-specific immune responses.

    Science.gov (United States)

    Heidrich, Katharina; Wirthmueller, Lennart; Tasset, Céline; Pouzet, Cécile; Deslandes, Laurent; Parker, Jane E

    2011-12-01

    Pathogen effectors are intercepted by plant intracellular nucleotide binding-leucine-rich repeat (NB-LRR) receptors. However, processes linking receptor activation to downstream defenses remain obscure. Nucleo-cytoplasmic basal resistance regulator EDS1 (ENHANCED DISEASE SUSCEPTIBILITY1) is indispensible for immunity mediated by TIR (Toll-interleukin-1 receptor)-NB-LRR receptors. We show that Arabidopsis EDS1 molecularly connects TIR-NB-LRR disease resistance protein RPS4 recognition of bacterial effector AvrRps4 to defense pathways. RPS4-EDS1 and AvrRps4-EDS1 complexes are detected inside nuclei of living tobacco cells after transient coexpression and in Arabidopsis soluble leaf extracts after resistance activation. Forced AvrRps4 localization to the host cytoplasm or nucleus reveals cell compartment-specific RPS4-EDS1 defense branches. Although nuclear processes restrict bacterial growth, programmed cell death and transcriptional resistance reinforcement require nucleo-cytoplasmic coordination. Thus, EDS1 behaves as an effector target and activated TIR-NB-LRR signal transducer for defenses across cell compartments.

  8. Extracts from Flammulina velutipes Inhibit the Adhesion of Pathogenic Fungi to Epithelial Cells

    Science.gov (United States)

    Kashina, Svetlana; Villavicencio, Lérida Liss Flores; Balleza, Marco; Sabanero, Gloria Barbosa; Tsutsumi, Víctor; López, Myrna Sabanero

    2016-01-01

    Background: Recently, extracts from natural sources have been tested for their antifungal properties. In this aspect, Flammulina velutipes extracts possess a significant amount of branch-chained carbohydrates with mannose moieties that, hypothetically, can reduce the adhesion. Objective: In this study, we assessed the capacity of extracts from F. velutipes (wild-type AQF-1 and ATCC 34574 as the reference strain) to inhibit the adhesion of S. schenkii and C. albicans to epithelial cells. Materials and Methods: The aqueous extracts from F. velutipes strains were obtained by sonication, total carbohydrate and protein was analyzed by Dubois and Lowry methods respectively. Effect of the extracts (50, 100 and 150 μg/mL) on the fungi adhesion to host cells was evaluated after 1 h interaction, and the percentage of inhibition of adhesion was measured. After of interaction the cytoskeleton from cell was analyzed with phalloidin-FITC. Results: The extract from strain AQF-1 (50, 100 and 150 μg/mL) inhibited the adhesion of: S. schenkii in a dose-dependent manner (4.9, 7.5 and 12.7%, respectively) and C. albicans in a dose-independent manner (5.2%). The percentage of inhibition by extracts from the strain ATCC34574 at the same concentrations, shown that are dose independent for both fungi: 3.9% for S. schenkii and 2.6% for C. albicans. Conclusion: The extracts from F. velutipes inhibit the adhesion of pathogenic fungi to host cells. The mechanism molecular is unknown; however, is probably an interaction between the polysaccharides from extracts with the fungi receptors. This aspect is currently analyzed. SUMMARY The yields of mycelium from two strains of F. velutipes and the extract from it were similar.Extracts from both strains have inhibited adhesion of S. schenkii and C. albicans to epithelial cells in vitro, but the extract from strain AQF-1 was more effective.The extracts have not prevented damage to epithelial cells caused by pathogenic fungi. Abbreviation Used: YPG

  9. Cyanobacteria as Cell Factories to Produce Plant Secondary Metabolites

    OpenAIRE

    Xue, Yong; He, Qingfang

    2015-01-01

    Cyanobacteria represent a promising platform for the production of plant secondary metabolites. Their capacity to express plant P450 proteins, which have essential functions in the biosynthesis of many plant secondary metabolites, makes cyanobacteria ideal for this purpose, and their photosynthetic capability allows cyanobacteria to grow with simple nutrient inputs. This review summarizes the advantages of using cyanobacteria to transgenically produce plant secondary metabolites. Some techniq...

  10. Gene expression profiling in host-pathogen interactions and identification of the molecular mechanisms involved in dendrictic cells activation

    OpenAIRE

    Torri,, M.

    2009-01-01

    In this thesis we used a functional genomic approach to study host-pathogen interactions [1]. We analyzed the interaction from the host point of view and in particular from the dendritic cells point of view. Dendritic cells (DCs) constitute a heterogeneous group of antigen-presenting leukocytes important in activation of both innate and adaptive immunity [2]. In the first part of this thesis we explored the possibility to use dendritic cell transcriptomes to generate biomarkers of inflamma...

  11. Integrating Wind And Solar With Hydrogen Producing Fuel Cells

    NARCIS (Netherlands)

    Hemmes, K.

    2007-01-01

    The often proposed solution for the fluctuating wind energy supply is the conversion of the surplus of wind energy into hydrogen by means of electrolysis. In this paper a patented alternative is proposed consisting of the integration of wind turbines with internal reforming fuel-cells, capable of co

  12. Cytokine-producing T cell subsets in human leishmaniasis

    DEFF Research Database (Denmark)

    Kemp, Kåre

    2000-01-01

    Leishmania specific Th1/Th2 cells have been identified in humans as well as in mice. There is a correlation between the clinical outcome of the infection and the cytokine response profile. Generally, the production of Th2 cytokines leads to severe infection, whereas the production of Th1 cytokine...

  13. High prevalence of extended-spectrum β-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India

    Directory of Open Access Journals (Sweden)

    Pathak A

    2012-04-01

    Full Text Available Ashish Pathak1,2, Yogyata Marothi3, Vandana Kekre4, Kalpana Mahadik5, Ragini Macaden6, Cecilia Stålsby Lundborg11Division of Global Health, Department of Public Health Sciences, Karolinska Institutet, Stockholm, Sweden; 2Department of Pediatrics, 3Department of Microbiology, 4Department of Medicine, 5Department of Obstetrics and Gynecology, RD Gardi Medical College, Ujjain, India; 6St Johns Research Institute, Bangalore, IndiaBackground: Recent reports of the rapid evolution of bacterial resistance in India require urgent antibiotic stewardship programs. This study aimed to define the magnitude and pattern of resistance of bacterial pathogens to guide empirical therapy.Methods: We prospectively collected consecutive, clinically significant, and nonduplicate bacterial isolates from each patient from two hospitals in Ujjain, India. The antibiotic susceptibility of the bacteria was tested using a disc diffusion method as recommended by the Clinical and Laboratory Standards Institute.Results: A total of 716 pathogens were isolated from 2568 patients (median age, 25 years; range, 0 days to 92 years. Gram-negative infections were predominant (62%. The isolated pathogens included Staphylococcus aureus (n = 221; 31%, Escherichia coli (n = 149; 21%, Pseudomonas aeruginosa (n = 127; 18%, and Klebsiella pneumoniae (n = 107; 15%. Common diagnoses included abscesses (56%, urinary tract infections (14%, blood stream infections (10%, pneumonia (10%, and vaginal infections (10%. In E. coli isolates, 69% (95% confidence interval [CI] 61.6–76.6 were extended-spectrum β-lactamase (ESBL producers and 41% (95% CI 31.6–50.5 of K. pneumoniae isolates were ESBL producers. These isolates had a high resistance to fluoroquinolones and β-lactams, except for imipenem and piperacillin-tazobactam. Salmonella typhi remained sensitive to third-generation cephalosporins. Methicillin-resistant S. aureus (MRSA constituted 30% of all S. aureus isolates and showed resistance

  14. Progress in amorphous silicon solar cells produced by reactive sputtering

    Science.gov (United States)

    Moustakas, T. D.

    The photovoltaic properties of reactively sputtered amorphous silicon are reviewed and it is shown that efficient PIN solar cells can be fabricated by the method of sputtering. The photovoltaic properties of the intrinsic films correlate with their structural and compositional inhomogeneities. Hydrogen incorporation and small levels of phosphorus and boron impurities also affect the photovoltaic properties through reduction of residual dangling bond related defects and modification of their occupation. The optical and transport properties of the doped P and N-films were found to depend sensitively on the amount of hydrogen and boron or phosphorus incorporation into the films as well as on their degree of crystallinity. Combination of the best intrinsic and doped films leads to PIN solar cell structures generating J(sc) of 13 mA/sq cm and V(oc) of between 0.85 to 0.95 volts. The efficiency of these devices, 5 to 6 percent, is limited by the low FF, typically about 50 percent. As a further test to the potential of this technology efficient tandem solar cell structures were fabricated, and device design concepts, such as the incorporation of optically reflective back contacts were tested.

  15. Differentiation of insulin-producing cells from human neural progenitor cells.

    Directory of Open Access Journals (Sweden)

    Yuichi Hori

    2005-04-01

    Full Text Available BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals that regulate in vivo pancreatic islet development, form clusters of glucose-responsive insulin-producing cells (IPCs. During in vitro differentiation of neural progenitor cells with this novel method, genes encoding essential known in vivo regulators of pancreatic islet development were expressed. Following transplantation into immunocompromised mice, IPCs released insulin C-peptide upon glucose challenge, remained differentiated, and did not form detectable tumors. CONCLUSION: Production of IPCs solely through extracellular factor modulation in the absence of genetic manipulations may promote strategies to derive transplantable islet-replacement tissues from human neural progenitor cells and other types of multipotent human stem cells.

  16. Application of dielectric spectroscopy for monitoring high cell density in monoclonal antibody producing CHO cell cultivations.

    Science.gov (United States)

    Párta, László; Zalai, Dénes; Borbély, Sándor; Putics, Akos

    2014-02-01

    The application of dielectric spectroscopy was frequently investigated as an on-line cell culture monitoring tool; however, it still requires supportive data and experience in order to become a robust technique. In this study, dielectric spectroscopy was used to predict viable cell density (VCD) at industrially relevant high levels in concentrated fed-batch culture of Chinese hamster ovary cells producing a monoclonal antibody for pharmaceutical purposes. For on-line dielectric spectroscopy measurements, capacitance was scanned within a wide range of frequency values (100-19,490 kHz) in six parallel cell cultivation batches. Prior to detailed mathematical analysis of the collected data, principal component analysis (PCA) was applied to compare dielectric behavior of the cultivations. PCA analysis resulted in detecting measurement disturbances. By using the measured spectroscopic data, partial least squares regression (PLS), Cole-Cole, and linear modeling were applied and compared in order to predict VCD. The Cole-Cole and the PLS model provided reliable prediction over the entire cultivation including both the early and decline phases of cell growth, while the linear model failed to estimate VCD in the later, declining cultivation phase. In regards to the measurement error sensitivity, remarkable differences were shown among PLS, Cole-Cole, and linear modeling. VCD prediction accuracy could be improved in the runs with measurement disturbances by first derivative pre-treatment in PLS and by parameter optimization of the Cole-Cole modeling.

  17. Does the Presence of Detached Root Border Cells of Zea mays Alter the Activity of the Pathogenic Nematode Meloidogyne incognita?

    Science.gov (United States)

    Rodger, S; Bengough, A G; Griffiths, B S; Stubbs, V; Young, I M

    2003-09-01

    ABSTRACT The root-knot nematode Meloidogyne incognita is a major pathogen of a range of important crops. Currently, control is typically achieved by the use of nematicides. However, recent work suggests that manipulating the ability of roots to slough off border cells, which then act as a decoy to the nematode, can significantly decrease damage to the roots. We investigated the attractiveness of border cells to M. incognita and the response of the nematode to border cells in close proximity. We found very limited attraction, in that nematodes did not preferentially alter direction to move toward the border cells, but a large and significant increase in nematode speed was observed once they were in the immediate vicinity of border cells. We discuss the results in the context of physical and biological mechanisms in relation to the control of pathogenic nematodes.

  18. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Directory of Open Access Journals (Sweden)

    Daniel A. Rappolee

    2012-12-01

    Full Text Available Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  19. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development.

    Science.gov (United States)

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-01-01

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK) which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK) that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  20. On the Thermus thermophilus HB8 potential pathogenicity triggered from rhamnolipids secretion: morphological alterations and cytotoxicity induced on fibroblastic cell line.

    Science.gov (United States)

    Pantazaki, A A; Choli-Papadopoulou, T

    2012-05-01

    A limited number of bacterial strains usually grown under nutrient limitation secrete rhamnolipids (RLs), which are recorded as virulence factors that are implicated in the pathogenicity of a microorganism. The non-pathogenic T. thermophilus HB8 produces extracellular rhamnolipids (TthRLs) under defined cultivation conditions using sunflower seed oil and sodium gluconate as carbon sources. In particular, the secreted TthRLs have been isolated, purified and identified with ATR-FTIR. Their effects on the cells' viability were examined when they were supplemented in a culture of human skin fibroblasts. Purified TthRLs triggered a sequence of rapid and pronounced morphological alterations characterized by transformation of fibroblast shape from polygonal to fusiform; retraction with cytoplasm condensation, rounding up, distortion of nuclei and loss of lamellar processes, and finally disruption of membrane. The addition of TthRLs in the cultured fibroblasts caused cytotoxicity, in contrast to that of rhamnose that stimulated viability, as it was assessed by MTT test. These results revealed that among the constituents of RLs that are implicated in the cytotoxicity, it has to be attributed to the lipidic chain variation and not to the carbohydrate part. TthRLs cytotoxicity on fibroblasts is comparable, and provoked similar effects, to that caused by saponin white, a known surfactant. TthRLs secretion might be a crucial point for the transformation of a non-pathogenic bacterium to a pathogenic one under certain environmental conditions favoring their secretion. RLs secretion in the microorganism's world might be a general route for the passage in the pathogenicity to ensure their survival under nutrient limitation conditions. PMID:21611776

  1. Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming

    NARCIS (Netherlands)

    Kwakkenbos, Mark J.; Diehl, Sean A.; Yasuda, Etsuko; Bakker, Arjen Q.; van Geelen, Caroline M. M.; Lukens, Michaël; van Bleek, Grada M.; Widjojoatmodjo, Myra N.; Bogers, Willy M. J. M.; Mei, Henrik; Radbruch, Andreas; Scheeren, Ferenc A.; Spits, Hergen; Beaumont, Tim

    2010-01-01

    The B cell lymphoma-6 (Bcl-6) and Bcl-xL proteins are expressed in germinal center B cells and enable them to endure the proliferative and mutagenic environment of the germinal center. By introducing these genes into peripheral blood memory B cells and culturing these cells with two factors produced

  2. Electrochemically Produced Graphene for Microporous Layers in Fuel Cells.

    Science.gov (United States)

    Najafabadi, Amin Taheri; Leeuwner, Magrieta J; Wilkinson, David P; Gyenge, Előd L

    2016-07-01

    The microporous layer (MPL) is a key cathodic component in proton exchange membrane fuel cells owing to its beneficial influence on two-phase mass transfer. However, its performance is highly dependent on material properties such as morphology, porous structure, and electrical resistance. To improve water management and performance, electrochemically exfoliated graphene (EGN) microsheets are considered as an alternative to the conventional carbon black (CB) MPLs. The EGN-based MPLs decrease the kinetic overpotential and the Ohmic potential loss, whereas the addition of CB to form a composite EGN+CB MPL improves the mass-transport limiting current density drastically. This is reflected by increases of approximately 30 and 70 % in peak power densities at 100 % relative humidity (RH) compared with those for CB- and EGN-only MPLs, respectively. The composite EGN+CB MPL also retains the superior performance at a cathode RH of 20 %, whereas the CB MPL shows significant performance loss.

  3. Serine protease espP subtype alpha, but not beta or gamma, of Shiga toxin-producing Escherichia coli is associated with highly pathogenic serogroups.

    Science.gov (United States)

    Khan, Abdul Basit; Naim, Asma; Orth, Dorothea; Grif, Katharina; Mohsin, Mashkoor; Prager, Rita; Dierich, Manfred P; Würzner, Reinhard

    2009-04-01

    Besides Shiga toxins (Stx), Stx-producing Escherichia coli (STEC) harbour several other putative virulence factors, including the serine protease EspP. We have investigated 214 STEC strains from Austria belonging to 61 different serotypes from humans, animals, and food for the presence of this serine protease gene and have determined the espP subtypes and their association with clinical outcome. espP was detected in 121 (57%) out of 214 strains. Sixty-five of 68 strains (96%) of non-sorbitol-fermenting (NSF) O157:H7/NM (NM, non-motile) were positive for espP, while none of 8 SF E. coli O157:NM isolates contained this gene. All 9 strains of serotype O145:NM and 17 of 21 strains (81%) of serotype O26:H11/NM were positive for espP. Nineteen STEC serogroups including O103 and O111 serogroups--considered to be highly pathogenic--were completely negative for espP. Only 5 of 12 strains isolated from patients suffering from haemolytic uraemic syndrome (HUS) were espP-positive (all serogroup NSF O157) as well as 28 of 39 strains from patients with bloody diarrhoea, 40 of 63 strains from patients with non-bloody diarrhoea, and 15 of 19 strains from asymptomatic patients. In O157:H7/NM, O26:H11/NM, and O145:NM only espP subtype alpha was found, whereas in most of the other non-O157 serogroups, subtypes beta and gamma were found. Subtype delta was not detected in our strain collection. Regarding the espP subtypes, only subtype alpha, but not beta and gamma, were found in HUS patients. Moreover, we could demonstrate that espP, and in particular subtype alpha, is associated with highly pathogenic serogroups.

  4. Characterization of the Inflammasome in Human Kupffer Cells in Response to Synthetic Agonists and Pathogens.

    Science.gov (United States)

    Zannetti, Claudia; Roblot, Guillaume; Charrier, Emily; Ainouze, Michelle; Tout, Issam; Briat, François; Isorce, Nathalie; Faure-Dupuy, Suzanne; Michelet, Maud; Marotel, Marie; Kati, Semra; Schulz, Thomas F; Rivoire, Michel; Traverse-Glehen, Alexandra; Luangsay, Souphalone; Alatiff, Omran; Henry, Thomas; Walzer, Thierry; Durantel, David; Hasan, Uzma

    2016-07-01

    The liver is the largest gland in the human body and functions as an innate immune organ. Liver macrophages called Kupffer cells (KC) constitute the largest group of macrophages in the human body. Innate immune responses involving KC represent the first line of defense against pathogens in the liver. Human monocyte-derived macrophages have been used to characterize inflammasome responses that lead to the release of the proinflammatory cytokines IL-1β and IL-18, but it has not yet been determined whether human KC contain functional inflammasomes. We show, to our knowledge for the first time, that KC express genes and proteins that make up several different inflammasome complexes. Moreover, activation of KC in response to the absent in melanoma 2 (AIM2) inflammasome led to the production of IL-1β and IL-18, which activated IL-8 transcription and hepatic NK cell activity, respectively. Other inflammasome responses were also activated in response to selected bacteria and viruses. However, hepatitis B virus inhibited the AIM2 inflammasome by reducing the mRNA stability of IFN regulatory factor 7, which regulated AIM2 transcription. These data demonstrate the production of IL-1β and IL-18 in KC, suggesting that KC contain functional inflammasomes that could be important players in the innate immune response following certain infections of the liver. We think our findings could potentially aid therapeutic approaches against chronic liver diseases that activate the inflammasome. PMID:27226092

  5. Classification of yeast cells from image features to evaluate pathogen conditions

    Science.gov (United States)

    van der Putten, Peter; Bertens, Laura; Liu, Jinshuo; Hagen, Ferry; Boekhout, Teun; Verbeek, Fons J.

    2007-01-01

    Morphometrics from images, image analysis, may reveal differences between classes of objects present in the images. We have performed an image-features-based classification for the pathogenic yeast Cryptococcus neoformans. Building and analyzing image collections from the yeast under different environmental or genetic conditions may help to diagnose a new "unseen" situation. Diagnosis here means that retrieval of the relevant information from the image collection is at hand each time a new "sample" is presented. The basidiomycetous yeast Cryptococcus neoformans can cause infections such as meningitis or pneumonia. The presence of an extra-cellular capsule is known to be related to virulence. This paper reports on the approach towards developing classifiers for detecting potentially more or less virulent cells in a sample, i.e. an image, by using a range of features derived from the shape or density distribution. The classifier can henceforth be used for automating screening and annotating existing image collections. In addition we will present our methods for creating samples, collecting images, image preprocessing, identifying "yeast cells" and creating feature extraction from the images. We compare various expertise based and fully automated methods of feature selection and benchmark a range of classification algorithms and illustrate successful application to this particular domain.

  6. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A.; Jacobson, Aaron; Phinney, Brett S.; Dolan, David; Durbin-Johnson, Blythe P.; Antonova, Elena S.; Lindow, Steven E.; Mellema, Matthew S.; Goulart, Luiz R.; Dandekar, Abhaya M.

    2016-01-01

    Pierce’s disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease “PrtA” that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa. PMID:27492542

  7. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa.

    Science.gov (United States)

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M

    2016-01-01

    Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa. PMID:27492542

  8. The impact of hypoxia on intestinal epithelial cell functions: consequences for invasion by bacterial pathogens.

    Science.gov (United States)

    Zeitouni, Nathalie E; Chotikatum, Sucheera; von Köckritz-Blickwede, Maren; Naim, Hassan Y

    2016-12-01

    The maintenance of oxygen homeostasis in human tissues is mediated by several cellular adaptations in response to low-oxygen stress, called hypoxia. A decrease in tissue oxygen levels is initially counteracted by increasing local blood flow to overcome diminished oxygenation and avoid hypoxic stress. However, studies have shown that the physiological oxygen concentrations in several tissues are much lower than atmospheric (normoxic) conditions, and the oxygen supply is finely regulated in individual cell types. The gastrointestinal tract has been described to subsist in a state of physiologically low oxygen level and is thus depicted as a tissue in the state of constant low-grade inflammation. The intestinal epithelial cell layer plays a vital role in the immune response to inflammation and infections that occur within the intestinal tissue and is involved in many of the adaptation responses to hypoxic stress. This is especially relevant in the context of inflammatory disorders, such as inflammatory bowel disease (IBD). Therefore, this review aims to describe the intestinal epithelial cellular response to hypoxia and the consequences for host interactions with invading gastrointestinal bacterial pathogens. PMID:27002817

  9. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Directory of Open Access Journals (Sweden)

    Andrew S Brown

    2016-06-01

    Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  10. Small GTPases promote actin coat formation on microsporidian pathogens traversing the apical membrane of Caenorhabditis elegans intestinal cells.

    Science.gov (United States)

    Szumowski, Suzannah C; Estes, Kathleen A; Popovich, John J; Botts, Michael R; Sek, Grace; Troemel, Emily R

    2016-01-01

    Many intracellular pathogens co-opt actin in host cells, but little is known about these interactions in vivo. We study the in vivo trafficking and exit of the microsporidian Nematocida parisii, which is an intracellular pathogen that infects intestinal cells of the nematode Caenorhabditis elegans. We recently demonstrated that N. parisii uses directional exocytosis to escape out of intestinal cells into the intestinal tract. Here, we show that an intestinal-specific isoform of C. elegans actin called ACT-5 forms coats around membrane compartments that contain single exocytosing spores, and that these coats appear to form after fusion with the apical membrane. We performed a genetic screen for host factors required for actin coat formation and identified small GTPases important for this process. Through analysis of animals defective in these factors, we found that actin coats are not required for pathogen exit although they may boost exocytic output. Later during infection, we find that ACT-5 also forms coats around membrane-bound vesicles that contain multiple spores. These vesicles are likely formed by clathrin-dependent compensatory endocytosis to retrieve membrane material that has been trafficked to the apical membrane as part of the exocytosis process. These findings provide insight into microsporidia interaction with host cells, and provide novel in vivo examples of the manner in which intracellular pathogens co-opt host actin during their life cycle. PMID:26147591

  11. Effects of TFAR19 gene on the in vivo biorheological properties and pathogenicity of mouse erythroleukemia cell line MEL

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    After injecting VP16, MEL cells and MEL-TF19 cells into the body of mice, with those injected with the same dose of saline as the control group, we observed the mice for their blood pictures, histological changes of the liver and spleen, and the hemorhelogical indexes within 4 weeks. The results indicated that after injecting MEL cells, the mice entered into a pathological status similar to erythroleukemia, which had the following exhibitions: the tissue structures of the liver and spleen were damaged, a mass of proerythroblasts, basophil erythroblasts and polychromatophilic erythroblasts could be observed on the smears of the bone marrow and spleen, and the deformability and orientation ability of erythrocytes were both depressed. The pathogenicity of MEL-TF19 cells carrying TFAR19 gene was obviously lower than that of MEL cells, and the MEL-TF19 cells even lost their faintish pathogenicity under the apop-tosis-inducing effect of the chemotherapeutic reagent. The outcome from the animal experiments suggests that the TFAR19 gene suppresses the pathogenicity of MEL cells to the mice, and the effect may be better exerted with the synergy of the chemotherapeutic reagent.

  12. NLRP3 Inflammasome Activation in THP-1 Target Cells Triggered by Pathogenic Naegleria fowleri.

    Science.gov (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Yoo, Jong-Kyun; Kang, Heekyoung; Seong, Gi-Sang; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2016-09-01

    Naegleria fowleri, known as the brain-eating amoeba, causes acute primary amoebic meningoencephalitis. During swimming and other recreational water activities, N. fowleri trophozoites penetrate the nasal mucosa and invade the olfactory bulbs, resulting in intense inflammatory reactions in the forebrain tissue. To investigate what kinds of inflammasome molecules are expressed in target cells due to N. fowleri infection, human macrophage cells (THP-1 cells) were cocultured with N. fowleri trophozoites in a noncontact system, and consequently, interleukin-1β (IL-1β) production was estimated. Caspase-1 activation and IL-1β production from THP-1 cells by Western blotting and the culture supernatant by enzyme-linked immunosorbent assay analysis were observed at 3 h after cocultivation. In addition, the increased expression of ASC and NLRP3, which make up an inflammasome complex, was also observed at 3 h after cocultivation. To confirm the caspase-1 activation and IL-1β production via the NLRP3 inflammasome in THP-1 cells triggered by N. fowleri trophozoites, THP-1 cells were pretreated with several inhibitors. The inhibition assay showed that CA-074 (a cathepsin B inhibitor), glybenclamide (an NLRP3 molecule inhibitor), and N-benzyloxycarbony-Val-Ala-Asp(O-methyl)-fluoromethylketone (Z-VAD-FMK; a caspase-1 inhibitor) reduced the levels of caspase-1 activation and IL-1β production from THP-1 cells. This study suggests that N. fowleri infection induces the NLRP3 inflammasome, which activates caspase-1 and subsequently produces IL-1β, thus resulting in inflammation.

  13. NLRP3 Inflammasome Activation in THP-1 Target Cells Triggered by Pathogenic Naegleria fowleri.

    Science.gov (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Yoo, Jong-Kyun; Kang, Heekyoung; Seong, Gi-Sang; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2016-09-01

    Naegleria fowleri, known as the brain-eating amoeba, causes acute primary amoebic meningoencephalitis. During swimming and other recreational water activities, N. fowleri trophozoites penetrate the nasal mucosa and invade the olfactory bulbs, resulting in intense inflammatory reactions in the forebrain tissue. To investigate what kinds of inflammasome molecules are expressed in target cells due to N. fowleri infection, human macrophage cells (THP-1 cells) were cocultured with N. fowleri trophozoites in a noncontact system, and consequently, interleukin-1β (IL-1β) production was estimated. Caspase-1 activation and IL-1β production from THP-1 cells by Western blotting and the culture supernatant by enzyme-linked immunosorbent assay analysis were observed at 3 h after cocultivation. In addition, the increased expression of ASC and NLRP3, which make up an inflammasome complex, was also observed at 3 h after cocultivation. To confirm the caspase-1 activation and IL-1β production via the NLRP3 inflammasome in THP-1 cells triggered by N. fowleri trophozoites, THP-1 cells were pretreated with several inhibitors. The inhibition assay showed that CA-074 (a cathepsin B inhibitor), glybenclamide (an NLRP3 molecule inhibitor), and N-benzyloxycarbony-Val-Ala-Asp(O-methyl)-fluoromethylketone (Z-VAD-FMK; a caspase-1 inhibitor) reduced the levels of caspase-1 activation and IL-1β production from THP-1 cells. This study suggests that N. fowleri infection induces the NLRP3 inflammasome, which activates caspase-1 and subsequently produces IL-1β, thus resulting in inflammation. PMID:27297387

  14. Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

    Directory of Open Access Journals (Sweden)

    Soares-Silveira Alda

    2002-07-01

    Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

  15. Enhancement of insulin-producing cell differentiation from embryonic stem cells using pax4-nucleofection method

    Institute of Scientific and Technical Information of China (English)

    Han-Tso Lin; Hung-Hai Ku; Chung-Lan Kao; Kun-Hsiung Lee; Yuh-Lih Chang; Shih-Hwa Chiou; Fu-Ting Tsai; Tung-Hu Tsai; Dey-Chyi Sheu; Larry LT Ho

    2007-01-01

    AIM: To enhance the differentiation of insulin producing cell (IPC) ability from embryonic stem (ES) cells in vitro.METHODS: Four-day embryoid body (EB)-formatted ES cells were dissociated as single cells for the followed plasmid DNA delivery. The use of Nucleofector- Electroporator (Amaxa biosystems, Germany) in combination with medium-contained G418 provided a high efficiency of gene delivery for advanced selection. Neucleofected cells were plated on the top of fibronectin coated Petri dishes. Addition of Ly294002 and raised the glucose in medium at 24 h before examination.The differentiation status of these cells was monitored by semi-quantitative PCR (SQ-PCR) detection of the expression of relative genes, such as oct-4, sox-17, foxa2, mixl1, pdx-1, insulin 1, glucagons and somatostatin. The percentage of IPC population on d 18 of the experiment was investigated by immunohistochemistry (IHC), and the content/secretion of insulin was estimated by ELISA assay. The mice with severe combined immunodeficiency disease (SCID) pretreated with streptozotocin (STZ) were used to eliminate plasma glucose restoration after pax4+ ES implantation.RESULTS: A high efficiency of gene delivery was demonstrated when neucleofection was used in the present study; approximately 70% cells showed DsRed expression 2 d after neucleofection. By selection of medium-contained G418, the percentage of DsRed expressing cells kept high till the end of study. The pancreatic differentiation seemed to be accelerated by pax4 nucleofection. When compared to the group of cells with mock control, foxa2, mixl1, pdx1, higher insulin and somatostatin levels were detected by SQ-PCR 4 d after nucleofection in the group of pax4 expressing plasmid delivery. Approximately 55% of neucleofected cells showed insulin expression 18 d after neucleofection, and only 18% of cells showed insulin expression in mock control. The disturbance was shown by nucleofected pax4 RNAi vector; only 8% of cells expressed insulin 18

  16. The insect pathogen Serratia marcescens Db10 uses a hybrid non-ribosomal peptide synthetase-polyketide synthase to produce the antibiotic althiomycin.

    Directory of Open Access Journals (Sweden)

    Amy J Gerc

    Full Text Available There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1-alb6. Bioinformatic analysis of the proteins encoded by alb1-6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS assembly line (Alb4/5/6, tailoring enzymes (Alb2/3 and an export/resistance protein (Alb1, and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2-Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism.

  17. Origin of Matrix-Producing Cells That Contribute to Aortic Fibrosis in Hypertension.

    Science.gov (United States)

    Wu, Jing; Montaniel, Kim Ramil C; Saleh, Mohamed A; Xiao, Liang; Chen, Wei; Owens, Gary K; Humphrey, Jay D; Majesky, Mark W; Paik, David T; Hatzopoulos, Antonis K; Madhur, Meena S; Harrison, David G

    2016-02-01

    Various hypertensive stimuli lead to exuberant adventitial collagen deposition in large arteries, exacerbating blood pressure elevation and end-organ damage. Collagen production is generally attributed to resident fibroblasts; however, other cells, including resident and bone marrow-derived stem cell antigen positive (Sca-1(+)) cells and endothelial and vascular smooth muscle cells, can produce collagen and contribute to vascular stiffening. Using flow cytometry and immunofluorescence, we found that adventitial Sca-1(+) progenitor cells begin to produce collagen and acquire a fibroblast-like phenotype in hypertension. We also found that bone marrow-derived cells represent more than half of the matrix-producing cells in hypertension, and that one-third of these are Sca-1(+). Cell sorting and lineage-tracing studies showed that cells of endothelial origin contribute to no more than one fourth of adventitial collagen I(+) cells, whereas those of vascular smooth muscle lineage do not contribute. Our findings indicate that Sca-1(+) progenitor cells and bone marrow-derived infiltrating fibrocytes are major sources of arterial fibrosis in hypertension. Endothelial to mesenchymal transition likely also contributes, albeit to a lesser extent and pre-existing resident fibroblasts represent a minority of aortic collagen-producing cells in hypertension. This study shows that vascular stiffening represents a complex process involving recruitment and transformation of multiple cells types that ultimately elaborate adventitial extracellular matrix.

  18. NK Cell-Mediated Regulation of Protective Memory Responses against Intracellular Ehrlichial Pathogens.

    Directory of Open Access Journals (Sweden)

    Samar Habib

    Full Text Available Ehrlichiae are gram-negative obligate intracellular bacteria that cause potentially fatal human monocytic ehrlichiosis. We previously showed that natural killer (NK cells play a critical role in host defense against Ehrlichia during primary infection. However, the contribution of NK cells to the memory response against Ehrlichia remains elusive. Primary infection of C57BL/6 mice with Ehrlichia muris provides long-term protection against a second challenge with the highly virulent Ixodes ovatus Ehrlichia (IOE, which ordinarily causes fatal disease in naïve mice. Here, we show that the depletion of NK cells in E. muris-primed mice abrogates the protective memory response against IOE. Approximately, 80% of NK cell-depleted E. muris-primed mice succumbed to lethal IOE infection on days 8-10 after IOE infection, similar to naïve mice infected with the same dose of IOE. The lack of a recall response in NK cell-depleted mice correlated with an increased bacterial burden, extensive liver injury, decreased frequency of Ehrlichia-specific IFN-γ-producing memory CD4+ and CD8+ T-cells, and a low titer of Ehrlichia-specific antibodies. Intraperitoneal infection of mice with E. muris resulted in the production of IL-15, IL-12, and IFN-γ as well as an expansion of activated NKG2D+ NK cells. The adoptive transfer of purified E. muris-primed hepatic and splenic NK cells into Rag2-/-Il2rg-/- recipient mice provided protective immunity against challenge with E. muris. Together, these data suggest that E. muris-induced memory-like NK cells, which contribute to the protective, recall response against Ehrlichia.

  19. Regulatory network modelling of iron acquisition by a fungal pathogen in contact with epithelial cells

    Directory of Open Access Journals (Sweden)

    Guthke Reinhard

    2010-11-01

    Full Text Available Abstract Background Reverse engineering of gene regulatory networks can be used to predict regulatory interactions of an organism faced with environmental changes, but can prove problematic, especially when focusing on complicated multi-factorial processes. Candida albicans is a major human fungal pathogen. During the infection process, this fungus is able to adapt to conditions of very low iron availability. Such adaptation is an important virulence attribute of virtually all pathogenic microbes. Understanding the regulation of iron acquisition genes will extend our knowledge of the complex regulatory changes during the infection process and might identify new potential drug targets. Thus, there is a need for efficient modelling approaches predicting key regulatory events of iron acquisition genes during the infection process. Results This study deals with the regulation of C. albicans iron uptake genes during adhesion to and invasion into human oral epithelial cells. A reverse engineering strategy is presented, which is able to infer regulatory networks on the basis of gene expression data, making use of relevant selection criteria such as sparseness and robustness. An exhaustive use of available knowledge from different data sources improved the network prediction. The predicted regulatory network proposes a number of new target genes for the transcriptional regulators Rim101, Hap3, Sef1 and Tup1. Furthermore, the molecular mode of action for Tup1 is clarified. Finally, regulatory interactions between the transcription factors themselves are proposed. This study presents a model describing how C. albicans may regulate iron acquisition during contact with and invasion of human oral epithelial cells. There is evidence that some of the proposed regulatory interactions might also occur during oral infection. Conclusions This study focuses on a typical problem in Systems Biology where an interesting biological phenomenon is studied using a small

  20. Atypical and classical memory B cells produce Plasmodium falciparum neutralizing antibodies

    DEFF Research Database (Denmark)

    Muellenbeck, Matthias F; Ueberheide, Beatrix; Amulic, Borko;

    2013-01-01

    . We show at the single cell level that natural Pf infection induces the development of classical memory B cells (CM) and atypical memory B cells (AtM) that produce broadly neutralizing antibodies against blood stage Pf parasites. CM and AtM contribute to anti-Pf serum IgG production, but only AtM show...

  1. Interleukin 17-Producing γδT Cells Increased in Patients with Active Pulmonary Tuberculosis

    Institute of Scientific and Technical Information of China (English)

    Meiyu Peng; Zhaohua Wang; Chunyan Yao; Lina Jiang; Qili Jin; Jing Wang; Baiqing Li

    2008-01-01

    Although it has been known that y8 T cells may play an important role in the immune response to infection of Mycobacterium tuberculosis (M. tb), the mechanisms by which the T8 T cells participate in the innate and/or acquired immunity to tuberculosis (TB) have not been full elucidated. In the present study, 27 patients with active pulmonary TB and 16 healthy donors (HD) were performed. We found that proportion of IL-17-producing cells among lymphocyte was similar between TB patients and HD, whereas the proportions of γδ T cells in IL-17- producing cells (59.2%) and IL-17-producing cells in γδ T cells (19.4%) in peripheral blood were markedly increased in TB patients when compared to those in HD (43.9% and 7.7%, respectively). In addition, the proportions of IFN-γ-producing γδ T cells in TB patients were obviously lower than that in HD. Upon re-stimulated with M. tb heat-treated antigen (M. tb-HAg) in vitro, fewer IL-17-producing γδ T cells were generated from HD and TB patients, whereas IFN-γ-producing γδ T cells were increased in TB patients compared to that in HD. Our findings in TB patients and healthy human were consistent with other murine investigation that the IL-17- producing γδ T cells were main source of IL-17 in mouse model of BCG infection, suggesting that γδ T cells might be involved in the formation of tubercular granuloma in pulmonary TB patients, but need further identification. Cellular & Molecular Immunology. 2008;5(3):203-208.

  2. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Science.gov (United States)

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  3. C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

    Directory of Open Access Journals (Sweden)

    Ning Ma

    Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

  4. Pleural mesothelial cells promote expansion of IL-17-producing CD8+ T cells in tuberculous pleural effusion.

    Science.gov (United States)

    Li, X; Zhou, Q; Yang, W B; Xiong, X Z; Du, R H; Zhang, J C

    2013-05-01

    IL-17-producing CD8(+) T lymphocytes (Tc17 cells) have recently been detected in many cancers and autoimmune diseases. However, the possible implication of Tc17 cells in tuberculous pleural effusion remains unclarified. In this study, distribution and phenotypic features of Tc17 cells in both tuberculous pleural effusion (TPE) and peripheral blood from patients with tuberculosis were determined. The effects of proinflammatory cytokines and local accessory cells (pleural mesothelial cells) on Tc17 cell expansion were also explored. We found that TPE contained more Tc17 cells than the blood. Compared with IFN-γ-producing CD8(+) T cells, Tc17 cells displayed higher expression of chemokine receptors (CCRs) and lower expression of cytotoxic molecules. In particularly, Tc17 cells in TPE exhibited high expression levels of CCR6, which could migrate in response to CCL20. Furthermore, IL-1β, IL-6, IL-23, or their various combinations could promote Tc17 cell expansion from CD8(+) T cells, whereas the proliferative response of Tc17 cells to above cytokines was lower than that of Th17 cells. Pleural mesothelial cells (PMCs) were able to stimulate Tc17 cell expansion via cell contact in an IL-1β/IL-6/IL-23 independent fashion. Thus this study demonstrates that Tc17 cells marks a subset of non-cytotoxic, CCR6(+) CD8(+) T lymphocytes with low proliferative capacity. The overrepresentation of Tc17 cells in TPE may be due to Tc17 cell expansion stimulated by pleural proinflammatory cytokines and to recruitment of Tc17 cells from peripheral blood. Additionally, PMCs may promote the production of IL-17 by CD8(+) T cells at sites of TPE via cell-cell interactions. PMID:23299924

  5. Differentiation of human labia minora dermis-derived fibroblasts into insulin-producing cells

    OpenAIRE

    Kim, Bona; Yoon, Byung Sun; Moon, Jai-Hee; Kim, Jonggun; Jun, Eun Kyoung; Lee, Jung Han; Kim, Jun Sung; Baik, Cheong Soon; Kim, Aeree; Whang, Kwang Youn; You, Seungkwon

    2011-01-01

    Recent evidence has suggested that human skin fibroblasts may represent a novel source of therapeutic stem cells. In this study, we report a 3-stage method to induce the differentiation of skin fibroblasts into insulin-producing cells (IPCs). In stage 1, we establish the isolation, expansion and characterization of mesenchymal stem cells from human labia minora dermis-derived fibroblasts (hLMDFs) (stage 1: MSC expansion). hLMDFs express the typical mesenchymal stem cell marker proteins and ca...

  6. Inner ear hair cells produced in vitro by a mesenchymal-to-epithelial transition

    OpenAIRE

    Hu, Zhengqing; Corwin, Jeffrey T.

    2007-01-01

    Sensory hair cell loss is a major contributor to disabling hearing and balance deficits that affect >250 million people worldwide. Sound exposures, infections, drug toxicity, genetic disorders, and aging all can cause hair cell loss and lead to permanent sensory deficits. Progress toward treatments for these deficits has been limited, in part because hair cells have only been obtainable via microdissection of the anatomically complex internal ear. Attempts to produce hair cells in vitro have ...

  7. Mechanisms underlying the toxicity of lactone aroma compounds towards the producing yeast cells

    OpenAIRE

    Aguedo, Mario; Beney, L.; Waché, Y.; Belin, J.-M.

    2003-01-01

    Aims: To study the fundamental mechanisms of toxicity of the fruity aroma compound γ-decalactone, that lead to alterations in cell viability during its biotechnological production by yeast cells; Yarrowia lipolytica that is able to produce high amounts of this metabolite was used here as a model. Methods and Results: Lactone concentrations above 150 mg l-1 inhibited cell growth, depolarized the living cells and increased membrane fluidity. Infrared spectroscopic measurements revealed that the...

  8. A novel IL-10-producing innate lymphoid cells (ILC10) in a contact hypersensitivity mouse model

    Science.gov (United States)

    Kim, Hyuk Soon; Jang, Jong-Hwa; Lee, Min Bum; Jung, In Duk; Park, Yeong-Min; Kim, Young Mi; Choi, Wahn Soo

    2016-01-01

    The immunoregulatory cytokine Interleukin 10 (IL-10) protein is produced by various cells during the course of inflammatory disorders. Mainly, it downregulates pro-inflammatory cytokines, antigen presentation, and helper T cell activation. In this study, we show that the ratio of IL-10-producing cells was significantly increased in lineage negative (i.e., not T, B, or leukocyte cell lineages) cells than in lineage positive cells in lymphoid and peripheral tissues. We further observed that IL-10-producing innate lymphoid cells (ILCs), here called firstly ILC10, were increased in number in oxazolone-induced contact hypersensitivity (CHS) mice. In detail, IL-10-producing lineage negative cells were elevated in the axillary, inguinal lymph node, and ear tissues of CHS mice. Notably, the cells expressed classical ILC marker proteins such as CD45, CD127, and Sca-1. Altogether, our findings suggest for the first time that ILC10s are present in various physiological settings and could be involved in numerous immune responses as regulatory cells. [BMB Reports 2016; 49(5): 293-296] PMID:26949018

  9. An experimental and theoretical approach to the study of the photoacoustic signal produced by cancer cells

    Directory of Open Access Journals (Sweden)

    Rafael Pérez Solano

    2012-03-01

    Full Text Available The distinctive spectral absorption characteristics of cancer cells make photoacoustic techniques useful for detection in vitro and in vivo. Here we report on our evaluation of the photoacoustic signal produced by a series of monolayers of different cell lines in vitro. Only the melanoma cell line HS936 produced a detectable photoacoustic signal in which amplitude was dependent on the number of cells. This finding appears to be related to the amount of melanin available in these cells. Other cell lines (i.e. HL60, SK-Mel-1, T47D, Hela, HT29 and PC12 exhibited values similar to a precursor of melanin (tyrosinase, but failed to produce sufficient melanin to generate a photoacoustic signal that could be distinguished from background noise. To better understand this phenomenon, we determined a formula for the time-domain photoacoustic wave equation for a monolayer of cells in a non-viscous fluid on the thermoelastic regime. The theoretical results showed that the amplitude and profile of the photoacoustic signal generated by a cell monolayer depended upon the number and distribution of the cells and the location of the point of detection. These findings help to provide a better understanding of the factors involved in the generation of a photoacoustic signal produced by different cells in vitro and in vivo.

  10. AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6

    International Nuclear Information System (INIS)

    Cell lines derived from Kaposi sarcoma lesions of patients with AIDS (AIDS-KS cells) produce several cytokines, including an endothelial cell growth factor, interleukin 1β, and basic fibroblast growth factor. Since exposure to human immunodeficiency virus increases interleukin 6 (IL-6) production in monocytes and endothelial cells produce IL-6, the authors examined IL-6 expression and response in AIDS-KS cell lines and IL-6 expression in AIDS Kaposi sarcoma tissue. The AIDS-KS cell lines (N521J and EKS3) secreted large amounts of immunoreactive and biologically active IL-6. The authors found both IL-6 and IL-6 receptor (IL-6-R) RNA by slot blot hybridization analysis of AIDS-KS cells. The IL-6-R was functional, as [3H]thymidine incorporation by AIDS-KS cells increased significantly after exposure to human recombinant IL-6 (hrIL-6) at >10 units/ml. When AIDS-KS cells (EKS3) were exposed to IL-6 antisense oligonucleotide, cellular proliferation decreased by nearly two-thirds, with a corresponding decrease in the production of IL-6. These results show that both IL-6 and IL-6-R are produced by AIDS-KS cells and that IL-6 is required for optimal AIDS-KS cell proliferation, and they suggest that IL-6 is an autocrine growth factor for AIDS-KS cells

  11. Deciphering the responses of root border-like cells of Arabidopsis and flax to pathogen-derived elicitors.

    Science.gov (United States)

    Plancot, Barbara; Santaella, Catherine; Jaber, Rim; Kiefer-Meyer, Marie Christine; Follet-Gueye, Marie-Laure; Leprince, Jérôme; Gattin, Isabelle; Souc, Céline; Driouich, Azeddine; Vicré-Gibouin, Maïté

    2013-12-01

    Plant pathogens including fungi and bacteria cause many of the most serious crop diseases. The plant innate immune response is triggered upon recognition of microbe-associated molecular patterns (MAMPs) such as flagellin22 and peptidoglycan. To date, very little is known of MAMP-mediated responses in roots. Root border cells are cells that originate from root caps and are released individually into the rhizosphere. Root tips of Arabidopsis (Arabidopsis thaliana) and flax (Linum usitatissimum) release cells known as "border-like cells." Whereas root border cells of pea (Pisum sativum) are clearly involved in defense against fungal pathogens, the function of border-like cells remains to be established. In this study, we have investigated the responses of root border-like cells of Arabidopsis and flax to flagellin22 and peptidoglycan. We found that both MAMPs triggered a rapid oxidative burst in root border-like cells of both species. The production of reactive oxygen species was accompanied by modifications in the cell wall distribution of extensin epitopes. Extensins are hydroxyproline-rich glycoproteins that can be cross linked by hydrogen peroxide to enhance the mechanical strength of the cell wall. In addition, both MAMPs also caused deposition of callose, a well-known marker of MAMP-elicited defense. Furthermore, flagellin22 induced the overexpression of genes involved in the plant immune response in root border-like cells of Arabidopsis. Our findings demonstrate that root border-like cells of flax and Arabidopsis are able to perceive an elicitation and activate defense responses. We also show that cell wall extensin is involved in the innate immunity response of root border-like cells.

  12. Transcriptional control of fungal cell cycle and cellular events by Fkh2, a forkhead transcription factor in an insect pathogen

    OpenAIRE

    Wang, Juan-juan; Qiu, Lei; Cai, Qing; Ying, Sheng-Hua; Feng, Ming-Guang

    2015-01-01

    Transcriptional control of the cell cycle by forkhead (Fkh) transcription factors is likely associated with fungal adaptation to host and environment. Here we show that Fkh2, an ortholog of yeast Fkh1/2, orchestrates cell cycle and many cellular events of Beauveria bassiana, a filamentous fungal insect pathogen. Deletion of Fkh2 in B. bassiana resulted in dramatic down-regulation of the cyclin-B gene cluster and hence altered cell cycle (longer G2/M and S, but shorter G0/G1, phases) in unicel...

  13. Quantitative studies of the gastrin-producing cells of the human antrum. A methodological study

    DEFF Research Database (Denmark)

    Nielsen, H O; Halken, S; Lorentzen, M

    1980-01-01

    The antral gastrin-producing cells (G-cells) have been identified by the indirect immunoperoxidase technique in two antrum preparations removed due to a recurrent duodenal and gastric ulcer. Morphometric principles were applied to the G-cells with determination of their volume density, numerical ....... A method for estimating the total G-cell population and the total G-cell volume in the antrum was developed. In the antrum removed due to a gastric ulcer the number of G-cells was 190 x 10(6) and their total volume 176 mm3....

  14. Investigation of Antiangiogenic Tumor Therapy Potential of Microencapsulated HEK293 VEGF165b Producing Cells

    Directory of Open Access Journals (Sweden)

    Fatemeh Afkhami

    2010-01-01

    encapsulated and non-encapsulated cells was similar. The effect of VEGF165b harvested from encapsulated cells on Human Umbilical Vein Endothelial cells (HUVECs proliferation were also examined.The same inhibitory effects on HUVECs proliferation was seen when the cells were incubated with a mixture of VEGF165b and a 2-fold VEGF165b or with VEGF165b and 2-fold excess VEGF165b released from encapsulated cells. Subcutaneous injection of microencapsulated VEGF165b producing cells in tumor site of nude mice resulted in the reduction of the number of vessels around the tumors.

  15. Immune competence of the mammary gland as affected by somatic cell and pathogenic bacteria in ewes with subclinical mastitis.

    Science.gov (United States)

    Albenzio, M; Santillo, A; Caroprese, M; Ruggieri, D; Ciliberti, M; Sevi, A

    2012-07-01

    Immune competence of the ewe mammary gland was investigated by monitoring the leukocyte differential count, cytokine pattern, and endogenous proteolytic enzymes in milk samples with different somatic cell counts (SCC) and pathogenic bacteria. Furthermore, the leukocyte differential count and T-lymphocyte populations were evaluated in ewe blood. A total of 1,500 individual milk samples were randomly selected from the pool of the samples collected during sampling and grouped into 5 classes of 300 samples each, on the basis of SCC. Classes were 2,000,000 cells/mL. Microbiological analyses of ewe milk were conducted to detect mastitis-related pathogens. Sheep whose udders were without clinical abnormalities, and whose milk was apparently normal but with at least 10(3)cfu/mL of the same pathogen were considered to have subclinical mastitis and therefore defined as infected. Polymorphonuclear neutrophilic leukocytes (PMNL) and macrophages increased with SCC, whereas lymphocytes decreased. Milk samples with SCC >1,000,000 cells/mL showed differences in leukocyte populations between uninfected and infected ewes, with higher percentages of PMNL and macrophages and lower percentages of lymphocytes in infected animals. Nonviable PMNL levels were the highest in ewe milk samples with SCC 500,000 cells/mL, nonviable PMNL were higher in uninfected ewes than in infected ones. In infected animals giving milk with SCC >1,000,000 cells/mL, a higher CD4(+)/CD8(+) ratio was observed, suggesting that the presence of pathogens induced an activation of both CD4(+) and CD8(+). The levels of tumor necrosis factor-α and IL-12 were higher in infected than uninfected ewes, irrespective of SCC. Plasmin activity increased along with SCC and was always higher in infected than uninfected animals; cathepsin D increased starting from 1,001,000 cells/mL in milk samples from noninfected ewes and starting from 301,000 cells/mL in milk samples from infected animals. The associations between somatic

  16. Tc17 cells are a proinflammatory, plastic lineage of pathogenic CD8+ T cells that induce GVHD without antileukemic effects.

    Science.gov (United States)

    Gartlan, Kate H; Markey, Kate A; Varelias, Antiopi; Bunting, Mark D; Koyama, Motoko; Kuns, Rachel D; Raffelt, Neil C; Olver, Stuart D; Lineburg, Katie E; Cheong, Melody; Teal, Bianca E; Lor, Mary; Comerford, Iain; Teng, Michele W L; Smyth, Mark J; McCluskey, James; Rossjohn, Jamie; Stockinger, Brigitta; Boyle, Glen M; Lane, Steven W; Clouston, Andrew D; McColl, Shaun R; MacDonald, Kelli P A; Hill, Geoffrey R

    2015-09-24

    IL-17-producing cells are important mediators of graft-versus-host disease (GVHD) after allogeneic stem cell transplantation (SCT). Here we demonstrate that a distinct CD8(+) Tc17 population develops rapidly after SCT but fails to maintain lineage fidelity such that they are unrecognizable in the absence of a fate reporter. Tc17 differentiation is dependent on alloantigen presentation by host dendritic cells (DCs) together with IL-6. Tc17 cells express high levels of multiple prototypic lineage-defining transcription factors (eg, RORγt, T-bet) and cytokines (eg, IL-17A, IL-22, interferon-γ, granulocyte macrophage colony-stimulating factor, IL-13). Targeted depletion of Tc17 early after transplant protects from lethal acute GVHD; however, Tc17 cells are noncytolytic and fail to mediate graft-versus-leukemia (GVL) effects. Thus, the Tc17 differentiation program during GVHD culminates in a highly plastic, hyperinflammatory, poorly cytolytic effector population, which we term "inflammatory iTc17" (iTc17). Because iTc17 cells mediate GVHD without contributing to GVL, therapeutic inhibition of iTc17 development in a clinical setting represents an attractive approach for separating GVHD and GVL. PMID:26206951

  17. Assay of the multiple energy-producing pathways of mammalian cells.

    Directory of Open Access Journals (Sweden)

    Barry R Bochner

    Full Text Available BACKGROUND: To elucidate metabolic changes that occur in diabetes, obesity, and cancer, it is important to understand cellular energy metabolism pathways and their alterations in various cells. METHODOLOGY AND PRINCIPAL FINDINGS: Here we describe a technology for simultaneous assessment of cellular energy metabolism pathways. The technology employs a redox dye chemistry specifically coupled to catabolic energy-producing pathways. Using this colorimetric assay, we show that human cancer cell lines from different organ tissues produce distinct profiles of metabolic activity. Further, we show that murine white and brown adipocyte cell lines produce profiles that are distinct from each other as well as from precursor cells undergoing differentiation. CONCLUSIONS: This technology can be employed as a fundamental tool in genotype-phenotype studies to determine changes in cells from shared lineages due to differentiation or mutation.

  18. Cytotoxicity and DNA crosslinks produced by mitomycin analogs in aerobic and hypoxic EMT6 cells.

    Science.gov (United States)

    Keyes, S R; Loomis, R; DiGiovanna, M P; Pritsos, C A; Rockwell, S; Sartorelli, A C

    1991-01-01

    Several mitomycin antibiotics were evaluated for their capacities to kill EMT6 tumor cells and to produce DNA crosslinks under conditions of oxygenation and hypoxia. The agents examined included mitomycin C, porfiromycin, and the 7-aminomethyl dithioacetal derivative of mitomycin C (BMY-43324), all of which caused greater kill of hypoxic cells than of their oxygenated counterparts; the N,N'-dimethylaminomethylene derivative of mitomycin C (BMY-25282), which was considerably more cytotoxic under oxygenated conditions than in hypoxia; and the N,N'-dimethylaminomethylene derivative of porfiromycin (BL-6783), which was equal in its toxicity to hypoxic and oxygenated cells. All of these agents produced DNA crosslinks in EMT6 cells, as measured by alkaline elution. The number of crosslinks required to produce a given amount of cell kill was similar, regardless of the mitomycin employed or the degree of oxygenation, suggesting that the crosslinking of DNA was a major lesion in the cytodestructive action of the mitomycins. PMID:1760250

  19. Production of islet-like insulin-producing cell clusters in vitro from adipose-derived stem cells

    Directory of Open Access Journals (Sweden)

    Loan Thi-Tung Dang

    2015-01-01

    Full Text Available Diabetes mellitus is a high incidence disease that has increased rapidly in recent years. Many new therapies are being studied and developed in order to find an effective treatment. An ideal candidate is stem cell therapy. In this study, we investigated the differentiation of adipose derived stem cells (ADSCs into pseudo-islets in defined medium in vitro, to produce large quantities of insulin-producing cells (IPCs for transplantation. ADSCs isolated from adipose tissue were induced to differentiate into islet-like insulin-producing cell clusters in vitro by inducing medium DMEM/F12 containing nicotinamide, N2, B27, bFGF, and insulin-transferrin-selenite (ITS. Differentiated cells were analyzed for properties of IPCs, including storage of Zn2+ by dithizone staining, insulin production by ELISA and immunochemistry, and beta cell-related gene expression by reverse transcriptase PCR. The results showed that after 2 weeks of differentiation, the ADSCs aggregated into cell clusters, and after 4 weeks they formed islets, 50 and ndash;400 micrometers in diameter. These islet cells exhibited characteristics of pancreatic beta cells as they were positive for dithizone staining, expressed insulin in vitro and C-peptide in the cytoplasm, and expressed pancreatic beta cell-specific genes, including Pdx-1, NeuroD, and Ngn3. These results demonstrate that ADSCs can be used to produce a large number of functional islets for research as well as application. [Biomed Res Ther 2015; 2(1.000: 184-192

  20. The Chinese highly pathogenic porcine reproductive and respiratory syndrome virus infection suppresses Th17 cells response in vivo.

    Science.gov (United States)

    Zhang, Long; Zhou, Lei; Ge, Xinna; Guo, Xin; Han, Jun; Yang, Hanchun

    2016-06-30

    Porcine reproductive and respiratory syndrome virus (PRRSV) has been shown to immunomodulate innate and adaptive immunity of pigs. The Chinese highly pathogenic PRRSV (HP-PRRSV) infection causes severe bacterial secondary infection in pigs. However, the mechanism in relation to the bacterial secondary infection induced by HP-PRRSV remains unknown. In the present study, Th17 cells response in peripheral blood, lungs, spleens and lymph nodes of piglets were analyzed, and bacterial loads in lungs of piglets were examined upon HP-PRRSV infection. Meanwhile the changes of CD4(+) and CD8(+) T cells in peripheral blood of the inoculated piglets were analyzed. The results showed that HP-PRRSV-inoculated piglets exhibited a suppressed Th17 cells response in peripheral blood and a reduced number of Th17 cells in lungs, and higher bacterial loads in lungs, compared with low pathogenic PRRSV. Moreover, HP-PRRSV obviously resulted in severe depletion of porcine T cells in peripheral blood at the early stage of infection. These findings indicate that HP-PRRSV infection suppresses the response of Th17 cells that play an important role in combating bacterial infections, suggesting a possible correlation between the suppression of Th17 cells response in vivo and bacterial secondary infection induced by HP-PRRSV. Our present study adds a novel insight into better understanding of the pathogenesis of the Chinese HP-PRRSV. PMID:27259830

  1. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    Energy Technology Data Exchange (ETDEWEB)

    Su, Xin; Guan, Wuqiang; Yu, Yong-Chun; Fu, Yinghui, E-mail: fuyh@fudan.edu.cn

    2014-07-18

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1{sup +} or nestin{sup +} stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU{sup +} cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU{sup +} cells, very few are mash1{sup +} or nestin{sup +} stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1{sup +} microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition.

  2. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    International Nuclear Information System (INIS)

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1+ or nestin+ stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU+ cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU+ cells, very few are mash1+ or nestin+ stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1+ microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition

  3. Pathogen Sensors

    Directory of Open Access Journals (Sweden)

    Joseph Irudayaraj

    2009-10-01

    Full Text Available The development of sensors for detecting foodborne pathogens has been motivated by the need to produce safe foods and to provide better healthcare. However, in the more recent times, these needs have been expanded to encompass issues relating to biosecurity, detection of plant and soil pathogens, microbial communities, and the environment. The range of technologies that currently flood the sensor market encompass PCR and microarray-based methods, an assortment of optical sensors (including bioluminescence and fluorescence, in addition to biosensor-based approaches that include piezoelectric, potentiometric, amperometric, and conductometric sensors to name a few. More recently, nanosensors have come into limelight, as a more sensitive and portable alternative, with some commercial success. However, key issues affecting the sensor community is the lack of standardization of the testing protocols and portability, among other desirable elements, which include timeliness, cost-effectiveness, user-friendliness, sensitivity and specificity. [...

  4. Apoptotic effects on cultured cells of atmospheric-pressure plasma produced using various gases

    Science.gov (United States)

    Tominami, Kanako; Kanetaka, Hiroyasu; Kudo, Tada-aki; Sasaki, Shota; Kaneko, Toshiro

    2016-01-01

    This study investigated the effects of low-temperature atmospheric-pressure plasma on various cells such as rat fibroblastic Rat-1 cell line, rat neuroblastoma-like PC12 cell line, and rat macrophage-like NR8383 cell line. The plasma was irradiated directly to a culture medium containing plated cells for 0-20 s. The applied voltage, excitation frequency, and argon or helium gas flow were, respectively, 3-6 kV, 10 kHz, and 3 L/min. Cell viability and apoptotic activity were evaluated using annexin-V/propidium iodide staining. Results showed that the low-temperature atmospheric-pressure plasma irradiation promoted cell death in a discharge-voltage-dependent and irradiation-time-dependent manner. Furthermore, different effects are produced depending on the cell type. Moreover, entirely different mechanisms might be responsible for the induction of apoptosis in cells by helium and argon plasma.

  5. Pathogenic Role of NKT and NK Cells in Acetaminophen-Induced Liver Injury is Dependent on the Presence of DMSO

    OpenAIRE

    Masson, Mary Jane; Carpenter, Leah D.; Graf, Mary L.; Pohl, Lance R.

    2008-01-01

    Dimethyl sulfoxide (DMSO) is commonly used in biological studies to dissolve drugs and enzyme inhibitors with low solubility. While DMSO is generally thought of as being relatively inert, it can induce biological effects that are often overlooked. An example highlighting this potential problem is found in the recent report demonstrating a pathogenic role for NKT and NK cells in acetaminophen-induced liver injury (AILI) in C57Bl/6 mice in which DMSO was used to facilitate APAP dissolution. We ...

  6. Evaluation of a Rapid, Quantitative Real-Time PCR Method for Enumeration of Pathogenic Candida Cells in Water

    OpenAIRE

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one ...

  7. From the Cover: Cell-replacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells

    Science.gov (United States)

    Sapir, Tamar; Shternhall, Keren; Meivar-Levy, Irit; Blumenfeld, Tamar; Cohen, Hamutal; Skutelsky, Ehud; Eventov-Friedman, Smadar; Barshack, Iris; Goldberg, Iris; Pri-Chen, Sarah; Ben-Dor, Lya; Polak-Charcon, Sylvie; Karasik, Avraham; Shimon, Ilan; Mor, Eytan; Ferber, Sarah

    2005-05-01

    Shortage in tissue availability from cadaver donors and the need for life-long immunosuppression severely restrict the large-scale application of cell-replacement therapy for diabetic patients. This study suggests the potential use of adult human liver as alternate tissue for autologous beta-cell-replacement therapy. By using pancreatic and duodenal homeobox gene 1 (PDX-1) and soluble factors, we induced a comprehensive developmental shift of adult human liver cells into functional insulin-producing cells. PDX-1-treated human liver cells express insulin, store it in defined granules, and secrete the hormone in a glucose-regulated manner. When transplanted under the renal capsule of diabetic, immunodeficient mice, the cells ameliorated hyperglycemia for prolonged periods of time. Inducing developmental redirection of adult liver offers the potential of a cell-replacement therapy for diabetics by allowing the patient to be the donor of his own insulin-producing tissue. pancreas | transdifferentiation

  8. A Modified Method of Insulin Producing Cells’ Generation from Bone Marrow-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Paweł Czubak

    2014-01-01

    Full Text Available Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells’ transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs. In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs. We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors’ concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

  9. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells.

    Directory of Open Access Journals (Sweden)

    Tania S Quiroz

    Full Text Available The availability of the complete genome sequence of several Salmonella enterica serovars has revealed the presence of unstable genetic elements in these bacteria, such as pathogenicity islands and prophages. This is the case of Salmonella enterica serovar Enteritidis (S. Enteritidis, a bacterium that causes gastroenteritis in humans and systemic infection in mice. The whole genome sequence analysis for S. Enteritidis unveiled the presence of several genetic regions that are absent in other Salmonella serovars. These regions have been denominated "regions of difference" (ROD. In this study we show that ROD21, one of such regions, behaves as an unstable pathogenicity island. We observed that ROD21 undergoes spontaneous excision by two independent recombination events, either under laboratory growth conditions or during infection of murine cells. Importantly, we also found that one type of excision occurred at higher rates when S. Enteritidis was residing inside murine phagocytic cells. These data suggest that ROD21 is an unstable pathogenicity island, whose frequency of excision depends on the environmental conditions found inside phagocytic cells.

  10. Excision of an unstable pathogenicity island in Salmonella enterica serovar Enteritidis is induced during infection of phagocytic cells.

    Science.gov (United States)

    Quiroz, Tania S; Nieto, Pamela A; Tobar, Hugo E; Salazar-Echegarai, Francisco J; Lizana, Rodrigo J; Quezada, Carolina P; Santiviago, Carlos A; Araya, Daniela V; Riedel, Claudia A; Kalergis, Alexis M; Bueno, Susan M

    2011-01-01

    The availability of the complete genome sequence of several Salmonella enterica serovars has revealed the presence of unstable genetic elements in these bacteria, such as pathogenicity islands and prophages. This is the case of Salmonella enterica serovar Enteritidis (S. Enteritidis), a bacterium that causes gastroenteritis in humans and systemic infection in mice. The whole genome sequence analysis for S. Enteritidis unveiled the presence of several genetic regions that are absent in other Salmonella serovars. These regions have been denominated "regions of difference" (ROD). In this study we show that ROD21, one of such regions, behaves as an unstable pathogenicity island. We observed that ROD21 undergoes spontaneous excision by two independent recombination events, either under laboratory growth conditions or during infection of murine cells. Importantly, we also found that one type of excision occurred at higher rates when S. Enteritidis was residing inside murine phagocytic cells. These data suggest that ROD21 is an unstable pathogenicity island, whose frequency of excision depends on the environmental conditions found inside phagocytic cells.

  11. Thymoproteasomes produce unique peptide motifs for positive selection of CD8(+) T cells.

    Science.gov (United States)

    Sasaki, Katsuhiro; Takada, Kensuke; Ohte, Yuki; Kondo, Hiroyuki; Sorimachi, Hiroyuki; Tanaka, Keiji; Takahama, Yousuke; Murata, Shigeo

    2015-01-01

    Positive selection in the thymus provides low-affinity T-cell receptor (TCR) engagement to support the development of potentially useful self-major histocompatibility complex class I (MHC-I)-restricted T cells. Optimal positive selection of CD8(+) T cells requires cortical thymic epithelial cells that express β5t-containing thymoproteasomes (tCPs). However, how tCPs govern positive selection is unclear. Here we show that the tCPs produce unique cleavage motifs in digested peptides and in MHC-I-associated peptides. Interestingly, MHC-I-associated peptides carrying these tCP-dependent motifs are enriched with low-affinity TCR ligands that efficiently induce the positive selection of functionally competent CD8(+) T cells in antigen-specific TCR-transgenic models. These results suggest that tCPs contribute to the positive selection of CD8(+) T cells by preferentially producing low-affinity TCR ligand peptides.

  12. New method to differentiate human peripheral blood monocytes into insulin producing cells: Human hematosphere culture.

    Science.gov (United States)

    Hur, Jin; Yang, Ji Min; Choi, Jae-Il; Yun, Ji-Yeon; Jang, Jae Hee; Kim, Joonoh; Kim, Ju-Young; Oh, Il-Young; Yoon, Chang-Hwan; Cho, Hyun-Jai; Park, Young-Bae; Kim, Hyo-Soo

    2012-02-24

    Strategy to differentiate stem cells into insulin producing cells (IPCs) in vitro has been a promising one to get cell source of β-cell replacement therapy for diabetes. It has been suggested that islets and neurons share features and nestin-positive cells could differentiate into IPCs. We have recently developed a three-dimensional culture system using human peripheral blood cells named as blood-born hematosphere (BBHS). Here we showed that most of BBHS were composed of nestin-positive cells. Under the four-stage differentiation protocol for IPCs, we plated nestin-positive BBHS onto fibronectin-coated dish. These cells form islet-like clusters and most of them expressed insulin. Pancreatic specific genes were turned on, such as transcription factors (Pdx-1, Ngn3 and Nkx6.1), genes related to endocrine function (Glut-2 and PC2) or β cell function (Kir6.2, SUR1). Furthermore islet differentiation was confirmed by dithizone (DTZ) staining to detect zinc ion which binds insulin protein within the cells. Finally, IPCs derived from BBHS showed capability to secrete insulin in response to glucose stimulation. Taken together, our novel protocol successfully induced islet-like human insulin producing cells out of BBHS. This strategy of ex vivo expansion of IPCs using BBHS provides an autologous therapeutic cell source for the treatment of diabetes. PMID:22310720

  13. CCR6 marks regulatory T cells as a colon-tropic, interleukin-10-producing phenotype1

    OpenAIRE

    Kitamura, Kazuya; Farber, Joshua M; Kelsall, Brian L.

    2010-01-01

    Expression of CCR6 and its ligand, CCL20, are increased in the colon of humans with inflammatory bowel diseases and mice with experimental colits, however their role in disease pathogenesis remains obscure. Here we demonstrate a role for CCR6 on regulatory T (Treg)3 cells in the T cell-transfer model of colitis. Rag2−/− mice given Ccr6−/− CD4+CD45RBhigh T cells had more severe colitis with increased IFN-γ-producing T cells, compared to the mice given WT cells. While equivalent frequency of in...

  14. Generation of Insulin-Producing Human Mesenchymal Stem Cells Using Recombinant Adeno-Associated Virus

    OpenAIRE

    Kim, Jeong Hwan; Park, Si-Nae; Suh, Hwal

    2007-01-01

    The purpose of current experiment is the generation of insulin-producing human mesenchymal stem cells as therapeutic source for the cure of type 1 diabetes. Type 1 diabetes is generally caused by insulin deficiency accompanied by the destruction of islet β-cells. In various trials for the treatment of type 1 diabetes, cell-based gene therapy using stem cells is considered as one of the most useful candidate for the treatment. In this experiment, human mesenchymal stem cells were transduced wi...

  15. Lung adenocarcinoma with clear cell features producing carbohydrate antigen 19-9.

    Science.gov (United States)

    Goto, Taichiro; Hada, Masao; Oyama, Toshio

    2015-10-01

    A 76-year-old man underwent surgery for lung cancer. Histopathologically, most of the resected tumor was composed of polygonal cells with foamy cytoplasm, and the cells were arranged predominantly in acinar patterns. In this case, although the carbohydrate antigen 19-9 level was high before surgery, it normalized after resection. The tumor was considered a carbohydrate antigen 19-9-producing tumor, which was further supported by the results of immunohistochemical analysis. Adenocarcinoma with clear cell features, producing carbohydrate antigen 19-9, is an exceedingly rare entity.

  16. Effects of Supplementation of Various Medium Components on Chinese Hamster Ovary Cell Cultures Producing Recombinant Antibody

    OpenAIRE

    Kim, Do Yun; Lee, Joon Chul; Chang, Ho Nam; Oh, Duk Jae

    2005-01-01

    Thirteen vitamins, twenty amino acids, hormones, inorganic salts, and other chemical agents, which constitute typical serum-free media, were evaluated for the development of fortified medium to enhance cell growth and productivity of recombinant antibody in the cultures of the recombinant Chinese hamster ovary (rCHO) cells. Two different rCHO cell lines, rCHO-A producing recombinant antibodies against the human platelet and rCHO-B secreting recombinant antibodies against the S surface antigen...

  17. Detection of PIVKA II produced by human hepatoma cells in nude mice.

    Science.gov (United States)

    Kohda, H; Ono, M; Sekiya, C; Ohta, H; Ohhira, M; Ohhira, M; Yoshida, Y; Ikeda, N; Namiki, M

    1991-03-01

    A novel experimental nude mouse model, which is useful for investigation of the mechanisms of PIVKA II synthesis, was established by inoculation with PIVKA II-producing human hepatoma cells (huH-1). We have found markedly elevated levels of PIVKA II in the plasma of nude mice transplanted with huH-1 cells and increased PIVKA II content in huH-1 tumor tissues. Whereas we have not found detectable level of PIVKA II neither in the plasma nor in tumor tissues of nude mice transplanted different human hepatoma cells (HLF) which is not producing PIVKA II. Histology of the tumor tissues produced by huH-1 cells revealed a thick trabecular pattern with blood spaces.

  18. Visualization and identification of IL-7 producing cells in reporter mice.

    Directory of Open Access Journals (Sweden)

    Renata I Mazzucchelli

    Full Text Available Interleukin-7 (IL-7 is required for lymphocyte development and homeostasis although the actual sites of IL-7 production have never been clearly identified. We produced a bacterial artificial chromosome (BAC transgenic mouse expressing ECFP in the Il7 locus. The construct lacked a signal peptide and ECFP (enhanced cyan fluorescent protein accumulated inside IL-7-producing stromal cells in thoracic thymus, cervical thymus and bone marrow. In thymus, an extensive reticular network of IL-7-containing processes extended from cortical and medullary epithelial cells, closely contacting thymocytes. Central memory CD8 T cells, which require IL-7 and home to bone marrow, physically associated with IL-7-producing cells as we demonstrate by intravital imaging.

  19. Dynamic regulation of effector IFN-γ-producing and IL-17-producing T cell subsets in the development of acute graft-versus-host disease.

    Science.gov (United States)

    Zhao, Kai; Ruan, Suhong; Yin, Lingling; Zhao, Dongmei; Chen, Chong; Pan, Bin; Zeng, Lingyu; Li, Zhenyu; Xu, Kailin

    2016-02-01

    Graft-versus-host disease (GVHD) as the predominant complication of allogeneic hematopoietic stem cell transplantation remains to be fully understood. It is known that the cytokines produced by allogeneic reactive effector CD4+ and CD8+ T cells are involved in GVHD. However, the regulation and coordination of IFN-γ-producing and IL-17-producing effector T cells remain unclear. The present study aimed to investigate the dynamic changes of alloantigen-specific effector CD4+ T and CD8+ T cell subsets by flow cytometry, which produce inflammatory cytokines involved in the multistep GVHD pathogenesis progress. The results demonstrated that IL-17-producing CD8+ T (Tc17) cells and IFN-γ+CD8+ T (Tc1) cells were detected in the early stage of GVHD. The differentiation of CD4+ T cells into Th1 cell (IFN-γ+CD4+ T) and Th17 (IL-17+CD4+ T) cells was later than that of the Tc1 and Tc17 cells. The effector CD4+ T and CD8+ T cell subsets either became exhausted or became memory cells, exhibiting a CD62L-CD44+ phenotype following marked expansion during GVHD. Furthermore, T cell-associated type I (IL-2 and IFN-γ) and type II (IL-4 and IL-10) classical cytokines exhibited coordinated dynamic regulation. It was concluded that the differentiation of cytokine-producing Tc1 and Tc17 cells may be the key step in the initiation of GVHD, whereas CD4+ effector Th1 and Th17 cells are considered to be pathophysiological factors leading to the continuous aggravation of GVHD. PMID:26647759

  20. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

    LENUS (Irish Health Repository)

    Sibartie, Shomik

    2009-01-01

    BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

  1. In vitro pancreas duodenal homeobox-1 enhances the differentiation of pancreatic ductal epithelial cells into insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To observe whether pancreatic and duodenal homeobox factor-1 enhances the differentiation of pancreatic ductal epithelial cells into insulin-producing cells in vitro.METHODS: Rat pancreatic tissue was submitted to digestion by collegenase, ductal epithelial cells were separated by density gradient centrifugation and then cultured in RPMI1640 medium with 10% fetal bovine serum. After 3-5 passages, the cells were incubated in a six-well plate for 24 h before transfection of recombination plasmid XIHbox8VP16. Lightcycler quantitative real-time RT-PCR was used to detect the expression of PDX-1 and insulin mRNA in pancreatic epithelial cells. The expression of PDX-1 and insulin protein was analyzed by Western blotting. Insulin secretion was detected by radioimmunoassay. Insulinproducing cells were detected by dithizone-staining.RESULTS: XIHbox8 mRNA was expressed in pancreatic ductal epithelial cells. PDX-1 and insulin mRNA as well as PDX-1 and insulin protein were significantly increased in the transfected group. The production and insulin secretion of insulin-producing cells differentiated from pancreatic ductal epithelial cells were higher than those of the untransfected cells in vitro with a significant difference (1.32 ± 0.43 vs 3.48 ± 0.81, P < 0.01 at 5.6 mmol/L; 4.86 ± 1.15 vs 10.25 ± 1.32, P < 0.01 at 16.7 mmol/L).CONCLUSION: PDX-1 can differentiate rat pancreatic ductal epithelial cells into insulin-producing cells in vitro.In vitro PDX-1 transfection is a valuable strategy for increasing the source of insulin-producing cells.

  2. Staphylococcus aureus produces membrane-derived vesicles that induce host cell death.

    Directory of Open Access Journals (Sweden)

    Mamata Gurung

    Full Text Available Gram-negative bacteria produce outer membrane vesicles that play a role in the delivery of virulence factors to host cells. However, little is known about the membrane-derived vesicles (MVs produced by gram-positive bacteria. The present study examined the production of MVs from Staphylococcus aureus and investigated the delivery of MVs to host cells and subsequent cytotoxicity. Four S. aureus strains tested, two type strains and two clinical isolates, produced spherical nanovesicles during in vitro culture. MVs were also produced during in vivo infection of a clinical S. aureus isolate in a mouse pneumonia model. Proteomic analysis showed that 143 different proteins were identified in the S. aureus-derived MVs. S. aureus MVs were interacted with the plasma membrane of host cells via a cholesterol-rich membrane microdomain and then delivered their component protein A to host cells within 30 min. Intact S. aureus MVs induced apoptosis of HEp-2 cells in a dose-dependent manner, whereas lysed MVs neither delivered their component into the cytosol of host cells nor induced cytotoxicity. In conclusion, this study is the first report that S. aureus MVs are an important vehicle for delivery of bacterial effector molecules to host cells.

  3. Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells

    Science.gov (United States)

    Zalzman, Michal; Gupta, Sanjeev; Giri, Ranjit K.; Berkovich, Irina; Sappal, Baljit S.; Karnieli, Ohad; Zern, Mark A.; Fleischer, Norman; Efrat, Shimon

    2003-06-01

    Beta-cell replacement is considered to be the most promising approach for treatment of type 1 diabetes. Its application on a large scale is hindered by a shortage of cells for transplantation. Activation of insulin expression, storage, and regulated secretion in stem/progenitor cells offers novel ways to overcome this shortage. We explored whether fetal human progenitor liver cells (FH) could be induced to differentiate into insulin-producing cells after expression of the pancreatic duodenal homeobox 1 (Pdx1) gene, which is a key regulator of pancreatic development and insulin expression in beta cells. FH cells possess a considerable replication capacity, and this was further extended by introduction of the gene for the catalytic subunit of human telomerase. Immortalized FH cells expressing Pdx1 activated multiple beta-cell genes, produced and stored considerable amounts of insulin, and released insulin in a regulated manner in response to glucose. When transplanted into hyperglycemic immunodeficient mice, the cells restored and maintained euglycemia for prolonged periods. Quantitation of human C-peptide in the mouse serum confirmed that the glycemia was normalized by the transplanted human cells. This approach offers the potential of a novel source of cells for transplantation into patients with type 1 diabetes.

  4. Liver dendritic cells present bacterial antigens and produce cytokines upon Salmonella encounter.

    Science.gov (United States)

    Johansson, Cecilia; Wick, Mary Jo

    2004-02-15

    The capacity of murine liver dendritic cells (DC) to present bacterial Ags and produce cytokines after encounter with Salmonella was studied. Freshly isolated, nonparenchymal liver CD11c(+) cells had heterogeneous expression of MHC class II and CD11b and a low level of CD40 and CD86 expression. Characterization of liver DC subsets revealed that CD8alpha(-)CD4(-) double negative cells constituted the majority of liver CD11c(+) ( approximately 85%) with few cells expressing CD8alpha or CD4. Flow cytometry analysis of freshly isolated CD11c(+) cells enriched from the liver and cocultured with Salmonella expressing green fluorescent protein (GFP) showed that CD11c(+) MHC class II(high) cells had a greater capacity to internalize Salmonella relative to CD11c(+) MHC class II(low) cells. Moreover, both CD8alpha(-) and CD8alpha(+) liver DC internalized bacteria with similar efficiency after both in vitro and in vivo infection. CD11c(+) cells enriched from the liver could also process Salmonella for peptide presentation on MHC class I and class II to primary, Ag-specific T cells after internalization requiring actin cytoskeletal rearrangements. Flow cytometry analysis of liver CD11c(+) cells infected with Salmonella expressing GFP showed that both CD8alpha(-) and CD8alpha(+) DC produced IL-12p40 and TNF-alpha. The majority of cytokine-positive cells did not contain bacteria (GFP(-)) whereas only a minor fraction of cytokine-positive cells were GFP(+). Furthermore, only approximately 30-50% of liver DC containing bacteria (GFP(+)) produced cytokines. Thus, liver DC can internalize and process Salmonella for peptide presentation to CD4(+) and CD8(+) T cells and elicit proinflammatory cytokine production upon Salmonella encounter, suggesting that DC in the liver may contribute to immunity against hepatotropic bacteria.

  5. In vitro cultivation of human fetal pancreatic ductal stem cells and their differentiation into insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Zhong-Xiang Yao; Mao-Lin Qin; Jian-Jun Liu; Xing-Shu Chen; De-Shan Zhou

    2004-01-01

    AIM: To isolate, culture and identify the human fetal pancreatic ductal stem cells in vitro, and to observe the potency of these multipotential cells differentiation into insulin-producing cells.METHODS: The human fetal pancreas was digested by 1 g/L collagease type Ⅳ and then 2.5 g/L trypsin was used to isolate the pancreatic ducta stem cells, followed by culture in serum-free, glucose-free DMEM media with some additional chemical substrates in vitro (according to the different Stage). The cells were induced by glucose-free (control),5 mmol/L, 17.8 mmol/L and 25 mmol/L glucose, respectively.The cell types of differentiated cells were identified using immunocytochemical staining.RESULTS: The shape of human fetal pancreatic ductal stem cells culturedin vitro was firstly fusiform in the first 2 wk,and became monolayer and cobblestone pattern after another 3 to 4 wk. After induced and differentiated by the glucose of different concentrations for another 1 to 2 wk,the cells formed the pancreatic islet-like structures. The identification and potency of these cells were then identified by using the pancreatic ductal stem cell marker, cytokeratin-19 (CK-19), pancreatic β cell marker, insulin and pancreatic α cell marker, glucagons with immunocytochemical staining.At the end of the second week, 95.2% of the cells were positive for CK-19 immunoreactivity. Up to 22.7% of the cells induced by glucose were positive for insulin immunoreactivity, and less than 3.8% of the cells were positive for glucagon immunoreactivity in pancreatic isletlike structures. The positive ratio of immunoreactive staining was dependent on the concentration of glucose, and it was observed that the 17.8 mmol/L glucose stimulated effectively to produce insulin- and glucagons-producing cells.CONCLUSION: The human fetal pancreatic ductal stem cells are capable of proliferation in vitro. These cells have multidifferentiation potential and can be induced by glucose and differentiated into insulin-producing

  6. Programmed cell death in barley aleurone cells is not directly stimulated by reactive oxygen species produced in response to gibberellin.

    Science.gov (United States)

    Aoki, Nozomi; Ishibashi, Yushi; Kai, Kyohei; Tomokiyo, Reisa; Yuasa, Takashi; Iwaya-Inoue, Mari

    2014-05-01

    The cereal aleurone layer is a secretory tissue that produces enzymes to hydrolyze the starchy endosperm during germination. We recently demonstrated that reactive oxygen species (ROS), produced in response to gibberellins (GA), promoted GAMyb expression, which induces α-amylase expression in barley aleurone cells. On the other hand, ROS levels increase during programmed cell death (PCD) in barley aleurone cells, and GAMyb is involved in PCD of these cells. In this study, we investigated whether the ROS produced in response to GA regulate PCD directly by using mutants of Slender1 (SLN1), a DELLA protein that negatively regulates GA signaling. The wild-type, the sln1c mutant (which exhibits gibberellin-type signaling even in the absence of GA), and the Sln1d mutant (which is gibberellin-insensitive with respect to α-amylase production) all produced ROS in response to GA, suggesting that ROS production in aleurone cells in response to GA is independent of GA signaling through this DELLA protein. Exogenous GA promoted PCD in the wild-type. PCD in sln1c was induced even without exogenous GA (and so without induction of ROS), whereas PCD in Sln1d was not induced in the presence of exogenous GA, even though the ROS content increased significantly in response to GA. These results suggest that PCD in barley aleurone cells is not directly stimulated by ROS produced in response to GA but is regulated by GA signaling through DELLA protein.

  7. Genetic correlations between pathogen-specific mastitis and somatic cell count in Danish Holsteins

    DEFF Research Database (Denmark)

    Sørensen, Lars Peter; Mark, Thomas; Madsen, P.;

    2009-01-01

    _170) or 300 d (LASCC_300) after calving, and the mastitis traits were unspecific mastitis (all mastitis treatments, both clinical and subclinical, regardless of the causative pathogen) and mastitis caused by either Streptococcus dysgalactiae, Escherichia coli, coagulase-negative staphylococci (CNS......, especially for Strep. uberis, Strep. dysgalactiae, and CNS and, to a lesser extent, for Staph. aureus and E. coli. Data recording should preferably be improved, and economic weights for the pathogen-specific mastitis traits should be estimated before implementing an udder health index that includes pathogen....... uberis, and E. coli (r(a) = 0.54 to 0.69) and were lowest for Staph. aureus mastitis (r(a) = 0.44). The genetic correlation between LASCC_300 and the mastitis traits were generally smaller (r(a) = 0.47 to 0.69). Caution should be taken when interpreting the results, however, because some posterior...

  8. Eugenol alters the integrity of cell membrane and acts against the nosocomial pathogen Proteus mirabilis.

    Science.gov (United States)

    Devi, K Pandima; Sakthivel, R; Nisha, S Arif; Suganthy, N; Pandian, S Karutha

    2013-03-01

    Eugenol, a member of the phenylpropanoids class of chemical compounds, is a clear to pale yellow oily liquid extracted from certain essential oils especially from clove oil, nutmeg, cinnamon, and bay leaf. The antibacterial activity of eugenol and its mechanism of bactericidal action against Proteus mirabilis were evaluated. Treatment with eugenol at their minimum inhibitory concentration [0.125 % (v/v)] and minimum bactericidal concentration [0.25 % (v/v)] reduced the viability and resulted in complete inhibition of P. mirabilis. A strong bactericidal effect on P. mirabilis was also evident, as eugenol inactivated the bacterial population within 30 min exposure. Chemo-attractant property and the observance of highest antibacterial activity at alkaline pH suggest that eugenol can work more effectively when given in vivo. Eugenol inhibits the virulence factors produced by P. mirabilis as observed by swimming motility, swarming behavior and urease activity. It interacts with cellular membrane of P. mirabilis and makes it highly permeable, forming nonspecific pores on plasma membrane, which in turn directs the release of 260 nm absorbing materials and uptake of more crystal violet from the medium into the cells. SDS-polyacrylamide gel, scanning electron microscopy and Fourier transform infrared analysis further proves the disruptive action of eugenol on the plasma membrane of P. mirabilis. The findings reveal that eugenol shows an excellent bactericidal activity against P. mirabilis by altering the integrity of cell membrane. PMID:23444040

  9. Reactive oxygen species-dependent necroptosis in Jurkat T cells induced by pathogenic free-living Naegleria fowleri.

    Science.gov (United States)

    Song, K-J; Jang, Y S; Lee, Y A; Kim, K A; Lee, S K; Shin, M H

    2011-07-01

    Naegleria fowleri, a free-living amoeba, is the causative pathogen of primary amoebic meningoencephalitis in humans and experimental mice. N. fowleri is capable of destroying tissues and host cells through lytic necrosis. However, the mechanism by which N. fowleri induces host cell death is unknown. Electron microscopy indicated that incubation of Jurkat T cells with N. fowleri trophozoites induced necrotic morphology of the Jurkat T cells. N. fowleri also induced cytoskeletal protein cleavage, extensive poly (ADP-ribose) polymerase hydrolysis and lactate dehydrogenase (LDH) release. Although no activation of caspase-3 was observed in Jurkat T cells co-incubated with amoebae, intracellular reactive oxygen species (ROS) were strongly generated by NADPH oxidase (NOX). Pretreating cells with necroptosis inhibitor necrostatin-1 or NOX inhibitor diphenyleneiodonium chloride (DPI) strongly inhibited amoeba-induced ROS generation and Jurkat cell death, whereas pan-caspase inhibitor z-VAD-fmk did not. N. fowleri-derived secretory products (NfSP) strongly induced intracellular ROS generation and cell death. Necroptotic effects of NfSP were effectively inhibited by pretreating NfSP with proteinase K. Moreover, NfSP-induced LDH release and intracellular ROS accumulation were inhibited by pretreating Jurkat T cells with DPI or necrostatin-1. These results suggest that N. fowleri induces ROS-dependent necroptosis in Jurkat T cells.

  10. Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

    Directory of Open Access Journals (Sweden)

    Juliana Branco Novo

    2012-01-01

    Full Text Available Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher’s patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr− cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa and secreted (63–69 kDa form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources.

  11. Clonally expanded CD4+ T cells can produce infectious HIV-1 in vivo.

    Science.gov (United States)

    Simonetti, Francesco R; Sobolewski, Michele D; Fyne, Elizabeth; Shao, Wei; Spindler, Jonathan; Hattori, Junko; Anderson, Elizabeth M; Watters, Sarah A; Hill, Shawn; Wu, Xiaolin; Wells, David; Su, Li; Luke, Brian T; Halvas, Elias K; Besson, Guillaume; Penrose, Kerri J; Yang, Zhiming; Kwan, Richard W; Van Waes, Carter; Uldrick, Thomas; Citrin, Deborah E; Kovacs, Joseph; Polis, Michael A; Rehm, Catherine A; Gorelick, Robert; Piatak, Michael; Keele, Brandon F; Kearney, Mary F; Coffin, John M; Hughes, Stephen H; Mellors, John W; Maldarelli, Frank

    2016-02-16

    Reservoirs of infectious HIV-1 persist despite years of combination antiretroviral therapy and make curing HIV-1 infections a major challenge. Most of the proviral DNA resides in CD4(+)T cells. Some of these CD4(+)T cells are clonally expanded; most of the proviruses are defective. It is not known if any of the clonally expanded cells carry replication-competent proviruses. We report that a highly expanded CD4(+) T-cell clone contains an intact provirus. The highly expanded clone produced infectious virus that was detected as persistent plasma viremia during cART in an HIV-1-infected patient who had squamous cell cancer. Cells containing the intact provirus were widely distributed and significantly enriched in cancer metastases. These results show that clonally expanded CD4(+)T cells can be a reservoir of infectious HIV-1.

  12. Human CD141+ DCs induce CD4+ T cells to produce type 2 cytokines1

    Science.gov (United States)

    Yu, Chun I; Becker, Christian; Metang, Patrick; Marches, Florentina; Wang, Yuanyuan; Toshiyuki, Hori; Banchereau, Jacques; Merad, Miriam; Palucka, Karolina

    2014-01-01

    Dendritic cells (DCs) play the central role in the priming of naïve T cells and the differentiation of unique effector T cells. Here, using lung tissues and blood from both humans and humanized mice, we analyzed the response of human CD1c+ and CD141+ DC subsets to live-attenuated influenza virus (LAIV). Specifically, we analyzed the type of CD4+ T cell immunity elicited by LAIV-exposed DCs. Both DC subsets induce proliferation of allogeneic naïve CD4+ T cells with capacity to secrete IFN-γ. However, CD141+ DCs are uniquely able to induce the differentiation of IL-4 and IL-13 producing CD4+ T cells. CD141+ DCs induce IL-4 and IL-13 secreting CD4+ T cells through OX40L. Thus, CD141+ DCs demonstrate remarkable plasticity in guiding adaptive immune responses. PMID:25246496

  13. In vitro cell cultures obtained from different explants of Corylus avellana produce Taxol and taxanes

    Directory of Open Access Journals (Sweden)

    Cavalli Francesca

    2006-12-01

    Full Text Available Abstract Background Taxol is an effective antineoplastic agent, originally extracted from the bark of Taxus brevifolia with a low yield. Many attempts have been made to produce Taxol by chemical synthesis, semi-synthesis and plant tissue cultures. However, to date, the availability of this compound is not sufficient to satisfy the commercial requirements. The aim of the present work was to produce suspension cell cultures from plants not belonging to Taxus genus and to verify whether they produced Taxol and taxanes. For this purpose different explants of hazel (Corylus avellana species were used to optimize the protocol for inducing in vitro callus, an undifferentiated tissue from which suspension cell cultures were established. Results Calli were successfully induced from stems, leaves and seeds grown in various hormone concentrations and combinations. The most suitable callus to establish suspension cell cultures was obtained from seeds. Media recovered from suspension cell cultures contained taxanes, and showed antiproliferative activity on human tumour cells. Taxol, 10-deacetyltaxol and 10-deacetylbaccatin III were the main taxanes identified. The level of Taxol recovered from the media of hazel cultures was similar to that found in yew cultures. Moreover, the production of taxanes in hazel cell cultures increased when elicitors were used. Conclusion Here we show that hazel cell cultures produce Taxol and taxanes under controlled conditions. This result suggests that hazel possesses the enzymes for Taxol production, which until now was considered to be a pathway particular to Taxus genus. The main benefit of producing taxanes through hazel cell cultures is that hazel is widely available, grows at a much faster rate in vivo, and is easier to cultivate in vitro than yew. In addition, the production of callus directly from hazel seeds shortens the culture time and minimizes the probability of contamination. Therefore, hazel could become a

  14. Host cell capable of producing enzymes useful for degradation of lignocellulosic material

    Science.gov (United States)

    Los, Alrik Pieter; Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Damveld, Robbertus Antonius

    2015-08-18

    The invention relates to a host cell comprising at least four different heterologous polynucleotides chosen from the group of polynucleotides encoding cellulases, hemicellulases and pectinases, wherein the host cell is capable of producing the at least four different enzymes chosen from the group of cellulases, hemicellulases and pectinases, wherein the host cell is a filamentous fungus and is capable of secretion of the at least four different enzymes. This host cell can suitably be used for the production of an enzyme composition that can be used in a process for the saccharification of cellulosic material.

  15. Platelet activating factor produced in vitro by Kaposi's sarcoma cells induces and sustains in vivo angiogenesis.

    OpenAIRE

    Bussolino, F.; Arese, M; Montrucchio, G; Barra, L; Primo, L; Benelli, R; Sanavio, F; M. Aglietta; Ghigo, D; Rola-Pleszczynski, M R

    1995-01-01

    Imbalance in the network of soluble mediators may play a pivotal role in the pathogenesis of Kaposi's sarcoma (KS). In this study, we demonstrated that KS cells grown in vitro produced and in part released platelet activating factor (PAF), a powerful lipid mediator of inflammation and cell-to-cell communication. IL-1, TNF, and thrombin enhanced the synthesis of PAF. PAF receptor mRNA and specific, high affinity binding site for PAF were present in KS cells. Nanomolar concentration of PAF stim...

  16. Differentiation of embryonic stem cells into insulin-producing cells promoted by Nkx2.2 gene transfer

    Institute of Scientific and Technical Information of China (English)

    Akira Shiroi; Shigehiko Ueda; Yukiteru Ouji; Ko Saito; Kei Moriya; Yuko Sugie; Hiroshi Fukui; Shigeaki Ishizaka; Masahide Yoshikawa

    2005-01-01

    AIM: To investigate the ability of a genetically altered embryonic stem (ES) cell line to generate insulin-producing cells in vitro following transfer of the Nkx2.2 gene.METHODS: Hamster Nkx2.2 genes were transferred into mouse ES cells. Parental and Nkx2.2-transfected ES cells were initiated toward differentiation in embryoid body (EB)culture for 5 d and the resulting EBs were transferred to an attached culture system. Dithizone (DTZ), a zincchelating agent known to selectively stain pancreatic beta cells, was used to detect insulin-producing cells.The outgrowths were incubated in DTZ solution (final concentration, 100 μg/mL) for 15 min before being examined microscopically. Gene expression of the endocrine pancreatic markers was also analyzed by RT-PCR. In addition, insulin production was determined immunohistochemically and its secretion was examined using an ELISA.RESULTS: DTZ-stained cellular clusters appeared after approximately 14 d in the culture of Nkx2.2-transfected ES cells (Nkx-ES cells), which was as much as 2 wk earlier, than those in the culture of parental ES cells (wt-ES). The frequency of DTZ-positive cells among total cultured cells on day 28 accounted for approximately 1.0% and 0.1% of the Nkx-ES- and wt-ES-derived EB outgrowths, respectively. The DTZ-positive cellular clusters were found to be immunoreactive to insulin, while the gene expressions of pancreatic-duodenal homeobox 1(PDX1), proinsulin 1 and proinsulin 2 were observed in the cultures that contained DTZ-positive cellular clusters.Insulin secretion was also confirmed by ELISA, whereas glucose-dependent secretion was not demonstrated.CONCLUSION: Nkx2.2-transfected ES cells showed an ability to differentiate into insulin-producing cells.

  17. What makes pathogens pathogenic

    OpenAIRE

    Ehrlich, Garth D.; Hiller, N.Luisa; Hu, Fen Ze

    2008-01-01

    Metazoans contain multiple complex microbial ecosystems in which the balance between host and microbe can be tipped from commensalism to pathogenicity. This transition is likely to depend both on the prevailing environmental conditions and on specific gene-gene interactions placed within the context of the entire ecosystem.

  18. Cells that emerge from embryonic explants produce fibers of type IV collagen.

    Science.gov (United States)

    Chen, J M; Little, C D

    1985-10-01

    Double immunofluorescence staining experiments designed to examine the synthesis and deposition of collagen types I and IV in cultured explants of embryonic mouse lung revealed the presence of connective tissue-like fibers that were immunoreactive with anti-type IV collagen antibodies. This observation is contrary to the widely accepted belief that type IV collagen is found only in sheet-like arrangements beneath epithelia or as a sheath-like layer enveloping bundles of nerve or muscle cells. The extracellular matrix produced by cells that migrate from embryonic mouse lung rudiments in vitro was examined by double indirect immunofluorescence microscopy. Affinity-purified monospecific polyclonal antibodies were used to examine cells after growth on glass or native collagen substrata. The data show that embryonic mesenchymal cells can produce organized fibers of type IV collagen that are not contained within a basement membrane, and that embryonic epithelial cells deposit fibers and strands of type IV collagen beneath their basal surface when grown on glass; however, when grown on a rat tail collagen substratum the epithelial cells produce a fine meshwork. To our knowledge this work represents the first report that type IV collagen can be organized by cells into a fibrous extracellular matrix that is not a basement membrane.

  19. Ebola virus-like particles produced in insect cells exhibit dendritic cell stimulating activity and induce neutralizing antibodies

    International Nuclear Information System (INIS)

    Recombinant baculoviruses (rBV) expressing Ebola virus VP40 (rBV-VP40) or GP (rBV-GP) proteins were generated. Infection of Sf9 insect cells by rBV-VP40 led to assembly and budding of filamentous particles from the cell surface as shown by electron microscopy. Ebola virus-like particles (VLPs) were produced by coinfection of Sf9 cells with rBV-VP40 and rBV-GP, and incorporation of Ebola GP into VLPs was demonstrated by SDS-PAGE and Western blot analysis. Recombinant baculovirus infection of insect cells yielded high levels of VLPs, which were shown to stimulate cytokine secretion from human dendritic cells similar to VLPs produced in mammalian cells. The immunogenicity of Ebola VLPs produced in insect cells was evaluated by immunization of mice. Analysis of antibody responses showed that most of the GP-specific antibodies were of the IgG2a subtype, while no significant level of IgG1 subtype antibodies specific for GP was induced, indicating the induction of a Th1-biased immune response. Furthermore, sera from Ebola VLP immunized mice were able to block infection by Ebola GP pseudotyped HIV virus in a single round infection assay, indicating that a neutralizing antibody against the Ebola GP protein was induced. These results show that production of Ebola VLPs in insect cells using recombinant baculoviruses represents a promising approach for vaccine development against Ebola virus infection

  20. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytongenes single cells

    DEFF Research Database (Denmark)

    Nielsen, Dennis Sandris; Cho, Gyu-Sung; Hanak, Alexander;

    2010-01-01

    A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins...... and/or bacteriocin-producing LAB as “natural” food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure...... of the physiological state of sessile and planktonic L. monocytogenes (strains EGDe and N53-1) during co-culturing with plantaricin-producing L. plantarum (strains BFE 5092 and PCS 20) was investigated using fluorescence ratio imaging microscopy (FRIM). Mono-cultures of L. monocytogenes were used as control...... affected pHi of L. monocytogenes N53-1 with only 20% of the cells being able to maintain pHi in the physiological optimal range with pH > 7 and 52% of the cells with pHi ~ pHex, showing that the cells had no proton gradient towards the environment. The effect on L. monocytogenes EGDe was less pronounced...

  1. In vitro cell quality of buffy coat platelets in additive solution treated with pathogen reduction technology

    DEFF Research Database (Denmark)

    Ostrowski, Sisse R; Bochsen, Louise; Salado-Jimena, José A;

    2010-01-01

    Pathogen reduction technologies (PRTs) may induce storage lesion in platelet (PLT) concentrates. To investigate this, buffy coat PLTs (BCPs) in PLT additive solution (AS; SSP+) with or without Mirasol PRT (CaridianBCT Biotechnologies) were assessed by quality control tests and four-color flow...

  2. Spray deposition of live cells throughout the electrospinning process produces nanofibrous three-dimensional tissue scaffolds

    Directory of Open Access Journals (Sweden)

    Seil J

    2011-05-01

    Full Text Available Justin T Seil, Thomas J WebsterLaboratories for Nanomedicine Research, School of Engineering, Brown University, Providence, RI, USAAbstract: Compared with traditional in-vitro cell culture materials, three-dimensional nanofibrous scaffolds provide a superior environment for promoting cell functions. Since nanofibrous scaffolds have nanometer pore sizes, cells are unable to penetrate on their own, so must be incorporated into the scaffold during fabrication to ensure proper cell distribution. In this study, biodegradable and cytocompatible poly(DL-lactide-co-glycolide (PLGA nanofibers were produced using an electrospinning process. As a model cell line, fibroblasts were periodically sprayed from a pump-action spray bottle onto the developing scaffold. The viability of cells before and after spraying, and also after incorporation into the scaffold, was compared. Results indicated that cell spraying and the scaffold fabrication process did not significantly reduce cell viability. These findings, thus, contribute to the understanding of how to produce more physiological relevant cell-seeded nanofibrous scaffolds, an important element for the future of nanotechnology and tissue engineering.Keywords: nanomaterials, tissue engineering, PLGA, nanotechnology

  3. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  4. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  5. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  6. Ankylosing spondylitis patients display altered dendritic cell and T cell populations that implicate pathogenic roles for the IL-23 cytokine axis and intestinal inflammation

    OpenAIRE

    Wright, Pamela B.; McEntegart, Anne; McCarey, David; McInnes, Iain B.; Siebert, Stefan; Milling, Simon W F

    2015-01-01

    Objective. AS is a systemic inflammatory disease of the SpA family. Polymorphisms at loci including HLA-B27, IL-23R and ERAP-1 directly implicate immune mechanisms in AS pathogenesis. Previously, in an SpA model, we identified HLA-B27–mediated effects on dendritic cells that promoted disease-associated Th17 cells. Here we extend these studies to AS patients using deep immunophenotyping of candidate pathogenic cell populations. The aim of our study was to functionally characterize the immune p...

  7. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    International Nuclear Information System (INIS)

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  8. A Rapid Culture Technique Produces Functional Dendritic-Like Cells from Human Acute Myeloid Leukemia Cell Lines

    Directory of Open Access Journals (Sweden)

    Jian Ning

    2011-01-01

    Full Text Available Most anti-cancer immunotherapeutic strategies involving dendritic cells (DC as vaccines rely upon the adoptive transfer of DC loaded with exogenous tumour-peptides. This study utilized human acute myeloid leukemia (AML cells as progenitors from which functional dendritic-like antigen presenting cells (DLC were generated, that constitutively express tumour antigens for recognition by CD8+ T cells. DLC were generated from AML cell lines KG-1 and MUTZ-3 using rapid culture techniques and appropriate cytokines. DLC were evaluated for their cell-surface phenotype, antigen uptake and ability to stimulate allogeneic responder cell proliferation, and production of IFN-γ; compared with DC derived from normal human PBMC donors. KG-1 and MUTZ-3 DLC increased expression of CD80, CD83, CD86, and HLA-DR, and MUTZ-3 DLC downregulated CD14 and expressed CD1a. Importantly, both KG-1 and MUTZ-3-derived DLC promoted proliferation of allogeneic responder cells more efficiently than unmodified cells; neither cells incorporated FITC-labeled dextran, but both stimulated IFN-γ production from responding allogeneic CD8+ T cells. Control DC produced from PBMC using the FastDC culture also expressed high levels of critical cell surface ligands and demonstrated good APC function. This paper indicates that functional DLC can be cultured from the AML cell lines KG-1 and MUTZ-3, and FastDC culture generates functional KG-1 DLC.

  9. Cz-Silicon Produced from Solar-Grade and Recycled Materials. Part II: Investigating Performances of Solar Cell Produced from Solar-Grade Cz-Silicon

    Science.gov (United States)

    Zhang, Song; Øvrelid, Eivind Johannes; Di Sabtino, Marisa; Juel, Mari; Tranell, Gabriella

    2015-03-01

    This paper is the second of two, investigating the properties of P-type Cz-silicon materials and solar cells produced with recycled silicon and Elkem Solar Silicon (ESS) materials. While the focus on the first work was on the bulk properties and grown defects of the material, the current study focuses on the solar cell performances. In the processing of the solar cells, the phosphorous diffusion process was optimized to improve the bulk properties and thus to maximize the final solar cell characteristics. Results from the characterization of material defects suggest that the performances of the experimental ingots are limited by the activated grown-in defects, which should be strictly controlled during crystal growth and solar cell processing. The solar cells produced from the investigated ingots showed efficiency values up to 18.5 pct and fill factor values up to 79 pct, comparable to conventional silicon produced from poly silicon. Solar cells produced from mixed recycled and ESS material exhibit a better performance than 100 pct recycled material. Boron and oxygen concentration levels and net doping level showed a concurrent effect on light-induced degradation (LID). Appropriate compensation was finally demonstrated to be an efficient way to improve solar cells efficiency of Cz-silicon produced from recycled silicon, even though higher dopant concentration incurred relatively faster LID.

  10. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    OpenAIRE

    Shruti Dave

    2014-01-01

    The pathophysiology of type 1 diabetes mellitus (T1DM) is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs) offer a ...

  11. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Directory of Open Access Journals (Sweden)

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  12. Chinese Experts Successfully Produced Transgenic Animals from Haploid Embryonic Stem Cells

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Individual animals produced by haploid stem cells are ideal models for studying recessive genes. Hap- loid stem cells not only can maintain haploidy, but also are capable of replicating themselves infinitely. Modified genes can be passed on to future generations through genetic engineering of haploid embryonic stem cells, which thus avoids the germlinechimerism caused by other transgenic methods and greatly im- proves the analysis efficiency of the function of gene modification. However, natural haploids are only re- stricted to germline cells in mammals. Currently in mammals, only the embryonic stem cells in rats and mice can be used as the carrier of gene modification, but the embryonic stem cells of other mammals, in- eluding primates, cannot guarantee germline transmission, which has seriously hindered the establishment of disease models by using these species.

  13. Correlation between standard plate count and somatic cell count milk quality results for Wisconsin dairy producers.

    Science.gov (United States)

    Borneman, Darand L; Ingham, Steve

    2014-05-01

    The objective of this study was to determine if a correlation exists between standard plate count (SPC) and somatic cell count (SCC) monthly reported results for Wisconsin dairy producers. Such a correlation may indicate that Wisconsin producers effectively controlling sanitation and milk temperature (reflected in low SPC) also have implemented good herd health management practices (reflected in low SCC). The SPC and SCC results for all grade A and B dairy producers who submitted results to the Wisconsin Department of Agriculture, Trade, and Consumer Protection, in each month of 2012 were analyzed. Grade A producer SPC results were less dispersed than grade B producer SPC results. Regression analysis showed a highly significant correlation between SPC and SCC, but the R(2) value was very small (0.02-0.03), suggesting that many other factors, besides SCC, influence SPC. Average SCC (across 12 mo) for grade A and B producers decreased with an increase in the number of monthly SPC results (out of 12) that were ≤ 25,000 cfu/mL. A chi-squared test of independence showed that the proportion of monthly SCC results >250,000 cells/mL varied significantly depending on whether the corresponding SPC result was ≤ 25,000 or >25,000 cfu/mL. This significant difference occurred in all months of 2012 for grade A and B producers. The results suggest that a generally consistent level of skill exists across dairy production practices affecting SPC and SCC.

  14. De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts

    Directory of Open Access Journals (Sweden)

    Yi-Ju Chen

    2014-03-01

    Full Text Available The ability to interconvert terminally differentiated cells could serve as a powerful tool for cell-based treatment of degenerative diseases, including diabetes mellitus. To determine which, if any, adult tissues are competent to activate an islet β cell program, we performed an in vivo screen by expressing three β cell “reprogramming factors” in a wide spectrum of tissues. We report that transient intestinal expression of these factors—Pdx1, MafA, and Ngn3 (PMN—promotes rapid conversion of intestinal crypt cells into endocrine cells, which coalesce into “neoislets” below the crypt base. Neoislet cells express insulin and show ultrastructural features of β cells. Importantly, intestinal neoislets are glucose-responsive and able to ameliorate hyperglycemia in diabetic mice. Moreover, PMN expression in human intestinal “organoids” stimulates the conversion of intestinal epithelial cells into β-like cells. Our results thus demonstrate that the intestine is an accessible and abundant source of functional insulin-producing cells.

  15. Proteomic differences in recombinant CHO cells producing two similar antibody fragments.

    Science.gov (United States)

    Sommeregger, Wolfgang; Mayrhofer, Patrick; Steinfellner, Willibald; Reinhart, David; Henry, Michael; Clynes, Martin; Meleady, Paula; Kunert, Renate

    2016-09-01

    Chinese hamster ovary (CHO) cells are the most commonly used mammalian hosts for the production of biopharmaceuticals. To overcome unfavorable features of CHO cells, a lot of effort is put into cell engineering to improve phenotype. "Omics" studies investigating elevated growth rate and specific productivities as well as extracellular stimulus have already revealed many interesting engineering targets. However, it remains largely unknown how physicochemical properties of the recombinant product itself influence the host cell. In this study, we used quantitative label-free LC-MS proteomic analyses to investigate product-specific proteome differences in CHO cells producing two similar antibody fragments. We established recombinant CHO cells producing the two antibodies, 3D6 and 2F5, both as single-chain Fv-Fc homodimeric antibody fragments (scFv-Fc). We applied three different vector strategies for transgene delivery (i.e., plasmid, bacterial artificial chromosome, recombinase-mediated cassette exchange), selected two best performing clones from transgene variants and transgene delivery methods and investigated three consecutively passaged cell samples by label-free proteomic analysis. LC-MS-MS profiles were compared in several sample combinations to gain insights into different aspects of proteomic changes caused by overexpression of two different heterologous proteins. This study suggests that not only the levels of specific product secretion but the product itself has a large impact on the proteome of the cell. Biotechnol. Bioeng. 2016;113: 1902-1912. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26913574

  16. T4-like coliphage ΦKAZ14 virulent to pathogenic and extended spectrum β-lactamase-producing Escherichia coli of poultry origin

    Institute of Scientific and Technical Information of China (English)

    Kaikabo; Adamu; Ahmad; Abdulkarim; Sabo; Mohanmmed; Faridah; Abas; Sieo; Chin; Chin

    2015-01-01

    <正>Dear Editor,Bacteriophages(otherwise called phages)are a type of virus that infect bacteria.This viral type has found useful applications in the control of bacterial pathogens in foods and food processing environments.In addition,phages may be useful to prevent colonization and shedding of bacteria into the surrounding environment.

  17. High-throughput sorting of the highest producing cell via a transiently protein-anchored system.

    Directory of Open Access Journals (Sweden)

    Kuo-Hsiang Chuang

    Full Text Available Developing a high-throughput method for the effecient selection of the highest producing cell is very important for the production of recombinant protein drugs. Here, we developed a novel transiently protein-anchored system coupled with fluorescence activated cell sorting (FACS for the efficient selection of the highest producing cell. A furin cleavage peptide (RAKR was used to join a human anti-epithelial growth factor antibody (αEGFR Ab and the extracellular-transmembrane-cytosolic domains of the mouse B7-1 antigen (B7. The furin inhibitor can transiently switch secreted αEGFR Ab into a membrane-anchored form. After cell sorting, the level of membrane αEGFR Ab-RAKR-B7 is proportional to the amount of secreted αEGFR Ab in the medium. We further selected 23 αEGFR Ab expressing cells and demonstrated a high correlation (R2 = 0.9165 between the secretion level and surface expression levels of αEGFR Ab. These results suggested that the novel transiently protein-anchored system can easily and efficiently select the highest producing cells, reducing the cost for the production of biopharmaceuticals.

  18. Anti-proliferative effect of fungal taxol extracted from Cladosporium oxysporum against human pathogenic bacteria and human colon cancer cell line HCT 15

    Science.gov (United States)

    Gokul Raj, K.; Manikandan, R.; Arulvasu, C.; Pandi, M.

    2015-03-01

    Cladosporium oxysporum a new taxol producing endophytic fungus was identified and production of taxol were characterized using UV-visible spectroscopy (UV-vis), high-performance liquid chromatography (HPLC), infrared (IR) nuclear magnetic resonance spectroscopy (NMR (13C and 1H)) and liquid chromatography-mass spectrometry (LC-MS). The taxol biosynthetic gene (dbat) was evaluated for new taxol producing fungus. Antibacterial activity against six different human pathogenic bacteria was done by agar well diffusion method. The anticancer efficacy of isolated fungal taxol were also evaluated in human colon cancer cell HCT 15 by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), cytotoxicity and nuclear morphology analysis. The isolated fungal taxol showed positive towards biosynthetic gene (dbat) and effective against both Gram positive as well as Gram negative. The fungal taxol suppress growth of cancer cell line HCT 15 with an IC50 value of 3.5 μM concentration by 24 h treatment. Thus, the result reveals that C. oxysporum could be a potential alternative source for production of taxol and have antibacterial as well as anticancer properties with possible clinical applications.

  19. Interactions between rye (Secale cereale) root border cells (RBCs) and pathogenic and nonpathogenic rhizosphere strains of Fusarium culmorum.

    Science.gov (United States)

    Jaroszuk-Sciseł, Jolanta; Kurek, Ewa; Rodzik, Beata; Winiarczyk, Krystyna

    2009-10-01

    Interactions of rye (Secale cereale) root border cells (RBCs), generated during plant growth and surrounding the root cap, with nonpathogenic rhizosphere Fusarium culmorum isolates: DEMFc2 (PGPF) and DEMFc5 (DRMO), and a pathogenic strain DEMFc37 were studied in test tube experiments. The effect of water-suspended RBCs released from the rye root cap on the rate of macroconidia germination and hyphae (mycelial) growth of F. culmorum strains was also examined. It was found that root caps of 3-d-old rye seedlings (with the root length of 20mm) were surrounded with a layer of RBCs generated in a number specific for this plant species of 1980+/-30. Introduction of the macroconidia of the tested F. culmorum strains into the root zone of 3-d-old seedlings resulted, after 3d of incubation, in the formation of mantle-like structures only in the rhizosphere of plants inoculated with the pathogenic DEMFc37 strain. The macroconidia were suspended in (1) water, (2) a water mixture with root caps deprived of RBCs, (3) Martin medium, (4) malt extract broth, and (5) a water mixture with rye RBCs, and their percentage germination was determined during 96-h incubation at 20 degrees C. Germination of the macroconidia of all the tested F. culmorum strains suspended in the rich growth media (Martin and malt extract broth) and in the mixture with RBCs was significantly speeded up. While only an average of 16.6 % of macroconidia suspended in water germinated after 96-h incubation, more than 90 % of those suspended in the growth media or in the mixture with RBCs germinated after 24h of incubation. In all the treatments, the highest rate of macroconidia germination was found in suspensions of the pathogenic strain and the lowest in macroconidial suspensions of the PGPF strain. The stimulatory effect of RBCs was not specific to the pathogenic strain. Nevertheless, microscopic observation revealed that it was only in the suspension containing a mixture of rye RBCs and macroconidia of the

  20. The periodontal pathogen Porphyromonas gingivalis induces expression of transposases and cell death of Streptococcus mitis in a biofilm model.

    Science.gov (United States)

    Duran-Pinedo, Ana E; Baker, Vinesha D; Frias-Lopez, Jorge

    2014-08-01

    Oral microbial communities are extremely complex biofilms with high numbers of bacterial species interacting with each other (and the host) to maintain homeostasis of the system. Disturbance in the oral microbiome homeostasis can lead to either caries or periodontitis, two of the most common human diseases. Periodontitis is a polymicrobial disease caused by the coordinated action of a complex microbial community, which results in inflammation of tissues that support the teeth. It is the most common cause of tooth loss among adults in the United States, and recent studies have suggested that it may increase the risk for systemic conditions such as cardiovascular diseases. In a recent series of papers, Hajishengallis and coworkers proposed the idea of the "keystone-pathogen" where low-abundance microbial pathogens (Porphyromonas gingivalis) can orchestrate inflammatory disease by turning a benign microbial community into a dysbiotic one. The exact mechanisms by which these pathogens reorganize the healthy oral microbiome are still unknown. In the present manuscript, we present results demonstrating that P. gingivalis induces S. mitis death and DNA fragmentation in an in vitro biofilm system. Moreover, we report here the induction of expression of multiple transposases in a Streptococcus mitis biofilm when the periodontopathogen P. gingivalis is present. Based on these results, we hypothesize that P. gingivalis induces S. mitis cell death by an unknown mechanism, shaping the oral microbiome to its advantage. PMID:24866802

  1. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Directory of Open Access Journals (Sweden)

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  2. Suppressing Erwinia carotovora pathogenicity by projecting N-acyl homoserine lactonase onto the surface of Pseudomonas putida cells.

    Science.gov (United States)

    Li, Qianqian; Ni, Hong; Meng, Shan; He, Yan; Yu, Ziniu; Li, Lin

    2011-12-01

    N-Acyl homoserine lactones (AHLs) serve as the vital quorum-sensing signals that regulate the virulence of the pathogenic bacterium Erwinia carotovora. In the present study, an approach to efficiently restrain the pathogenicity of E. carotovora-induced soft rot disease is described. Bacillus thuringiensis-derived N-acyl homoserine lactonase (AiiA) was projected onto the surface of Pseudomonas putida cells, and inoculation with both strains was challenged. The previously identified N-terminal moiety of the ice nucleation protein, InaQ-N, was applied as the anchoring motif. A surface display cassette with inaQ-N/ aiiA was constructed and expressed under the control of a constitutive promoter in P. putida AB92019. Surface localization of the fusion protein was confirmed by Western blot analysis, flow cytometry, and immunofluorescence microscopy. The antagonistic activity of P. putida MB116 expressing InaQ-N/AiiA toward E. carotovora ATCC25270 was evaluated by challenge inoculation in potato slices at different ratios. The results revealed a remarkable suppressing effect on E. carotovora infection. The active component was further analyzed using different cell fractions, and the cell surface-projected fusion protein was found to correspond to the suppressing effect. PMID:22210621

  3. Isolation and characterization of cytotoxic effector cells and antibody producing cells from human intestine.

    Science.gov (United States)

    MacDermott, R P

    1985-01-01

    We have examined the ability of intestinal and peripheral blood mononuclear cells isolated from patients with inflammatory bowel disease to mediate killing against cell line targets in spontaneous, antibody-dependent, lectin-induced, and interferon-induced cell-mediated cytotoxicity assays, as well as responsiveness in the allogeneic mixed leukocyte reaction, and effector capabilities in cell-mediated lympholysis. IMC were poor mediators of spontaneous or antibody-dependent cellular cytotoxicity with cell line cells as targets (in comparison to normal PBMC, but were capable of killing antibody coated chicken red blood cells. Although IMC were capable of responding to allogeneic cell surface antigens in the mixed leukocyte reaction, they did not exhibit effector function in cell-mediated lympholysis. Mitogenic lectins induced cell-mediated cytotoxicity by isolated intestinal mononuclear cells from controls and patients. HFIF induces cytotoxicity by control but not inflammatory bowel disease intestinal cells. Pokeweed mitogen was the lectin which induced the greatest amount of killing against human cell line targets. We therefore speculate that exogenous agents, or endogenous factors released during viral infection, could play a role in inducing cell mediated cytotoxic damage to the intestine in inflammatory bowel disease patients. In addition, the functional differences between IMC and PBMC indicate that intestinal MNC may have unique cell capabilities which must be better understood prior to the delineation of immunopathologic events in solid organ tissues. We have also examined the secretion of IgA, IgM, and IgG by isolated human IMC, human bone marrow MNC from rib specimens, and PBMC from patients with CD, UC, SLE, or Henoch-Schoenlein purpura (HSP). Control IMC exhibited high spontaneous secretion of IgA, while intestinal MNC from UC and CD patients exhibited only modest increases in IgA secretion. PBMC from patients with CD, UC, SLE, or HSP exhibited markedly

  4. [INTERCONNECTION BETWEEN CELL MICROVESICULAR TRANSPORT AND PATHOGENS PERSISTENCE IN VITRO AND IN VIVO].

    Science.gov (United States)

    Miller, G G; Mukhachev, A Ya; Bykovsky, A F

    2015-01-01

    This review presents an information and proof evidence toward to the role of microvesicles, originating from the different sources pro- and eucaryotes in the initiation and development of persistence of several human and animal pathogens. Also an information about another properties of microvesicles, as well as the reference of role in the different somatic pathology, intercellular interaction and in the intracellular transport of biologically active macromolecules as well as life origin and evolutionary events.

  5. Human umbilical cord mesenchymal stem cells derived from Wharton's jelly differentiate into insulin-producing cells in vitro

    Institute of Scientific and Technical Information of China (English)

    WANG Hong-wu; LIN Li-min; HE Hong-yan; YOU Fang; LI Wei-zhong; HUANG Tian-hua; MA Gui-xia; MA Lian

    2011-01-01

    Background Islet transplantation is an effective way of reversing type Ⅰ diabetes. However, islet transplantation is hampered by issues such as immune rejection and shortage of donor islets. Mesenchymal stem cells can differentiate into insulin-producing cells. However, the potential of human umbilical cord mesenchymal stem cells (huMSCs) to become insulin-producing cells remains undetermined.Methods We isolated and induced cultured huMSCs under islet cell culture conditions. The response of huMSCs were monitored under an inverted phase contrast microscope. Immunocytochemical and immunofluorescence staining methods were used to measure insulin and glucagon protein levels. Reverse transcription-polymerase chain reaction (RT-PCR) was performed to detect gene expression of human insulin and PDX-1. Dithizone-staining was employed to determine the zinc contents in huMSCs. Insulin secretion was also evaluated through radioimmunoassay.Results HuMSCs induced by nicotinamide and β-mercaptoethanol or by neurogenic differentiation 1 gene (NeuroD1)transfection gradually changed morphology from typically elongated fibroblast-shaped cells to round cells. They had a tendency to form clusters. Immunocytochemical studies showed positive expression of human insulin and glucagon in these cells in response to induction. RT-PCR experiments found that huMSCs expressed insulin and PDX-1 genes following induction and dithizone stained the cytoplasm of huMSCs a brownish red color after induction. Insulin secretion in induced huMSCs was significantly elevated compared with the control group (t=6.183, P<0.05).Conclusions HuMSCs are able to differentiate into insulin-producing cells in vitro. The potential use of huMSCs in βcell replacement therapy of diabetes needs to be studied further.

  6. Volatiles produced by interacting microorganisms potentially useful for the control of plant pathogens Voláteis produzidos pela interação entre microorganismos potencialmente úteis no controle de fitopatógenos

    OpenAIRE

    Vicente Paulo Campos; Renata Silva Canuto de Pinho; Eduardo Souza Freire

    2010-01-01

    The results of studies about interactions between microorganisms involving at least one plant pathogen are of interest to the areas of ethiology and control in Plant Pathology. Various aspects of these interactions have been studied over the years but the toxicity of volatile organic compounds (VOCs) has been emphasized only recently, developing techniques and procedures, and producing additional knowledge to those already obtained with water-soluble substances. This new facet of these intera...

  7. Edwardsiella tarda Endocarditis Confirmed by Indium-111 White Blood Cell Scan: An Unusual Pathogen and Diagnostic Modality.

    Science.gov (United States)

    Litton, Kayleigh M; Rogers, Bret A

    2016-01-01

    Edwardsiella tarda is a freshwater marine member of the family Enterobacteriaceae which often colonizes fish, lizards, snakes, and turtles but is an infrequent human pathogen. Indium-111- ((111)In-) labeled white blood cell (WBC) scintigraphy is an imaging modality which has a wide range of reported sensitivity and specificity (from 60 to 100% and from 68 to 92%, resp.) for diagnosing acute and chronic infection. We describe a case of suspected E. tarda prosthetic aortic valve and mitral valve endocarditis with probable vegetations and new mitral regurgitation on transthoracic and transesophageal echocardiograms which was supported with the use of (111)In-labeled WBC scintigraphy. PMID:26885418

  8. IL-17 produced by Paneth cells drives TNF-induced shock.

    NARCIS (Netherlands)

    Takahashi, N.; Laere, I. van; Rycke, R de; Cauwels, A.; Joosten, L.A.B.; Lubberts, E.; Berg, W.B. van den; Libert, C.

    2008-01-01

    Tumor necrosis factor (TNF) has very potent antitumor activity, but it also provokes a systemic inflammatory response syndrome that leads to shock, organ failure, and death. Here, we demonstrate that interleukin (IL)-17, a proinflammatory cytokine known to be produced mainly by activated T cells, ha

  9. Cinacalcet for hypercalcemia caused by pulmonary squamous cell carcinoma producing parathyroid hormone-related Peptide

    NARCIS (Netherlands)

    Bech, A.; Smolders, K.; Telting, D.; Boer, H. de

    2012-01-01

    BACKGROUND: Current treatments for hypercalcemia caused by lung cell carcinomas producing parathyroid hormone-related peptide (PTH-rp) have limited efficacy, probably because of their lack of effect on PTH-rp secretion. In this case study we explored the efficacy of the calcimimetic cinacalcet as su

  10. Human B Cell-Derived Lymphoblastoid Cell Lines Constitutively Produce Fas Ligand and Secrete MHCII+FasL+ Killer Exosomes

    OpenAIRE

    Klinker, Matthew W.; Lizzio, Vincent; Reed, Tamra J.; Fox, David A.; Lundy, Steven K.

    2014-01-01

    Immune suppression mediated by exosomes is an emerging concept with potentially immense utility for immunotherapy in a variety of inflammatory contexts, including allogeneic transplantation. Exosomes containing the apoptosis-inducing molecule Fas ligand (FasL) have demonstrated efficacy in inhibiting antigen-specific immune responses upon adoptive transfer in animal models. We report here that a very high frequency of human B cell-derived lymphoblastoid cell lines (LCL) constitutively produce...

  11. IL-21-producer CD4+ T cell kinetics during primary simian immunodeficiency virus infection.

    Science.gov (United States)

    Shi, Shoi; Seki, Sayuri; Matano, Tetsuro; Yamamoto, Hiroyuki

    2013-01-01

    IL-21 signaling is important for T cell and B cell-mediated clearance of chronic viral infections. While non-cognate follicular helper CD4+ T cells (TFH) are indicated to be pivotal in providing IL-21-mediated help to activated B cells within germinal centers, how this signaling may be disrupted in early AIDS virus infection is not clear. In this study, we assessed the lineage and kinetics of peripheral blood IL-21-producing CD4+ T cells in primary simian immunodeficiency virus (SIV) infection of rhesus macaques. After SIV challenge, antigen-nonspecific IL-21 production was observed in Th1, Th2 and Th17 cells with Th1 dominance. While IL-21+ Th2 and IL-21+ Th17 showed variable kinetics, an increase in total IL-21+ CD4+ T cells and IL-21+ Th1 from week 3 to week 8 was observed, preceding plasma SIV-specific IgG development from week 5 to week 12. SIV Gag-specific IL-21+ CD4+ T cells detectable at week 2 were decreased in frequencies at week 5. Results imply that kinetics of IL-21+ CD4+ T cells comprised of multiple lineages, potentially targeted by SIV with a bias of existing frequencies during their precursor stage, associate with availability of cooperative B-cell help provided through a proportionate precursor pool developing into TFH and subsequent anti-SIV antibody responses. PMID:23791954

  12. Characterization of polyhormonal insulin-producing cells derived in vitro from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bruin

    2014-01-01

    Full Text Available Human embryonic stem cells (hESCs were used as a model system of human pancreas development to study characteristics of the polyhormonal cells that arise during fetal pancreas development. HESCs were differentiated into fetal-like pancreatic cells in vitro using a 33-day, 7-stage protocol. Cultures were ~90–95% PDX1-positive by day (d 11 and 70–75% NKX6.1-positive by d17. Polyhormonal cells were scattered at d17, but developed into islet-like clusters that expressed key transcription factors by d33. Human C-peptide and glucagon secretion were first detected at d17 and increased thereafter in parallel with INS and GCG transcript levels. HESC-derived cells were responsive to KCl and arginine, but not glucose in perifusion studies. Compared to adult human islets, hESC-derived cells expressed ~10-fold higher levels of glucose transporter 1 (GLUT1 mRNA, but similar levels of glucokinase (GCK. In situ hybridization confirmed the presence of GLUT1 transcript within endocrine cells. However, GLUT1 protein was excluded from this population and was instead observed predominantly in non-endocrine cells, whereas GCK was co-expressed in insulin-positive cells. In rubidium efflux assays, hESC-derived cells displayed mild potassium channel activity, but no responsiveness to glucose, metabolic inhibitors or glibenclamide. Western blotting experiments revealed that the higher molecular weight SUR1 band was absent in hESC-derived cells, suggesting a lack of functional KATP channels at the cell surface. In addition, KATP channel subunit transcript levels were not at a 1:1 ratio, as would be expected (SUR1 levels were ~5-fold lower than KIR6.2. Various ratios of SUR1:KIR6.2 plasmids were transfected into COSM6 cells and rubidium efflux was found to be particularly sensitive to a reduction in SUR1. These data suggest that an impaired ratio of SUR1:KIR6.2 may contribute to the observed KATP channel defects in hESC-derived islet endocrine cells, and along with

  13. Human amnion epithelial cells can be induced to differentiate into functional insulin-producing cells

    Institute of Scientific and Technical Information of China (English)

    Yanan Hou; Qin Huang; Tianjin Liu; Lihe Guo

    2008-01-01

    Pancreatic islet transplantation has demonstrated that long-term insulin independence may be achieved in patients suffering from diabetes mellitus type 1. However, limited availability of islet tissue means that new sources of insulinproducing cells that are responsive to glucose are required. Here, we show that human amnion epithelial cells (HAEC) can be induced to differentiate into functional insulinproducing cells in vitro. After induction of differentiation, HAEC expressed multiple pancreatic --cell genes, including insulin, pancreas duodenum homeobox-1, paired box gene 6,NK2 transcription factor-related locus 2, Islet 1, glucokinase,and glucose transporter-2, and released C-peptide in a glucose-regulated manner in response to other extracellular stimulations. The transplantation of induced HAEC into streptozotocin-induced diabetic C57 mice reversed hyperglycemia, restored body weight, and maintained euglycemia for 30 d. These findings indicated that HAEC may be a new source for cell replacement therapy in type 1 diabetes.

  14. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Shogo [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Research Fellow of the Japan Society for the Promotion of Science, Tokyo (Japan); Nagasawa, Ayumi; Masuda, Yuya; Tsunematsu, Tetsuya [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Hayasaka, Koji; Matsuno, Kazuhiko; Shimizu, Chikara [Division of Laboratory and Transfusion Medicine, Hokkaido University Hospital, Sapporo (Japan); Ozaki, Yukio [Department of Clinical and Laboratory Medicine, Faculty of Medicine, University of Yamanashi (Japan); Moriyama, Takanori, E-mail: moriyama@hs.hokuda.ac.jp [Medical Laboratory Science, Faculty of Health Sciences, Hokkaido University, Sapporo (Japan)

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer It has been thought that BDNF is not produced in the megakaryocytic lineage. Black-Right-Pointing-Pointer MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. Black-Right-Pointing-Pointer BDNF accelerates proliferation of MEG-01 in an autocrine manner. Black-Right-Pointing-Pointer BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  15. Primary B-cell deficiencies reveal a link between human IL-17-producing CD4 T-cell homeostasis and B-cell differentiation.

    Directory of Open Access Journals (Sweden)

    Rita R Barbosa

    Full Text Available IL-17 is a pro-inflammatory cytokine implicated in autoimmune and inflammatory conditions. The development/survival of IL-17-producing CD4 T cells (Th17 share critical cues with B-cell differentiation and the circulating follicular T helper subset was recently shown to be enriched in Th17 cells able to help B-cell differentiation. We investigated a putative link between Th17-cell homeostasis and B cells by studying the Th17-cell compartment in primary B-cell immunodeficiencies. Common Variable Immunodeficiency Disorders (CVID, defined by defects in B-cell differentiation into plasma and memory B cells, are frequently associated with autoimmune and inflammatory manifestations but we found no relationship between these and Th17-cell frequency. In fact, CVID patients showed a decrease in Th17-cell frequency in parallel with the expansion of activated non-differentiated B cells (CD21(lowCD38(low. Moreover, Congenital Agammaglobulinemia patients, lacking B cells due to impaired early B-cell development, had a severe reduction of circulating Th17 cells. Finally, we found a direct correlation in healthy individuals between circulating Th17-cell frequency and both switched-memory B cells and serum BAFF levels, a crucial cytokine for B-cell survival. Overall, our data support a relationship between Th17-cell homeostasis and B-cell maturation, with implications for the understanding of the pathogenesis of inflammatory/autoimmune diseases and the physiology of B-cell depleting therapies.

  16. The myosin motor domain-containing chitin synthase PdChsVII is required for development, cell wall integrity and virulence in the citrus postharvest pathogen Penicillium digitatum.

    Science.gov (United States)

    Gandía, Mónica; Harries, Eleonora; Marcos, Jose F

    2014-06-01

    Chitin is an essential component of the fungal cell wall and a potential target in the development of new antifungal compounds, due to its presence in fungi and not in plants or vertebrates. Chitin synthase genes (chs) constitute a complex family in filamentous fungi and are involved in fungal development, morphogenesis, pathogenesis and virulence. In this study, additional chs genes in the citrus postharvest pathogen Penicillium digitatum have been identified. Comparative analyses included each PdChs in each one of the classes I to VII previously established, and support the grouping of these into three divisions. Disruption of the gene coding PdChsVII, which contains a short version of a myosin motor domain, has been achieved by using Agrobacterium tumefaciens-mediated transformation and revealed its role in the life cycle of the fungus. Disruption strains were viable but showed reduced growth and conidia production. Moreover, Pdchs mutants developed morphological defects as balloon-like enlarged cells and increased chitin content, indicative of an altered cell wall structure. Gene disruption also increased susceptibility to antifungal compounds such as calcofluor white (CFW), sodium dodecyl sulfate (SDS), hydroxide peroxide (H2O2) and commercial fungicides, but significantly no change was observed in the sensitivity to antifungal peptides. The PdchsVII mutants were able to infect citrus fruit and produced tissue maceration, although had reduced virulence and most importantly were greatly impaired in the production of visible mycelium and conidia on the fruit.

  17. Pan-European resistance monitoring programmes encompassing food-borne bacteria and target pathogens of food-producing and companion animals.

    Science.gov (United States)

    de Jong, A; Thomas, V; Klein, U; Marion, H; Moyaert, H; Simjee, S; Vallé, M

    2013-05-01

    Antimicrobial resistance is a concern both for animal and human health. Veterinary programmes monitoring resistance of animal and zoonotic pathogens are therefore essential. Various European countries have implemented national surveillance programmes, particularly for zoonotic and commensal bacteria, and the European Food Safety Authority (EFSA) is compiling the data. However, harmonisation is identified as a weakness and an essential need in order to compare data across countries. Comparisons of resistance monitoring data among national programmes are hampered by differences between programmes, such as sampling and testing methodology, and different epidemiological cut-off values or clinical breakpoints. Moreover, only very few valid data are available regarding target pathogens both of farm and companion animals. The European Animal Health Study Centre (CEESA) attempts to fill these gaps. The resistance monitoring programmes of CEESA have been a collaboration of veterinary pharmaceutical companies for over a decade and include two different projects: the European Antimicrobial Susceptibility Surveillance in Animals (EASSA) programme, which collects food-borne bacteria at slaughter from healthy animals, and the pathogen programmes that collect first-intention target pathogens from acutely diseased animals. The latter comprises three subprogrammes: VetPath; MycoPath; and ComPath. All CEESA projects include uniform sample collection and bacterial identification to species level in various European Union (EU) member states. A central laboratory conducts quantitative susceptibility testing to antimicrobial agents either important in human medicine or commonly used in veterinary medicine. This 'methodology harmonisation' allows easy comparisons among EU member states and makes the CEESA programmes invaluable to address food safety and antibiotic efficacy.

  18. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1

    Directory of Open Access Journals (Sweden)

    Amir Allahverdi

    2015-07-01

    Full Text Available Objective: Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1 is a master regulator gene required for embryonic development of the pancreas and is crucial for normal pancreatic islets activities in adults. Materials and Methods: We induced the over-expression of the PDX1 gene in human bone marrow MSCs (BM-MSCs by Lenti-PDX1 in order to generate IPCs. Next, we examine the ability of the cells by measuring insulin/c-peptide production and INSULIN and PDX1 gene expressions. Results: After transduction, MSCs changed their morphology at day 5 and gradually differentiated into IPCs. INSULIN and PDX1 expressions were confirmed by real time polymerase chain reaction (RT-PCR and immunostaining. IPC secreted insulin and C-peptide in the media that contained different glucose concentrations. Conclusion: MSCs differentiated into IPCs by genetic manipulation. Our result showed that lentiviral vectors could deliver PDX1 gene to MSCs and induce pancreatic differentiation.

  19. B-cell exposure to self-antigen induces IL-10 producing B cells as well as IL-6- and TNF-α-producing B-cell subsets in healthy humans

    DEFF Research Database (Denmark)

    Langkjær, Anina; Kristensen, Birte; Hansen, Bjarke E;

    2012-01-01

    Human B cells are able to secrete IL-10 after stimulation with mitogens, but their ability to produce IL-10 and regulate T-cell responses after stimulation with self-antigens is unclear. We co-cultured thyroglobulin-pulsed B cells from healthy donors with autologous T cells and observed production...... of IL-10 and TGF-β, in addition to TNF-α and IL-6. Pulsing with foreign antigen, tetanus toxoid (TT), induced a Th1-response with minimal IL-10 production. After thyroglobulin-pulsing, 1.10±0.50% of B cells and 1.00±0.20% of CD4(+) T cells produced IL-10, compared to 0.29±0.19% of B cells (P=0.......01) and 0.13±0.15% of CD4(+) T cells (P=0.006) following TT-pulsing. Thyroglobulin-stimulated, IL-10-secreting B cells were enriched within CD5(+) and CD24(high) cells. While thyroglobulin-pulsed B cells induced only modest proliferation of CD4(+) T cells, B cells pulsed with TT induced vigorous...

  20. Associations between CXCR1 polymorphisms and pathogen-specific incidence rate of clinical mastitis, test-day somatic cell count, and test-day milk yield.

    Science.gov (United States)

    Verbeke, Joren; Van Poucke, Mario; Peelman, Luc; Piepers, Sofie; De Vliegher, Sarne

    2014-12-01

    The CXCR1 gene plays an important role in the innate immunity of the bovine mammary gland. Associations between single nucleotide polymorphisms (SNP) CXCR1c.735C>G and c.980A>G and udder health have been identified before in small populations. A fluorescent multiprobe PCR assay was designed specifically and validated to genotype both SNP simultaneously in a reliable and cost-effective manner. In total, 3,106 cows from 50 commercial Flemish dairy herds were genotyped using this assay. Associations between genotype and detailed phenotypic data, including pathogen-specific incidence rate of clinical mastitis (IRCM), test-day somatic cell count, and test-day milk yield (MY) were analyzed. Staphylococcus aureus IRCM tended to associate with SNP c.735C>G. Cows with genotype c.735GG had lower Staph. aureus IRCM compared with cows with genotype c.735CC (rate ratio = 0.35, 95% confidence interval = 0.14–0.90). Additionally, a parity-specific association between Staph. aureus IRCM and SNP c.980A>G was detected. Heifers with genotype c.980GG had a lower Staph. aureus IRCM compared with heifers with genotype c.980AG (rate ratio = 0.15, 95% confidence interval = 0.04–0.56). Differences were less pronounced in multiparous cows. Associations between CXCR1 genotype and somatic cell count were not detected. However, MY was associated with SNP c.735C>G. Cows with genotype c.735GG out-produced cows with genotype c.735CC by 0.8 kg of milk/d. Results provide a basis for further research on the relation between CXCR1 polymorphism and pathogen-specific mastitis resistance and MY. PMID:25459910

  1. B-cell infiltration and frequency of cytokine producing cells differ between localized and disseminated human cutaneous leishmaniases

    Directory of Open Access Journals (Sweden)

    MGS Vieira

    2002-10-01

    Full Text Available Biopsies from human localized cutaneous lesions (LCL n = 7 or disseminated lesions (DL n = 8 cases were characterized according to cellular infiltration,frequency of cytokine (IFN-g, TNF-alpha or iNOS enzyme producing cells. LCL, the most usual form of the disease with usually one or two lesions, exhibits extensive tissue damage. DL is a rare form with widespread lesions throughout the body; exhibiting poor parasite containment but less tissue damage. We demonstrated that LCL lesions exhibit higher frequency of B lymphocytes and a higher intensity of IFN-gamma expression. In both forms of the disease CD8+ were found in higher frequency than CD4+ T cells. Frequency of TNF-alpha and iNOS producing cells, as well as the frequency of CD68+ macrophages, did not differ between LCL and DL. Our findings reinforce the link between an efficient control of parasite and tissue damage, implicating higher frequency of IFN-gamma producing cells, as well as its possible counteraction by infiltrated B cells and hence possible humoral immune response in situ.

  2. Improved cytotoxic effects of Salmonella-producing cytosine deaminase in tumour cells

    Science.gov (United States)

    Mesa-Pereira, Beatriz; Medina, Carlos; Camacho, Eva María; Flores, Amando; Santero, Eduardo

    2015-01-01

    In order to increase the cytotoxic activity of a Salmonella strain carrying a salicylate-inducible expression system that controls cytosine deaminase production, we have modified both, the vector and the producer bacterium. First, the translation rates of the expression module containing the Escherichia coli codA gene cloned under the control of the Pm promoter have been improved by using the T7 phage gene 10 ribosome binding site sequence and replacing the original GUG start codon by AUG. Second, to increase the time span in which cytosine deaminase may be produced by the bacteria in the presence of 5-fluorocytosine, a 5-fluorouracyl resistant Salmonella strain has been constructed by deleting its upp gene sequence. This new Salmonella strain shows increased cytosine deaminase activity and, after infecting tumour cell cultures, increased cytotoxic and bystander effects under standard induction conditions. In addition, we have generated a purD mutation in the producer strain to control its intracellular proliferation by the presence of adenine and avoid the intrinsic Salmonella cell death induction. This strategy allows the analysis and comparison of the cytotoxic effects of cytosine deaminase produced by different Salmonella strains in tumour cell cultures. PMID:25227763

  3. Cell-free methods to produce structurally intact mammalian membrane proteins.

    Science.gov (United States)

    Shinoda, Takehiro; Shinya, Naoko; Ito, Kaori; Ishizuka-Katsura, Yoshiko; Ohsawa, Noboru; Terada, Takaho; Hirata, Kunio; Kawano, Yoshiaki; Yamamoto, Masaki; Tomita, Taisuke; Ishibashi, Yohei; Hirabayashi, Yoshio; Kimura-Someya, Tomomi; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2016-01-01

    The crystal structures of four membrane proteins, from bacteria or a unicellular alga, have been solved with samples produced by cell-free protein synthesis. In this study, for mammalian membrane protein production, we established the precipitating and soluble membrane fragment methods: membrane proteins are synthesized with the Escherichia coli cell-free system in the presence of large and small membrane fragments, respectively, and are simultaneously integrated into the lipid environments. We applied the precipitating membrane fragment method to produce various mammalian membrane proteins, including human claudins, glucosylceramide synthase, and the γ-secretase subunits. These proteins were produced at levels of about 0.1-1.0 mg per ml cell-free reaction under the initial conditions, and were obtained as precipitates by ultracentrifugation. Larger amounts of membrane proteins were produced by the soluble membrane fragment method, collected in the ultracentrifugation supernatants, and purified directly by column chromatography. For several proteins, the conditions of the membrane fragment methods were further optimized, such as by the addition of specific lipids/detergents. The functional and structural integrities of the purified proteins were confirmed by analyses of their ligand binding activities, size-exclusion chromatography profiles, and/or thermal stabilities. We successfully obtained high-quality crystals of the complex of human claudin-4 with an enterotoxin. PMID:27465719

  4. Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

    Science.gov (United States)

    Lamont-Friedrich, Stephanie J.; Michl, Thomas D.; Giles, Carla; Griesser, Hans J.; Coad, Bryan R.

    2016-07-01

    The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata. Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others.

  5. Role of thyrotropin-releasing hormone in prolactin-producing cell models.

    Science.gov (United States)

    Kanasaki, Haruhiko; Oride, Aki; Mijiddorj, Tselmeg; Kyo, Satoru

    2015-12-01

    Thyrotropin-releasing hormone (TRH) is a hypothalamic hypophysiotropic neuropeptide that was named for its ability to stimulate the release of thyroid-stimulating hormone in mammals. It later became apparent that it exerts a number of species-dependent hypophysiotropic activities that regulate other pituitary hormones. TRH also regulates the synthesis and release of prolactin, although whether it is a physiological regulator of prolactin that remains unclear. Occupation of the Gq protein-coupled TRH receptor in the prolactin-producing lactotroph increases the turnover of inositol, which in turn activates the protein kinase C pathway and the release of Ca(2+) from storage sites. TRH-induced signaling events also include the activation of extracellular signal-regulated kinase (ERK) and induction of MAP kinase phosphatase, an inactivator of activated ERK. TRH stimulates prolactin synthesis through the activation of ERK, whereas prolactin release occurs via elevation of intracellular Ca(2+). We have been investigating the role of TRH in a pituitary prolactin-producing cell model. Rat pituitary somatolactotroph GH3 cells, which produce and release both prolactin and growth hormone (GH), are widely used as a model for the study of prolactin- and GH-secreting cells. In this review, we describe the general action of TRH as a hypophysiotropic factor in vertebrates and focus on the role of TRH in prolactin synthesis using GH3 cells.

  6. Cell-penetration by Co(III)cyclen-based peptide-cleaving catalysts selective for pathogenic proteins of amyloidoses.

    Science.gov (United States)

    Chei, Woo Suk; Lee, Joo-Won; Kim, Jae Bum; Suh, Junghun

    2010-07-15

    Derivatives of the Co(III) complex of 1,4,7,10-tetraazacyclododecane (cyclen) with various organic pendants have been reported as target-selective peptide-cleaving catalysts, which can be exploited as catalytic drugs. In order to provide a firm basis for the catalytic drugs based on Co(III)cyclen, the ability of the Co(III)cyclen-containing peptide-cleaving catalysts to penetrate animal cells such as mouse fibroblast NIH-3T 3 or human embryonic kidney (HEK) 293 cells is demonstrated in the present study. Since the catalysts destroy pathogenic proteins for amyloidoses, results of the present study are expected to initiate extensive efforts to obtain therapeutically safe catalytic drugs for amyloidoses such as Alzheimer's disease, type 2 diabetes mellitus, Parkinson's disease, Huntington's disease, mad cow disease, and so on. PMID:20542701

  7. ADAM12 produced by tumor cells rather than stromal cells accelerates breast tumor progression

    DEFF Research Database (Denmark)

    Frohlich, Camilla; Nehammer, Camilla; Albrechtsen, Reidar;

    2011-01-01

    hypothesized, however, that the tumor-associated stroma may stimulate ADAM12 expression in tumor cells, based on the fact that TGF-ß1 stimulates ADAM12 expression and is a well-known growth factor released from tumor-associated stroma. TGF-ß1 stimulation of ADAM12-negative Lewis lung tumor cells induced ADAM12...... synthesis, and growth of these cells in vivo induced a >200-fold increase in ADAM12 expression. Our observation that ADAM12 expression is significantly higher in the terminal duct lobular units (TDLUs) adjacent to human breast carcinoma compared with TDLUs found in normal breast tissue supports our......Expression of ADAM12 is low in most normal tissues, but is markedly increased in numerous human cancers, including breast carcinomas. We have previously shown that overexpression of ADAM12 accelerates tumor progression in a mouse model of breast cancer (PyMT). In the present study, we found...

  8. Androgen excess produces systemic oxidative stress and predisposes to beta-cell failure in female mice.

    Directory of Open Access Journals (Sweden)

    Suhuan Liu

    Full Text Available In women, excess production of the male hormone, testosterone (T, is accompanied by insulin resistance. However, hyperandrogenemia is also associated with beta-cell dysfunction and type 2 diabetes raising the possibility that androgen receptor (AR activation predisposes to beta-cell failure. Here, we tested the hypothesis that excess AR activation produces systemic oxidative stress thereby contributing to beta-cell failure. We used normal female mice (CF and mice with androgen resistance by testicular feminization (Tfm. These mice were exposed to androgen excess and a beta-cell stress induced by streptozotocin (STZ. We find that following exposure to T, or the selective AR-agonist dehydrotestosterone (DHT, CF mice challenged with STZ, which are normally protected, are prone to beta-cell failure and insulin-deficient diabetes. Conversely, T-induced predisposition to beta-cell failure is abolished in Tfm mice. We do not observe any proapoptotic effect of DHT alone or in the presence of H(2O(2 in cultured mouse and human islets. However, we observe that exposure of CF mice to T or DHT provokes systemic oxidative stress, which is eliminated in Tfm mice. This work has significance for hyperandrogenic women; excess activation of AR by testosterone may provoke systemic oxidative stress. In the presence of a prior beta-cell stress, this may predispose to beta-cell failure.

  9. Differentiation of P19 embryonal carcinoma stem cells into insulin-producing cells promoted by pancreas-conditioned medium.

    Science.gov (United States)

    Mansouri, Akram; Esmaeili, Fariba; Nejatpour, Azadeh; Houshmand, Fariba; Shabani, Leila; Ebrahimie, Esmaeil

    2016-07-01

    The ability of embryonal carcinoma )EC (stem cells to generate insulin-producing cells (IPCs) is still unknown. We examined the trophic effects of pancreas-conditioned medium (PCM) on in vitro production of IPCs. Initially, P19 EC cells were characterized by the expression of stem cell markers, Oct3/4, Sox-2 and Nanog. To direct differentiation, P19-derived embryoid bodies (EBs) were induced by selection of nestin-positive cells and treatment with different concentrations of PCM. Morphological studies documented the presence of islet-like cell IPCs clusters. The differentiated cells were immunoreactive for β cell-specific proteins, including insulin, proinsulin, C-peptide and insulin receptor-β. The expression of genes related to pancreatic β cell development and function (PDX-1, INS1, INS2, EP300 and CREB1) was confirmed by qPCR. During differentiation, the expression of EP300 and CREB1 increased by 2.5 and 3.1 times, respectively. In contrast, a sharp decrease in the expression of Oct3/4, Sox-2 and Nanog by 4, 1.5 and 1.5 times, respectively, was observed. The differentiated cells were functionally active, synthesizing and secreting insulin in a glucose-regulated manner. Network prediction highlighted crosstalk between PDX-1 transcription factor and INS2 ligand in IPC generation and revealed positive regulatory effects of EP300, CREB1, PPARA, EGR, KIT, GLP1R, and PKT2 on activation of PDX-1 and INS2. This is the first report of the induction of IPC differentiation from EC cells by using neonate mouse PCM. Since P19 EC cells are widely available, easily cultured without feeders and do not require special growth conditions, they would provide a valuable tool for studying pancreatic β cell differentiation and development. Copyright © 2016 John Wiley & Sons, Ltd. PMID:25044225

  10. Proteome data from a host-pathogen interaction study with Staphylococcus aureus and human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kristin Surmann

    2016-06-01

    Full Text Available To simultaneously obtain proteome data of host and pathogen from an internalization experiment, human alveolar epithelial A549 cells were infected with Staphylococcus aureus HG001 which carried a plasmid (pMV158GFP encoding a continuously expressed green fluorescent protein (GFP. Samples were taken hourly between 1.5 h and 6.5 h post infection. By fluorescence activated cell sorting GFP-expressing bacteria could be enriched from host cell debris, but also infected host cells could be separated from those which did not carry bacteria after contact (exposed. Additionally, proteome data of A549 cells which were not exposed to S. aureus but underwent the same sample processing steps are provided as a control. Time-resolved changes in bacterial protein abundance were quantified in a label-free approach. Proteome adaptations of host cells were monitored by comparative analysis to a stable isotope labeled cell culture (SILAC standard. Proteins were extracted from the cells, digested proteolytically, measured by nanoLC–MS/MS, and subsequently identified by database search and then quantified. The data presented here are related to a previously published research article describing the interplay of S. aureus HG001 and human epithelial cells (Surmann et al., 2015 [1]. They have been deposited to the ProteomeXchange platform with the identifiers PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002384 for the S. aureus HG001 proteome dataset and PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002388 for the A549 proteome dataset.

  11. Comparative analysis of hydrogen-producing bacteria and its immobilized cells for characteristics of hydrogen production

    Institute of Scientific and Technical Information of China (English)

    王相晶; 任南琪; 向文胜; 王爱杰; 林明; 郭婉茜

    2003-01-01

    A strain of hydrogen producing bacteria was immobilized by polyvinyl alcohol-boric acid method,with the addition of a small amount of calcium alginate. The immobilized cells were insensitive to the presence of traces of O2. Moreover, the immobilized cells increased both the evolution rate and the yield of hydrogen production. Batch experiments with a medium containing 10 g/L glucose demonstrated the yields of hydrogen production by the immobilized and free cells were 2.14 mol/mol glucose and 1.69 mol/mol glucose, respectively.In continuous cultures atmedium retention time of 2. 0 h, the yield and the evolution rate of hydrogen producmedium retention time of 6. 0 h, the yield and the evolution rate of hydrogen production by free cells were only 1.75 mol/mol glucose and 362.9ml/(L·h),respectively.

  12. Preadipocyte factor 1 induces pancreatic ductal cell differentiation into insulin-producing cells.

    Science.gov (United States)

    Rhee, Marie; Lee, Seung-Hwan; Kim, Ji-Won; Ham, Dong-Sik; Park, Heon-Seok; Yang, Hae Kyung; Shin, Ju-Young; Cho, Jae-Hyoung; Kim, Young-Bum; Youn, Byung-Soo; Sul, Hei Sook; Yoon, Kun-Ho

    2016-01-01

    The preadipocyte factor 1 (Pref-1) is involved in the proliferation and differentiation of various precursor cells. However, the intracellular signaling pathways that control these processes and the role of Pref-1 in the pancreas remain poorly understood. Here, we showed that Pref-1 induces insulin synthesis and secretion via two independent pathways. The overexpression of Pref-1 activated MAPK signaling, which induced nucleocytoplasmic translocation of FOXO1 and PDX1 and led to the differentiation of human pancreatic ductal cells into β-like cells and an increase in insulin synthesis. Concurrently, Pref-1 activated Akt signaling and facilitated insulin secretion. A proteomics analysis identified the Rab43 GTPase-activating protein as a downstream target of Akt. A serial activation of both proteins induced various granular protein syntheses which led to enhanced glucose-stimulated insulin secretion. In a pancreatectomised diabetic animal model, exogenous Pref-1 improved glucose homeostasis by accelerating pancreatic ductal and β-cell regeneration after injury. These data establish a novel role for Pref-1, opening the possibility of applying this molecule to the treatment of diabetes. PMID:27044861

  13. Embryonic stem-like cells derived from in vitro produced bovine blastocysts

    Directory of Open Access Journals (Sweden)

    Erika Regina Leal de Freitas

    2011-06-01

    Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.

  14. Deoxysphingolipids, novel biomarkers for type 2 diabetes, are cytotoxic for insulin-producing cells.

    Science.gov (United States)

    Zuellig, Richard A; Hornemann, Thorsten; Othman, Alaa; Hehl, Adrian B; Bode, Heiko; Güntert, Tanja; Ogunshola, Omolara O; Saponara, Enrica; Grabliauskaite, Kamile; Jang, Jae-Hwi; Ungethuem, Udo; Wei, Yu; von Eckardstein, Arnold; Graf, Rolf; Sonda, Sabrina

    2014-04-01

    Irreversible failure of pancreatic β-cells is the main culprit in the pathophysiology of diabetes, a disease that is now a global epidemic. Recently, elevated plasma levels of deoxysphingolipids, including 1-deoxysphinganine, have been identified as a novel biomarker for the disease. In this study, we analyzed whether deoxysphingolipids directly compromise the functionality of insulin-producing Ins-1 cells and primary islets. Treatment with 1-deoxysphinganine induced dose-dependent cytotoxicity with senescent, necrotic, and apoptotic characteristics and compromised glucose-stimulated insulin secretion. In addition, 1-deoxysphinganine altered cytoskeleton dynamics, resulting in intracellular accumulation of filamentous actin and activation of the Rho family GTPase Rac1. Moreover, 1-deoxysphinganine selectively upregulated ceramide synthase 5 expression and was converted to 1-deoxy-dihydroceramides without altering normal ceramide levels. Inhibition of intracellular 1-deoxysphinganine trafficking and ceramide synthesis improved the viability of the cells, indicating that the intracellular metabolites of 1-deoxysphinganine contribute to its cytotoxicity. Analyses of signaling pathways identified Jun N-terminal kinase and p38 mitogen-activated protein kinase as antagonistic effectors of cellular senescence. The results revealed that 1-deoxysphinganine is a cytotoxic lipid for insulin-producing cells, suggesting that the increased levels of this sphingolipid observed in diabetic patients may contribute to the reduced functionality of pancreatic β-cells. Thus, targeting deoxysphingolipid synthesis may complement the currently available therapies for diabetes. PMID:24379346

  15. Crystal evaluation of spherical silicon produced by dropping method and their solar cell performance

    Energy Technology Data Exchange (ETDEWEB)

    Omae, Satoshi; Minemoto, Takashi; Takakura, Hideyuki; Hamakawa, Yoshihiro [Faculty of Science and Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577 (Japan); Murozono, Mikio [Clean Venture 21 Co., 2-8-1 Tsuda-yamate, Hirakata, Osaka 573-0128 (Japan)

    2006-12-15

    The characterization of silicon spheres 1mm in diameter, which were produced by a dropping method and solar cell performance using spheres are reported. Scanning electron microscopy observations of the Si spheres after Dash etching and X-ray pole figures indicate that the spherical Si has many defects and crystal grains. Systematic study of the crystal growth temperature and the atmosphere in the dropping area yields improvements in the crystallinity as well as a decrease in the concentrations of oxygen and carbon. Moreover, the spherical Si solar cell performance improved because these impurities are the prime factor for recombination centers. (author)

  16. Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector.

    OpenAIRE

    Smith, G.E.; Ju, G; Ericson, B L; Moschera, J; Lahm, H W; Chizzonite, R; Summers, M D

    1985-01-01

    A cDNA coding for human interleukin 2 (IL-2) was inserted into the genome of Autographa californica nuclear polyhedrosis virus adjacent to the polyhedrin promoter. Cells infected with recombinant virus produced high levels of Mr 15,500 IL-2 polypeptide, the majority of which was secreted into the culture medium during infection. The recombinant IL-2 was able to stimulate the growth of an IL-2-dependent cell line. The N-terminal amino acid sequence of the insect-derived IL-2 was identical to t...

  17. Reinforcement of epithelial cell adhesion to basement membrane by a bacterial pathogen as a new infectious stratagem.

    Science.gov (United States)

    Kim, Minsoo; Ogawa, Michinaga; Mimuro, Hitomi; Sasakawa, Chihiro

    2010-01-01

    The intestinal epithelium undergoes a rapid turnover in addition to rapid exfoliation in response to bacterial infection, thus acting as an intrinsic defense against microbial intruders. It has long been questioned how mucosal pathogens can circumvent the intestinal defense systems. Our recent discovery of a bacterial ploy used by Shigella provided us with fresh insight. Shigella delivers OspE via the type III secretion system during multiplication within epithelial cells. This effector protein reinforces epithelial adherence to the basement membrane by interacting with integrin-linked kinase (ILK), a unique intracellular Ser/Thr kinase that links the cell-adhesion receptors, integrin, and growth factors to the actin cytoskeleton. The interaction between OspE and ILK increased formation of focal adhesions (FAs) and surface levels of b1-integrin, while suppressing phosphorylation of FAK and paxillin, thus suppressing rapid turnover of FAs, reducing cell motility and promoting cell adhesion to extracellular matrix. The impact of this OspE-ILK interplay was demonstrated both in vitro and in vivo by infecting polarized epithelial cell monolayers and guinea pig colons with Shigella possessing or lacking the ospE gene. The findings thus establish a new class of virulence-associated factors, and provide new insight into the functioning of the intestinal barrier and bacterial strategies for circumventing it. PMID:21178415

  18. Augmenting the Activity of Monoterpenoid Phenols against Fungal Pathogens Using 2-Hydroxy-4-methoxybenzaldehyde that Target Cell Wall Integrity.

    Science.gov (United States)

    Kim, Jong H; Chan, Kathleen L; Mahoney, Noreen

    2015-01-01

    Disruption of cell wall integrity system should be an effective strategy for control of fungal pathogens. To augment the cell wall disruption efficacy of monoterpenoid phenols (carvacrol, thymol), antimycotic potency of benzaldehyde derivatives that can serve as chemosensitizing agents were evaluated against strains of Saccharomyces cerevisiae wild type (WT), slt2Δ and bck1Δ (mutants of the mitogen-activated protein kinase (MAPK) and MAPK kinase kinase, respectively, in the cell wall integrity pathway). Among fourteen compounds investigated, slt2Δ and bck1Δ showed higher susceptibility to nine benzaldehydes, compared to WT. Differential antimycotic activity of screened compounds indicated "structure-activity relationship" for targeting the cell wall integrity, where 2-hydroxy-4-methoxybenzaldehyde (2H4M) exhibited the highest antimycotic potency. The efficacy of 2H4M as an effective chemosensitizer to monoterpenoid phenols (viz., 2H4M + carvacrol or thymol) was assessed in yeasts or filamentous fungi (Aspergillus, Penicillium) according to European Committee on Antimicrobial Susceptibility Testing or Clinical Laboratory Standards Institute M38-A protocols, respectively. Synergistic chemosensitization greatly lowers minimum inhibitory or fungicidal concentrations of the co-administered compounds. 2H4M also overcame the tolerance of two MAPK mutants (sakAΔ, mpkCΔ) of Aspergillus fumigatus to fludioxonil (phenylpyrrole fungicide). Collectively, 2H4M possesses chemosensitizing capability to magnify the efficacy of monoterpenoid phenols, which improves target-based (viz., cell wall disruption) antifungal intervention. PMID:26569223

  19. IL-17A-producing T cells are associated with the progression of lung adenocarcinoma.

    Science.gov (United States)

    Bao, Zhang; Lu, Guohua; Cui, Dawei; Yao, Yinan; Yang, Guangdie; Zhou, Jianying

    2016-08-01

    Accumulating evidence has shown that T cells are crucial in shaping the tumor microenvironment and regulating tumor development. However, the roles of IL-17A‑producingcells (IL-17A+CD4+ Th17, IL-17A+CD8+ Tc17 and IL-17A+ γδT17 cells) and related cytokines in the progression of lung cancer (LC) remain uncertain. Here, we found that the frequencies of both Th17 and γδT17 cells in the peripheral blood of patients with lung adenocarcinoma (LA) were higher than those in healthy controls (HCs), whereas the frequency of Tc17 cells in the patients with LA was decreased. In addition, the frequencies of circulating Th17 and γδT17 cells, but not Tc17 cells, were positively associated with tumor invasion and metastasis. Furthermore, the major source of IL-17A production was Th17 cells, followed by Tc17 and γδT17 cells, in peripheral blood from patients with LA and HCs; but the percentages of Th17 and γδT17 cells in total intracellular IL-17A+ cells obtained from the patients with LC were higher than those from HCs. Moreover, the protein and corresponding mRNA levels of IL-17A, IL-23, IL-1β, and TGF-β1 were much higher in the patients with LA than those in HCs, and the levels of IL-17A in patients were positively correlated with numbers of both Th17 and γδT17 cells, but not Tc17 cells. Finally, the frequencies of circulating Th17 and γδT17 cells, along with the levels of IL-17A, IL-23, IL-1β, and TGF-β1 were decreased in the patients with LA after tumor resection, whereas the frequency of circulating Tc17 cells was inversely increased in these patients. Our findings indicate that Th17, Tc17, γδT17 cells, and IL-17A-associated cytokines contribute to the development of LA and thus represent promising targets for therapeutic strategies. PMID:27277161

  20. C-type lectin Langerin is a beta-glucan receptor on human Langerhans cells that recognizes opportunistic and pathogenic fungi

    NARCIS (Netherlands)

    M.A.W.P. de Jong; L.E.M. Vriend; B. Theelen; M.E. Taylor; D. Fluitsma; T. Boekhout; T.B.H. Geijtenbeek

    2010-01-01

    Langerhans cells (LCs) lining the stratified epithelia and mucosal tissues are the first antigen presenting cells to encounter invading pathogens, such as viruses, bacteria and fungi. Fungal infections form a health threat especially in immuno-compromised individuals. LCs express C-type lectin Lange

  1. HCV Specific IL-21 Producing T Cells but Not IL-17A Producing T Cells Are Associated with HCV Viral Control in HIV/HCV Coinfection

    Science.gov (United States)

    MacParland, Sonya A.; Fadel, Saleh M.; Mihajlovic, Vesna; Fawaz, Ali; Kim, Connie; Rahman, A. K. M. Nur-ur; Liu, Jun; Kaul, Rupert; Kovacs, Colin; Grebely, Jason; Dore, Gregory J.; Wong, David K.; Ostrowski, Mario A.

    2016-01-01

    Background Decreased hepatitis C virus (HCV) clearance, faster cirrhosis progression and higher HCV RNA levels are associated with Human Immunodeficiency virus (HIV) coinfection. The CD4+ T helper cytokines interleukin (IL)-21 and IL-17A are associated with virus control and inflammation, respectively, both important in HCV and HIV disease progression. Here, we examined how antigen-specific production of these cytokines during HCV mono and HIV/HCV coinfection was associated with HCV virus control. Methods We measured HCV-specific IL-21 and IL-17A production by transwell cytokine secretion assay in PBMCs from monoinfected and coinfected individuals. Viral control was determined by plasma HCV RNA levels. Results In acutely infected individuals, those able to establish transient/complete HCV viral control tended to have stronger HCV-specific IL-21-production than non-controllers. HCV-specific IL-21 production also correlated with HCV viral decline in acute infection. Significantly stronger HCV-specific IL-21 production was detected in HAART-treated coinfected individuals. HCV-specific IL-17A production was not associated with lower plasma HCV RNA levels in acute or chronic HCV infection and responses were stronger in HIV coinfection. HCV-specific IL-21/ IL-17A responses did not correlate with microbial translocation or fibrosis. Exogenous IL-21 treatment of HCV-specific CD8+ T cells from monoinfected individuals enhanced their function although CD8+ T cells from coinfected individuals were somewhat refractory to the effects of IL-21. Conclusions These data show that HCV-specific IL-21 and IL-17A-producing T cells are induced in HIV/HCV coinfection. In early HIV/HCV coinfection, IL-21 may contribute to viral control, and may represent a novel tool to enhance acute HCV clearance in HIV/HCV coinfected individuals. PMID:27124305

  2. Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

    Energy Technology Data Exchange (ETDEWEB)

    Lea, P.J.; Pawlowski, A.; Persad, S.D.; Menon, I.A.; Haberman, H.F.

    1988-01-01

    Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells.

  3. Human tolerogenic dendritic cells produce IL-35 in the absence of other IL-12 family members.

    Science.gov (United States)

    Dixon, Karen O; van der Kooij, Sandra W; Vignali, Dario A A; van Kooten, Cees

    2015-06-01

    IL-35 is a cytokine of the IL-12 family, existing as a heterodimer of IL-12p35 and Ebi3. IL-35 has anti-inflammatory properties and is produced by regulatory T cells in humans and mice, where it is required for optimal suppression of immune responses. Distinct from other IL-12 cytokines, the expression of IL-35 has not been described in antigen-presenting cells. In view of the immune-regulatory properties of IL-35, we investigated the expression, regulation, and function of IL-12p35 and Ebi3 in human monocyte-derived dendritic cells and tolerogenic DCs (tolDCs). These tolDCs do not produce IL-12p70 or the homodimer IL-12p40. We demonstrate that tolDCs completely lack transcriptional expression of IL-12p40. However, tolDCs maintain mRNA expression of IL-12p35 and Ebi3. Using intracellular flow cytometry and Western blot analysis, we show that tolDCs produce Ebi3 and IL-12p35, and both can be enhanced upon stimulation with IFN-γ, LPS, or CD40L. tolDCs supernatants have the capacity to suppress T-cell activation. Using IL12A silencing, we demonstrate that IL-12p35 is required for tolDCs to reach their full suppressive potential. Taken together, our results indicate that tolDCs produce IL-35, providing an additional novel mechanism by which tolDCs elicit their tolerogenic potential.

  4. Vascular cell responses to ECM produced by smooth muscle cells on TiO2 nanotubes

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • TiO2 nanotubes with the tube diameter of 30 nm via anodic oxidation was prepared. • SMCs on TiO2 nanotubes presented enhanced extracellular matrix secreting. • ECM prepared via decellularization retained the components: Fn, Ln and collagen. • ECM-covered TiO2 nanotubes significantly improved the proliferation of ECs. - Abstract: There is an increasing interest in developing new methods to promote biocompatibility of biomedical materials. The TiO2 nanotubes with the tube diameter of 30 nm were prepared by anodization. The response behavior of the human umbilical vein endothelial cell (HUVEC) and human umbilical artery smooth muscle cell (HUASMC) to these different nanotube sizes was investigated. Compared to the flat Ti, the growth and viability of HUVEC are prohibited, but there was no significant difference of HUASMC on 30 nm TiO2 nanotubes. In this study, extracellular matrix (ECM) as a complex cellular environment which provides structural support to cells and regulates the cells functions was further used to modify the biological properties of TiO2 nanotubes. The ECM secreted from HUASMC was successfully deposited onto the 30 nm TiO2 nanotubes. Moreover, immunofluorescence staining of common ECM components, such as fibronectin, laminin and type IV collagen, also indicated the successful ECM-covering on nanotube surfaces. Interestingly, the surface of ECM-covered TiO2 nanotubes significantly improved the proliferation of HUVECs in vitro. This suggested that the ECM secreted from HUASMCs on the TiO2 nanotubular surface could further improve the HUVECs adhesion and proliferation

  5. Hepatitis E Virus Produced from Cell Culture Has a Lipid Envelope.

    Directory of Open Access Journals (Sweden)

    Ying Qi

    Full Text Available The absence of a productive cell culture system hampered detailed analysis of the structure and protein composition of the hepatitis E virion. In this study, hepatitis E virus from a robust HEV cell culture system and from the feces of infected monkeys at the peak of virus excretion was purified by ultra-centrifugation. The common feature of the two samples after ultracentrifugation was that the ORF2 protein mainly remained in the top fractions. The ORF2 protein from cell culture system was glycosylated, with an apparent molecular weight of 88 kDa, and was not infectious in PLC/PRF/5 cells. The ORF2 protein in this fraction can bind to and protect HEV RNA from digestion by RNase A. The RNA-ORF2 product has a similar sedimentation coefficient to the virus from feces. The viral RNA in the cell culture supernatant was mainly in the fraction of 1.15 g/cm3 but that from the feces was mainly in the fraction of 1.21 g/cm3. Both were infectious in PLC/PRF/5 cells. And the fraction in the middle of the gradient (1.06 g/cm3 from the cell culture supernatant,but not that from the feces, also has ORF2 protein and HEV RNA but was not infectious in PLC/PRF/5.The infectious RNA-rich fraction from the cell culture contained ORF3 protein and lipid but the corresponding fraction from feces had no lipid and little ORF3 protein. The lipid on the surface of the virus has no effect on its binding to cells but the ORF3 protein interferes with binding. The result suggests that most of the secreted ORF2 protein is not associated with HEV RNA and that hepatitis E virus produced in cell culture differs in structure from the virus found in feces in that it has a lipid envelope.

  6. Removal of Cadmium and Zinc from Soil using Immobilized Cell of Biosurfactant Producing Bacteria

    Directory of Open Access Journals (Sweden)

    Charoon Sarin

    2010-07-01

    Full Text Available Immobilized biosurfactant producing bacteria (Bacillus subtilis TP8 and Pseudomonas fluorescens G7 were assessed for survival in heavy metal contaminated soil and for their ability to remove cadmium and zinc from contaminated soil. P. fluorescens G7 was considered to be a good candidate for bioremediation of heavy metals because of its high minimum inhibitory concentrations (MIC for each heavy metal and because of the obviously increased numbers of cell surviving after incubation in the heavy metal contaminated soil up to 4 weeks. The results of soil remediation showed that approximately 19% of Zn and 16.7% of Cd could be removed by this immobilized biosurfactant producing bacteria after incubation for 2 weeks. The results confirm the potential applicability of the immobilized biosurfactant producing bacteria for heavy metal bioremediation.

  7. Plasticity of Ectomesenchymal Stem Cells and its Ability of Producing Tissue Engineering Tooth by Recombining with Dental Epithelial Cells

    Institute of Scientific and Technical Information of China (English)

    Yan JIN; Liu-Yu BAO; Yi-Jing WANG; Hui-Xia HE

    2005-01-01

    @@ 1 Introduction Recently, it has been found that human dental pulp stem cells could generate dentin-pulp complex-like structures in nude mice, but studies on tissue engineering tooth-like structures by cultured human dental epithelial and mesenchymal stem cells are still reported rarely. Ectomesenchyme is an unique structure of vertebrates embryo compose of postmigratory cephalic neural crest cells(NCC) and its derivatives. The aim of the present study was to identify and isolate the ectomesenchymal stem cells(EMSC) and to demonstrate that EMSCs have the ability of plasticity both in vivo and in vitro. The further interesting was to evaluate the role of EMSC in producing of a tissue engineering tooth together with odontogenic epithelium.

  8. Canine olfactory ensheathing cells from the olfactory mucosa can be engineered to produce active chondroitinase ABC.

    Science.gov (United States)

    Carwardine, Darren; Wong, Liang-Fong; Fawcett, James W; Muir, Elizabeth M; Granger, Nicolas

    2016-08-15

    A multitude of factors must be overcome following spinal cord injury (SCI) in order to achieve clinical improvement in patients. It is thought that by combining promising therapies these diverse factors could be combatted with the aim of producing an overall improvement in function. Chondroitin sulphate proteoglycans (CSPGs) present in the glial scar that forms following SCI present a significant block to axon regeneration. Digestion of CSPGs by chondroitinase ABC (ChABC) leads to axon regeneration, neuronal plasticity and functional improvement in preclinical models of SCI. However, the enzyme activity decays at body temperature within 24-72h, limiting the translational potential of ChABC as a therapy. Olfactory ensheathing cells (OECs) have shown huge promise as a cell transplant therapy in SCI. Their beneficial effects have been demonstrated in multiple small animal SCI models as well as in naturally occurring SCI in canine patients. In the present study, we have genetically modified canine OECs from the mucosa to constitutively produce enzymatically active ChABC. We have developed a lentiviral vector that can deliver a mammalian modified version of the ChABC gene to mammalian cells, including OECs. Enzyme production was quantified using the Morgan-Elson assay that detects the breakdown products of CSPG digestion in cell supernatants. We confirmed our findings by immunolabelling cell supernatant samples using Western blotting. OECs normal cell function was unaffected by genetic modification as demonstrated by normal microscopic morphology and the presence of the low affinity neurotrophin receptor (p75(NGF)) following viral transduction. We have developed the means to allow production of active ChABC in combination with a promising cell transplant therapy for SCI repair. PMID:27423610

  9. α-Fetoprotein-producing ovarian tumor in a postmenopausal woman with germ cell differentiation.

    Science.gov (United States)

    Meguro, Shiori; Yasuda, Masanori

    2013-02-01

    α-Fetoprotein (AFP)-producing ovarian tumors (APOTs) are rarely encountered in postmenopausal women, irrespective of whether they are of the germ cell or non-germ cell type. The APOTs that do occur in postmenopausal women are characterized by variable histologies such as hepatoid carcinoma, yolk sac tumor, and epithelial malignancies, most of which are combined. We herein present a case with APOT, which arose in a 58-year-old, gravida 2, para 2, postmenopausal woman. Preoperatively, the tumor, which was in the right ovary, was found to produce AFP (102768.0 ng/mL). The tumor was evenly composed of glands mimicking secretory endometrial gland or fetal gut accompanied by abundant stroma. Immunohistochemically, these glands were positive for SALL4, glypican-3, and hepatocyte nuclear factor 1β. We considered the present case as an AFP-producing adenocarcinoma with adenofibroma showing germ cell differentiation, but it seemed controversial that this tumor should be designated as a yolk sac tumor of the glandular type. The expression profiles of SALL4, OCT4, glypican-3, and hepatocyte nuclear factor 1β were thought to provide interesting implications to characterize the present case. PMID:22056036

  10. Distribution of Nitric Oxide-Producing Cells along Spinal Cord in Urodeles

    Directory of Open Access Journals (Sweden)

    Mayada A Mahmoud

    2014-09-01

    Full Text Available Nitric oxide is a unique neurotransmitter, which participates in many physiological and pathological processes in the organism. There are little data about the neuronal nitric oxide synthase immunoreactivity in the spinal cord of amphibians. In this respect, the present study aims to investigate the distribution of nitric oxide producing cells in the spinal cord of urodele and to find out the possibility of a functional locomotory role to this neurotransmitter. The results of the present study demonstrate a specific pattern of NADPH-d labeling in the selected amphibian model throughout the spinal cord length as NADPH-d-producing cells and fibres were present in almost all segments of the spinal cord of the salamander investigated. However, their number, cytological characteristics and labeling intensity varied significantly. It was noticed that the NO-producing cells (NO-PC were accumulated in the ventral side of certain segments in the spinal cord corresponding to the brachial and sacral plexuses. In addition, the number of NO-PC was found to be increased also at the beginning of the tail and this could be due to the fact that salamanders are tetrapods having bimodal locomotion, namely swimming and walking.

  11. Adenylate cyclases involvement in pathogenicity, a minireview.

    Science.gov (United States)

    Costache, Adriana; Bucurenci, Nadia; Onu, Adrian

    2013-01-01

    Cyclic AMP (cAMP), one of the most important secondary messengers, is produced by adenylate cyclase (AC) from adenosine triphosphate (ATP). AC is a widespread enzyme, being present both in prokaryotes and eukaryotes. Although they have the same enzymatic activity (ATP cyclization), the structure of these proteins varies, depending on their function and the producing organism. Some pathogenic bacteria utilize these enzymes as toxins which interact with calmodulin (or another eukaryote activator), causing intense cAMP synthesis and disruption of infected cell functions. In contrast, other pathogenic bacteria benefit of augmentation of AC activity for their own function. Based on sequence analysis ofAC catalytic domain from two pathogenic bacteria (Bacillus anthracis and Bordetellapertussis) with known three-dimensional structures, a possible secondary structure for 1-255 amino acid fragment from Pseudomonas aeruginosa AC (with 80TKGFSVKGKSS90 as the ATP binding site) is proposed.

  12. Pathogenic Actions of Cell Adhesion Molecule 1 in Pulmonary Emphysema and Atopic Dermatitis

    OpenAIRE

    Yoneshige, Azusa; Hagiyama, Man; Fujita, Mitsugu; Ito, Akihiko

    2015-01-01

    Cell adhesion mediated by adhesion molecules is of central importance in the maintenance of tissue homeostasis. Therefore, altered expression of adhesion molecules leads to the development of various tissue disorders involving cell activation, degeneration, and apoptosis. Nevertheless, it still remains unclear what initiates the altered expression of adhesion molecules and how the subsequent pathological cascades proceed. In this regard, cell adhesion molecule 1 (CADM1) is one of the candidat...

  13. A Pathogenic Role for CD8+ T Cells in a Spontaneous Model of Demyelinating Disease

    DEFF Research Database (Denmark)

    Brisebois, Marcel; Zehntner, Simone P.; Estrada, José;

    2006-01-01

    Transgenic (Tg) mice that overexpress the costimulatory ligand B7.2/CD86 on microglia spontaneously develop a T cell-mediated demyelinating disease. Characterization of the inflammatory infiltrates in the nervous tissue revealed a predominance of CD8+ T cells, suggesting a prominent role of this T...... pathogenesis. Collectively, our data indicate that the spontaneous demyelinating disease in this animal model occurs as a consequence of an inflammatory response initiated through the activation of CNS-specific CD8+ T cells by Tg expression of B7.2 within the target organ. Thus, autoreactive CD8+ T cells can...

  14. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Shruti Dave

    2014-01-01

    Full Text Available The pathophysiology of type 1 diabetes mellitus (T1DM is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs offer a promising possibility that deserves to be explored further. MSCs are multipotent, nonhematopoietic progenitors. They have been explored as an treatment option in tissue regeneration as well as potential of in vitro transdifferentiation into insulin-secreting cells. Thus, the major therapeutic goals for T1DM have been achieved in this way. The regenerative capabilities of MSCs have been a driving force to initiate studies testing their therapeutic effectiveness; their immunomodulatory properties have been equally exciting; which would appear capable of disabling immune dysregulation that leads to β-cell destruction in T1DM. Furthermore, MSCs can be cultured under specially defined conditions, their transdifferentiation can be directed toward the β-cell phenotype, and the formation of insulin-producing cells (IPCs can be targeted. To date, the role of MSCs-derived IPC in T1DM-a unique approach with some positive findings-have been unexplored, but it is still in its very early phase. In this study, a new approach of MSCs-derived IPCs, as a potential therapeutic benefit for T1DM in experimental animal models as well as in humans has been summarized.

  15. Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

    OpenAIRE

    Carlos P Taborda; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

    2008-01-01

    Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

  16. Induction of IL-10- and IFN-gamma-producing T-cell responses by autoreactive T-cells expressing human T-cell leukemia virus type I Tax.

    Science.gov (United States)

    Takatsuka, Natsuko; Hasegawa, Atsuhiko; Takamori, Ayako; Shimizu, Yukiko; Kato, Hirotomo; Ohashi, Takashi; Amagasa, Teruo; Masuda, Takao; Kannagi, Mari

    2009-09-01

    Human T-cell leukemia virus type I (HTLV-I) is associated with adult T-cell leukemia, HTLV-I-associated myelopathy/tropical spastic paraparesis and various autoimmune-like disorders. T-cell immune suppression is also associated with HTLV-I infection. Mechanisms of diverse immune dysregulation in HTLV-I infection are obscure. Here, we investigated a potential link between autoimmunity and immune suppression in HTLV-I infection. G14, an IL-2-dependent HTLV-I-negative CD4(+)CD8(+) T-cell line previously established from an HTLV-I-infected rat, constantly proliferated and produced IFN-gamma. IFN-gamma production by G14 cells was dependent on interactions between CD4 and MHC-II, suggesting that G14 cells recognized self-antigens presented by MHC-II on themselves. To examine immune response to G14 cells, we inoculated G14 cells into syngeneic naive rats. Interestingly, T-cells isolated from these rats vigorously proliferated when stimulated with G14-Tax cells that stably expressed HTLV-I Tax, but not with G14 cells. G14-Tax-mediated T-cell proliferation was abrogated by antibodies to CD80 and CD86 that were up-regulated in G14-Tax cells. T-cells propagated by repetitive G14-Tax cell stimulations in culture with IL-2 expressed CD4, CD25 and cytolytic T lymphocyte-associated antigen 4 (CTLA-4), produced abundant amounts of IL-10 and IFN-gamma in response to G14 cells and suppressed growth of G14 cells mainly through supernatant-mediated mechanisms. Similar IL-10- and IFN-gamma-producing CD4(+)CD25(+)CTLA-4(+) T-cells were predominantly induced in culture of splenocytes from HTLV-I-infected rats following stimulation with G14-Tax cells. These results implied that expression of Tax in the otherwise low immunogenic autoreactive T-cells induced IL-10- and IFN-gamma-producing T-cell responses with regulatory effects against the autoreactive cells. Our findings provide new insights into the complex immune conditions underlying HTLV-I-associated diseases. PMID:19654198

  17. Prevention of immunodeficiency virus induced CD4+ T-cell depletion by prior infection with a non-pathogenic virus

    International Nuclear Information System (INIS)

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIVPCO) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is not the primary cause of immunodeficiency. Although this approach was analogous to immunization with a modified live vaccine, correlates of immunity such as a serum-neutralizing antibody or virus-specific T-cell proliferative response were not found in protected animals. Differences in cytokine transcription profile, most notably in interferon gamma, were observed between the protected and unprotected groups. These data provide support for the importance of non-adaptive enhancement of the immune response in the prevention of CD4+ T-cell loss

  18. The ClpP protease homologue is required for the transmission traits and cell division of the pathogen Legionella pneumophila

    Directory of Open Access Journals (Sweden)

    Zhang Qin-fen

    2010-02-01

    Full Text Available Abstract Background Legionella pneumophila, the intracellular bacterial pathogen that causes Legionnaires' disease, exhibit characteristic transmission traits such as elevated stress tolerance, shortened length and virulence during the transition from the replication phase to the transmission phase. ClpP, the catalytic core of the Clp proteolytic complex, is widely involved in many cellular processes via the regulation of intracellular protein quality. Results In this study, we showed that ClpP was required for optimal growth of L. pneumophila at high temperatures and under several other stress conditions. We also observed that cells devoid of clpP exhibited cell elongation, incomplete cell division and compromised colony formation. Furthermore, we found that the clpP-deleted mutant was more resistant to sodium stress and failed to proliferate in the amoebae host Acanthamoeba castellanii. Conclusions The data present in this study illustrate that the ClpP protease homologue plays an important role in the expression of transmission traits and cell division of L. pneumophila, and further suggest a putative role of ClpP in virulence regulation.

  19. Polymorphous silicon thin films produced in dusty plasmas: application to solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Roca i Cabarrocas, Pere; Chaabane, N; Kharchenko, A V; Tchakarov, S [Laboratoire de Physique des Interfaces et des Couches Minces (UMR 7647), Ecole Polytechnique, 91128 Palaiseau Cedex (France)

    2004-12-01

    We summarize our current understanding of the optimization of PIN solar cells produced by plasma enhanced chemical vapour deposition from silane-hydrogen mixtures. To increase the deposition rate, the discharge is operated under plasma conditions close to powder formation, where silicon nanocrystals contribute to the deposition of so-called polymorphous silicon thin films. We show that the increase in deposition rate can be achieved via an accurate control of the plasma parameters. However, this also results in a highly defective interface in the solar cells due to the bombardment of the P-layer by positively charged nanocrystals during the deposition of the I-layer. We show that decreasing the ion energy by increasing the total pressure or by using silane-helium mixtures allows us to increase both the deposition rate and the solar cells efficiency, as required for cost effective thin film photovoltaics.

  20. Polymorphous silicon thin films produced in dusty plasmas: application to solar cells

    Science.gov (United States)

    Cabarrocas, Pere Roca i.; Chaâbane, N.; Kharchenko, A. V.; Tchakarov, S.

    2004-12-01

    We summarize our current understanding of the optimization of PIN solar cells produced by plasma enhanced chemical vapour deposition from silane hydrogen mixtures. To increase the deposition rate, the discharge is operated under plasma conditions close to powder formation, where silicon nanocrystals contribute to the deposition of so-called polymorphous silicon thin films. We show that the increase in deposition rate can be achieved via an accurate control of the plasma parameters. However, this also results in a highly defective interface in the solar cells due to the bombardment of the P-layer by positively charged nanocrystals during the deposition of the I-layer. We show that decreasing the ion energy by increasing the total pressure or by using silane helium mixtures allows us to increase both the deposition rate and the solar cells efficiency, as required for cost effective thin film photovoltaics.

  1. Shale gas produced water treatment using innovative microbial capacitive desalination cell

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, Zachary A. [New Mexico State University, Las Cruces, NM 88003 (United States); Forrestal, Casey [University of Colorado Boulder, Boulder, CO 80309 (United States); Ren, Zhiyong Jason, E-mail: jason.ren@colorado.edu [University of Colorado Boulder, Boulder, CO 80309 (United States); Xu, Pei, E-mail: wxpei@hotmail.com [New Mexico State University, Las Cruces, NM 88003 (United States)

    2015-02-11

    Highlights: • Actual shale gas produced water was treated with no external energy input. • Biodegradation of organics generated stable voltages for desalination. • On average, 36 mg TDS per g activated carbon was removed in 1 h. • A maximum organic removal rate of 6.4 mg DOC per hour was achieved in the reactor. - Abstract: The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization—a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input.

  2. Shale gas produced water treatment using innovative microbial capacitive desalination cell

    International Nuclear Information System (INIS)

    Highlights: • Actual shale gas produced water was treated with no external energy input. • Biodegradation of organics generated stable voltages for desalination. • On average, 36 mg TDS per g activated carbon was removed in 1 h. • A maximum organic removal rate of 6.4 mg DOC per hour was achieved in the reactor. - Abstract: The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization—a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input

  3. Myeloid-derived suppressor cells are elevated in patients with psoriasis and produce various molecules

    Science.gov (United States)

    Ilkovitch, Dan; Ferris, Laura K.

    2016-01-01

    Psoriasis is a debilitating chronic inflammatory disease. In addition to the characteristic effects on the skin, chronic inflammation associated with the disease is recognized to contribute to cardiovascular, hepatic and renal comorbidities. Immature myeloid regulatory cells, known as myeloid-derived suppressor cells (MDSCs), have been demonstrated to accumulate in various diseases and chronic inflammatory states, including inflammatory bowel disease and various types of cancer. The results of the present study, obtained using flow cytometry and cell culture analysis of peripheral blood mononuclear cells from psoriasis and healthy patients, revealed that MDSC levels are significantly increased in the blood of patients with psoriasis compared with healthy controls. Furthermore, these cells are capable of producing various molecules, including matrix metalloproteinase-9 and-1, interleukin-8, growth-related oncogene, and monocyte chemoattractant protein 1. These molecules may recruit additional immune cells involved in the pathogenesis of the disease, and contribute to the chronic inflammatory state in these patients. Therefore, MDSCs, which have various immune regulatory functions, may contribute to the pathogenesis of psoriasis as a systemic inflammatory disease. PMID:27574042

  4. Completely ES cell-derived mice produced by tetraploid complementation using inner cell mass (ICM deficient blastocysts.

    Directory of Open Access Journals (Sweden)

    Duancheng Wen

    Full Text Available Tetraploid complementation is often used to produce mice from embryonic stem cells (ESCs by injection of diploid (2n ESCs into tetraploid (4n blastocysts (ESC-derived mice. This method has also been adapted to mouse cloning and the derivation of mice from induced pluripotent stem (iPS cells. However, the underlying mechanism(s of the tetraploid complementation remains largely unclear. Whether this approach can give rise to completely ES cell-derived mice is an open question, and has not yet been unambiguously proven. Here, we show that mouse tetraploid blastocysts can be classified into two groups, according to the presence or absence of an inner cell mass (ICM. We designate these as type a (presence of ICM at blastocyst stage or type b (absence of ICM. ESC lines were readily derived from type a blastocysts, suggesting that these embryos retain a pluripotent epiblast compartment; whereas the type b blastocysts possessed very low potential to give rise to ESC lines, suggesting that they had lost the pluripotent epiblast. When the type a blastocysts were used for tetraploid complementation, some of the resulting mice were found to be 2n/4n chimeric; whereas when type b blastocysts were used as hosts, the resulting mice are all completely ES cell-derived, with the newborn pups displaying a high frequency of abdominal hernias. Our results demonstrate that completely ES cell-derived mice can be produced using ICM-deficient 4n blastocysts, and provide evidence that the exclusion of tetraploid cells from the fetus in 2n/4n chimeras can largely be attributed to the formation of ICM-deficient blastocysts.

  5. Completely ES cell-derived mice produced by tetraploid complementation using inner cell mass (ICM) deficient blastocysts.

    Science.gov (United States)

    Wen, Duancheng; Saiz, Nestor; Rosenwaks, Zev; Hadjantonakis, Anna-Katerina; Rafii, Shahin

    2014-01-01

    Tetraploid complementation is often used to produce mice from embryonic stem cells (ESCs) by injection of diploid (2n) ESCs into tetraploid (4n) blastocysts (ESC-derived mice). This method has also been adapted to mouse cloning and the derivation of mice from induced pluripotent stem (iPS) cells. However, the underlying mechanism(s) of the tetraploid complementation remains largely unclear. Whether this approach can give rise to completely ES cell-derived mice is an open question, and has not yet been unambiguously proven. Here, we show that mouse tetraploid blastocysts can be classified into two groups, according to the presence or absence of an inner cell mass (ICM). We designate these as type a (presence of ICM at blastocyst stage) or type b (absence of ICM). ESC lines were readily derived from type a blastocysts, suggesting that these embryos retain a pluripotent epiblast compartment; whereas the type b blastocysts possessed very low potential to give rise to ESC lines, suggesting that they had lost the pluripotent epiblast. When the type a blastocysts were used for tetraploid complementation, some of the resulting mice were found to be 2n/4n chimeric; whereas when type b blastocysts were used as hosts, the resulting mice are all completely ES cell-derived, with the newborn pups displaying a high frequency of abdominal hernias. Our results demonstrate that completely ES cell-derived mice can be produced using ICM-deficient 4n blastocysts, and provide evidence that the exclusion of tetraploid cells from the fetus in 2n/4n chimeras can largely be attributed to the formation of ICM-deficient blastocysts.

  6. The IL-17A-producing CD8+ T-cell population in psoriatic lesional skin comprises mucosa-associated invariant T cells and conventional T cells.

    Science.gov (United States)

    Teunissen, Marcel B M; Yeremenko, Nataliya G; Baeten, Dominique L P; Chielie, Saskia; Spuls, Phyllis I; de Rie, Menno A; Lantz, Olivier; Res, Pieter C M

    2014-12-01

    IL-17A is pivotal in the etiology of psoriasis, and CD8(+) T cells with the ability to produce this cytokine (Tc17 cells) are over-represented in psoriatic lesions. Here we demonstrate that the frequency of Tc17 cells in peripheral blood of psoriasis patients correlated with the clinical severity of the disease. Analysis of cutaneous-associated lymphocyte antigen expression showed that the blood Tc17 population contains a significantly higher proportion of cells with skin-homing potential compared with the CD8(+) T-cell population lacking IL-17A/IL-22 expression. IL-17A-producing CD8(+) T cells in blood have previously been reported to belong mainly to the mucosa-associated invariant T-cell (MAIT cell) lineage characterized by TCR Vα7.2 chain, CD161, IL-18Rα, and multidrug transporter ABCB1 expression. We demonstrate the presence of CD8(+) MAIT cells in the dermis and epidermis of psoriatic plaques, as well as healthy skin; however, IL-17A-producing CD8(+) MAIT cells were predominantly found in psoriatic skin. Notably, we observed IL-17A production in a large proportion of psoriatic plaque-derived CD8(+) T cells devoid of MAIT cell characteristics, likely representing conventional CD8(+) T cells. In conclusion, we provide supporting evidence that implicates Tc17 cells in the pathogenesis of psoriasis and describe the presence of innate CD8(+) MAIT cells in psoriatic lesions as an alternative source of IL-17A. PMID:24945094

  7. Pathogen-mediated proteolysis of the cell death regulator RIPK1 and the host defense modulator RIPK2 in human aortic endothelial cells.

    Directory of Open Access Journals (Sweden)

    Andrés G Madrigal

    Full Text Available Porphyromonas gingivalis is the primary etiologic agent of periodontal disease that is associated with other human chronic inflammatory diseases, including atherosclerosis. The ability of P. gingivalis to invade and persist within human aortic endothelial cells (HAEC has been postulated to contribute to a low to moderate chronic state of inflammation, although how this is specifically achieved has not been well defined. In this study, we demonstrate that P. gingivalis infection of HAEC resulted in the rapid cleavage of receptor interacting protein 1 (RIPK1, a mediator of tumor necrosis factor (TNF receptor-1 (TNF-R1-induced cell activation or death, and RIPK2, a key mediator of both innate immune signaling and adaptive immunity. The cleavage of RIPK1 or RIPK2 was not observed in cells treated with apoptotic stimuli, or cells stimulated with agonists to TNF-R1, nucleotide oligomerization domain receptor 1(NOD1, NOD2, Toll-like receptor 2 (TLR2 or TLR4. P. gingivalis-induced cleavage of RIPK1 and RIPK2 was inhibited in the presence of a lysine-specific gingipain (Kgp inhibitor. RIPK1 and RIPK2 cleavage was not observed in HAEC treated with an isogenic mutant deficient in the lysine-specific gingipain, confirming a role for Kgp in the cleavage of RIPK1 and RIPK2. Similar proteolysis of poly (ADP-ribose polymerase (PARP was observed. We also demonstrated direct proteolysis of RIPK2 by P. gingivalis in a cell-free system which was abrogated in the presence of a Kgp-specific protease inhibitor. Our studies thus reveal an important role for pathogen-mediated modification of cellular kinases as a potential strategy for bacterial persistence within target host cells, which is associated with low-grade chronic inflammation, a hallmark of pathogen-mediated chronic inflammatory disorders.

  8. Understanding Transcriptional Enhancement in Monoclonal Antibody-Producing Chinese Hamster Ovary Cells

    Science.gov (United States)

    Nicoletti, Sarah E.

    With the demand for monoclonal antibody (mAB) therapeutics continually increasing, the need to better understand what makes a high productivity clone has gained substantial interest. Monoclonal antibody producing Chinese hamster ovary (CHO) cells with different productivities were provided by a biopharmaceutical company for investigation. Gene copy numbers, mRNA levels, and mAb productivities were previously determined for two low producing clones and their amplified progeny. These results showed an increase in mRNA copy number in amplified clones, which correlated to the observed increases in specific productivity of these clones. The presence of multiple copies of mRNA per one copy of DNA in the higher productivity clones has been coined as transcriptional enhancement. The methylation status of the CMV promoter as well as transcription factor/promoter interactions were evaluated to determine the cause of transcriptional enhancement. Methylation analysis via bisulfite sequencing revealed no significant difference in overall methylation status of the CMV promoter. These data did, however, reveal the possibility of differential interactions of transcription factors between the high and low productivity cell clones. This finding was further supported by chromatin immunoprecipitations previously performed in the lab, as well as literature studies. Transcription activator-like effector (TALE) binding proteins were constructed and utilized to selectively immunoprecipitate the CMV promoter along with its associated transcription factors in the different CHO cell clones. Cells were transfected with the TALE proteins, harvested and subjected to a ChIP-like procedure. Results obtained from the TALE ChIP demonstrated the lack of binding of the protein to the promoter and the need to redesign the TALE. Overall, results obtained from this study were unable to give a clear indication as to the causes of transcriptional enhancement in the amplified CHO cell clones. Further

  9. Calpains are involved in asexual and sexual development, cell wall integrity and pathogenicity of the rice blast fungus.

    Science.gov (United States)

    Liu, Xiao-Hong; Ning, Guo-Ao; Huang, Lu-Yao; Zhao, Ya-Hui; Dong, Bo; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-01-01

    Calpains are ubiquitous and well-conserved proteins that belong to the calcium-dependent, non-lysosomal cysteine protease family. In this study, 8 putative calpains were identified using Pfam domain analysis and BlastP searches in M. oryzae. Three single gene deletion mutants (ΔMocapn7, ΔMocapn9 and ΔMocapn14) and two double gene deletion mutants (ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7) were obtained using the high-throughput gene knockout system. The calpain disruption mutants showed defects in colony characteristics, conidiation, sexual reproduction and cell wall integrity. The mycelia of the ΔMocapn7, ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7 mutants showed reduced pathogenicity on rice and barley. PMID:27502542

  10. Differentiation of bone marrow-derived mesenchymal stem cells from diabetic patients into insulin-producing cells in vitro

    Institute of Scientific and Technical Information of China (English)

    SUN Yu; LI Hui; WANG Ke-xin; CHEN Li; HOU Xin-guo; HOU Wei-kai; DONG Jian-jun; SUN Lei; TANG Kuan-xiao; WANG Bin; SONG Jun

    2007-01-01

    Bckground Stem cells, which have the ability to differentiate into insulin-producing cells (IPCs), would provide a potentially unlimited source of islet cells for transplantation and alleviate the major limitations of availability and allogeneic rejection. Therefore, the utilization of stem cells is becoming the most promising therapy for diabetes mellitus (DM). Here,we studied the differentiation capacity of the diabetic patient's bone marrow-derived mesenchymal stem cells (MSCs) and tested the feasibility of using MSCs for β-cell replacement.Methods Bone marrow-derived MSCs were obtained from 10 DM patients (5 type 1 DM and 5 type 2 DM) and induced to IPCs under a three-stage protocol. Representative cell surface antigen expression profiles of MSCs were analysed by flow cytometric analysis. Reverse transcription-polymerase chain reaction (RT-PCR) was performed to detect multiple genes related to pancreatic β-cell development and function. The identity of the IPCs was illustrated by the analysis of morphology, ditizone staining and immunocytochemistry. Release of insulin by these cells was confirmed by immunoradioassay.Results Flow cytometric analysis of MSCs at passage 3 showed that these cells expressed high levels of CD29 (98.28%), CD44 (99.56%) and CD106 (98.34%). Typical islet-like cell clusters were observed at the end of the protocol (18 days). Ditizone staining and immunohistochemistry for insulin were both positive. These differentiated cells at stage 2 (10 days) expressed nestin, pancreatic duodenal homeobox-1 (PDX-1), Neurogenin3, Pax4, insulin, glucagon, but at stage 3 (18 days) we observed the high expression of PDX-1, insulin, glucagon. Insulin was secreted by these cells in response to different concentrations of glucose stimulation in a regulated manner (P<0.05).Conclusions Bone marrow-derived MSCs from DM patients can differentiate into functional IPCs under certain conditions in vitro. Using diabetic patient's own bone marrow-derived MSCs as

  11. Bone invading NSCLC cells produce IL-7: mice model and human histologic data

    International Nuclear Information System (INIS)

    Bone metastases are a common and dismal consequence of lung cancer that is a leading cause of death. The role of IL-7 in promoting bone metastases has been previously investigated in NSCLC, but many aspects remain to be disclosed. To further study IL-7 function in bone metastasis, we developed a human-in-mice model of bone aggression by NSCLC and analyzed human bone metastasis biopsies. We used NOD/SCID mice implanted with human bone. After bone engraftment, two groups of mice were injected subcutaneously with A549, a human NSCLC cell line, either close or at the contralateral flank to the human bone implant, while a third control group did not receive cancer cells. Tumor and bone vitality and IL-7 expression were assessed in implanted bone, affected or not by A549. Serum IL-7 levels were evaluated by ELISA. IL-7 immunohistochemistry was performed on 10 human bone NSCLC metastasis biopsies for comparison. At 12 weeks after bone implant, we observed osteogenic activity and neovascularization, confirming bone vitality. Tumor aggressive cells implanted close to human bone invaded the bone tissue. The bone-aggressive cancer cells were positive for IL-7 staining both in the mice model and in human biopsies. Higher IL-7 serum levels were found in mice injected with A549 cells close to the bone implant compared to mice injected with A549 cells in the flank opposite to the bone implant. We demonstrated that bone-invading cells express and produce IL-7, which is known to promote osteoclast activation and osteolytic lesions. Tumor-bone interaction increases IL-7 production, with an increase in IL-7 serum levels. The presented mice model of bone invasion by contiguous tumor is suitable to study bone-tumor cell interaction. IL-7 plays a role in the first steps of metastatic process

  12. Bone invading NSCLC cells produce IL-7: mice model and human histologic data

    Directory of Open Access Journals (Sweden)

    Quarto Rodolfo

    2010-01-01

    Full Text Available Abstract Background Bone metastases are a common and dismal consequence of lung cancer that is a leading cause of death. The role of IL-7 in promoting bone metastases has been previously investigated in NSCLC, but many aspects remain to be disclosed. To further study IL-7 function in bone metastasis, we developed a human-in-mice model of bone aggression by NSCLC and analyzed human bone metastasis biopsies. Methods We used NOD/SCID mice implanted with human bone. After bone engraftment, two groups of mice were injected subcutaneously with A549, a human NSCLC cell line, either close or at the contralateral flank to the human bone implant, while a third control group did not receive cancer cells. Tumor and bone vitality and IL-7 expression were assessed in implanted bone, affected or not by A549. Serum IL-7 levels were evaluated by ELISA. IL-7 immunohistochemistry was performed on 10 human bone NSCLC metastasis biopsies for comparison. Results At 12 weeks after bone implant, we observed osteogenic activity and neovascularization, confirming bone vitality. Tumor aggressive cells implanted close to human bone invaded the bone tissue. The bone-aggressive cancer cells were positive for IL-7 staining both in the mice model and in human biopsies. Higher IL-7 serum levels were found in mice injected with A549 cells close to the bone implant compared to mice injected with A549 cells in the flank opposite to the bone implant. Conclusions We demonstrated that bone-invading cells express and produce IL-7, which is known to promote osteoclast activation and osteolytic lesions. Tumor-bone interaction increases IL-7 production, with an increase in IL-7 serum levels. The presented mice model of bone invasion by contiguous tumor is suitable to study bone-tumor cell interaction. IL-7 plays a role in the first steps of metastatic process.

  13. Rituximab induces sustained reduction of pathogenic B cells in patients with peripheral nervous system autoimmunity

    Science.gov (United States)

    Maurer, Michael A.; Rakocevic, Goran; Leung, Carol S.; Quast, Isaak; Lukačišin, Martin; Goebels, Norbert; Münz, Christian; Wardemann, Hedda; Dalakas, Marinos; Lünemann, Jan D.

    2012-01-01

    The B cell–depleting IgG1 monoclonal antibody rituximab can persistently suppress disease progression in some patients with autoimmune diseases. However, the mechanism underlying these long-term beneficial effects has remained unclear. Here, we evaluated Ig gene usage in patients with anti–myelin-associated glycoprotein (anti-MAG) neuropathy, an autoimmune disease of the peripheral nervous system that is mediated by IgM autoantibodies binding to MAG antigen. Patients with anti-MAG neuropathy showed substantial clonal expansions of blood IgM memory B cells that recognized MAG antigen. The group of patients showing no clinical improvement after rituximab therapy were distinguished from clinical responders by a higher load of clonal IgM memory B cell expansions before and after therapy, by persistence of clonal expansions despite efficient peripheral B cell depletion, and by a lack of substantial changes in somatic hypermutation frequencies of IgM memory B cells. We infer from these data that the effectiveness of rituximab therapy depends on efficient depletion of noncirculating B cells and is associated with qualitative immunological changes that indicate reconfiguration of B cell memory through sustained reduction of autoreactive clonal expansions. These findings support the continued development of B cell–depleting therapies for autoimmune diseases. PMID:22426210

  14. Development of disease prevention method using radiation irradiated pathogenic microorganisms, cells and animals

    International Nuclear Information System (INIS)

    Enhancement of the abilities of specific and non-specific disease prevention through the regulation of cytokine production has been paid attention in clinical and veterinary fields. Bovine monocytes isolated from the peripheral blood were exposed to X-ray at 0.1-10 Gy and cultured in the conditions with and without LPS stimulation to investigate the radiation effects at a low level on the expression of cytokine mRNA. The expressions of IL-1 and TNFα were significantly increased in the bovine peripheral monocytes by the exposure to X-ray. If it become possible to control the induction of IL-1 and TNFα by low level X-ray, the radiation would be used as a new biophylaxis method. Then, an investigation was made on the radiation effects on pathogenic plasmid such as capsule plasmid of Bacillus anthracis. A system able to detect a one-base change in base sequence was designed using capE gene, which has been known to mediate the positive regulation of capsule expression. Not only phenotypic changes but also little changes in the phenotype caused by gene mutation became detectable. Thus, it became possible by this detection method to make analysis of radiation induced gene mutation in a plasmid and its frequency. (M.N.)

  15. Pathogen sensing pathways in human embryonic stem cell derived-endothelial cells: role of NOD1 receptors.

    Directory of Open Access Journals (Sweden)

    Daniel M Reed

    Full Text Available Human embryonic stem cell-derived endothelial cells (hESC-EC, as well as other stem cell derived endothelial cells, have a range of applications in cardiovascular research and disease treatment. Endothelial cells sense Gram-negative bacteria via the pattern recognition receptors (PRR Toll-like receptor (TLR-4 and nucleotide-binding oligomerisation domain-containing protein (NOD-1. These pathways are important in terms of sensing infection, but TLR4 is also associated with vascular inflammation and atherosclerosis. Here, we have compared TLR4 and NOD1 responses in hESC-EC with those of endothelial cells derived from other stem cells and with human umbilical vein endothelial cells (HUVEC. HUVEC, endothelial cells derived from blood progenitors (blood outgrowth endothelial cells; BOEC, and from induced pluripotent stem cells all displayed both a TLR4 and NOD1 response. However, hESC-EC had no TLR4 function, but did have functional NOD1 receptors. In vivo conditioning in nude rats did not confer TLR4 expression in hESC-EC. Despite having no TLR4 function, hESC-EC sensed Gram-negative bacteria, a response that was found to be mediated by NOD1 and the associated RIP2 signalling pathways. Thus, hESC-EC are TLR4 deficient but respond to bacteria via NOD1. This data suggests that hESC-EC may be protected from unwanted TLR4-mediated vascular inflammation, thus offering a potential therapeutic advantage.

  16. Structure and function of a unique pore-forming protein from a pathogenic acanthamoeba

    NARCIS (Netherlands)

    Michalek, M.; Sönnichsen, F.D.; Wechselberger, R.W.; Wienk, H.L.J.; Leippe, M.; et al., [No Value

    2013-01-01

    Human pathogens often produce soluble protein toxins that generate pores inside membranes, resulting in the death of target cells and tissue damage. In pathogenic amoebae, this has been exemplified with amoebapores of the enteric protozoan parasite Entamoeba histolytica. Here we characterize acantha

  17. Expression System Based on an MTIIa Promoter to Produce hPSA in Mammalian Cell Cultures.

    Science.gov (United States)

    Santos, Anderson K; Parreira, Ricardo C; Resende, Rodrigo R

    2016-01-01

    Because of the limitations of standard culture techniques, the development of new recombinant protein expression systems with biotechnological potential is a key challenge. Ideally, such systems should be able to effectively and accurately synthesize a protein of interest with intrinsic metabolic capacity. Here, we describe such a system that was designed based on a plasmid vector containing promoter elements derived from the metallothionein MTIIa promoter, as well as processing and purification elements. This promoter can be induced by heavy metals in a culture medium to induce the synthesis of human prostate-specific antigen (hPSA), which has been modified to insert elements for purification, proteolysis, and secretion. We optimized hPSA production in this system by comparing the effects and contributions of ZnCl2, CdCl2, and CuSO4 in HEK293FT, HeLa, BHK-21, and CHO-K1 cells. We also compared the effectiveness of three different transfection agents: multi-walled carbon nanotubes, Lipofectamine 2000, and X-tremeGENE HP Reagent. hPSA production was confirmed via the detection of enhanced green fluorescent protein fluorescence, and cell viability was determined. The expression of hPSA was compared with that of the native protein produced by LNCaP cells, using enzyme-linked immunosorbent assay and sodium dodecyl sulfate polyacrylamide gel electrophoresis. X-tremeGENE reagent, the BHK-21 cell line, and CuSO4 showed the highest hPSA production rates. Furthermore, BHK-21 cells were more resistant to the oxidative stress caused by 100 μM CuSO4. These results suggest that the proposed optimized inducible expression system can effectively produce recombinant proteins with desired characteristics for a wide range of applications in molecular biology. PMID:27582737

  18. Expression System Based on an MTIIa Promoter to Produce hPSA in Mammalian Cell Cultures

    Science.gov (United States)

    Santos, Anderson K.; Parreira, Ricardo C.; Resende, Rodrigo R.

    2016-01-01

    Because of the limitations of standard culture techniques, the development of new recombinant protein expression systems with biotechnological potential is a key challenge. Ideally, such systems should be able to effectively and accurately synthesize a protein of interest with intrinsic metabolic capacity. Here, we describe such a system that was designed based on a plasmid vector containing promoter elements derived from the metallothionein MTIIa promoter, as well as processing and purification elements. This promoter can be induced by heavy metals in a culture medium to induce the synthesis of human prostate-specific antigen (hPSA), which has been modified to insert elements for purification, proteolysis, and secretion. We optimized hPSA production in this system by comparing the effects and contributions of ZnCl2, CdCl2, and CuSO4 in HEK293FT, HeLa, BHK-21, and CHO-K1 cells. We also compared the effectiveness of three different transfection agents: multi-walled carbon nanotubes, Lipofectamine 2000, and X-tremeGENE HP Reagent. hPSA production was confirmed via the detection of enhanced green fluorescent protein fluorescence, and cell viability was determined. The expression of hPSA was compared with that of the native protein produced by LNCaP cells, using enzyme-linked immunosorbent assay and sodium dodecyl sulfate polyacrylamide gel electrophoresis. X-tremeGENE reagent, the BHK-21 cell line, and CuSO4 showed the highest hPSA production rates. Furthermore, BHK-21 cells were more resistant to the oxidative stress caused by 100 μM CuSO4. These results suggest that the proposed optimized inducible expression system can effectively produce recombinant proteins with desired characteristics for a wide range of applications in molecular biology. PMID:27582737

  19. Expression system based on an MTIIa promoter to produce hPSA in mammalian cell cultures

    Directory of Open Access Journals (Sweden)

    Anderson K Santos

    2016-08-01

    Full Text Available Because of the limitations of standard culture techniques, the development of new recombinant protein expression systems with biotechnological potential is a key challenge. Ideally, such systems should be able to effectively and accurately synthesize a protein of interest with intrinsic metabolic capacity. Here, we describe such a system that was designed based on a plasmid vector containing promoter elements derived from the metallothionein MTIIa promoter, as well as processing and purification elements. This promoter can be induced by heavy metals in a culture medium to induce the synthesis of human prostate-specific antigen (hPSA, which has been modified to insert elements for purification, proteolysis, and secretion. We optimized hPSA production in this system by comparing the effects and contributions of ZnCl2, CdCl2, and CuSO4 in HEK293FT, HeLa, BHK-21, and CHO-K1 cells. We also compared the effectiveness of three different transfection agents: multi-walled carbon nanotubes, Lipofectamine 2000, and X-tremeGENE HP Reagent. hPSA production was confirmed via the detection of enhanced green fluorescent protein fluorescence, and cell viability was determined. The expression of hPSA was compared with that of the native protein produced by LNCaP cells, using enzyme-linked immunosorbent assay and sodium dodecyl sulphate polyacrylamide gel electrophoresis. X-tremeGENE reagent, the BHK-21 cell line, and CuSO4 showed the highest hPSA production rates. Furthermore, BHK-21 cells were more resistant to the oxidative stress caused by 100 μM CuSO4. These results suggest that the proposed optimized inducible expression system can effectively produce recombinant proteins with desired characteristics for a wide range of applications in molecular biology.

  20. HCN Producing Bacteria Enable Sensing Of Non-Bioavailable Hg Species by the Whole Cell Biosensor

    Science.gov (United States)

    Horvat, M.; Rijavec, T.; Koron, N.; Lapanje, A.

    2015-12-01

    Bacteria play an important role in Hg transformation reactions. The production of cyanide (HCN) and other secondary metabolites seems to be key elements involved in these transformations. Current hypotheses link the role of HCN production to growth inhibition of nonHCN producing competitor organisms (role of an antimicrobial agent). Our past investigations showed that HCN production did not correlate with antimicrobial activity and since pK value of HCN is very high (pK = 9,21), it can be expected that most of the produced HCN is removed from the microenvironment. This way, the expected inhibitory concentrations can hardly be reached. Accordingly, we proposed a new concept, where the ability of complexation of transient metals by HCN served as a regulation process for the accessibility of micro-elements. In our study, we focused on the presence of HCN producing bacteria and carried it out in the Hg contaminated environment connected to the Idrija Mercury Mine, Slovenia. We characterised the isolates according to the presence of Hg resistance (HgR), level of HCN production and genetic similarities. In laboratory setups, using our merR whole cell based biosensor, we determined the transformation of low bioavailable Hg0 and HgS forms into bioavailable Hg by these HCN producing bacteria. We observed that HgR strains producing HCN had the highest impact on increased Hg bioavailability. In the proposed ecological strategy HgR HCN producing bacteria increase their competitive edge over non-HgR competitors through the increase of Hg toxicity. Due to their activity, Hg is made available to other organisms as well and thus enters into the ecosystem. Finally, using some of the characteristics of bacteria (e.g. Hg resistance genetic elements), we developed a fully automated sensing approach, combining biosensorics and mechatronics, to measure the bioavailability of Hg in situ.

  1. Pathogenic LRRK2 mutations do not alter gene expression in cell model systems or human brain tissue.

    Directory of Open Access Journals (Sweden)

    Michael J Devine

    Full Text Available Point mutations in LRRK2 cause autosomal dominant Parkinson's disease. Despite extensive efforts to determine the mechanism of cell death in patients with LRRK2 mutations, the aetiology of LRRK2 PD is not well understood. To examine possible alterations in gene expression linked to the presence of LRRK2 mutations, we carried out a case versus control analysis of global gene expression in three systems: fibroblasts isolated from LRRK2 mutation carriers and healthy, non-mutation carrying controls; brain tissue from G2019S mutation carriers and controls; and HEK293 inducible LRRK2 wild type and mutant cell lines. No significant alteration in gene expression was found in these systems following correction for multiple testing. These data suggest that any alterations in basal gene expression in fibroblasts or cell lines containing mutations in LRRK2 are likely to be quantitatively small. This work suggests that LRRK2 is unlikely to play a direct role in modulation of gene expression, although it remains possible that this protein can influence mRNA expression under pathogenic cicumstances.

  2. Identification of hop polyphenolic components which inhibit prostaglandin E2 production by gingival epithelial cells stimulated with periodontal pathogen.

    Science.gov (United States)

    Inaba, Hiroaki; Tagashira, Motoyuki; Honma, Daiki; Kanda, Tomomasa; Kou, Yurong; Ohtake, Yasuyuki; Amano, Atsuo

    2008-03-01

    Chronic marginal periodontitis is a destructive inflammatory disease caused by an imbalance between bacterial virulence and host defense ability, resulting in eventual tooth exfoliation. Porphyromonas gingivalis, a major periodontal pathogen, triggers a series of cellular inflammatory responses including the production of prostaglandin E2 (PGE2), which causes periodontal destruction; thus, anti-inflammatory reagents are considered beneficial for periodontal therapy. In the present study, we examined whether hop- and apple-derived polyphenols (HBP and ACT, respectively) inhibit PGE2 production by human gingival epithelial (HGE) cells stimulated with P. gingivalis components. HGE cells were stimulated with P. gingivalis membrane vesicles, and the effects of HBP, ACT and epigallocatechin gallate (EGCg) on PGE2 production by HGE cells were evaluated using an enzyme-linked immunosorbent assay. HBP and EGCg significantly inhibited PGE2 production, whereas ACT did not. By further fractionation steps of HBP to identify the effective components, 3 components of HBP, 2-[(2-methylpropanoyl)-phloroglucinol]1-O-beta-D-glucopyranoside (MPPG), quercetin 3-O-beta-D-glucopyranoside (isoquercitrin), and kaempferol 3-O-beta-glucopyranoside (astragalin), were found to be elements which significantly inhibited cellular PGE2 production. These results suggest that HBP is a potent inhibitor of cellular PGE2 production induced by P. gingivalis, and HBP may be useful for the prevention and attenuation of periodontitis. PMID:18310924

  3. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    Energy Technology Data Exchange (ETDEWEB)

    Ramadan, Qasem, E-mail: qasem.alramadan@epfl.ch [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore); Christophe, Lay; Teo, William; ShuJun, Li; Hua, Feng Han [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore)

    2010-07-12

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  4. Shale gas produced water treatment using innovative microbial capacitive desalination cell.

    Science.gov (United States)

    Stoll, Zachary A; Forrestal, Casey; Ren, Zhiyong Jason; Xu, Pei

    2015-01-01

    The rapid development of unconventional oil and gas production has generated large amounts of wastewater for disposal, raising significant environmental and public health concerns. Treatment and beneficial use of produced water presents many challenges due to its high concentrations of petroleum hydrocarbons and salinity. The objectives of this study were to investigate the feasibility of treating actual shale gas produced water using a bioelectrochemical system integrated with capacitive deionization-a microbial capacitive desalination cell (MCDC). Microbial degradation of organic compounds in the anode generated an electric potential that drove the desalination of produced water. Sorption and biodegradation resulted in a combined organic removal rate of 6.4 mg dissolved organic carbon per hour in the reactor, and the MCDC removed 36 mg salt per gram of carbon electrode per hour from produced water. This study is a proof-of-concept that the MCDC can be used to combine organic degradation with desalination of contaminated water without external energy input. PMID:25464328

  5. Metabolic analysis of antibody producing Chinese hamster ovary cell culture under different stresses conditions.

    Science.gov (United States)

    Badsha, Md Bahadur; Kurata, Hiroyuki; Onitsuka, Masayoshi; Oga, Takushi; Omasa, Takeshi

    2016-07-01

    Chinese hamster ovary (CHO) cells are commonly used as the host cell lines concerning their ability to produce therapeutic proteins with complex post-translational modifications. In this study, we have investigated the time course extra- and intracellular metabolome data of the CHO-K1 cell line, under a control and stress conditions. The addition of NaCl and trehalose greatly suppressed cell growth, where the maximum viable cell density of NaCl and trehalose cultures were 2.2-fold and 2.8-fold less than that of a control culture. Contrariwise, the antibody production of both the NaCl and trehalose cultures was sustained for a longer time to surpass that of the control culture. The NaCl and trehalose cultures showed relatively similar dynamics of cell growth, antibody production, and substrate/product concentrations, while they indicated different dynamics from the control culture. The principal component analysis of extra- and intracellular metabolome dynamics indicated that their dynamic behaviors were consistent with biological functions. The qualitative pattern matching classification and hierarchical clustering analyses for the intracellular metabolome identified the metabolite clusters whose dynamic behaviors depend on NaCl and trehalose. The volcano plot revealed several reporter metabolites whose dynamics greatly change between in the NaCl and trehalose cultures. The elastic net identified some critical, intracellular metabolites that are distinct between the NaCl and trehalose. While a relatively small number of intracellular metabolites related to the cell growth, glucose, glutamine, lactate and ammonium ion concentrations, the mechanism of antibody production was suggested to be very complicated or not to be explained by elastic net regression analysis. PMID:26803706

  6. A novel method for producing target cells and assessing cytotoxic T lymphocyte activity in outbred hosts

    Directory of Open Access Journals (Sweden)

    Bendinelli Mauro

    2009-03-01

    Full Text Available Abstract Background Cytotoxic T lymphocytes play a crucial role in the immunological control of microbial infections and in the design of vaccines and immunotherapies. Measurement of cytotoxic T lymphocyte activity requires that the test antigen is presented by target cells having the same or compatible class I major hystocompatibility complex antigens as the effector cells. Conventional assays use target cells labeled with 51chromium and infer cytotoxic T lymphocyte activity by measuring the isotope released by the target cells lysed following incubation with antigen-specific cytotoxic T lymphocytes. This assay is sensitive but needs manipulation and disposal of hazardous radioactive reagents and provides a bulk estimate of the reporter released, which may be influenced by spontaneous release of the label and other poorly controllable variables. Here we describe a novel method for producing target in outbred hosts and assessing cytotoxic T lymphocyte activity by flow cytometry. Results The method consists of culturing skin fibroblasts, immortalizing them with a replication defective clone of simian virus 40, and finally transducing them with a bicistronic vector encoding the target antigen and the reporter green fluorescent protein. When used in a flow cytometry-based assay, the target cells obtained with this method proved valuable for assessing the viral envelope protein specific cytotoxic T lymphocyte activity in domestic cats acutely or chronically infected with feline immunodeficiency virus, a lentivirus similar to human immunodeficiency virus and used as animal model for AIDS studies. Conclusion Given the versatility of the bicistronic vector used, its ability to deliver multiple and large transgenes in target cells, and its extremely wide cell specificity when pseudotyped with the vesicular stomatitis virus envelope protein, the method is potentially exploitable in many animal species.

  7. 3 dimensional cell cultures: a comparison between manually and automatically produced alginate beads.

    Science.gov (United States)

    Lehmann, R; Gallert, C; Roddelkopf, T; Junginger, S; Wree, A; Thurow, K

    2016-08-01

    Cancer diseases are a common problem of the population caused by age and increased harmful environmental influences. Herein, new therapeutic strategies and compound screenings are necessary. The regular 2D cultivation has to be replaced by three dimensional cell culturing (3D) for better simulation of in vivo conditions. The 3D cultivation with alginate matrix is an appropriate method for encapsulate cells to form cancer constructs. The automated manufacturing of alginate beads might be an ultimate method for large-scaled manufacturing constructs similar to cancer tissue. The aim of this study was the integration of full automated systems for the production, cultivation and screening of 3D cell cultures. We compared the automated methods with the regular manual processes. Furthermore, we investigated the influence of antibiotics on these 3D cell culture systems. The alginate beads were formed by automated and manual procedures. The automated steps were processes by the Biomek(®) Cell Workstation (celisca, Rostock, Germany). The proliferation and toxicity were manually and automatically evaluated at day 14 and 35 of cultivation. The results visualized an accumulation and expansion of cell aggregates over the period of incubation. However, the proliferation and toxicity were faintly and partly significantly decreased on day 35 compared to day 14. The comparison of the manual and automated methods displayed similar results. We conclude that the manual production process could be replaced by the automation. Using automation, 3D cell cultures can be produced in industrial scale and improve the drug development and screening to treat serious illnesses like cancer.

  8. IFN-γ and IL-21 Double Producing T Cells Are Bcl6-Independent and Survive into the Memory Phase in Plasmodium chabaudi Infection.

    Directory of Open Access Journals (Sweden)

    Victor H Carpio

    Full Text Available CD4 T cells are required to fight malaria infection by promoting both phagocytic activity and B cell responses for parasite clearance. In Plasmodium chabaudi infection, one specific CD4 T cell subset generates anti-parasitic IFN-γ and the antibody-promoting cytokine, IL-21. To determine the lineage of these multifunctional T cells, we followed IFN-γ+ effector T cells (Teff into the memory phase using Ifng-reporter mice. While Ifng+ Teff expanded, the level of the Th1 lineage-determining transcription factor T-bet only peaked briefly. Ifng+ Teff also co-express ICOS, the B cell area homing molecule CXCR5, and other Tfh lineage-associated molecules including Bcl6, the transcription factor required for germinal center (GC T follicular helper cells (Tfh differentiation. Because Bcl6 and T-bet co-localize to the nucleus of Ifng+ Teff, we hypothesized that Bcl6 controls the Tfh-like phenotype of Ifng+ Teff cells in P. chabaudi infection. We first transferred Bcl6-deficient T cells into wildtype hosts. Bcl6-deficient T cells did not develop into GC Tfh, but they still generated CXCR5+ IFN-γ+ IL-21+ IL-10+ Teff, suggesting that this predominant population is not of the Tfh-lineage. IL-10 deficient mice, which have increased IFN-γ and T-bet expression, demonstrated expansion of both IFN-γ+ IL-21+ CXCR5+ cells and IFN-γ+ GC Tfh cells, suggesting a Th1 lineage for the former. In the memory phase, all Ifng+ T cells produced IL-21, but only a small percentage of highly proliferative Ifng+ T cells maintained a T-bethi phenotype. In chronic malaria infection, serum IFN-γ correlates with increased protection, and our observation suggests Ifng+ T cells are maintained by cellular division. In summary, we found that Ifng+ T cells are not strictly Tfh derived during malaria infection. T cells provide the host with a survival advantage when facing this well-equipped pathogen, therefore, understanding the lineage of pivotal T cell players will aid in the

  9. A closer look at opposing models for the T cell response to pathogens

    Science.gov (United States)

    Hanson, Shalla

    2016-06-01

    The problem of understanding the mechanisms of differentiation, activation, and interconversion of phenotypes of CD8+ T cells is one of crucial importance in cancer therapy, owing to both the anti-tumor efficacy of CD8+ T cells as well as the severe toxicity that results from excess expansion of this population. Several opposing theories exist which describe potential pathways for the development of the CD8+ T cell repertoire; however, the accuracy of each remains controversial. Here we review the current hypotheses, provide a critical overview of pivotal biological data from which these theories are derived, and discuss principle population-level implications. Finally, we offer a novel hypothesis which maintains consistency with each of the experimental studies and seeks to unify the currently opposing but not so disparate theories.

  10. Dendritic Cells in Systemic Lupus Erythematosus: From Pathogenic Players to Therapeutic Tools.

    Science.gov (United States)

    Klarquist, Jared; Zhou, Zhenyuan; Shen, Nan; Janssen, Edith M

    2016-01-01

    System lupus erythematosus (SLE) is a multifactorial systemic autoimmune disease with a wide variety of presenting features. SLE is believed to result from dysregulated immune responses, loss of tolerance of CD4 T cells and B cells to ubiquitous self-antigens, and the subsequent production of anti-nuclear and other autoreactive antibodies. Recent research has associated lupus development with changes in the dendritic cell (DC) compartment, including altered DC subset frequency and localization, overactivation of mDCs and pDCs, and functional defects in DCs. Here we discuss the current knowledge on the role of DC dysfunction in SLE pathogenesis, with the focus on DCs as targets for interventional therapies. PMID:27122656

  11. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    DEFF Research Database (Denmark)

    Søndergaard, Jonas Nørskov

    for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response...... that Mtb induces signaling in moDCs that misdirects the immune response into an extracellular Th17 response, even though the bacteria hide inside immune cells. Finally it is demonstrated how HIV-1 strains, capable of provoking sustained infection, induce a highmannose-independent complete necrotic...

  12. Influence of 5 major Salmonella pathogenicity islands on NK cell depletion in mice infected with Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Ondrackova Petra

    2010-03-01

    Full Text Available Abstract Background In this study we were interested in the colonisation and early immune response of Balb/C mice to infection with Salmonella Enteritidis and isogenic pathogenicity island free mutants. Results The virulence of S. Enteritidis for Balb/C mice was exclusively dependent on intact SPI-2. Infections with any of the mutants harbouring SPI-2 (including the mutant in which we left only SPI-2 but removed SPI-1, SPI-3, SPI-4 and SPI-5 resulted in fatalities, liver injures and NK cell depletion from the spleen. The infection was of minimal influence on counts of splenic CD4 CD8 T lymphocytes and γδ T-lymphocytes although a reduced ability of splenic lymphocytes to respond to non-specific mitogens indicated general immunosuppression in mice infected with SPI-2 positive S. Enteritidis mutants. Further investigations showed that NK cells were depleted also in blood but not in the caecal lamina propria. However, NK cell depletion was not directly associated with the presence of SPI-2 and was rather an indicator of virulence or avirulence of a particular mutant because the depletion was not observed in mice infected with other attenuated mutants such as lon and rfaL. Conclusions The virulence of S. Enteritidis for Balb/C mice is exclusively dependent on the presence of SPI-2 in its genome, and a major hallmark of the infection in terms of early changes in lymphocyte populations is the depletion of NK cells in spleen and blood. The decrease of NK cells in circulation can be used as a marker of attenuation of S. Enteritidis mutants for Balb/C mice.

  13. IL-11 produced by breast cancer cells augments osteoclastogenesis by sustaining the pool of osteoclast progenitor cells

    Directory of Open Access Journals (Sweden)

    McCoy Erin M

    2013-01-01

    Full Text Available Abstract Background Interleukin (IL-11, a cytokine produced by breast cancer, has been implicated in breast cancer-induced osteolysis (bone destruction but the mechanism(s of action remain controversial. Some studies show that IL-11 is able to promote osteoclast formation independent of the receptor activator of NF-κB ligand (RANKL, while others demonstrate IL-11 can induce osteoclast formation by inducing osteoblasts to secrete RANKL. This work aims to further investigate the role of IL-11 in metastasis-induced osteolysis by addressing a new hypothesis that IL-11 exerts effects on osteoclast progenitor cells. Methods To address the precise role of breast cancer-derived IL-11 in osteoclastogenesis, we determined the effect of breast cancer conditioned media on osteoclast progenitor cells with or without an IL-11 neutralizing antibody. We next investigated whether recombinant IL-11 exerts effects on osteoclast progenitor cells and survival of mature osteoclasts. Finally, we examined the ability of IL-11 to mediate osteoclast formation in tissue culture dishes and on bone slices in the absence of RANKL, with suboptimal levels of RANKL, or from RANKL-pretreated murine bone marrow macrophages (BMMs. Results We found that freshly isolated murine bone marrow cells cultured in the presence of breast cancer conditioned media for 6 days gave rise to a population of cells which were able to form osteoclasts upon treatment with RANKL and M-CSF. Moreover, a neutralizing anti-IL-11 antibody significantly inhibited the ability of breast cancer conditioned media to promote the development and/or survival of osteoclast progenitor cells. Similarly, recombinant IL-11 was able to sustain a population of osteoclast progenitor cells. However, IL-11 was unable to exert any effect on osteoclast survival, induce osteoclastogenesis independent of RANKL, or promote osteoclastogenesis in suboptimal RANKL conditions. Conclusions Our data indicate that a IL-11 plays an

  14. Selection of a Streptomyces strain able to produce cell wall degrading enzymes and active against Sclerotinia sclerotiorum.

    Science.gov (United States)

    Fróes, Adriana; Macrae, Andrew; Rosa, Juliana; Franco, Marcella; Souza, Rodrigo; Soares, Rosângela; Coelho, Rosalie

    2012-10-01

    Control of plant pathogen Sclerotinia sclerotiorum is an ongoing challenge because of its wide host range and the persistence of its sclerotia in soil. Fungicides are the most commonly used method to control this fungus but these can have ecotoxicity impacts. Chitinolytic Streptomyces strains isolated from Brazilian tropical soils were capable of inhibiting S. sclerotiorum growth in vitro, offering new possibilities for integrated pest management and biocontrol, with a new approach to dealing with an old problem. Strain Streptomyces sp. 80 was capable of irreversibly inhibiting fungal growth. Compared to other strains, its crude enzymes had the highest chitinolytic levels when measured at 25°C and strongly inhibited sclerotia from S. sclerotiorum. It produced four hydrolytic enzymes involved in fungal cell wall degradation when cultured in presence of the fungal mycelium. The best production, obtained after three days, was 0.75 U/ml for exochitinase, 0.9 U/ml for endochitinase, 0.16 U/ml for glucanase, and 1.78 U/ml for peptidase. Zymogram analysis confirmed two hydrolytic bands of chitinolytic activity with apparent molecular masses of 45.8 and 206.8 kDa. One glucanase activity with an apparent molecular mass of 55 kDa was also recorded, as well as seven bands of peptidase activity with apparent molecular masses ranging from 15.5 to 108.4 kDa. Differential interference contrast microscopy also showed alterations of hyphal morphology after co-culture. Streptomyces sp. 80 seems to be promising as a biocontrol agent against S. sclerotiorum, contributing to the development of new methods for controlling plant diseases and reducing the negative impact of using fungicides. PMID:23124748

  15. Interferon-¿ production by human T cells and natural killer cells in vitro in response to antigens from the two intracellular pathogens Mycobacterium tuberculosis and Leishmania major

    DEFF Research Database (Denmark)

    Kemp, K; Hviid, L; Kharazmi, A;

    1997-01-01

    protein derivative of tuberculin (PPD) and Leishmania antigens. It was found that IFN-gamma was produced in response to both PPD and Leishmania stimulant by T cells in the cultures. Activation of IFN-gamma producing natural killer (NK) cells was demonstrated only in some cultures, and only......Acquired resistance to both mycobacteria and Leishmania is primarily mediated by interferon-gamma (IFN-gamma), which triggers mechanisms leading to the death of the microorganism in macrophages. In this study, cell activation and IFN-gamma production was investigated in human peripheral blood...... mononuclear cells (PBMC) from individuals previously sensitized to tuberculin and without known exposure to Leishmania parasites. Immune staining for intracellular IFN-gamma and surface markers allowed flow cytometric identification of the cellular sources of IFN-gamma in cell cultures incubated with purified...

  16. A member of the cathelicidin family of antimicrobial peptides is produced in the upper airway of the chinchilla and its mRNA expression is altered by common viral and bacterial co-pathogens of otitis media.

    Science.gov (United States)

    McGillivary, Glen; Ray, William C; Bevins, Charles L; Munson, Robert S; Bakaletz, Lauren O

    2007-03-01

    Cationic antimicrobial peptides (AMPs), a component of the innate immune system, play a major role in defense of mucosal surfaces against a wide spectrum of microorganisms such as viral and bacterial co-pathogens of the polymicrobial disease otitis media (OM). To further understand the role of AMPs in OM, we cloned a cDNA encoding a cathelicidin homolog (cCRAMP) from upper respiratory tract (URT) mucosae of the chinchilla, the predominant host used to model experimental OM. Recombinant cCRAMP exhibited alpha-helical secondary structure and killed the three main bacterial pathogens of OM. In situ hybridization showed cCRAMP mRNA production in epithelium of the chinchilla Eustachian tube and RT-PCR was used to amplify cCRAMP mRNA from several other tissues of the chinchilla URT. Quantitative RT-PCR analysis of chinchilla middle ear epithelial cells (CMEEs) incubated with either viral (influenza A virus, adenovirus, or RSV) or bacterial (nontypeable H. influenzae, M. catarrhalis, or S. pneumoniae) pathogens associated with OM demonstrated distinct microbe-specific patterns of altered expression. Collectively, these data showed that viruses and bacteria modulate AMP messages in the URT, which likely contributes to the disease course of OM.

  17. Pathogen Phytosensing: Plants to Report Plant Pathogens

    Directory of Open Access Journals (Sweden)

    C. Neal Stewart

    2008-04-01

    Full Text Available Real-time systems that provide evidence of pathogen contamination in crops can be an important new line of early defense in agricultural centers. Plants possess defense mechanisms to protect against pathogen attack. Inducible plant defense is controlled by signal transduction pathways, inducible promoters and cis-regulatory elements corresponding to key genes involved in defense, and pathogen-specific responses. Identified inducible promoters and cis-acting elements could be utilized in plant sentinels, or ‘phytosensors’, by fusing these to reporter genes to produce plants with altered phenotypes in response to the presence of pathogens. Here, we have employed cis-acting elements from promoter regions of pathogen inducible genes as well as those responsive to the plant defense signal molecules salicylic acid, jasmonic acid, and ethylene. Synthetic promoters were constructed by combining various regulatory elements supplemented with the enhancer elements from the Cauliflower mosaic virus (CaMV 35S promoter to increase basal level of the GUS expression. The inducibility of each synthetic promoter was first assessed in transient expression assays using Arabidopsis thaliana protoplasts and then examined for efficacy in stably transgenic Arabidopsis and tobacco plants. Histochemical and fluorometric GUS expression analyses showed that both transgenic Arabidopsis and tobacco plants responded to elicitor and phytohormone treatments with increased GUS expression when compared to untreated plants. Pathogen-inducible phytosensor studies were initiated by analyzing the sensitivity of the synthetic promoters against virus infection. Transgenic tobacco plants infected with Alfalfa mosaic virus showed an increase in GUS expression when compared to mock-inoculated control plants, whereas Tobacco mosaic virus infection caused no changes in GUS expression. Further research, using these transgenic plants against a range of different

  18. Effective chikungunya virus-like particle vaccine produced in insect cells.

    Directory of Open Access Journals (Sweden)

    Stefan W Metz

    Full Text Available The emerging arthritogenic, mosquito-borne chikungunya virus (CHIKV causes severe disease in humans and represents a serious public health threat in countries where Aedes spp mosquitoes are present. This study describes for the first time the successful production of CHIKV virus-like particles (VLPs in insect cells using recombinant baculoviruses. This well-established expression system is rapidly scalable to volumes required for epidemic responses and proved well suited for processing of CHIKV glycoproteins and production of enveloped VLPs. Herein we show that a single immunization with 1 µg of non-adjuvanted CHIKV VLPs induced high titer neutralizing antibody responses and provided complete protection against viraemia and joint inflammation upon challenge with the Réunion Island CHIKV strain in an adult wild-type mouse model of CHIKV disease. CHIKV VLPs produced in insect cells using recombinant baculoviruses thus represents as a new, safe, non-replicating and effective vaccine candidate against CHIKV infections.

  19. The observation of damage regions produced by neutron irradiation in lithium-doped silicon solar cells.

    Science.gov (United States)

    Ghosh, S.; Sargent, G. A.

    1972-01-01

    Study regions of lattice disorder produced in lithium-doped float-zone melted n/p-type silicon solar cells by irradiation with monoenergetic neutrons at doses between 10 to the 10th and 10 to the 13th per cu cm. The defect regions were revealed by chemically etching the surface of the solar cells and by observing carbon replicas in an electron microscope. It was found that the defect density increased with increasing irradiation dose and increased lithium content, whereas the average defect diameter was found to decrease. From thermal annealing experiments it was found that in the lithium-doped material the defect structure was stable at temperatures between 300 and 1200 K. This was found to be in contrast to the undoped material where at the lowest doses considerable annealing was observed to occur. These results are discussed in terms of the theoretical predictions and models of defect clusters proposed by Gossick (1959) and Crawford and Cleland (1959).

  20. Network model explains why cancer cells use inefficient pathway to produce energy

    Science.gov (United States)

    Lee, Joo Sang; Marko, John; Motter, Adilson

    2012-02-01

    The Warburg effect---the use of the (energetically inefficient) fermentative pathway as opposed to (energetically efficient) respiration even in the presence of oxygen---is a common property of cancer metabolism. Here, we propose that the Warburg effect is in fact a consequence of a trade-off between the benefit of rapid growth and the cost for protein synthesis. Using genome-scale metabolic networks, we have modeled the cellular resources for protein synthesis as a growth defect that increases with enzyme concentration. Based on our model, we demonstrate that the cost of protein production during rapid growth drives the cell to rely on fermentation to produce ATP. We also identify an intimate link between extensive fermentation and rapid biosynthesis. Our findings emphasize the importance of protein synthesis as a limiting factor on cell proliferation and provide a novel mathematical framework to analyze cancer metabolism.

  1. Insulin-Producing Cells Differentiated from Human Bone Marrow Mesenchymal Stem Cells In Vitro Ameliorate Streptozotocin-Induced Diabetic Hyperglycemia.

    Directory of Open Access Journals (Sweden)

    Ying Xin

    Full Text Available The two major obstacles in the successful transplantation of islets for diabetes treatment are inadequate supply of insulin-producing tissue and immune rejection. Induction of the differentiation of human bone marrow-derived mesenchymal stem cells (hMSCs into insulin-producing cells (IPCs for autologous transplantation may alleviate those limitations.hMSCs were isolated and induced to differentiate into IPCs through a three-stage differentiation protocol in a defined media with high glucose, nicotinamide, and exendin-4. The physiological characteristics and functions of IPCs were then evaluated. Next, about 3 × 10(6 differentiated cells were transplanted into the renal sub-capsular space of streptozotocin (STZ-induced diabetic nude mice. Graft survival and function were assessed by immunohistochemistry, TUNEL staining and measurements of blood glucose levels in the mice.The differentiated IPCs were characterized by Dithizone (DTZ positive staining, expression of pancreatic β-cell markers, and human insulin secretion in response to glucose stimulation. Moreover, 43% of the IPCs showed L-type Ca2+ channel activity and similar changes in intracellular Ca2+ in response to glucose stimulation as that seen in pancreatic β-cells in the process of glucose-stimulated insulin secretion. Transplantation of functional IPCs into the renal subcapsular space of STZ-induced diabetic nude mice ameliorated the hyperglycemia. Immunofluorescence staining revealed that transplanted IPCs sustainably expressed insulin, c-peptide, and PDX-1 without apparent apoptosis in vivo.IPCs derived from hMSCs in vitro can ameliorate STZ-induced diabetic hyperglycemia, which indicates that these hMSCs may be a promising approach to overcome the limitations of islet transplantation.

  2. Amino acid consumption in naïve and recombinant CHO cell cultures: producers of a monoclonal antibody

    OpenAIRE

    Carrillo-Cocom, L. M.; Genel-Rey, T.; Araíz-Hernández, D.; López-Pacheco, F.; López-Meza, J.; Rocha-Pizaña, M. R.; Ramírez-Medrano, A.; Alvarez, M. M.

    2014-01-01

    Most commercial media for mammalian cell culture are designed to satisfy the amino acid requirements for cell growth, but not necessarily those for recombinant protein production. In this study, we analyze the amino acid consumption pattern in naïve and recombinant Chinese hamster ovary (CHO) cell cultures. The recombinant model we chose was a CHO-S cell line engineered to produce a monoclonal antibody. We report the cell concentration, product concentration, and amino acid concentration prof...

  3. Drosophila adiponectin receptor in insulin producing cells regulates glucose and lipid metabolism by controlling insulin secretion.

    Directory of Open Access Journals (Sweden)

    Su-Jin Kwak

    Full Text Available Adipokines secreted from adipose tissue are key regulators of metabolism in animals. Adiponectin, one of the adipokines, modulates pancreatic beta cell function to maintain energy homeostasis. Recently, significant conservation between Drosophila melanogaster and mammalian metabolism has been discovered. Drosophila insulin like peptides (Dilps regulate energy metabolism similarly to mammalian insulin. However, in Drosophila, the regulatory mechanism of insulin producing cells (IPCs by adipokine signaling is largely unknown. Here, we describe the discovery of the Drosophila adiponectin receptor and its function in IPCs. Drosophila adiponectin receptor (dAdipoR has high homology with the human adiponectin receptor 1. The dAdipoR antibody staining revealed that dAdipoR was expressed in IPCs of larval and adult brains. IPC- specific dAdipoR inhibition (Dilp2>dAdipoR-Ri showed the increased sugar level in the hemolymph and the elevated triglyceride level in whole body. Dilps mRNA levels in the Dilp2>dAdipoR-Ri flies were similar with those of controls. However, in the Dilp2>dAdipoR-Ri flies, Dilp2 protein was accumulated in IPCs, the level of circulating Dilp2 was decreased, and insulin signaling was reduced in the fat body. In ex vivo fly brain culture with the human adiponectin, Dilp2 was secreted from IPCs. These results indicate that adiponectin receptor in insulin producing cells regulates insulin secretion and controls glucose and lipid metabolism in Drosophila melanogaster. This study demonstrates a new adipokine signaling in Drosophila and provides insights for the mammalian adiponectin receptor function in pancreatic beta cells, which could be useful for therapeutic application.

  4. In vivo ectopic bone formation by devitalized mineralized stem cell carriers produced under mineralizing culture condition.

    Science.gov (United States)

    Chai, Yoke Chin; Geris, Liesbet; Bolander, Johanna; Pyka, Grzegorz; Van Bael, Simon; Luyten, Frank P; Schrooten, Jan

    2014-12-01

    Functionalization of tissue engineering scaffolds with in vitro-generated bone-like extracellular matrix (ECM) represents an effective biomimetic approach to promote osteogenic differentiation of stem cells in vitro. However, the bone-forming capacity of these constructs (seeded with or without cells) is so far not apparent. In this study, we aimed at developing a mineralizing culture condition to biofunctionalize three-dimensional (3D) porous scaffolds with highly mineralized ECM in order to produce devitalized, osteoinductive mineralized carriers for human periosteal-derived progenitors (hPDCs). For this, three medium formulations [i.e., growth medium only (BM1), with ascorbic acid (BM2), and with ascorbic acid and dexamethasone (BM3)] supplemented with calcium (Ca(2+)) and phosphate (PO4 (3-)) ions simultaneously as mineralizing source were investigated. The results showed that, besides the significant impacts on enhancing cell proliferation (the highest in BM3 condition), the formulated mineralizing media differentially regulated the osteochondro-related gene markers in a medium-dependent manner (e.g., significant upregulation of BMP2, bone sialoprotein, osteocalcin, and Wnt5a in BM2 condition). This has resulted in distinguished cell populations that were identifiable by specific gene signatures as demonstrated by the principle component analysis. Through devitalization, mineralized carriers with apatite crystal structures unique to each medium condition (by X-ray diffraction and SEM analysis) were obtained. Quantitatively, BM3 condition produced carriers with the highest mineral and collagen contents as well as human-specific VEGF proteins, followed by BM2 and BM1 conditions. Encouragingly, all mineralized carriers (after reseeded with hPDCs) induced bone formation after 8 weeks of subcutaneous implantation in nude mice models, with BM2-carriers inducing the highest bone volume, and the lowest in the BM3 condition (as quantitated by nano-computed tomography

  5. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.;

    2014-01-01

    is widely thought to indicate limited ligand presentation and discrimination within a pattern-like recognition system. Here, we evaluated the TCR repertoire of MAIT cells responsive to three classes of microbes. Substantial diversity and heterogeneity were apparent across the functional MAIT cell repertoire...

  6. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    DEFF Research Database (Denmark)

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.;

    2015-01-01

    is widely thought to indicate limited ligand presentation and discrimination within a pattern-like recognition system. Here, we evaluated the TCR repertoire of MAIT cells responsive to three classes of microbes. Substantial diversity and heterogeneity were apparent across the functional MAIT cell repertoire...

  7. Infiltration of IL-17-Producing T Cells and Treg Cells in a Mouse Model of Smoke-Induced Emphysema.

    Science.gov (United States)

    Duan, Min-Chao; Zhang, Jian-Quan; Liang, Yue; Liu, Guang-Nan; Xiao, Jin; Tang, Hai-Juan; Liang, Yi

    2016-08-01

    Chronic obstructive pulmonary disease (COPD) is a progressive and irreversible chronic inflammatory disease associated with the accumulation of activated T cells. To date, there is little information concerning the intrinsic association among Th17, Tc17, and regulatory T (Treg) cells in COPD. The objective of this study was to investigate the variation of lungs CD4(+)Foxp3(+) Treg cells and IL-17-producing CD4 and CD8 (Th17 and Tc17) lymphocytes in mice with cigarette-induced emphysema. Groups of mice were exposed to cigarette smoke or room air. At weeks 12 and 24, mice were sacrificed to observe histological changes by HE stain. The frequencies of Th17 (CD4(+)IL-17(+)T), Tc17 (CD8(+)IL-17(+)T), and Treg (CD4(+)Foxp3(+)T) cells in lungs from these mice were analyzed by flow cytometry. The mRNA levels of orphan nuclear receptor ROR γt and Foxp3 were performed by real-time quantitative polymerase chain reaction. The protein levels of interleukin-17 (IL-17), IL-6, IL-10, and transforming growth factor-beta (TGF-β1) were measured by enzyme-linked immunosorbent assay. Cigarette smoke caused substantial enlargement of the air spaces accompanied by the destruction of the normal alveolar architecture and led to emphysema. The frequencies of Th17 and Tc17 cells, as well as the expressions of IL-6, IL-17, TGF-β1, and ROR γt were greater in the lungs of cigarette smoke (CS)-exposed mice, particularly in the 24-week CS-exposed mice. The frequencies of Treg cells and the expressions of IL-10 and Foxp3 were lower in CS-exposed mice compared to control group. More important, the frequencies of Tregs were negatively correlated with Th17 cells and with Tc17 cells. Interestingly, a significant portion of the cells that infiltrate the lungs was skewed towards a Tc17 phenotype. Our findings suggest the contribution of Th17, Tc17, and Treg cells in the pathogenesis of COPD. Rebalance of these cells will be helpful for developing and refining the new immunological therapies for COPD

  8. Experimental investigation of solid oxide fuel cells using biomass gasification producer gases

    Energy Technology Data Exchange (ETDEWEB)

    Norheim, Arnstein

    2005-07-01

    The main objective of this thesis is theoretical and experimental investigations related to utilisation of biomass gasification producer gases as fuel for Solid Oxide Fuel Cells (SOFC). Initial fundamental steps towards a future system of combined heat and power production based on biomass gasification and SOFC are performed and include: 1) Theoretical modeling of the composition of biomass gasification producer gases. 2) Experimental investigation of SOFC performance using biomass gasification producer gas as fuel. 3) Experimental investigation of SOFC performance using biomass gasification producer gas containing high sulphur concentration. The modeling of the composition of gasifier producer gas was performed using the program FactSage. The main objective was to investigate the amount and speciation of trace species in the producer gases as several parameters were varied. Thus, the composition at thermodynamic equilibrium of sulphur, chlorine, potassium, sodium and compounds of these were established. This was done for varying content of the trace species in the biomass material at different temperatures and fuel utilisation i.e. varying oxygen content in the producer gas. The temperature interval investigated was in the range of normal SOFC operation. It was found that sulphur is expected to be found as H2S irrespective of temperature and amount of sulphur. Only at very high fuel utilisation some S02 is formed. Important potassium containing compounds in the gas are gaseous KOH and K. When chlorine is present, the amount of KOH and K will decrease due to the formation of KCI. The level of sodium investigated here was low, but some Na, NaOH and NaCl is expected to be formed. Below a certain temperature, condensation of alkali rich carbonates may occur. The temperature at which condensation begins is mainly depending on the amount of potassium present; the condensation temperature increases with increasing potassium content. In the first experimental work

  9. Characterization and Inducing Melanoma Cell Apoptosis Activity of Mannosylerythritol Lipids-A Produced from Pseudozyma aphidis.

    Science.gov (United States)

    Fan, Linlin; Li, Hongji; Niu, Yongwu; Chen, Qihe

    2016-01-01

    Mannosylerythritol lipids (MELs) are natural glycolipid biosurfactants which have potential applications in the fields of food, cosmetic and medicine. In this study, MELs were produced from vegetable oil by Pseudozyma aphidis. Their structural data through LC/MS, GC/MS and NMR analysis revealed that MEL-A with two acetyls was the major compound and the identified homologs of MEL-A contained a length of C8 to C14 fatty acid chains. This glycolipid exhibited a surface tension of 27.69 mN/m at a critical micelle concentration (CMC), self-assembling into particles in the water solution. It was observed to induce cell growth-inhibition and apoptosis of B16 melanoma cells in a dose-dependent manner, as well as cause cell cycle arrest at the S phase. Further quantitative RT-PCR analysis and western blotting revealed an increasing tendency of both mRNA and protein expressions of Caspase-12, CHOP, GRP78 and Caspase-3, and a down-regulation of protein Bcl-2. Combined with the up regulation of signaling IRE1 and ATF6, it can be speculated that MEL-A-induced B16 melanoma cell apoptosis was associated with the endoplasmic reticulum stress (ERS). PMID:26828792

  10. Characterization and Inducing Melanoma Cell Apoptosis Activity of Mannosylerythritol Lipids-A Produced from Pseudozyma aphidis.

    Directory of Open Access Journals (Sweden)

    Linlin Fan

    Full Text Available Mannosylerythritol lipids (MELs are natural glycolipid biosurfactants which have potential applications in the fields of food, cosmetic and medicine. In this study, MELs were produced from vegetable oil by Pseudozyma aphidis. Their structural data through LC/MS, GC/MS and NMR analysis revealed that MEL-A with two acetyls was the major compound and the identified homologs of MEL-A contained a length of C8 to C14 fatty acid chains. This glycolipid exhibited a surface tension of 27.69 mN/m at a critical micelle concentration (CMC, self-assembling into particles in the water solution. It was observed to induce cell growth-inhibition and apoptosis of B16 melanoma cells in a dose-dependent manner, as well as cause cell cycle arrest at the S phase. Further quantitative RT-PCR analysis and western blotting revealed an increasing tendency of both mRNA and protein expressions of Caspase-12, CHOP, GRP78 and Caspase-3, and a down-regulation of protein Bcl-2. Combined with the up regulation of signaling IRE1 and ATF6, it can be speculated that MEL-A-induced B16 melanoma cell apoptosis was associated with the endoplasmic reticulum stress (ERS.

  11. An antigen-mediated selection system for mammalian cells that produce glycosylated single-chain Fv

    International Nuclear Information System (INIS)

    Selection and production of specific antibodies are limiting the development of high-throughput immunoassays such as antibody chips. In this study, we propose an antigen-mediated selection of antibody producers (ASAP) system in mammalian cells. As a model system, transgenes encoding anti-fluorescein ScFv fused to cytokine receptors were introduced to IL-3-dependent cell lines. Addition of fluorescein-conjugated BSA induced growth signal through the ScFv/receptor chimeras, leading to selective expansion of the transduced cells. Cre recombinase was then used to excise the receptor gene flanked by two loxP recognition sites in the introns, resulting in secretion of his-myc-tagged ScFv to the culture medium. When the first loxP site was used in the exon as a linker between ScFv and receptor, enhanced antigen-mediated cell proliferation and production of unexpectedly glycosylated ScFv were achieved. ASAP is the first mammalian selection/production system of recombinant human ScFvs, without need for subcloning and with the advantage of glycosylated product

  12. Cadmium and cisplatin damage erythropoietin-producing proximal renal tubular cells

    Energy Technology Data Exchange (ETDEWEB)

    Horiguchi, Hyogo; Oguma, Etsuko; Kayama, Fujio [Jichi Medical School, Division of Environmental Medicine, Center for Community Medicine, Tochigi (Japan); Core Research for Evolutional Science and Technology, Japan Science Technology Corporation (CREST-JST), Saitama (Japan)

    2006-10-15

    The concomitant manifestations of proximal renal tubular dysfunction and anemia with erythropoietin (Epo) deficiency observed in chronic cadmium (Cd) intoxication, such as Itai-itai disease, suggest a close local correlation between the Cd-targeted tubular cells and Epo-producing cells in the kidney. Therefore, we investigated the local relationship between hypoxia-induced Epo production and renal tubular injury in rats injected with Cd at 2 mg/kg twice a week for 8 months. Anemia due to insufficient production of Epo was observed in Cd-intoxicated rats. In situ hybridization detected Epo mRNA expression in the proximal renal tubular cells of hypoxic rats without Cd intoxication, and the Cd-intoxicated rats showed atrophy of Epo-expressing renal tubules and replacement of them with fibrotic tissue. A single dose of cisplatin at 8 mg/kg, which can induce clinical manifestations similar to those of Cd including renal tubular damage along with Epo-deficient anemia, resulted in Epo-expressing renal tubule destruction on day 4. These data indicate that Cd and cisplatin would induce anemia through the direct injury of the proximal renal tubular cells that are responsible for Epo production. (orig.)

  13. Association of expression levels of pluripotency/stem cell markers with the differentiation outcome of Wharton's jelly mesenchymal stem cells into insulin producing cells.

    Science.gov (United States)

    Kassem, Dina H; Kamal, Mohamed M; El-Kholy, Abd El-Latif G; El-Mesallamy, Hala O

    2016-08-01

    Recently, there has been much attention towards generation of insulin producing cells (IPCs) from stem cells, especially from Wharton's jelly mesenchymal stem cells (WJ-MSCs). However, generation of mature IPCs remains a challenge. Assessment of generation of IPCs was usually done by examining β-cell markers, however, assessment of pluripotency/stem cell markers drew less attention. Therefore, the purpose of this study was to investigate the levels of pluripotency/stem cell markers during differentiation of WJ-MSCs into IPCs and the association of these levels with differentiation outcomes. WJ-MSCs were isolated, characterized then induced to differentiate into IPCs using three different protocols namely A, B and C. Differentiated IPCs were assessed by the expression of pluripotency/stem cell markers, together with β-cell markers using qRT-PCR, and functionally by measuring glucose stimulated insulin secretion. Differentiated cells from protocol A showed lowest expression of pluripotency/stem cell markers and relatively best GSIS. However, protocol B showed concomitant expression of pluripotency/stem cell and β-cell markers with relatively less insulin secretion as compared to protocol A. Protocol C failed to generate glucose-responsive IPCs. In conclusion, sustained expression of pluripotency/stem cell markers could be associated with the incomplete differentiation of WJ-MSCs into IPCs. A novel finding for which further investigations are warranted. PMID:27265786

  14. Association of expression levels of pluripotency/stem cell markers with the differentiation outcome of Wharton's jelly mesenchymal stem cells into insulin producing cells.

    Science.gov (United States)

    Kassem, Dina H; Kamal, Mohamed M; El-Kholy, Abd El-Latif G; El-Mesallamy, Hala O

    2016-08-01

    Recently, there has been much attention towards generation of insulin producing cells (IPCs) from stem cells, especially from Wharton's jelly mesenchymal stem cells (WJ-MSCs). However, generation of mature IPCs remains a challenge. Assessment of generation of IPCs was usually done by examining β-cell markers, however, assessment of pluripotency/stem cell markers drew less attention. Therefore, the purpose of this study was to investigate the levels of pluripotency/stem cell markers during differentiation of WJ-MSCs into IPCs and the association of these levels with differentiation outcomes. WJ-MSCs were isolated, characterized then induced to differentiate into IPCs using three different protocols namely A, B and C. Differentiated IPCs were assessed by the expression of pluripotency/stem cell markers, together with β-cell markers using qRT-PCR, and functionally by measuring glucose stimulated insulin secretion. Differentiated cells from protocol A showed lowest expression of pluripotency/stem cell markers and relatively best GSIS. However, protocol B showed concomitant expression of pluripotency/stem cell and β-cell markers with relatively less insulin secretion as compared to protocol A. Protocol C failed to generate glucose-responsive IPCs. In conclusion, sustained expression of pluripotency/stem cell markers could be associated with the incomplete differentiation of WJ-MSCs into IPCs. A novel finding for which further investigations are warranted.

  15. Comparative Pathogenicity of United Kingdom Isolates of the Emerging Pathogen Candida auris and Other Key Pathogenic Candida Species.

    Science.gov (United States)

    Borman, Andrew M; Szekely, Adrien; Johnson, Elizabeth M

    2016-01-01

    Candida auris, first described in 2009, has since emerged as an important, multidrug-resistant, nosocomial agent of candidemia, with large outbreaks reported worldwide and high mortality rates associated with therapeutic failure. The current study employed C. auris isolates from a variety of centers in the United Kingdom to evaluate the pathogenicity of this emerging pathogen compared to that of other common pathogenic yeast species in the invertebrate Galleria mellonella infection model. We showed that C. auris isolates differ in their growth characteristics in vitro, with a proportion of isolates failing to release daughter cells after budding, resulting in the formation of large aggregates of cells that cannot be physically disrupted. Our results also demonstrate strain-specific differences in the behavior of C. auris in G. mellonella, with the aggregate-forming isolates exhibiting significantly less pathogenicity than their nonaggregating counterparts. Importantly, the nonaggregating isolates exhibited pathogenicity comparable to that of C. albicans, which is currently accepted as the most pathogenic member of the genus, despite the fact that C. auris isolates do not produce hyphae and produce only rudimentary pseudohyphae either in vitro or in G. mellonella. IMPORTANCE The incidence of invasive candidiasis, which includes candidemia and deep tissue infections, continues to rise and is associated with considerable mortality rates. Candida albicans remains the most common cause of invasive candidiasis, although the prevalence of non-albicans species has increased over recent years. Since its first description in 2009, Candida auris has emerged as a serious nosocomial health risk, with widespread outbreaks in numerous hospitals worldwide. However, despite receiving considerable attention, little is known concerning the pathogenicity of this emerging fungal pathogen. Here, using the Galleria mellonella insect systemic infection model, we show strain

  16. Comparative Pathogenicity of United Kingdom Isolates of the Emerging Pathogen Candida auris and Other Key Pathogenic Candida Species

    Science.gov (United States)

    Szekely, Adrien; Johnson, Elizabeth M.

    2016-01-01

    ABSTRACT Candida auris, first described in 2009, has since emerged as an important, multidrug-resistant, nosocomial agent of candidemia, with large outbreaks reported worldwide and high mortality rates associated with therapeutic failure. The current study employed C. auris isolates from a variety of centers in the United Kingdom to evaluate the pathogenicity of this emerging pathogen compared to that of other common pathogenic yeast species in the invertebrate Galleria mellonella infection model. We showed that C. auris isolates differ in their growth characteristics in vitro, with a proportion of isolates failing to release daughter cells after budding, resulting in the formation of large aggregates of cells that cannot be physically disrupted. Our results also demonstrate strain-specific differences in the behavior of C. auris in G. mellonella, with the aggregate-forming isolates exhibiting significantly less pathogenicity than their nonaggregating counterparts. Importantly, the nonaggregating isolates exhibited pathogenicity comparable to that of C. albicans, which is currently accepted as the most pathogenic member of the genus, despite the fact that C. auris isolates do not produce hyphae and produce only rudimentary pseudohyphae either in vitro or in G. mellonella. IMPORTANCE The incidence of invasive candidiasis, which includes candidemia and deep tissue infections, continues to rise and is associated with considerable mortality rates. Candida albicans remains the most common cause of invasive candidiasis, although the prevalence of non-albicans species has increased over recent years. Since its first description in 2009, Candida auris has emerged as a serious nosocomial health risk, with widespread outbreaks in numerous hospitals worldwide. However, despite receiving considerable attention, little is known concerning the pathogenicity of this emerging fungal pathogen. Here, using the Galleria mellonella insect systemic infection model, we show

  17. Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

    OpenAIRE

    David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

    2015-01-01

    Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widel...

  18. The stimulation of EL-4 cells to produce interleukin-2 and its potential use in immunocytotoxicity testing

    International Nuclear Information System (INIS)

    The ability of EL-4 thymoma cells to produce interleukin-2 (IL-2) following exposure to phorbol-12-myristate 13-acetate (PMA) and Concanavalin A (Con A) has been studied in vitro using medium containing either 10% or 1% fetal calf serum (FCS). The potent stimulatory effect of PMA on IL-2 production by EL-4 cells has been confirmed by measuring 3H-thymidine incorporation by the IL-2-dependent T cell line, CTLL-2, in the presence of conditioned medium (CM) from stimulated cultures. EL-4 cells produced several times more IL-2 when cultured in medium containing 10% FCS than when only 1% FCS was present. Added together, PMA and Con A acted synergistically in some EL-4 cell cultures. The ability of E:-4 cells to produce IL-2 was maintained after further incubation without stimulants. CM with IL-2 activity from stimulated EL-4 cells could prove useful in immunotoxicity testing

  19. Caspase dependent programmed cell death in developing embryos: a potential target for therapeutic intervention against pathogenic nematodes.

    Directory of Open Access Journals (Sweden)

    Alok Das Mohapatra

    2011-09-01

    Full Text Available BACKGROUND: Successful embryogenesis is a critical rate limiting step for the survival and transmission of parasitic worms as well as pathology mediated by them. Hence, blockage of this important process through therapeutic induction of apoptosis in their embryonic stages offers promise for developing effective anti-parasitic measures against these extra cellular parasites. However, unlike in the case of protozoan parasites, induction of apoptosis as a therapeutic approach is yet to be explored against metazoan helminth parasites. METHODOLOGY/PRINCIPAL FINDINGS: For the first time, here we developed and evaluated flow cytometry based assays to assess several conserved features of apoptosis in developing embryos of a pathogenic filarial nematode Setaria digitata, in-vitro as well as ex-vivo. We validated programmed cell death in developing embryos by using immuno-fluorescence microscopy and scoring expression profile of nematode specific proteins related to apoptosis [e.g. CED-3, CED-4 and CED-9]. Mechanistically, apoptotic death of embryonic stages was found to be a caspase dependent phenomenon mediated primarily through induction of intracellular ROS. The apoptogenicity of some pharmacological compounds viz. DEC, Chloroquine, Primaquine and Curcumin were also evaluated. Curcumin was found to be the most effective pharmacological agent followed by Primaquine while Chloroquine displayed minimal effect and DEC had no demonstrable effect. Further, demonstration of induction of apoptosis in embryonic stages by lipid peroxidation products [molecules commonly associated with inflammatory responses in filarial disease] and demonstration of in-situ apoptosis of developing embryos in adult parasites in a natural bovine model of filariasis have offered a framework to understand anti-fecundity host immunity operational against parasitic helminths. CONCLUSIONS/SIGNIFICANCE: Our observations have revealed for the first time, that induction of apoptosis in

  20. Generation of clinical grade dendritic cells with capacity to produce biologically active IL-12p70

    Directory of Open Access Journals (Sweden)

    Bigalke Iris

    2007-04-01

    Full Text Available Abstract Background For optimal T cell activation it is desirable that dendritic cells (DCs display peptides within MHC molecules as signal 1, costimulatory molecules as signal 2 and, in addition, produce IL-12p70 as signal 3. IL-12p70 polarizes T cell responses towards CD4+ T helper 1 cells, which then support the development of CD8+ cytotoxic T lymphocytes. We therefore developed new maturation cocktails allowing DCs to produce biologically active IL-12p70 for large-scale cancer vaccine development. Methods After elutriation of leukapheresis products in a closed bag system, enriched monocytes were cultured with GM-CSF and IL-4 for six days to generate