WorldWideScience

Sample records for cells produce pathogenic

  1. Extracellular proteolytic enzymes produced by human pathogenic Vibrio species

    Shin-Ichi eMiyoshi

    2013-11-01

    Full Text Available Bacteria in the genus Vibrio produce extracellular proteolytic enzymes to obtain nutrients via digestion of various protein substrates. However, the enzymes secreted by human pathogenic species have been documented to modulate the bacterial virulence. Several species including Vibrio cholerae and V. vulnificus are known to produce thermolysin-like metalloproteases termed vibriolysin. The vibriolysin from V. vulnificus, a causative agent of serious systemic infection, is a major toxic factor eliciting the secondary skin damage characterized by formation of the hemorrhagic brae. The vibriolysin from intestinal pathogens may play indirect roles in pathogenicity because it can activate protein toxins and hemagglutinin by the limited proteolysis and can affect the bacterial attachment to or detachment from the intestinal surface by degradation of the mucus layer. Two species causing wound infections, V. alginolyticus and V. parahaemolyticus, produce another metalloproteases so-called collagenases. Although the detailed pathological roles have not been studied, the collagenase is potent to accelerate the bacterial dissemination through digestion of the protein components of the extracellular matrix. Some species produce cymotrypsin-like serine proteases, which may also affect the bacterial virulence potential. The intestinal pathogens produce sufficient amounts of the metalloprotease at the small intestinal temperature; however, the metalloprotease production by extra-intestinal pathogens is much higher around the body surface temperature. On the other hand, the serine protease is expressed only in the absence of the metalloprotease.

  2. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  3. The Gene tia, Harbored by the Subtilase-Encoding Pathogenicity Island, Is Involved in the Ability of Locus of Enterocyte Effacement-Negative Shiga Toxin-Producing Escherichia coli Strains To Invade Monolayers of Epithelial Cells

    Chiani, Paola; Michelacci, Valeria; Minelli, Fabio; Caprioli, Alfredo; Morabito, Stefano

    2017-01-01

    ABSTRACT Locus of enterocyte effacement (LEE)-negative Shiga toxin (Stx)-producing Escherichia coli (STEC) strains are human pathogens that lack the LEE locus, a pathogenicity island (PAI) involved in the intimate adhesion of LEE-positive strains to the host gut epithelium. The mechanism used by LEE-negative STEC strains to colonize the host intestinal mucosa is still not clear. The cell invasion determinant tia, previously described in enterotoxigenic E. coli strains, has been identified in LEE-negative STEC strains that possess the subtilase-encoding pathogenicity island (SE-PAI). We evaluated the role of the gene tia, present in these LEE-negative STEC strains, in the invasion of monolayers of cultured cells. We observed that these strains were able to invade Caco-2 and HEp-2 cell monolayers and compared their invasion ability with that of a mutant strain in which the gene tia had been inactivated. Mutation of the gene tia resulted in a strong reduction of the invasive phenotype, and complementation of the tia mutation with a functional copy of the gene restored the invasion activity. Moreover, we show that the gene tia is overexpressed in bacteria actively invading cell monolayers, demonstrating that tia is involved in the ability to invade cultured monolayers of epithelial cells shown by SE-PAI-positive E. coli, including STEC, strains. However, the expression of the tia gene in the E. coli K-12 strain JM109 was not sufficient, in its own right, to confer to this strain the ability to invade cell monolayers, suggesting that at least another factor must be involved in the invasion ability displayed by the SE-PAI-positive strains. PMID:28893912

  4. The Gene tia, Harbored by the Subtilase-Encoding Pathogenicity Island, Is Involved in the Ability of Locus of Enterocyte Effacement-Negative Shiga Toxin-Producing Escherichia coli Strains To Invade Monolayers of Epithelial Cells.

    Bondì, Roslen; Chiani, Paola; Michelacci, Valeria; Minelli, Fabio; Caprioli, Alfredo; Morabito, Stefano

    2017-12-01

    Locus of enterocyte effacement (LEE)-negative Shiga toxin (Stx)-producing Escherichia coli (STEC) strains are human pathogens that lack the LEE locus, a pathogenicity island (PAI) involved in the intimate adhesion of LEE-positive strains to the host gut epithelium. The mechanism used by LEE-negative STEC strains to colonize the host intestinal mucosa is still not clear. The cell invasion determinant tia , previously described in enterotoxigenic E. coli strains, has been identified in LEE-negative STEC strains that possess the subtilase-encoding pathogenicity island (SE-PAI). We evaluated the role of the gene tia , present in these LEE-negative STEC strains, in the invasion of monolayers of cultured cells. We observed that these strains were able to invade Caco-2 and HEp-2 cell monolayers and compared their invasion ability with that of a mutant strain in which the gene tia had been inactivated. Mutation of the gene tia resulted in a strong reduction of the invasive phenotype, and complementation of the tia mutation with a functional copy of the gene restored the invasion activity. Moreover, we show that the gene tia is overexpressed in bacteria actively invading cell monolayers, demonstrating that tia is involved in the ability to invade cultured monolayers of epithelial cells shown by SE-PAI-positive E. coli , including STEC, strains. However, the expression of the tia gene in the E. coli K-12 strain JM109 was not sufficient, in its own right, to confer to this strain the ability to invade cell monolayers, suggesting that at least another factor must be involved in the invasion ability displayed by the SE-PAI-positive strains. Copyright © 2017 American Society for Microbiology.

  5. Efferocytosis of Pathogen-Infected Cells

    Niloofar Karaji

    2017-12-01

    Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

  6. Regulatory T cells and immunity to pathogens.

    Rouse, Barry T; Suvas, Susmit

    2007-09-01

    Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

  7. Biocontrol interventions for inactivation of foodborne pathogens on produce

    Post-harvest interventions for control of foodborne pathogens on minimally processed foods are crucial for food safety. Biocontrol interventions have the primary objective of developing novel antagonists in combinations with physical and chemical interventions to inactivate pathogenic microbes. Ther...

  8. Aspergillus flavus: human pathogen, allergen and mycotoxin producer.

    Hedayati, M T; Pasqualotto, A C; Warn, P A; Bowyer, P; Denning, D W

    2007-06-01

    Aspergillus infections have grown in importance in the last years. However, most of the studies have focused on Aspergillus fumigatus, the most prevalent species in the genus. In certain locales and hospitals, Aspergillus flavus is more common in air than A. fumigatus, for unclear reasons. After A. fumigatus, A. flavus is the second leading cause of invasive aspergillosis and it is the most common cause of superficial infection. Experimental invasive infections in mice show A. flavus to be 100-fold more virulent than A. fumigatus in terms of inoculum required. Particularly common clinical syndromes associated with A. flavus include chronic granulomatous sinusitis, keratitis, cutaneous aspergillosis, wound infections and osteomyelitis following trauma and inoculation. Outbreaks associated with A. flavus appear to be associated with single or closely related strains, in contrast to those associated with A. fumigatus. In addition, A. flavus produces aflatoxins, the most toxic and potent hepatocarcinogenic natural compounds ever characterized. Accurate species identification within Aspergillus flavus complex remains difficult due to overlapping morphological and biochemical characteristics, and much taxonomic and population genetics work is necessary to better understand the species and related species. The flavus complex currently includes 23 species or varieties, including two sexual species, Petromyces alliaceus and P. albertensis. The genome of the highly related Aspergillus oryzae is completed and available; that of A. flavus in the final stages of annotation. Our understanding of A. flavus lags far behind that of A. fumigatus. Studies of the genomics, taxonomy, population genetics, pathogenicity, allergenicity and antifungal susceptibility of A. flavus are all required.

  9. Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.

    Ireton, Keith

    2013-07-17

    Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.

  10. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    DANG SUN

    Two regulatory T cell clones (Tregs) were used in this study. Treg1 cells were clone-derived from the previously described. Keywords. methylation; cDNA microarray; type 1 diabetes; pathogenic T cells; .... Gender-specific differences in.

  11. Producing Newborn Synchronous Mammalian Cells

    Gonda, Steve R.; Helmstetter, Charles E.; Thornton, Maureen

    2008-01-01

    A method and bioreactor for the continuous production of synchronous (same age) population of mammalian cells have been invented. The invention involves the attachment and growth of cells on an adhesive-coated porous membrane immersed in a perfused liquid culture medium in a microgravity analog bioreactor. When cells attach to the surface divide, newborn cells are released into the flowing culture medium. The released cells, consisting of a uniform population of synchronous cells are then collected from the effluent culture medium. This invention could be of interest to researchers investigating the effects of the geneotoxic effects of the space environment (microgravity, radiation, chemicals, gases) and to pharmaceutical and biotechnology companies involved in research on aging and cancer, and in new drug development and testing.

  12. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  13. Genetic reprogramming of host cells by bacterial pathogens.

    Tran Van Nhieu, Guy; Arbibe, Laurence

    2009-10-29

    During the course of infection, pathogens often induce changes in gene expression in host cells and these changes can be long lasting and global or transient and of limited amplitude. Defining how, when, and why bacterial pathogens reprogram host cells represents an exciting challenge that opens up the opportunity to grasp the essence of pathogenesis and its molecular details.

  14. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater.

    Franz, Eelco; Veenman, Christiaan; van Hoek, Angela H A M; de Roda Husman, Ana; Blaak, Hetty

    2015-09-24

    To assess public health risks from environmental exposure to Extended-Spectrum β-Lactamases (ESBL)-producing bacteria, it is necessary to have insight in the proportion of relative harmless commensal variants and potentially pathogenic ones (which may directly cause disease). In the current study, 170 ESBL-producing E. coli from Dutch wastewater (n = 82) and surface water (n = 88) were characterized with respect to ESBL-genotype, phylogenetic group, resistance phenotype and virulence markers associated with enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), extraintesinal E. coli (ExPEC), and Shiga toxin-producing E. coli (STEC). Overall, 17.1% of all ESBL-producing E. coli were suspected pathogenic variants. Suspected ExPECs constituted 8.8% of all ESBL-producing variants and 8.3% were potential gastrointestinal pathogens (4.1% EAEC, 1.8% EPEC, 1.2% EIEC, 1.2% ETEC, no STEC). Suspected pathogens were significantly associated with ESBL-genotype CTX-M-15 (X(2) = 14.7, P antibiotics. In conclusion, this study demonstrates that the aquatic environment is a potential reservoir of E. coli variants that combine ESBL-genes, a high level of multi-drug resistance and virulence factors, and therewith pose a health risk to humans upon exposure.

  15. Lipids in host-pathogen interactions: pathogens exploit the complexity of the host cell lipidome.

    van der Meer-Janssen, Ynske P M; van Galen, Josse; Batenburg, Joseph J; Helms, J Bernd

    2010-01-01

    Lipids were long believed to have a structural role in biomembranes and a role in energy storage utilizing cellular lipid droplets and plasma lipoproteins. Research over the last decades has identified an additional role of lipids in cellular signaling, membrane microdomain organization and dynamics, and membrane trafficking. These properties make lipids an attractive target for pathogens to modulate host cell processes in order to allow their survival and replication. In this review we will summarize the often ingenious strategies of pathogens to modify the lipid homeostasis of host cells, allowing them to divert cellular processes. To this end pathogens take full advantage of the complexity of the lipidome. The examples are categorized in generalized and emerging principles describing the involvement of lipids in host-pathogen interactions. Several pathogens are described that simultaneously induce multiple changes in the host cell signaling and trafficking mechanisms. Elucidation of these pathogen-induced changes may have important implications for drug development. The emergence of high-throughput lipidomic techniques will allow the description of changes of the host cell lipidome at the level of individual molecular lipid species and the identification of lipid biomarkers.

  16. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Banach, J.L.; Sampers, I.; Haute, van S.; Fels, van der H.J.

    2015-01-01

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water

  17. Post irradiation effect on some antiphagocytic substances produced by pathogenic microorganisms

    Shehata, M.M.K.

    2003-01-01

    Some clinical isolated microorganiams can produce antiphagocytic virulence substance. In this study 43 bacterial strains were isolated from cervix of 50 patients. Escheruchia coli was the most common species isolated (39.53%) followed by Klebsiella pneumoniae (23.26), Pseudomonas aeruginosa (11.63%), Proteus mirabilis (9.30%), Klebsiella oxytoca (4.65%), Staphylococcus warneri (4.65%), Klebsiella group 47 (2.33%), Morganella morganii (2.33%) and Staphylococcus hominis (2.33%) four yeast fungal organisms were isolated in this study Candida albicans was the only Candida species isolated representing 8.51% of total number of pathogenic bacteria and yeast fungi isolated. Radiotherapy of these cancer patients had many effects on the microbial cells. The tested isolates were exposed to in-vivo multiple fractionated doses 10-50Gy and in-vitro single equivalent dose 7.04-20Gy. The isolated strains were tested for antimicrbial agent susceptibility using 18 different antibiotics for bacterial isolates and anystatin for Candida albicans. The effect of bacterial and yeast fungal virulence factors on neutrophil phagocytosis and antimicrobial activity was examined. Disk susceptibility testing suggested that, the isolated producer strains which were positive for extracellular proteinase enzyme and/or for slime production that correlate with infectivity were resistant to erythromycin, streptomycin, neomycin, kanamycin, tetracycline, cephalothin and sulphamethoxazol/trimethoprim and rarely susceptible to amoxicillin /clavulanic acid and cefotaxime. In contrast, many non-producer strains were susceptible to most of the tested antibiotics with marked variability among species. In case of Candida albicans all the tested strains were susceptible to the tested antimycotic agent used before and after in-vitro irradiation at a dose level of 20gy. It was found that slime substance and/or proteinase enzyme reduced the phagocytic activity of the leukocytes against the producer bacterial

  18. The cereal pathogen Fusarium pseudograminearum produces a new class of active cytokinins during infection

    Sørensen, Jens Laurids; Benfield, Aurelie H.; Wollenberg, Rasmus Dam

    2018-01-01

    -senescence activities and the production of a cytokinin mimic by what was once considered a necrotrophic pathogen that promotes cell death and senescence challenges the simple view that this pathogen invades its hosts by employing a barrage of lytic enzymes and toxins. Through genome mining, a gene cluster in the F....... pseudograminearum genome for the production of Fusarium cytokinins was identified and the biosynthetic pathway established using gene knockouts. The Fusarium cytokinins could activate plant cytokinin signalling, demonstrating their genuine hormone mimicry. In planta analysis of the transcriptional response to one...

  19. Cultivating Insect Cells To Produce Recombinant Proteins

    Spaulding, Glenn; Goodwin, Thomas; Prewett, Tacey; Andrews, Angela; Francis, Karen; O'Connor, Kim

    1996-01-01

    Method of producing recombinant proteins involves growth of insect cells in nutrient solution in cylindrical bioreactor rotating about cylindrical axis, oriented horizontally and infecting cells with viruses into which genes of selected type cloned. Genes in question those encoding production of desired proteins. Horizontal rotating bioreactor preferred for use in method, denoted by acronym "HARV", described in "High-Aspect-Ratio Rotating Cell-Culture Vessel" (MSC-21662).

  20. Pathogenic Assay of Probiotic Bacteria Producing Proteolytic Enzymes as Bioremediation Bacteria Against Vannamei Shrimp Larvae (Litopenaeus vannamei

    Wilis Ari Setyati

    2017-06-01

    Full Text Available Application of bacteria in bioremediation of shrimp culture ponds is one of the methods used to clean internal pollutants. This study aimed to evaluate the pathogenicity of extracellular proteolytic enzyme produced by the probiotic bacteria as bioremediation bacteria on vannamei shrimp larvae culture. There were five probiotic bacteria, which were successfully isolated from the sediments served as substrate in mangrove area. The isolated bacteria were coded in number as 13, 19, 30, 33, and 36. Pathogenic bacteria Vibrio harveyi was used as positive control. Pathogenic assay was carried out in two different bacterial concentrations, i.e. 10⁸ and 10⁶ cells.mL-1. The results showed that the lowest survival rate (SR of shrimp larvae in positive control V. harveyi was 53 and 65%. Whereas isolates with the highest SR value (100% were obtained from bacteria coded as 13 and 30. Isolates no. 19, 33 and 36 had SR of more than 90%. Total plate count (TPC data showed that the bacteria increased significantly at the end of the study with an average increase value of 24%. The smallest TPC value was shown by bacterial isolate no. 19, while the largest was obtained from the isolate no. 13. These results suggest that all probiotic bacteria were not pathogenic to the vannamei shrimp larvae.   Keywords: aquaculture, shrimp, bioremediation, pathogenesis, vibrio.

  1. Prevalence and concentration of bacterial pathogens in raw produce and minimally processed packaged salads produced in and for the Netherlands.

    Wijnands, Lucas M; Delfgou-van Asch, Ellen H M; Beerepoot-Mensink, Marieke E; van der Meij-Florijn, Alice; Fitz-James, Ife; van Leusden, Frans M; Pielaat, Annemarie

    2014-03-01

    Recent outbreaks with vegetable or fruits as vehicles have raised interest in the characterization of the public health risk due to microbial contamination of these commodities. Because qualitative and quantitative data regarding prevalence and concentration of various microbes are lacking, we conducted a survey to estimate the prevalence and contamination level of raw produce and the resulting minimally processed packaged salads as sold in The Netherlands. A dedicated sampling plan accounted for the amount of processed produce in relation to the amount of products, laboratory capacity, and seasonal influences. Over 1,800 samples of produce and over 1,900 samples of ready-to-eat mixed salads were investigated for Salmonella enterica serovars, Campylobacter spp., Escherichia coli O157, and Listeria monocytogenes. The overall prevalence in raw produce varied between 0.11% for E. coli O157 and L. monocytogenes and 0.38% for Salmonella. Prevalence point estimates for specific produce/pathogen combinations ranged for Salmonella from 0.53% in iceberg lettuce to 5.1% in cucumber. For Campylobacter, this ranged from 0.83% in endive to 2.7% in oak tree lettuce. These data will be used to determine the public health risk posed by the consumption of ready-to-eat mixed salads in The Netherlands.

  2. Enteric Pathogen Survival Varies Substantially in Irrigation Water from Belgian Lettuce Producers

    Van Der Linden, Inge; Cottyn, Bart; Uyttendaele, Mieke; Berkvens, Nick; Vlaemynck, Geertrui; Heyndrickx, Marc; Maes, Martine

    2014-01-01

    It is accepted that irrigation water is a potential carrier of enteric pathogens, such as Salmonella and E. coli O157:H7 and, therefore, a source for contamination of fresh produce. We tested this by comparing irrigation water samples taken from five different greenhouses in Belgium. The water samples were inoculated with four zoonotic strains, two Salmonella and two E. coli O157:H7 strains, and pathogen survival and growth in the water were monitored up till 14 days. The influence of water temperature and chemical water quality was evaluated, and the survival tests were also performed in water samples from which the resident aquatic microbiota had previously been eliminated by filter sterilization. The pathogen’s survival differed greatly in the different irrigation waters. Three water samples contained nutrients to support important growth of the pathogens, and another enabled weaker growth. However, for all, growth was only observed in the samples that did not contain the resident aquatic microbiota. In the original waters with their specific water biota, pathogen levels declined. The same survival tendencies existed in water of 4 °C and 20 °C, although always more expressed at 20 °C. Low water temperatures resulted in longer pathogen survival. Remarkably, the survival capacity of two E. coli 0157:H7 strains differed, while Salmonella Thompson and Salmonella Typhimurium behaved similarly. The pathogens were also transferred to detached lettuce leaves, while suspended in two of the water samples or in a buffer. The effect of the water sample on the pathogen’s fitness was also reproduced on the leaves when stored at 100% relative humidity. Inoculation of the suspension in buffer or in one of the water samples enabled epiphytic growth and survival, while the pathogen level in the other water sample decreased once loaded on the leaves. Our results show that irrigation waters from different origin may have a different capacity to transmit enteric pathogens and

  3. Antimicrobial resistance prevalence of pathogenic and commensal Escherichia coli in food-producing animals in Belgium

    Chantziaras, Ilias; Dewulf, Jeroen; Boyen, Filip; Callens, Benedicte; Butaye, Patrick

    2014-01-01

    In this article, detailed studies on antimicrobial resistance to commensal E. coli (in pigs, meat-producing bovines, broiler chickens and veal calves) and pathogenic E. coli (in pigs and bovines) in Belgium are presented for 2011. Broiler chicken and veal calf isolates of commensal E. coli demonstrated higher antimicrobial resistance prevalence than isolates from pigs and bovines. Fifty percent of E. coli isolates from broiler chickens were resistant to at least five antimicrobials, whereas s...

  4. Cells and methods for producing fatty alcohols

    Pfleger, Brian F.; Youngquist, Tyler J.

    2017-07-18

    Recombinant cells and methods for improved yield of fatty alcohols. The recombinant cells harbor a recombinant thioesterase gene, a recombinant acyl-CoA synthetase gene, and a recombinant acyl-CoA reductase gene. In addition, a gene product from one or more of an acyl-CoA dehydrogenase gene, an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase gene, and a 3-ketoacyl-CoA thiolase gene in the recombinant cells is functionally deleted. Culturing the recombinant cells produces fatty alcohols at high yields.

  5. Long-Term Live Cell Imaging of Cell Migration: Effects of Pathogenic Fungi on Human Epithelial Cell Migration.

    Wöllert, Torsten; Langford, George M

    2016-01-01

    Long-term live cell imaging was used in this study to determine the responses of human epithelial cells to pathogenic biofilms formed by Candida albicans. Epithelial cells of the skin represent the front line of defense against invasive pathogens such as C. albicans but under certain circumstances, especially when the host's immune system is compromised, the skin barrier is breached. The mechanisms by which the fungal pathogen penetrates the skin and invade the deeper layers are not fully understood. In this study we used keratinocytes grown in culture as an in vitro model system to determine changes in host cell migration and the actin cytoskeleton in response to virulence factors produced by biofilms of pathogenic C. albicans. It is clear that changes in epithelial cell migration are part of the response to virulence factors secreted by biofilms of C. albicans and the actin cytoskeleton is the downstream effector that mediates cell migration. Our goal is to understand the mechanism by which virulence factors hijack the signaling pathways of the actin cytoskeleton to alter cell migration and thereby invade host tissues. To understand the dynamic changes of the actin cytoskeleton during infection, we used long-term live cell imaging to obtain spatial and temporal information of actin filament dynamics and to identify signal transduction pathways that regulate the actin cytoskeleton and its associated proteins. Long-term live cell imaging was achieved using a high resolution, multi-mode epifluorescence microscope equipped with specialized light sources, high-speed cameras with high sensitivity detectors, and specific biocompatible fluorescent markers. In addition to the multi-mode epifluorescence microscope, a spinning disk confocal long-term live cell imaging system (Olympus CV1000) equipped with a stage incubator to create a stable in vitro environment for long-term real-time and time-lapse microscopy was used. Detailed descriptions of these two long-term live

  6. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

    Pálková, Z.; Váchová, Libuše

    2016-01-01

    Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

  7. Toxins Produced by Valsa mali var. mali and Their Relationship with Pathogenicity

    Caixia Wang

    2014-03-01

    Full Text Available Valsa mali var. mali (Vmm, the causal agent of apple tree canker disease, produces various toxic compounds, including protocatechuic acid, p-hydroxybenzoic acid, p-hydroxyacetophenone, 3-(p-hydroxyphenylpropanoic acid and phloroglucinol. Here, we examined the relationship between toxin production and the pathogenicity of Vmm strains and determined their bioactivities in several assays, for further elucidating the pathogenesis mechanisms of Vmm and for developing new procedures to control this disease. The toxins were quantified with the high performance liquid chromatography (HPLC method, and the results showed that the strain with attenuated virulence produced low levels of toxins with only three to four kinds of compounds being detectable. In contrast, higher amounts of toxins were produced by the more aggressive strain, and all five compounds were detected. This indicated a significant correlation between the pathogenicity of Vmm strains and their ability to produce toxins. However, this correlation only existed in planta, but not in vitro. During the infection of Vmm, protocatechuic acid was first detected at three days post inoculation (dpi, and the others at seven or 11 dpi. In addition, all compounds produced noticeable symptoms on host plants at concentrations of 2.5 to 40 mmol/L, with protocatechuic acid being the most effective compound, whereas 3-(p-hydroxyphenylpropanoic acid or p-hydroxybenzoic acid were the most active compounds on non-host plants.

  8. Pathogen-Reactive T Helper Cell Analysis in the Pig

    Friederike Ebner

    2017-05-01

    Full Text Available There is growing interest in studying host–pathogen interactions in human-relevant large animal models such as the pig. Despite the progress in developing immunological reagents for porcine T cell research, there is an urgent need to directly assess pathogen-specific T cells—an extremely rare population of cells, but of upmost importance in orchestrating the host immune response to a given pathogen. Here, we established that the activation marker CD154 (CD40L, known from human and mouse studies, identifies also porcine antigen-reactive CD4+ T lymphocytes. CD154 expression was upregulated early after antigen encounter and CD4+CD154+ antigen-reactive T cells coexpressed cytokines. Antigen-induced expansion and autologous restimulation enabled a time- and dose-resolved analysis of CD154 regulation and a significantly increased resolution in phenotypic profiling of antigen-responsive cells. CD154 expression identified T cells responding to staphylococcal Enterotoxin B superantigen stimulation as well as T cells responding to the fungus Candida albicans and T cells specific for a highly prevalent intestinal parasite, the nematode Ascaris suum during acute and trickle infection. Antigen-reactive T cells were further detected after immunization of pigs with a single recombinant bacterial antigen of Streptococcus suis only. Thus, our study offers new ways to study antigen-specific T lymphocytes in the pig and their contribution to host–pathogen interactions.

  9. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    Reestablishing a well-balanced population of regulatory T cells (Tregs) and pathogenic T cells (Tpaths) is necessary for diabetic patients to regain glucose control. However, the molecular mechanisms modulating functional differentiation of Tpaths and Tregs remain unclear. In this study, we anal- ysed the gene expression ...

  10. Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells

    2017-05-01

    intestinal inflammation by reducing TH17 cells and preserving group 3 innate lymphoid cells . Nat Med, 2016. 22(3): p. 319-23.   ...stable population of YFP+  cells  similar  to  innate  IL‐17–producing  cells  (e.g., γδ T  cells ) during acute infection (Fig.2) , which is in sharp contrast...AWARD NUMBER: W81XWH-16-1-0100 TITLE: Prevention of Lung Carcinogenesis by Suppressing Pathogenic CD4 T Cells PRINCIPAL INVESTIGATOR: Seon Hee

  11. Metabolites produced by antagonistic microbes inhibit the principal avocado pathogens in vitro

    Sara Ramírez R.

    2015-04-01

    Full Text Available The demand for Hass avocado in the global market exceeds the supply by over 50%. Colombia has a remarkable advantage as a producer in the region due to its high yields. However, the productivity of this crop can be seriously affected by diseases such as root rot, caused by Phytophthora cinnamomi, postharvest body rot and stem end rot, caused by Colletotrichum sp. and Phomopsis sp., respectively. The potential of 76 bacterial isolates obtained from avocado rhizosphere to produce inhibitory metabolites against avocado's pathogens was evaluated. The antagonistic effect of the rhizobacteria against P. cinnamomi, Colletotrichum sp. and Phomopsis sp. was tested through dual cultures. Thirty-six percent of the tested isolates presented inhibition halos against P. cinnamomi, 36% against Colletotrichum sp. and 67% against Phomopsis sp. Additionally, three isolates were selected for fermentation tests using different broth cultures. The extracts obtained from fermentations in the minimal medium of isolates ARP5.1 and AED06 showed inhibitory activity against the evaluated pathogens, but this effect was not observed with the AED26 extract. The media supplemented with copper chloride did not enhance activity of the extracts. These results suggest that using microbial metabolic extracts is a viable alternative for controlling avocado pathogens in vitro.

  12. Isolation of Biosurfactant–Producing Bacteria with Antimicrobial Activity against Bacterial Pathogens

    Siripun Sarin

    2011-01-01

    Full Text Available The aims of this research were to study biosurfactant producing bacteria isolated from soil and to determine their property and efficiency as biosurfactants in order to inhibit bacterial pathogens. The result showed that there were 8 bacterial isolates out of 136 isolates of the total biosurfactant producing bacteria screened that exhibited the diameter of clear zone more than 1.5 cm. in the oil spreading test. The highest potential of emulsifying activity (%EA24 of 54.4 and the maximum additive concentration, (%MAC of 24.2 was obtained from the fermentation broth of the G7 isolate which the G7 isolate was later identified as Pseudomonas fluorescens. Escherichia coli, Staphylococcus aureus and Psuedomonas aeruginosa were the tested bacterial pathogens that were most sensitive to the acid precipitated biosurfactant obtained from P. fluorescens G7 with the lowest minimum inhibitory concentration (MIC of 41.6 mg/ml and minimum bactericidal concentration (MBC of 41.6 mg/ml compared with the acid precipitated bisurfactants of the other isolates used in the antimicrobial activity test. The type of the separated crude biosurfactant produced by P. fluorescens G7 analyzed later by using the rhamose test, TLC and FT-IR techniques was rhamnolipid.

  13. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Banach, Jennifer L.; Sampers, Imca; Van Haute, Sam; van der Fels-Klerx, H.J. (Ine)

    2015-01-01

    The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer. PMID:26213953

  14. Effect of Disinfectants on Preventing the Cross-Contamination of Pathogens in Fresh Produce Washing Water

    Jennifer L. Banach

    2015-07-01

    Full Text Available The potential cross-contamination of pathogens between clean and contaminated produce in the washing tank is highly dependent on the water quality. Process wash water disinfectants are applied to maintain the water quality during processing. The review examines the efficacy of process wash water disinfectants during produce processing with the aim to prevent cross-contamination of pathogens. Process wash water disinfection requires short contact times so microorganisms are rapidly inactivated. Free chlorine, chlorine dioxide, ozone, and peracetic acid were considered suitable disinfectants. A disinfectant’s reactivity with the organic matter will determine the disinfectant residual, which is of paramount importance for microbial inactivation and should be monitored in situ. Furthermore, the chemical and worker safety, and the legislative framework will determine the suitability of a disinfection technique. Current research often focuses on produce decontamination and to a lesser extent on preventing cross-contamination. Further research on a sanitizer’s efficacy in the washing water is recommended at the laboratory scale, in particular with experimental designs reflecting industrial conditions. Validation on the industrial scale is warranted to better understand the overall effects of a sanitizer.

  15. Bacillomycin D Produced by Bacillus amyloliquefaciens Is Involved in the Antagonistic Interaction with the Plant-Pathogenic Fungus Fusarium graminearum.

    Gu, Qin; Yang, Yang; Yuan, Qiming; Shi, Guangming; Wu, Liming; Lou, Zhiying; Huo, Rong; Wu, Huijun; Borriss, Rainer; Gao, Xuewen

    2017-10-01

    Fusarium graminearum (teleomorph: Ascomycota, Hypocreales, Gibberella , Gibberella zeae ) is a destructive fungal pathogen that threatens the production and quality of wheat and barley worldwide. Controlling this toxin-producing pathogen is a significant challenge. In the present study, the commercially available strain Bacillus amyloliquefaciens ( Bacteria , Firmicutes , Bacillales , Bacillus ) FZB42 showed strong activity against F. graminearum The lipopeptide bacillomycin D, produced by FZB42, was shown to contribute to the antifungal activity. Purified bacillomycin D showed strong activity against F. graminearum , and its 50% effective concentration was determined to be approximately 30 μg/ml. Analyses using scanning and transmission electron microscopy revealed that bacillomycin D caused morphological changes in the plasma membranes and cell walls of F. graminearum hyphae and conidia. Fluorescence microscopy combined with different dyes showed that bacillomycin D induced the accumulation of reactive oxygen species and caused cell death in F. graminearum hyphae and conidia. F. graminearum secondary metabolism also responded to bacillomycin D challenge, by increasing the production of deoxynivalenol. Biological control experiments demonstrated that bacillomycin D exerted good control of F. graminearum on corn silks, wheat seedlings, and wheat heads. In response to bacillomycin D, F. graminearum genes involved in scavenging reactive oxygen species were downregulated, whereas genes involved in the synthesis of deoxynivalenol were upregulated. Phosphorylation of MGV1 and HOG1, the mitogen-activated protein kinases of F. graminearum , was increased in response to bacillomycin D. Taken together, these findings reveal the mechanism of the antifungal action of bacillomycin D. IMPORTANCE Biological control of plant disease caused by Fusarium graminearum is desirable. Bacillus amyloliquefaciens FZB42 is a representative of the biocontrol bacterial strains. In this work

  16. Efficacy of Peracetic Acid in Inactivating Foodborne Pathogens on Fresh Produce Surface.

    Singh, Prashant; Hung, Yen-Con; Qi, Hang

    2018-02-01

    Washing treatment with effective sanitizer is one of the critical steps in ensuring fresh produce safety. This study was to evaluate the efficacy of peracetic acid (PAA; VigorOx® 15 F&V), chlorine-based sanitizers (acidic electrolyzed water [AEO], near neutral electrolyzed water and bleach), lactic acid, and deionized (DI) water to reduce Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium DT104 from fresh produce surfaces. A 5-strain cocktail of E. coli O157:H7, L. monocytogenes, and S. Typhimurium DT104 was separately prepared and used for surface inoculation on produce samples (E. coli O157:H7 on romaine lettuce, lemons, tomatoes, and blueberries; L. monocytogenes on romaine lettuce and cantaloupe; S. Typhimurium DT104 on lemons, tomatoes, cantaloupe, and blueberries). PAA at 45, 85, and 100 mg/L; AEO, NNEO, and bleach at 100 mg/L of free chlorine; lactic acid at 2%; and DI water were used for washing inoculated produce in an automated produce washer for 5 min. In general, PAA at 100 mg/L achieved the highest microbial inactivation of E. coli O157:H7 (lettuce, lemon, tomato, and blueberry at 2.2, 5.7, 5.5, and 6.7 log CFU/g, respectively), S. Typhimurium DT104 (lemon, tomato, cantaloupe, blueberry at 5.4, 6.8, 4.5, and 5.9 log CFU/g, respectively), and L. monocytogenes (lettuce and cantaloupe at 2.4 and 4.4 log CFU/g, respectively). Efficacy of sanitizers on produce with coarse surface (for example, lettuce and cantaloupe) was lower than produce with smooth texture (lemon, tomato, and blueberry). Cross-contamination of E. coli O157:H7 among romaine lettuce heads during simulated retail crisping process was greatly reduced by the application of PAA and NNEO. NNEO and PAA showed high efficacy in foodborne pathogen removal from fresh produce. Produce surface texture plays an important role in pathogen removal. NNEO and PAA effectively prevented cross-contamination during the crisping process. © 2018 Institute of Food Technologists®.

  17. [The Advances in the Contamination and Detection of Foodborne Pathogen Noroviruses in Fresh Produce].

    Xie, Yajing; Liu, Xianjin

    2015-11-01

    This article reviewed the researches proceeding on the contamination and detection of the foodborne pathogen noroviruses (NoVs) in fresh produce, which involved the NoVs contaminations in fresh produce, the special attachment of NoVs in fresh produce, the NoVs outbreaks associated with fresh produce and the NoVs detection in fresh produce. There had been an increase in reported infectious disease risks associated with the consumptions of fresh produce for recent 30 years. Because the NoVs, as a primary cause of viral gastroenteritis thoughout the world, were highly contagious, had a low infectious dose, and were persistent in the environment. And also the methods for NoVs detection in food had significantly developed over the last 15 years. Currently NoVs were the most common pathogen accounting for 40% of outbreaks associated with fresh produce (i. e., fruits and vegetables). Data from outbreaks investigations verified fresh produce as the high risk food products for NoVs. The fresh produce were typically eaten raw with no thermal processing, can be contaminated at any step during production and processing from faecally polluted water and fertilizers, the poor hygiene practices by food handlers and the cross-contamination. The attachment of NoVs to the fresh produce was due to the physio-chemical factors of virus protein coat, the special attachment to different fresh produce, and the possibility for internalization of NoVs. It might provide answers to why those high risk foods were more frequently implicated (i. e., lettuce and raspberries). According to the data of foodborne NoVs outbreaks which were associated with fresh produce from EU countries and the USA, the outbreaks in EU countries were mainly associated with NoVs contaminated raspberries and lettuce, while in USA which were associated with NoVs contaminated lettuce. Unfortunately, there were no NoVs detection methods for fresh produce or the data of foodborne NoVs outbreaks which were associated with

  18. Contamination of knives and graters by bacterial foodborne pathogens during slicing and grating of produce.

    Erickson, Marilyn C; Liao, Jean; Cannon, Jennifer L; Ortega, Ynes R

    2015-12-01

    Poor hygiene and improper food preparation practices in consumers' homes have previously been demonstrated as contributing to foodborne diseases. To address potential cross-contamination by kitchen utensils in the home, a series of studies was conducted to determine the extent to which the use of a knife or grater on fresh produce would lead to the utensil's contamination with Escherichia coli O157:H7 or Salmonella enterica. When shredding inoculated carrots (ca. 5.3 log CFU/carrot), all graters became contaminated and the number of E. coli O157:H7 present on the utensil was significantly greater than Salmonella (p Contamination of knives after slicing inoculated produce (4.9-5.4 log CFU/produce item) could only be detected by enrichment culture. After slicing tomatoes, honeydew melons, strawberries, cucumbers, and cantaloupes, the average prevalence of knife contamination by the two pathogens was 43%, 17%, 15%, 7%, and 3%, respectively. No significant increase in the incidence or level of contamination occurred on the utensils when residues were present (p > 0.05); however, subsequent contamination of 7 produce items processed with the contaminated utensils did occur. These results highlight the necessity of proper sanitization of these utensils when used in preparation of raw produce. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

    Palková, Zdena; Váchová, Libuše

    2016-09-01

    Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Low Prevalence of Human Pathogens on Fresh Produce on Farms and in Packing Facilities: A Systematic Review

    Amelia E. Van Pelt

    2018-02-01

    Full Text Available Foodborne illness burdens individuals around the world and may be caused by consuming fresh produce contaminated with bacterial, parasite, and viral pathogens. Pathogen contamination on produce may originate at the farm and packing facility. This research aimed to determine the prevalence of human pathogens (bacteria, parasites, and viruses on fresh produce (fruits, herbs, and vegetables on farms and in packing facilities worldwide through a systematic review of 38 peer-reviewed articles. The median and range of the prevalence was calculated, and Kruskal–Wallis tests and logistic regression were performed to compare prevalence among pooled samples of produce groups, pathogen types, and sampling locations. Results indicated a low median percentage of fresh produce contaminated with pathogens (0%. Both viruses (p-value = 0.017 and parasites (p-value = 0.033, on fresh produce, exhibited higher prevalence than bacteria. No significant differences between fresh produce types or between farm and packing facility were observed. These results may help to better quantify produce contamination in the production environment and inform strategies to prevent future foodborne illness.

  1. Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

    Biagi, C.M.R. de

    1992-01-01

    Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

  2. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles

  3. Potential aquaculture probiont Lactococcus lactis TW34 produces nisin Z and inhibits the fish pathogen Lactococcus garvieae.

    Sequeiros, Cynthia; Garcés, Marisa E; Vallejo, Marisol; Marguet, Emilio R; Olivera, Nelda L

    2015-04-01

    Bacteriocin-producing Lactococcus lactis TW34 was isolated from marine fish. TW34 bacteriocin inhibited the growth of the fish pathogen Lactococcus garvieae at 5 AU/ml (minimum inhibitory concentration), whereas the minimum bactericidal concentration was 10 AU/ml. Addition of TW34 bacteriocin to L. garvieae cultures resulted in a decrease of six orders of magnitude of viable cells counts demonstrating a bactericidal mode of action. The direct detection of the bacteriocin activity by Tricine-SDS-PAGE showed an active peptide with a molecular mass ca. 4.5 kDa. The analysis by MALDI-TOF-MS detected a strong signal at m/z 2,351.2 that corresponded to the nisin leader peptide mass without the initiating methionine, whose sequence STKDFNLDLVSVSKKDSGASPR was confirmed by MS/MS. Sequence analysis of nisin structural gene confirmed that L. lactis TW34 was a nisin Z producer. This nisin Z-producing strain with probiotic properties might be considered as an alternative in the prevention of lactococcosis, a global disease in aquaculture systems.

  4. Environmental E.coli isolate characterization and selection as improved indicators for pathogens associated with produce contamination

    Contamination of food and water by pathogens is a substantial public health issue in the United States. According to the Centers for Disease Control and Prevention, 49% of foodborne illness is caused by produce, and despite efforts to reduce produce contamination, these issues persist. Escherichia c...

  5. Follicular B Cells Promote Atherosclerosis via T Cell-Mediated Differentiation Into Plasma Cells and Secreting Pathogenic Immunoglobulin G.

    Tay, Christopher; Liu, Yu-Han; Kanellakis, Peter; Kallies, Axel; Li, Yi; Cao, Anh; Hosseini, Hamid; Tipping, Peter; Toh, Ban-Hock; Bobik, Alex; Kyaw, Tin

    2018-05-01

    B cells promote or protect development of atherosclerosis. In this study, we examined the role of MHCII (major histocompatibility II), CD40 (cluster of differentiation 40), and Blimp-1 (B-lymphocyte-induced maturation protein) expression by follicular B (FO B) cells in development of atherosclerosis together with the effects of IgG purified from atherosclerotic mice. Using mixed chimeric Ldlr -/- mice whose B cells are deficient in MHCII or CD40, we demonstrate that these molecules are critical for the proatherogenic actions of FO B cells. During development of atherosclerosis, these deficiencies affected T-B cell interactions, germinal center B cells, plasma cells, and IgG. As FO B cells differentiating into plasma cells require Blimp-1, we also assessed its role in the development of atherosclerosis. Blimp-1-deficient B cells greatly attenuated atherosclerosis and immunoglobulin-including IgG production, preventing IgG accumulation in atherosclerotic lesions; Blimp-1 deletion also attenuated lesion proinflammatory cytokines, apoptotic cell numbers, and necrotic core. To determine the importance of IgG for atherosclerosis, we purified IgG from atherosclerotic mice. Their transfer but not IgG from nonatherosclerotic mice into Ldlr -/- mice whose B cells are Blimp-1-deficient increased atherosclerosis; transfer was associated with IgG accumulating in atherosclerotic lesions, increased lesion inflammatory cytokines, apoptotic cell numbers, and necrotic core size. The mechanism by which FO B cells promote atherosclerosis is highly dependent on their expression of MHCII, CD40, and Blimp-1. FO B cell differentiation into IgG-producing plasma cells also is critical for their proatherogenic actions. Targeting B-T cell interactions and pathogenic IgG may provide novel therapeutic strategies to prevent atherosclerosis and its adverse cardiovascular complications. © 2018 American Heart Association, Inc.

  6. Isolation, Characterization and Biological Properties of Membrane Vesicles Produced by the Swine Pathogen Streptococcus suis.

    Bruno Haas

    Full Text Available Streptococcus suis, more particularly serotype 2, is a major swine pathogen and an emerging zoonotic agent worldwide that mainly causes meningitis, septicemia, endocarditis, and pneumonia. Although several potential virulence factors produced by S. suis have been identified in the last decade, the pathogenesis of S. suis infections is still not fully understood. In the present study, we showed that S. suis produces membrane vesicles (MVs that range in diameter from 13 to 130 nm and that appear to be coated by capsular material. A proteomic analysis of the MVs revealed that they contain 46 proteins, 9 of which are considered as proven or suspected virulence factors. Biological assays confirmed that S. suis MVs possess active subtilisin-like protease (SspA and DNase (SsnA. S. suis MVs degraded neutrophil extracellular traps, a property that may contribute to the ability of the bacterium to escape the host defense response. MVs also activated the nuclear factor-kappa B (NF-κB signaling pathway in both monocytes and macrophages, inducing the secretion of pro-inflammatory cytokines, which may in turn contribute to increase the permeability of the blood brain barrier. The present study brought evidence that S. suis MVs may play a role as a virulence factor in the pathogenesis of S. suis infections, and given their composition be an excellent candidate for vaccine development.

  7. De novo identification of viral pathogens from cell culture hologenomes

    Patowary Ashok

    2012-01-01

    Full Text Available Abstract Background Fast, specific identification and surveillance of pathogens is the cornerstone of any outbreak response system, especially in the case of emerging infectious diseases and viral epidemics. This process is generally tedious and time-consuming thus making it ineffective in traditional settings. The added complexity in these situations is the non-availability of pure isolates of pathogens as they are present as mixed genomes or hologenomes. Next-generation sequencing approaches offer an attractive solution in this scenario as it provides adequate depth of sequencing at fast and affordable costs, apart from making it possible to decipher complex interactions between genomes at a scale that was not possible before. The widespread application of next-generation sequencing in this field has been limited by the non-availability of an efficient computational pipeline to systematically analyze data to delineate pathogen genomes from mixed population of genomes or hologenomes. Findings We applied next-generation sequencing on a sample containing mixed population of genomes from an epidemic with appropriate processing and enrichment. The data was analyzed using an extensive computational pipeline involving mapping to reference genome sets and de-novo assembly. In depth analysis of the data generated revealed the presence of sequences corresponding to Japanese encephalitis virus. The genome of the virus was also independently de-novo assembled. The presence of the virus was in addition, verified using standard molecular biology techniques. Conclusions Our approach can accurately identify causative pathogens from cell culture hologenome samples containing mixed population of genomes and in principle can be applied to patient hologenome samples without any background information. This methodology could be widely applied to identify and isolate pathogen genomes and understand their genomic variability during outbreaks.

  8. Translocation of cell-penetrating peptides into Candida fungal pathogens.

    Gong, Zifan; Karlsson, Amy J

    2017-09-01

    Cell-penetrating peptides (CPPs) are small peptides capable of crossing cellular membranes while carrying molecular cargo. Although they have been widely studied for their ability to translocate nucleic acids, small molecules, and proteins into mammalian cells, studies of their interaction with fungal cells are limited. In this work, we evaluated the translocation of eleven fluorescently labeled peptides into the important human fungal pathogens Candida albicans and C. glabrata and explored the mechanisms of translocation. Seven of these peptides (cecropin B, penetratin, pVEC, MAP, SynB, (KFF) 3 K, and MPG) exhibited substantial translocation (>80% of cells) into both species in a concentration-dependent manner, and an additional peptide (TP-10) exhibiting strong translocation into only C. glabrata. Vacuoles were involved in translocation and intracellular trafficking of the peptides in the fungal cells and, for some peptides, escape from the vacuoles and localization in the cytosol were correlated to toxicity toward the fungal cells. Endocytosis was involved in the translocation of cecropin B, MAP, SynB, MPG, (KFF) 3 K, and TP-10, and cecropin B, penetratin, pVEC, and MAP caused membrane permeabilization during translocation. These results indicate the involvement of multiple translocation mechanisms for some CPPs. Although high levels of translocation were typically associated with toxicity of the peptides toward the fungal cells, SynB was translocated efficiently into Candida cells at concentrations that led to minimal toxicity. Our work highlights the potential of CPPs in delivering antifungal molecules and other bioactive cargo to Candida pathogens. © 2017 The Protein Society.

  9. Pathogenicity and cell wall-degrading enzyme activities of some ...

    Dr. J. T. Ekanem

    2005-12-17

    Dec 17, 2005 ... be attributed to the activities of these cell wall degrading enzymes. Keywords: Cowpea ... bacteria have long been known to produce enzymes capable of ... Inoculated seeds were sown in small plastic pots filled with steam- ...

  10. Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

    Sandra Mojsova

    2015-10-01

    Full Text Available The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1 isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua. One isolate had a broader antimicrobial activity. None of the isolates showed inhibitory activity against S. enteritidis, E. coli and Y. enterocolitica. The genes enterocin P, cytolysin and enterocin A were the most frequently detected structural genes among the PCR positive strains. No amplification was obtained in two strains E. faecalis-25 and E. faecalis-86. Three different genes were identified in some strains. With the exclusion of strains possessing a virulence factor, such as cytolysin, producers of more than one enterocins could be of a great technological potential as protective cultures in the cheese industry.

  11. How pathogens use linear motifs to perturb host cell networks

    Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  12. Occurrence of mastitis pathogens in relation to somatic cells

    Marcela Vyletělová Klimešová

    2013-01-01

    Full Text Available There were examined 161 cows from 4 farms in total. The suspect animals were selected according to viscosity test results, clinical symptoms and somatic cell count (SCC. Milk samples were examined for the presence of pathogens and for SCC. 55 mastitis pathogens were identified. The most frequently isolated species was Enterococcus faecalis (n = 20, followed by Staphylococcus aureus (n = 6 and Streptococcus uberis (n = 5. The SCC ranged from 9 to 24 204 ths.ml−1. There was positive occurrence of bacteria genus Staphylococcus and Enterococcus at lower SCC (50 ths.ml−1 and at higher SCC numbers (> 300 ths. ml−1 bacteria genus Streptococcus, Enterobacter and Escherichia coli. Differences in SCC were significant (P < 0.001 in negative samples xg 131 SCC versus 491 for positive, 611 for staphylococci and 464 ths.ml−1 for other positive. SCC discrimination limit for practical likelihood of pathogen occurrence estimation in infectious sample groups was calculated. This limit for suspicion of infection is 159 for positive group, 113 for staphylococci and 174 ths.ml−1 for other positive. This could be possible to recommend the value 174 ths.ml−1 for practical use with target to apply preventive or curative measures.

  13. Antagonistic activity of antibiotic producing Streptomyces sp. against fish and human pathogenic bacteria

    Nazmul Hossain

    2014-04-01

    Full Text Available In this study, attempts were made to isolate Streptomyces sp. from soil samples of two different regions of Bangladesh and evaluate their antagonistic activity against fish and human pathogenic bacteria. A total of 10 isolates were identified as Streptomyces sp. based on several morphological, physiological and biochemical tests. Cross streak method was used to observe the antagonistic activity of the Streptomyces sp. isolates against different fish pathogens belonging to the genus Aeromonas, Pseudomonas and Edwardsiella and human clinical isolates belonging to the genus Klebsiella, Salmonella and Streptococcus. Seven Streptomyces sp. isolates showed antagonism against both fish and human pathogenic bacteria. Four isolates viz., N24, N26, N28 and N47 showed broad spectrum of antagonistic activity (80-100% against all genera of fish and human pathogenic bacteria. The isolate N49 exhibited highest spectrum of antagonism against all fish pathogens (90-100% but comparatively lower degree of antagonism against human pathogens (50-60%. Rest of the two isolates (N21 and N23 showed variability in their antagonism. Results showed that broad spectrum antibiotic(s could be developed from the isolates N24, N26, N28 and N47against several human and fish pathogens. The isolate N49 could be a potential source of antibiotic, especially for fish pathogenic bacteria.

  14. Intervention technologies for food safety on minimally processed produce:Perspectives on food-borne and plant pathogens

    Produce contamination associated with enteric pathogens such Escherichia coli O157:H7, salmonella spp., Listeria monocytogenes, Shigella and others are significant challenges to food safety. This is due to the illnesses and economic impacts resulting from the outbreaks. Innovative technologies for i...

  15. The fish pathogen Yersinia ruckeri produces holomycin and uses an RNA methyltransferase for self-resistance.

    Qin, Zhiwei; Baker, Alexander Thomas; Raab, Andrea; Huang, Sheng; Wang, Tiehui; Yu, Yi; Jaspars, Marcel; Secombes, Christopher J; Deng, Hai

    2013-05-24

    Holomycin and its derivatives belong to a class of broad-spectrum antibacterial natural products containing a rare dithiolopyrrolone heterobicyclic scaffold. The antibacterial mechanism of dithiolopyrrolone compounds has been attributed to the inhibition of bacterial RNA polymerase activities, although the exact mode of action has not been established in vitro. Some dithiopyrrolone derivatives display potent anticancer activities. Recently the biosynthetic gene cluster of holomycin has been identified and characterized in Streptomyces clavuligerus. Here we report that the fish pathogen Yersinia ruckeri is a holomycin producer, as evidenced through genome mining, chemical isolation, and structural elucidation as well as genetic manipulation. We also identified a unique regulatory gene hom15 at one end of the gene cluster encoding a cold-shock-like protein that likely regulates the production of holomycin in low cultivation temperatures. Inactivation of hom15 resulted in a significant loss of holomycin production. Finally, gene disruption of an RNA methyltransferase gene hom12 resulted in the sensitivity of the mutant toward holomycin. A complementation experiment of hom12 restored the resistance against holomycin. Although the wild-type Escherichia coli BL21(DE3) Gold is susceptible to holomycin, the mutant harboring hom12 showed tolerance toward holomycin. High resolution liquid chromatography (LC)-ESI/MS analysis of digested RNA fragments demonstrated that the wild-type Y. ruckeri and E. coli harboring hom12 contain a methylated RNA fragment, whereas the mutated Y. ruckeri and the wild-type E. coli only contain normal non-methylated RNA fragments. Taken together, our results strongly suggest that this putative RNA methyltransferase Hom12 is the self-resistance protein that methylates the RNA of Y. ruckeri to reduce the cytotoxic effect of holomycin during holomycin production.

  16. Vaccines based on the cell surface carbohydrates of pathogenic bacteria

    Jones Christopher

    2005-01-01

    Full Text Available Glycoconjugate vaccines, in which a cell surface carbohydrate from a micro-organism is covalently attached to an appropriate carrier protein are proving to be the most effective means to generate protective immune responses to prevent a wide range of diseases. The technology appears to be generic and applicable to a wide range of pathogens, as long as antibodies against surface carbohydrates help protect against infection. Three such vaccines, against Haemophilus influenzae type b, Neisseria meningitidis Group C and seven serotypes of Streptococcus pneumoniae, have already been licensed and many others are in development. This article discusses the rationale for the development and use of glycoconjugate vaccines, the mechanisms by which they elicit T cell-dependent immune responses and the implications of this for vaccine development, the role of physicochemical methods in the characterisation and quality control of these vaccines, and the novel products which are under development.

  17. Marking and quantifying IL-17A-producing cells in vivo.

    April E Price

    Full Text Available Interleukin (IL-17A plays an important role in host defense against a variety of pathogens and may also contribute to the pathogenesis of autoimmune diseases. However, precise identification and quantification of the cells that produce this cytokine in vivo have not been performed. We generated novel IL-17A reporter mice to investigate expression of IL-17A during Klebsiella pneumoniae infection and during experimental autoimmune encephalomyelitis, conditions previously demonstrated to potently induce IL-17A production. In both settings, the majority of IL-17A was produced by non-CD4(+ T cells, particularly γδ T cells, but also invariant NKT cells and other CD4(-CD3ε(+ cells. As measured in dual-reporter mice, IFN-γ-producing Th1 cells greatly outnumbered IL-17A-producing Th17 cells throughout both challenges. Production of IL-17A by cells from unchallenged mice or by non-T cells under any condition was not evident. Administration of IL-1β and/or IL-23 elicited rapid production of IL-17A by γδ T cells, invariant NKT cells and other CD4(-CD3ε(+ cells in vivo, demonstrating that these cells are poised for rapid cytokine production and likely comprise the major sources of this cytokine during acute immunologic challenges.

  18. NREL Scientists Report First Solar Cell Producing More Electrons In

    measured in operating quantum dot solar cells at low light intensity; these cells showed significant power Photocurrent Than Solar Photons Entering Cell | News | NREL NREL Scientists Report First Solar Cell Producing More Electrons In Photocurrent Than Solar Photons Entering Cell News Release: NREL

  19. Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

    Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

    2013-01-01

    Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

  20. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  1. Composition of Mineral Produced by Dental Mesenchymal Stem Cells.

    Volponi, A A; Gentleman, E; Fatscher, R; Pang, Y W Y; Gentleman, M M; Sharpe, P T

    2015-11-01

    Mesenchymal stem cells isolated from different dental tissues have been described to have osteogenic/odontogenic-like differentiation capacity, but little attention has been paid to the biochemical composition of the material that each produces. Here, we used Raman spectroscopy to analyze the mineralized materials produced in vitro by different dental cell populations, and we compared them with the biochemical composition of native dental tissues. We show that different dental stem cell populations produce materials that differ in their mineral and matrix composition and that these differ from those of native dental tissues. In vitro, BCMP (bone chip mass population), SCAP (stem cells from apical papilla), and SHED (stem cells from human-exfoliated deciduous teeth) cells produce a more highly mineralized matrix when compared with that produced by PDL (periodontal ligament), DPA (dental pulp adult), and GF (gingival fibroblast) cells. Principal component analyses of Raman spectra further demonstrated that the crystallinity and carbonate substitution environments in the material produced by each cell type varied, with DPA cells, for example, producing a more carbonate-substituted mineral and with SCAP, SHED, and GF cells creating a less crystalline material when compared with other dental stem cells and native tissues. These variations in mineral composition reveal intrinsic differences in the various cell populations, which may in turn affect their specific clinical applications. © International & American Associations for Dental Research 2015.

  2. IL-17-producing NKT cells depend exclusively on IL-7 for homeostasis and survival.

    Webster, K E; Kim, H-O; Kyparissoudis, K; Corpuz, T M; Pinget, G V; Uldrich, A P; Brink, R; Belz, G T; Cho, J-H; Godfrey, D I; Sprent, J

    2014-09-01

    Natural killer T (NKT) cells are innate-like T cells that rapidly recognize pathogens and produce cytokines that shape the ensuing immune response. IL-17-producing NKT cells are enriched in barrier tissues, such as the lung, skin, and peripheral lymph nodes, and the factors that maintain this population in the periphery have not been elucidated. Here we show that NKT17 cells deviate from other NKT cells in their survival requirements. In contrast to conventional NKT cells that are maintained by IL-15, RORγt(+) NKT cells are IL-15 independent and instead rely completely on IL-7. IL-7 initiates a T-cell receptor-independent (TCR-independent) expansion of NKT17 cells, thus supporting their homeostasis. Without IL-7, survival is dramatically impaired, yet residual cells remain lineage committed with no downregulation of RORγt evident. Their preferential response to IL-7 does not reflect enhanced signaling through STAT proteins, but instead is modulated via the PI3K/AKT/mTOR signaling pathway. The ability to compete for IL-7 is dependent on high-density IL-7 receptor expression, which would promote uptake of low levels of IL-7 produced in the non-lymphoid sites of lung and skin. This dependence on IL-7 is also reported for RORγt(+) innate lymphoid cells and CD4(+) Th17 cells, and suggests common survival requirements for functionally similar cells.

  3. Living biointerfaces based on non-pathogenic bacteria to direct cell differentiation

    Rodrigo-Navarro, Aleixandre; Rico, Patricia; Saadeddin, Anas; Garcia, Andres J.; Salmeron-Sanchez, Manuel

    2014-07-01

    Genetically modified Lactococcus lactis, non-pathogenic bacteria expressing the FNIII7-10 fibronectin fragment as a protein membrane have been used to create a living biointerface between synthetic materials and mammalian cells. This FNIII7-10 fragment comprises the RGD and PHSRN sequences of fibronectin to bind α5β1 integrins and triggers signalling for cell adhesion, spreading and differentiation. We used L. lactis strain to colonize material surfaces and produce stable biofilms presenting the FNIII7-10 fragment readily available to cells. Biofilm density is easily tunable and remains stable for several days. Murine C2C12 myoblasts seeded over mature biofilms undergo bipolar alignment and form differentiated myotubes, a process triggered by the FNIII7-10 fragment. This biointerface based on living bacteria can be further modified to express any desired biochemical signal, establishing a new paradigm in biomaterial surface functionalisation for biomedical applications.

  4. Pathogenic Assay of Probiotic Bacteria Producing Proteolytic Enzymes as Bioremediation Bacteria Against Vannamei Shrimp Larvae (Litopenaeus vannamei)

    Wilis Ari Setyati; Muhammad Zainuddin; Person Pesona Renta

    2017-01-01

    Application of bacteria in bioremediation of shrimp culture ponds is one of the methods used to clean internal pollutants. This study aimed to evaluate the pathogenicity of extracellular proteolytic enzyme produced by the probiotic bacteria as bioremediation bacteria on vannamei shrimp larvae culture. There were five probiotic bacteria, which were successfully isolated from the sediments served as substrate in mangrove area. The isolated bacteria were coded in number as 13, 19, 30, 33, and 36...

  5. Phenotypic and genotypic characteristics of enterocin producing enterococci against pathogenic bacteria

    Sandra Mojsova; Kiril Krstevski; Igor Dzadzovski; Zagorka Popova; Pavle Sekulovski

    2015-01-01

    The study investigated the antimicrobial activity of 13 enterococcal strains (E. faecalis -8, E. faecium-2, E. hirae-2, E. spp.-1) isolated from our traditional cheeses against pathogen microorganisms. Also, it includes the detection of the following enterocin structural genes: enterocin A, enterocin B, enterocin P, enterocin L50A/B, bacteriocin 31, enterocin AS48, enterocin Q, enterocin EJ97 and cytolysin by using PCR method. All isolates inhibited growth of L. monocytogenes and L.innocua...

  6. Bioactivity of glycolipopeptide cell-bound biosurfactants against skin pathogens.

    Vecino, X; Rodríguez-López, L; Ferreira, D; Cruz, J M; Moldes, A B; Rodrigues, L R

    2018-04-01

    The antimicrobial and anti-adhesive activities of the cell-bound biosurfactants, produced by Lactobacillus pentosus (PEB), characterized as glycolipopeptide macromolecules, were evaluated against several microorganisms present in the skin microflora, envisaging its potential use as a "natural" ingredient in cosmetic and personal care formulations. Their performance was compared with another cell-bound biosurfactants also characterized as glycolipopeptides produced by Lactobacillus paracasei (PAB). At concentrations of 50mg/mL, the PEB showed an important antimicrobial activity against Pseudomonas aeruginosa (85% when extracted with phosphate buffer (PB) and 100% when extracted with phosphate buffer saline (PBS)), Streptococcus agalactiae (100% for both extracts), Staphylococcus aureus (67% when extracted with PBS and 100% when extracted with PB), Escherichia coli (72% when extracted with PB and 89% when extracted with PBS), Streptococcus pyogenes (about 85% for both extracts) and Candida albicans (around 70% for both extracts), comparable with that obtained for the PAB. However, at lower concentrations the PAB exhibited in general higher antimicrobial activities. Biosurfactants produced by both microorganisms also showed significant anti-adhesive properties against all the microorganisms under study, except for E. coli and C. albicans (less than 30%). Overall, these cell-bound biosurfactants could be used as potential antimicrobial and anti-adhesive agents in cosmetic and pharmaceutical formulations. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Diplopimarane, a 20-nor-ent-pimarane produced by the oak pathogen Diplodia quercivora.

    Andolfi, Anna; Maddau, Lucia; Basso, Sara; Linaldeddu, Benedetto T; Cimmino, Alessio; Scanu, Bruno; Deidda, Antonio; Tuzi, Angela; Evidente, Antonio

    2014-11-26

    In this study a new 20-nor-ent-pimarane, named diplopimarane, was isolated together with sphaeropsidins A (9) and C (10), and (+)-epiepoformin (11) from organic crude extracts of Diplodia quercivora, a recently described oak pathogen originally found on declining Quercus canariensis trees in Tunisia. Diplopimarane was characterized as (1S,2R)-2,8,8-trimethyl-2-vinyl-1,2,3,4,5,6,7,8-octahydrophenanthrene-1,9,10-triol by spectroscopic, X-ray, optical, and chemical methods. It exhibited a wide range of activities including remarkable phytotoxicity on nonhost plants such as tomato cuttings, moderate antifungal activity against important plant pathogens, and moderate zootoxicity against Artemia salina. Its derivatives (2-4 and 6) were also tested for their phytotoxic and zootoxic activities. All these derivatives proved to be active against A. salina at 200 μg/mL, while 2 and 6 were also active on tomato cuttings. The other secondary metabolites (9, 10, and 11) herein reported for D. quercivora exhibited phytotoxic, antifungal, and zootoxic activity. This is the first report on the secondary metabolites secreted in vitro by this oak pathogen that could be key components of its adaptative strategies.

  8. Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

    García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

    2016-01-01

    The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

  9. IL-9-Producing Mast Cell Precursors and Food Allergy

    2017-10-01

    AWARD NUMBER: W81XWH-15-1-0517 TITLE: IL-9-Producing Mast Cell Precursors and Food Allergy PRINCIPAL INVESTIGATOR: Dr. Simon P. Hogan PhD...IL-9-Producing Mast Cell Precursors and Food Allergy 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Yui Hsi Wang, Sunil...threatening anaphylaxis. We have identified a novel multi-functional IL-9-producing mucosal mast cells (MMC9s) that produce large amounts of IL-9, IL

  10. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile; Zhang, Jue; Fang, Jing

    2015-01-01

    Highlights: • We propose a new approach to treat S. aureus inoculated on strawberries by PAW. • PAW could inactivate S. aureus on strawberries via the Log Reduction results, further confirmed by CLSM and SEM. • The short-lived ROS in PAW are considered the most important agents in inactivation process. • No significant change was found in color, firmness and pH of the PAW treated strawberries. - Abstract: Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  11. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce

    Ma, Ruonan; Wang, Guomin; Tian, Ying; Wang, Kaile [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); Zhang, Jue, E-mail: zhangjue@pku.edu.cn [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); College of Engineering, Peking University, Beijing 100871 (China); Fang, Jing [Academy for Advanced Interdisciplinary Studies, Peking University, Beijing 100871 (China); College of Engineering, Peking University, Beijing 100871 (China)

    2015-12-30

    Highlights: • We propose a new approach to treat S. aureus inoculated on strawberries by PAW. • PAW could inactivate S. aureus on strawberries via the Log Reduction results, further confirmed by CLSM and SEM. • The short-lived ROS in PAW are considered the most important agents in inactivation process. • No significant change was found in color, firmness and pH of the PAW treated strawberries. - Abstract: Non-thermal plasma has been widely considered to be an effective method for decontamination of foods. Recently, numerous studies report that plasma-activated water (PAW) also has outstanding antibacterial ability. This study presents the first report on the potential of PAW for the inactivation of Staphylococcus aureus (S. aureus) inoculated on strawberries. PAW treatments achieved a reduction of S. aureus ranging from 1.6 to 2.3 log at day-0 storage, while 1.7 to 3.4 log at day-4 storage. The inactivation efficiency depended on the plasma-activated time for PAW generation and PAW-treated time of strawberries inoculated with S. aureus. LIVE/DEAD staining and scanning electron microscopy results confirm that PAW could damage the bacterial cell wall. Moreover, optical emission spectra and oxidation reduction potential results demonstrate the inactivation is mainly attributed to oxidative stress induced by reactive oxygen species in PAW. In addition, no significant change was found in color, firmness and pH of the PAW treated strawberries. Thus, PAW can be a promising alternative to traditional sanitizers applied in the fresh produce industry.

  12. Targeting development of incretin-producing cells increases insulin secretion

    Petersen, Natalia; Reimann, Frank; van Es, Johan H

    2015-01-01

    the number of intestinal L cells, which produce GLP-1, is an alternative strategy to augment insulin responses and improve glucose tolerance. Blocking the NOTCH signaling pathway with the γ-secretase inhibitor dibenzazepine increased the number of L cells in intestinal organoid-based mouse and human culture...... of the development of incretin-producing cells in the intestine has potential as a therapeutic strategy to improve glycemic control....

  13. Assessment of the pathogenicity of cell-culture-adapted Newcastle disease virus strain Komarov.

    Visnuvinayagam, Sivam; Thangavel, K; Lalitha, N; Malmarugan, S; Sukumar, Kuppannan

    2015-01-01

    Newcastle disease vaccines hitherto in vogue are produced from embryonated chicken eggs. Egg-adapted mesogenic vaccines possess several drawbacks such as paralysis and mortality in 2-week-old chicks and reduced egg production in the egg-laying flock. Owing to these possible drawbacks, we attempted to reduce the vaccine virulence for safe vaccination by adapting the virus in a chicken embryo fibroblast cell culture (CEFCC) system. Eighteen passages were carried out by CEFCC, and the pathogenicity was assessed on the basis of the mean death time, intracerebral pathogenicity index, and intravenous pathogenicity index, at equal passage intervals. Although the reduction in virulence demonstrated with increasing passage levels in CEFCC was encouraging, 20% of the 2-week-old birds showed paralytic symptoms with the virus vaccine from the 18(th)(final) passage. Thus, a tissue-culture-adapted vaccine would demand a few more passages by CEFCC in order to achieve a complete reduction in virulence for use as a safe and effective vaccine, especially among younger chicks. Moreover, it can be safely administered even to unprimed 8-week-old birds.

  14. Evolution of structural diversity of trichothecenes, a family of toxins produced by plant pathogenic and entomopathogenic fungi.

    Proctor, Robert H; McCormick, Susan P; Kim, Hye-Seon; Cardoza, Rosa E; Stanley, April M; Lindo, Laura; Kelly, Amy; Brown, Daren W; Lee, Theresa; Vaughan, Martha M; Alexander, Nancy J; Busman, Mark; Gutiérrez, Santiago

    2018-04-01

    Trichothecenes are a family of terpenoid toxins produced by multiple genera of fungi, including plant and insect pathogens. Some trichothecenes produced by the fungus Fusarium are among the mycotoxins of greatest concern to food and feed safety because of their toxicity and frequent occurrence in cereal crops, and trichothecene production contributes to pathogenesis of some Fusarium species on plants. Collectively, fungi produce over 150 trichothecene analogs: i.e., molecules that share the same core structure but differ in patterns of substituents attached to the core structure. Here, we carried out genomic, phylogenetic, gene-function, and analytical chemistry studies of strains from nine fungal genera to identify genetic variation responsible for trichothecene structural diversity and to gain insight into evolutionary processes that have contributed to the variation. The results indicate that structural diversity has resulted from gain, loss, and functional changes of trichothecene biosynthetic (TRI) genes. The results also indicate that the presence of some substituents has arisen independently in different fungi by gain of different genes with the same function. Variation in TRI gene duplication and number of TRI loci was also observed among the fungi examined, but there was no evidence that such genetic differences have contributed to trichothecene structural variation. We also inferred ancestral states of the TRI cluster and trichothecene biosynthetic pathway, and proposed scenarios for changes in trichothecene structures during divergence of TRI cluster homologs. Together, our findings provide insight into evolutionary processes responsible for structural diversification of toxins produced by pathogenic fungi.

  15. Exploration and conservation of bacterial genetic resources as bacteriocin producing inhibitory microorganisms to pathogen bacteria in livestock

    Chotiah S

    2013-06-01

    Full Text Available Exploration and conservation of microorganisms producing bacteriocin was done as the primary study towards the collection of potential bacteria and its application in improving livestock health condition and inhibit food borne pathogens. Diferent kinds of samples such as beef cattle rectal swab, rumen fluids, cow’s milk, chicken gut content, goat’s milk were collected at Bogor cattle slaughter houses, poultry slaughter houses, dairy cattle and goat farms. A total of 452 bacterial isolates consisted of 73 Gram negative bacteria and 379 Gram positive bacteria were isolated from samples collected and screened for bacteriocin activity. Determination of bacteriocin activity with bioassay using agar spot tests were carried out on liquid and semisolid medium assessing 8 kins of indicators of pathogenic bacteria and food borne pathogens. A total of 51 bacteriocin producing strains were collected and some of the strains had high inhibitory zone such as Lactobacillus casei SS14C (26 mm, Enterobacter cloacae SRUT (24mm, Enterococcus faecalis SK39 (21mm and Bifidobacterium dentium SS14T (20mm respectively, to Salmonella typhimurium BCC B0046/ATCC 13311, E. coli O157 hemolytic BCC B2717, Listeria monocytogenes BCC B2767/ATCC 7764 and Escherichia coli VTEC O157 BCC B2687. Evaluation after conservation ex situ to all bacterocin producing strain at 5oC for 1 year in freeze drying ampoules in vacuum and dry condition revealed the decreasing viability starting from log 0.8 CFU/ml for Lactococcus and Leuconostoc to log 2.2. CFU/ml for Streptococcus. Result of the study showed that the bacteriocin producing strains obtained were offered a potential resource for preventing disease of livestock and food borne diseases.

  16. Diversity and natural functions of antibiotices produced by beneficial and pathogenic soil bacteria

    Soil and plant-associated environments harbor numerous bacterial species that produce antibiotic metabolites. Many of these bacteria have been exploited for the discovery of clinical antibiotics and other therapeutics. In the field of plant pathology, antibiotic-producing bacteria are used as a reso...

  17. Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria.

    Raaijmakers, Jos M; Mazzola, Mark

    2012-01-01

    Soil- and plant-associated environments harbor numerous bacteria that produce antibiotic metabolites with specific or broad-spectrum activities against coexisting microorganisms. The function and ecological importance of antibiotics have long been assumed to yield a survival advantage to the producing bacteria in the highly competitive but resource-limited soil environments through direct suppression. Although specific antibiotics may enhance producer persistence when challenged by competitors or predators in soil habitats, at subinhibitory concentrations antibiotics exhibit a diversity of other roles in the life history of the producing bacteria. Many processes modulated by antibiotics may be inherently critical to the producing bacterium, such as the acquisition of substrates or initiation of developmental changes that will ensure survival under stressful conditions. Antibiotics may also have roles in more complex interactions, including in virulence on host plants or in shaping the outcomes of multitrophic interactions. The innate functions of antibiotics to producing bacteria in their native ecosystem are just beginning to emerge, but current knowledge already reveals a breadth of activities well beyond the historical perspective of antibiotics as weaponry in microbial conflicts.

  18. The response of CD1d-restricted invariant NKT cells to microbial pathogens and their products

    Luc eVan Kaer

    2015-05-01

    Full Text Available Invariant natural killer T (iNKT cells become activated during a wide variety of infections. This includes organisms lacking cognate CD1d-binding glycolipid antigens recognized by the semi-invariant T cell receptor of iNKT cells. Additional studies have shown that iNKT cells also become activated in vivo in response to microbial products such as bacterial lipopolysaccharide, a potent inducer of cytokine production in antigen-presenting cells (APCs. Other studies have shown that iNKT cells are highly responsive to stimulation by cytokines such as interleukin-12. These findings have led to the concept that microbial pathogens can activate iNKT cells either directly via glycolipids, or indirectly by inducing cytokine production in APCs. iNKT cells activated in this manner produce multiple cytokines that can influence the outcome of infection, usually in favor of the host, although potent iNKT cell activation may contribute to an uncontrolled cytokine storm and sepsis. One aspect of the response of iNKT cells to microbial pathogens is that it is short-lived and followed by an extended time period of unresponsiveness to reactivation. This refractory period may represent a means to avoid chronic activation and cytokine production by iNKT cells, thus protecting the host against some of the negative effects of iNKT cell activation, but potentially putting the host at risk for secondary infections. These effects of microbial pathogens and their products on iNKT cells are not only important for understanding the role of these cells in immune responses against infections but also for the development of iNKT cell-based therapies.

  19. [Ultrastructure and molecular biochemistry on pathogenic fungal cells: the architecture of septal cell walls of dermatophytes].

    Kitajima, Y

    2001-01-01

    This review provides abstracts of our research for which the year 2000 prize of The Japanese Society for Medical Mycology was awarded. The study consists of 4 fields: 1)Ultrastructure and biochemistry of the cell walls of dermatophytes. 2) Freeze-fracture electron microscopic study on the membrane systems of pathogenic fungi. 3) Action mechanisms of antifungal agents in terms of membrane structure and functions. 4) Dimorphism and virulence of pathogenic fungi in terms of molecular biology of membrane lipids. Since the detailed contents of these studies were reported in my previous review article (Jpn J Med Mycol 41: 211-217, 2000), I would like to mention these studies only briefly here, together with a detailed review of the septal cell wall architecture of dermatophytes, which I did not cover in my earlier articles.

  20. Host cells and methods for producing isoprenyl alkanoates

    Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-12-01

    The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

  1. Human Cells as Platform to Produce Gamma-Carboxylated Proteins.

    de Sousa Bomfim, Aline; de Freitas, Marcela Cristina Corrêa; Covas, Dimas Tadeu; de Sousa Russo, Elisa Maria

    2018-01-01

    The gamma-carboxylated proteins belong to a family of proteins that depend on vitamin K for normal biosynthesis. The major representative gamma-carboxylated proteins are the coagulation system proteins, for example, factor VII, factor IX, factor X, prothrombin, and proteins C, S, and Z. These molecules have harbored posttranslational modifications, such as glycosylation and gamma-carboxylation, and for this reason they need to be produced in mammalian cell lines. Human cells lines have emerged as the most promising alternative to the production of gamma-carboxylated proteins. In this chapter, the methods to generate human cells as a platform to produce gamma-carboxylated proteins, for example the coagulation factors VII and IX, are presented. From the cell line modification up to the vitamin K adaptation of the produced cells is described in the protocols presented in this chapter.

  2. Automated surface-scanning detection of pathogenic bacteria on fresh produce

    Horikawa, Shin; Du, Songtao; Liu, Yuzhe; Chen, I.-Hsuan; Xi, Jianguo; Crumpler, Michael S.; Sirois, Donald L.; Best, Steve R.; Wikle, Howard C.; Chin, Bryan A.

    2017-05-01

    This paper investigates the effects of surface-scanning detector position on the resonant frequency and signal amplitude of a wireless magnetoelastic (ME) biosensor for direct pathogen detection on solid surfaces. The experiments were conducted on the surface of a flat polyethylene (PE) plate as a model study. An ME biosensor (1 mm × 0.2 mm × 30 μm) was placed on the PE surface, and a surface-scanning detector was brought close and aligned to the sensor for wireless resonant frequency measurement. The position of the detector was accurately controlled by using a motorized three-axis translation system (i.e., controlled X, Y, and Z positions). The results showed that the resonant frequency variations of the sensor were -125 to +150 Hz for X and Y detector displacements of +/-600 μm and Z displacements of +100 to +500 μm. These resonant frequency variations were small compared to the sensor's initial resonant frequency (< 0.007% of 2.2 MHz initial resonant frequency) measured at the detector home position, indicating high accuracy of the measurement. In addition, the signal amplitude was, as anticipated, found to decrease exponentially with increasing detection distance (i.e., Z distance). Finally, additional experiments were conducted on the surface of cucumbers. Similar results were obtained.

  3. Diversity and natural functions of antibiotics produced by beneficial and plant pathogenic bacteria

    Raaijmakers, J.M.; Mazzola, M.

    2012-01-01

    Soil- and plant-associated environments harbor numerous bacteria that produce antibiotic metabolites with specific or broad-spectrum activities against coexisting microorganisms. The function and ecological importance of antibiotics have long been assumed to yield a survival advantage to the

  4. An endogenously produced fragment of cardiac myosin-binding protein C is pathogenic and can lead to heart failure.

    Razzaque, Md Abdur; Gupta, Manish; Osinska, Hanna; Gulick, James; Blaxall, Burns C; Robbins, Jeffrey

    2013-08-16

    A stable 40-kDa fragment is produced from cardiac myosin-binding protein C when the heart is stressed using a stimulus, such as ischemia-reperfusion injury. Elevated levels of the fragment can be detected in the diseased mouse and human heart, but its ability to interfere with normal cardiac function in the intact animal is unexplored. To understand the potential pathogenicity of the 40-kDa fragment in vivo and to investigate the molecular pathways that could be targeted for potential therapeutic intervention. We generated cardiac myocyte-specific transgenic mice using a Tet-Off inducible system to permit controlled expression of the 40-kDa fragment in cardiomyocytes. When expression of the 40-kDa protein is induced by crossing the responder animals with tetracycline transactivator mice under conditions in which substantial quantities approximating those observed in diseased hearts are reached, the double-transgenic mice subsequently experience development of sarcomere dysgenesis and altered cardiac geometry, and the heart fails between 12 and 17 weeks of age. The induced double-transgenic mice had development of cardiac hypertrophy with myofibrillar disarray and fibrosis, in addition to activation of pathogenic MEK-ERK pathways. Inhibition of MEK-ERK signaling was achieved by injection of the mitogen-activated protein kinase (MAPK)/ERK inhibitor U0126. The drug effectively improved cardiac function, normalized heart size, and increased probability of survival. These results suggest that the 40-kDa cardiac myosin-binding protein C fragment, which is produced at elevated levels during human cardiac disease, is a pathogenic fragment that is sufficient to cause hypertrophic cardiomyopathy and heart failure.

  5. DMPD: Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. [Dynamic Macrophage Pathway CSML Database

    Full Text Available 17275324 Innate immune sensing of pathogens and danger signals by cell surface Toll... Show Innate immune sensing of pathogens and danger signals by cell surface Toll-likereceptors. PubmedID 172...75324 Title Innate immune sensing of pathogens and danger signals by cell surface

  6. Associations between pathogen-specific clinical mastitis and somatic cell count patterns

    Haas, de Y.; Veerkamp, R.F.; Barkema, H.W.; Gröhn, Y.T.; Schukken, Y.H.

    2004-01-01

    Associations were estimated between pathogen-specific cases of clinical mastitis (CM) and somatic cell count (SCC) patterns based on deviations from the typical curve for SCC during lactation and compared with associations between pathogen-specific CM and lactation average SCC. Data from 274 Dutch

  7. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation, 2004-2005 Annual Report.

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2005-05-01

    In the spring of 2004 naturally produced smolts outmigrating from the Yakima River Basin were collected for the sixth year of pathogen screening. This component of the evaluation is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. Since 1999 the Cle Elum Hatchery has been releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. In 1998 and 2000 through 2004 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. Of these pathogens, only R. salmoninarum was detected in very low levels in the naturally produced smolts outmigrating in 2004. To date, only bacterial pathogens have been detected and prevalences have been low. There have been small variations each year and these changes are attributed to normal fluctuations in prevalence. All of the pathogens detected are widely distributed in Washington State.

  8. A hepatocellular carcinoma cell line producing mature hepatitis B viral particles

    Fellig, Yakov; Almogy, Gidon; Galun, Eithan; Ketzinel-Gilad, Mali

    2004-01-01

    Current in vitro models for hepatitis B virus (HBV) are based on human hepatoblastoma cell lines transfected with HBV genome. The objective of this work was to develop an in vitro, hepatocellular carcinoma (HCC)-based system supporting HBV full replication and producing mature viral particles. The FLC4 human HCC cell line was stably transfected with a plasmid carrying a head-to-tail dimer of the adwHBV genome. One of the clones, FLC4A10 II , exhibited prolonged expression of HBV, as was demonstrated by secreted levels of HBsAg, HBeAg, and HBV DNA in the culture medium of the growing cells. Furthermore, the cells produced HBV particles that were detected by a cesium chloride density gradient performed on the culture medium. Analysis by Southern blot revealed that HBV DNA has integrated into the FLC4A10 II cell genome. The presence of HBV in the FLC4A10 II cells did not cause alterations in cell morphology and the cells continued to resemble mature hepatocytes. They do exhibit a high mitotic activity. The new HBV stably transfected cell line, FLC4A10 II , can serve as an important tool for further exploration of HBV host-pathogen interaction, viral life cycle, and for assessing new antiviral agents

  9. Mast Cells Produce a Unique Chondroitin Sulfate Epitope.

    Farrugia, Brooke L; Whitelock, John M; O'Grady, Robert; Caterson, Bruce; Lord, Megan S

    2016-02-01

    The granules of mast cells contain a myriad of mediators that are stored and protected by the sulfated glycosaminoglycan (GAG) chains that decorate proteoglycans. Whereas heparin is the GAG predominantly associated with mast cells, mast cell proteoglycans are also decorated with heparan sulfate and chondroitin sulfate (CS). This study investigated a unique CS structure produced by mast cells that was detected with the antibody clone 2B6 in the absence of chondroitinase ABC digestion. Mast cells in rodent tissue sections were characterized using toluidine blue, Leder stain and the presence of mast cell tryptase. The novel CS epitope was identified in rodent tissue sections and localized to cells that were morphologically similar to cells chemically identified as mast cells. The rodent mast cell-like line RBL-2H3 was also shown to express the novel CS epitope. This epitope co-localized with multiple CS proteoglycans in both rodent tissue and RBL-2H3 cultured cells. These findings suggest that the novel CS epitope that decorates mast cell proteoglycans may play a role in the way these chains are structured in mast cells. © 2016 The Histochemical Society.

  10. Mucin-producing signet ring cell adenoma of the thyroid

    Gulwani Hanni

    2008-10-01

    Full Text Available Signet ring cell adenoma of the thyroid, though rare, is well documented. This change is chiefly due to intracellular accumulation of thyroglobulin that appears mucinous. Awareness of this entity is important as it may closely simulate a metastatic mucin-secreting signet ring cell carcinoma. Although the mucinous material in signet ring cells has been reported to stain positive with thyroglobulin, in some cases it may not be so. We herein describe a rare case of a 46-year-old man who was hypothyroid and the mass removed from the thyroid showed a mucin-producing signet ring cell adenoma of the thyroid.

  11. Pathogen-free, plasma-poor platelet lysate and expansion of human mesenchymal stem cells.

    Iudicone, Paola; Fioravanti, Daniela; Bonanno, Giuseppina; Miceli, Michelina; Lavorino, Claudio; Totta, Pierangela; Frati, Luigi; Nuti, Marianna; Pierelli, Luca

    2014-01-27

    Supplements to support clinical-grade cultures of mesenchymal stem cells (MSC) are required to promote growth and expansion of these cells. Platelet lysate (PL) is a human blood component which may replace animal serum in MSC cultures being rich in various growth factors. Here, we describe a plasma poor pathogen-free platelet lysate obtained by pooling 12 platelet (PLT) units, to produce a standardized and safe supplement for clinical-grade expansion of MSC. PL lots were obtained by combining 2 6-unit PLT pools in additive solution (AS) following a transfusional-based procedure including pathogen inactivation (PI) by Intercept technology and 3 cycles of freezing/thawing, followed by membrane removal. Three PI-PL and 3 control PL lots were produced to compare their ability to sustain bone marrow derived MSC selection and expansion. Moreover, two further PL, subjected to PI or not, were also produced starting from the same initial PLT pools to evaluate the impact of PI on growth factor concentration and capacity to sustain cell growth. Additional PI-PL lots were used for comparison with fetal bovine serum (FBS) on MSC expansion. Immunoregulatory properties of PI-PL-generated MSC were documented in vitro by mixed lymphocyte culture (MLC) and peripheral blood mononuclear cells (PBMC) mitogen induced proliferation. PI-PL and PL control lots had similar concentrations of 4 well-described growth factors endowed with MSC stimulating ability. Initial growth and MSC expansion by PI-PL and PL controls were comparable either using different MSC populations or in head to head experiments. Moreover, PI-PL and PL control sustained similar MSC growth of frozen/thawed MSC. Multilineage differentiation of PI-derived and PI-PL-derived MSC were maintained in any MSC cultures as well as their immunoregulatory properties. Finally, no direct impact of PI on growth factor concentration and MSC growth support was observed, whereas the capacity of FBS to sustain MSC expansion in basic

  12. The Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins

    Andong eGong

    2015-10-01

    Full Text Available Aflatoxigenic Aspergillus fungi and associated aflatoxins are ubiquitous in the production and storage of food/feed commodities. Controlling these pests is a challenge. In this study, the Shewanella algae strain YM8 was found to produce volatiles that have strong antifungal activity against Aspergillus pathogens. Gas chromatography-mass spectrometry profiling revealed 15 volatile organic compounds (VOCs emitted from YM8, of which dimethyl trisulfide was the most abundant. We obtained authentic reference standards for six of the VOCs; these all significantly reduced mycelial growth and conidial germination in Aspergillus; dimethyl trisulfide and 2,4-bis(1,1-dimethylethyl-phenol showed the strongest inhibitory activity. YM8 completely inhibited Aspergillus growth and aflatoxin biosynthesis in maize and peanut samples stored at different water activity levels, and scanning electron microscopy revealed severely damaged conidia and a complete lack of mycelium development and conidiogenesis. YM8 also completely inhibited the growth of eight other agronomically important species of phytopathogenic fungi: A. parasiticus, A. niger, Alternaria alternate, Botrytis cinerea, Fusarium graminearum, Fusarium oxysporum, Monilinia fructicola, and Sclerotinia sclerotiorum. This study demonstrates the susceptibility of Aspergillus and other fungi to VOCs from marine bacteria and indicates a new strategy for effectively controlling these pathogens and the associated mycotoxin production in the field and during storage.

  13. An Insecticidal Compound Produced by an Insect-Pathogenic Bacterium Suppresses Host Defenses through Phenoloxidase Inhibition

    Ihsan Ullah

    2014-12-01

    Full Text Available A bioassay-guided column chromatographic strategy was adopted in the present study to fractionate the culture extract of Photorhabdus temperata M1021 to identify potential insecticidal and antimicrobial compounds. An ethyl acetate (EtOAc culture extract of P. temperata was assayed against Galleria mellonella larvae through intra-hemocoel injection and exhibited 100% insect mortality within 60 h. The EtOAc fraction and an isolated compound exhibited phenoloxidase (PO inhibition of up to 60% and 63%, respectively. The compound was identified as 1,2-benzenedicarboxylic acid (phthalic acid, PA by gas chromatography-mass spectrometry and nuclear magnetic resonance. PA exhibited insecticidal activity against G. mellonella in a dose-dependent manner, and 100% insect mortality was observed at 108 h after injection of 1 M PA. In a PO inhibition assay, 0.5 and 1 M concentrations of PA were found to inhibit PO activity by 74% and 82%, respectively; and in a melanotic nodule formation assay, nodule formation was significantly inhibited (27 and 10 nodules by PA (0.5 and 1 M, respectively. PA was furthermore found to have substantial antioxidant activity and maximum antioxidant activity was 64.7% for 0.5 M PA as compare to control. Antibacterial activity was assessed by The MIC values ranged from 0.1 M to 0.5 M of PA. This study reports a multifunctional PA, a potential insecticidal agent, could a factor of insect mortality along with other toxins produced by P. temperata M1021.

  14. Lasiojasmonates A-C, three jasmonic acid esters produced by Lasiodiplodia sp., a grapevine pathogen.

    Andolfi, Anna; Maddau, Lucia; Cimmino, Alessio; Linaldeddu, Benedetto T; Basso, Sara; Deidda, Antonio; Serra, Salvatorica; Evidente, Antonio

    2014-07-01

    In this study, a strain (BL 101) of a species of Lasiodiplodia, not yet formally described, which was isolated from declining grapevine plants showing wedge-shaped cankers, was investigated for its ability to produce in vitro bioactive secondary metabolites. From culture filtrates of this strain three jasmonic acid esters, named lasiojasmonates A-C and 16-O-acetylbotryosphaerilactones A and C were isolated together with (1R,2R)-jasmonic acid, its methyl ester, botryosphaerilactone A, (3S,4R,5R)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone and (3R,4S)-botryodiplodin. The structures of lasiojasmonates A-C were established by spectroscopic methods as (1R*,2R*,3'S*,4'R*,5'R*)-4-hydroxymethyl-3,5-dimethyldihydro-2-furanone, (1R*,2R*,3'S*,4'R*,5'R*,10'R*,12'R*,13'R*,14'S*) and (1R*,2R*,3'S*,4'R*,5'R*,10'S*,12'R*,13'R*,14'S*)-4-(4-hydroxymethyl-3,5-dimethyltetrahydro-furan-2-yloxymethyl)-3,5-dimethyldihydro-2-furanones jasmonates (1, 4 and 5). The structures of 16-O-acetylbotryosphaerilactones A and C were determined by comparison of their spectral data with those of the corresponding acetyl derivatives obtained by acetylation of botryosphaerilactone A. The metabolites isolated, except 4 and 5, were tested at 1mg/mL on leaves of grapevine cv. Cannonau and cork oak using the leaf puncture assay. They were also tested on detached grapevine leaves at 0.5mg/mL and tomato cuttings at 0.1mg/mL. In all phytotoxic assays only jasmonic acid was found to be active. All metabolites were inactive in the zootoxic assay at 50 μg/mL. Copyright © 2014. Published by Elsevier Ltd.

  15. Aflatoxins produced by Aspergillus nomius ASR3, a pathogen isolated from the leaf-cutter ant Atta sexdens rubropilosa

    Eduardo Afonso da Silva-Junior

    Full Text Available ABSTRACT Aspergillus spp. cause economic impacts due to aflatoxins production. Although the toxicity of aflatoxins is already known, little information about their ecological roles is available. Here we investigated the compounds produced by Aspergillus nomius ASR3 directly from a dead leaf-cutter queen ant Atta sexdens rubropilosa and the fungal axenic culture. Chemical analyses were carried out by high-resolution mass spectrometry and tandem mass spectrometry techniques. Aflatoxins B1 and G1 were detected in both the axenic culture and in the dead leaf-cutter queen ant. The presence of these mycotoxins in the dead leaf-cutter queen ant suggests that these compounds can be related to the insect pathogenicity of A. nomius against A. sexdens rubropilosa.

  16. Host cells and methods for producing diacid compounds

    Steen, Eric J.; Fortman, Jeffrey L.; Dietrich, Jeffrey A.; Keasling, Jay D.

    2018-04-24

    The present invention provides for a method of producing one or more fatty acid derived dicarboxylic acids in a genetically modified host cell which does not naturally produce the one or more derived fatty acid derived dicarboxylic acids. The invention provides for the biosynthesis of dicarboxylic acid ranging in length from C3 to C26. The host cell can be further modified to increase fatty acid production or export of the desired fatty acid derived compound, and/or decrease fatty acid storage or metabolism.

  17. First Report of Pseudobodo sp, a New Pathogen for a Potential Energy-Producing Algae: Chlorella vulgaris Cultures

    Zhang, Bangzhou; Yang, Luxi; Zhang, Huajun; Zhang, Jingyan; Li, Yi; Zheng, Wei; Tian, Yun; Liu, Jingwen; Zheng, Tianling

    2014-01-01

    Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4–5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant. PMID:24599263

  18. First report of Pseudobodo sp, a new pathogen for a potential energy-producing algae: Chlorella vulgaris cultures.

    Zhangran Chen

    Full Text Available Chlorella vulgaris, is a kind of single-celled green algae, which could serve as a potential source of food and energy because of its photosynthetic efficiency. In our study, a pathogenic organism targeting C. vulgaris was discovered. The algae-lytic activity relates to a fraction from lysates of infected C. vulgaris that was blocked upon filtration through a 3 µm filter. 18S rRNA gene sequence analysis revealed that it shared 99.0% homology with the protist Pseudobodo tremulans. Scanning electron microscope analysis showed that Pseudobodo sp. KD51 cells were approximately 4-5 µm long, biflagellate with an anterior collar around the anterior part of the cell in unstressed feeding cells. Besides the initial host, Pseudobodo sp. KD51 could also kill other algae, indicating its relatively wide predatory spectrum. Heat stability, pH and salinity tolerance experiments were conducted to understand their effects on its predatory activities, and the results showed that Pseudobodo sp. KD51 was heat-sensitive, and pH and salinity tolerant.

  19. Macropinocytosis is responsible for the uptake of pathogenic and non-pathogenic mycobacteria by B lymphocytes (Raji cells

    García-Pérez Blanca Estela

    2012-10-01

    Full Text Available Abstract Background The classical roles of B cells include the production of antibodies and cytokines and the generation of immunological memory, these being key factors in the adaptive immune response. However, their role in innate immunity is currently being recognised. Traditionally, B cells have been considered non-phagocytic cells; therefore, the uptake of bacteria by B cells is not extensively documented. In this study, we analysed some of the features of non-specific bacterial uptake by B lymphocytes from the Raji cell line. In our model, B cells were infected with Mycobacterium tuberculosis (MTB, Mycobacterium smegmatis (MSM, and Salmonella typhimurium (ST. Results Our observations revealed that the Raji B cells were readily infected by the three bacteria that were studied. All of the infections induced changes in the cellular membrane during bacterial internalisation. M. smegmatis and S. typhimurium were able to induce important membrane changes that were characterised by abundant filopodia and lamellipodia formation. These membrane changes were driven by actin cytoskeletal rearrangements. The intracellular growth of these bacteria was also controlled by B cells. M. tuberculosis infection also induced actin rearrangement-driven membrane changes; however, the B cells were not able to control this infection. The phorbol 12-myristate 13-acetate (PMA treatment of B cells induced filopodia and lamellipodia formation, the production of spacious vacuoles (macropinosomes, and the fluid-phase uptake that is characteristic of macropinocytosis. S. typhimurium infection induced the highest fluid-phase uptake, although both mycobacteria also induced fluid uptake. A macropinocytosis inhibitor such as amiloride was used and abolished the bacterial uptake and the fluid-phase uptake that is triggered during the bacterial infection. Conclusions Raji B cells can internalise S. typhimurium and mycobacteria through an active process, such as

  20. Jasmonate ZIM-domain (JAZ protein regulates host and nonhost pathogen-induced cell death in tomato and Nicotiana benthamiana.

    Yasuhiro Ishiga

    Full Text Available The nonhost-specific phytotoxin coronatine (COR produced by several pathovars of Pseudomonas syringae functions as a jasmonic acid-isoleucine (JA-Ile mimic and contributes to disease development by suppressing plant defense responses and inducing reactive oxygen species in chloroplast. It has been shown that the F-box protein CORONATINE INSENSITIVE 1 (COI1 is the receptor for COR and JA-Ile. JASMONATE ZIM DOMAIN (JAZ proteins act as negative regulators for JA signaling in Arabidopsis. However, the physiological significance of JAZ proteins in P. syringae disease development and nonhost pathogen-induced hypersensitive response (HR cell death is not completely understood. In this study, we identified JAZ genes from tomato, a host plant for P. syringae pv. tomato DC3000 (Pst DC3000, and examined their expression profiles in response to COR and pathogens. Most JAZ genes were induced by COR treatment or inoculation with COR-producing Pst DC3000, but not by the COR-defective mutant DB29. Tomato SlJAZ2, SlJAZ6 and SlJAZ7 interacted with SlCOI1 in a COR-dependent manner. Using virus-induced gene silencing (VIGS, we demonstrated that SlJAZ2, SlJAZ6 and SlJAZ7 have no effect on COR-induced chlorosis in tomato and Nicotiana benthamiana. However, SlJAZ2-, SlJAZ6- and SlJAZ7-silenced tomato plants showed enhanced disease-associated cell death to Pst DC3000. Furthermore, we found delayed HR cell death in response to the nonhost pathogen Pst T1 or a pathogen-associated molecular pattern (PAMP, INF1, in SlJAZ2- and SlJAZ6-silenced N. benthamiana. These results suggest that tomato JAZ proteins regulate the progression of cell death during host and nonhost interactions.

  1. Virus-like particle of Macrobrachium rosenbergii nodavirus produced in Spodoptera frugiperda (Sf9) cells is distinctive from that produced in Escherichia coli.

    Kueh, Chare Li; Yong, Chean Yeah; Masoomi Dezfooli, Seyedehsara; Bhassu, Subha; Tan, Soon Guan; Tan, Wen Siang

    2017-03-01

    Macrobrachium rosenbergii nodavirus (MrNV) is a virus native to giant freshwater prawn. Recombinant MrNV capsid protein has been produced in Escherichia coli, which self-assembled into virus-like particles (VLPs). However, this recombinant protein is unstable, degrading and forming heterogenous VLPs. In this study, MrNV capsid protein was produced in insect Spodoptera frugiperda (Sf9) cells through a baculovirus system. Dynamic light scattering (DLS) and transmission electron microscopy (TEM) revealed that the recombinant protein produced by the insect cells self-assembled into highly stable, homogenous VLPs each of approximately 40 nm in diameter. Enzyme-linked immunosorbent assay (ELISA) showed that the VLPs produced in Sf9 cells were highly antigenic and comparable to those produced in E. coli. In addition, the Sf9 produced VLPs were highly stable across a wide pH range (2-12). Interestingly, the Sf9 produced VLPs contained DNA of approximately 48 kilo base pairs and RNA molecules. This study is the first report on the production and characterization of MrNV VLPs produced in a eukaryotic system. The MrNV VLPs produced in Sf9 cells were about 10 nm bigger and had a uniform morphology compared with the VLPs produced in E. coli. The insect cell production system provides a good source of MrNV VLPs for structural and immunological studies as well as for host-pathogen interaction studies. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:549-557, 2017. © 2016 American Institute of Chemical Engineers.

  2. Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

    Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

    2016-04-01

    Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

    Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

    2017-06-01

    Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

  4. Antimicrobial properties of black grape (Vitis vinifera L.) peel extracts against antibiotic-resistant pathogenic bacteria and toxin producing molds.

    Yadav, Devbrat; Kumar, Arvind; Kumar, Pramod; Mishra, Diwaker

    2015-01-01

    Black grape peel possesses a substantial amount of polyphenolic antimicrobial compounds that can be used for controlling the growth of pathogenic microorganisms. The purpose of this study was to assess antibacterial and antifungal activity of black grape peel extracts against antibiotic-resistant pathogenic bacteria and toxin producing molds, respectively. Peel of grape was subjected to polyphenolic extraction using different solvents viz., water, ethanol, acetone, and methanol. Antibiotic-resistant strains of Staphylococcus aureus, Enterococcus faecalis, Enterobacter aerogenes, Salmonella typhimurium, and Escherichia coli were screened for the antibacterial activity of different grape extracts. Antibacterial activity was analyzed using agar well diffusion method. Penicillium chrysogenum, Penicillium expansum, Aspergillus niger and Aspergillus versicolor were screened for the antifungal activity. Antifungal activity was determined by counting nongerminated spores in the presence of peel extracts. As compared to other solvent extracts, methanol extracts possessed high antibacterial and antifungal activity. S. typhimurium and E. coli showed complete resistance against antibacterial action at screened concentrations of grape peel extracts. Maximum zone of inhibition was found in case of S. aureus, i.e., 22 mm followed by E. faecalis and E. aerogenes, i.e., 18 and 21 mm, respectively, at 1080 mg tannic acid equivalent (TAE)/ml. The maximum and minimum percent of growth inhibition was shown by P. expansum and A. niger as 73% and 15% at 1080 TAE/ml concentration of grape peel extract, respectively. Except S. typhimurium and E. coli, growth of all bacterial and mold species were found to be significantly (P < 0.05) inhibited by all the solvent extracts.

  5. Nisin Z produced by Lactococcus lactis from bullfrog hatchery is active against Citrobacter freundii, a red-leg syndrome related pathogen.

    Quintana, Gabriel; Niederle, Maria V; Minahk, Carlos J; Picariello, Gianluca; Nader-Macías, María E F; Pasteris, Sergio E

    2017-09-27

    Lactococcus lactis subsp. lactis CRL 1584 isolated from a bullfrog hatchery produces a bacteriocin that inhibits both indigenous Citrobacter freundii (a Red-Leg Syndrome related pathogen) and Lactobacillus plantarum, and Listeria monocytogenes as well. Considering that probiotics requires high cell densities and/or bacteriocin concentrations, the effect of the temperature on L. lactis growth and bacteriocin production was evaluated to find the optimal conditions. Thus, the growth rate was maximal at 36 °C, whereas the highest biomass and bacteriocin activity was achieved between 20 and 30 °C and 20-25 °C, respectively. The bacteriocin synthesis was closely growth associated reaching the maximal values at the end of the exponential phase. Since bacteriocins co-production has been evidenced in bacterial genera, a purification of the bacteriocin/s from L. lactis culture supernatants was carried out. The active fraction was purified by cationic-exchange chromatography and then, a RP-HPLC was carried out. The purified sample was a peptide with a 3353.05 Da, a molecular mass that matches nisin Z, which turned out to be the only bacteriocin produced by L. lactis CRL 1584. Nisin Z showed bactericidal effect on C. freundii and L. monocytogenes, which increased in the presence L-lactic acid + H 2 O 2 . This is the first report on nisin Z production by L. lactis from a bullfrog hatchery that resulted active on a Gram-negative pathogen. This peptide has potential probiotic for raniculture and as food biopreservative for bullfrog meat.

  6. Genetic associations for pathogen-specific clinical mastitis and patterns of peaks in somatic cell count

    Haas, de Y.; Barkema, H.W.; Schukken, Y.H.; Veerkamp, R.F.

    2003-01-01

    Genetic associations were estimated between pathogen-specific cases of clinical mastitis (CM), lactational average somatic cell score (LACSCS), and patterns of peaks in somatic cell count (SCC) which were based on deviations from the typical lactation curve for SCC. The dataset contained test-day

  7. Dickeya dadantii, a plant pathogenic bacterium producing Cyt-like entomotoxins, causes septicemia in the pea aphid Acyrthosiphon pisum.

    Costechareyre, Denis; Balmand, Séverine; Condemine, Guy; Rahbé, Yvan

    2012-01-01

    Dickeya dadantii (syn. Erwinia chrysanthemi) is a plant pathogenic bacteria that harbours a cluster of four horizontally-transferred, insect-specific toxin genes. It was recently shown to be capable of causing an acute infection in the pea aphid Acyrthosiphon pisum (Insecta: Hemiptera). The infection route of the pathogen, and the role and in vivo expression pattern of these toxins, remain unknown. Using bacterial numeration and immunolocalization, we investigated the kinetics and the pattern of infection of this phytopathogenic bacterium within its insect host. We compared infection by the wild-type strain and by the Cyt toxin-deficient mutant. D. dadantii was found to form dense clusters in many luminal parts of the aphid intestinal tract, including the stomach, from which it invaded internal tissues as early as day 1 post-infection. Septicemia occurred soon after, with the fat body being the main infected tissue, together with numerous early infections of the embryonic chains showing embryonic gut and fat body as the target organs. Generalized septicemia led to insect death when the bacterial load reached about 10(8) cfu. Some individual aphids regularly escaped infection, indicating an effective partial immune response to this bacteria. Cyt-defective mutants killed insects more slowly but were capable of localisation in any type of tissue. Cyt toxin expression appeared to be restricted to the digestive tract where it probably assisted in crossing over the first cell barrier and, thus, accelerating bacterial diffusion into the aphid haemocel. Finally, the presence of bacteria on the surface of leaves hosting infected aphids indicated that the insects could be vectors of the bacteria.

  8. Dickeya dadantii, a plant pathogenic bacterium producing Cyt-like entomotoxins, causes septicemia in the pea aphid Acyrthosiphon pisum.

    Denis Costechareyre

    Full Text Available Dickeya dadantii (syn. Erwinia chrysanthemi is a plant pathogenic bacteria that harbours a cluster of four horizontally-transferred, insect-specific toxin genes. It was recently shown to be capable of causing an acute infection in the pea aphid Acyrthosiphon pisum (Insecta: Hemiptera. The infection route of the pathogen, and the role and in vivo expression pattern of these toxins, remain unknown. Using bacterial numeration and immunolocalization, we investigated the kinetics and the pattern of infection of this phytopathogenic bacterium within its insect host. We compared infection by the wild-type strain and by the Cyt toxin-deficient mutant. D. dadantii was found to form dense clusters in many luminal parts of the aphid intestinal tract, including the stomach, from which it invaded internal tissues as early as day 1 post-infection. Septicemia occurred soon after, with the fat body being the main infected tissue, together with numerous early infections of the embryonic chains showing embryonic gut and fat body as the target organs. Generalized septicemia led to insect death when the bacterial load reached about 10(8 cfu. Some individual aphids regularly escaped infection, indicating an effective partial immune response to this bacteria. Cyt-defective mutants killed insects more slowly but were capable of localisation in any type of tissue. Cyt toxin expression appeared to be restricted to the digestive tract where it probably assisted in crossing over the first cell barrier and, thus, accelerating bacterial diffusion into the aphid haemocel. Finally, the presence of bacteria on the surface of leaves hosting infected aphids indicated that the insects could be vectors of the bacteria.

  9. Anti-tumor therapy with macroencapsulated endostatin producer cells.

    Rodrigues, Danielle B; Chammas, Roger; Malavasi, Natália V; da Costa, Patrícia L N; Chura-Chambi, Rosa M; Balduino, Keli N; Morganti, Ligia

    2010-03-02

    Theracyte is a polytetrafluoroethylene membrane macroencapsulation system designed to induce neovascularization at the tissue interface, protecting the cells from host's immune rejection, thereby circumventing the problem of limited half-life and variation in circulating levels. Endostatin is a potent inhibitor of angiogenesis and tumor growth. Continuous delivery of endostatin improves the efficacy and potency of the antitumoral therapy. The purpose of this study was to determine whether recombinant fibroblasts expressing endostatin encapsulated in Theracyte immunoisolation devices can be used for delivery of this therapeutic protein for treatment of mice bearing B16F10 melanoma and Ehrlich tumors. Mice were inoculated subcutaneously with melanoma (B16F10 cells) or Ehrlich tumor cells at the foot pads. Treatment began when tumor thickness had reached 0.5 mm, by subcutaneous implantation of 107 recombinant encapsulated or non-encapsulated endostatin producer cells. Similar melanoma growth inhibition was obtained for mice treated with encapsulated or non-encapsulated endostatin-expressing cells. The treatment of mice bearing melanoma tumor with encapsulated endostatin-expressing cells was decreased by 50.0%, whereas a decrease of 56.7% in tumor thickness was obtained for mice treated with non-encapsulated cells. Treatment of Ehrlich tumor-bearing mice with non-encapsulated endostatin-expressing cells reduced tumor thickness by 52.4%, whereas lower tumor growth inhibition was obtained for mice treated with encapsulated endostatin-expressing cells: 24.2%. Encapsulated endostatin-secreting fibroblasts failed to survive until the end of the treatment. However, endostatin release from the devices to the surrounding tissues was confirmed by immunostaining. Decrease in vascular structures, functional vessels and extension of the vascular area were observed in melanoma microenvironments. This study indicates that immunoisolation devices containing endostatin

  10. Antimicrobial activity against oral pathogens and immunomodulatory effects and toxicity of geopropolis produced by the stingless bee Melipona fasciculata Smith

    Liberio Silvana A

    2011-11-01

    Full Text Available Abstract Background Native bees of the tribe Meliponini produce a distinct kind of propolis called geopropolis. Although many pharmacological activities of propolis have already been demonstrated, little is known about geopropolis, particularly regarding its antimicrobial activity against oral pathogens. The present study aimed at investigating the antimicrobial activity of M. fasciculata geopropolis against oral pathogens, its effects on S. mutans biofilms, and the chemical contents of the extracts. A gel prepared with a geopropolis extract was also analyzed for its activity on S. mutans and its immunotoxicological potential. Methods Antimicrobial activities of three hydroalcoholic extracts (HAEs of geopropolis, and hexane and chloroform fractions of one extract, were evaluated using the agar diffusion method and the broth dilution technique. Ethanol (70%, v/v and chlorhexidine (0.12%, w/w were used as negative and positive controls, respectively. Total phenol and flavonoid concentrations were assayed by spectrophotometry. Immunotoxicity was evaluated in mice by topical application in the oral cavity followed by quantification of biochemical and immunological parameters, and macro-microscopic analysis of animal organs. Results Two extracts, HAE-2 and HAE-3, showed inhibition zones ranging from 9 to 13 mm in diameter for S. mutans and C. albicans, but presented no activity against L. acidophilus. The MBCs for HAE-2 and HAE-3 against S. mutans were 6.25 mg/mL and 12.5 mg/mL, respectively. HAE-2 was fractionated, and its chloroform fraction had an MBC of 14.57 mg/mL. HAE-2 also exhibited bactericidal effects on S. mutans biofilms after 3 h of treatment. Significant differences (p Conclusions In summary, geopropolis produced by M. fasciculata can exert antimicrobial action against S. mutans and C. albicans, with significant inhibitory activity against S. mutans biofilms. The extract with the highest flavonoid concentration, HAE-2, presented the

  11. Antimicrobial activity against oral pathogens and immunomodulatory effects and toxicity of geopropolis produced by the stingless bee Melipona fasciculata Smith.

    Liberio, Silvana A; Pereira, Antônio Luís A; Dutra, Richard P; Reis, Aramys S; Araújo, Maria José A M; Mattar, Nadia S; Silva, Lucilene A; Ribeiro, Maria Nilce S; Nascimento, Flávia Raquel F; Guerra, Rosane N M; Monteiro-Neto, Valério

    2011-11-04

    Native bees of the tribe Meliponini produce a distinct kind of propolis called geopropolis. Although many pharmacological activities of propolis have already been demonstrated, little is known about geopropolis, particularly regarding its antimicrobial activity against oral pathogens. The present study aimed at investigating the antimicrobial activity of M. fasciculata geopropolis against oral pathogens, its effects on S. mutans biofilms, and the chemical contents of the extracts. A gel prepared with a geopropolis extract was also analyzed for its activity on S. mutans and its immunotoxicological potential. Antimicrobial activities of three hydroalcoholic extracts (HAEs) of geopropolis, and hexane and chloroform fractions of one extract, were evaluated using the agar diffusion method and the broth dilution technique. Ethanol (70%, v/v) and chlorhexidine (0.12%, w/w) were used as negative and positive controls, respectively. Total phenol and flavonoid concentrations were assayed by spectrophotometry. Immunotoxicity was evaluated in mice by topical application in the oral cavity followed by quantification of biochemical and immunological parameters, and macro-microscopic analysis of animal organs. Two extracts, HAE-2 and HAE-3, showed inhibition zones ranging from 9 to 13 mm in diameter for S. mutans and C. albicans, but presented no activity against L. acidophilus. The MBCs for HAE-2 and HAE-3 against S. mutans were 6.25 mg/mL and 12.5 mg/mL, respectively. HAE-2 was fractionated, and its chloroform fraction had an MBC of 14.57 mg/mL. HAE-2 also exhibited bactericidal effects on S. mutans biofilms after 3 h of treatment. Significant differences (p < 0.05) in total phenol and flavonoid concentrations were observed among the samples. Signs toxic effects were not observed after application of the geopropolis-based gel, but an increase in the production of IL-4 and IL-10, anti-inflammatory cytokines, was detected. In summary, geopropolis produced by M. fasciculata can

  12. Pathogenic Acinetobacter: from the Cell Surface to Infinity and Beyond

    Weber, Brent S.; Harding, Christian M.

    2015-01-01

    The genus Acinetobacter encompasses multiple nosocomial opportunistic pathogens that are of increasing worldwide relevance because of their ability to survive exposure to various antimicrobial and sterilization agents. Among these, Acinetobacter baumannii, Acinetobacter nosocomialis, and Acinetobacter pittii are the most frequently isolated in hospitals around the world. Despite the growing incidence of multidrug-resistant Acinetobacter spp., little is known about the factors that contribute to pathogenesis. New strategies for treating and managing infections caused by multidrug-resistant Acinetobacter strains are urgently needed, and this requires a detailed understanding of the pathobiology of these organisms. In recent years, some virulence factors important for Acinetobacter colonization have started to emerge. In this review, we focus on several recently described virulence factors that act at the bacterial surface level, such as the capsule, O-linked protein glycosylation, and adhesins. Furthermore, we describe the current knowledge regarding the type II and type VI secretion systems present in these strains. PMID:26712938

  13. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    PURNIMA R. CHITLANGE

    2014-11-01

    Full Text Available Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check whether the cell phone act as a vector for transmission of various pathogens, a potential study was carried out in microbiology department of Shri Radhakisan Laxminarayan Toshniwal College of Science, Akola. Total 20 cell samples were screened. Two parameters were considered: College students and hospital staff. The isolated bacteria Staphylococcus aureus, E. coli, Pseudomonas sp., Bacillus subtilis, Aerobacter aerogenes, Salmonella, Shigella, Streptococci, P. vulgaris were identified on the basis of morphological and cultural characteristics. The main aim of present study was to check the contamination by bacterial pathogens on cell phones and also to check role of cell phone for transmission of pathogens from person to person or not.

  14. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    DANG SUN

    1School of Life Sciences, Tsinghua University, Qinghuayuan Road, Beijing 100084, People's Republic of China. 2Alliance ... Reestablishing a well-balanced population of regulatory T cells (Tregs) .... Definition of CpG methylation peaks: Log2 ratios between ..... How these eight genes work in T cell function differentiation.

  15. Increased IL-35 producing Tregs and CD19+IL-35+ cells are associated with disease progression in leprosy patients.

    Tarique, Mohd; Saini, Chaman; Naqvi, Raza Ali; Khanna, Neena; Rao, D N

    2017-03-01

    The clinical forms of leprosy consist of a spectrum that reflects the host's immune response to the M. leprae; it provides an ideal model to study the host pathogen interaction and immunological dysregulation in humans. IL-10 and TGF-β producing Tregs are high in leprosy patients and responsible for immune suppression and M. leprae specific T cells anergy. In leprosy, involvement of IL-35 producing Tregs and Bregs remain unstudied. To study the role of IL-35 producing Tregs and Bregs in the human leprosy. Peripheral blood mononuclear cells from leprosy patients were isolated and stimulated with M. leprae antigen (MLCwA) for 48h. Intracellular cytokine IL-35 was evaluated in CD4 + CD25 + Tregs, CD19 + cells by FACS. Expression of PD-1 on CD4 + CD25 + Tregs, CD19 + cells and its ligand (PD-L1) on B cells, CD11c cells were evaluated by flow cytometry (FACS). Serum IL-35 level was estimated by ELISA. The frequency of IL-35 producing Tregs and Bregs cells were found to be high in leprosy patients (pleprosy patients. This study point out a shift in our understanding of the immunological features that mediate and regulate the immune suppression and the disease progression in leprosy patients with a new paradigm (IL-35 producing Tregs and Bregs) that is beyond TGF-β and IL-10 producing Treg cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  17. Purification of a toxic metalloprotease produced by the pathogenic Photobacterium damselae subsp. piscicida isolated from cobia (Rachycentron canadum).

    Liu, Ping-Chung; Chuang, Wen-Hsiao; Lee, Kuo-Kau

    2011-01-01

    The aim of the present study was to purify and characterize a toxic protease secreted by the pathogenic Photobacterium damselae subsp. piscicida strain CP1 originally isolated from diseased cobia (Rachycentron canadum). The toxin isolated by anion exchange chromatography, was a metalloprotease, inhibited by L-cysteine, ethylenediaminetetraacetic acid (EDTA), ethylene glycol-bis(beta-aminoethyl ether)N,N,N',N'-tetraacetic acid (EGTA), 1,10-phenanthroline, N-tosyl-L-phenylalanine-chloromethyl ketone (TPCK), and N-alpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK), and showed maximal activity at pH 6.0-8.0 and an apparent molecular mass of about 34.3 kDa. The toxin was also completely inhibited by HgCl2, and partially by sodium dodecyl sulfate (SDS) and CuCl2. The extracellular products and the partially purified protease were lethal to cobia with LD50 values of 1.26 and 6.8 microg protein/g body weight, respectively. The addition of EDTA completely inhibited the lethal toxicity of the purified protease, indicating that this metalloprotease was a lethal toxin produced by the bacterium.

  18. Biological effects of paenilamicin, a secondary metabolite antibiotic produced by the honey bee pathogenic bacterium Paenibacillus larvae.

    Garcia-Gonzalez, Eva; Müller, Sebastian; Hertlein, Gillian; Heid, Nina; Süssmuth, Roderich D; Genersch, Elke

    2014-10-01

    Paenibacillus larvae is the etiological agent of American Foulbrood (AFB) a world-wide distributed devastating disease of the honey bee brood. Previous comparative genome analysis and more recently, the elucidation of the bacterial genome, provided evidence that this bacterium harbors putative functional nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs) and therefore, might produce nonribosomal peptides (NRPs) and polyketides (PKs). Such biosynthesis products have been shown to display a wide-range of biological activities such as antibacterial, antifungal or cytotoxic activity. Herein we present an in silico analysis of the first NRPS/PKS hybrid of P. larvae and we show the involvement of this cluster in the production of a compound named paenilamicin (Pam). For the characterization of its in vitro and in vivo bioactivity, a knock-out mutant strain lacking the production of Pam was constructed and subsequently compared to wild-type species. This led to the identification of Pam by mass spectrometry. Purified Pam-fractions showed not only antibacterial but also antifungal and cytotoxic activities. The latter suggested a direct effect of Pam on honey bee larval death which could, however, not be corroborated in laboratory infection assays. Bee larvae infected with the non-producing Pam strain showed no decrease in larval mortality, but a delay in the onset of larval death. We propose that Pam, although not essential for larval mortality, is a virulence factor of P. larvae influencing the time course of disease. These findings are not only of significance in elucidating and understanding host-pathogen interactions but also within the context of the quest for new compounds with antibiotic activity for drug development. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  19. GM-CSF-Producing Th Cells in Rats Sensitive and Resistant to Experimental Autoimmune Encephalomyelitis.

    Stojić-Vukanić, Zorica; Pilipović, Ivan; Vujnović, Ivana; Nacka-Aleksić, Mirjana; Petrović, Raisa; Arsenović-Ranin, Nevena; Dimitrijević, Mirjana; Leposavić, Gordana

    2016-01-01

    Given that granulocyte macrophage colony-stimulating factor (GM-CSF) is identified as the key factor to endow auto-reactive Th cells with the potential to induce neuroinflammation in experimental autoimmune encephalomyelitis (EAE) models, the frequency and phenotype of GM-CSF-producing (GM-CSF+) Th cells in draining lymph nodes (dLNs) and spinal cord (SC) of Albino Oxford (AO) and Dark Agouti (DA) rats immunized for EAE were examined. The generation of neuroantigen-specific GM-CSF+ Th lymphocytes was impaired in dLNs of AO rats (relatively resistant to EAE induction) compared with their DA counterparts (susceptible to EAE) reflecting impaired CD4+ lymphocyte proliferation and less supportive of GM-CSF+ Th cell differentiation dLN cytokine microenvironment. Immunophenotyping of GM-CSF+ Th cells showed their phenotypic heterogeneity in both strains and revealed lower frequency of IL-17+IFN-γ+, IL-17+IFN-γ-, and IL-17-IFN-γ+ cells accompanied by higher frequency of IL-17-IFN-γ- cells among them in AO than in DA rats. Compared with DA, in AO rats was also found (i) slightly lower surface density of CCR2 (drives accumulation of highly pathogenic GM-CSF+IFN-γ+ Th17 cells in SC) on GM-CSF+IFN-γ+ Th17 lymphocytes from dLNs, and (ii) diminished CCL2 mRNA expression in SC tissue, suggesting their impaired migration into the SC. Moreover, dLN and SC cytokine environments in AO rats were shown to be less supportive of GM-CSF+IFN-γ+ Th17 cell differentiation (judging by lower expression of mRNAs for IL-1β, IL-6 and IL-23/p19). In accordance with the (i) lower frequency of GM-CSF+ Th cells in dLNs and SC of AO rats and their lower GM-CSF production, and (ii) impaired CCL2 expression in the SC tissue, the proportion of proinflammatory monocytes among peripheral blood cells and their progeny (CD45hi cells) among the SC CD11b+ cells were reduced in AO compared with DA rats. Collectively, the results indicate that the strain specificities in efficacy of several mechanisms

  20. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students

    PURNIMA R. CHITLANGE

    2014-01-01

    Chitlange PR. 2014. Contamination of cell phones by pathogenic microorganisms: Comparison between hospital staff and college students. Nusantara Bioscience 6: 203-206. Cell phone (CP) is a long range portable electronic device. The cell phone is constantly exposed to arrays of micro organisms, making it a harbour and breeding ground for microbes especially those associated with skin. The adult human is covered with approximately 2m2 of skin with area supporting about 106 bacteria. To check wh...

  1. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2015-01-01

    with this interpretation, MAIT cell clones with distinct TCRs responded differentially to a riboflavin metabolite. These results suggest that MAIT cells can discriminate between pathogen-derived ligands in a clonotype-dependent manner, providing a basis for adaptive memory via recruitment of specific repertoires shaped...

  2. Assessment of Shiga toxin-producing Escherichia coli isolates from wildlife meat as potential pathogens for humans.

    Miko, Angelika; Pries, Karin; Haby, Sabine; Steege, Katja; Albrecht, Nadine; Krause, Gladys; Beutin, Lothar

    2009-10-01

    A total of 140 Shiga toxin-producing Escherichia coli (STEC) strains from wildlife meat (deer, wild boar, and hare) isolated in Germany between 1998 and 2006 were characterized with respect to their serotypes and virulence markers associated with human pathogenicity. The strains grouped into 38 serotypes, but eight O groups (21, 146, 128, 113, 22, 88, 6, and 91) and four H types (21, 28, 2, and 8) accounted for 71.4% and 75.7% of all STEC strains from game, respectively. Eighteen of the serotypes, including enterohemorrhagic E. coli (EHEC) O26:[H11] and O103:H2, were previously found to be associated with human illness. Genes linked to high-level virulence for humans (stx(2), stx(2d), and eae) were present in 46 (32.8%) STEC strains from game. Fifty-four STEC isolates from game belonged to serotypes which are frequently found in human patients (O103:H2, O26:H11, O113:H21, O91:H21, O128:H2, O146:H21, and O146:H28). These 54 STEC isolates were compared with 101 STEC isolates belonging to the same serotypes isolated from farm animals, from their food products, and from human patients. Within a given serotype, most STEC strains were similar with respect to their stx genotypes and other virulence attributes, regardless of origin. The 155 STEC strains were analyzed for genetic similarity by XbaI pulsed-field gel electrophoresis. O103:H2, O26:H11, O113:H21, O128:H2, and O146:H28 STEC isolates from game were 85 to 100% similar to STEC isolates of the same strains from human patients. By multilocus sequence typing, game EHEC O103:H2 strains were attributed to a clonal lineage associated with hemorrhagic diseases in humans. The results from our study indicate that game animals represent a reservoir for and a potential source of human pathogenic STEC and EHEC strains.

  3. Assessment of Shiga Toxin-Producing Escherichia coli Isolates from Wildlife Meat as Potential Pathogens for Humans▿

    Miko, Angelika; Pries, Karin; Haby, Sabine; Steege, Katja; Albrecht, Nadine; Krause, Gladys; Beutin, Lothar

    2009-01-01

    A total of 140 Shiga toxin-producing Escherichia coli (STEC) strains from wildlife meat (deer, wild boar, and hare) isolated in Germany between 1998 and 2006 were characterized with respect to their serotypes and virulence markers associated with human pathogenicity. The strains grouped into 38 serotypes, but eight O groups (21, 146, 128, 113, 22, 88, 6, and 91) and four H types (21, 28, 2, and 8) accounted for 71.4% and 75.7% of all STEC strains from game, respectively. Eighteen of the serotypes, including enterohemorrhagic E. coli (EHEC) O26:[H11] and O103:H2, were previously found to be associated with human illness. Genes linked to high-level virulence for humans (stx2, stx2d, and eae) were present in 46 (32.8%) STEC strains from game. Fifty-four STEC isolates from game belonged to serotypes which are frequently found in human patients (O103:H2, O26:H11, O113:H21, O91:H21, O128:H2, O146:H21, and O146:H28). These 54 STEC isolates were compared with 101 STEC isolates belonging to the same serotypes isolated from farm animals, from their food products, and from human patients. Within a given serotype, most STEC strains were similar with respect to their stx genotypes and other virulence attributes, regardless of origin. The 155 STEC strains were analyzed for genetic similarity by XbaI pulsed-field gel electrophoresis. O103:H2, O26:H11, O113:H21, O128:H2, and O146:H28 STEC isolates from game were 85 to 100% similar to STEC isolates of the same strains from human patients. By multilocus sequence typing, game EHEC O103:H2 strains were attributed to a clonal lineage associated with hemorrhagic diseases in humans. The results from our study indicate that game animals represent a reservoir for and a potential source of human pathogenic STEC and EHEC strains. PMID:19700552

  4. Pathogen Screening of Naturally Produced Yakima River Spring Chinook Smolts; Yakima/Klickitat Fisheries Project Monitoring and Evaluation Report 6 of 7, 2003-2004 Annual Report.

    Thomas, Joan B. (Washington Department of Fish and Wildlife, Olympia, WA)

    2004-05-01

    In 1999 the Cle Elum Hatchery began releasing spring chinook salmon smolts into the upper Yakima River to increase natural production. Part of the evaluation of this program is to monitor whether introduction of hatchery produced smolts would impact the prevalence of specific pathogens in the naturally produced spring chinook smolts. Increases in prevalence of any of these pathogens could negatively impact the survival of these fish. In 1998 and 2000 through 2003 naturally produced smolts were collected for monitoring at the Chandler smolt collection facility on the lower Yakima River. Smolts were collected from mid to late outmigration, with a target of 200 fish each year. The pathogens monitored were infectious hematopoeitic necrosis virus, infectious pancreatic necrosis virus, viral hemorrhagic septicemia virus, Flavobacterium psychrophilum, Flavobacterium columnare, Aeromonas salmonicida, Yersinia ruckeri, Edwardsiella ictaluri, Renibacterium salmoninarum and Myxobolus cerebralis. To date, only the bacterial pathogens have been detected and prevalences have been low. Prevalences have varied each year and these changes are attributed to normal fluctuation of prevalence. All of the pathogens detected are widely distributed in Washington State.

  5. Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

    Beatriz García

    2016-11-01

    Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

  6. PRM1 and KAR5 function in cell-cell fusion and karyogamy to drive distinct bisexual and unisexual cycles in the Cryptococcus pathogenic species complex.

    Ci Fu

    2017-11-01

    Full Text Available Sexual reproduction is critical for successful evolution of eukaryotic organisms in adaptation to changing environments. In the opportunistic human fungal pathogens, the Cryptococcus pathogenic species complex, C. neoformans primarily undergoes bisexual reproduction, while C. deneoformans undergoes both unisexual and bisexual reproduction. During both unisexual and bisexual cycles, a common set of genetic circuits regulates a yeast-to-hyphal morphological transition, that produces either monokaryotic or dikaryotic hyphae. As such, both the unisexual and bisexual cycles can generate genotypic and phenotypic diversity de novo. Despite the similarities between these two cycles, genetic and morphological differences exist, such as the absence of an opposite mating-type partner and monokaryotic instead of dikaryotic hyphae during C. deneoformans unisexual cycle. To better understand the similarities and differences between these modes of sexual reproduction, we focused on two cellular processes involved in sexual reproduction: cell-cell fusion and karyogamy. We identified orthologs of the plasma membrane fusion protein Prm1 and the nuclear membrane fusion protein Kar5 in both Cryptococcus species, and demonstrated their conserved roles in cell fusion and karyogamy during C. deneoformans α-α unisexual reproduction and C. deneoformans and C. neoformans a-α bisexual reproduction. Notably, karyogamy occurs inside the basidum during bisexual reproduction in C. neoformans, but often occurs earlier following cell fusion during bisexual reproduction in C. deneoformans. Characterization of these two genes also showed that cell fusion is dispensable for solo unisexual reproduction in C. deneoformans. The blastospores produced along hyphae during C. deneoformans unisexual reproduction are diploid, suggesting that diploidization occurs early during hyphal development, possibly through either an endoreplication pathway or cell fusion-independent karyogamy

  7. Involvement of Activating NK Cell Receptors and Their Modulation in Pathogen Immunity

    Francesco Marras

    2011-01-01

    Full Text Available Natural Killer (NK cells are endowed with cell-structure-sensing receptors providing inhibitory protection from self-destruction (inhibitory NK receptors, iNKRs, including killer inhibitory receptors and other molecules and rapid triggering potential leading to functional cell activation by Toll-like receptors (TLRs, cytokine receptors, and activating NK cell receptors including natural cytotoxicity receptors (NCRs, i.e., NKp46, NKp46, and NKp44. NCR and NKG2D recognize ligands on infected cells which may be endogenous or may directly bind to some structures derived from invading pathogens. In this paper, we address the known direct or indirect interactions between activating receptors and pathogens and their expression during chronic HIV and HCV infections.

  8. Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

    Martin S Davey

    2011-05-01

    Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

  9. Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

    Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

    2011-01-01

    Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

  10. In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

    Lew, Y Y; Michalak, T I

    2001-02-01

    Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

  11. Anti-tumor therapy with macroencapsulated endostatin producer cells

    Balduino Keli N

    2010-03-01

    Full Text Available Abstract Background Theracyte is a polytetrafluoroethylene membrane macroencapsulation system designed to induce neovascularization at the tissue interface, protecting the cells from host's immune rejection, thereby circumventing the problem of limited half-life and variation in circulating levels. Endostatin is a potent inhibitor of angiogenesis and tumor growth. Continuous delivery of endostatin improves the efficacy and potency of the antitumoral therapy. The purpose of this study was to determine whether recombinant fibroblasts expressing endostatin encapsulated in Theracyte immunoisolation devices can be used for delivery of this therapeutic protein for treatment of mice bearing B16F10 melanoma and Ehrlich tumors. Results Mice were inoculated subcutaneously with melanoma (B16F10 cells or Ehrlich tumor cells at the foot pads. Treatment began when tumor thickness had reached 0.5 mm, by subcutaneous implantation of 107 recombinant encapsulated or non-encapsulated endostatin producer cells. Similar melanoma growth inhibition was obtained for mice treated with encapsulated or non-encapsulated endostatin-expressing cells. The treatment of mice bearing melanoma tumor with encapsulated endostatin-expressing cells was decreased by 50.0%, whereas a decrease of 56.7% in tumor thickness was obtained for mice treated with non-encapsulated cells. Treatment of Ehrlich tumor-bearing mice with non-encapsulated endostatin-expressing cells reduced tumor thickness by 52.4%, whereas lower tumor growth inhibition was obtained for mice treated with encapsulated endostatin-expressing cells: 24.2%. Encapsulated endostatin-secreting fibroblasts failed to survive until the end of the treatment. However, endostatin release from the devices to the surrounding tissues was confirmed by immunostaining. Decrease in vascular structures, functional vessels and extension of the vascular area were observed in melanoma microenvironments. Conclusions This study indicates that

  12. Probiotic Modulation of Innate Cell Pathogen Sensing and Signaling Events

    Amy Llewellyn

    2017-10-01

    Full Text Available There is a growing body of evidence documenting probiotic bacteria to have a beneficial effect to the host through their ability to modulate the mucosal immune system. Many probiotic bacteria can be considered to act as either immune activators or immune suppressors, which have appreciable influence on homeostasis, inflammatory- and suppressive-immunopathology. What is becoming apparent is the ability of these probiotics to modulate innate immune responses via direct or indirect effects on the signaling pathways that drive these activatory or suppressive/tolerogenic mechanisms. This review will focus on the immunomodulatory role of probiotics on signaling pathways in innate immune cells: from positive to negative regulation associated with innate immune cells driving gut mucosal functionality. Research investigations have shown probiotics to modulate innate functionality in many ways including, receptor antagonism, receptor expression, binding to and expression of adaptor proteins, expression of negative regulatory signal molecules, induction of micro-RNAs, endotoxin tolerisation and finally, the secretion of immunomodulatory proteins, lipids and metabolites. The detailed understanding of the immunomodulatory signaling effects of probiotic strains will facilitate strain-specific selective manipulation of innate cell signal mechanisms in the modulation of mucosal adjuvanticity, immune deviation and tolerisation in both healthy subjects and patients with inflammatory and suppressive pathology.

  13. Probiotic Modulation of Innate Cell Pathogen Sensing and Signaling Events

    Llewellyn, Amy; Foey, Andrew

    2017-01-01

    There is a growing body of evidence documenting probiotic bacteria to have a beneficial effect to the host through their ability to modulate the mucosal immune system. Many probiotic bacteria can be considered to act as either immune activators or immune suppressors, which have appreciable influence on homeostasis, inflammatory- and suppressive-immunopathology. What is becoming apparent is the ability of these probiotics to modulate innate immune responses via direct or indirect effects on the signaling pathways that drive these activatory or suppressive/tolerogenic mechanisms. This review will focus on the immunomodulatory role of probiotics on signaling pathways in innate immune cells: from positive to negative regulation associated with innate immune cells driving gut mucosal functionality. Research investigations have shown probiotics to modulate innate functionality in many ways including, receptor antagonism, receptor expression, binding to and expression of adaptor proteins, expression of negative regulatory signal molecules, induction of micro-RNAs, endotoxin tolerisation and finally, the secretion of immunomodulatory proteins, lipids and metabolites. The detailed understanding of the immunomodulatory signaling effects of probiotic strains will facilitate strain-specific selective manipulation of innate cell signal mechanisms in the modulation of mucosal adjuvanticity, immune deviation and tolerisation in both healthy subjects and patients with inflammatory and suppressive pathology. PMID:29065562

  14. Biological Role of Paenilarvins, Iturin-Like Lipopeptide Secondary Metabolites Produced by the Honey Bee Pathogen Paenibacillus larvae.

    Hertlein, Gillian; Seiffert, Marlene; Gensel, Sebastian; Garcia-Gonzalez, Eva; Ebeling, Julia; Skobalj, Ranko; Kuthning, Anja; Süssmuth, Roderich D; Genersch, Elke

    2016-01-01

    The Gram-positive bacterium Paenibacillus larvae (P. larvae) is the causative agent of a deadly honey bee brood disease called American Foulbrood (AFB). AFB is a notifiable epizootic in most countries and, hence, P. larvae is of considerable relevance for veterinarians and apiculturists alike. Over the last decade, much progress has been made in the understanding of the (patho)biology of P. larvae. Recently, several non-ribosomally produced peptides (NRP) and peptide/polyketide (NRP/PK) hybrids produced by P. larvae were identified. Among these NRPs were iturin-like lipopeptides, the paenilarvins A-C. Iturins are known to exhibit strong anti-fungal activity; for some iturins, cytotoxic activity towards mammalian erythrocytes and human cancer cell lines are described. We here present our results on the analysis of the natural function of the paenilarvins during pathogenesis of P. larvae infections. We demonstrated production of paenilarvins in infected larvae. However, we could neither demonstrate cytotoxicity of paenilarvins towards cultured insect cells nor towards larvae in feeding assays. Accordingly, exposure bioassays performed with larvae infected by wild-type P. larvae and a knockout mutant of P. larvae lacking production of paenilarvins did not substantiate a role for the paenilarvins as virulence factor. Further experiments are necessary to analyze the relevance of the paenilarvins' anti-fungal activity for P. larvae infections in the presence of fungal competitors in the larval midgut or cadaver.

  15. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

    2015-01-01

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  16. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  17. Microstructure of Cell Wall-Associated Melanin in the Human Pathogenic Fungus cryptococcus neoformans

    Eisenman, H.C.; Nosanchuk, J.D.; Webber, J. Beau W.; Emerson, T.A.; Casadevall, A.

    2005-01-01

    Melanin is a virulence factor for many pathogenic fungal species,including Cryptococcus neoformans. Melanin is deposited in the cell wall, and melanin isolated from this fungus retains the shape of the cells, resulting in hollow spheres called ``ghosts''. In this study, atomic force, scanning electron, and transmission electron microscopy revealed that melanin ghosts are covered with roughly spherical granular particles approximately 40-130 nm in diameter, and that the melanin is arranged in ...

  18. Dickeya dadantii, a plant pathogenic bacterium producing Cyt-like entomotoxins, causes septicemia in the pea aphid Acyrthosiphon pisum

    Costechareyre, Denis; Balmand, Severine; Condemine, Guy; Rahbé, Yves

    2012-01-01

    International audience; Dickeya dadantii (syn. Erwinia chrysanthemi) is a plant pathogenic bacteria that harbours a cluster of four horizontally-transferred, insect-specific toxin genes. It was recently shown to be capable of causing an acute infection in the pea aphid Acyrthosiphon pisum (Insecta: Hemiptera). The infection route of the pathogen, and the role and in vivo expression pattern of these toxins, remain unknown. Using bacterial numeration and immunolocalization, we investigated the ...

  19. CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

    Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

    2017-07-21

    Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

  20. Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

    Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

    2016-02-01

    Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

    Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

    2014-01-01

    Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

  2. Host-pathogen interactions in bovine mammary epithelial cells and HeLa cells by Staphylococcus aureus isolated from subclinical bovine mastitis.

    Castilho, Ivana G; Dantas, Stéfani Thais Alves; Langoni, Hélio; Araújo, João P; Fernandes, Ary; Alvarenga, Fernanda C L; Maia, Leandro; Cagnini, Didier Q; Rall, Vera L M

    2017-08-01

    Staphylococcus aureus is a common pathogen that causes subclinical bovine mastitis due to several virulence factors. In this study, we analyzed S. aureus isolates collected from the milk of cows with subclinical mastitis that had 8 possible combinations of bap, icaA, and icaD genes, to determine their capacity to produce biofilm on biotic (bovine primary mammary epithelial cells and HeLa cells) and abiotic (polystyrene microplates) surfaces, and their ability to adhere to and invade these cells. We also characterized isolates for microbial surface components recognizing adhesive matrix molecules (MSCRAMM) and agr genes, and for their susceptibility to cefquinome sulfate in the presence of biofilm. All isolates adhered to and invaded both cell types, but invasion indexes were higher in bovine primary mammary epithelial cells. Using tryptic soy broth + 1% glucose on abiotic surfaces, 5 out of 8 isolates were biofilm producers, but only the bap + icaA + icaD + isolate was positive in Dulbecco's Modified Eagle's medium. The production of biofilm on biotic surfaces occurred only with this isolate and only on HeLa cells, because the invasion index for bovine primary mammary epithelial cells was too high, making it impossible to use these cells in this assay. Of the 5 biofilm producers in tryptic soy broth + 1% glucose, 4 presented with the bap/fnbA/clfA/clfB/eno/fib/ebpS combination, and all were protected from cefquinome sulfate. We found no predominance of any agr group. The high invasive potential of S. aureus made it impossible to observe biofilm in bovine primary mammary epithelial cells, and we concluded that cells with lower invasion rates, such as HeLa cells, were more appropriate for this assay. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Luminal epithelial cells within the mammary gland can produce basal cells upon oncogenic stress.

    Hein, S M; Haricharan, S; Johnston, A N; Toneff, M J; Reddy, J P; Dong, J; Bu, W; Li, Y

    2016-03-17

    In the normal mammary gland, the basal epithelium is known to be bipotent and can generate either basal or luminal cells, whereas the luminal epithelium has not been demonstrated to contribute to the basal compartment in an intact and normally developed mammary gland. It is not clear whether cellular heterogeneity within a breast tumor results from transformation of bipotent basal cells or from transformation and subsequent basal conversion of the more differentiated luminal cells. Here we used a retroviral vector to express an oncogene specifically in a small number of the mammary luminal epithelial cells and tested their potential to produce basal cells during tumorigenesis. This in-vivo lineage-tracing work demonstrates that luminal cells are capable of producing basal cells on activation of either polyoma middle T antigen or ErbB2 signaling. These findings reveal the plasticity of the luminal compartment during tumorigenesis and provide an explanation for cellular heterogeneity within a cancer.

  4. Altered T-cell responses by the periodontal pathogen Porphyromonas gingivalis.

    Hazem Khalaf

    Full Text Available Several studies support an association between the chronic inflammatory diseases periodontitis and atherosclerosis with a crucial role for the periodontal pathogen Porphyromonas gingivalis. However, the interplay between this pathogen and the adaptive immune system, including T-cells, is sparsely investigated. Here we used Jurkat T-cells to determine the effects of P. gingivalis on T-cell-mediated adaptive immune responses. We show that viable P. gingivalis targets IL-2 expression at the protein level. Initial cellular events, including ROS production and [Ca(2+](i, were elevated in response to P. gingivalis, but AP-1 and NF-κB activity dropped below basal levels and T-cells were unable to sustain stable IL-2 accumulation. IL-2 was partially restored by Leupeptin, but not by Cathepsin B Inhibitor, indicating an involvement of Rgp proteinases in the suppression of IL-2 accumulation. This was further confirmed by purified Rgp that caused a dose-dependent decrease in IL-2 levels. These results provide new insights of how this periodontal pathogen evades the host adaptive immune system by inhibiting IL-2 accumulation and thus attenuating T-cell proliferation and cellular communication.

  5. A modified method of insulin producing cells' generation from bone marrow-derived mesenchymal stem cells.

    Czubak, Paweł; Bojarska-Junak, Agnieszka; Tabarkiewicz, Jacek; Putowski, Lechosław

    2014-01-01

    Type 1 diabetes mellitus is a result of autoimmune destruction of pancreatic insulin producing β-cells and so far it can be cured only by insulin injection, by pancreas transplantation, or by pancreatic islet cells' transplantation. The methods are, however, imperfect and have a lot of disadvantages. Therefore new solutions are needed. The best one would be the use of differentiated mesenchymal stem cells (MSCs). In the present study, we investigated the potential of the bone marrow-derived MSCs line for in vitro differentiation into insulin producing cells (IPSs). We applied an 18-day protocol to differentiate MSCs. Differentiating cells formed cell clusters some of which resembled pancreatic islet-like cells. Using dithizone we confirmed the presence of insulin in the cells. What is more, the expression of proinsulin C-peptide in differentiated IPCs was analyzed by flow cytometry. For the first time, we investigated the influence of growth factors' concentration on IPCs differentiation efficiency. We have found that an increase in the concentration of growth factors up to 60 ng/mL of β-FGF/EGF and 30 ng/mL of activin A/β-cellulin increases the percentage of IPCs. Further increase of growth factors does not show any increase of the percentage of differentiated cells. Our findings suggest that the presented protocol can be adapted for differentiation of insulin producing cells from stem cells.

  6. Pathogenic LRRK2 mutations, through increased kinase activity, produce enlarged lysosomes with reduced degradative capacity and increase ATP13A2 expression.

    Henry, Anastasia G; Aghamohammadzadeh, Soheil; Samaroo, Harry; Chen, Yi; Mou, Kewa; Needle, Elie; Hirst, Warren D

    2015-11-01

    Lysosomal dysfunction plays a central role in the pathogenesis of several neurodegenerative disorders, including Parkinson's disease (PD). Several genes linked to genetic forms of PD, including leucine-rich repeat kinase 2 (LRRK2), functionally converge on the lysosomal system. While mutations in LRRK2 are commonly associated with autosomal-dominant PD, the physiological and pathological functions of this kinase remain poorly understood. Here, we demonstrate that LRRK2 regulates lysosome size, number and function in astrocytes, which endogenously express high levels of LRRK2. Expression of LRRK2 G2019S, the most common pathological mutation, produces enlarged lysosomes and diminishes the lysosomal capacity of these cells. Enlarged lysosomes appears to be a common phenotype associated with pathogenic LRRK2 mutations, as we also observed this effect in cells expressing other LRRK2 mutations; R1441C or Y1699C. The lysosomal defects associated with these mutations are dependent on both the catalytic activity of the kinase and autophosphorylation of LRRK2 at serine 1292. Further, we demonstrate that blocking LRRK2's kinase activity, with the potent and selective inhibitor PF-06447475, rescues the observed defects in lysosomal morphology and function. The present study also establishes that G2019S mutation leads to a reduction in lysosomal pH and increased expression of the lysosomal ATPase ATP13A2, a gene linked to a parkinsonian syndrome (Kufor-Rakeb syndrome), in brain samples from mouse and human LRRK2 G2019S carriers. Together, these results demonstrate that PD-associated LRRK2 mutations perturb lysosome function in a kinase-dependent manner, highlighting the therapeutic promise of LRRK2 kinase inhibitors in the treatment of PD. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Rice bacterial blight pathogen Xanthomonas oryzae pv. oryzae produces multiple DSF-family signals in regulation of virulence factor production

    Cha Jae-Soon

    2010-07-01

    Full Text Available Abstract Background Xanthomonas oryzae pv. oryzae (Xoo is the causal agent of rice bacterial blight disease. Xoo produces a range of virulence factors, including EPS, extracellular enzyme, iron-chelating siderophores, and type III-secretion dependent effectors, which are collectively essential for virulence. Genetic and genomics evidence suggest that Xoo might use the diffusible signal factor (DSF type quorum sensing (QS system to regulate the virulence factor production. However, little is known about the chemical structure of the DSF-like signal(s produced by Xoo and the factors influencing the signal production. Results Xoo genome harbours an rpf cluster comprising rpfB, rpfF, rpfC and rpfG. The proteins encoded by these genes are highly homologous to their counterparts in X. campestris pv. campestris (Xcc, suggesting that Xcc and Xoo might use similar mechanisms for DSF biosynthesis and autoregulation. Consistent with in silico analysis, the rpfF mutant was DSF-deficient and the rpfC mutant produced about 25 times higher DSF-like activity than the wild type Xoo strain KACC10331. From the supernatants of rpfC mutant, we purified three compounds showing strong DSF-like activity. Mass spectrometry and NMR analysis revealed that two of them were the previously characterized DSF and BDSF; the third one was a novel unsaturated fatty acid with 2 double bonds and was designated as CDSF in this study. Further analysis showed that all the three DSF-family signals were synthesized via the enzyme RpfF encoded by Xoo2868. DSF and BDSF at a final concentration of 3 μM to the rpfF mutant could fully restore its extracellular xylanase activity and EPS production to the wild type level, but CDSF was less active than DSF and BDSF in induction of EPS and xylanase. DSF and CDSF shared a similar cell density-dependent production time course with the maximum production being detected at 42 h after inoculation, whereas the maximum production of BDSF was observed

  8. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  9. Mucosal-Associated Invariant T Cell Interactions with Commensal and Pathogenic Bacteria: Potential Role in Antimicrobial Immunity in the Child

    Liana Ghazarian

    2017-12-01

    Full Text Available Mucosal-associated invariant T (MAIT cells are unconventional CD3+CD161high T lymphocytes that recognize vitamin B2 (riboflavin biosynthesis precursor derivatives presented by the MHC-I related protein, MR1. In humans, their T cell receptor is composed of a Vα7.2-Jα33/20/12 chain, combined with a restricted set of Vβ chains. MAIT cells are very abundant in the liver (up to 40% of resident T cells and in mucosal tissues, such as the lung and gut. In adult peripheral blood, they represent up to 10% of circulating T cells, whereas they are very few in cord blood. This large number of MAIT cells in the adult likely results from their gradual expansion with age following repeated encounters with riboflavin-producing microbes. Upon recognition of MR1 ligands, MAIT cells have the capacity to rapidly eliminate bacterially infected cells through the production of inflammatory cytokines (IFNγ, TNFα, and IL-17 and cytotoxic effector molecules (perforin and granzyme B. Thus, MAIT cells may play a crucial role in antimicrobial defense, in particular at mucosal sites. In addition, MAIT cells have been implicated in diseases of non-microbial etiology, including autoimmunity and other inflammatory diseases. Although their participation in various clinical settings has received increased attention in adults, data in children are scarce. Due to their innate-like characteristics, MAIT cells might be particularly important to control microbial infections in the young age, when long-term protective adaptive immunity is not fully developed. Herein, we review the data showing how MAIT cells may control microbial infections and how they discriminate pathogens from commensals, with a focus on models relevant for childhood infections.

  10. Lactobacillus crispatus L1: high cell density cultivation and exopolysaccharide structure characterization to highlight potentially beneficial effects against vaginal pathogens.

    Donnarumma, Giovanna; Molinaro, Antonio; Cimini, Donatella; De Castro, Cristina; Valli, Vivien; De Gregorio, Vincenza; De Rosa, Mario; Schiraldi, Chiara

    2014-05-30

    Vaginal lactic acid bacteria defend the host against pathogens through a combination of competitive exclusion, competition for nutrients, production of antimicrobial substances and through the activation of the immune system. A new human isolate named Lactobacillus crispatus L1 was characterized in this work, and a preliminary evaluation of its probiotic potential is described together with a process to obtain a high productivity of viable biomass. In a simulated digestion process 1.8⋅10(10) cells∙ml(-1) survived the gastric environment with 80% viability, without being affected by small intestine juices. Experiments on six different C sources were performed to analyze growth and organic acids production and, glucose, provided the best performances. A microfiltration strategy was exploited to improve the cellular yield in 2 L-fermentation processes, reaching 27 g · l(-1) of dry biomass. Moreover, L. crispatus L1 demonstrated a greater stability to high concentrations of lactic acid, compared to other lactobacilli. The specific L. crispatus L1 exopolysaccharide was purified from the fermentation broth and characterized by NMR showing structural features and similarity to exopolysaccharides produced by pathogenic strains. Live L. crispatus L1 cells strongly reduced adhesion of a yeast pathogenic strain, Candida albicans in particular, in adherence assays. Interestingly a higher expression of the human defensin HBD-2 was also observed in vaginal cells treated with the purified exopolysaccharide, indicating a possible correlation with C. albicans growth inhibition. The paper describes the evaluation of L. crispatus L1 as potential vaginal probiotic and the fermentation processes to obtain high concentrations of viable cells.

  11. Control of epithelial cell function by interleukin-22-producing RORγt+ innate lymphoid cells

    Sanos, Stephanie L; Vonarbourg, Cedric; Mortha, Arthur; Diefenbach, Andreas

    2011-01-01

    It is rapidly emerging that the defence system of innate lymphocytes is more diverse than previously recognized. In addition to natural killer (NK) cells, lymphoid tissue inducer (LTi) cells, and natural helper cells have now been identified. LTi cells are developmentally dependent on the orphan transcription factor RORγt and instruct lymph node development during embryogenesis. More recently, it has become evident, that in addition to their role for lymph organ development, LTi cells are also potent producers of cytokines such as interleukin-22 (IL-22) and IL-17 in adult mice. In addition to LTi cells, another RORγt-dependent innate lymphocyte subset co-expressing RORγt and NK cell receptors (NKRs) has been identified. These NKR+ RORγt+ cells are also potent producers of IL-22 but it is unclear whether they are part of the NK cell or LTi cell lineage. This review will highlight recent progress in understanding development and function of innate IL-22-producing lymphocyte subsets. PMID:21391996

  12. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  13. Quantification of residual host cell DNA in adenoviral vectors produced on PER.C6 cells

    Gijsbers, Linda; Koel, Björn; Weggeman, Miranda; Goudsmit, Jaap; Havenga, Menzo; Marzio, Giuseppe

    2005-01-01

    Recombinant adenoviral vectors for gene therapy and vaccination are routinely prepared on cultures of immortalized cells, allowing the production of vector batches of high titer and consistent quality. Quantification of residual DNA from the producing cell line is part of the purity tests for

  14. Hotspot autoimmune T cell receptor binding underlies pathogen and insulin peptide cross-reactivity

    Cole, David K.; Bulek, Anna M.; Dolton, Garry; Schauenberg, Andrea J.; Szomolay, Barbara; Trimby, Andrew; Jothikumar, Prithiviraj; Fuller, Anna; Skowera, Ania; Rossjohn, Jamie; Zhu, Cheng; Miles, John J.; Wooldridge, Linda; Rizkallah, Pierre J.; Sewell, Andrew K.

    2016-01-01

    The cross-reactivity of T cells with pathogen- and self-derived peptides has been implicated as a pathway involved in the development of autoimmunity. However, the mechanisms that allow the clonal T cell antigen receptor (TCR) to functionally engage multiple peptide–major histocompatibility complexes (pMHC) are unclear. Here, we studied multiligand discrimination by a human, preproinsulin reactive, MHC class-I–restricted CD8+ T cell clone (1E6) that can recognize over 1 million different peptides. We generated high-resolution structures of the 1E6 TCR bound to 7 altered peptide ligands, including a pathogen-derived peptide that was an order of magnitude more potent than the natural self-peptide. Evaluation of these structures demonstrated that binding was stabilized through a conserved lock-and-key–like minimal binding footprint that enables 1E6 TCR to tolerate vast numbers of substitutions outside of this so-called hotspot. Highly potent antigens of the 1E6 TCR engaged with a strong antipathogen-like binding affinity; this engagement was governed though an energetic switch from an enthalpically to entropically driven interaction compared with the natural autoimmune ligand. Together, these data highlight how T cell cross-reactivity with pathogen-derived antigens might break self-tolerance to induce autoimmune disease. PMID:27183389

  15. The modular nature of dendritic cell responses to commensal and pathogenic fungi.

    Lisa Rizzetto

    Full Text Available The type of adaptive immune response following host-fungi interaction is largely determined at the level of the antigen-presenting cells, and in particular by dendritic cells (DCs. The extent to which transcriptional regulatory events determine the decision making process in DCs is still an open question. By applying the highly structured DC-ATLAS pathways to analyze DC responses, we classified the various stimuli by revealing the modular nature of the different transcriptional programs governing the recognition of either pathogenic or commensal fungi. Through comparison of the network parts affected by DC stimulation with fungal cells and purified single agonists, we could determine the contribution of each receptor during the recognition process. We observed that initial recognition of a fungus creates a temporal window during which the simultaneous recruitment of cell surface receptors can intensify, complement and sustain the DC activation process. The breakdown of the response to whole live cells, through the purified components, showed how the response to invading fungi uses a set of specific modules. We find that at the start of fungal recognition, DCs rapidly initiate the activation process. Ligand recognition is further enhanced by over-expression of the receptor genes, with a significant correspondence between gene expression and protein levels and function. Then a marked decrease in the receptor levels follows, suggesting that at this moment the DC commits to a specific fate. Overall our pathway based studies show that the temporal window of the fungal recognition process depends on the availability of ligands and is different for pathogens and commensals. Modular analysis of receptor and signalling-adaptor expression changes, in the early phase of pathogen recognition, is a valuable tool for rapid and efficient dissection of the pathogen derived components that determine the phenotype of the DC and thereby the type of immune response

  16. Insulin-producing cells generated from dedifferentiated human pancreatic beta cells expanded in vitro.

    Holger A Russ

    Full Text Available Expansion of beta cells from the limited number of adult human islet donors is an attractive prospect for increasing cell availability for cell therapy of diabetes. However, attempts at expanding human islet cells in tissue culture result in loss of beta-cell phenotype. Using a lineage-tracing approach we provided evidence for massive proliferation of beta-cell-derived (BCD cells within these cultures. Expansion involves dedifferentiation resembling epithelial-mesenchymal transition (EMT. Epigenetic analyses indicate that key beta-cell genes maintain open chromatin structure in expanded BCD cells, although they are not transcribed. Here we investigated whether BCD cells can be redifferentiated into beta-like cells.Redifferentiation conditions were screened by following activation of an insulin-DsRed2 reporter gene. Redifferentiated cells were characterized for gene expression, insulin content and secretion assays, and presence of secretory vesicles by electron microscopy. BCD cells were induced to redifferentiate by a combination of soluble factors. The redifferentiated cells expressed beta-cell genes, stored insulin in typical secretory vesicles, and released it in response to glucose. The redifferentiation process involved mesenchymal-epithelial transition, as judged by changes in gene expression. Moreover, inhibition of the EMT effector SLUG (SNAI2 using shRNA resulted in stimulation of redifferentiation. Lineage-traced cells also gave rise at a low rate to cells expressing other islet hormones, suggesting transition of BCD cells through an islet progenitor-like stage during redifferentiation.These findings demonstrate for the first time that expanded dedifferentiated beta cells can be induced to redifferentiate in culture. The findings suggest that ex-vivo expansion of adult human islet cells is a promising approach for generation of insulin-producing cells for transplantation, as well as basic research, toxicology studies, and drug

  17. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi.

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter; Boomsma, Jacobus J

    2010-12-31

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21%) of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to those normally found in phytopathogens.

  18. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    Boomsma Jacobus J

    2010-12-01

    Full Text Available Abstract Background Leaf-cutting (attine ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets contain proteins that are produced by the fungal symbiont to pass unharmed through the digestive system of the ants, so they can enhance new fungus garden growth. Results We tested this hypothesis by using proteomics methods to determine the gene sequences of fecal proteins in Acromyrmex echinatior leaf-cutting ants. Seven (21% of the 33 identified proteins were pectinolytic enzymes that originated from the fungal symbiont and which were still active in the fecal droplets produced by the ants. We show that these enzymes are found in the fecal material only when the ants had access to fungus garden food, and we used quantitative polymerase chain reaction analysis to show that the expression of six of these enzyme genes was substantially upregulated in the fungal gongylidia. These unique structures serve as food for the ants and are produced only by the evolutionarily advanced garden symbionts of higher attine ants, but not by the fungi reared by the basal lineages of this ant clade. Conclusions Pectinolytic enzymes produced in the gongylidia of the fungal symbiont are ingested but not digested by Acromyrmex leaf-cutting ants so that they end up in the fecal fluid and become mixed with new garden substrate. Substantial quantities of pectinolytic enzymes are typically found in pathogenic fungi that attack live plant tissue, where they are known to breach the cell walls to allow the fungal mycelium access to the cell contents. As the leaf-cutting ant symbionts are derived from fungal clades that decompose dead plant material, our results suggest that their pectinolytic enzymes represent secondarily evolved adaptations that are convergent to

  19. Adhesion of Human Probiotic Lactobacillus rhamnosus to Cervical and Vaginal Cells and Interaction with Vaginosis-Associated Pathogens

    Sophie Coudeyras

    2008-01-01

    Full Text Available Objectives. The ability of a probiotic Lactobacillus rhamnosus strain (Lcr35 to adhere to cervical and vaginal cells and to affect the viability of two main vaginosis-associated pathogens, Prevotella bivia, Gardnerella vaginalis, as well as Candida albicans was investigated. Methods. Adhesion ability was determined in vitro with immortalized epithelial cells from the endocervix, ectocervix, and vagina. Coculture experiments were performed to count viable pathogens cells in the presence of Lcr35. Results. Lcr35 was able to specifically and rapidly adhere to the three cell lines. In coculture assays, a decrease in pathogen cell division rate was observed as from 4 hours of incubation and bactericidal activity after a longer period of incubation, mostly with P. bivia. Conclusion. The ability of Lcr35 to adhere to cervicovaginal cells and its antagonist activities against vaginosis-associated pathogens suggest that this probiotic strain is a promising candidate for use in therapy.

  20. Pathogen Trojan Horse Delivers Bioactive Host Protein to Alter Maize Anther Cell Behavior in Situ.

    van der Linde, Karina; Timofejeva, Ljudmilla; Egger, Rachel L; Ilau, Birger; Hammond, Reza; Teng, Chong; Meyers, Blake C; Doehlemann, Gunther; Walbot, Virginia

    2018-03-01

    Small proteins are crucial signals during development, host defense, and physiology. The highly spatiotemporal restricted functions of signaling proteins remain challenging to study in planta. The several month span required to assess transgene expression, particularly in flowers, combined with the uncertainties from transgene position effects and ubiquitous or overexpression, makes monitoring of spatiotemporally restricted signaling proteins lengthy and difficult. This situation could be rectified with a transient assay in which protein deployment is tightly controlled spatially and temporally in planta to assess protein functions, timing, and cellular targets as well as to facilitate rapid mutagenesis to define functional protein domains. In maize ( Zea mays ), secreted ZmMAC1 (MULTIPLE ARCHESPORIAL CELLS1) was proposed to trigger somatic niche formation during anther development by participating in a ligand-receptor module. Inspired by Homer's Trojan horse myth, we engineered a protein delivery system that exploits the secretory capabilities of the maize smut fungus Ustilago maydis , to allow protein delivery to individual cells in certain cell layers at precise time points. Pathogen-supplied ZmMAC1 cell-autonomously corrected both somatic cell division and differentiation defects in mutant Zm mac1-1 anthers. These results suggest that exploiting host-pathogen interactions may become a generally useful method for targeting host proteins to cell and tissue types to clarify cellular autonomy and to analyze steps in cell responses. © 2018 American Society of Plant Biologists. All rights reserved.

  1. Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview

    Rebecca S. Y. Wong

    2011-01-01

    Full Text Available Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects.

  2. Isolate-dependent growth, virulence, and cell wall composition in the human pathogen Aspergillus fumigatus.

    Nansalmaa Amarsaikhan

    Full Text Available The ubiquitous fungal pathogen Aspergillus fumigatus is a mediator of allergic sensitization and invasive disease in susceptible individuals. The significant genetic and phenotypic variability between and among clinical and environmental isolates are important considerations in host-pathogen studies of A. fumigatus-mediated disease. We observed decreased radial growth, rate of germination, and ability to establish colony growth in a single environmental isolate of A. fumigatus, Af5517, when compared to other clinical and environmental isolates. Af5517 also exhibited increased hyphal diameter and cell wall β-glucan and chitin content, with chitin most significantly increased. Morbidity, mortality, lung fungal burden, and tissue pathology were decreased in neutropenic Af5517-infected mice when compared to the clinical isolate Af293. Our results support previous findings that suggest a correlation between in vitro growth rates and in vivo virulence, and we propose that changes in cell wall composition may contribute to this phenotype.

  3. Mechanisms of Disease: Host-Pathogen Interactions between Burkholderia Species and Lung Epithelial Cells

    David, Jonathan; Bell, Rachel E.; Clark, Graeme C.

    2015-01-01

    Members of the Burkholderia species can cause a range of severe, often fatal, respiratory diseases. A variety of in vitro models of infection have been developed in an attempt to elucidate the mechanism by which Burkholderia spp. gain entry to and interact with the body. The majority of studies have tended to focus on the interaction of bacteria with phagocytic cells with a paucity of information available with regard to the lung epithelium. However, the lung epithelium is becoming more widely recognized as an important player in innate immunity and the early response to infections. Here we review the complex relationship between Burkholderia species and epithelial cells with an emphasis on the most pathogenic species, Burkholderia pseudomallei and Burkholderia mallei. The current gaps in knowledge in our understanding are highlighted along with the epithelial host-pathogen interactions that offer potential opportunities for therapeutic intervention. PMID:26636042

  4. Molecular mapping of the cell wall polysaccharides of the human pathogen Streptococcus agalactiae

    Beaussart, Audrey; Péchoux, Christine; Trieu-Cuot, Patrick; Hols, Pascal; Mistou, Michel-Yves; Dufrêne, Yves F.

    2014-11-01

    The surface of many bacterial pathogens is covered with polysaccharides that play important roles in mediating pathogen-host interactions. In Streptococcus agalactiae, the capsular polysaccharide (CPS) is recognized as a major virulence factor while the group B carbohydrate (GBC) is crucial for peptidoglycan biosynthesis and cell division. Despite the important roles of CPS and GBC, there is little information available on the molecular organization of these glycopolymers on the cell surface. Here, we use atomic force microscopy (AFM) and transmission electron microscopy (TEM) to analyze the nanoscale distribution of CPS and GBC in wild-type (WT) and mutant strains of S. agalactiae. TEM analyses reveal that in WT bacteria, peptidoglycan is covered with a very thin (few nm) layer of GBC (the ``pellicle'') overlaid by a 15-45 nm thick layer of CPS (the ``capsule''). AFM-based single-molecule mapping with specific antibody probes shows that CPS is exposed on WT cells, while it is hardly detected on mutant cells impaired in CPS production (ΔcpsE mutant). By contrast, both TEM and AFM show that CPS is over-expressed in mutant cells altered in GBC expression (ΔgbcO mutant), indicating that the production of the two surface glycopolymers is coordinated in WT cells. In addition, AFM topographic imaging and molecular mapping with specific lectin probes demonstrate that removal of CPS (ΔcpsE), but not of GBC (ΔgbcO), leads to the exposure of peptidoglycan, organized into 25 nm wide bands running parallel to the septum. These results indicate that CPS forms a homogeneous barrier protecting the underlying peptidoglycan from environmental exposure, while the presence of GBC does not prevent peptidoglycan detection. This work shows that single-molecule AFM, combined with high-resolution TEM, represents a powerful platform for analysing the molecular arrangement of the cell wall polymers of bacterial pathogens.

  5. Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

    Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

    2018-03-25

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  6. The Cell Wall of the Human Fungal Pathogen Aspergillus fumigatus: Biosynthesis, Organization, Immune Response, and Virulence.

    Latgé, Jean-Paul; Beauvais, Anne; Chamilos, Georgios

    2017-09-08

    More than 90% of the cell wall of the filamentous fungus Aspergillus fumigatus comprises polysaccharides. Biosynthesis of the cell wall polysaccharides is under the control of three types of enzymes: transmembrane synthases, which are anchored to the plasma membrane and use nucleotide sugars as substrates, and cell wall-associated transglycosidases and glycosyl hydrolases, which are responsible for remodeling the de novo synthesized polysaccharides and establishing the three-dimensional structure of the cell wall. For years, the cell wall was considered an inert exoskeleton of the fungal cell. The cell wall is now recognized as a living organelle, since the composition and cellular localization of the different constitutive cell wall components (especially of the outer layers) vary when the fungus senses changes in the external environment. The cell wall plays a major role during infection. The recognition of the fungal cell wall by the host is essential in the initiation of the immune response. The interactions between the different pattern-recognition receptors (PRRs) and cell wall pathogen-associated molecular patterns (PAMPs) orientate the host response toward either fungal death or growth, which would then lead to disease development. Understanding the molecular determinants of the interplay between the cell wall and host immunity is fundamental to combatting Aspergillus diseases.

  7. Culture of human cell lines by a pathogen-inactivated human platelet lysate.

    Fazzina, R; Iudicone, P; Mariotti, A; Fioravanti, D; Procoli, A; Cicchetti, E; Scambia, G; Bonanno, G; Pierelli, L

    2016-08-01

    Alternatives to the use of fetal bovine serum (FBS) have been investigated to ensure xeno-free growth condition. In this study we evaluated the efficacy of human platelet lysate (PL) as a substitute of FBS for the in vitro culture of some human cell lines. PL was obtained by pools of pathogen inactivated human donor platelet (PLT) concentrates. Human leukemia cell lines (KG-1, K562, JURKAT, HL-60) and epithelial tumor cell lines (HeLa and MCF-7) were cultured with either FBS or PL. Changes in cell proliferation, viability, morphology, surface markers and cell cycle were evaluated for each cell line. Functional characteristics were analysed by drug sensitivity test and cytotoxicity assay. Our results demonstrated that PL can support growth and expansion of all cell lines, although the cells cultured in presence of PL experienced a less massive proliferation compared to those grown with FBS. We found a comparable percentage of viable specific marker-expressing cells in both conditions, confirming lineage fidelity in all cultures. Functionality assays showed that cells in both FBS- and PL-supported cultures maintained their normal responsiveness to adriamycin and NK cell-mediated lysis. Our findings indicate that PL is a feasible serum substitute for supporting growth and propagation of haematopoietic and epithelial cell lines with many advantages from a perspective of process standardization, ethicality and product safety.

  8. Comparison of the disinfection efficacy of chlorine-based products for inactivation of viral indicators and pathogenic bacteria in produce wash water.

    Chaidez, Cristobal; Moreno, Maria; Rubio, Werner; Angulo, Miguel; Valdez, Benigno

    2003-09-01

    Outbreaks of pathogenic bacteria infections associated with the consumption of fresh produce has occurred with increased frequency in recent years. This study was undertaken to determine the efficacy of three commonly used disinfectants in packing-houses of Culiacan, Mexico (sodium hypochlorite [NaOCl], trichlor-s-triazinetrione [TST] and thrichlormelamine [TCM]) for inactivation of viral indicators and pathogenic bacteria inoculated onto produce wash water. Each microbial challenge consisted of 2 L of water containing approximately 8 log10 bacterial CFU ml(-1), and 8 log10 viral PFU ml(-1) treated with 100 and 300 mg l(-1) of total chlorine with modified turbidity. Water samples were taken after 2 min of contact with chlorine-based products and assayed for the particular microorganisms. TST and NaOCl were found to effectively reduce for bacterial pathogens and viral indicators 8 log10 and 7 log10, respectively (alpha=0.05). The highest inactivation rate was observed when the turbidity was low and the disinfectant was applied at 300 mg l(-1). TCM did not show effective results when compared with the TST and NaOCl (Pturbidity created by the organic and inorganic material present in the water tanks carried by the fresh produce may affect the efficacy of the chlorine-based products.

  9. B cells promote obesity-associated periodontitis and oral pathogen-associated inflammation.

    Zhu, Min; Belkina, Anna C; DeFuria, Jason; Carr, Jordan D; Van Dyke, Thomas E; Gyurko, Robert; Nikolajczyk, Barbara S

    2014-08-01

    Individuals with T2D and PD suffer significantly from the ability of one disease to intensify the other. Disease-associated inflammation is one mechanism thought to fuel this pathogenic feed-forward loop. Several lines of evidence indicate that proinflammatory B cells promote T2D and PD; thus, B cells are top candidates for a cell type that predisposes PD in T2D. To test directly the role of B cells in T2D-associated PD, we compared outcomes from oral Porphyromonas gingivalis challenge of lean WT or B cell-null mice with outcomes from mice that were obese and insulin-resistant before challenge. Obese WT mice responded to oral P. gingivalis challenge with significant periodontal bone loss, whereas obese B cell-null mice were protected completely from PD. By contrast, lean WT and B cell-null mice suffer similar periodontal bone loss in response to oral pathogen. B cells from obese/insulin-resistant hosts also support oral osteoclastogenesis and both oral and systemic production of inflammatory cytokines, including pro-osteoclastogenic TNF-α and MIP-2, an ortholog of human IL-8. B cells furthermore impact AT inflammation in obese, P. gingivalis-infected hosts. Taken together, these data show that fundamentally different mechanisms regulate PD in lean and obese hosts, with B cells able to promote PD only if the hosts are "primed" by obesity. These results justify more intense analysis of obesity-associated changes in B cells that predispose PD in human T2D. © 2014 Society for Leukocyte Biology.

  10. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  11. Synthesis and Characterization of Cefotaxime Conjugated Gold Nanoparticles and Their Use to Target Drug-Resistant CTX-M-Producing Bacterial Pathogens.

    Shaikh, Sibhghatulla; Rizvi, Syed Mohd Danish; Shakil, Shazi; Hussain, Talib; Alshammari, Thamir M; Ahmad, Waseem; Tabrez, Shams; Al-Qahtani, Mohammad H; Abuzenadah, Adel M

    2017-09-01

    Multidrug-resistance due to "β lactamases having the expanded spectrum" (ESBLs) in members of Enterobacteriaceae is a matter of continued clinical concern. CTX-M is among the most common ESBLs in Enterobacteriaceae family. In the present study, a nanoformulation of cefotaxime was prepared using gold nanoparticles to combat drug-resistance in ESBL producing strains. Here, two CTX-M-15 positive cefotaxime resistant bacterial strains (i.e., one Escherichia coli and one Klebsiella pneumoniae strain) were used for testing the efficacy of "cefotaxime loaded gold-nanoparticles." Bromelain was used for both reduction and capping in the process of synthesis of gold-nanoparticles. Thereafter, cefotaxime was conjugated onto it with the help of activator 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide. For characterization of both unconjugated and cefotaxime conjugated gold nanoparticles; UV-Visible spectroscopy, Scanning, and Transmission type Electron Microscopy methods accompanied with Dynamic Light Scattering were used. We used agar diffusion method plus microbroth-dilution method for the estimation of the antibacterial-activity and determination of minimum inhibitory concentration or MIC values, respectively. MIC values of cefotaxime loaded gold nanoparticles against E. coli and K. pneumoniae were obtained as 1.009 and 2.018 mg/L, respectively. These bacterial strains were completely resistant to cefotaxime alone. These results reinforce the utility of conjugating an old unresponsive antibiotic with gold nanoparticles to restore its efficacy against otherwise resistant bacterial pathogens. J. Cell. Biochem. 118: 2802-2808, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. Pathogen-expanded CD11b+ invariant NKT cells feedback inhibit T cell proliferation via membrane-bound TGF-β1.

    Han, Yanmei; Jiang, Zhengping; Chen, Zhubo; Gu, Yan; Liu, Yanfang; Zhang, Xiang; Cao, Xuetao

    2015-04-01

    Natural killer T cells (NKT cells) are effector cells, but also regulator of immune response, which either promote or suppress immune response through production of different cytokines. However, the subsets of NKT cells with definite phenotype and regulatory function need to be further identified. Furthermore, the mechanisms for NKT cells to regulate immune response remain to be fully elucidated. Here we identified CD11b(+) invariant NKT (CD11b(+) iNKT) cells as a new subset of regulatory NKT cells in mouse models with infection. αGalCer:CD1d complex(+)TCRβ(+)NK1.1(+) NKT cells could be categorized to CD11b(+) and CD11b(-) subsets. NKT cells are enriched in liver. During Listeria monocytogenes infection, hepatic CD11b(+) iNKT cells were significantly induced and expanded, with peak expansion on day 8. CD11b(+) iNKT cells were also expanded significantly in spleen and mesenteric lymph nodes. As compared to CD11b(-) iNKT cells, CD11b(+) iNKT cells expressed higher levels of CD27, FasL, B7H1, CD69, and particularly higher level of membrane-bound TGF-β1 (mTGF-β1), but produced less IFN-γ, IL-4, IL-10 and TGF-β1. Hepatic CD11b(+) iNKT cells suppressed antigen-nonspecific and OVA-specific CD4 and CD8 T cell proliferation through mTGF-β1 both in vitro and in vivo, meanwhile, they did not interfere with activation of CD4 T cells and cytotoxicity of the activated CD8 T cells. Thus, we have identified a new subset of pathogen-expanded CD11b(+) invariant NKT cells which can feedback inhibit T cell response through cell-to-cell contact via cell surface (membrane-bound) TGF-β1, especially at the late stage of immune response against infection. CD11b(+) regulatory iNKT cells may contribute to protect host from pathological injure by preventing immune overactivation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells

    Szu-Hsiu Liu

    2012-01-01

    Full Text Available Embryonic stem (ES cells are a potential source of a variety of differentiated cells for cell therapy, drug discovery, and toxicology screening. Here, we present an efficacy strategy for the differentiation of mouse ES cells into insulin-producing cells (IPCs by a two-step differentiation protocol comprising of (i the formation of definitive endoderm in monolayer culture by activin A, and (ii this monolayer endoderm being induced to differentiate into IPCs by nicotinamide, insulin, and laminin. Differentiated cells can be obtained within approximately 7 days. The differentiation IPCs combined application of RT-PCR, ELISA, and immunofluorescence to characterize phenotypic and functional properties. In our study, we demonstrated that IPCs produced pancreatic transcription factors, endocrine progenitor marker, definitive endoderm, pancreatic β-cell markers, and Langerhans α and δ cells. The IPCs released insulin in a manner that was dose dependent upon the amount of glucose added. These techniques may be able to be applied to human ES cells, which would have very important ramifications for treating human disease.

  14. Indole-3-Acetic Acid Is Produced by Emiliania huxleyi Coccolith-Bearing Cells and Triggers a Physiological Response in Bald Cells.

    Labeeuw, Leen; Khey, Joleen; Bramucci, Anna R; Atwal, Harjot; de la Mata, A Paulina; Harynuk, James; Case, Rebecca J

    2016-01-01

    Indole-3-acetic acid (IAA) is an auxin produced by terrestrial plants which influences development through a variety of cellular mechanisms, such as altering cell orientation, organ development, fertility, and cell elongation. IAA is also produced by bacterial pathogens and symbionts of plants and algae, allowing them to manipulate growth and development of their host. They do so by either producing excess exogenous IAA or hijacking the IAA biosynthesis pathway of their host. The endogenous production of IAA by algae remains contentious. Using Emiliania huxleyi, a globally abundant marine haptophyte, we investigated the presence and potential role of IAA in algae. Homologs of genes involved in several tryptophan-dependent IAA biosynthesis pathways were identified in E. huxleyi. This suggests that this haptophyte can synthesize IAA using various precursors derived from tryptophan. Addition of L-tryptophan to E. huxleyi stimulated IAA production, which could be detected using Salkowski's reagent and GC × GC-TOFMS in the C cell type (coccolith bearing), but not in the N cell type (bald). Various concentrations of IAA were exogenously added to these two cell types to identify a physiological response in E. huxleyi. The N cell type, which did not produce IAA, was more sensitive to it, showing an increased variation in cell size, membrane permeability, and a corresponding increase in the photosynthetic potential quantum yield of Photosystem II (PSII). A roseobacter (bacteria commonly associated with E. huxleyi) Ruegeria sp. R11, previously shown to produce IAA, was co-cultured with E. huxleyi C and N cells. IAA could not be detected from these co-cultures, and even when stimulated by addition of L-tryptophan, they produced less IAA than axenic C type culture similarly induced. This suggests that IAA plays a novel role signaling between different E. huxleyi cell types, rather than between a bacteria and its algal host.

  15. The Cell Wall-Associated Proteins in the Dimorphic Pathogenic Species of Paracoccidioides.

    Puccia, Rosana; Vallejo, Milene C; Longo, Larissa V G

    2017-01-01

    Paracoccidioides brasiliensis and P. lutzii cause human paracoccidioidomycosis (PCM). They are dimorphic ascomycetes that grow as filaments at mild temperatures up to 28oC and as multibudding pathogenic yeast cells at 37oC. Components of the fungal cell wall have an important role in the interaction with the host because they compose the cell outermost layer. The Paracoccidioides cell wall is composed mainly of polysaccharides, but it also contains proportionally smaller rates of proteins, lipids, and melanin. The polysaccharide cell wall composition and structure of Paracoccidioides yeast cells, filamentous and transition phases were studied in detail in the past. Other cell wall components have been better analyzed in the last decades. The present work gives to the readers a detailed updated view of cell wall-associated proteins. Proteins that have been localized at the cell wall compartment using antibodies are individually addressed. We also make an overview about PCM, the Paracoccidioides cell wall structure, secretion mechanisms, and fungal extracellular vesicles. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  16. Programmed Cell Death and Postharvest Deterioration of Horticultural Produce

    Woltering, E.J.; Iakimova, E.T.

    2010-01-01

    Programmed cell death (PCD) is a process where cells or tissues are broken down in an orderly and predictable manner, whereby nutrients are re-used by other cells, tissues or plant parts. The process of (petal) senescence shows many similarities to autophagic PCD in animal cells including a massive

  17. Assessing the Groundwater Quality at a Saudi Arabian Agricultural Site and the Occurrence of Opportunistic Pathogens on Irrigated Food Produce

    Alsalah, Dhafer

    2015-10-05

    This study examines the groundwater quality in wells situated near agricultural fields in Saudi Arabia. Fruits (e.g., tomato and green pepper) irrigated with groundwater were also assessed for the occurrence of opportunistic pathogens to determine if food safety was compromised by the groundwater. The amount of total nitrogen in most of the groundwater samples exceeded the 15 mg/L permissible limit for agricultural irrigation. Fecal coliforms in densities > 12 MPN/100 mL were detected in three of the groundwater wells that were in close proximity to a chicken farm. These findings, coupled with qPCR-based fecal source tracking, show that groundwater in wells D and E, which were nearest to the chicken farm, had compromised quality. Anthropogenic contamination resulted in a shift in the predominant bacterial phyla within the groundwater microbial communities. For example, there was an elevated presence of Proteobacteria and Cyanobacteria in wells D and E but a lower overall microbial richness in the groundwater perturbed by anthropogenic contamination. In the remaining wells, the genus Acinetobacter was detected at high relative abundance ranging from 1.5% to 48% of the total groundwater microbial community. However, culture-based analysis did not recover any antibiotic-resistant bacteria or opportunistic pathogens from these groundwater samples. In contrast, opportunistic pathogenic Enterococcus faecalis and Pseudomonas aeruginosa were isolated from the fruits irrigated with the groundwater from wells B and F. Although the groundwater was compromised, quantitative microbial risk assessment suggests that the annual risk incurred from accidental consumption of E. faecalis on these fruits was within the acceptable limit of 10−4. However, the annual risk arising from P. aeruginosa was 9.55 × 10−4, slightly above the acceptable limit. Our findings highlight that the groundwater quality at this agricultural site in western Saudi Arabia is not pristine and that better

  18. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae [Department of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Uhm, Sang Jun [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of); Lee, Hoon Taek, E-mail: htl3675@konkuk.ac.kr [Department of Animal Biotechnology, Bio-Organ Research Center, Konkuk University, Seoul 143-701 (Korea, Republic of)

    2010-07-09

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  19. Human pluripotent stem cell-derived erythropoietin-producing cells ameliorate renal anemia in mice.

    Hitomi, Hirofumi; Kasahara, Tomoko; Katagiri, Naoko; Hoshina, Azusa; Mae, Shin-Ichi; Kotaka, Maki; Toyohara, Takafumi; Rahman, Asadur; Nakano, Daisuke; Niwa, Akira; Saito, Megumu K; Nakahata, Tatsutoshi; Nishiyama, Akira; Osafune, Kenji

    2017-09-27

    The production of erythropoietin (EPO) by the kidneys, a principal hormone for the hematopoietic system, is reduced in patients with chronic kidney disease (CKD), eventually resulting in severe anemia. Although recombinant human EPO treatment improves anemia in patients with CKD, returning to full red blood cell production without fluctuations does not always occur. We established a method to generate EPO-producing cells from human induced pluripotent stem cells (hiPSCs) by modifying previously reported hepatic differentiation protocols. These cells showed increased EPO expression and secretion in response to low oxygen conditions, prolyl hydroxylase domain-containing enzyme inhibitors, and insulin-like growth factor 1. The EPO protein secreted from hiPSC-derived EPO-producing (hiPSC-EPO) cells induced the erythropoietic differentiation of human umbilical cord blood progenitor cells in vitro. Furthermore, transplantation of hiPSC-EPO cells into mice with CKD induced by adenine treatment improved renal anemia. Thus, hiPSC-EPO cells may be a useful tool for clarifying the mechanisms of EPO production and may be useful as a therapeutic strategy for treating renal anemia. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. Generation of insulin-producing cells from gnotobiotic porcine skin-derived stem cells

    Yang, Ji Hoon; Lee, Sung Ho; Heo, Young Tae; Uhm, Sang Jun; Lee, Hoon Taek

    2010-01-01

    A major problem in the treatment of type 1 diabetes mellitus is the limited availability of alternative sources of insulin-producing cells for islet transplantation. In this study, we investigated the effect of bone morphogenetic protein 4 (BMP-4) treatments of gnotobiotic porcine skin-derived stem cells (gSDSCs) on their reprogramming and subsequent differentiation into insulin-producing cells (IPCs). We isolated SDSCs from the ear skin of a gnotobiotic pig. During the proliferation period, the cells expressed stem-cell markers Oct-4, Sox-2, and CD90; nestin expression also increased significantly. The cells could differentiate into IPCs after treatments with activin-A, glucagon-like peptide-1 (GLP-1), and nicotinamide. After 15 days in the differentiation medium, controlled gSDSCs began expressing endocrine progenitor genes and proteins (Ngn3, Neuro-D, PDX-1, NKX2.2, NKX6.1, and insulin). The IPCs showed increased insulin synthesis after glucose stimulation. The results indicate that stem cells derived from the skin of gnotobiotic pigs can differentiate into IPCs under the appropriate conditions in vitro. Our three-stage induction protocol could be applied without genetic modification to source IPCs from stem cells in the skin of patients with diabetes for autologous transplantation.

  1. Human Liver Cells Expressing Albumin and Mesenchymal Characteristics Give Rise to Insulin-Producing Cells

    Irit Meivar-Levy

    2011-01-01

    Full Text Available Activation of the pancreatic lineage in the liver has been suggested as a potential autologous cell replacement therapy for diabetic patients. Transcription factors-induced liver-to-pancreas reprogramming has been demonstrated in numerous species both in vivo and in vitro. However, human-derived liver cells capable of acquiring the alternate pancreatic repertoire have never been characterized. It is yet unknown whether hepatic-like stem cells or rather adult liver cells give rise to insulin-producing cells. Using an in vitro experimental system, we demonstrate that proliferating adherent human liver cells acquire mesenchymal-like characteristics and a considerable level of cellular plasticity. However, using a lineage-tracing approach, we demonstrate that insulin-producing cells are primarily generated in cells enriched for adult hepatic markers that coexpress both albumin and mesenchymal markers. Taken together, our data suggest that adult human hepatic tissue retains a substantial level of developmental plasticity, which could be exploited in regenerative medicine approaches.

  2. Adaptive response to starvation in the fish pathogen Flavobacterium columnare: cell viability and ultrastructural changes

    Arias Covadonga R

    2012-11-01

    Full Text Available Abstract Background The ecology of columnaris disease, caused by Flavobacterium columnare, is poorly understood despite the economic losses that this disease inflicts on aquaculture farms worldwide. Currently, the natural reservoir for this pathogen is unknown but limited data have shown its ability to survive in water for extended periods of time. The objective of this study was to describe the ultrastructural changes that F. columnare cells undergo under starvation conditions. Four genetically distinct strains of this pathogen were monitored for 14 days in media without nutrients. Culturability and cell viability was assessed throughout the study. In addition, cell morphology and ultrastructure was analyzed using light microscopy, scanning electron microscopy, and transmission electron microscopy. Revival of starved cells under different nutrient conditions and the virulence potential of the starved cells were also investigated. Results Starvation induced unique and consistent morphological changes in all strains studied. Cells maintained their length and did not transition into a shortened, coccus shape as observed in many other Gram negative bacteria. Flavobacterium columnare cells modified their shape by morphing into coiled forms that comprised more than 80% of all the cells after 2 weeks of starvation. Coiled cells remained culturable as determined by using a dilution to extinction strategy. Statistically significant differences in cell viability were found between strains although all were able to survive in absence of nutrients for at least 14 days. In later stages of starvation, an extracellular matrix was observed covering the coiled cells. A difference in growth curves between fresh and starved cultures was evident when cultures were 3-months old but not when cultures were starved for only 1 month. Revival of starved cultures under different nutrients revealed that cells return back to their original elongated rod shape upon

  3. Relationship of blood and milk cell counts with mastitic pathogens in Murrah buffaloes

    C. Singh

    2010-02-01

    Full Text Available The present study was undertaken to see the effect of mastitic pathogens on the blood and milk counts of Murrah buffaloes. Milk and blood samples were collected from 9 mastitic Murrah buffaloes. The total leucocyte Counts (TLC and Differential leucocyte counts (DLC in blood were within normal range and there was a non-significant change in blood counts irrespective of different mastitic pathogens. Normal milk quarter samples had significantly (P<0.01 less Somatic cell counts (SCC. Lymphocytes were significantly higher in normal milk samples, whereas infected samples had a significant increase (P<0.01 in milk neutrophils. S. aureus infected buffaloes had maximum milk SCC, followed by E. coli and S. agalactiae. Influx of neutrophils in the buffalo mammary gland was maximum for S. agalactiae, followed by E.cli and S. aureus. The study indicated that level of mastitis had no affect on blood counts but it influenced the milk SCC of normal quarters.

  4. Scanning electron microscopy as a tool for the analysis of colony architecture produced by phenotypic switching of a human pathogenic yeast Candida tropicalis

    Furlaneto, M C; França, E J G; Moralez, A T P; Ferreira, L C S; Andrade, C G T J; Aragão, P H A

    2012-01-01

    Candida tropicalis has been identified as one of the most prevalent pathogenic yeast species of the Candida-non-albicans group. Phenotypic switching is a biological phenomenon related to the occurrence of spontaneous emergence of colonies with different morphologies that provides variability within colonizing populations in order to adapt to different environments. Currently, studies of the microstructure of switching variant colonies are not subject of extensive research. SEM analysis was used to verify the architecture of whole Candida colonies. The strain 49/07 exhibited a hemispherical shape character, while the strain 335/07 showed a volcano shape with mycelated-edge colony. The ring switch variant is characterized by a highly wrinkled centre and an irregular periphery. The rough phenotype exhibited a three-dimensional architecture and was characterized by the presence of deep central and peripheral depressions areas. The ultrastructural analysis also allowed the observation of the arrangement of individual cells within the colonies. The whole smooth colony consisted entirely of yeast cells. Differently, aerial filaments were found all around the colony periphery of the volcano shape colony. For this colony type the mycelated-edge consisted mainly of hyphae, although yeast cells are also seen. The ring and rough colonies phenotypes comprised mainly yeast cells with the presence of extracellular material connecting neighbouring cells. This study has shown that SEM can be used effectively to examine the microarchitecture of colonies morphotypes of the yeast C. tropicalis and further our understanding of switching event in this pathogen.

  5. The varieties of immunological experience: of pathogens, stress, and dendritic cells.

    Pulendran, Bali

    2015-01-01

    In the 40 years since their discovery, dendritic cells (DCs) have been recognized as central players in immune regulation. DCs sense microbial stimuli through pathogen-recognition receptors (PRRs) and decode, integrate, and present information derived from such stimuli to T cells, thus stimulating immune responses. DCs can also regulate the quality of immune responses. Several functionally specialized subsets of DCs exist, but DCs also display functional plasticity in response to diverse stimuli. In addition to sensing pathogens via PRRs, emerging evidence suggests that DCs can also sense stress signals, such as amino acid starvation, through ancient stress and nutrient sensing pathways, to stimulate adaptive immunity. Here, I discuss these exciting advances in the context of a historic perspective on the discovery of DCs and their role in immune regulation. I conclude with a discussion of emerging areas in DC biology in the systems immunology era and suggest that the impact of DCs on immunity can be usefully contextualized in a hierarchy-of-organization model in which DCs, their receptors and signaling networks, cell-cell interactions, tissue microenvironment, and the host macroenvironment represent different levels of the hierarchy. Immunity or tolerance can then be represented as a complex function of each of these hierarchies.

  6. Pathogen inactivation of Dengue virus in red blood cells using amustaline and glutathione.

    Aubry, Maite; Laughhunn, Andrew; Santa Maria, Felicia; Lanteri, Marion C; Stassinopoulos, Adonis; Musso, Didier

    2017-12-01

    Dengue virus (DENV) is an arbovirus primarily transmitted through mosquito bite; however, DENV transfusion-transmitted infections (TTIs) have been reported and asymptomatic DENV RNA-positive blood donors have been identified in endemic countries. DENV is considered a high-risk pathogen for blood safety. One of the mitigation strategies to prevent arbovirus TTIs is pathogen inactivation. In this study we demonstrate that the amustaline and glutathione (S-303/GSH) treatment previously found effective against Zika virus in red blood cells (RBCs) is also effective in inactivating DENV. Red blood cells were spiked with high levels of DENV. Viral RNA loads and infectious titers were measured in the untreated control and before and after pathogen inactivation treatment of RBC samples. DENV infectivity was also assessed over five successive cell culture passages to detect any potential residual replicative virus. The mean ± SD DENV titer in RBCs before inactivation was 6.61 ± 0.19 log 50% tissue culture infectious dose (TCID 50 )/mL and the mean viral RNA load was 8.42 log genome equivalents/mL. No replicative DENV was detected either immediately after completion of treatment using S-303/GSH or after cell culture passages. Treatment using S-303/GSH inactivated high levels of DENV in RBCs to the limit of detection. In combination with previous studies showing the effective inactivation of DENV in plasma and platelets using the licensed amotosalen/UVA system, this study demonstrates that high levels of DENV can be inactivated in all blood components. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  7. Generation of high-yield insulin producing cells from human bone marrow mesenchymal stem cells.

    Jafarian, Arefeh; Taghikhani, Mohammad; Abroun, Saeid; Pourpak, Zahra; Allahverdi, Amir; Soleimani, Masoud

    2014-07-01

    Allogenic islet transplantation is a most efficient approach for treatment of diabetes mellitus. However, the scarcity of islets and long term need for an immunosuppressant limits its application. Recently, cell replacement therapies that generate of unlimited sources of β cells have been developed to overcome these limitations. In this study we have described a stage specific differentiation protocol for the generation of insulin producing islet-like clusters from human bone marrow mesenchymal stem cells (hBM-MSCs). This specific stepwise protocol induced differentiation of hMSCs into definitive endoderm, pancreatic endoderm and pancreatic endocrine cells that expressed of sox17, foxa2, pdx1, ngn3, nkx2.2, insulin, glucagon, somatostatin, pancreatic polypeptide, and glut2 transcripts respectively. In addition, immunocytochemical analysis confirmed protein expression of the above mentioned genes. Western blot analysis discriminated insulin from proinsulin in the final differentiated cells. In derived insulin producing cells (IPCs), secreted insulin and C-peptide was in a glucose dependent manner. We have developed a protocol that generates effective high-yield human IPCs from hBM-MSCs in vitro. These finding suggest that functional IPCs generated by this procedure can be used as a cell-based approach for insulin dependent diabetes mellitus.

  8. Imbalance between IL-17A-Producing Cells and Regulatory T Cells during Ischemic Stroke

    Yuehua Hu

    2014-01-01

    Full Text Available Immune responses and inflammation are key elements in the pathogenesis of ischemic stroke (IS. Although the involvement of IL-17A in IS has been demonstrated using animal models, the involvement of IL-17A and IL-17-secreting T cell subsets in IS patients has not been verified, and whether the balance of Treg/IL-17-secreting T cells is altered in IS patients remains unknown. In the present study, we demonstrated that the proportion of peripheral Tregs and the levels of IL-10 and TGF-β were reduced in patients with IS compared with controls using flow cytometry (FCM, real-time PCR, and ELISA assays. However, the proportions of Th17 and γδ T cells, the primary IL-17A-secreting cells, increased dramatically, and these effects were accompanied by increases in the levels of IL-17A, IL-23, IL-6, and IL-1β in IS patients. These studies suggest that the increase in IL-17A-producing cells and decrease in Treg cells might contribute to the pathogenesis of IS. Manipulating the balance between Tregs and IL-17A-producing cells might be helpful for the treatment of IS.

  9. Challenges and Strategies for Proteome Analysis of the Interaction of Human Pathogenic Fungi with Host Immune Cells.

    Krüger, Thomas; Luo, Ting; Schmidt, Hella; Shopova, Iordana; Kniemeyer, Olaf

    2015-12-14

    Opportunistic human pathogenic fungi including the saprotrophic mold Aspergillus fumigatus and the human commensal Candida albicans can cause severe fungal infections in immunocompromised or critically ill patients. The first line of defense against opportunistic fungal pathogens is the innate immune system. Phagocytes such as macrophages, neutrophils and dendritic cells are an important pillar of the innate immune response and have evolved versatile defense strategies against microbial pathogens. On the other hand, human-pathogenic fungi have sophisticated virulence strategies to counteract the innate immune defense. In this context, proteomic approaches can provide deeper insights into the molecular mechanisms of the interaction of host immune cells with fungal pathogens. This is crucial for the identification of both diagnostic biomarkers for fungal infections and therapeutic targets. Studying host-fungal interactions at the protein level is a challenging endeavor, yet there are few studies that have been undertaken. This review draws attention to proteomic techniques and their application to fungal pathogens and to challenges, difficulties, and limitations that may arise in the course of simultaneous dual proteome analysis of host immune cells interacting with diverse morphotypes of fungal pathogens. On this basis, we discuss strategies to overcome these multifaceted experimental and analytical challenges including the viability of immune cells during co-cultivation, the increased and heterogeneous protein complexity of the host proteome dynamically interacting with the fungal proteome, and the demands on normalization strategies in terms of relative quantitative proteome analysis.

  10. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase

    Nudelman Irina

    2010-10-01

    Full Text Available Abstract Background Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. Description We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to

  11. Signaling network of dendritic cells in response to pathogens: a community-input supported knowledgebase.

    Patil, Sonali; Pincas, Hanna; Seto, Jeremy; Nudelman, German; Nudelman, Irina; Sealfon, Stuart C

    2010-10-07

    Dendritic cells are antigen-presenting cells that play an essential role in linking the innate and adaptive immune systems. Much research has focused on the signaling pathways triggered upon infection of dendritic cells by various pathogens. The high level of activity in the field makes it desirable to have a pathway-based resource to access the information in the literature. Current pathway diagrams lack either comprehensiveness, or an open-access editorial interface. Hence, there is a need for a dependable, expertly curated knowledgebase that integrates this information into a map of signaling networks. We have built a detailed diagram of the dendritic cell signaling network, with the goal of providing researchers with a valuable resource and a facile method for community input. Network construction has relied on comprehensive review of the literature and regular updates. The diagram includes detailed depictions of pathways activated downstream of different pathogen recognition receptors such as Toll-like receptors, retinoic acid-inducible gene-I-like receptors, C-type lectin receptors and nucleotide-binding oligomerization domain-like receptors. Initially assembled using CellDesigner software, it provides an annotated graphical representation of interactions stored in Systems Biology Mark-up Language. The network, which comprises 249 nodes and 213 edges, has been web-published through the Biological Pathway Publisher software suite. Nodes are annotated with PubMed references and gene-related information, and linked to a public wiki, providing a discussion forum for updates and corrections. To gain more insight into regulatory patterns of dendritic cell signaling, we analyzed the network using graph-theory methods: bifan, feedforward and multi-input convergence motifs were enriched. This emphasis on activating control mechanisms is consonant with a network that subserves persistent and coordinated responses to pathogen detection. This map represents a navigable

  12. Suppression of immune-mediated liver injury after vaccination with attenuated pathogenic cells.

    Mei, Yunhua; Wang, Ying; Xu, Lingyun

    2007-05-15

    Cell vaccination via immunization with attenuated pathogenic cells is an effective preventive method that has been successfully applied in several animal models of inflammatory or autoimmune diseases. Concanavalin A (Con A)-induced hepatitis (CIH) is a commonly used experimental model to study immune-mediated liver injury. Multiple cell types including T lymphocytes, macrophages and neutrophils have been found to be involved in the pathogenesis of CIH. In this study, we used attenuated spleen lymphocytes or peripheral blood lymphocytes as vaccines to investigate whether they could induce protective immune responses to prevent mice from developing CIH. We found that mice receiving such vaccination before CIH induction developed much milder diseases, exhibited a lower level of alanine aminotransferase (ALT) released into their plasma and had less inflammatory lesions in their livers. Such CIH-suppression is dose- and frequency-dependent. The suppressive effect was associated with inhibition of several major inflammatory mediators, pro-inflammatory cytokines and chemokines.

  13. Pathogen reduction by ultraviolet C light effectively inactivates human white blood cells in platelet products.

    Pohler, Petra; Müller, Meike; Winkler, Carla; Schaudien, Dirk; Sewald, Katherina; Müller, Thomas H; Seltsam, Axel

    2015-02-01

    Residual white blood cells (WBCs) in cellular blood components induce a variety of adverse immune events, including nonhemolytic febrile transfusion reactions, alloimmunization to HLA antigens, and transfusion-associated graft-versus-host disease (TA-GVHD). Pathogen reduction (PR) methods such as the ultraviolet C (UVC) light-based THERAFLEX UV-Platelets system were developed to reduce the risk of transfusion-transmitted infection. As UVC light targets nucleic acids, it interferes with the replication of both pathogens and WBCs. This preclinical study aimed to evaluate the ability of UVC light to inactivate contaminating WBCs in platelet concentrates (PCs). The in vitro and in vivo function of WBCs from UVC-treated PCs was compared to that of WBCs from gamma-irradiated and untreated PCs by measuring cell viability, proliferation, cytokine secretion, antigen presentation in vitro, and xenogeneic GVHD responses in a humanized mouse model. UVC light was at least as effective as gamma irradiation in preventing GVHD in the mouse model. It was more effective in suppressing T-cell proliferation (>5-log reduction in the limiting dilution assay), cytokine secretion, and antigen presentation than gamma irradiation. The THERAFLEX UV-Platelets (MacoPharma) PR system can substitute gamma irradiation for TA-GVHD prophylaxis in platelet (PLT) transfusion. Moreover, UVC treatment achieves suppression of antigen presentation and inhibition of cytokine accumulation during storage of PCs, which has potential benefits for transfusion recipients. © 2014 AABB.

  14. Characterisation of insulin-producing cells differentiated from tonsil derived mesenchymal stem cells.

    Kim, So-Yeon; Kim, Ye-Ryung; Park, Woo-Jae; Kim, Han Su; Jung, Sung-Chul; Woo, So-Youn; Jo, Inho; Ryu, Kyung-Ha; Park, Joo-Won

    2015-01-01

    Tonsil-derived (T-) mesenchymal stem cells (MSCs) display mutilineage differentiation potential and self-renewal capacity and have potential as a banking source. Diabetes mellitus is a prevalent disease in modern society, and the transplantation of pancreatic progenitor cells or various stem cell-derived insulin-secreting cells has been suggested as a novel therapy for diabetes. The potential of T-MSCs to trans-differentiate into pancreatic progenitor cells or insulin-secreting cells has not yet been investigated. We examined the potential of human T-MSCs to trans-differentiate into pancreatic islet cells using two different methods based on β-mercaptoethanol and insulin-transferin-selenium, respectively. First, we compared the efficacy of the two methods for inducing differentiation into insulin-producing cells. We demonstrated that the insulin-transferin-selenium method is more efficient for inducing differentiation into insulin-secreting cells regardless of the source of the MSCs. Second, we compared the differentiation potential of two different MSC types: T-MSCs and adipose-derived MSCs (A-MSCs). T-MSCs had a differentiation capacity similar to that of A-MSCs and were capable of secreting insulin in response to glucose concentration. Islet-like clusters differentiated from T-MSCs had lower synaptotagmin-3, -5, -7, and -8 levels, and consequently lower secreted insulin levels than cells differentiated from A-MSCs. These results imply that T-MSCs can differentiate into functional pancreatic islet-like cells and could provide a novel, alternative cell therapy for diabetes mellitus. Copyright © 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  15. IL-9-Producing Mast Cell Precursors and Food Allergy

    2016-10-01

    that Stat6-/- BM progenitors in sensitized wild type recipients that were competent in GFP- CD4+ST2+TH2 and ILC2s ( innate lymphoid cells ) generation, and...report demonstrated that type 2 innate lymphoid cells (ILC2s) lack cell lineage markers and have the potential to pro- duce IL-9 (Wilhelm et al., 2011...Fujii, H., and Koyasu, S. (2010). Innate production of T(H)2 cytokines by adipose tissue-associated c-Kit(+)Sca-1(+) lymphoid cells . Nature 463, 540–544

  16. Mouse endometrial stromal cells produce basement-membrane components

    Wewer, U M; Damjanov, A; Weiss, J

    1986-01-01

    During mouse pregnancy, uterine stromal cells transform into morphologically distinct decidual cells under the influence of the implanting embryo and a proper hormonal environment. Mechanical stimulation of hormonally primed uterine stromal cells leads to the same morphologic alterations. The dec......During mouse pregnancy, uterine stromal cells transform into morphologically distinct decidual cells under the influence of the implanting embryo and a proper hormonal environment. Mechanical stimulation of hormonally primed uterine stromal cells leads to the same morphologic alterations....... Mouse decidual cells isolated from 6- to 7-day pregnant uteri explanted in vitro continue to synthesize basement-membrane-like extracellular matrix. Using immunohistochemistry and metabolic labeling followed by immunoprecipitation, SDS-PAGE, and fluorography, it was shown that the decidual cells...... to undergo pseudodecidualization. We thus showed that stromal cells from pregnant and nonpregnant mouse uteri synthesize significant amounts of basement-membrane components in vitro, and hence could serve as a good model for the study of normal basement-membrane components....

  17. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  18. Cloning, characterization and anion inhibition study of a β-class carbonic anhydrase from the caries producing pathogen Streptococcus mutans.

    Dedeoglu, Nurcan; De Luca, Viviana; Isik, Semra; Yildirim, Hatice; Kockar, Feray; Capasso, Clemente; Supuran, Claudiu T

    2015-07-01

    The oral pathogenic bacterium involved in human dental caries formation Streptococcus mutans, encodes for two carbonic anhydrase (CA, EC 4.2.1.1) one belonging to the α- and the other one to the β-class. This last enzyme (SmuCA) has been cloned, characterized and investigated for its inhibition profile with a major class of CA inhibitors, the inorganic anions. Here we show that SmuCA has a good catalytic activity for the CO2 hydration reaction, with kcat 4.2×10(5)s(-1) and kcat/Km of 5.8×10(7)M(-1)×s(-1), being inhibited by cyanate, carbonate, stannate, divannadate and diethyldithiocarbamate in the submillimolar range (KIs of 0.30-0.64mM) and more efficiently by sulfamide, sulfamate, phenylboronic acid and phenylarsonic acid (KIs of 15-46μM). The anion inhibition profile of the S. mutans enzyme is very different from other α- and β-CAs investigated earlier. Identification of effective inhibitors of this new enzyme may lead to pharmacological tools useful for understanding the role of S. mutans CAs in dental caries formation, and eventually the development of pharmacological agents with a new mechanism of antibacterial action. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Pathogen-specific effects of quantitative trait loci affecting clinical mastitis and somatic cell count in danish holstein cattle

    Sørensen, Lars Peter; Guldbrandtsen, Bernt; Thomasen, J.R.

    2008-01-01

    The aim of this study was to investigate whether quantitative trait loci (QTL) affecting the risk of clinical mastitis (CM) and QTL affecting somatic cell score (SCS) exhibit pathogen-specific effects on the incidence of mastitis. Bacteriological data on mastitis pathogens were used to investigate...... pathogen specificity of QTL affecting treatments of mastitis in first parity (CM1), second parity (CM2), and third parity (CM3), and QTL affecting SCS. The 5 most common mastitis pathogens in the Danish dairy population were analyzed: Streptococcus dysgalactiae, Escherichia coli, coagulase...... against coagulase-negative staphylococci and Strep. uberis. Our results show that particular mastitis QTL are highly likely to exhibit pathogen-specificity. However, the results should be interpreted carefully because the results are sensitive to the sampling method and method of analysis. Field data were...

  20. Pathogenicity of fumonisin-producing and nonproducing strains of Aspergillus species in section Nigri to maize ears and seedlings

    Species of Aspergillus section Nigri are commonly associated with maize kernels, and some strains can produce fumonisin mycotoxins. However, there is little information about the extent to which these fungi contribute to fumonisin contamination in grain, the damage they cause to maize ears, or their...

  1. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage.

    Wang, Kai; Jin, Xiao-Lu; Shen, Xiao-Ge; Sun, Li-Ping; Wu, Li-Ming; Wei, Jiang-Qin; Marcucci, Maria Cristina; Hu, Fu-Liang; Liu, Jian-Xin

    2016-01-01

    Chinese propolis (CP), an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T), we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS), heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA) did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

  2. Effects of Chinese Propolis in Protecting Bovine Mammary Epithelial Cells against Mastitis Pathogens-Induced Cell Damage

    Kai Wang

    2016-01-01

    Full Text Available Chinese propolis (CP, an important hive product, can alleviate inflammatory responses. However, little is known regarding the potential of propolis treatment for mastitis control. To investigate the anti-inflammatory effects of CP on bovine mammary epithelial cells (MAC-T, we used a range of pathogens to induce cellular inflammatory damage. Cell viability was determined and expressions of inflammatory/antioxidant genes were measured. Using a cell-based reporter assay system, we evaluated CP and its primary constituents on the NF-κB and Nrf2-ARE transcription activation. MAC-T cells treated with bacterial endotoxin (lipopolysaccharide, LPS, heat-inactivated Escherichia coli, and Staphylococcus aureus exhibited significant decreases in cell viability while TNF-α and lipoteichoic acid (LTA did not. Pretreatment with CP prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. There were also corresponding decreases in expressions of proinflammatory IL-6 and TNF-α mRNA. Compared with the mastitis challenged cells, enhanced expressions of antioxidant genes HO-1, Txnrd-1, and GCLM were observed in CP-treated cells. CP and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin had strong inhibitive effects against NF-κB activation and increased the transcriptional activity of Nrf2-ARE. These findings suggest that propolis may be valuable in the control of bovine mastitis.

  3. Structural characterization of proteoglycans produced by testicular peritubular cells and Sertoli cells

    Skinner, M.K.; Fritz, I.B.

    1985-01-01

    The structural characteristics of proteoglycans produced by seminiferous peritubular cells and by Sertoli cells are defined. Peritubular cells secrete two proteoglycans designated PC I and PC II. PC I is a high molecular mass protein containing chondroitin glycosaminoglycan (GAG) chains (maximum 70 kDa). PC II has a protein core of 45 kDa and also contains chondroitin GAG chains (maximum 70 kDa). Preliminary results imply that PC II may be a degraded or processed form of PC I. Sertoli cells secrete two different proteoglycans, designated SC I and SC II. SC I is a large protein containing both chondroitin (maximum 62 kDa) and heparin (maximum 15 kDa) GAG chains. Results obtained suggest that this novel proteoglycan contains both chondroitin and heparin GAG chains bound to the same core protein. SC II has a 50-kDa protein core and contains chondroitin (maximum 25 kDa) GAG chains. A proteoglycan obtained from extracts of Sertoli cells is described which contains heparin (maximum 48 kDa) GAG chains. In addition, Sertoli cells secrete a sulfoprotein, SC III, which is not a proteoglycan. The stimulation by follicle-stimulating hormone of the incorporation of [ 35 S]SO 2 ) -4 ) into moieties secreted by Sertoli cells is shown to represent an increased production or sulfation of SC III, and not an increased production or sulfation of proteoglycans. Results are discussed in relation to the possible functions of proteoglycans in the seminiferous tubule

  4. The plant cell nucleus: a true arena for the fight between plants and pathogens.

    Deslandes, Laurent; Rivas, Susana

    2011-01-01

    Communication between the cytoplasm and the nucleus is a fundamental feature shared by both plant and animal cells. Cellular factors involved in the transport of macromolecules through the nuclear envelope, including nucleoporins, importins and Ran-GTP related components, are conserved among a variety of eukaryotic systems. Interestingly, mutations in these nuclear components compromise resistance signalling, illustrating the importance of nucleocytoplasmic trafficking in plant innate immunity. Indeed, spatial restriction of defence regulators by the nuclear envelope and stimulus-induced nuclear translocation constitute an important level of defence-associated gene regulation in plants. A significant number of effectors from different microbial pathogens are targeted to the plant cell nucleus. In addition, key host factors, including resistance proteins, immunity components, transcription factors and transcriptional regulators shuttle between the cytoplasm and the nucleus, and their level of nuclear accumulation determines the output of the defence response, further confirming the crucial role played by the nucleus during the interaction between plants and pathogens. Here, we discuss recent findings that situate the nucleus at the frontline of the mutual recognition between plants and invading microbes.

  5. Immune Recognition of Latency-insitigating Pathogens by Human Dendritic Cells

    Søndergaard, Jonas Nørskov

    for society. Consequently there is a pressing need to search for new treatment strategies. Nowadays it is known that HIV-1 and Mtb have acquired the ability to escape the removal from the body by exploiting the immune system for their own benefits. Dendritic cells (DCs) determine the way the immune response......Latent infections with the human pathogenic microorganisms Mycobacterium tuberculosis (Mtb) and the human immunodeficiency virus (HIV) are creating some of the most devastating pandemics to date, with great impact on the infected people’s lives, their expected lifetime, as well as general costs...... unfolds by signaling other immune cells how to respond. An early deregulation of the DCs may therefore propagate into detrimental effects in later stages of the immune response, and may permit HIV-1 and Mtb to become latent. Hence, understanding the way HIV-1 and Mtb interacts with DCs could lead to novel...

  6. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  7. Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

    Marinela Contreras

    2017-07-01

    Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

  8. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other

  9. Use of an Optical Trap for Study of Host-Pathogen Interactions for Dynamic Live Cell Imaging

    Tam, Jenny M.; Castro, Carlos E.; Heath, Robert J. W.; Mansour, Michael K.; Cardenas, Michael L.; Xavier, Ramnik J.; Lang, Matthew J.; Vyas, Jatin M.

    2011-01-01

    Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system1, 2; however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis3 have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous int...

  10. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  11. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  12. Differentiation, distribution and gammadelta T cell-driven regulation of IL-22-producing T cells in tuberculosis.

    Shuyu Yao

    2010-02-01

    Full Text Available Differentiation, distribution and immune regulation of human IL-22-producing T cells in infections remain unknown. Here, we demonstrated in a nonhuman primate model that M. tuberculosis infection resulted in apparent increases in numbers of T cells capable of producing IL-22 de novo without in vitro Ag stimulation, and drove distribution of these cells more dramatically in lungs than in blood and lymphoid tissues. Consistently, IL-22-producing T cells were visualized in situ in lung tuberculosis (TB granulomas by confocal microscopy and immunohistochemistry, indicating that mature IL-22-producing T cells were present in TB granuloma. Surprisingly, phosphoantigen HMBPP activation of Vgamma2Vdelta2 T cells down-regulated the capability of T cells to produce IL-22 de novo in lymphocytes from blood, lung/BAL fluid, spleen and lymph node. Up-regulation of IFNgamma-producing Vgamma2Vdelta2 T effector cells after HMBPP stimulation coincided with the down-regulated capacity of these T cells to produce IL-22 de novo. Importantly, anti-IFNgamma neutralizing Ab treatment reversed the HMBPP-mediated down-regulation effect on IL-22-producing T cells, suggesting that Vgamma2Vdelta2 T-cell-driven IFNgamma-networking function was the mechanism underlying the HMBPP-mediated down-regulation of the capability of T cells to produce IL-22. These novel findings raise the possibility to ultimately investigate the function of IL-22 producing T cells and to target Vgamma2Vdelta2 T cells for balancing potentially hyper-activating IL-22-producing T cells in severe TB.

  13. Porcine induced pluripotent stem cells produce chimeric offspring.

    West, Franklin D; Terlouw, Steve L; Kwon, Dae Jin; Mumaw, Jennifer L; Dhara, Sujoy K; Hasneen, Kowser; Dobrinsky, John R; Stice, Steven L

    2010-08-01

    Ethical and moral issues rule out the use of human induced pluripotent stem cells (iPSCs) in chimera studies that would determine the full extent of their reprogrammed state, instead relying on less rigorous assays such as teratoma formation and differentiated cell types. To date, only mouse iPSC lines are known to be truly pluripotent. However, initial mouse iPSC lines failed to form chimeric offspring, but did generate teratomas and differentiated embryoid bodies, and thus these specific iPSC lines were not completely reprogrammed or truly pluripotent. Therefore, there is a need to address whether the reprogramming factors and process used eventually to generate chimeric mice are universal and sufficient to generate reprogrammed iPSC that contribute to chimeric offspring in additional species. Here we show that porcine mesenchymal stem cells transduced with 6 human reprogramming factors (POU5F1, SOX2, NANOG, KLF4, LIN28, and C-MYC) injected into preimplantation-stage embryos contributed to multiple tissue types spanning all 3 germ layers in 8 of 10 fetuses. The chimerism rate was high, 85.3% or 29 of 34 live offspring were chimeras based on skin and tail biopsies harvested from 2- to 5-day-old pigs. The creation of pluripotent porcine iPSCs capable of generating chimeric offspring introduces numerous opportunities to study the facets significantly affecting cell therapies, genetic engineering, and other aspects of stem cell and developmental biology.

  14. Anaerobic Co-Culture of Mesenchymal Stem Cells and Anaerobic Pathogens - A New In Vitro Model System

    Kriebel, Katja; Biedermann, Anne; Kreikemeyer, Bernd; Lang, Hermann

    2013-01-01

    BACKGROUND: Human mesenchymal stem cells (hMSCs) are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIP...

  15. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  16. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  17. Living biointerfaces based on non-pathogenic bacteria support stem cell differentiation

    Hay, Jake J.; Rodrigo-Navarro, Aleixandre; Hassi, Karoliina; Moulisova, Vladimira; Dalby, Matthew J.; Salmeron-Sanchez, Manuel

    2016-02-01

    Lactococcus lactis, a non-pathogenic bacteria, has been genetically engineered to express the III7-10 fragment of human fibronectin as a membrane protein. The engineered L. lactis is able to develop biofilms on different surfaces (such as glass and synthetic polymers) and serves as a long-term substrate for mammalian cell culture, specifically human mesenchymal stem cells (hMSC). This system constitutes a living interface between biomaterials and stem cells. The engineered biofilms remain stable and viable for up to 28 days while the expressed fibronectin fragment induces hMSC adhesion. We have optimised conditions to allow long-term mammalian cell culture, and found that the biofilm is functionally equivalent to a fibronectin-coated surface in terms of osteoblastic differentiation using bone morphogenetic protein 2 (BMP-2) added to the medium. This living bacteria interface holds promise as a dynamic substrate for stem cell differentiation that can be further engineered to express other biochemical cues to control hMSC differentiation.

  18. Resistance to cereal rusts at the plant cell wall - what can we learn from other host-pathogen systems?

    Collins, N.C.; Niks, R.E.; Schulze-Lefert, P.

    2007-01-01

    The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of

  19. Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital

    J B Sarma

    2011-01-01

    Full Text Available Purpose: A study was carried out in an Indian teaching hospital in 2009 to detect the rate of surgical site infections (SSI and peripheral vascular access site infections. Materials and Methods: The study was a point-prevalence study involving over 300 patients. The presence of infection was determined according to the CDC criteria. Swabs were taken from the infected sites and identification and sensitivity were carried out using VITEK® 2 automated system. Characterisation of β-lactamase was carried out at ARRML, Colindale, London. Results: The rate of SSI was 15% for the clean and clean-contaminated categories while that for the dirty contaminated category was 85% (NNIS risk index 0. Cultures yielded definite or probable pathogens from 64% (9/14 of the patients with SSI. In 1/3 rd of the cultures, Staphylococcus aureus was grown and the rest had Enterobacteriaceae, either extended-spectrum β-lactamase (ESBL producers or Amp-C hyperproducers and, alarmingly, three isolates were positive for newly recognised New Delhi metallo-β-lactamase-1 (NDM-1. In medicine, 87% (n = 99 of the patients had a peripheral IV access device, 55% developed associated phlebitis/infection and, in seven, probable pathogens were isolated (Candida species and Escherichia coli producing ESBL and NDM-1, respectively, Staphylococcus aureus and Enterococcus faecium. All ESBL and metallo-β-lactamase producers were resistant to multiple classes of antimicrobials, the latter being sensitive only to colistin and tigecycline. The study also found that all post-operative patients were on antibiotics, 92% on IV [213 defined daily doses (DDD/100 post-op patients] limited mainly to the third-generation cephalosporins (26% and aminoglycosides (24% and imidazole derivatives (30%. In medicine, 83% (n = 82 were on IV antibiotics (123 DDD/100 bed-days, limited mainly to the third-generation cephalosporins (74%. Conclusion: Indiscriminate use of antibiotics is a major problem

  20. Cytokine-producing T cell subsets in human leishmaniasis

    Kemp, Kåre

    2000-01-01

    Leishmania specific Th1/Th2 cells have been identified in humans as well as in mice. There is a correlation between the clinical outcome of the infection and the cytokine response profile. Generally, the production of Th2 cytokines leads to severe infection, whereas the production of Th1 cytokine...

  1. Integrating Wind And Solar With Hydrogen Producing Fuel Cells

    Hemmes, K.

    2007-01-01

    The often proposed solution for the fluctuating wind energy supply is the conversion of the surplus of wind energy into hydrogen by means of electrolysis. In this paper a patented alternative is proposed consisting of the integration of wind turbines with internal reforming fuel-cells, capable of

  2. Transplants of cells engineered to produce GABA suppress spontaneous seizures

    Thompson, K. W.; Suchomelová, Lucie

    2004-01-01

    Roč. 45, č. 1 (2004), s. 4-12 ISSN 0013-9580 Grant - others:VA Greater Los Angeles Healthcare System Research Service(US) MREP Institutional research plan: CEZ:AV0Z5011922 Keywords : cell transplantation * epilepsy * seizures Subject RIV: FH - Neurology Impact factor: 3.329, year: 2004

  3. Cyanobacteria as Cell Factories to Produce Plant Secondary Metabolites

    Xue, Yong; He, Qingfang

    2015-01-01

    Cyanobacteria represent a promising platform for the production of plant secondary metabolites. Their capacity to express plant P450 proteins, which have essential functions in the biosynthesis of many plant secondary metabolites, makes cyanobacteria ideal for this purpose, and their photosynthetic capability allows cyanobacteria to grow with simple nutrient inputs. This review summarizes the advantages of using cyanobacteria to transgenically produce plant secondary metabolites. Some techniq...

  4. Probiotic Bifidobacterium breve induces IL-10-producing Tr1 cells in the colon.

    Seong Gyu Jeon

    Full Text Available Specific intestinal microbiota has been shown to induce Foxp3(+ regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103(+ dendritic cells (DCs mediated B. breve-induced development of IL-10-producing T cells. CD103(+ DCs from Il10(-/-, Tlr2(-/-, and Myd88(-/- mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103(+ DCs failed to induce IL-10 production from co-cultured Il27ra(-/- T cells. B. breve treatment of Tlr2(-/- mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103(+ DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4(+ T cells from wild-type mice, but not Il10(-/- mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells.

  5. Probiotic Bifidobacterium breve induces IL-10-producing Tr1 cells in the colon.

    Jeon, Seong Gyu; Kayama, Hisako; Ueda, Yoshiyasu; Takahashi, Takuya; Asahara, Takashi; Tsuji, Hirokazu; Tsuji, Noriko M; Kiyono, Hiroshi; Ma, Ji Su; Kusu, Takashi; Okumura, Ryu; Hara, Hiromitsu; Yoshida, Hiroki; Yamamoto, Masahiro; Nomoto, Koji; Takeda, Kiyoshi

    2012-01-01

    Specific intestinal microbiota has been shown to induce Foxp3(+) regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103(+) dendritic cells (DCs) mediated B. breve-induced development of IL-10-producing T cells. CD103(+) DCs from Il10(-/-), Tlr2(-/-), and Myd88(-/-) mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103(+) DCs failed to induce IL-10 production from co-cultured Il27ra(-/-) T cells. B. breve treatment of Tlr2(-/-) mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103(+) DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4(+) T cells from wild-type mice, but not Il10(-/-) mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells.

  6. Targeting of histamine producing cells by EGCG: a green dart against inflammation?

    Melgarejo, Esther; Medina, Miguel Angel; Sánchez-Jiménez, Francisca; Urdiales, José Luis

    2010-09-01

    The human body is made of some 250 different cell types. From them, only a small subset of cell types is able to produce histamine. They include some neurons, enterochromaffin-like cells, gastrin-containing cells, mast cells, basophils, and monocytes/macrophages, among others. In spite of the reduced number of these histamine-producing cell types, they are involved in very different physiological processes. Their deregulation is related with many highly prevalent, as well as emergent and rare diseases, mainly those described as inflammation-dependent pathologies, including mastocytosis, basophilic leukemia, gastric ulcer, Crohn disease, and other inflammatory bowel diseases. Furthermore, oncogenic transformation switches some non-histamine-producing cells to a histamine producing phenotype. This is the case of melanoma, small cell lung carcinoma, and several types of neuroendocrine tumors. The bioactive compound epigallocatechin-3-gallate (EGCG), a major component of green tea, has been shown to target histamine-producing cells producing great alterations in their behavior, with relevant effects on their proliferative potential, as well as their adhesion, migration, and invasion potentials. In fact, EGCG has been shown to have potent anti-inflammatory, anti-tumoral, and anti-angiogenic effects and to be a potent inhibitor of the histamine-producing enzyme, histidine decarboxylase. Herein, we review the many specific effects of EGCG on concrete molecular targets of histamine-producing cells and discuss the relevance of these data to support the potential therapeutic interest of this compound to treat inflammation-dependent diseases.

  7. Dissecting HIV Virulence: Heritability of Setpoint Viral Load, CD4+ T-Cell Decline, and Per-Parasite Pathogenicity.

    Bertels, Frederic; Marzel, Alex; Leventhal, Gabriel; Mitov, Venelin; Fellay, Jacques; Günthard, Huldrych F; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Battegay, Manuel; Rauch, Andri; Cavassini, Matthias; Calmy, Alexandra; Bernasconi, Enos; Schmid, Patrick; Scherrer, Alexandra U; Müller, Viktor; Bonhoeffer, Sebastian; Kouyos, Roger; Regoes, Roland R

    2018-01-01

    Pathogen strains may differ in virulence because they attain different loads in their hosts, or because they induce different disease-causing mechanisms independent of their load. In evolutionary ecology, the latter is referred to as "per-parasite pathogenicity". Using viral load and CD4+ T-cell measures from 2014 HIV-1 subtype B-infected individuals enrolled in the Swiss HIV Cohort Study, we investigated if virulence-measured as the rate of decline of CD4+ T cells-and per-parasite pathogenicity are heritable from donor to recipient. We estimated heritability by donor-recipient regressions applied to 196 previously identified transmission pairs, and by phylogenetic mixed models applied to a phylogenetic tree inferred from HIV pol sequences. Regressing the CD4+ T-cell declines and per-parasite pathogenicities of the transmission pairs did not yield heritability estimates significantly different from zero. With the phylogenetic mixed model, however, our best estimate for the heritability of the CD4+ T-cell decline is 17% (5-30%), and that of the per-parasite pathogenicity is 17% (4-29%). Further, we confirm that the set-point viral load is heritable, and estimate a heritability of 29% (12-46%). Interestingly, the pattern of evolution of all these traits differs significantly from neutrality, and is most consistent with stabilizing selection for the set-point viral load, and with directional selection for the CD4+ T-cell decline and the per-parasite pathogenicity. Our analysis shows that the viral genotype affects virulence mainly by modulating the per-parasite pathogenicity, while the indirect effect via the set-point viral load is minor. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Inflammasome and Fas-Mediated IL-1β Contributes to Th17/Th1 Cell Induction in Pathogenic Bacterial Infection In Vivo.

    Uchiyama, Ryosuke; Yonehara, Shin; Taniguchi, Shun'ichiro; Ishido, Satoshi; Ishii, Ken J; Tsutsui, Hiroko

    2017-08-01

    CD4 + Th cells play crucial roles in orchestrating immune responses against pathogenic microbes, after differentiating into effector subsets. Recent research has revealed the importance of IFN-γ and IL-17 double-producing CD4 + Th cells, termed Th17/Th1 cells, in the induction of autoimmune and inflammatory diseases. In addition, Th17/Th1 cells are involved in the regulation of infection caused by the intracellular bacterium Mycobacterium tuberculosis in humans. However, the precise mechanism of Th17/Th1 induction during pathogen infection is unclear. In this study, we showed that the inflammasome and Fas-dependent IL-1β induces Th17/Th1 cells in mice, in response to infection with the pathogenic intracellular bacterium Listeria monocytogenes In the spleens of infected wild-type mice, Th17/Th1 cells were induced, and expressed T-bet and Rorγt. In Pycard -/- mice, which lack the adaptor molecule of the inflammasome (apoptosis-associated speck-like protein containing a caspase recruitment domain), Th17/Th1 induction was abolished. In addition, the Fas-mediated IL-1β production was required for Th17/Th1 induction during bacterial infection: Th17/Th1 induction was abolished in Fas -/- mice, whereas supplementation with recombinant IL-1β restored Th17/Th1 induction via IL-1 receptor 1 (IL-1R1), and rescued the mortality of Fas -/- mice infected with Listeria IL-1R1, but not apoptosis-associated speck-like protein containing a caspase recruitment domain or Fas on T cells, was required for Th17/Th1 induction, indicating that IL-1β stimulates IL-1R1 on T cells for Th17/Th1 induction. These results indicate that IL-1β, produced by the inflammasome and Fas-dependent mechanisms, contributes cooperatively to the Th17/Th1 induction during bacterial infection. This study provides a deeper understanding of the molecular mechanisms underlying Th17/Th1 induction during pathogenic microbial infections in vivo. Copyright © 2017 by The American Association of Immunologists

  9. Differentiation of insulin-producing cells from human neural progenitor cells.

    Yuichi Hori

    2005-04-01

    Full Text Available BACKGROUND: Success in islet-transplantation-based therapies for type 1 diabetes, coupled with a worldwide shortage of transplant-ready islets, has motivated efforts to develop renewable sources of islet-replacement tissue. Islets and neurons share features, including common developmental programs, and in some species brain neurons are the principal source of systemic insulin. METHODS AND FINDINGS: Here we show that brain-derived human neural progenitor cells, exposed to a series of signals that regulate in vivo pancreatic islet development, form clusters of glucose-responsive insulin-producing cells (IPCs. During in vitro differentiation of neural progenitor cells with this novel method, genes encoding essential known in vivo regulators of pancreatic islet development were expressed. Following transplantation into immunocompromised mice, IPCs released insulin C-peptide upon glucose challenge, remained differentiated, and did not form detectable tumors. CONCLUSION: Production of IPCs solely through extracellular factor modulation in the absence of genetic manipulations may promote strategies to derive transplantable islet-replacement tissues from human neural progenitor cells and other types of multipotent human stem cells.

  10. From Human Mesenchymal Stem Cells to Insulin-Producing Cells: Comparison between Bone Marrow- and Adipose Tissue-Derived Cells.

    Gabr, Mahmoud M; Zakaria, Mahmoud M; Refaie, Ayman F; Abdel-Rahman, Engy A; Reda, Asmaa M; Ali, Sameh S; Khater, Sherry M; Ashamallah, Sylvia A; Ismail, Amani M; Ismail, Hossam El-Din A; El-Badri, Nagwa; Ghoneim, Mohamed A

    2017-01-01

    The aim of this study is to compare human bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose tissue-derived mesenchymal stem cells (AT-MSCs), for their differentiation potentials to form insulin-producing cells. BM-MSCs were obtained during elective orthotopic surgery and AT-MSCs from fatty aspirates during elective cosmetics procedures. Following their expansion, cells were characterized by phenotyping, trilineage differentiation ability, and basal gene expression of pluripotency genes and for their metabolic characteristics. Cells were differentiated according to a Trichostatin-A based protocol. The differentiated cells were evaluated by immunocytochemistry staining for insulin and c-peptide. In addition the expression of relevant pancreatic endocrine genes was determined. The release of insulin and c-peptide in response to a glucose challenge was also quantitated. There were some differences in basal gene expression and metabolic characteristics. After differentiation the proportion of the resulting insulin-producing cells (IPCs), was comparable among both cell sources. Again, there were no differences neither in the levels of gene expression nor in the amounts of insulin and c-peptide release as a function of glucose challenge. The properties, availability, and abundance of AT-MSCs render them well-suited for applications in regenerative medicine. Conclusion . BM-MSCs and AT-MSCs are comparable regarding their differential potential to form IPCs. The availability and properties of AT-MSCs render them well-suited for applications in regenerative medicine.

  11. From Human Mesenchymal Stem Cells to Insulin-Producing Cells: Comparison between Bone Marrow- and Adipose Tissue-Derived Cells

    Mahmoud M. Gabr

    2017-01-01

    Full Text Available The aim of this study is to compare human bone marrow-derived mesenchymal stem cells (BM-MSCs and adipose tissue-derived mesenchymal stem cells (AT-MSCs, for their differentiation potentials to form insulin-producing cells. BM-MSCs were obtained during elective orthotopic surgery and AT-MSCs from fatty aspirates during elective cosmetics procedures. Following their expansion, cells were characterized by phenotyping, trilineage differentiation ability, and basal gene expression of pluripotency genes and for their metabolic characteristics. Cells were differentiated according to a Trichostatin-A based protocol. The differentiated cells were evaluated by immunocytochemistry staining for insulin and c-peptide. In addition the expression of relevant pancreatic endocrine genes was determined. The release of insulin and c-peptide in response to a glucose challenge was also quantitated. There were some differences in basal gene expression and metabolic characteristics. After differentiation the proportion of the resulting insulin-producing cells (IPCs, was comparable among both cell sources. Again, there were no differences neither in the levels of gene expression nor in the amounts of insulin and c-peptide release as a function of glucose challenge. The properties, availability, and abundance of AT-MSCs render them well-suited for applications in regenerative medicine. Conclusion. BM-MSCs and AT-MSCs are comparable regarding their differential potential to form IPCs. The availability and properties of AT-MSCs render them well-suited for applications in regenerative medicine.

  12. Programmed death-1 receptor suppresses γ-IFN producing NKT cells in human tuberculosis.

    Singh, Amar; Dey, Aparajit Ballav; Mohan, Anant; Mitra, Dipendra Kumar

    2014-05-01

    IFN-γ biased Th1 effector immune response is crucial for containment of Mycobacterium tuberculosis infection. Various T cell subsets with regulatory function dictate the generation of Th1 like cells. NKT cells are a specialized T cell subset known to be activated early in immune response and control T cell response via release of immunoregulatory cytokines like IFN-γ, IL-4 and IL-10. M. tuberculosis, with abundance of its cell wall lipids may potently activate NKT cells resulting in cytokine production and PD-1 expression. In this study, among 49 treatment naive active pulmonary tuberculosis patients, we found a higher percentage of PD1(+) NKT cells correlating with sputum bacillary load. Furthermore, blocking PD-1 increased the number of IFN-γ producing NKT cells by inhibiting their apoptosis. Moreover, peripheral frequency of NKT cells declined with therapy suggesting their role in host T cell response. In this study, we concluded that PD-1 preferentially induces apoptosis of IFN-γ producing NKT cells while sparing NKT cells that produce IL-4. Such a polarized NKT cell function may impose a Th2 bias on the ensuing effector T cell response leading to inefficient clearance of M. tuberculosis. Inhibiting PD-1 may therefore alter the T cell response in favor of the host by rescuing type 1 NKT cells from apoptosis and boosting Th1 effector T cell functions against M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Two is better than one: advances in pathogen-boosted immunotherapy and adoptive T-cell therapy.

    Xin, Gang; Schauder, David M; Zander, Ryan; Cui, Weiguo

    2017-09-01

    The recent tremendous successes in clinical trials take cancer immunotherapy into a new era and have attracted major attention from both academia and industry. Among the variety of immunotherapy strategies developed to boost patients' own immune systems to fight against malignant cells, the pathogen-based and adoptive cell transfer therapies have shown the most promise for treating multiple types of cancer. Pathogen-based therapies could either break the immune tolerance to enhance the effectiveness of cancer vaccines or directly infect and kill cancer cells. Adoptive cell transfer can induce a strong durable antitumor response, with recent advances including engineering dual specificity into T cells to recognize multiple antigens and improving the metabolic fitness of transferred cells. In this review, we focus on the recent prospects in these two areas and summarize some ongoing studies that represent potential advancements for anticancer immunotherapy, including testing combinations of these two strategies.

  14. Pathogen-induced ERF68 regulates hypersensitive cell death in tomato.

    Liu, An-Chi; Cheng, Chiu-Ping

    2017-10-01

    Ethylene response factors (ERFs) are a large plant-specific transcription factor family and play diverse important roles in various plant functions. However, most tomato ERFs have not been characterized. In this study, we showed that the expression of an uncharacterized member of the tomato ERF-IX subgroup, ERF68, was significantly induced by treatments with different bacterial pathogens, ethylene (ET) and salicylic acid (SA), but only slightly induced by bacterial mutants defective in the type III secretion system (T3SS) or non-host pathogens. The ERF68-green fluorescent protein (ERF68-GFP) fusion protein was localized in the nucleus. Transactivation and electrophoretic mobility shift assays (EMSAs) further showed that ERF68 was a functional transcriptional activator and was bound to the GCC-box. Moreover, transient overexpression of ERF68 led to spontaneous lesions in tomato and tobacco leaves and enhanced the expression of genes involved in ET, SA, jasmonic acid (JA) and hypersensitive response (HR) pathways, whereas silencing of ERF68 increased tomato susceptibility to two incompatible Xanthomonas spp. These results reveal the involvement of ERF68 in the effector-triggered immunity (ETI) pathway. To identify ERF68 target genes, chromatin immunoprecipitation combined with high-throughput sequencing (ChIP-seq) was performed. Amongst the confirmed target genes, a few genes involved in cell death or disease defence were differentially regulated by ERF68. Our study demonstrates the function of ERF68 in the positive regulation of hypersensitive cell death and disease defence by modulation of multiple signalling pathways, and provides important new information on the complex regulatory function of ERFs. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  15. High prevalence of extended-spectrum β-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India

    Pathak A

    2012-04-01

    Full Text Available Ashish Pathak1,2, Yogyata Marothi3, Vandana Kekre4, Kalpana Mahadik5, Ragini Macaden6, Cecilia Stålsby Lundborg11Division of Global Health, Department of Public Health Sciences, Karolinska Institutet, Stockholm, Sweden; 2Department of Pediatrics, 3Department of Microbiology, 4Department of Medicine, 5Department of Obstetrics and Gynecology, RD Gardi Medical College, Ujjain, India; 6St Johns Research Institute, Bangalore, IndiaBackground: Recent reports of the rapid evolution of bacterial resistance in India require urgent antibiotic stewardship programs. This study aimed to define the magnitude and pattern of resistance of bacterial pathogens to guide empirical therapy.Methods: We prospectively collected consecutive, clinically significant, and nonduplicate bacterial isolates from each patient from two hospitals in Ujjain, India. The antibiotic susceptibility of the bacteria was tested using a disc diffusion method as recommended by the Clinical and Laboratory Standards Institute.Results: A total of 716 pathogens were isolated from 2568 patients (median age, 25 years; range, 0 days to 92 years. Gram-negative infections were predominant (62%. The isolated pathogens included Staphylococcus aureus (n = 221; 31%, Escherichia coli (n = 149; 21%, Pseudomonas aeruginosa (n = 127; 18%, and Klebsiella pneumoniae (n = 107; 15%. Common diagnoses included abscesses (56%, urinary tract infections (14%, blood stream infections (10%, pneumonia (10%, and vaginal infections (10%. In E. coli isolates, 69% (95% confidence interval [CI] 61.6–76.6 were extended-spectrum β-lactamase (ESBL producers and 41% (95% CI 31.6–50.5 of K. pneumoniae isolates were ESBL producers. These isolates had a high resistance to fluoroquinolones and β-lactams, except for imipenem and piperacillin-tazobactam. Salmonella typhi remained sensitive to third-generation cephalosporins. Methicillin-resistant S. aureus (MRSA constituted 30% of all S. aureus isolates and showed resistance

  16. Transformation of Nonfunctioning Pancreatic Neuroendocrine Carcinoma Cells into Insulin Producing Cells after Treatment with Sunitinib

    Jung Hun Ohn

    2013-06-01

    Full Text Available We report a rare case of severe hypoglycemia after sunitinib treatment for pancreatic neuroendocrine carcinoma. We describe the initial clinical presentation, laboratory results, pathologic findings, and managment in a patient with a nonfunctioning pancreatic neuroendocrine carcinoma with liver metastases who developed life threatening hypoglycemia after 2 months of sunitinib therapy. A 46-year-old woman presented to the emergency department with loss of consciousness from hypoglycemia. Serum C-peptide and insulin levels at fasting state revealed that the hypoglycemia resulted from endogenous hyperinsulinemia. She had been diagnosed with nonfunctioning pancreatic neuroendocrine carcinoma based on a biopsy of metastatic cervical lymph node and was being treated with sunitinib, a small molecule tyrosine kinase inhibitor. Immunohistochemical stain of the metastatic liver mass demonstrated that the initially nonfunctioning neuroendocrine carcinoma cells had changed into insulin-producing cells after sunitinib therapy. Transarterial chemoembolization of the liver masses and systemic chemotherapy with streptozotocin/adriamycin relieved the hypoglycemia. A nonfunctioning pancreatic neuroendocrine carcinoma was transformed into an insulin-producing tumor after treatment with sunitinib, causing endogenous hyperinsulinemia and severe hypoglycemia.

  17. Electrochemically Produced Graphene for Microporous Layers in Fuel Cells.

    Najafabadi, Amin Taheri; Leeuwner, Magrieta J; Wilkinson, David P; Gyenge, Előd L

    2016-07-07

    The microporous layer (MPL) is a key cathodic component in proton exchange membrane fuel cells owing to its beneficial influence on two-phase mass transfer. However, its performance is highly dependent on material properties such as morphology, porous structure, and electrical resistance. To improve water management and performance, electrochemically exfoliated graphene (EGN) microsheets are considered as an alternative to the conventional carbon black (CB) MPLs. The EGN-based MPLs decrease the kinetic overpotential and the Ohmic potential loss, whereas the addition of CB to form a composite EGN+CB MPL improves the mass-transport limiting current density drastically. This is reflected by increases of approximately 30 and 70 % in peak power densities at 100 % relative humidity (RH) compared with those for CB- and EGN-only MPLs, respectively. The composite EGN+CB MPL also retains the superior performance at a cathode RH of 20 %, whereas the CB MPL shows significant performance loss. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Polarized Th2 like cells, in the absence of Th0 cells, are responsible for lymphocyte produced IL-4 in high IgE-producer schistosomiasis patients

    Soares-Silveira Alda

    2002-07-01

    Full Text Available Abstract Background Human resistance to re-infection with S. mansoni is correlated with high levels of anti-soluble adult worm antigens (SWAP IgE. Although it has been shown that IL-4 and IL-5 are crucial in establishing IgE responses in vitro, the active in vivo production of these cytokines by T cells, and the degree of polarization of Th2 vs. Th0 in human schistosomiasis is not known. To address this question, we determined the frequency of IL-4 and IFN-γ or IL-5 and IL-2 producing lymphocytes from schistosomiasis patients with high or low levels of IgE anti-SWAP. Results Our analysis showed that high and low IgE-producers responded equally to schistosomiasis antigens as determined by proliferation. Moreover, patients from both groups displayed similar percentages of circulating lymphocytes. However, high IgE-producers had an increased percentage of activated CD4+ T cells as compared to the low IgE-producers. Moreover, intracellular cytokine analysis, after short-term stimulation with anti-CD3/CD28 mAbs, showed that IgE high-producers display an increase in the percentage of T lymphocytes expressing IL-4 and IL-5 as compared to IgE low-responders. A coordinate control of the frequency of IL-4 and IL-5 producing lymphocytes in IgE high, but not IgE low-responders, was observed. Conclusions High IgE phenotype human schistosomiasis patients exhibit a coordinate regulation of IL-4 and IL-5 producing cells and the lymphocyte derived IL-4 comes from true polarized Th2 like cells, in the absence of measurable Th0 cells as measured by co-production of IL-4 and IFN-γ.

  19. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development.

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-12-10

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK) which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK) that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  20. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Daniel A. Rappolee

    2012-12-01

    Full Text Available Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  1. Origin of Matrix-Producing Cells That Contribute to Aortic Fibrosis in Hypertension.

    Wu, Jing; Montaniel, Kim Ramil C; Saleh, Mohamed A; Xiao, Liang; Chen, Wei; Owens, Gary K; Humphrey, Jay D; Majesky, Mark W; Paik, David T; Hatzopoulos, Antonis K; Madhur, Meena S; Harrison, David G

    2016-02-01

    Various hypertensive stimuli lead to exuberant adventitial collagen deposition in large arteries, exacerbating blood pressure elevation and end-organ damage. Collagen production is generally attributed to resident fibroblasts; however, other cells, including resident and bone marrow-derived stem cell antigen positive (Sca-1(+)) cells and endothelial and vascular smooth muscle cells, can produce collagen and contribute to vascular stiffening. Using flow cytometry and immunofluorescence, we found that adventitial Sca-1(+) progenitor cells begin to produce collagen and acquire a fibroblast-like phenotype in hypertension. We also found that bone marrow-derived cells represent more than half of the matrix-producing cells in hypertension, and that one-third of these are Sca-1(+). Cell sorting and lineage-tracing studies showed that cells of endothelial origin contribute to no more than one fourth of adventitial collagen I(+) cells, whereas those of vascular smooth muscle lineage do not contribute. Our findings indicate that Sca-1(+) progenitor cells and bone marrow-derived infiltrating fibrocytes are major sources of arterial fibrosis in hypertension. Endothelial to mesenchymal transition likely also contributes, albeit to a lesser extent and pre-existing resident fibroblasts represent a minority of aortic collagen-producing cells in hypertension. This study shows that vascular stiffening represents a complex process involving recruitment and transformation of multiple cells types that ultimately elaborate adventitial extracellular matrix. © 2015 American Heart Association, Inc.

  2. The B cell death function of obinutuzumab-HDEL produced in plant (Nicotiana benthamiana L. is equivalent to obinutuzumab produced in CHO cells.

    Jin Won Lee

    Full Text Available Plants have attracted attention as bio-drug production platforms because of their economical and safety benefits. The preliminary efficacy of ZMapp, a cocktail of antibodies produced in N. benthamiana (Nicotiana benthamiana L., suggested plants may serve as a platform for antibody production. However, because the amino acid sequences of the Fab fragment are diverse and differences in post-transcriptional processes between animals and plants remain to be elucidated, it is necessary to confirm functional equivalence of plant-produced antibodies to the original antibody. In this study, Obinutuzumab, a third generation anti-CD20 antibody, was produced in N. benthamiana leaves (plant-obinutuzumab and compared to the original antibody produced in glyco-engineered Chinese hamster ovary (CHO cells (CHO-obinutuzumab. Two forms (with or without an HDEL tag were generated and antibody yields were compared. The HDEL-tagged form was more highly expressed than the non-HDEL-tagged form which was cleaved in the N-terminus. To determine the equivalence in functions of the Fab region between the two forms, we compared the CD20 binding affinities and direct binding induced cell death of a CD20-positive B cells. Both forms showed similar CD20 binding affinities and direct cell death of B cell. The results suggested that plant-obinutuzumab was equivalent to CHO-obinutuzumab in CD20 binding, cell aggregation, and direct cell death via binding. Therefore, our findings suggest that Obinutuzumab is a promising biosimilar candidate that can be produced efficiently in plants.

  3. Dendritic-cell control of pathogen-driven T-cell polarization

    Kapsenberg, Martien L.

    2003-01-01

    Dendritic cells (DCs) are central in the orchestration of the various forms of immunity and tolerance. Their immunoregulatory role mainly relies on the ligation of specific receptors that initiate and modulate DC maturation resulting in the development of functionally different effector DC subsets

  4. Use of an optical trap for study of host-pathogen interactions for dynamic live cell imaging.

    Tam, Jenny M; Castro, Carlos E; Heath, Robert J W; Mansour, Michael K; Cardenas, Michael L; Xavier, Ramnik J; Lang, Matthew J; Vyas, Jatin M

    2011-07-28

    Dynamic live cell imaging allows direct visualization of real-time interactions between cells of the immune system(1, 2); however, the lack of spatial and temporal control between the phagocytic cell and microbe has rendered focused observations into the initial interactions of host response to pathogens difficult. Historically, intercellular contact events such as phagocytosis(3) have been imaged by mixing two cell types, and then continuously scanning the field-of-view to find serendipitous intercellular contacts at the appropriate stage of interaction. The stochastic nature of these events renders this process tedious, and it is difficult to observe early or fleeting events in cell-cell contact by this approach. This method requires finding cell pairs that are on the verge of contact, and observing them until they consummate their contact, or do not. To address these limitations, we use optical trapping as a non-invasive, non-destructive, but fast and effective method to position cells in culture. Optical traps, or optical tweezers, are increasingly utilized in biological research to capture and physically manipulate cells and other micron-sized particles in three dimensions(4). Radiation pressure was first observed and applied to optical tweezer systems in 1970(5, 6), and was first used to control biological specimens in 1987(7). Since then, optical tweezers have matured into a technology to probe a variety of biological phenomena(8-13). We describe a method(14) that advances live cell imaging by integrating an optical trap with spinning disk confocal microscopy with temperature and humidity control to provide exquisite spatial and temporal control of pathogenic organisms in a physiological environment to facilitate interactions with host cells, as determined by the operator. Live, pathogenic organisms like Candida albicans and Aspergillus fumigatus, which can cause potentially lethal, invasive infections in immunocompromised individuals(15, 16) (e.g. AIDS

  5. Cooperation between Monocyte-Derived Cells and Lymphoid Cells in the Acute Response to a Bacterial Lung Pathogen.

    Andrew S Brown

    2016-06-01

    Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.

  6. Redox regulation of stress signals: possible roles of dendritic stellate TRX producer cells (DST cell types).

    Yodoi, Junji; Nakamura, Hajime; Masutani, Hiroshi

    2002-01-01

    Thioredoxin (TRX) is a 12 kDa protein with redox-active dithiol (Cys-Gly-Pro-Cys) in the active site. TRX is induced by a variety of stresses including viral infection and inflammation. The promoter sequences of the TRX gene contain a series of stress-responsive elements including ORE, ARE, XRE, CRE and SP-1. TRX promotes DNA binding of transcription factors such as NF-kappaB, AP-1 and p53. TRX interacts with target proteins modulating the activity of those proteins. We have identified TRX binding protein-2 (TBP-2), which was identical to vitamin D3 up-regulated protein 1 (VDUP1). Potential action of TBP-2/VDUP1 as a redox-sensitive tumor suppressor will be discussed. There is accumulating evidence for the involvement of TRX in the protection against infectious and inflammatory disorders. We will discuss the role of TRX-dependent redox regulation of the host defense mechanism, in particular its relation to the emerging concept of constitutive and/or inducible TRX on special cell types with dendritic and stellate morphology in the immune, endocrine and nervous systems, which we provisionally designate as dendritic stellate TRX producer cells (DST cell types).

  7. The regulation of function, growth and survival of GLP-1-producing L-cells

    Kuhre, Rune Ehrenreich; Holst, Jens Juul; Kappe, Camilla

    2016-01-01

    that regulate the growth, survival and function of these cells are largely unknown. We recently showed that prolonged exposure to high concentrations of the fatty acid palmitate induced lipotoxic effects, similar to those operative in insulin-producing cells, in an in vitro model of GLP-1-producing cells...... absorption and disposal, as well as cell proliferation and survival. In Type 2 Diabetes (T2D) reduced plasma levels of GLP-1 have been observed, and plasma levels of GLP-1, as well as reduced numbers of GLP-1 producing cells, have been correlated to obesity and insulin resistance. Increasing endogenous...... secretion of GLP-1 by selective targeting of the molecular mechanisms regulating secretion from the L-cell has been the focus of much recent research. An additional and promising strategy for enhancing endogenous secretion may be to increase the L-cell mass in the intestinal epithelium, but the mechanisms...

  8. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

  9. Perforin-2 is essential for intracellular defense of parenchymal cells and phagocytes against pathogenic bacteria

    McCormack, Ryan M; de Armas, Lesley R; Shiratsuchi, Motoaki; Fiorentino, Desiree G; Olsson, Melissa L; Lichtenheld, Mathias G; Morales, Alejo; Lyapichev, Kirill; Gonzalez, Louis E; Strbo, Natasa; Sukumar, Neelima; Stojadinovic, Olivera; Plano, Gregory V; Munson, George P; Tomic-Canic, Marjana; Kirsner, Robert S; Russell, David G; Podack, Eckhard R

    2015-01-01

    Perforin-2 (MPEG1) is a pore-forming, antibacterial protein with broad-spectrum activity. Perforin-2 is expressed constitutively in phagocytes and inducibly in parenchymal, tissue-forming cells. In vitro, Perforin-2 prevents the intracellular replication and proliferation of bacterial pathogens in these cells. Perforin-2 knockout mice are unable to control the systemic dissemination of methicillin-resistant Staphylococcus aureus (MRSA) or Salmonella typhimurium and perish shortly after epicutaneous or orogastric infection respectively. In contrast, Perforin-2-sufficient littermates clear the infection. Perforin-2 is a transmembrane protein of cytosolic vesicles -derived from multiple organelles- that translocate to and fuse with bacterium containing vesicles. Subsequently, Perforin-2 polymerizes and forms large clusters of 100 Å pores in the bacterial surface with Perforin-2 cleavage products present in bacteria. Perforin-2 is also required for the bactericidal activity of reactive oxygen and nitrogen species and hydrolytic enzymes. Perforin-2 constitutes a novel and apparently essential bactericidal effector molecule of the innate immune system. DOI: http://dx.doi.org/10.7554/eLife.06508.001 PMID:26402460

  10. The Secreted Protease PrtA Controls Cell Growth, Biofilm Formation and Pathogenicity in Xylella fastidiosa.

    Gouran, Hossein; Gillespie, Hyrum; Nascimento, Rafael; Chakraborty, Sandeep; Zaini, Paulo A; Jacobson, Aaron; Phinney, Brett S; Dolan, David; Durbin-Johnson, Blythe P; Antonova, Elena S; Lindow, Steven E; Mellema, Matthew S; Goulart, Luiz R; Dandekar, Abhaya M

    2016-08-05

    Pierce's disease (PD) is a deadly disease of grapevines caused by the Gram-negative bacterium Xylella fastidiosa. Though disease symptoms were formerly attributed to bacteria blocking the plant xylem, this hypothesis is at best overly simplistic. Recently, we used a proteomic approach to characterize the secretome of X. fastidiosa, both in vitro and in planta, and identified LesA as one of the pathogenicity factors of X. fastidiosa in grapevines that leads to leaf scorching and chlorosis. Herein, we characterize another such factor encoded by PD0956, designated as an antivirulence secreted protease "PrtA" that displays a central role in controlling in vitro cell proliferation, length, motility, biofilm formation, and in planta virulence. The mutant in X. fastidiosa exhibited reduced cell length, hypermotility (and subsequent lack of biofilm formation) and hypervirulence in grapevines. These findings are supported by transcriptomic and proteomic analyses with corresponding plant infection data. Of particular interest, is the hypervirulent response in grapevines observed when X. fastidiosa is disrupted for production of PrtA, and that PD-model tobacco plants transformed to express PrtA exhibited decreased symptoms after infection by X. fastidiosa.

  11. Organic metabolites produced by Vibrio parahaemolyticus strain ...

    Identification and action of several antibacterial metabolites produced by a fish pathogen Vibrio parahaemolyticus strain An3 from marine ecosystem of Goa has been demonstrated. Antibacterial activity of the crude cell extract of the test bacterium has been evaluated against indicator pathogenic bacterial strains such as ...

  12. IL-1β promotes the differentiation of polyfunctional human CCR6+CXCR3+ Th1/17 cells that are specific for pathogenic and commensal microbes1

    Duhen, Thomas; Campbell, Daniel J

    2014-01-01

    In humans, Th1/17 cells, identified by co-expression of the chemokine receptors CCR6 and CXCR3, have been proposed to be highly pathogenic in several autoimmune disorders due in part to their expression of the pro-inflammatory cytokines IL-17, IFN-γ and GM-CSF. However, their developmental requirements, relationship with “classic” Th17 and Th1 cells and physiological role in normal immune responses are not well understood. Here, we examined CCR6+CXCR3+ Th1/17 cells from healthy individuals, and found that ex vivo those cells produced the effector cytokines IL-17, IL-22 and IFN-γ in all possible combinations, and were highly responsive to both IL-12 and IL-23. Moreover, although the antigen specificity of CCR6+CXCR3+ Th1/17 cells showed substantial overlap with that of Th1 and Th17 cells, this population was enriched in cells recognizing certain extracellular bacteria and expressing the intestinal homing receptor integrin β7. Finally, we identified IL-1β as a key cytokine that renders Th17 cells sensitive to IL-12, and both cytokines together potently induced the differentiation of cells that produce IL-17, IFN-γ and GM-CSF. Therefore, interfering with IL-1β and IL-12 signaling in Th17 cells during inflammation may be a promising therapeutic approach to reduce their differentiation into “pathogenic” CCR6+CXCR3+ Th1/17 cells in patients with autoimmune diseases. PMID:24890729

  13. NK Cell-Mediated Regulation of Protective Memory Responses against Intracellular Ehrlichial Pathogens.

    Samar Habib

    Full Text Available Ehrlichiae are gram-negative obligate intracellular bacteria that cause potentially fatal human monocytic ehrlichiosis. We previously showed that natural killer (NK cells play a critical role in host defense against Ehrlichia during primary infection. However, the contribution of NK cells to the memory response against Ehrlichia remains elusive. Primary infection of C57BL/6 mice with Ehrlichia muris provides long-term protection against a second challenge with the highly virulent Ixodes ovatus Ehrlichia (IOE, which ordinarily causes fatal disease in naïve mice. Here, we show that the depletion of NK cells in E. muris-primed mice abrogates the protective memory response against IOE. Approximately, 80% of NK cell-depleted E. muris-primed mice succumbed to lethal IOE infection on days 8-10 after IOE infection, similar to naïve mice infected with the same dose of IOE. The lack of a recall response in NK cell-depleted mice correlated with an increased bacterial burden, extensive liver injury, decreased frequency of Ehrlichia-specific IFN-γ-producing memory CD4+ and CD8+ T-cells, and a low titer of Ehrlichia-specific antibodies. Intraperitoneal infection of mice with E. muris resulted in the production of IL-15, IL-12, and IFN-γ as well as an expansion of activated NKG2D+ NK cells. The adoptive transfer of purified E. muris-primed hepatic and splenic NK cells into Rag2-/-Il2rg-/- recipient mice provided protective immunity against challenge with E. muris. Together, these data suggest that E. muris-induced memory-like NK cells, which contribute to the protective, recall response against Ehrlichia.

  14. Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy

    Matthew M Wielgosz

    Full Text Available We have developed a producer cell line that generates lentiviral vector particles of high titer. The vector encodes the Wiskott-Aldrich syndrome (WAS protein. An insulator element has been added to the long terminal repeats of the integrated vector to limit proto-oncogene activation. The vector provides high-level, stable expression of WAS protein in transduced murine and human hematopoietic cells. We have also developed a monoclonal antibody specific for intracellular WAS protein. This antibody has been used to monitor expression in blood and bone marrow cells after transfer into lineage negative bone marrow cells from WAS mice and in a WAS negative human B-cell line. Persistent expression of the transgene has been observed in transduced murine cells 12–20 weeks following transplantation. The producer cell line and the specific monoclonal antibody will facilitate the development of a clinical protocol for gene transfer into WAS protein deficient stem cells.

  15. Anaerobic co-culture of mesenchymal stem cells and anaerobic pathogens - a new in vitro model system.

    Katja Kriebel

    Full Text Available BACKGROUND: Human mesenchymal stem cells (hMSCs are multipotent by nature and are originally isolated from bone marrow. In light of a future application of hMSCs in the oral cavity, a body compartment with varying oxygen partial pressures and an omnipresence of different bacterial species i.e. periodontitis pathogens, we performed this study to gain information about the behavior of hMSC in an anaerobic system and the response in interaction with oral bacterial pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We established a model system with oral pathogenic bacterial species and eukaryotic cells cultured in anaerobic conditions. The facultative anaerobe bacteria Fusobacterium nucleatum, Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were studied. Their effects on hMSCs and primary as well as permanent gingival epithelial cells (Ca9-22, HGPEC were comparatively analyzed. We show that hMSCs cope with anoxic conditions, since 40% vital cells remain after 72 h of anaerobic culture. The Ca9-22 and HGPEC cells are significantly more sensitive to lack of oxygen. All bacterial species reveal a comparatively low adherence to and internalization into hMSCs (0.2% and 0.01% of the initial inoculum, respectively. In comparison, the Ca9-22 and HGPEC cells present better targets for bacterial adherence and internalization. The production of the pro-inflammatory chemokine IL-8 is higher in both gingival epithelial cell lines compared to hMSCs and Fusobacterium nucleatum induce a time-dependent cytokine secretion in both cell lines. Porphyromonas gingivalis is less effective in stimulating secretion of IL-8 in the co-cultivation experiments. CONCLUSIONS/SIGNIFICANCE: HMSCs are suitable for use in anoxic regions of the oral cavity. The interaction with local pathogenic bacteria does not result in massive pro-inflammatory cytokine responses. The test system established in this study allowed further investigation of parameters prior to set up of

  16. AMPK in Pathogens

    Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

    2016-01-01

    During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

  17. Induction of Interleukin-10 Producing Dendritic Cells As a Tool to Suppress Allergen-Specific T Helper 2 Responses

    Stefan Schülke

    2018-03-01

    Full Text Available Dendritic cells (DCs are gatekeepers of the immune system that control induction and polarization of primary, antigen-specific immune responses. Depending on their maturation/activation status, the molecules expressed on their surface, and the cytokines produced DCs have been shown to either elicit immune responses through activation of effector T cells or induce tolerance through induction of either T cell anergy, regulatory T cells, or production of regulatory cytokines. Among the cytokines produced by tolerogenic DCs, interleukin 10 (IL-10 is a key regulatory cytokine limiting und ultimately terminating excessive T-cell responses to microbial pathogens to prevent chronic inflammation and tissue damage. Because of their important role in preventing autoimmune diseases, transplant rejection, allergic reactions, or in controlling chronic inflammation DCs have become an interesting tool to modulate antigen-specific immune responses. For the treatment of allergic inflammation, the aim is to downregulate allergen-specific T helper 2 (Th2 responses and the associated clinical symptoms [allergen-driven Th2 activation, Th2-driven immunoglobulin E (IgE production, IgE-mediated mast cell and basophil activation, allergic inflammation]. Here, combining the presentation of allergens by DCs with a pro-tolerogenic, IL-10-producing phenotype is of special interest to modulate allergen-specific immune responses in the treatment of allergic diseases. This review discusses the reported strategies to induce DC-derived IL-10 secretion for the suppression of allergen-specific Th2-responses with a focus on IL-10 treatment, IL-10 transduction, and the usage of both whole bacteria and bacteria-derived components. Interestingly, while IL-10-producing DCs induced either by IL-10 treatment or IL-10 transduction are arrested in an immature/semi-mature state, treatment of DCs with live or killed bacteria as well as isolated bacterial components results in the induction of

  18. Pleural mesothelial cells promote expansion of IL-17-producing CD8+ T cells in tuberculous pleural effusion.

    Li, X; Zhou, Q; Yang, W B; Xiong, X Z; Du, R H; Zhang, J C

    2013-05-01

    IL-17-producing CD8(+) T lymphocytes (Tc17 cells) have recently been detected in many cancers and autoimmune diseases. However, the possible implication of Tc17 cells in tuberculous pleural effusion remains unclarified. In this study, distribution and phenotypic features of Tc17 cells in both tuberculous pleural effusion (TPE) and peripheral blood from patients with tuberculosis were determined. The effects of proinflammatory cytokines and local accessory cells (pleural mesothelial cells) on Tc17 cell expansion were also explored. We found that TPE contained more Tc17 cells than the blood. Compared with IFN-γ-producing CD8(+) T cells, Tc17 cells displayed higher expression of chemokine receptors (CCRs) and lower expression of cytotoxic molecules. In particularly, Tc17 cells in TPE exhibited high expression levels of CCR6, which could migrate in response to CCL20. Furthermore, IL-1β, IL-6, IL-23, or their various combinations could promote Tc17 cell expansion from CD8(+) T cells, whereas the proliferative response of Tc17 cells to above cytokines was lower than that of Th17 cells. Pleural mesothelial cells (PMCs) were able to stimulate Tc17 cell expansion via cell contact in an IL-1β/IL-6/IL-23 independent fashion. Thus this study demonstrates that Tc17 cells marks a subset of non-cytotoxic, CCR6(+) CD8(+) T lymphocytes with low proliferative capacity. The overrepresentation of Tc17 cells in TPE may be due to Tc17 cell expansion stimulated by pleural proinflammatory cytokines and to recruitment of Tc17 cells from peripheral blood. Additionally, PMCs may promote the production of IL-17 by CD8(+) T cells at sites of TPE via cell-cell interactions.

  19. Development of a high-titer retrovirus producer cell line capable of gene transfer into rhesus monkey hematopoietic stem cells

    Bodine, D.M.; McDonagh, K.T.; Brandt, S.J.; Ney, P.A.; Agricola, B.; Byrne, E.; Nienhuis, A.W.

    1990-01-01

    Retroviral-mediated gene transfer into primitive hematopoietic cells has been difficult to achieve in large-animal models. The authors have developed an amphotropic producer clone that generates >10 10 recombinant retroviral particles (colony-forming units) per ml of culture medium. Autologous rhesus monkey bone marrow cells were cocultured with either high or low titer producer clones for 4-6 days and reinfused into sublethally irradiated animals. The proviral genome was detected in blood and bone-marrow cells from all three animals reconstituted with cells cocultured with the high-titer producer cells. In contrast, three animals reconstituted with bone marrow cocultured with the low-titer producer clone exhibited no evidence of gene transfer

  20. The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin

    Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.

    2012-01-01

    There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578

  1. Pathogen-Specific Binding Soluble Down Syndrome Cell Adhesion Molecule (Dscam Regulates Phagocytosis via Membrane-Bound Dscam in Crab

    Xue-Jie Li

    2018-04-01

    Full Text Available The Down syndrome cell adhesion molecule (Dscam gene is an extraordinary example of diversity that can produce thousands of isoforms and has so far been found only in insects and crustaceans. Cumulative evidence indicates that Dscam may contribute to the mechanistic foundations of specific immune responses in insects. However, the mechanism and functions of Dscam in relation to pathogens and immunity remain largely unknown. In this study, we identified the genome organization and alternative Dscam exons from Chinese mitten crab, Eriocheir sinensis. These variants, designated EsDscam, potentially produce 30,600 isoforms due to three alternatively spliced immunoglobulin (Ig domains and a transmembrane domain. EsDscam was significantly upregulated after bacterial challenge at both mRNA and protein levels. Moreover, bacterial specific EsDscam isoforms were found to bind specifically with the original bacteria to facilitate efficient clearance. Furthermore, bacteria-specific binding of soluble EsDscam via the complete Ig1–Ig4 domain significantly enhanced elimination of the original bacteria via phagocytosis by hemocytes; this function was abolished by partial Ig1–Ig4 domain truncation. Further studies showed that knockdown of membrane-bound EsDscam inhibited the ability of EsDscam with the same extracellular region to promote bacterial phagocytosis. Immunocytochemistry indicated colocalization of the soluble and membrane-bound forms of EsDscam at the hemocyte surface. Far-Western and coimmunoprecipitation assays demonstrated homotypic interactions between EsDscam isoforms. This study provides insights into a mechanism by which soluble Dscam regulates hemocyte phagocytosis via bacteria-specific binding and specific interactions with membrane-bound Dscam as a phagocytic receptor.

  2. An experimental and theoretical approach to the study of the photoacoustic signal produced by cancer cells

    Rafael Pérez Solano

    2012-03-01

    Full Text Available The distinctive spectral absorption characteristics of cancer cells make photoacoustic techniques useful for detection in vitro and in vivo. Here we report on our evaluation of the photoacoustic signal produced by a series of monolayers of different cell lines in vitro. Only the melanoma cell line HS936 produced a detectable photoacoustic signal in which amplitude was dependent on the number of cells. This finding appears to be related to the amount of melanin available in these cells. Other cell lines (i.e. HL60, SK-Mel-1, T47D, Hela, HT29 and PC12 exhibited values similar to a precursor of melanin (tyrosinase, but failed to produce sufficient melanin to generate a photoacoustic signal that could be distinguished from background noise. To better understand this phenomenon, we determined a formula for the time-domain photoacoustic wave equation for a monolayer of cells in a non-viscous fluid on the thermoelastic regime. The theoretical results showed that the amplitude and profile of the photoacoustic signal generated by a cell monolayer depended upon the number and distribution of the cells and the location of the point of detection. These findings help to provide a better understanding of the factors involved in the generation of a photoacoustic signal produced by different cells in vitro and in vivo.

  3. AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6

    Miles, S.A.; Rezai, A.R.; Salazar-Gonzalez, J.F.; Meyden, M.V.; Stevens, R.H.; Mitsuyasu, R.T.; Martinez-Maza, O.; Logan, D.M.; Taga, Tetsuya; Hirano, Toshio; Kishimoto, Tadamitsu

    1990-01-01

    Cell lines derived from Kaposi sarcoma lesions of patients with AIDS (AIDS-KS cells) produce several cytokines, including an endothelial cell growth factor, interleukin 1β, and basic fibroblast growth factor. Since exposure to human immunodeficiency virus increases interleukin 6 (IL-6) production in monocytes and endothelial cells produce IL-6, the authors examined IL-6 expression and response in AIDS-KS cell lines and IL-6 expression in AIDS Kaposi sarcoma tissue. The AIDS-KS cell lines (N521J and EKS3) secreted large amounts of immunoreactive and biologically active IL-6. The authors found both IL-6 and IL-6 receptor (IL-6-R) RNA by slot blot hybridization analysis of AIDS-KS cells. The IL-6-R was functional, as [ 3 H]thymidine incorporation by AIDS-KS cells increased significantly after exposure to human recombinant IL-6 (hrIL-6) at >10 units/ml. When AIDS-KS cells (EKS3) were exposed to IL-6 antisense oligonucleotide, cellular proliferation decreased by nearly two-thirds, with a corresponding decrease in the production of IL-6. These results show that both IL-6 and IL-6-R are produced by AIDS-KS cells and that IL-6 is required for optimal AIDS-KS cell proliferation, and they suggest that IL-6 is an autocrine growth factor for AIDS-KS cells

  4. Proangiogenic hematopoietic cells of monocytic origin: roles in vascular regeneration and pathogenic processes of systemic sclerosis.

    Yamaguchi, Yukie; Kuwana, Masataka

    2013-02-01

    New blood vessel formation is critical, not only for organ development and tissue regeneration, but also for various pathologic processes, such as tumor development and vasculopathy. The maintenance of the postnatal vascular system requires constant remodeling, which occurs through angiogenesis, vasculogenesis, and arteriogenesis. Vasculogenesis is mediated by the de novo differentiation of mature endothelial cells from endothelial progenitor cells (EPCs). Early studies provided evidence that bone marrow-derived CD14⁺ monocytes can serve as a subset of EPCs because of their expression of endothelial markers and ability to promote neovascularization in vitro and in vivo. However, the current consensus is that monocytic cells do not give rise to endothelial cells in vivo, but function as support cells, by promoting vascular formation and repair through their immediate recruitment to the site of vascular injury, secretion of proangiogenic factors, and differentiation into mural cells. These monocytes that function in a supporting role in vascular repair are now termed monocytic pro-angiogenic hematopoietic cells (PHCs). Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by excessive fibrosis and microvasculopathy, along with poor vascular formation and repair. We recently showed that in patients with SSc, circulating monocytic PHCs increase dramatically and have enhanced angiogenic potency. These effects may be induced in response to defective vascular repair machinery. Since CD14⁺ monocytes can also differentiate into fibroblast-like cells that produce extracellular matrix proteins, here we propose a new hypothesis that aberrant monocytic PHCs, once mobilized into circulation, may also contribute to the fibrotic process of SSc.

  5. Quantitative studies of the gastrin-producing cells of the human antrum. A methodological study

    Nielsen, H O; Halken, S; Lorentzen, M

    1980-01-01

    The antral gastrin-producing cells (G-cells) have been identified by the indirect immunoperoxidase technique in two antrum preparations removed due to a recurrent duodenal and gastric ulcer. Morphometric principles were applied to the G-cells with determination of their volume density, numerical....... A method for estimating the total G-cell population and the total G-cell volume in the antrum was developed. In the antrum removed due to a gastric ulcer the number of G-cells was 190 x 10(6) and their total volume 176 mm3....

  6. C5a regulates IL-12+ DC migration to induce pathogenic Th1 and Th17 cells in sepsis.

    Ning Ma

    Full Text Available OBJECTIVE: It is well known that complement system C5a is excessively activated during the onset of sepsis. However, it is unclear whether C5a can regulate dentritic cells (DCs to stimulate adaptive immune cells such as Th1 and Th17 in sepsis. METHODS: Sepsis was induced by cecal ligation and puncture (CLP. CLP-induced sepsis was treated with anti-C5a or IL-12. IL-12(+DC, IFNγ(+Th1, and IL-17(+Th17 cells were analyzed by flow cytometry. IL-12 was measured by ELISA. RESULTS: Our studies here showed that C5a induced IL-12(+DC cell migration from the peritoneal cavity to peripheral blood and lymph nodes. Furthermore, IL-12(+DC cells induced the expansion of pathogenic IFNγ(+Th1 and IL-17(+Th17 cells in peripheral blood and lymph nodes. Moreover, IL-12, secreted by DC cells in the peritoneal cavity, is an important factor that prevents the development of sepsis. CONCLUSION: Our data suggests that C5a regulates IL-12(+DC cell migration to induce pathogenic Th1 and Th17 cells in sepsis.

  7. Ontogeny and localization of the cells produce IL-2 in healthy animals.

    Yamamoto, Mutsumi; Seki, Yoichi; Iwai, Kazuyuki; Ko, Iei; Martin, Alicia; Tsuji, Noriko; Miyagawa, Shuji; Love, Robert B; Iwashima, Makio

    2013-03-01

    IL-2 is a growth factor for activated T cells and is required for maintenance of naturally arising regulatory T cells (nTregs). Mice defective in IL-2/IL-2 receptor signaling pathways have impaired nTregs and suffer from lymphoproliferative disorders, suggesting that IL-2 is present and functional in healthy animals. However, the cellular source of IL-2 is currently unknown. To determine which cells produce IL-2 in healthy animals, we established mice carrying cre gene knock in at the il-2 locus (termed IL-2(cre)). When IL-2(cre) mice were crossed with EGFP reporter mice, EGFP was exclusively expressed by a fraction of CD4 T cells present in both lymphoid and non-lymphoid tissues. Live imaging of IL-2(cre) mice that carry the luciferase reporter showed concentrated localization of luciferase(+) cells in Peyer's patches. These cells were not observed in new born mice but appeared within 3days after birth. Reduction of antigen receptor repertoire by transgene expression reduced their number, indicating that recognition of environmental antigens is necessary for generation of these IL-2 producers in healthy animals. A substantial fraction of EGFP(+) cells also produce IL-10 and IFN-γ, a characteristic profile of type 1 regulatory T cells (Tr1). The data suggest that a group of Tr1 cells have addition roles in immune homeostasis by producing IL-2 along with other cytokines and help maintaining Tregs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Insulin-Producing Endocrine Cells Differentiated In Vitro From Human Embryonic Stem Cells Function in Macroencapsulation Devices In Vivo.

    Agulnick, Alan D; Ambruzs, Dana M; Moorman, Mark A; Bhoumik, Anindita; Cesario, Rosemary M; Payne, Janice K; Kelly, Jonathan R; Haakmeester, Carl; Srijemac, Robert; Wilson, Alistair Z; Kerr, Justin; Frazier, Mauro A; Kroon, Evert J; D'Amour, Kevin A

    2015-10-01

    The PEC-01 cell population, differentiated from human embryonic stem cells (hESCs), contains pancreatic progenitors (PPs) that, when loaded into macroencapsulation devices (to produce the VC-01 candidate product) and transplanted into mice, can mature into glucose-responsive insulin-secreting cells and other pancreatic endocrine cells involved in glucose metabolism. We modified the protocol for making PEC-01 cells such that 73%-80% of the cell population consisted of PDX1-positive (PDX1+) and NKX6.1+ PPs. The PPs were further differentiated to islet-like cells (ICs) that reproducibly contained 73%-89% endocrine cells, of which approximately 40%-50% expressed insulin. A large fraction of these insulin-positive cells were single hormone-positive and expressed the transcription factors PDX1 and NKX6.1. To preclude a significant contribution of progenitors to the in vivo function of ICs, we used a simple enrichment process to remove remaining PPs, yielding aggregates that contained 93%-98% endocrine cells and 1%-3% progenitors. Enriched ICs, when encapsulated and implanted into mice, functioned similarly to the VC-01 candidate product, demonstrating conclusively that in vitro-produced hESC-derived insulin-producing cells can mature and function in vivo in devices. A scaled version of our suspension culture was used, and the endocrine aggregates could be cryopreserved and retain functionality. Although ICs expressed multiple important β cell genes, the cells contained relatively low levels of several maturity-associated markers. Correlating with this, the time to function of ICs was similar to PEC-01 cells, indicating that ICs required cell-autonomous maturation after delivery in vivo, which would occur concurrently with graft integration into the host. Type 1 diabetes (T1D) affects approximately 1.25 million people in the U.S. alone and is deadly if not managed with insulin injections. This paper describes the production of insulin-producing cells in vitro and a new

  9. Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

    Skelton, David; Goodyear, Abbey; Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T.; Logan, Timothy M.

    2010-01-01

    NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U- 13 C-glucose and 15 N-glutamate as labeled precursors. This study suggests that uniformly 15 N, 13 C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

  10. Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

    Skelton, David; Goodyear, Abbey [Florida State University, Department of Chemistry and Biochemistry (United States); Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T. [Florida State University, Institute of Molecular Biophysics (United States); Logan, Timothy M., E-mail: tlogan@fsu.ed [Florida State University, Department of Chemistry and Biochemistry (United States)

    2010-10-15

    NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U-{sup 13}C-glucose and {sup 15}N-glutamate as labeled precursors. This study suggests that uniformly {sup 15}N,{sup 13}C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

  11. Purification and characterization of two new cell-bound bioactive compounds produced by wild Lactococcus lactis strain.

    Saraiva, Margarete Alice Fontes; Brede, Dag Anders; Nes, Ingolf Figved; Baracat-Pereira, Maria Cristina; de Queiroz, Marisa Vieira; de Moraes, Célia Alencar

    2017-07-03

    Novel compounds and innovative methods are required considering that antibiotic resistance has reached a crisis point. In the study, two cell-bound antimicrobial compounds produced by Lactococcus lactis ID1.5 were isolated and partially characterized. Following purification by cationic exchange and a solid-phase C18 column, antimicrobial activity was recovered after three runs of RPC using 60% (v/v) and 100% (v/v) of 2-propanol for elution, suggesting that more than one antimicrobial compound were produced by L. lactis ID1.5, which were in this study called compounds AI and AII. The mass spectrum of AI and AII showed major intensity ions at m/z 1070.05 and 955.9 Da, respectively. The compound AI showed a spectrum of antimicrobial activity mainly against L. lactis species, while the organisms most sensitive to compound AII were Bacillus subtilis, Listeria innocua, Streptococcus pneumoniae and Pseudomonas aeruginosa. The antimicrobial activity of both compounds was suppressed by treatment with Tween 80. Nevertheless, both compounds showed high stability to heat and proteases treatments. The isolated compounds, AI and AII, showed distinct properties from other antimicrobial substances already reported as produced by L. lactis, and have a significant inhibitory effect against two clinically important respiratory pathogens. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  13. Cerebellar stem cells do not produce neurons and astrocytes in adult mouse

    Su, Xin; Guan, Wuqiang; Yu, Yong-Chun; Fu, Yinghui

    2014-01-01

    Highlights: • No new neurons and astrocytes are generated in adult mouse cerebellum. • Very few mash1 + or nestin + stem cells exist, and most of them are quiescent. • Cell proliferation rate is diversified among cerebellar regions and decreases over time. - Abstract: Although previous studies implied that cerebellar stem cells exist in some adult mammals, little is known about whether these stem cells can produce new neurons and astrocytes. In this study by bromodeoxyuridine (BrdU) intraperitoneal (i.p.) injection, we found that there are abundant BrdU + cells in adult mouse cerebellum, and their quantity and density decreases significantly over time. We also found cell proliferation rate is diversified in different cerebellar regions. Among these BrdU + cells, very few are mash1 + or nestin + stem cells, and the vast majority of cerebellar stem cells are quiescent. Data obtained by in vivo retrovirus injection indicate that stem cells do not produce neurons and astrocytes in adult mouse cerebellum. Instead, some cells labeled by retrovirus are Iba1 + microglia. These results indicate that very few stem cells exist in adult mouse cerebellum, and none of these stem cells contribute to neurogenesis and astrogenesis under physiological condition

  14. Effectiveness of a Glycylcycline Antibiotic for Reducing the Pathogenicity of Superantigen-Producing Methicillin-Resistant Staphylococcus aureus in Burn Wounds.

    Nosanov, Lauren B; Jo, Daniel Y; Randad, Pranay R; Moffatt, Lauren T; Carney, Bonnie C; Ortiz, Rachel T; Shupp, Jeffrey W

    2017-01-01

    Objective : Burn-injured patients are highly susceptible to infectious complications, which are often associated with increased morbidity and mortality. Rates of antibiotic resistance have increased, and resistant species such as methicillin-resistant Staphylococcus aureus provide additional challenges in the form of virulence factors. Proteins can disrupt local healing, leading to systemic immune disruption. To optimize outcomes, treatments that reduce pathogenicity must be identified. This study aims to compare a glycylcycline antibiotic-tigecycline-with clindamycin for effectiveness in treating superantigenic methicillin-resistant Staphylococcus aureus in burn wounds. Methods : Sprague-Dawley rats received paired 2 × 2-cm burn wounds, which were subsequently inoculated with known virulence factor-producing methicillin-resistant Staphylococcus aureus or media alone on postinjury day 1. Infected animals received twice-daily tigecycline (high or low dose), twice-daily clindamycin (high or low dose), or saline alone (positive controls). Daily sampling and imaging assessments were performed. Results : Bacterial counts and toxin levels were reduced significantly in antibiotic-treated groups relative to positive controls ( P study supports the use of tigecycline in the treatment of methicillin-resistant Staphylococcus aureus -infected burn wounds. While both protein synthesis inhibitors are effective, tigecycline appears to be superior in controlling toxin levels, enabling better wound healing.

  15. Prevalence of Stx-producing Shigella species isolated from French Travelers Returning from the Caribbean: An Emerging Pathogen with International Implications

    Gray, Miranda D.; Lacher, David W.; Leonard, Susan R.; Abbott, Jason; Zhao, Shaohua; Lampel, Keith A.; Prothery, Estelle; Gouali, Malika; Weill, François-Xavier; Maurelli, Anthony T.

    2015-01-01

    Shiga toxins are potent cytotoxins that inhibit host cell protein synthesis, leading to cell death. Classically, these toxins are associated with intestinal infections due to Shiga toxin-producing Escherichia coli or Shigella dysenteriae serotype 1 and infections with these strains can lead to hemolytic uremic syndrome. Over the past decade there is increasing recognition that Shiga toxin is produced by additional Shigella species. We recently reported the presence and expression of stx genes in Shigella flexneri 2a clinical isolates. The toxin genes were carried by a new stx-encoding bacteriophage and infection with these strains correlated with recent travel to Haiti or the Dominican Republic. In this study we further explored the epidemiological link to this region by utilizing the French National Reference Center for Escherichia coli, Shigella and Salmonella collection to survey the frequency of Stx-producing Shigella species isolated from French travelers returning from the Caribbean. About 21% of the isolates tested were found to encode and produce Stx. These isolates included strains of S. flexneri 2a, S. flexneri Y, and S. dysenteriae 4. All of the travelers whom were infected with Stx-producing Shigella had recently traveled to Haiti, the Dominican Republic, or French Guiana. Furthermore, whole genome sequencing found that the toxin genes were encoded by a prophage that was highly identical to the phage we identified in our previous study. These findings demonstrate that this new stx-encoding prophage is circulating within that geographical area, has spread to other continents, and is capable of spreading to multiple Shigella serogroups. PMID:25980352

  16. Potential in a single cancer cell to produce heterogeneous morphology, radiosensitivity and gene expression

    Ban, Sadayuki; Ishikawa, Ken-ichi; Kawai, Seiko; Koyama-Saegusa, Kumiko; Ishikawa, Atsuko; Imai, Takashi; Shimada, Yutaka; Inazawa, Johji

    2005-01-01

    Morphologically heterogeneous colonies were formed from a cultured cell line (KYSE70) established from one human esophageal carcinoma tissue. Two subclones were separated from a single clone (clone 13) of KYSE70 cells. One subclone (clone 13-3G) formed mainly mounding colonies and the other (clone 13-6G) formed flat, diffusive colonies. X-irradiation stimulated the cells to dedifferentiate from the mounding state to the flat, diffusive state. Clone 13-6G cells were more radiosensitive than the other 3 cell lines. Clustering analysis for gene expression level by oligonucleotide microarray demonstrated that in the radiosensitive clone 13-6G cells, expression of genes involved in cell adhesion was upregulated, but genes involved in the response to DNA damage stimulus were downregulated. The data demonstrated that a single cancer cell had the potential to produce progeny heterogeneous in terms of morphology, radiation sensitivity and gene expression, and irradiation enhanced the dedifferentiation of cancer cells. (author)

  17. From the Cover: Cell-replacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells

    Sapir, Tamar; Shternhall, Keren; Meivar-Levy, Irit; Blumenfeld, Tamar; Cohen, Hamutal; Skutelsky, Ehud; Eventov-Friedman, Smadar; Barshack, Iris; Goldberg, Iris; Pri-Chen, Sarah; Ben-Dor, Lya; Polak-Charcon, Sylvie; Karasik, Avraham; Shimon, Ilan; Mor, Eytan; Ferber, Sarah

    2005-05-01

    Shortage in tissue availability from cadaver donors and the need for life-long immunosuppression severely restrict the large-scale application of cell-replacement therapy for diabetic patients. This study suggests the potential use of adult human liver as alternate tissue for autologous beta-cell-replacement therapy. By using pancreatic and duodenal homeobox gene 1 (PDX-1) and soluble factors, we induced a comprehensive developmental shift of adult human liver cells into functional insulin-producing cells. PDX-1-treated human liver cells express insulin, store it in defined granules, and secrete the hormone in a glucose-regulated manner. When transplanted under the renal capsule of diabetic, immunodeficient mice, the cells ameliorated hyperglycemia for prolonged periods of time. Inducing developmental redirection of adult liver offers the potential of a cell-replacement therapy for diabetics by allowing the patient to be the donor of his own insulin-producing tissue. pancreas | transdifferentiation

  18. Interleukin 4-producing CD4+ T cells in the skin of cats with allergic dermatitis.

    Roosje, P J; Dean, G A; Willemse, T; Rutten, V P M G; Thepen, T

    2002-03-01

    Lesional skin of cats with allergic dermatitis has a cellular infiltrate and a CD4/CD8 ratio comparable to that in humans with atopic dermatitis. CD4+ helper T cells and in particular cells belonging to the Th2 subset play an important role in disease pathogenesis in humans. We investigated the cytokine pattern of CD4+ T cells in situ, with special emphasis on the putative presence of cells producing interleukin 4 (IL4), in cats with allergic dermatitis. Immunohistochemical procedures were used to determine that CD4+ T cells in lesional and nonlesional skin of cats with allergic dermatitis can produce IL4, as occurs in humans. Lesional and nonlesional skin of cats with allergic dermatitis had significantly more IL4+ T cells (P = 0.001) than did skin of healthy control cats. Double staining indicated that all IL4+ cells were positive for pan-T or CD4 markers. Double labeling for mast cell chymase and IL4 stained primarily different cells. Western blotting demonstrated cross-reactivity between the antibody against human IL4 and a feline recombinant IL4. These results indicate that IL4 is primarily produced by CD4+ T cells and is also present in clinically uninvolved skin, indicating a role in the pathogenesis of allergic dermatitis in cats.

  19. Increased frequencies of IL-31-producing T cells are found in chronic atopic dermatitis skin

    Szegedi, Krisztina; Kremer, Andreas E.; Kezic, Sanja; Teunissen, Marcel B. M.; Bos, Jan D.; Luiten, Rosalie M.; Res, Pieter C.; Middelkamp-Hup, Maritza A.

    2012-01-01

    Interleukin (IL)-31 has been associated with pruritus, a characteristic feature of atopic dermatitis (AD). Local T cell responses may be responsible for the increased level of IL-31 mRNA observed in AD. We investigated the frequency of IL-31-producing T cells in AD lesions, as well as their cytokine

  20. Gene probes to detect cross-culture contamination in hormone producing cell lines

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk

    1988-01-01

    hamster insulin gene. Karyotyping confirmed the absence of human chromosomes in the Clone-16 cells while sizes, centromere indices, and banding patterns were identical to Syrian hamster fibroblasts. We conclude that the insulin-producing Clone-16 cells are of Syrian hamster origin and demonstrate...

  1. Radiation pretreatment of cellulosic wastes and immobilization of cells producing cellulase for their conversion to glucose

    Kumakura, Minoru; Kaetsu, Isao

    1988-01-01

    Radiation pretreatment of cellulosic wastes such as saw dust and chaff was studied by using electron beam accelerator, in which irradiation effect was increased by increasing irradiation dose and dose rate, by after heating irradiated materials at 100∼140deg C, and by irradiation in the addition of alkaline solution. Trichoderma reesei cells producing cellulase were immobilized by using fibrous porous carrier obtained from radiation polymerization. The filter paper, cellobiose, and CMC activities in the immobilized growing cells were higher than those in free cells. The activity in the immobilized cells obtained with hydrophobic carrier was higher than that obtained with hydrophilic one. Durability of the immobilized cells was examined by repeated batch culture. It was found that the enzyme solution produced in the culture of the immobilized cells can hydrolyze effectively saw dust pretreated by radiation. (author)

  2. Autophagy is essential for the differentiation of porcine PSCs into insulin-producing cells.

    Ren, Lipeng; Yang, Hong; Cui, Yanhua; Xu, Shuanshuan; Sun, Fen; Tian, Na; Hua, Jinlian; Peng, Sha

    2017-07-01

    Porcine pancreatic stem cells (PSCs) are seed cells with potential use for diabetes treatment. Stem cell differentiation requires strict control of protein turnover and lysosomal digestion of organelles. Autophagy is a highly conserved process that controls the turnover of organelles and proteins within cells and contributes to the balance of cellular components. However, whether autophagy plays roles in PSC differentiation remains unknown. In this study, we successfully induced porcine PSCs into insulin-producing cells and found that autophagy was activated during the second induction stage. Inhibition of autophagy in the second stage resulted in reduced differentiational efficiency and impaired glucose-stimulated insulin secretion. Moreover, the expression of active β-catenin increased while autophagy was activated but was suppressed when autophagy was inhibited. Therefore, autophagy is essential to the formation of insulin-producing cells, and the effects of autophagy on differentiation may be regulated by canonical Wnt signalling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. SCR96, a small cysteine-rich secretory protein of Phytophthora cactorum, can trigger cell death in the Solanaceae and is important for pathogenicity and oxidative stress tolerance.

    Chen, Xiao-Ren; Li, Yan-Peng; Li, Qi-Yuan; Xing, Yu-Ping; Liu, Bei-Bei; Tong, Yun-Hui; Xu, Jing-You

    2016-05-01

    Peptides and small molecules produced by both the plant pathogen Phytophthora and host plants in the apoplastic space mediate the relationship between the interplaying organisms. Various Phytophthora apoplastic effectors, including small cysteine-rich (SCR) secretory proteins, have been identified, but their roles during interaction remain to be determined. Here, we identified an SCR effector encoded by scr96, one of three novel genes encoding SCR proteins in P. cactorum with similarity to the P. cactorum phytotoxic protein PcF. Together with the other two genes, scr96 was transcriptionally induced throughout the developmental and infection stages of the pathogen. These genes triggered plant cell death (PCD) in the Solanaceae, including Nicotiana benthamiana and tomato. The scr96 gene did not show single nucleotide polymorphisms in a collection of P. cactorum isolates from different countries and host plants, suggesting that its role is essential and non-redundant during infection. Homologues of SCR96 were identified only in oomycetes, but not in fungi and other organisms. A stable protoplast transformation protocol was adapted for P. cactorum using green fluorescent protein as a marker. The silencing of scr96 in P. cactorum caused gene-silenced transformants to lose their pathogenicity on host plants and these transformants were significantly more sensitive to oxidative stress. Transient expression of scr96 partially recovered the virulence of gene-silenced transformants on plants. Overall, our results indicate that the P. cactorum scr96 gene encodes an important virulence factor that not only causes PCD in host plants, but is also important for pathogenicity and oxidative stress tolerance. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  4. Generation of a transplantable erythropoietin-producer derived from human mesenchymal stem cells.

    Yokoo, Takashi; Fukui, Akira; Matsumoto, Kei; Ohashi, Toya; Sado, Yoshikazu; Suzuki, Hideaki; Kawamura, Tetsuya; Okabe, Masataka; Hosoya, Tatsuo; Kobayashi, Eiji

    2008-06-15

    Differentiation of autologous stem cells into functional transplantable tissue for organ regeneration is a promising regenerative therapeutic approach for cancer, diabetes, and many human diseases. Yet to be established, however, is differentiation into tissue capable of producing erythropoietin (EPO), which has a critical function in anemia. We report a novel EPO-producing organ-like structure (organoid) derived from human mesenchymal stem cells. Using our previously established relay culture system, a human mesenchymal stem cell-derived, human EPO-competent organoid was established in rat omentum. The organoid-derived levels of human EPO increased in response to anemia induced by rapid blood withdrawal. In addition, the presence of an organoid in rats suppressed for native (rat) EPO production enhanced recovery from anemia when compared with control animals lacking the organoid. Together these results confirmed the generation of a stem cell-derived organoid that is capable of producing EPO and sensitive to physiological regulation.

  5. Contamination of infectious RD-114 virus in vaccines produced using non-feline cell lines.

    Yoshikawa, Rokusuke; Sato, Eiji; Miyazawa, Takayuki

    2011-01-01

    All domestic cats have a replication-competent endogenous retrovirus, termed RD-114 virus, in their genome and several feline cell lines produce RD-114 viruses. Recently, we found that a portion of live attenuated feline and canine vaccines produced using feline cell lines was contaminated with infectious RD-114 viruses. In this study, we expanded our survey and examined canine vaccines produced using 'non-feline' cell lines. Consequently, we found two vaccines containing RD-114 viral RNA by reverse transcriptase (RT)-polymerase chain reaction (PCR) and real-time RT-PCR. We also confirmed the presence of infectious RD-114 virus in the vaccines by the LacZ marker rescue assay and PCR to detect proviral DNA in TE671 cells (human rhabdomyosarcoma cells) inoculated with the vaccines. It is impossible to investigate the definitive cause of contamination with RD-114 virus; however, we suspect that a seed canine parvovirus type 2 was contaminated with RD-114 virus, because many canine parvoviruses have been isolated and attenuated using feline cell lines. To exclude RD-114 virus from live attenuated vaccines, we must pay attention to the contamination of seed viruses with RD-114 virus in addition to avoiding feline cell lines producing RD-114 virus when manufacturing vaccines. Copyright © 2010 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.

  6. Staphylococcus aureus produces membrane-derived vesicles that induce host cell death.

    Mamata Gurung

    Full Text Available Gram-negative bacteria produce outer membrane vesicles that play a role in the delivery of virulence factors to host cells. However, little is known about the membrane-derived vesicles (MVs produced by gram-positive bacteria. The present study examined the production of MVs from Staphylococcus aureus and investigated the delivery of MVs to host cells and subsequent cytotoxicity. Four S. aureus strains tested, two type strains and two clinical isolates, produced spherical nanovesicles during in vitro culture. MVs were also produced during in vivo infection of a clinical S. aureus isolate in a mouse pneumonia model. Proteomic analysis showed that 143 different proteins were identified in the S. aureus-derived MVs. S. aureus MVs were interacted with the plasma membrane of host cells via a cholesterol-rich membrane microdomain and then delivered their component protein A to host cells within 30 min. Intact S. aureus MVs induced apoptosis of HEp-2 cells in a dose-dependent manner, whereas lysed MVs neither delivered their component into the cytosol of host cells nor induced cytotoxicity. In conclusion, this study is the first report that S. aureus MVs are an important vehicle for delivery of bacterial effector molecules to host cells.

  7. Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells

    Zalzman, Michal; Gupta, Sanjeev; Giri, Ranjit K.; Berkovich, Irina; Sappal, Baljit S.; Karnieli, Ohad; Zern, Mark A.; Fleischer, Norman; Efrat, Shimon

    2003-06-01

    Beta-cell replacement is considered to be the most promising approach for treatment of type 1 diabetes. Its application on a large scale is hindered by a shortage of cells for transplantation. Activation of insulin expression, storage, and regulated secretion in stem/progenitor cells offers novel ways to overcome this shortage. We explored whether fetal human progenitor liver cells (FH) could be induced to differentiate into insulin-producing cells after expression of the pancreatic duodenal homeobox 1 (Pdx1) gene, which is a key regulator of pancreatic development and insulin expression in beta cells. FH cells possess a considerable replication capacity, and this was further extended by introduction of the gene for the catalytic subunit of human telomerase. Immortalized FH cells expressing Pdx1 activated multiple beta-cell genes, produced and stored considerable amounts of insulin, and released insulin in a regulated manner in response to glucose. When transplanted into hyperglycemic immunodeficient mice, the cells restored and maintained euglycemia for prolonged periods. Quantitation of human C-peptide in the mouse serum confirmed that the glycemia was normalized by the transplanted human cells. This approach offers the potential of a novel source of cells for transplantation into patients with type 1 diabetes.

  8. Liver sinusoidal endothelial cells induce immunosuppressive IL-10-producing Th1 cells via the Notch pathway

    Neumann, Katrin; Rudolph, Christine; Neumann, Christian; Janke, Marko; Amsen, Derk; Scheffold, Alexander

    2015-01-01

    Under homeostasis, liver sinusoidal endothelial cells (LSECs) shift intrahepatic T-cell responses towards tolerance. However, the role of LSECs in the regulation of T-cell-induced liver inflammation is less clear. Here, we studied the capacity of LSECs to modulate pro-inflammatory Th1-cell

  9. Interleukin 17-producing γδT cells promote hepatic regeneration in mice.

    Rao, Raghavendra; Graffeo, Christopher S; Gulati, Rishabh; Jamal, Mohsin; Narayan, Suchithra; Zambirinis, Constantinos P; Barilla, Rocky; Deutsch, Michael; Greco, Stephanie H; Ochi, Atsuo; Tomkötter, Lena; Blobstein, Reuven; Avanzi, Antonina; Tippens, Daniel M; Gelbstein, Yisroel; Van Heerden, Eliza; Miller, George

    2014-08-01

    Subsets of leukocytes synergize with regenerative growth factors to promote hepatic regeneration. γδT cells are early responders to inflammation-induced injury in a number of contexts. We investigated the role of γδT cells in hepatic regeneration using mice with disruptions in Tcrd (encodes the T-cell receptor δ chain) and Clec7a (encodes C-type lectin domain family 7 member a, also known as DECTIN1). We performed partial hepatectomies on wild-type C57BL/6, CD45.1, Tcrd(-/-), or Clec7a(-/-) mice. Cells were isolated from livers of patients and mice via mechanical and enzymatic digestion. γδT cells were purified by fluorescence-activated cell sorting. In mice, partial hepatectomy up-regulated expression of CCL20 and ligands of Dectin-1, which was associated with recruitment and activation of γδT cells and their increased production of interleukin (IL)-17 family cytokines. Recruited γδT cells induced production of IL-6 by antigen-presenting cells and suppressed expression of interferon gamma by natural killer T cells, promoting hepatocyte proliferation. Absence of IL-17-producing γδT cells or deletion of Dectin-1 prevented development of regenerative phenotypes in subsets of innate immune cells. This slowed liver regeneration and was associated with reduced expression of regenerative growth factors and cell cycle regulators. Conversely, exogenous administration of IL-17 family cytokines or Dectin-1 ligands promoted regeneration. More broadly, we found that γδT cells are required for inflammatory responses mediated by IL-17 and Dectin-1. γδT cells regulate hepatic regeneration by producing IL-22 and IL-17, which have direct mitogenic effects on hepatocytes and promote a regenerative phenotype in hepatic leukocytes, respectively. Dectin-1 ligation is required for γδT cells to promote hepatic regeneration. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

  10. Generation of insulin-producing human mesenchymal stem cells using recombinant adeno-associated virus.

    Kim, Jeong Hwan; Park, Si-Nae; Suh, Hwal

    2007-02-28

    The purpose of current experiment is the generation of insulin-producing human mesenchymal stem cells as therapeutic source for the cure of type 1 diabetes. Type 1 diabetes is generally caused by insulin deficiency accompanied by the destruction of islet beta-cells. In various trials for the treatment of type 1 diabetes, cell-based gene therapy using stem cells is considered as one of the most useful candidate for the treatment. In this experiment, human mesenchymal stem cells were transduced with AAV which is containing furin-cleavable human preproinsulin gene to generate insulin-producing cells as surrogate beta-cells for the type 1 diabetes therapy. In the rAAV production procedure, rAAV was generated by transfection of AD293 cells. Human mesenchymal stems cells were transduced using rAAV with a various multiplicity of infection. Transduction of recombinant AAV was also tested using beta-galactosidse expression. Cell viability was determined by using MTT assay to evaluate the toxicity of the transduction procedure. Expression and production of Insulin were tested using reverse transcriptase-polymerase chain reaction and immunocytochemistry. Secretion of human insulin and C-peptide from the cells was assayed using enzyme-linked immunosorbent assay. Production of insulin and C-peptide from the test group represented a higher increase compared to the control group. In this study, we examined generation of insulin-producing cells from mesenchymal stem cells by genetic engineering for diabetes therapy. This work might be valuable to the field of tissue engineering for diabetes treatment.

  11. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand

    Supawadee Piratae

    2017-04-01

    Full Text Available Objective: To evaluate the prevalence of blood parasite infection in stray dogs by PCR technique and the association between levels of packed cell volume (PCV and blood parasitic infection in stray dogs. Methods: A total of 65 blood samples were collected from stray dogs in animal quarantine station from Mahasarakham, Thailand to evaluate the levels of PCV before molecular screening for tick-borne pathogens infection. Results: Stray dogs were positive with one or more pathogens in 44 (67.69% out of 65 blood samples. Ehrlichia canis [43.1%, 95% confidence interval (CI: 38.1–48.1] was the most common blood pathogen found infecting in stray dogs in Mahasarakham Province, followed by Anaplasma platys (29.2%, 95% CI: 24.2–34.2, Hepatozoon canis (12.3%, 95% CI: 7.3–17.3 and Babesia canis vogeli (6.2%, 95% CI: 1.2–11.2, respectively. Moreover, co-infections with two pathogens were identified in 11 (16.9% of dogs examined and two (2.9% dogs were coinfections with three pathogens. Statistically significant relationship between the PCV levels and Ehrlichia canis infection was found (P < 0.05. Conclusions: This study indicated that blood pathogens are spreading in stray dogs and they are potentially high risk of agent transmission to human via exposure with tick vectors. It was also the first report of Anaplasma platys infection in dogs in north-eastern part of Thailand.

  12. Riboflavin-ultraviolet light pathogen reduction treatment does not impact the immunogenicity of murine red blood cells.

    Tormey, Christopher A; Santhanakrishnan, Manjula; Smith, Nicole H; Liu, Jingchun; Marschner, Susanne; Goodrich, Raymond P; Hendrickson, Jeanne E

    2016-04-01

    Ultraviolet (UV) illumination/pathogen reduction effectively inactivates white blood cells (WBCs) in whole blood. Given that cotransfused WBCs may impact recipient immune responses, we hypothesized that pathogen reduction of whole blood may alter responses to RBC antigens. Transgenic mice expressing a model (HOD) antigen, authentic human (hGPA or KEL) antigens, or natural fluorescence (uGFP) on their RBCs were utilized as blood donors. Recipients were transfused with fresh whole blood to which riboflavin had been added or fresh whole blood treated by UV illumination/pathogen reduction treatment after the addition of riboflavin. Posttransfusion RBC recovery, survival, and alloimmunization were measured by flow cytometry. UV illumination/pathogen reduction treatment did not alter RBC antigen expression, and recipients of treated syngeneic RBCs had persistently negative direct antiglobulin tests. Greater than 75% of treated and untreated syngeneic RBCs were recovered 24 hours posttransfusion in all experiments, although alterations in the long-term posttransfusion survival of treated RBCs were observed. Treated and untreated KEL RBCs induced similar recipient alloimmune responses, with all recipients making anti-KEL glycoprotein immunoglobulins (p > 0.05). Alloimmune responses to treated HOD or hGPA RBCs were no different from untreated RBCs (p > 0.05). Pathogen inactivation treatment of fresh whole murine blood with riboflavin and UV illumination does not impact the rate or magnitude of RBC alloimmunization to three distinct RBC antigens. Further, UV illumination/pathogen reduction appears safe from an immunohematologic standpoint, with no immunogenic neoantigens detected on treated murine RBCs. Future studies with fresh and stored human RBCs are warranted to confirm these findings. © 2015 AABB.

  13. Cell wall modifications during conidial maturation of the human pathogenic fungus Pseudallescheria boydii

    Ghamrawi, Sarah; Rénier, Gilles; Saulnier, Patrick; Cuenot, Stéphane; Zykwinska, Agata; Dutilh, Bas E; Thornton, Christopher; Faure, Sébastien; Bouchara, Jean-Philippe

    Progress in extending the life expectancy of cystic fibrosis (CF) patients remains jeopardized by the increasing incidence of fungal respiratory infections. Pseudallescheria boydii (P. boydii), an emerging pathogen of humans, is a filamentous fungus frequently isolated from the respiratory

  14. Cell Wall Modifications during Conidial Maturation of the Human Pathogenic Fungus Pseudallescheria boydii

    Ghamrawi, S.; Renier, G.; Saulnier, P.; Cuenot, S.; Zykwinska, A.; Dutilh, B.E.; Thornton, C.; Faure, S.; Bouchara, J.P.

    2014-01-01

    Progress in extending the life expectancy of cystic fibrosis (CF) patients remains jeopardized by the increasing incidence of fungal respiratory infections. Pseudallescheria boydii (P. boydii), an emerging pathogen of humans, is a filamentous fungus frequently isolated from the respiratory

  15. Purification and characterization of a bioactive alpha-fetoprotein produced by HEK-293 cells.

    Lin, Bo; Peng, Guoqing; Feng, Haipeng; Li, Wei; Dong, Xu; Chen, Yi; Lu, Yan; Wang, Qiaoyun; Xie, Xieju; Zhu, Mingyue; Li, Mengsen

    2017-08-01

    Alpha-fetoprotein (AFP) is a biomarker that is used to diagnose hepatocellular carcinoma (HCC) and can promote malignancy in HCC. AFP is an important target in the treatment of liver cancer. To obtain enough AFP to screen for AFP inhibitors, we expressed and purified AFP in HEK-293 cells. In the present study, we produced AFP in the cells and harvested highly pure rAFP (or recombinant expression AFP in HEK-293 cells). We also analysed the bioactivity of rAFP and found that rAFP promoted growth of the human HCC cells, antagonize paclitaxel inhibition of HCC cell proliferation, suppress expression of active caspase-3, and promote expression of Ras and survivin. This study provides a method to produce significant amounts of AFP for use in biochemical assays and functional studies and to screen AFP inhibitors for use in HCC therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  17. Comparative Genomics of Recent Shiga Toxin-Producing Escherichia coli O104:H4: Short-Term Evolution of an Emerging Pathogen

    Grad, Yonatan H.; Godfrey, Paul; Cerquiera, Gustavo C.; Mariani-Kurkdjian, Patricia; Gouali, Malika; Bingen, Edouard; Shea, Terrence P.; Haas, Brian J.; Griggs, Allison; Young, Sarah; Zeng, Qiandong; Lipsitch, Marc; Waldor, Matthew K.; Weill, François-Xavier; Wortman, Jennifer R.; Hanage, William P.

    2013-01-01

    ABSTRACT The large outbreak of diarrhea and hemolytic uremic syndrome (HUS) caused by Shiga toxin-producing Escherichia coli O104:H4 in Europe from May to July 2011 highlighted the potential of a rarely identified E. coli serogroup to cause severe disease. Prior to the outbreak, there were very few reports of disease caused by this pathogen and thus little known of its diversity and evolution. The identification of cases of HUS caused by E. coli O104:H4 in France and Turkey after the outbreak and with no clear epidemiological links raises questions about whether these sporadic cases are derived from the outbreak. Here, we report genome sequences of five independent isolates from these cases and results of a comparative analysis with historical and 2011 outbreak isolates. These analyses revealed that the five isolates are not derived from the outbreak strain; however, they are more closely related to the outbreak strain and each other than to isolates identified prior to the 2011 outbreak. Over the short time scale represented by these closely related organisms, the majority of genome variation is found within their mobile genetic elements: none of the nine O104:H4 isolates compared here contain the same set of plasmids, and their prophages and genomic islands also differ. Moreover, the presence of closely related HUS-associated E. coli O104:H4 isolates supports the contention that fully virulent O104:H4 isolates are widespread and emphasizes the possibility of future food-borne E. coli O104:H4 outbreaks. PMID:23341549

  18. Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

    Novo, Juliana Branco; Morganti, Ligia; Moro, Ana Maria; Paes Leme, Adriana Franco; Serrano, Solange Maria de Toledo; Raw, Isaias; Ho, Paulo Lee

    2012-01-01

    Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR) results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher's patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr−) cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa) and secreted (63–69 kDa) form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources. PMID:23091360

  19. Generation of a Chinese Hamster Ovary Cell Line Producing Recombinant Human Glucocerebrosidase

    Juliana Branco Novo

    2012-01-01

    Full Text Available Impaired activity of the lysosomal enzyme glucocerebrosidase (GCR results in the inherited metabolic disorder known as Gaucher disease. Current treatment consists of enzyme replacement therapy by administration of exogenous GCR. Although effective, it is exceptionally expensive, and patients worldwide have a limited access to this medicine. In Brazil, the public healthcare system provides the drug free of charge for all Gaucher’s patients, which reaches the order of $ 84 million per year. However, the production of GCR by public institutions in Brazil would reduce significantly the therapy costs. Here, we describe a robust protocol for the generation of a cell line producing recombinant human GCR. The protein was expressed in CHO-DXB11 (dhfr− cells after stable transfection and gene amplification with methotrexate. As expected, glycosylated GCR was detected by immunoblotting assay both as cell-associated (~64 and 59 kDa and secreted (63–69 kDa form. Analysis of subclones allowed the selection of stable CHO cells producing a secreted functional enzyme, with a calculated productivity of 5.14 pg/cell/day for the highest producer. Although being laborious, traditional methods of screening high-producing recombinant cells may represent a valuable alternative to generate expensive biopharmaceuticals in countries with limited resources.

  20. Liver sinusoidal endothelial cells induce immunosuppressive IL-10-producing Th1 cells via the Notch pathway.

    Neumann, Katrin; Rudolph, Christine; Neumann, Christian; Janke, Marko; Amsen, Derk; Scheffold, Alexander

    2015-07-01

    Under homeostasis, liver sinusoidal endothelial cells (LSECs) shift intrahepatic T-cell responses towards tolerance. However, the role of LSECs in the regulation of T-cell-induced liver inflammation is less clear. Here, we studied the capacity of LSECs to modulate pro-inflammatory Th1-cell differentiation in mice. Using in vitro co-culture systems and subsequent cytokine analysis, we showed that LSECs induced high amounts of the anti-inflammatory cytokine IL-10 in developing Th1 cells. These LSEC-stimulated Th1 cells had no pro-inflammatory capacity in vivo but instead actively suppressed an inflammatory Th1-cell-induced delayed-type hypersensitivity reaction. Blockage of IL-10 signaling in vivo inhibited immunosuppressive activity of LSEC-stimulated Th1 cells. We identified the Notch pathway as a mechanism how LSECs trigger IL-10 expression in Th1 cells. LSECs expressed high levels of the Delta-like and Jagged family of Notch ligands and induced expression of the Notch target genes hes-1 and deltex-1 in Th1 cells. Blockade of Notch signaling selectively inhibited IL-10 induction in Th1 cells by LSECs. Our findings suggest that LSEC-induced IL-10 expression in Th1 cells via the Notch pathway may contribute to the control of hepatic inflammatory immune responses by induction of a self-regulatory mechanism in pro-inflammatory Th1 cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Host cell capable of producing enzymes useful for degradation of lignocellulosic material

    Los, Alrik Pieter; Sagt, Cornelis Maria Jacobus; Schoonneveld-Bergmans, Margot Elisabeth Francoise; Damveld, Robbertus Antonius

    2017-08-22

    The invention relates to a host cell comprising at least four different heterologous polynucleotides chosen from the group of polynucleotides encoding cellulases, hemicellulases and pectinases, wherein the host cell is capable of producing the at least four different enzymes chosen from the group of cellulases, hemicellulases and pectinases, wherein the host cell is a filamentous fungus and is capable of secretion of the at least four different enzymes. This host cell can suitably be used for the production of an enzyme composition that can be used in a process for the saccharification of cellulosic material.

  2. Host cell capable of producing enzymes useful for degradation of lignocellulosic material

    Los, Alrik Pieter; Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Damveld, Robbertus Antonius

    2015-08-18

    The invention relates to a host cell comprising at least four different heterologous polynucleotides chosen from the group of polynucleotides encoding cellulases, hemicellulases and pectinases, wherein the host cell is capable of producing the at least four different enzymes chosen from the group of cellulases, hemicellulases and pectinases, wherein the host cell is a filamentous fungus and is capable of secretion of the at least four different enzymes. This host cell can suitably be used for the production of an enzyme composition that can be used in a process for the saccharification of cellulosic material.

  3. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria.

    Sibartie, Shomik

    2009-01-01

    BACKGROUND: Human intestinal epithelial cells (IECs) secrete the chemokine CCL20 in response to infection by various enteropathogenic bacteria or exposure to bacterial flagellin. CCL20 recruits immature dendritic cells and lymphocytes to target sites. Here we investigated IEC responses to various pathogenic and commensal bacteria as well as the modulatory effects of commensal bacteria on pathogen-induced CCL20 secretion. HT-29 human IECs were incubated with commensal bacteria (Bifidobacterium infantis or Lactobacillus salivarius), or with Salmonella typhimurium, its flagellin, Clostridium difficile, Mycobacterium paratuberculosis, or Mycobacterium smegmatis for varying times. In some studies, HT-29 cells were pre-treated with a commensal strain for 2 hr prior to infection or flagellin stimulation. CCL20 and interleukin (IL)-8 secretion and nuclear factor (NF)-kappaB activation were measured using enzyme-linked immunosorbent assays. RESULTS: Compared to untreated cells, S. typhimurium, C. difficile, M. paratuberculosis, and flagellin activated NF-kappaB and stimulated significant secretion of CCL20 and IL-8 by HT-29 cells. Conversely, B. infantis, L. salivarius or M. smegmatis did not activate NF-kappaB or augment CCL20 or IL-8 production. Treatment with B. infantis, but not L. salivarius, dose-dependently inhibited the baseline secretion of CCL20. In cells pre-treated with B. infantis, C. difficile-, S. typhimurium-, and flagellin-induced CCL20 were significantly attenuated. B. infantis did not limit M. Paratuberculosis-induced CCL20 secretion. CONCLUSION: This study is the first to demonstrate that a commensal strain can attenuate CCL20 secretion in HT-29 IECs. Collectively, the data indicate that M. paratuberculosis may mediate mucosal damage and that B. infantis can exert immunomodulatory effects on IECs that mediate host responses to flagellin and flagellated enteric pathogens.

  4. Ebola virus-like particles produced in insect cells exhibit dendritic cell stimulating activity and induce neutralizing antibodies

    Ye Ling; Lin Jianguo; Sun Yuliang; Bennouna, Soumaya; Lo, Michael; Wu Qingyang; Bu Zhigao; Pulendran, Bali; Compans, Richard W.; Yang Chinglai

    2006-01-01

    Recombinant baculoviruses (rBV) expressing Ebola virus VP40 (rBV-VP40) or GP (rBV-GP) proteins were generated. Infection of Sf9 insect cells by rBV-VP40 led to assembly and budding of filamentous particles from the cell surface as shown by electron microscopy. Ebola virus-like particles (VLPs) were produced by coinfection of Sf9 cells with rBV-VP40 and rBV-GP, and incorporation of Ebola GP into VLPs was demonstrated by SDS-PAGE and Western blot analysis. Recombinant baculovirus infection of insect cells yielded high levels of VLPs, which were shown to stimulate cytokine secretion from human dendritic cells similar to VLPs produced in mammalian cells. The immunogenicity of Ebola VLPs produced in insect cells was evaluated by immunization of mice. Analysis of antibody responses showed that most of the GP-specific antibodies were of the IgG2a subtype, while no significant level of IgG1 subtype antibodies specific for GP was induced, indicating the induction of a Th1-biased immune response. Furthermore, sera from Ebola VLP immunized mice were able to block infection by Ebola GP pseudotyped HIV virus in a single round infection assay, indicating that a neutralizing antibody against the Ebola GP protein was induced. These results show that production of Ebola VLPs in insect cells using recombinant baculoviruses represents a promising approach for vaccine development against Ebola virus infection

  5. Jasmonic Acid, Abscisic Acid, and Salicylic Acid Are Involved in the Phytoalexin Responses of Rice to Fusarium fujikuroi, a High Gibberellin Producer Pathogen.

    Siciliano, Ilenia; Amaral Carneiro, Greice; Spadaro, Davide; Garibaldi, Angelo; Gullino, Maria Lodovica

    2015-09-23

    Fusarium fujikuroi, the causal agent of bakanae disease, is the main seedborne pathogen on rice. To understand the basis of rice resistance, a quantitative method to simultaneously detect phytohormones and phytoalexins was developed by using HPLC-MS/MS. With this method dynamic profiles and possible interactions of defense-related phytohormones and phytoalexins were investigated on two rice cultivars, inoculated or not with F. fujikuroi. In the resistant cultivar Selenio, the presence of pathogen induced high production of phytoalexins, mainly sakuranetin, and symptoms of bakanae were not observed. On the contrary, in the susceptible genotype Dorella, the pathogen induced the production of gibberellin and abscisic acid and inhibited jasmonic acid production, phytoalexins were very low, and bakanae symptoms were observed. The results suggested that a wide range of secondary metabolites are involved in plant defense against pathogens and phytoalexin synthesis could be an important factor for rice resistance against bakanae disease.

  6. Alkane-grown Beauveria bassiana produce mycelial pellets displaying peroxisome proliferation, oxidative stress, and cell surface alterations.

    Huarte-Bonnet, Carla; Paixão, Flávia R S; Ponce, Juan C; Santana, Marianela; Prieto, Eduardo D; Pedrini, Nicolás

    2018-06-01

    The entomopathogenic fungus Beauveria bassiana is able to grow on insect cuticle hydrocarbons, inducing alkane assimilation pathways and concomitantly increasing virulence against insect hosts. In this study, we describe some physiological and molecular processes implicated in growth, nutritional stress response, and cellular alterations found in alkane-grown fungi. The fungal cytology was investigated using light and transmission electron microscopy while the surface topography was examined using atomic force microscopy. Additionally, the expression pattern of several genes associated with oxidative stress, peroxisome biogenesis, and hydrophobicity were analysed by qPCR. We found a novel type of growth in alkane-cultured B. bassiana similar to mycelial pellets described in other alkane-free fungi, which were able to produce viable conidia and to be pathogenic against larvae of the beetles Tenebrio molitor and Tribolium castaneum. Mycelial pellets were formed by hyphae cumulates with high peroxidase activity, exhibiting peroxisome proliferation and an apparent surface thickening. Alkane-grown conidia appeared to be more hydrophobic and cell surfaces displayed different topography than glucose-grown cells. We also found a significant induction in several genes encoding for peroxins, catalases, superoxide dismutases, and hydrophobins. These results show that both morphological and metabolic changes are triggered in mycelial pellets derived from alkane-grown B. bassiana. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  7. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    Barhoom Sima

    2008-02-01

    Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

  8. A Rapid Culture Technique Produces Functional Dendritic-Like Cells from Human Acute Myeloid Leukemia Cell Lines

    Jian Ning

    2011-01-01

    Full Text Available Most anti-cancer immunotherapeutic strategies involving dendritic cells (DC as vaccines rely upon the adoptive transfer of DC loaded with exogenous tumour-peptides. This study utilized human acute myeloid leukemia (AML cells as progenitors from which functional dendritic-like antigen presenting cells (DLC were generated, that constitutively express tumour antigens for recognition by CD8+ T cells. DLC were generated from AML cell lines KG-1 and MUTZ-3 using rapid culture techniques and appropriate cytokines. DLC were evaluated for their cell-surface phenotype, antigen uptake and ability to stimulate allogeneic responder cell proliferation, and production of IFN-γ; compared with DC derived from normal human PBMC donors. KG-1 and MUTZ-3 DLC increased expression of CD80, CD83, CD86, and HLA-DR, and MUTZ-3 DLC downregulated CD14 and expressed CD1a. Importantly, both KG-1 and MUTZ-3-derived DLC promoted proliferation of allogeneic responder cells more efficiently than unmodified cells; neither cells incorporated FITC-labeled dextran, but both stimulated IFN-γ production from responding allogeneic CD8+ T cells. Control DC produced from PBMC using the FastDC culture also expressed high levels of critical cell surface ligands and demonstrated good APC function. This paper indicates that functional DLC can be cultured from the AML cell lines KG-1 and MUTZ-3, and FastDC culture generates functional KG-1 DLC.

  9. Differentiated THP-1 Cells Exposed to Pathogenic and Nonpathogenic Borrelia Species Demonstrate Minimal Differences in Production of Four Inflammatory Cytokines.

    Stokes, John V; Moraru, Gail M; McIntosh, Chelsea; Kummari, Evangel; Rausch, Keiko; Varela-Stokes, Andrea S

    2016-11-01

    Tick-borne borreliae include Lyme disease and relapsing fever agents, and they are transmitted primarily by ixodid (hard) and argasid (soft) tick vectors, respectively. Tick-host interactions during feeding are complex, with host immune responses influenced by biological differences in tick feeding and individual differences within and between host species. One of the first encounters for spirochetes entering vertebrate host skin is with local antigen-presenting cells, regardless of whether the tick-associated Borrelia sp. is pathogenic. In this study, we performed a basic comparison of cytokine responses in THP-1-derived macrophages after exposure to selected borreliae, including a nonpathogen. By using THP-1 cells, differentiated to macrophages, we eliminated variations in host response and reduced the system to an in vitro model to evaluate the extent to which the Borrelia spp. influence cytokine production. Differentiated THP-1 cells were exposed to four Borrelia spp., Borrelia hermsii (DAH), Borrelia burgdorferi (B31), B. burgdorferi (NC-2), or Borrelia lonestari (LS-1), or lipopolysaccharides (LPS) (activated) or media (no treatment) controls. Intracellular and secreted interferon (IFN)-γ, interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α were measured using flow cytometric and Luminex-based assays, respectively, at 6, 24, and 48 h postexposure time points. Using a general linear model ANOVA for each cytokine, treatment (all Borrelia spp. and LPS compared to no treatment) had a significant effect on secreted TNF-α only. Time point had a significant effect on intracellular IFN-γ, TNF-α and IL-6. However, we did not see significant differences in selected cytokines among Borrelia spp. Thus, in this model, we were unable to distinguish pathogenic from nonpathogenic borreliae using the limited array of selected cytokines. While unique immune profiles may be detectable in an in vitro model and may reveal predictors for pathogenicity in borreliae

  10. [In vitro generation of insulin-producing cells from the neonatal rat bone marrow mesenchymal stem cells].

    Li, Xiaohu; Huang, Haiyan; Liu, Xirong; Xia, Hongxia; Li, Mincai

    2015-03-01

    To observe the differentiation of the neonatal rat bone marrow mesenchymal stem cells (MSCs) into insulin-producing cells and detect the expressions of insulin, pancreatic duodenal homebox-1 (PDX-1) and nestin. MSCs were isolated from the neonatal rats and cultured in the modified medium composed of 10 μg/L human epidermal growth factor (EGF), 10 μg/L basic fibroblast growth factor (bFGF), 10 μg/L hepatocyte growth factor (HGF), 10 μg/L human B cell regulin, 20 mmol/L nicotinamide and 20 g/L B27. After the induction, the mRNA expressions of insulin, PDX-1 and nestin were examined by reverse transcription-PCR, and the insulin, PDX-1 and nestin protein levels were detected by immunocytochemistry. The insulin and PDX-1 mRNA expressions increased and the nestin mRNA expression decreased in the differentiation of the neonatal rat MSCs into insulin-producing cells. The nestin, PDX-1 and insulin proteins were co-expressed in insulin-producing cells. MSCs can be induced to differentiate into insulin-producing cells.

  11. B Cells and B Cell Blasts Withstand Cryopreservation While Retaining Their Functionality for Producing Antibody

    Philipp Fecher

    2018-05-01

    Full Text Available In individuals who have once developed humoral immunity to an infectious/foreign antigen, the antibodies present in their body can mediate instant protection when the antigen re-enters. Such antigen-specific antibodies can be readily detected in the serum. Long term humoral immunity is, however, also critically dependent on the ability of memory B cells to engage in a secondary antibody response upon re-exposure to the antigen. Antibody molecules in the body are short lived, having a half-life of weeks, while memory B cells have a life span of decades. Therefore, the presence of serum antibodies is not always a reliable indicator of B cell memory and comprehensive monitoring of humoral immunity requires that both serum antibodies and memory B cells be assessed. The prevailing view is that resting memory B cells and B cell blasts in peripheral blood mononuclear cells (PBMC cannot be cryopreserved without losing their antibody secreting function, and regulated high throughput immune monitoring of B cell immunity is therefore confined to—and largely limited by—the need to test freshly isolated PBMC. Using optimized protocols for freezing and thawing of PBMC, and four color ImmunoSpot® analysis for the simultaneous detection of all immunoglobulin classes/subclasses we show here that both resting memory B cells and B cell blasts retain their ability to secrete antibody after thawing, and thus demonstrate the feasibility of B cell immune monitoring using cryopreserved PBMC.

  12. B Cells and B Cell Blasts Withstand Cryopreservation While Retaining Their Functionality for Producing Antibody.

    Fecher, Philipp; Caspell, Richard; Naeem, Villian; Karulin, Alexey Y; Kuerten, Stefanie; Lehmann, Paul V

    2018-05-31

    In individuals who have once developed humoral immunity to an infectious/foreign antigen, the antibodies present in their body can mediate instant protection when the antigen re-enters. Such antigen-specific antibodies can be readily detected in the serum. Long term humoral immunity is, however, also critically dependent on the ability of memory B cells to engage in a secondary antibody response upon re-exposure to the antigen. Antibody molecules in the body are short lived, having a half-life of weeks, while memory B cells have a life span of decades. Therefore, the presence of serum antibodies is not always a reliable indicator of B cell memory and comprehensive monitoring of humoral immunity requires that both serum antibodies and memory B cells be assessed. The prevailing view is that resting memory B cells and B cell blasts in peripheral blood mononuclear cells (PBMC) cannot be cryopreserved without losing their antibody secreting function, and regulated high throughput immune monitoring of B cell immunity is therefore confined to-and largely limited by-the need to test freshly isolated PBMC. Using optimized protocols for freezing and thawing of PBMC, and four color ImmunoSpot ® analysis for the simultaneous detection of all immunoglobulin classes/subclasses we show here that both resting memory B cells and B cell blasts retain their ability to secrete antibody after thawing, and thus demonstrate the feasibility of B cell immune monitoring using cryopreserved PBMC.

  13. In vitro generation of functional insulin-producing cells from lipoaspirated human adipose tissue-derived stem cells.

    Mohamad Buang, Mohamad Lizan; Seng, Heng Kien; Chung, Lee Han; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2012-01-01

    Tissue engineering strategy has been considered as an alternative treatment for diabetes mellitus due to lack of permanent pharmaceutical treatment and islet donors for transplantation. Various cell lines have been used to generate functional insulin-producing cells (IPCs) including progenitor pancreatic cell lines, embryonic stem cells (ESCs), umbilical cord blood stem cells (UCB-SCs), adult bone marrow stem cells (BMSCs), and adipose tissue-derived stem cells (ADSCs). Human ADSCs from lipoaspirated abdominal fat tissue was differentiated into IPCs following a two-step induction protocol based on a combination of alternating high and low glucose, nicotinamide, activin A and glucagon-like peptide 1 (GLP-1) for a duration of 3 weeks. During differentiation, histomorphological changes of the stem cells towards pancreatic β-islet characteristics were observed via light microscope and transmission electron microscope (TEM). Dithizone (DTZ) staining, which is selective towards IPCs, was used to stain the new islet-like cells. Production of insulin hormone by the cells was analyzed via enzyme-linked immunosorbent assay (ELISA), whereas its hormonal regulation was tested via a glucose challenge test. Histomorphological changes of the differentiated cells were noted to resemble pancreatic β-cells, whereas DTZ staining positively stained the cells. The differentiated cells significantly produced human insulin as compared to the undifferentiated ADSCs, and its production was increased with an increase of glucose concentration in the culture medium. These initial data indicate that human lipoaspirated ADSCs have the potential to differentiate into functional IPCs, and could be used as a therapy to treat diabetes mellitus in the future. Copyright © 2012 IMSS. Published by Elsevier Inc. All rights reserved.

  14. Heat Shock Protein 47: A Novel Biomarker of Phenotypically Altered Collagen-Producing Cells

    Taguchi, Takashi; Nazneen, Arifa; Al-Shihri, Abdulmonem A.; Turkistani, Khadijah A.; Razzaque, Mohammed S.

    2011-01-01

    Heat shock protein 47 (HSP47) is a collagen-specific molecular chaperone that helps the molecular maturation of various types of collagens. A close association between increased expression of HSP47 and the excessive accumulation of collagens is found in various human and experimental fibrotic diseases. Increased levels of HSP47 in fibrotic diseases are thought to assist in the increased assembly of procollagen, and thereby contribute to the excessive deposition of collagens in fibrotic areas. Currently, there is not a good universal histological marker to identify collagen-producing cells. Identifying phenotypically altered collagen-producing cells is essential for the development of cell-based therapies to reduce the progression of fibrotic diseases. Since HSP47 has a single substrate, which is collagen, the HSP47 cellular expression provides a novel universal biomarker to identify phenotypically altered collagen-producing cells during wound healing and fibrosis. In this brief article, we explained why HSP47 could be used as a universal marker for identifying phenotypically altered collagen-producing cells

  15. Neuropharmacological and neuroprotective activities of some metabolites produced by cell suspension culture of Waltheria americana Linn.

    Mundo, Jorge; Villeda-Hernández, Juana; Herrera-Ruiz, Maribel; Gutiérrez, María Del Carmen; Arellano-García, Jesús; León-Rivera, Ismael; Perea-Arango, Irene

    2017-10-01

    Waltheria americana is a plant used in Mexican traditional medicine to treat some nervous system disorders. The aims of the present study were to isolate and determine the neuropharmacological and neurprotective activities of metabolites produced by a cell suspension culture of Waltheria americana. Submerged cultivation of W. americana cells provided biomass. A methanol-soluble extract (WAsc) was obtained from biomass. WAsc was fractionated yielding the chromatographic fractions 4WAsc-H 2 O and WAsc-CH 2 Cl 2 . For the determination of anticonvulsant activity in vivo, seizures were induced in mice by pentylenetetrazol (PTZ). Neuropharmacological activities (release of gamma amino butyric acid (GABA) and neuroprotection) of chromatographic fractions were determined by in vitro histological analysis of brain sections of mice post mortem. Fraction 4WAsc-H 2 O (containing saccharides) did not produce neuronal damage, neurodegeneration, interstitial tissue edema, astrocytic activation, nor cell death. Pretreatment of animals with 4WAsc-H 2 O and WAsc-CH 2 Cl 2 from W. americana cell suspensions induced an increase in: GABA release, seizure latency, survival time, neuroprotection, and a decrease in the degree of severity of tonic/tonic-clonic convulsions, preventing PTZ-induced death of up to 100% of animals of study. Bioactive compounds produced in suspension cell culture of W. americana produce neuroprotective and neuropharmacological activities associated with the GABAergic neurotransmission system. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Bone marrow stromal cells spontaneously produce Flt3-ligand: influence of ionizing radiations and cytokine stimulation.

    Bertho, Jean Marc; Demarquay, Christelle; Mouiseddine, Moubarak; Douenat, Noémie; Stefani, Johanna; Prat, Marie; Paquet, François

    2008-08-01

    To define the ability of human bone marrow (BM) stromal cells to produce fms-like tyrosine kinase 3 (Flt3)-ligand (FL), and the effect of irradiation, tumour necrosis factor-alpha (TNFalpha) or tumour growth factor beta (TGFbeta) on FL production. Primary BM stromal cell cultures were irradiated at 2-10 Gy or were stimulated with TNFalpha or TGFbeta1. The presence of FL was tested in culture supernatants and in cell lysate. The presence of a membrane-bound form of FL and the level of gene expression were also tested. Primary BM stromal cells spontaneously released FL. This production was increased by TNFalpha but not by TGFbeta1 or by irradiation. Chemical induction of osteoblastic differentiation from BM stromal cells also induced an increase in FL release. Our results suggest that the observed increase in FL concentration after in vivo irradiation is an indirect effect. The possible implication of BM stromal cells in these mechanisms is discussed.

  17. High numbers of IL-2-producing CD8+ T cells during viral infection: correlation with stable memory development

    Kristensen, Nanna Ny; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    2002-01-01

    that IL-2-producing cells appear slightly delayed compared with the majority of IFN-gamma producing cells, and the relative frequency of the IL-2-producing subset increases with transition into the memory phase. In contrast to acute immunizing infection, few IL-2-producing cells are generated during...... chronic LCMV infection. Furthermore, in MHC class II-deficient mice, which only transiently control LCMV infection, IL-2-producing CD8+ T cells are initially generated, but by 4 weeks after infection this subset has nearly disappeared. Eventually the capacity to produce IFN-gamma also becomes impaired...

  18. Stable producer cell lines for adeno-associated virus (AAV) assembly.

    Chadeuf, Gilliane; Salvetti, Anna

    2010-10-01

    Stable producer cell lines containing both the rep and cap genes and recombinant adeno-associated virus (rAAV) vectors can be infected with a helper virus to provide reliable and efficient production of rAAV stocks. However, the development of these cell lines is time-consuming. The procedure described here is therefore recommended only for studies requiring the production of high amounts of rAAV, such as preclinical studies performed in large animals.

  19. Paramecium species ingest and kill the cells of the human pathogenic fungus Cryptococcus neoformans.

    Frager, Shalom Z; Chrisman, Cara J; Shakked, Rachel; Casadevall, Arturo

    2010-08-01

    A fundamental question in the field of medical mycology is the origin of virulence in those fungal pathogens acquired directly from the environment. In recent years, it was proposed that the virulence of certain environmental animal-pathogenic microbes, such as Cryptococcus neoformans, originated from selection pressures caused by species-specific predation. In this study, we analyzed the interaction of C. neoformans with three Paramecium spp., all of which are ciliated mobile protists. In contrast to the interaction with amoebae, some Paramecium spp. rapidly ingested C. neoformans and killed the fungus. This study establishes yet another type of protist-fungal interaction supporting the notion that animal-pathogenic fungi in the environment are under constant selection by predation.

  20. Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

    Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

    2017-01-01

    The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

  1. De Novo Formation of Insulin-Producing “Neo-β Cell Islets” from Intestinal Crypts

    Yi-Ju Chen

    2014-03-01

    Full Text Available The ability to interconvert terminally differentiated cells could serve as a powerful tool for cell-based treatment of degenerative diseases, including diabetes mellitus. To determine which, if any, adult tissues are competent to activate an islet β cell program, we performed an in vivo screen by expressing three β cell “reprogramming factors” in a wide spectrum of tissues. We report that transient intestinal expression of these factors—Pdx1, MafA, and Ngn3 (PMN—promotes rapid conversion of intestinal crypt cells into endocrine cells, which coalesce into “neoislets” below the crypt base. Neoislet cells express insulin and show ultrastructural features of β cells. Importantly, intestinal neoislets are glucose-responsive and able to ameliorate hyperglycemia in diabetic mice. Moreover, PMN expression in human intestinal “organoids” stimulates the conversion of intestinal epithelial cells into β-like cells. Our results thus demonstrate that the intestine is an accessible and abundant source of functional insulin-producing cells.

  2. Designer exosomes produced by implanted cells intracerebrally deliver therapeutic cargo for Parkinson's disease treatment.

    Kojima, Ryosuke; Bojar, Daniel; Rizzi, Giorgio; Hamri, Ghislaine Charpin-El; El-Baba, Marie Daoud; Saxena, Pratik; Ausländer, Simon; Tan, Kelly R; Fussenegger, Martin

    2018-04-03

    Exosomes are cell-derived nanovesicles (50-150 nm), which mediate intercellular communication, and are candidate therapeutic agents. However, inefficiency of exosomal message transfer, such as mRNA, and lack of methods to create designer exosomes have hampered their development into therapeutic interventions. Here, we report a set of EXOsomal transfer into cells (EXOtic) devices that enable efficient, customizable production of designer exosomes in engineered mammalian cells. These genetically encoded devices in exosome producer cells enhance exosome production, specific mRNA packaging, and delivery of the mRNA into the cytosol of target cells, enabling efficient cell-to-cell communication without the need to concentrate exosomes. Further, engineered producer cells implanted in living mice could consistently deliver cargo mRNA to the brain. Therapeutic catalase mRNA delivery by designer exosomes attenuated neurotoxicity and neuroinflammation in in vitro and in vivo models of Parkinson's disease, indicating the potential usefulness of the EXOtic devices for RNA delivery-based therapeutic applications.

  3. Human B cells produce chemokine CXCL10 in the presence of Mycobacterium tuberculosis specific T cells

    Hoff, Soren T; Salman, Ahmed M; Ruhwald, Morten

    2015-01-01

    BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment. A candid......BACKGROUND: The role of B cells in human host response to Mycobacterium tuberculosis (Mtb) infection is still controversial, but recent evidence suggest that B cell follicle like structures within the lung may influence host responses through regulation of the local cytokine environment...

  4. CD4(+) T cells producing interleukin (IL)-17, IL-22 and interferon-? are major effector T cells in nickel allergy

    Dyring Andersen, Beatrice; Skov, Lone; Løvendorf, Marianne B

    2013-01-01

    the frequencies of CD4(+) , CD8(+) and γδ T cells producing IL-17, IL-22 and interferon (IFN)-γ in the blood and skin from nickel-allergic patients. Patients/materials/methods Blood samples were collected from 14 patients and 17 controls, and analysed by flow cytometry. Biopsies were taken from 5 patients and 6......-allergic patients, there was massive cellular infiltration dominated by CD4(+) T cells producing IL-17, IL-22 and IFN-γ in nickel-challenged skin but not in vehicle-challenged skin. Conclusion CD4(+) T cells producing IL-17, IL-22 and IFN-γ are important effector cells in the eczematous reactions of nickel......Background It has been suggested that interleukin (IL)-17 and IL-22 play important roles in the elicitation of human allergic contact dermatitis; however, the frequencies of T cell subtypes producing IL-17 and IL-22 in human allergic contact dermatitis are unknown. Objectives To determine...

  5. Platelet lysates produced from expired platelet concentrates support growth and osteogenic differentiation of mesenchymal stem cells.

    Sandra Mjoll Jonsdottir-Buch

    Full Text Available BACKGROUND: Mesenchymal stem cells are promising candidates in regenerative cell therapy. Conventional culture methods involve the use of animal substances, specifically fetal bovine serum as growth supplement. Since the use of animal-derived products is undesirable for human applications, platelet lysates produced from human platelets are an attractive alternative. This is especially true if platelet lysates from already approved transfusion units at blood banks can be utilized. The purpose of this study was to produce human platelet lysates from expired, blood bank-approved platelet concentrates and evaluate their use as growth supplement in the culture of mesenchymal stem cells. METHODOLOGY/PRINCIPAL FINDINGS: In this study, bone marrow-derived mesenchymal stem cells were cultured with one of three culture supplements; fetal bovine serum, lysates from freshly prepared human platelet concentrates, or lysates from expired human platelet concentrates. The effects of these platelet-derived culture supplements on basic mesenchymal stem cell characteristics were evaluated. All cultures maintained the typical mesenchymal stem cell surface marker expression, trilineage differentiation potential, and the ability to suppress in vitro immune responses. However, mesenchymal stem cells supplemented with platelet lysates proliferated faster than traditionally cultured cells and increased the expression of the osteogenic marker gene RUNX-2; yet no difference between the use of fresh and expired platelet concentrates was observed. CONCLUSION/SIGNIFICANCE: Our findings suggest that human platelet lysates produced from expired platelet concentrates can be used as an alternative to fetal bovine serum for mesenchymal stem cell culture to the same extent as lysates from fresh platelets.

  6. Porcine circovirus type 2 associated reproductive failure in a specific pathogen free (SPF piglet producing herd in Norway: a case report

    M. Oropeza-Moe

    2017-10-01

    Full Text Available Abstract Background Since 1999, scientists have published evidence of transplacental infection by porcine circovirus type 2 (PCV2 and reproductive failure in pigs. Affected herds have frequently been start-up herds, either naïve or with a high proportion of PCV2 susceptible gilts. Here, delayed farrowing in non-vaccinated gilts was observed in a commercial specific pathogen free (SPF herd. Mummified fetuses and stillborn piglets recovered from these gilts were PCV2 positive. Case presentation The case herd was a self-recruiting, piglet producing unit of 240 sows. After detecting livestock associated methicillin resistant Staphylococcus aureus (LA-MRSA, CC398, stamping out was imposed by the authorities. An SPF herd was re-established and all dams were vaccinated against PCV2 until the farmer decided to exclude this vaccine. The first non-vaccinated batch consisted of 76% gilts. Here, one gilt showed signs of impending farrowing. This gilt was slaughtered three to four weeks after the expected farrowing date without having expelled any uterine contents. In the subsequent batch consisting of 79% gilts, three gilts showed similar clinical signs. Delayed farrowing was observed in two of these gilts and the uterine contents from the third gilt were recovered at the abattoir. Mummified fetuses and stillborn piglets were recovered from all three gilts. High levels of PCV2 DNA (>107 viral genomic copies/ 500 ng tissue were found in myocardial samples by real-time PCR analysis. One myocardial sample submitted for immunohistochemical (IHC analysis showed moderate amounts of PCV2 antigen. In the subsequent batch consisting of 77% gilts, several weak-born piglets were seen across different litters. Conclusions This case report describes an apparent link between in utero PCV2 infection, pre partum nest-building behaviour, mammary development and delayed farrowing. To date, no reports have described imminent signs of farrowing and delayed farrowing as

  7. Effect of combined treatment with preoperative. gamma. -therapy on function of gastrin producing cells in patients with gastric cancer

    Berdov, B A; Vedzizheva, T B; Bassalyk, L S; Zagrebin, V M [Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii; Akademiya Meditsinskikh Nauk SSSR, Moscow. Onkologicheskij Nauchnyj Tsentr)

    1982-04-01

    It is stated that preoperative irradiation with the dose of 20 Gy doesn't produce any considerable effect on function of the extragastric gastrin producing cells. Despite the decrease of reserve potentialities of gastrin producing cells in patients with stomach cancer the basal level of gastrin in the group of gastric cancer patients on the whole is higher than in practically healthy people. Radiotherapy results in the pronounced inhiibition of gastrin synthesis and secretion of gastrin producing cells.

  8. RNA-Seq Highlights High Clonal Variation in Monoclonal Antibody Producing CHO Cells

    Orellana, Camila A.; Marcellin, Esteban; Palfreyman, Robin W.

    2018-01-01

    The development of next-generation sequencing technologies has opened new opportunities to better characterize complex eukaryotic cells. Chinese hamster ovary (CHO) cells play a primary role in therapeutic protein production, with currently five of the top ten blockbuster drugs produced in CHO......-regulation of genes encoding secreted glycoproteins is found to be the most significant change. The large number of significant differences even between subclones challenges the notion of identifying and manipulating a few key genes to generate high production CHO cell lines....

  9. Multiple growth hormone-binding proteins are expressed on insulin-producing cells

    Møldrup, A; Billestrup, N; Thorn, N A

    1989-01-01

    The insulin-producing rat islet tumor cell line, RIN-5AH, expresses somatogen binding sites and responds to GH by increased proliferation and insulin production. Affinity cross-linking shows that RIN-5AH cells contain two major GH-binding subunits of Mr 100-130K (110K), which appear to exist as d....... It is concluded that the RIN-5AH cells have multiple GH-binding proteins which may mediate signals for either proliferation and/or insulin production....

  10. [Renal cell carcinoma producing erythrocytosis due to inappropriate production of erythropoietin].

    Villanueva-Gimeno, M M; Vicario-Bermúdez, J M; Fonseca-López, Ch; Caballero-Castro, J P; Zabala-López, S I; Sánchez-Elipe, M A; González-Gómez, N

    2013-01-01

    Erythrocytosis, or polycythaemia, is an increase, in absolute terms, of the erythrocyte mass. The most common solid tumour related to this phenomenon is renal cell carcinoma, which can produce erythrocytosis by increasing erythropoietin production. About 30% of symptomatic renal cell carcinomas are diagnosed due to the appearance of a paraneoplastic syndrome. Polycythaemia is one of these. Surgery, (radical or partial nephrectomy), is the treatment of choice in renal cell carcinoma and helps to keep the erythrocytosis situation under control. Copyright © 2011 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

  11. Perivascular Adipose Tissue Harbors Atheroprotective IgM-Producing B Cells

    Prasad Srikakulapu

    2017-09-01

    Full Text Available Adipose tissue surrounding major arteries (Perivascular adipose tissue or PVAT has long been thought to exist to provide vessel support and insulation. Emerging evidence suggests that PVAT regulates artery physiology and pathology, such as, promoting atherosclerosis development through local production of inflammatory cytokines. Yet the immune subtypes in PVAT that regulate inflammation are poorly characterized. B cells have emerged as important immune cells in the regulation of visceral adipose tissue inflammation and atherosclerosis. B cell-mediated effects on atherosclerosis are subset-dependent with B-1 cells attenuating and B-2 cells aggravating atherosclerosis. While mechanisms whereby B-2 cells aggravate atherosclerosis are less clear, production of immunoglobulin type M (IgM antibodies is thought to be a major mechanism whereby B-1 cells limit atherosclerosis development. B-1 cell-derived IgM to oxidation specific epitopes (OSE on low density lipoproteins (LDL blocks oxidized LDL-induced inflammatory cytokine production and foam cell formation. However, whether PVAT contains B-1 cells and whether atheroprotective IgM is produced in PVAT is unknown. Results of the present study provide clear evidence that the majority of B cells in and around the aorta are derived from PVAT. Interestingly, a large proportion of these B cells belong to the B-1 subset with the B-1/B-2 ratio being 10-fold higher in PVAT relative to spleen and bone marrow. Moreover, PVAT contains significantly greater numbers of IgM secreting cells than the aorta. ApoE−/− mice with B cell-specific knockout of the gene encoding the helix-loop-helix factor Id3, known to have attenuated diet-induced atherosclerosis, have increased numbers of B-1b cells and increased IgM secreting cells in PVAT relative to littermate controls. Immunostaining of PVAT on human coronary arteries identified fat associated lymphoid clusters (FALCs harboring high numbers of B cells, and flow

  12. Wnt signaling requires retromer-dependent recycling of MIG-14/Wntless in Wnt-producing cells.

    Yang, P.T.; Lorenowicz, M.J.; Silhankova, M.; Coudreuse, D.Y.M.; Betist, M.C.; Korswagen, H.C.

    2008-01-01

    Wnt proteins are secreted signaling molecules that play a central role in development and adult tissue homeostasis. We have previously shown that Wnt signaling requires retromer function in Wnt-producing cells. The retromer is a multiprotein complex that mediates endosome-to-Golgi transport of

  13. Bet-hedging in bacteriocin producing Escherichia coli populations: the single cell perspective

    Bayramoglu, Bihter; Toubiana, David; van Vliet, Simon; Inglis, R. Fredrik; Shnerb, Nadav; Gillor, Osnat

    2017-02-01

    Production of public goods in biological systems is often a collaborative effort that may be detrimental to the producers. It is therefore sustainable only if a small fraction of the population shoulders the cost while the majority reap the benefits. We modelled this scenario using Escherichia coli populations producing colicins, an antibiotic that kills producer cells’ close relatives. Colicin expression is a costly trait, and it has been proposed that only a small fraction of the population actively expresses the antibiotic. Colicinogenic populations were followed at the single-cell level using time-lapse microscopy, and showed two distinct, albeit dynamic, subpopulations: the majority silenced colicin expression, while a small fraction of elongated, slow-growing cells formed colicin-expressing hotspots, placing a significant burden on expressers. Moreover, monitoring lineages of individual colicinogenic cells showed stochastic switching between expressers and non-expressers. Hence, colicin expressers may be engaged in risk-reducing strategies—or bet-hedging—as they balance the cost of colicin production with the need to repel competitors. To test the bet-hedging strategy in colicin-mediated interactions, competitions between colicin-sensitive and producer cells were simulated using a numerical model, demonstrating a finely balanced expression range that is essential to sustaining the colicinogenic population.

  14. ANGPTL4 is produced by entero-endocrine cells in the human intestinal tract

    Alex, S.; Lichtenstein, L.L.; Dijk, W.; Mensink, R.P.; Tan, N.S.; Kersten, A.H.

    2014-01-01

    Gut hormones produced by entero-endocrine cells (EEC) located throughout the gastrointestinal tract play a major role in the regulation of glucose and energy homeostasis. Angiopoietin-like 4 (ANGPTL4, also referred to as fasting induced adipose factor) is a secreted factor involved in regulation of

  15. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  16. Identification and characterization of smallest pore-forming protein in the cell wall of pathogenic Corynebacterium urealyticum DSM 7109.

    Abdali, Narges; Younas, Farhan; Mafakheri, Samaneh; Pothula, Karunakar R; Kleinekathöfer, Ulrich; Tauch, Andreas; Benz, Roland

    2018-05-09

    Corynebacterium urealyticum, a pathogenic, multidrug resistant member of the mycolata, is known as causative agent of urinary tract infections although it is a bacterium of the skin flora. This pathogenic bacterium shares with the mycolata the property of having an unusual cell envelope composition and architecture, typical for the genus Corynebacterium. The cell wall of members of the mycolata contains channel-forming proteins for the uptake of solutes. In this study, we provide novel information on the identification and characterization of a pore-forming protein in the cell wall of C. urealyticum DSM 7109. Detergent extracts of whole C. urealyticum cultures formed in lipid bilayer membranes slightly cation-selective pores with a single-channel conductance of 1.75 nS in 1 M KCl. Experiments with different salts and non-electrolytes suggested that the cell wall pore of C. urealyticum is wide and water-filled and has a diameter of about 1.8 nm. Molecular modelling and dynamics has been performed to obtain a model of the pore. For the search of the gene coding for the cell wall pore of C. urealyticum we looked in the known genome of C. urealyticum for a similar chromosomal localization of the porin gene to known porH and porA genes of other Corynebacterium strains. Three genes are located between the genes coding for GroEL2 and polyphosphate kinase (PKK2). Two of the genes (cur_1714 and cur_1715) were expressed in different constructs in C. glutamicum ΔporAΔporH and in porin-deficient BL21 DE3 Omp8 E. coli strains. The results suggested that the gene cur_1714 codes alone for the cell wall channel. The cell wall porin of C. urealyticum termed PorACur was purified to homogeneity using different biochemical methods and had an apparent molecular mass of about 4 kDa on tricine-containing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Biophysical characterization of the purified protein (PorACur) suggested indeed that cur_1714 is the gene

  17. In vitro cell quality of buffy coat platelets in additive solution treated with pathogen reduction technology

    Ostrowski, Sisse R; Bochsen, Louise; Salado-Jimena, José A

    2010-01-01

    Pathogen reduction technologies (PRTs) may induce storage lesion in platelet (PLT) concentrates. To investigate this, buffy coat PLTs (BCPs) in PLT additive solution (AS; SSP+) with or without Mirasol PRT (CaridianBCT Biotechnologies) were assessed by quality control tests and four-color flow...

  18. Genetic correlations between pathogen-specific mastitis and somatic cell count in Danish Holsteins

    Sørensen, Lars Peter; Mark, Thomas; Madsen, P.

    2009-01-01

    _170) or 300 d (LASCC_300) after calving, and the mastitis traits were unspecific mastitis (all mastitis treatments, both clinical and subclinical, regardless of the causative pathogen) and mastitis caused by either Streptococcus dysgalactiae, Escherichia coli, coagulase-negative staphylococci (CNS...

  19. Skin-infiltrating, interleukin-22-producing T cells differentiate pediatric psoriasis from adult psoriasis.

    Cordoro, Kelly M; Hitraya-Low, Maria; Taravati, Keyon; Sandoval, Priscila Munoz; Kim, Esther; Sugarman, Jeffrey; Pauli, Mariela L; Liao, Wilson; Rosenblum, Michael D

    2017-09-01

    Evidence from adult psoriasis studies implicates an imbalance between regulatory and effector T cells, particularly T H -17-producing T cells, in the pathogenesis of psoriasis. Little is known about the immunopathology of psoriasis in children. We sought to functionally characterize the inflammatory cell profiles of psoriatic plaques from pediatric patients and compare them with healthy, age-matched controls and adult psoriasis patients. Skin samples from pediatric psoriasis patients and healthy controls were analyzed by multiparameter flow cytometry to determine the dominant immune cell subsets present and cytokines produced. Lesional tissue from pediatric psoriasis patients had significantly increased interleukin (IL) 22 derived from CD4 + and CD8 + cells compared with the tissues from healthy pediatric controls and adult psoriasis patients. Tissue from pediatric psoriasis patients had significantly less elevation of IL-17 derived from CD4 + and CD8 + cells compared with the tissue from adult psoriasis patients. In contrast with the lesions from adult patients, lesional skin in pediatric patients with psoriasis did not have increases in regulatory T cells. This is a pilot study, thus the sample size is small. Significant differences in IL-17 and IL-22 expression were observed in the pediatric psoriasis patients compared with pediatric healthy controls and adult psoriasis patients. IL-22 might be relevant in the pathogenesis of pediatric psoriasis and represents a potential treatment target unique to pediatric psoriasis. Copyright © 2017 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  20. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    Tamura, Shogo [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Research Fellow of the Japan Society for the Promotion of Science, Tokyo (Japan); Nagasawa, Ayumi; Masuda, Yuya; Tsunematsu, Tetsuya [Graduate School of Health Sciences, Hokkaido University, Sapporo (Japan); Hayasaka, Koji; Matsuno, Kazuhiko; Shimizu, Chikara [Division of Laboratory and Transfusion Medicine, Hokkaido University Hospital, Sapporo (Japan); Ozaki, Yukio [Department of Clinical and Laboratory Medicine, Faculty of Medicine, University of Yamanashi (Japan); Moriyama, Takanori, E-mail: moriyama@hs.hokuda.ac.jp [Medical Laboratory Science, Faculty of Health Sciences, Hokkaido University, Sapporo (Japan)

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer It has been thought that BDNF is not produced in the megakaryocytic lineage. Black-Right-Pointing-Pointer MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. Black-Right-Pointing-Pointer BDNF accelerates proliferation of MEG-01 in an autocrine manner. Black-Right-Pointing-Pointer BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  1. BDNF, produced by a TPO-stimulated megakaryocytic cell line, regulates autocrine proliferation

    Tamura, Shogo; Nagasawa, Ayumi; Masuda, Yuya; Tsunematsu, Tetsuya; Hayasaka, Koji; Matsuno, Kazuhiko; Shimizu, Chikara; Ozaki, Yukio; Moriyama, Takanori

    2012-01-01

    Highlights: ► It has been thought that BDNF is not produced in the megakaryocytic lineage. ► MEG-01 produces BDNF upon TPO stimulation and regulates its proliferation. ► BDNF accelerates proliferation of MEG-01 in an autocrine manner. ► BDNF may be an autocrine MEG-CSF, which regulates megakaryopoiesis. -- Abstract: While human platelets release endogenous brain-derived neurotrophic factor (BDNF) upon activation, a previous report on MEG-01, a megakaryocytic cell line, found no trace of BDNF production, and the pathophysiological function of platelet BDNF has remained elusive. In the present study, we demonstrate that MEG-01 produces BDNF in the presence of TPO and that this serves to potentiate cell proliferation. Our in vitro findings suggest that BDNF regulates MEG-01 proliferation in an autocrine manner, and we suggest that BDNF may be a physiological autocrine regulator of megakaryocyte progenitors.

  2. Evidence for paracrine/autocrine regulation of GLP-1-producing cells

    Kappe, Camilla; Zhang, Qimin; Holst, Jens Juul

    2013-01-01

    Glucagon-like peptide-1 (GLP-1), secreted from gut L cells upon nutrient intake, forms the basis for novel drugs against type 2 diabetes (T2D). Secretion of GLP-1 has been suggested to be impaired in T2D and in conditions associated with hyperlipidemia and insulin resistance. Further, recent...... studies support lipotoxicity of GLP-1-producing cells in vitro. However, little is known about the regulation of L-cell viability/function, the effects of insulin signaling, or the potential effects of stable GLP-1 analogs and dipeptidyl peptidase-4 (DPP-4) inhibitors. We determined effects of insulin...... as well as possible autocrine action of GLP-1 on viability/apoptosis of GLP-1-secreting cells in the presence/absence of palmitate, while also assessing direct effects on function. The studies were performed using the GLP-1-secreting cell line GLUTag, and palmitate was used to simulate hyperlipidemia. Our...

  3. Identification of IFN-gamma-producing CD4+ T cells following PMA stimulation

    Kemp, K; Bruunsgaard, H

    2001-01-01

    Treatment of T cells with phorbol esters, such as phorbol myristate acetate (PMA), induces downregulation of CD4, making unambiguous identification of this subset difficult. In this study, the kinetics of intracellular expression of interferon-gamma (IFN-gamma) and downmodulation of surface CD4...... were measured in peripheral blood mononuclear cells (PBMC) after PMA stimulation. The number of IFN-gamma-producing cells increased within a 4-h period while the fluorescence intensity of the CD4(+) cell population decreased, and the two phenomena were correlated (n = 9; p = 0.01). Our data suggest...... that intracellular staining of CD4 together with cytokine staining will make identification of CD4(+) cells possible and facilitate the procedure of intracellular staining of cytokines....

  4. Inhibition of osteoclastogenesis by osteoblast-like cells genetically engineered to produce interleukin-10.

    Fujioka, Kazuki; Kishida, Tsunao; Ejima, Akika; Yamamoto, Kenta; Fujii, Wataru; Murakami, Ken; Seno, Takahiro; Yamamoto, Aihiro; Kohno, Masataka; Oda, Ryo; Yamamoto, Toshiro; Fujiwara, Hiroyoshi; Kawahito, Yutaka; Mazda, Osam

    2015-01-16

    Bone destruction at inflamed joints is an important complication associated with rheumatoid arthritis (RA). Interleukin-10 (IL-10) may suppress not only inflammation but also induction of osteoclasts that play key roles in the bone destruction. If IL-10-producing osteoblast-like cells are induced from patient somatic cells and transplanted back into the destructive bone lesion, such therapy may promote bone remodeling by the cooperative effects of IL-10 and osteoblasts. We transduced mouse fibroblasts with genes for IL-10 and Runx2 that is a crucial transcription factor for osteoblast differentiation. The IL-10-producing induced osteoblast-like cells (IL-10-iOBs) strongly expressed osteoblast-specific genes and massively produced bone matrix that were mineralized by calcium phosphate in vitro and in vivo. Culture supernatant of IL-10-iOBs significantly suppressed induction of osteoclast from RANKL-stimulated Raw264.7 cells as well as LPS-induced production of inflammatory cytokine by macrophages. The IL-10-iOBs may be applicable to novel cell-based therapy against bone destruction associated with RA. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Ultraviolet-Mediated Activation of Photo toxins from Peganum Harmala L. Seedlings to Control both Human-and Phyto-Pathogenic Microorganisms and Tumor Cells

    Kord, M.; Khafagi, I.; Dewedar, A.

    2003-01-01

    The medicinal plant Peganum harmala L. (zygophyllaceae) contains a number of Beta-carboline alkaloids, which are photosensitizers to bacteria, yeasts and eukaryotic cells in the presence of sunlight and artificial sources of long-wave UV radiation (365 nm). Ultraviolet irradiation of ten-day old aseptically germinated Peganum harmala inoculated on bacterial and yeast bioassay plates elicits strong phototoxic antimicrobials. Callus as well as crude methanol extracts of in vitro cultures were also investigated for the accumulation of photosensitizers. High performance liquid chromatographic analyses of irradiated and control tissues followed by fluorescent detection at 302 nm revealed the formation of serotonin (5-hydroxytryptamine) in irradiated tissues only. Eluted compounds detected at 330 nm revealed more than ten-fold accumulation of harmine, isoharmine and harmol in irradiated tissues. Moreover, several simple beta-carboline alkaloids were produced through irradiation with UV such as harmalanine and harmalacidine. UV-induced phototoxicity was proven against phyto pathogenic bacteria and human-pathogenic bacteria and yeasts. Photo-induced cytotoxicity was observed from two different toxicity bioassays, which are Artemia saline and potato discs tumor assay. The selective UV-dependent biological activities may imply a pharmacological potential of Peganum harmala in the control of infectious diseases and tumor tissues

  6. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation.

    Caitlin O'Mahony

    Full Text Available Host defence against infection requires a range of innate and adaptive immune responses that may lead to tissue damage. Such immune-mediated pathologies can be controlled with appropriate T regulatory (Treg activity. The aim of the present study was to determine the influence of gut microbiota composition on Treg cellular activity and NF-kappaB activation associated with infection. Mice consumed the commensal microbe Bifidobacterium infantis 35624 followed by infection with Salmonella typhimurium or injection with LPS. In vivo NF-kappaB activation was quantified using biophotonic imaging. CD4+CD25+Foxp3+ T cell phenotypes and cytokine levels were assessed using flow cytometry while CD4+ T cells were isolated using magnetic beads for adoptive transfer to naïve animals. In vivo imaging revealed profound inhibition of infection and LPS induced NF-kappaB activity that preceded a reduction in S. typhimurium numbers and murine sickness behaviour scores in B. infantis-fed mice. In addition, pro-inflammatory cytokine secretion, T cell proliferation, and dendritic cell co-stimulatory molecule expression were significantly reduced. In contrast, CD4+CD25+Foxp3+ T cell numbers were significantly increased in the mucosa and spleen of mice fed B. infantis. Adoptive transfer of CD4+CD25+ T cells transferred the NF-kappaB inhibitory activity. Consumption of a single commensal micro-organism drives the generation and function of Treg cells which control excessive NF-kappaB activation in vivo. These cellular interactions provide the basis for a more complete understanding of the commensal-host-pathogen trilogue that contribute to host homeostatic mechanisms underpinning protection against aberrant activation of the innate immune system in response to a translocating pathogen or systemic LPS.

  7. Human pathogenic Mycoplasma species induced cytokine gene expression in Epstein-Barr virus (EBV)-positive lymphoblastoid cell lines.

    Schäffner, E; Opitz, O; Pietsch, K; Bauer, G; Ehlers, S; Jacobs, E

    1998-04-01

    We addressed the question whether the in vitro interaction of two Epstein-Barr virus (EBV)-genome-positive B cell lines (EB-3 and HilB-gamma) with either Mycoplasma pneumoniae or M. hominis, with the mycoplasma species (M. fermentans, M. fermentans subsp. incognitus, M. penetrans, M. genitalium) or with mycoplasma species known to be mere commensals of the respiratory tract (M. orale and M. salivarium) would result in expression of mRNAs for IL-2, IL-2R, IL-4 and IL-6 as determined by reverse transcriptase (RT)-PCR after 4 and 24 h of cocultivation. The pattern of cytokine gene expression observed depended on (i) the origin of the transformed cell line, (ii) the pathogenicity of the Mycoplasma species, and (iii) the length of cocultivation. The EBV-immortalized lymphoblastoid cell line HilB-gamma showed mRNA expression for IL-2, IL-2-receptor, IL-4 and IL-6 peaking 24 h after stimulation with M. pneumoniae and all AIDS-related mycoplasma species tested. The Burkitt lymphoma cell line EB-3 showed a distinct and isolated strong II-2/IL-2 R-mRNA expression within 4 h after contact with the pathogenic and all of the AIDS related mycoplasma species. In neither EBV-containing cell line cytokine was gene expression detectable after stimulation with the commensal mycoplasma species, M. orale and M. salivarium, indicating species differences in the ability of mycoplasmas to interact with and stimulate B-cell lines. Our data suggest that some mcyoplasma species may act as immunomodulatory cofactors by eliciting inappropriate cytokine gene expression in B cells latently infected with EBV. Therefore, this cultivation model may prove useful in evaluating the pathogenetic potential of novel isolated mycoplasma species. Copyright 1998 Academic Press Limited.

  8. Interleukin-10 is produced by a specific subset of taste receptor cells and critical for maintaining structural integrity of mouse taste buds.

    Feng, Pu; Chai, Jinghua; Zhou, Minliang; Simon, Nirvine; Huang, Liquan; Wang, Hong

    2014-02-12

    Although inflammatory responses are a critical component in defense against pathogens, too much inflammation is harmful. Mechanisms have evolved to regulate inflammation, including modulation by the anti-inflammatory cytokine interleukin-10 (IL-10). Previously we have shown that taste buds express various molecules involved in innate immune responses, including the proinflammatory cytokine tumor necrosis factor (TNF). Here, using a reporter mouse strain, we show that taste cells also express the anti-inflammatory cytokine IL-10. Remarkably, IL-10 is produced by only a specific subset of taste cells, which are different from the TNF-producing cells in mouse circumvallate and foliate taste buds: IL-10 expression was found exclusively in the G-protein gustducin-expressing bitter receptor cells, while TNF was found in sweet and umami receptor cells as reported previously. In contrast, IL-10R1, the ligand-binding subunit of the IL-10 receptor, is predominantly expressed by TNF-producing cells, suggesting a novel cellular hierarchy for regulating TNF production and effects in taste buds. In response to inflammatory challenges, taste cells can increase IL-10 expression both in vivo and in vitro. These findings suggest that taste buds use separate populations of taste receptor cells that coincide with sweet/umami and bitter taste reception to modulate local inflammatory responses, a phenomenon that has not been previously reported. Furthermore, IL-10 deficiency in mice leads to significant reductions in the number and size of taste buds, as well as in the number of taste receptor cells per taste bud, suggesting that IL-10 plays critical roles in maintaining structural integrity of the peripheral gustatory system.

  9. Matrix stiffness and oxigen tension modulate epigenetic conversion of mouse dermal fibroblasts into insulin producing cells.

    Alessandro Zenobi

    2017-05-01

    Full Text Available In vivo, cells are surrounded by a three-dimensional (3-D organization of supporting matrix, neighboring cells and a gradient of chemical and mechanical signals (Antoni, et al., 2015. However, the present understanding of many biological processes is mainly based on two-dimensional (2-D systems that typically provides a static environment. In the present study, we tested two different 3-D culture systems and apply them to the epigenetic conversion of mouse dermal fibroblasts into insulin producing-cells (Pennarossa, et al., 2013; Brevini, et al., 2015, combining also the use of two oxygen tensions. In particular, cells were differentiated using the Polytetrafluoroethylene micro-bioreactor (PTFE and the Polyacrylamide (PAA gels with different stiffness (1 kPa; 4 kPa, maintained either in the standard 20% or in the more physiological 5% oxygen tensions. Standard differentiation performed on plastic substrates was assessed as a control. Cell morphology (Fig.1A, insulin expression and release were analyzed to evaluate the role of both stiffness and oxygen tension in the process. The results obtained showed that 1 kPa PAA gel and PTFE system induced a significantly higher insulin expression and release than plastic and 4 kPa PAA gel, especially in low oxygen condition (Fig.1B. Furthermore, comparing the efficiency of the two systems tested, 1 kPa PAA gel ensured a higher insulin transcription than PTFE (Fig.1C. Recent studies show the direct influence of substrates on lineage commitment and cell differentiation (Engler, et al., 2006; Evans, et al., 2009. The evidence here presented confirm that the use of an appropriate stiffness (similar to the pancreatic tissue, combined with a physiological oxygen tension, promote β-cell differentiation, with beneficial effects on cell functional activity and insulin release. The present results highlight the importance of 3-D cell rearrangement and oxigen tension to promote in vitro epigenetic conversion of

  10. Phosphorus-Based Dendrimer ABP Treats Neuroinflammation by Promoting IL-10-Producing CD4(+) T Cells.

    Hayder, Myriam; Varilh, Marjorie; Turrin, Cédric-Olivier; Saoudi, Abdelhadi; Caminade, Anne-Marie; Poupot, Rémy; Liblau, Roland S

    2015-11-09

    Dendrimers are polyfunctional nano-objects of perfectly defined structure that can provide innovative alternatives for the treatment of chronic inflammatory diseases, including multiple sclerosis (MS). To investigate the efficiency of a recently described amino-bis(methylene phosphonate)-capped ABP dendrimer as a potential drug candidate for MS, we used the classical mouse model of MOG35-55-induced experimental autoimmune encephalomyelitis (EAE). Our study provides evidence that the ABP dendrimer prevents the development of EAE and inhibits the progression of established disease with a comparable therapeutic benefit as the approved treatment Fingolimod. We also show that the ABP dendrimer redirects the pathogenic myelin-specific CD4(+) T cell response toward IL-10 production.

  11. Differentiation of PDX1 gene-modified human umbilical cord mesenchymal stem cells into insulin-producing cells in vitro.

    He, Dongmei; Wang, Juan; Gao, Yangjun; Zhang, Yuan

    2011-12-01

    Mesenchymal stem cells (MSCs) have significant advantages over other stem cell types, and greater potential for immediate clinical application. MSCs would be an interesting cellular source for treatment of type 1 diabetes. In this study, MSCs from human umbilical cord were differentiated into functional insulin-producing cells in vitro by introduction of the pancreatic and duodenal homeobox factor 1 (PDX1) and in the presence of induction factors. The expressions of cell surface antigens were detected by flow cytometry. After induction in an adipogenic medium or an osteogenic medium, the cells were observed by Oil Red O staining and alkaline phosphatase staining. Recombinant adenovirus carrying the PDX1 gene was constructed and MSCs were infected by the recombinant adenovirus, then treated with several inducing factors for differentiation into islet β-like cells. The expression of the genes and protein related to islet β-cells was detected by immunocytochemistry, RT-PCR and Western blot analysis. Insulin and C-peptide secretion were assayed. Our results show that the morphology and immunophenotype of MSCs from human umbilical cord were similar to those present in human bone marrow. The MSCs could be induced to differentiate into osteocytes and adipocytes. After induction by recombined adenovirus vector with induction factors, MSCs were aggregated and presented islet-like bodies. Dithizone staining of these cells was positive. The genes' expression related to islet β-cells was found. After induction, insulin and C-peptide secretion in the supernatant were significantly increased. In conclusion, our results demonstrated that PDX1 gene-modified human umbilical cord mesenchymal stem cells could be differentiated into insulin-producing cells in vitro.

  12. Extrinsic factors promoting insulin producing cell-differentiation and insulin expression enhancement-hope for diabetics.

    Dave, Shruti

    2013-11-01

    Diabetes mellitus (DM) is considered to be an autoimmune disorder leading to destruction of beta-cells resulting in to a loss of blood sugar control. Attempts using many pharmacological compositions including exogenous insulin have failed to show tight control of glycemia and associated manifestations. Stem cells are considered a potential tool for the supply of insulin-producing cells (IPC) generation in vitro. Stem cell differentiation in to pancreatic lineages requires influence of both intrinsic and extrinsic factors. Application of islet growth factors is considered to be potential for enhancement of beta-cell replication, function and survival. Use of certain extrinsic factors is known to facilitate expression of transcription factors known to be important for beta-cell differentiation and production of insulin enabling IPC generation. Hierarchies of secreted signals and transcription factors have been identified by studies from several laboratories that guide cell differentiation in to IPC. This knowledge provides insights for in vitro IPC differentiation from stem cells. Current advancement in medical knowledge promises an insulin independency for DM patients. The review sheds light on few specific extrinsic factors which facilitate differentiation of stem cells in to IPC in vitro have been discussed; which can be proven as a potential therapeutic option for treatment of DM and associated diseases.

  13. B-cell exposure to self-antigen induces IL-10 producing B cells as well as IL-6- and TNF-α-producing B-cell subsets in healthy humans

    Langkjær, Anina; Kristensen, Birte; Hansen, Bjarke E

    2012-01-01

    Human B cells are able to secrete IL-10 after stimulation with mitogens, but their ability to produce IL-10 and regulate T-cell responses after stimulation with self-antigens is unclear. We co-cultured thyroglobulin-pulsed B cells from healthy donors with autologous T cells and observed production...... of IL-10 and TGF-β, in addition to TNF-α and IL-6. Pulsing with foreign antigen, tetanus toxoid (TT), induced a Th1-response with minimal IL-10 production. After thyroglobulin-pulsing, 1.10±0.50% of B cells and 1.00±0.20% of CD4(+) T cells produced IL-10, compared to 0.29±0.19% of B cells (P=0.01) and 0.......13±0.15% of CD4(+) T cells (P=0.006) following TT-pulsing. Thyroglobulin-stimulated, IL-10-secreting B cells were enriched within CD5(+) and CD24(high) cells. While thyroglobulin-pulsed B cells induced only modest proliferation of CD4(+) T cells, B cells pulsed with TT induced vigorous proliferation. Thus, B...

  14. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1.

    Allahverdi, Amir; Abroun, Saied; Jafarian, Arefeh; Soleimani, Masoud; Taghikhani, Mohammad; Eskandari, Fatemeh

    2015-01-01

    Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs) in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs) are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1) is a master regulator gene required for embryonic development of the pancreas and is crucial for normal pancreatic islets activities in adults. We induced the over-expression of the PDX1 gene in human bone marrow MSCs (BM-MSCs) by Lenti-PDX1 in order to generate IPCs. Next, we examine the ability of the cells by measuring insulin/c-peptide production and INSULIN and PDX1 gene expressions. After transduction, MSCs changed their morphology at day 5 and gradually differentiated into IPCs. INSULIN and PDX1 expressions were confirmed by real time polymerase chain reaction (RT-PCR) and immunostaining. IPC secreted insulin and C-peptide in the media that contained different glucose concentrations. MSCs differentiated into IPCs by genetic manipulation. Our result showed that lentiviral vectors could deliver PDX1 gene to MSCs and induce pancreatic differentiation.

  15. B-cell infiltration and frequency of cytokine producing cells differ between localized and disseminated human cutaneous leishmaniases

    MGS Vieira

    2002-10-01

    Full Text Available Biopsies from human localized cutaneous lesions (LCL n = 7 or disseminated lesions (DL n = 8 cases were characterized according to cellular infiltration,frequency of cytokine (IFN-g, TNF-alpha or iNOS enzyme producing cells. LCL, the most usual form of the disease with usually one or two lesions, exhibits extensive tissue damage. DL is a rare form with widespread lesions throughout the body; exhibiting poor parasite containment but less tissue damage. We demonstrated that LCL lesions exhibit higher frequency of B lymphocytes and a higher intensity of IFN-gamma expression. In both forms of the disease CD8+ were found in higher frequency than CD4+ T cells. Frequency of TNF-alpha and iNOS producing cells, as well as the frequency of CD68+ macrophages, did not differ between LCL and DL. Our findings reinforce the link between an efficient control of parasite and tissue damage, implicating higher frequency of IFN-gamma producing cells, as well as its possible counteraction by infiltrated B cells and hence possible humoral immune response in situ.

  16. Concentration- and Time-Dependent Effects of Isothiocyanates Produced from Brassicaceae Shoot Tissues on the Pea Root Rot Pathogen Aphanomyces euteiches

    Hossain, S.; Bergkvist, G.; Berglund, K.; Glinwood, R.; Kabouw, P.; Martensson, A.; Persson, P.

    2014-01-01

    Isothiocyanates (ITCs) hydrolyzed from glucosinolates (GSLs) in Brassicaceae tissue are toxic to soil organisms. In this study, the effect of aliphatic and aromatic ITCs from hydrated dry Brassicaceae shoot tissues on the mycelium and oospores of the pea root rot pathogen Aphanomyces euteiches was

  17. IL-9-producing cells in the development of IgE-mediated food allergy.

    Shik, Dana; Tomar, Sunil; Lee, Jee-Boong; Chen, Chun-Yu; Smith, Andrew; Wang, Yui-Hsi

    2017-01-01

    Food allergy is a harmful immune reaction driven by uncontrolled type 2 immune responses. Considerable evidence demonstrates the key roles of mast cells, IgE, and TH2 cytokines in mediating food allergy. However, this evidence provides limited insight into why only some, rather than all, food allergic individuals are prone to develop life-threatening anaphylaxis. Clinical observations suggest that patients sensitized to food through the skin early in life may later develop severe food allergies. Aberrant epidermal thymic stromal lymphopoietin and interleukin (IL) 33 production and genetic predisposition can initiate an allergic immune response mediated by dendritic cells and CD4 + TH2 cells in inflamed skin. After allergic sensitization, intestinal IL-25 and food ingestion enhance concerted interactions between type 2 innate lymphoid cells (ILC2s) and CD4 + TH2 cells, which perpetuate allergic reactions from the skin to the gut. IL-4 and cross-linking of antigen/IgE/FcεR complexes induce emigrated mast cell progenitors to develop into the multi-functional IL-9-producing mucosal mast cells, which produce prodigious amounts of IL-9 and mast cell mediators to drive intestinal mastocytosis in an autocrine loop. ILC2s and TH9 cells may also serve as alternative cellular sources of IL-9 to augment the amplification of intestinal mastocytosis, which is the key cellular checkpoint in developing systemic anaphylaxis. These findings provide a plausible view of how food allergy develops and progresses in a stepwise manner and that atopic signals, dietary allergen ingestion, and inflammatory cues are fundamental in promoting life-threatening anaphylaxis. This information will aid in improving diagnosis and developing more effective therapies for food allergy-triggered anaphylaxis.

  18. Yeast cell wall extract induces disease resistance against bacterial and fungal pathogens in Arabidopsis thaliana and Brassica crop.

    Mari Narusaka

    Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.

  19. Differential Signaling and Sugar Exchanges in Response to Avirulent Pathogen- and Symbiont-Derived Molecules in Tobacco Cells

    Carole Pfister

    2017-11-01

    Full Text Available Plants interact with microbes whose ultimate aim is to exploit plant carbohydrates for their reproduction. Plant–microbe interactions (PMIs are classified according to the nature of their trophic exchanges: while mutualistic microbes trade nutrients with plants, pathogens unilaterally divert carbohydrates. The early responses following microbe recognition and the subsequent control of plant sugar distribution are still poorly understood. To further decipher PMI functionality, we used tobacco cells treated with microbial molecules mimicking pathogenic or mutualistic PMIs, namely cryptogein, a defense elicitor, and chitotetrasaccharide (CO4, which is secreted by mycorrhizal fungi. CO4 was perceived by tobacco cells and triggered widespread transient signaling components such as a sharp cytosolic Ca2+ elevation, NtrbohD-dependent H2O2 production, and MAP kinase activation. These CO4-induced events differed from those induced by cryptogein, i.e., sustained events leading to cell death. Furthermore, cryptogein treatment inhibited glucose and sucrose uptake but not fructose uptake, and promoted the expression of NtSUT and NtSWEET sugar transporters, whereas CO4 had no effect on sugar uptake and only a slight effect on NtSWEET2B expression. Our results suggest that microbial molecules induce different signaling responses that reflect microbial lifestyle and the subsequent outcome of the interaction.

  20. DNA Delivery and Genomic Integration into Mammalian Target Cells through Type IV A and B Secretion Systems of Human Pathogens

    Dolores L. Guzmán-Herrador

    2017-08-01

    Full Text Available We explore the potential of bacterial secretion systems as tools for genomic modification of human cells. We previously showed that foreign DNA can be introduced into human cells through the Type IV A secretion system of the human pathogen Bartonella henselae. Moreover, the DNA is delivered covalently attached to the conjugative relaxase TrwC, which promotes its integration into the recipient genome. In this work, we report that this tool can be adapted to other target cells by using different relaxases and secretion systems. The promiscuous relaxase MobA from plasmid RSF1010 can be used to deliver DNA into human cells with higher efficiency than TrwC. MobA also promotes DNA integration, albeit at lower rates than TrwC. Notably, we report that DNA transfer to human cells can also take place through the Type IV secretion system of two intracellular human pathogens, Legionella pneumophila and Coxiella burnetii, which code for a distantly related Dot/Icm Type IV B secretion system. This suggests that DNA transfer could be an intrinsic ability of this family of secretion systems, expanding the range of target human cells. Further analysis of the DNA transfer process showed that recruitment of MobA by Dot/Icm was dependent on the IcmSW chaperone, which may explain the higher DNA transfer rates obtained. Finally, we observed that the presence of MobA negatively affected the intracellular replication of C. burnetii, suggesting an interference with Dot/Icm translocation of virulence factors.

  1. Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum.

    Wojtasik, Wioleta; Kulma, Anna; Dymińska, Lucyna; Hanuza, Jerzy; Czemplik, Magdalena; Szopa, Jan

    2016-03-22

    Fusarium oxysporum infection leads to Fusarium-derived wilt, which is responsible for the greatest losses in flax (Linum usitatissimum) crop yield. Plants infected by Fusarium oxysporum show severe symptoms of dehydration due to the growth of the fungus in vascular tissues. As the disease develops, vascular browning and leaf yellowing can be observed. In the case of more virulent strains, plants die. The pathogen's attack starts with secretion of enzymes degrading the host cell wall. The main aim of the study was to evaluate the role of the cell wall polymers in the flax plant response to the infection in order to better understand the process of resistance and develop new ways to protect plants against infection. For this purpose, the expression of genes involved in cell wall polymer metabolism and corresponding polymer levels were investigated in flax seedlings after incubation with Fusarium oxysporum. This analysis was facilitated by selecting two groups of genes responding differently to the infection. The first group comprised genes strongly affected by the infection and activated later (phenylalanine ammonia lyase and glucosyltransferase). The second group comprised genes which are slightly affected (up to five times) and their expression vary as the infection progresses. Fusarium oxysporum infection did not affect the contents of cell wall polymers, but changed their structure. The results suggest that the role of the cell wall polymers in the plant response to Fusarium oxysporum infection is manifested through changes in expression of their genes and rearrangement of the cell wall polymers. Our studies provided new information about the role of cellulose and hemicelluloses in the infection process, the change of their structure and the expression of genes participating in their metabolism during the pathogen infection. We also confirmed the role of pectin and lignin in this process, indicating the major changes at the mRNA level of lignin metabolism genes

  2. An intermediate level of CD161 expression defines a novel activated, inflammatory, and pathogenic subset of CD8+ T cells involved in multiple sclerosis.

    Nicol, Bryan; Salou, Marion; Vogel, Isabel; Garcia, Alexandra; Dugast, Emilie; Morille, Jeremy; Kilens, Stéphanie; Charpentier, Eric; Donnart, Audrey; Nedellec, Steven; Jacq-Foucher, Marylène; Le Frère, Fabienne; Wiertlewski, Sandrine; Bourreille, Arnaud; Brouard, Sophie; Michel, Laure; David, Laurent; Gourraud, Pierre-Antoine; Degauque, Nicolas; Nicot, Arnaud B; Berthelot, Laureline; Laplaud, David-Axel

    2018-03-01

    Several lines of evidence support a key role for CD8 + T cells in central nervous system tissue damage of patients with multiple sclerosis. However, the precise phenotype of the circulating CD8 + T cells that may be recruited from the peripheral blood to invade the CNS remains largely undefined to date. It has been suggested that IL-17 secreting CD8 (Tc17) T cells may be involved, and in humans these cells are characterized by the expression of CD161. We focused our study on a unique and recently described subset of CD8 T cells characterized by an intermediate expression of CD161 as its role in neuroinflammation has not been investigated to date. The frequency, phenotype, and function of CD8 + T cells with an intermediate CD161 expression level were characterized ex-vivo, in vitro, and in situ using RNAseq, RT-PCR, flow cytometry, TCR sequencing, and immunohistofluorescence of cells derived from healthy volunteers (n = 61), MS subjects (n = 90), as well as inflammatory (n = 15) and non-inflammatory controls (n = 6). We report here that CD8 + CD161 int T cells present characteristics of effector cells, up-regulate cell-adhesion molecules and have an increased ability to cross the blood-brain barrier and to secrete IL-17, IFNγ, GM-CSF, and IL-22. We further demonstrate that these cells are recruited and enriched in the CNS of MS subjects where they produce IL-17. In the peripheral blood, RNAseq, RT-PCR, high-throughput TCR repertoire analyses, and flow cytometry confirmed an increased effector and transmigration pattern of these cells in MS patients, with the presence of supernumerary clones compared to healthy controls. Our data demonstrate that intermediate levels of CD161 expression identifies activated and effector CD8 + T cells with pathogenic properties that are recruited to MS lesions. This suggests that CD161 may represent a biomarker and a valid target for the treatment of neuroinflammation. Copyright © 2017 The Authors. Published by Elsevier Ltd

  3. A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia.

    Gisder, Sebastian; Möckel, Nadine; Linde, Andreas; Genersch, Elke

    2011-02-01

    The population of managed honey bees has been dramatically declining in the recent past in many regions of the world. Consensus now seems to be that pathogens and parasites (e.g. the ectoparasitic mite Varroa destructor, the microsporidium Nosema ceranae and viruses) play a major role in this demise. However, little is known about host-pathogen interactions for bee pathogens and attempts to develop novel strategies to combat bee diseases have been hampered by this gap in our knowledge. One reason for this dire situation is the complete lack of cell cultures for the propagation and study of bee pathogens. Here we present a cell culture model for two honey bee-pathogenic microsporidian species, Nosema apis and N. ceranae. Our cell culture system is based on a lepidopteran cell line, which proved to be susceptible to infection by both N. ceranae and N. apis and enabled us to illustrate the entire life cycle of these microsporidia. We observed hitherto undescribed spindle-shaped meronts and confirmed our findings in infected bees. Our cell culture model provides a previously unavailable means to explore the nature of interactions between the honey bee and its pathogen complex at a mechanistic level and will allow the development of novel treatment strategies.

  4. Edwardsiella tarda Endocarditis Confirmed by Indium-111 White Blood Cell Scan: An Unusual Pathogen and Diagnostic Modality

    Kayleigh M. Litton

    2016-01-01

    Full Text Available Edwardsiella tarda is a freshwater marine member of the family Enterobacteriaceae which often colonizes fish, lizards, snakes, and turtles but is an infrequent human pathogen. Indium-111- (111In- labeled white blood cell (WBC scintigraphy is an imaging modality which has a wide range of reported sensitivity and specificity (from 60 to 100% and from 68 to 92%, resp. for diagnosing acute and chronic infection. We describe a case of suspected E. tarda prosthetic aortic valve and mitral valve endocarditis with probable vegetations and new mitral regurgitation on transthoracic and transesophageal echocardiograms which was supported with the use of 111In-labeled WBC scintigraphy.

  5. Induced ICER Iγ down-regulates cyclin A expression and cell proliferation in insulin-producing β cells

    Inada, Akari; Weir, Gordon C.; Bonner-Weir, Susan

    2005-01-01

    We have previously found that cyclin A expression is markedly reduced in pancreatic β-cells by cell-specific overexpression of repressor inducible cyclic AMP early repressor (ICER Iγ) in transgenic mice. Here we further examined regulatory effects of ICER Iγ on cyclin A gene expression using Min6 cells, an insulin-producing cell line. The cyclin A promoter luciferase assay showed that ICER Iγ directly repressed cyclin A gene transcription. In addition, upon ICER Iγ overexpression, cyclin A mRNA levels markedly decreased, thereby confirming an inhibitory effect of ICER Iγ on cyclin A expression. Suppression of cyclin A results in inhibition of BrdU incorporation. Under normal culture conditions endogenous cyclin A is abundant in these cells, whereas ICER is hardly detectable. However, serum starvation of Min6 cells induces ICER Iγ expression with a concomitant very low expression level of cyclin A. Cyclin A protein is not expressed unless the cells are in active DNA replication. These results indicate a potentially important anti-proliferative effect of ICER Iγ in pancreatic β cells. Since ICER Iγ is greatly increased in diabetes as well as in FFA- or high glucose-treated islets, this effect may in part exacerbate diabetes by limiting β-cell proliferation

  6. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  7. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  8. Health status and productive performance of somatic cell cloned cattle and their offspring produced in Japan.

    Watanabe, Shinya; Nagai, Takashi

    2008-02-01

    Since the first somatic cell cloned calves were born in Japan in 1998, more than 500 cloned cattle have been produced by somatic cell nuclear transfer and many studies concerning cloned cattle and their offspring have been conducted in this country. However, most of the results have been published in Japanese; thus, the data produced in this country is not well utilized by researchers throughout the world. This article reviews the 65 reports produced by Japanese researchers (62 written in Japanese and 3 written in English), which employed 171 clones and 32 offspring, and categorizes them according to the following 7 categories: (1) genetic similarities and muzzle prints, (2) hematology and clinical chemistry findings, (3) pathology, (4) growth performance, (5) reproductive performance, (6) meat production performance and (7) milk production performance. No remarkable differences in health status or reproductive performance were found among conventionally bred cattle, somatic cell cloned cattle surviving to adulthood and offspring of somatic cell cloned cattle. Similarities in growth performance and meat quality were observed between nuclear donor cattle and their clones. The growth curves of the offspring resembled those of their full siblings.

  9. Gamma-radiation produces abnormal Bergmann fibers and ectopic granule cells in mouse cerebellar cortex

    Inouye, Minoru; Hayasaka, Shizu; Funahashi, Atsushi; Yamamura, Hideki

    1992-01-01

    Morphological changes in Bergmann glial fibers in the developing cerebellar cortex produced by exposure to gamma-rays were investigated in association with ectopic granule cells. Six-day-old mice that had been exposed to 3 Gy of gamma-radiation were killed 6 hours after exposure or at 7 through 30 days of age. Their cerebella were examined histologically and immunohistochemically for glial fibrillary acidic protein in Bergmann fibers. Extensive cell death took place in the external granular layer (EGL) of the cerebellum from 6 through 24 hours after exposure. This led to the thinning of the EGL and a decrease in the number of migrating cells in the molecular layer. The number of Bergmann cells was not decreased, but the fibers in the molecular layer were distorted; whereas, in the control these fibers were straight and perpendicular to the pial surface. The EGL began to recover 2 days after exposure, and abnormally oriented migrating cells were seen. At 17 days of age, some cell clustering was observed in the molecular layer of the irradiated cerebellum. Distortion of the Bergmann fibers was marked in regions where ectopic granule cells appeared at 30 days of age. These findings suggest that the distortion of Bergmann fibers leads to the production of ectopic granule cells after exposure to gamma-radiation. (author)

  10. Andrographolide interferes quorum sensing to reduce cell damage caused by avian pathogenic Escherichia coli.

    Guo, Xun; Zhang, Li-Yan; Wu, Shuai-Cheng; Xia, Fang; Fu, Yun-Xing; Wu, Yong-Li; Leng, Chun-Qing; Yi, Peng-Fei; Shen, Hai-Qing; Wei, Xu-Bin; Fu, Ben-Dong

    2014-12-05

    Avian pathogenic Escherichia coli (APEC) induce septicemia in chickens by invading type II pneumocytes to breach the blood-air barrier. The virulence of APEC can be regulated by quorum sensing (QS). Andrographolide is a QS inhibitor of Pseudomonas aeruginosa (P. aeruginosa). Therefore, we investigate whether andrographolide inhibits the injury of chicken type II pneumocytes by avian pathogenic E. coli O78 (APEC-O78) by disrupting the bacterial QS system. The results showed that sub-MIC of andrographolide significantly reduced the release of lactate dehydrogenase (LDH), F-actin cytoskeleton polymerization, and the degree of the adherence to chicken type II pneumocytes induced by APEC-O78. Further, we found that andrographolide significantly decreased the autoinducer-2 (AI-2) activity and the expression of virulence factors of APEC-O78. These results suggest that andrographolide reduce the pathogenicity of APEC-O78 in chicken type II pneumocytes by interfering QS and decreasing virulence. These results provide new evidence for colibacillosis prevention methods in chickens. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. The sugarcane defense protein SUGARWIN2 causes cell death in Colletotrichum falcatum but not in non-pathogenic fungi.

    Flávia P Franco

    Full Text Available Plants respond to pathogens and insect attacks by inducing and accumulating a large set of defense-related proteins. Two homologues of a barley wound-inducible protein (BARWIN have been characterized in sugarcane, SUGARWIN1 and SUGARWIN2 (sugarcane wound-inducible proteins. Induction of SUGARWINs occurs in response to Diatraea saccharalis damage but not to pathogen infection. In addition, the protein itself does not show any effect on insect development; instead, it has antimicrobial activities toward Fusarium verticillioides, an opportunistic fungus that usually occurs after D. saccharalis borer attacks on sugarcane. In this study, we sought to evaluate the specificity of SUGARWIN2 to better understand its mechanism of action against phytopathogens and the associations between fungi and insects that affect plants. We used Colletotrichum falcatum, a fungus that causes red rot disease in sugarcane fields infested by D. saccharalis, and Ceratocystis paradoxa, which causes pineapple disease in sugarcane. We also tested whether SUGARWIN2 is able to cause cell death in Aspergillus nidulans, a fungus that does not infect sugarcane, and in the model yeast Saccharomyces cerevisiae, which is used for bioethanol production. Recombinant SUGARWIN2 altered C. falcatum morphology by increasing vacuolization, points of fractures and a leak of intracellular material, leading to germling apoptosis. In C. paradoxa, SUGARWIN2 showed increased vacuolization in hyphae but did not kill the fungi. Neither the non-pathogenic fungus A. nidulans nor the yeast S. cerevisiae was affected by recombinant SUGARWIN2, suggesting that the protein is specific to sugarcane opportunistic fungal pathogens.

  12. New cell line development for antibody-producing Chinese hamster ovary cells using split green fluorescent protein

    Kim Yeon-Gu

    2012-05-01

    Full Text Available Abstract Background The establishment of high producer is an important issue in Chinese hamster ovary (CHO cell culture considering increased heterogeneity by the random integration of a transfected foreign gene and the altered position of the integrated gene. Fluorescence-activated cell sorting (FACS-based cell line development is an efficient strategy for the selection of CHO cells in high therapeutic protein production. Results An internal ribosome entry site (IRES was introduced for using two green fluorescence protein (GFP fragments as a reporter to both antibody chains, the heavy chain and the light chain. The cells co-transfected with two GFP fragments showed the emission of green fluorescence by the reconstitution of split GFP. The FACS-sorted pool with GFP expression had a higher specific antibody productivity (qAb than that of the unsorted pool. The qAb was highly correlated with the fluorescence intensity with a high correlation coefficient, evidenced from the analysis of median GFP and qAb in individual selected clones. Conclusions This study proved that the fragment complementation for split GFP could be an efficient indication for antibody production on the basis of high correlation of qAb with reconstitution of GFP. Taken together, we developed an efficient FACS-based screening method for high antibody-producing CHO cells with the benefits of the split GFP system.

  13. Genome of the carbapenemase-producing clinical isolate Elizabethkingia miricola EM_CHUV and comparative genomics with Elizabethkingia meningoseptica and Elizabethkingia anophelis: evidence for intrinsic multidrug resistance trait of emerging pathogens.

    Opota, O.; Diene, S.M.; Bertelli, C.; Prod'hom, G.; Eckert, P.; Greub, G.

    2017-01-01

    Elizabethkingia miricola is a Gram-negative non-fermenting rod emerging as a life-threatening human pathogen. The multidrug-resistant (MDR) carbapenemase-producing clinical isolate E. miricola EM_CHUV was recovered in the setting of severe nosocomial pneumonia. In this study, the genome of E. miricola EM_CHUV was sequenced and a functional analysis was performed, including a comparative genomic study with Elizabethkingia meningoseptica and Elizabethkingia anophelis. The resistome of EM_CHUV r...

  14. [Cloning goat producing human lactoferrin with genetically modified donor cells selected by single or dual markers].

    An, Liyou; Yuan, Yuguo; Yu, Baoli; Yang, Tingjia; Cheng, Yong

    2012-12-01

    We compared the efficiency of cloning goat using human lactoferrin (hLF) with genetically modified donor cells marked by single (Neo(r)) or double (Neo(r)/GFP) markers. Single marker expression vector (pBLC14) or dual markers expression vector (pAPLM) was delivered to goat fetal fibroblasts (GFF), and then the transgenic GFF was used as donor cells to produce transgenic goats. Respectively, 58.8% (20/34) and 86.7% (26/30) resistant cell lines confirmed the transgenic integration by PCR. Moreover, pAPLM cells lines were subcultured with several passages, only 20% (6/30) cell lines was observed fluorescence from each cell during the cell passage. Somatic cell nuclear transfer using the donor cells harbouring pBLC14 or pAPLM construct, resulting in a total of 806 reconstructed embryos, a pregnancy rate at 35 d (53.8%, 39.1%) and 60 d (26.9%, 21.7%), and an offspring birth rate (1.9%, 1.4%) with 5 and 7 newborn cloned goats, respectively. Transgene was confirmed by PCR and southern-blot in all cloned offspring. There were no significant differences at the reconstructed embryo fusion rates, pregnancy rates and the birth rate (P > 0.05) between single and double markers groups. The Neo(r)/GFP double markers could improve the reliability for accurately and efficiently selecting the genetically modified donor cells. No adverse effect was observed on the efficiency of transgenic goat production by SCNT using somatic cells transfected with double (Neo(r)/GFP) markers vector.

  15. Embryonic stem-like cells derived from in vitro produced bovine blastocysts

    Erika Regina Leal de Freitas

    2011-06-01

    Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.

  16. Aquaporins facilitate hydrogen peroxide entry into guard cells to mediate ABA- and pathogen-triggered stomatal closure.

    Rodrigues, Olivier; Reshetnyak, Ganna; Grondin, Alexandre; Saijo, Yusuke; Leonhardt, Nathalie; Maurel, Christophe; Verdoucq, Lionel

    2017-08-22

    Stomatal movements are crucial for the control of plant water status and protection against pathogens. Assays on epidermal peels revealed that, similar to abscisic acid (ABA), pathogen-associated molecular pattern (PAMP) flg22 requires the At PIP2;1 aquaporin to induce stomatal closure. Flg22 also induced an increase in osmotic water permeability ( P f ) of guard cell protoplasts through activation of At PIP2;1. The use of HyPer, a genetic probe for intracellular hydrogen peroxide (H 2 O 2 ), revealed that both ABA and flg22 triggered an accumulation of H 2 O 2 in wild-type but not pip2;1 guard cells. Pretreatment of guard cells with flg22 or ABA facilitated the influx of exogenous H 2 O 2 Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) and open stomata 1 (OST1)/Snf1-related protein kinase 2.6 (SnRK2.6) were both necessary to flg22-induced P f and both phosphorylated At PIP2;1 on Ser121 in vitro. Accumulation of H 2 O 2 and stomatal closure as induced by flg22 was restored in pip2;1 guard cells by a phosphomimetic form (Ser121Asp) but not by a phosphodeficient form (Ser121Ala) of At PIP2;1. We propose a mechanism whereby phosphorylation of At PIP2;1 Ser121 by BAK1 and/or OST1 is triggered in response to flg22 to activate its water and H 2 O 2 transport activities. This work establishes a signaling role of plasma membrane aquaporins in guard cells and potentially in other cellular context involving H 2 O 2 signaling.

  17. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytongenes single cells

    Nielsen, Dennis Sandris; Cho, Gyu-Sung; Hanak, Alexander

    2010-01-01

    and/or bacteriocin-producing LAB as “natural” food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure......A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins...

  18. Ultrastructural changes produced in Ehrlich ascites carcinoma cells by ultraviolet-visible radiation in the presence of melanins

    Lea, P.J.; Pawlowski, A.; Persad, S.D.; Menon, I.A.; Haberman, H.F.

    1988-01-01

    Irradiation of Ehrlich ascites carcinoma (EAC) cells in the presence of pheomelanin, i.e., red hair melanin (RHM), has been reported to produce extensive cell lysis. Irradiation in the presence of eumelanin, i.e., black hair melanin (BHM), or irradiation in the absence of either type of melanin did not produce this effect. We observed that RHM particles penetrated the cell membrane without apparent structural damage to the cell or the cell membrane. Irradiation of the cells in the absence of melanin did not produce any changes in the ultrastructure of the cells. Incubation of the cells in the dark in the presence of RHM produced only minor structural, mainly cytoplasmic changes. Irradiation of the cells in the presence of RHM produced extensive ultrastructural changes prior to complete cell lysis; these changes were more severe than the effects of incubation of the cells in the dark in the presence of RHM. When the cells incubated in the dark or irradiated in the presence of latex particles or either one of the eumelanins particles, viz. BHM or synthetic dopa melanin, these particles did not penetrate into the cells or produce any ultrastructural changes. These particles were in fact not even ingested by the cells.

  19. HCV Specific IL-21 Producing T Cells but Not IL-17A Producing T Cells Are Associated with HCV Viral Control in HIV/HCV Coinfection.

    Sonya A MacParland

    Full Text Available Decreased hepatitis C virus (HCV clearance, faster cirrhosis progression and higher HCV RNA levels are associated with Human Immunodeficiency virus (HIV coinfection. The CD4+ T helper cytokines interleukin (IL-21 and IL-17A are associated with virus control and inflammation, respectively, both important in HCV and HIV disease progression. Here, we examined how antigen-specific production of these cytokines during HCV mono and HIV/HCV coinfection was associated with HCV virus control.We measured HCV-specific IL-21 and IL-17A production by transwell cytokine secretion assay in PBMCs from monoinfected and coinfected individuals. Viral control was determined by plasma HCV RNA levels.In acutely infected individuals, those able to establish transient/complete HCV viral control tended to have stronger HCV-specific IL-21-production than non-controllers. HCV-specific IL-21 production also correlated with HCV viral decline in acute infection. Significantly stronger HCV-specific IL-21 production was detected in HAART-treated coinfected individuals. HCV-specific IL-17A production was not associated with lower plasma HCV RNA levels in acute or chronic HCV infection and responses were stronger in HIV coinfection. HCV-specific IL-21/ IL-17A responses did not correlate with microbial translocation or fibrosis. Exogenous IL-21 treatment of HCV-specific CD8+ T cells from monoinfected individuals enhanced their function although CD8+ T cells from coinfected individuals were somewhat refractory to the effects of IL-21.These data show that HCV-specific IL-21 and IL-17A-producing T cells are induced in HIV/HCV coinfection. In early HIV/HCV coinfection, IL-21 may contribute to viral control, and may represent a novel tool to enhance acute HCV clearance in HIV/HCV coinfected individuals.

  20. γδ T cells producing interleukin-17A regulate adipose regulatory T cell homeostasis and thermogenesis.

    Kohlgruber, Ayano C; Gal-Oz, Shani T; LaMarche, Nelson M; Shimazaki, Moto; Duquette, Danielle; Nguyen, Hung N; Mina, Amir I; Paras, Tyler; Tavakkoli, Ali; von Andrian, Ulrich; Banks, Alexander S; Shay, Tal; Brenner, Michael B; Lynch, Lydia

    2018-05-01

    γδ T cells are situated at barrier sites and guard the body from infection and damage. However, little is known about their roles outside of host defense in nonbarrier tissues. Here, we characterize a highly enriched tissue-resident population of γδ T cells in adipose tissue that regulate age-dependent regulatory T cell (T reg ) expansion and control core body temperature in response to environmental fluctuations. Mechanistically, innate PLZF + γδ T cells produced tumor necrosis factor and interleukin (IL) 17 A and determined PDGFRα + and Pdpn + stromal-cell production of IL-33 in adipose tissue. Mice lacking γδ T cells or IL-17A exhibited decreases in both ST2 + T reg cells and IL-33 abundance in visceral adipose tissue. Remarkably, these mice also lacked the ability to regulate core body temperature at thermoneutrality and after cold challenge. Together, these findings uncover important physiological roles for resident γδ T cells in adipose tissue immune homeostasis and body-temperature control.

  1. ADAM12 produced by tumor cells rather than stromal cells accelerates breast tumor progression

    Frohlich, Camilla; Nehammer, Camilla; Albrechtsen, Reidar

    2011-01-01

    that ADAM12 deficiency reduces breast tumor progression in the PyMT model. However, the catalytic activity of ADAM12 appears to be dispensable for its tumor-promoting effect. Interestingly, we demonstrate that ADAM12 endogenously expressed in tumor-associated stroma in the PyMT model does not influence......Expression of ADAM12 is low in most normal tissues, but is markedly increased in numerous human cancers, including breast carcinomas. We have previously shown that overexpression of ADAM12 accelerates tumor progression in a mouse model of breast cancer (PyMT). In the present study, we found...... hypothesized, however, that the tumor-associated stroma may stimulate ADAM12 expression in tumor cells, based on the fact that TGF-ß1 stimulates ADAM12 expression and is a well-known growth factor released from tumor-associated stroma. TGF-ß1 stimulation of ADAM12-negative Lewis lung tumor cells induced ADAM12...

  2. Distinct cytokines balance the development of regulatory T cells and interleukin-10-producing regulatory B cells

    Holáň, Vladimír; Zajícová, Alena; Javorková, Eliška; Trošan, Peter; Chudíčková, Milada; Pavlíková, M.; Krulová, Magdaléna

    2014-01-01

    Roč. 141, č. 4 (2014), s. 577-586 ISSN 0019-2805 R&D Projects: GA MZd(CZ) NT14102; GA ČR(CZ) GAP301/11/1568; GA ČR GAP304/11/0653 Institutional support: RVO:68378041 Keywords : Autoregulation * B cells * Cytokines Subject RIV: FF - HEENT, Dentistry Impact factor: 3.795, year: 2014

  3. Electroendocytosis is driven by the binding of electrochemically produced protons to the cell's surface.

    Nadav Ben-Dov

    Full Text Available Electroendocytosis involves the exposure of cells to pulsed low electric field and is emerging as a complementary method to electroporation for the incorporation of macromolecules into cells. The present study explores the underlying mechanism of electroendocytosis and its dependence on electrochemical byproducts formed at the electrode interface. Cell suspensions were exposed to pulsed low electric field in a partitioned device where cells are spatially restricted relative to the electrodes. The cellular uptake of dextran-FITC was analyzed by flow cytometery and visualized by confocal microscopy. We first show that uptake occurs only in cells adjacent to the anode. The enhanced uptake near the anode is found to depend on electric current density rather than on electric field strength, in the range of 5 to 65 V/cm. Electrochemically produced oxidative species that impose intracellular oxidative stress, do not play any role in the stimulated uptake. An inverse dependence is found between electrically induced uptake and the solution's buffer capacity. Electroendocytosis can be mimicked by chemically acidifying the extracellular solution which promotes the enhanced uptake of dextran polymers and the uptake of plasmid DNA. Electrochemical production of protons at the anode interface is responsible for inducing uptake of macromolecules into cells exposed to a pulsed low electric field. Expanding the understanding of the mechanism involved in electric fields induced drug-delivery into cells, is expected to contribute to clinical therapy applications in the future.

  4. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Generation of glucose-responsive, insulin-producing cells from human umbilical cord blood-derived mesenchymal stem cells.

    Prabakar, Kamalaveni R; Domínguez-Bendala, Juan; Molano, R Damaris; Pileggi, Antonello; Villate, Susana; Ricordi, Camillo; Inverardi, Luca

    2012-01-01

    We sought to assess the potential of human cord blood-derived mesenchymal stem cells (CB-MSCs) to derive insulin-producing, glucose-responsive cells. We show here that differentiation protocols based on stepwise culture conditions initially described for human embryonic stem cells (hESCs) lead to differentiation of cord blood-derived precursors towards a pancreatic endocrine phenotype, as assessed by marker expression and in vitro glucose-regulated insulin secretion. Transplantation of these cells in immune-deficient animals shows human C-peptide production in response to a glucose challenge. These data suggest that human cord blood may be a promising source for regenerative medicine approaches for the treatment of diabetes mellitus.

  6. Mitochondrial Respiration in Insulin-Producing β-Cells: General Characteristics and Adaptive Effects of Hypoxia.

    Hals, Ingrid K; Bruerberg, Simon Gustafson; Ma, Zuheng; Scholz, Hanne; Björklund, Anneli; Grill, Valdemar

    2015-01-01

    To provide novel insights on mitochondrial respiration in β-cells and the adaptive effects of hypoxia. Insulin-producing INS-1 832/13 cells were exposed to 18 hours of hypoxia followed by 20-22 hours re-oxygenation. Mitochondrial respiration was measured by high-resolution respirometry in both intact and permeabilized cells, in the latter after establishing three functional substrate-uncoupler-inhibitor titration (SUIT) protocols. Concomitant measurements included proteins of mitochondrial complexes (Western blotting), ATP and insulin secretion. Intact cells exhibited a high degree of intrinsic uncoupling, comprising about 50% of oxygen consumption in the basal respiratory state. Hypoxia followed by re-oxygenation increased maximal overall respiration. Exploratory experiments in peremabilized cells could not show induction of respiration by malate or pyruvate as reducing substrates, thus glutamate and succinate were used as mitochondrial substrates in SUIT protocols. Permeabilized cells displayed a high capacity for oxidative phosphorylation for both complex I- and II-linked substrates in relation to maximum capacity of electron transfer. Previous hypoxia decreased phosphorylation control of complex I-linked respiration, but not in complex II-linked respiration. Coupling control ratios showed increased coupling efficiency for both complex I- and II-linked substrates in hypoxia-exposed cells. Respiratory rates overall were increased. Also previous hypoxia increased proteins of mitochondrial complexes I and II (Western blotting) in INS-1 cells as well as in rat and human islets. Mitochondrial effects were accompanied by unchanged levels of ATP, increased basal and preserved glucose-induced insulin secretion. Exposure of INS-1 832/13 cells to hypoxia, followed by a re-oxygenation period increases substrate-stimulated respiratory capacity and coupling efficiency. Such effects are accompanied by up-regulation of mitochondrial complexes also in pancreatic islets

  7. Virus-producing cells determine the host protein profiles of HIV-1 virion cores

    2012-01-01

    Background Upon HIV entry into target cells, viral cores are released and rearranged into reverse transcription complexes (RTCs), which support reverse transcription and also protect and transport viral cDNA to the site of integration. RTCs are composed of viral and cellular proteins that originate from both target and producer cells, the latter entering the target cell within the viral core. However, the proteome of HIV-1 viral cores in the context of the type of producer cells has not yet been characterized. Results We examined the proteomic profiles of the cores purified from HIV-1 NL4-3 virions assembled in Sup-T1 cells (T lymphocytes), PMA and vitamin D3 activated THP1 (model of macrophages, mMΦ), and non-activated THP1 cells (model of monocytes, mMN) and assessed potential involvement of identified proteins in the early stages of infection using gene ontology information and data from genome-wide screens on proteins important for HIV-1 replication. We identified 202 cellular proteins incorporated in the viral cores (T cells: 125, mMΦ: 110, mMN: 90) with the overlap between these sets limited to 42 proteins. The groups of RNA binding (29), DNA binding (17), cytoskeleton (15), cytoskeleton regulation (21), chaperone (18), vesicular trafficking-associated (12) and ubiquitin-proteasome pathway-associated proteins (9) were most numerous. Cores of the virions from SupT1 cells contained twice as many RNA binding proteins as cores of THP1-derived virus, whereas cores of virions from mMΦ and mMN were enriched in components of cytoskeleton and vesicular transport machinery, most probably due to differences in virion assembly pathways between these cells. Spectra of chaperones, cytoskeletal proteins and ubiquitin-proteasome pathway components were similar between viral cores from different cell types, whereas DNA-binding and especially RNA-binding proteins were highly diverse. Western blot analysis showed that within the group of overlapping proteins, the level of

  8. Complete genome sequence of N2-fixing model strain Klebsiella sp. nov. M5al, which produces plant cell wall-degrading enzymes and siderophores

    Zhili Yu

    2018-03-01

    Full Text Available The bacterial strain M5al is a model strain for studying the molecular genetics of N2-fixation and molecular engineering of microbial production of platform chemicals 1,3-propanediol and 2,3-butanediol. Here, we present the complete genome sequence of the strain M5al, which belongs to a novel species closely related to Klebsiella michiganensis. M5al secretes plant cell wall-degrading enzymes and colonizes rice roots but does not cause soft rot disease. M5al also produces siderophores and contains the gene clusters for synthesis and transport of yersiniabactin which is a critical virulence factor for Klebsiella pathogens in causing human disease. We propose that the model strain M5al can be genetically modified to study bacterial N2-fixation in association with non-legume plants and production of 1,3-propanediol and 2,3-butanediol through degradation of plant cell wall biomass.

  9. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Ara?jo, Maria Jos? Abigail Mendes; B?falo, Michelle Cristiane; Sforcin, Jos? Maur?cio

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geop...

  10. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes

    Shruti Dave

    2014-01-01

    Full Text Available The pathophysiology of type 1 diabetes mellitus (T1DM is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs offer a promising possibility that deserves to be explored further. MSCs are multipotent, nonhematopoietic progenitors. They have been explored as an treatment option in tissue regeneration as well as potential of in vitro transdifferentiation into insulin-secreting cells. Thus, the major therapeutic goals for T1DM have been achieved in this way. The regenerative capabilities of MSCs have been a driving force to initiate studies testing their therapeutic effectiveness; their immunomodulatory properties have been equally exciting; which would appear capable of disabling immune dysregulation that leads to β-cell destruction in T1DM. Furthermore, MSCs can be cultured under specially defined conditions, their transdifferentiation can be directed toward the β-cell phenotype, and the formation of insulin-producing cells (IPCs can be targeted. To date, the role of MSCs-derived IPC in T1DM-a unique approach with some positive findings-have been unexplored, but it is still in its very early phase. In this study, a new approach of MSCs-derived IPCs, as a potential therapeutic benefit for T1DM in experimental animal models as well as in humans has been summarized.

  11. CD4+FOXP3+ cells produce IL-10 in the spleens of dogs with visceral leishmaniasis.

    Silva, Kathlenn Liezbeth Oliveira; de Andrade, Mariana M C; Melo, Larissa M; Perosso, Juliana; Vasconcelos, Rosemeri O; Munari, Danisio P; Lima, Valéria M F

    2014-05-28

    Visceral Leishmaniasis (VL) is caused by intracellular parasites of the genus Leishmania that affect humans and several animal species. Dogs are one of the main urban reservoirs of the parasite and play a central role in the transmission cycle to humans via sandflies. Studies concerning the immune response in dogs with VL have demonstrated that protective immunity is associated with cellular immune response, while disease progression is associated with humoral response and IL-10 and TGF-β production. The study aimed to evaluate IL-10 and TGF-β production by regulatory T (Treg) cells in the blood and spleen of dogs naturally infected by Leishmania spp. and correlate this with parasite load. Five healthy dogs and 29 dogs with proven infection were selected for the study group. Real-time PCR was used to quantify parasite load and confirm infection by Leishmania spp. Treg cells producing IL-10 and TGF-β were quantified using flow cytometry. An increase in IL-10 production by Treg cells was verified in the spleen of dogs naturally infected by Leishmania spp. Concurrently, a decrease in the total number of T cells in these dogs was verified compared with healthy dogs. No association was determined between parasite load and the percentage of spleen Treg cells producing IL-10 and TGF-β. These findings suggest that Treg cells are an important source of IL-10 in the spleen, participating in immune response modulation, while the reduced percentage of these cells in infected dogs could be attributed to persistent immune activation. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Removal of Cadmium and Zinc from Soil using Immobilized Cell of Biosurfactant Producing Bacteria

    Charoon Sarin

    2010-07-01

    Full Text Available Immobilized biosurfactant producing bacteria (Bacillus subtilis TP8 and Pseudomonas fluorescens G7 were assessed for survival in heavy metal contaminated soil and for their ability to remove cadmium and zinc from contaminated soil. P. fluorescens G7 was considered to be a good candidate for bioremediation of heavy metals because of its high minimum inhibitory concentrations (MIC for each heavy metal and because of the obviously increased numbers of cell surviving after incubation in the heavy metal contaminated soil up to 4 weeks. The results of soil remediation showed that approximately 19% of Zn and 16.7% of Cd could be removed by this immobilized biosurfactant producing bacteria after incubation for 2 weeks. The results confirm the potential applicability of the immobilized biosurfactant producing bacteria for heavy metal bioremediation.

  13. miR-375 induces human decidua basalis-derived stromal cells to become insulin-producing cells.

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2014-09-01

    This paper focuses on the development of renewable sources of isletreplacement tissue for the treatment of type I diabetes mellitus. Placental tissue-derived mesenchymal stem cells (MSCs) are a promising source for regenerative medicine due to their plasticity and easy availability. They have the potential to differentiate into insulin-producing cells. miR-375 is a micro RNA that is expressed in the pancreas and involved in islet development. Human placental decidua basalis MSCs (PDB-MSCs) were cultured from full-term human placenta. The immunophenotype of the isolated cells was checked for CD90, CD105, CD44, CD133 and CD34 markers. The MSCs (P3) were chemically transfected with hsa-miR-375. Total RNA was extracted 4 and 6 days after transfection. The expressions of insulin, NGN3, GLUT2, PAX4, PAX6, KIR6.2, NKX6.1, PDX1, and glucagon genes were evaluated using real-time qPCR. On day 6, we tested the potency of the clusters in response to the high glucose challenge and assessed the presence of insulin and NGN3 proteins via immunocytochemistry. Flow cytometry analysis confirmed that more than 90% of the cells were positive for CD90, CD105 and CD44 and negative for CD133 and CD34. Morphological changes were followed from day 2. Cell clusters formed during day 6. Insulin-producing clusters showed a deep red color with DTZ. The expression of pancreatic-specific transcription factors increased remarkably during the four days after transfection and significantly increased on day 7. The clusters were positive for insulin and NGN3 proteins, and C-peptide and insulin secretion increased in response to changes in the glucose concentration (2.8 mM and 16.7 mM). In conclusion, the MSCs could be programmed into functional insulin-producing cells by transfection of miR-375.

  14. Chlorine-rich plasma polymer coating for the prevention of attachment of pathogenic fungal cells onto materials surfaces

    Lamont-Friedrich, Stephanie J; Michl, Thomas D; Giles, Carla; Griesser, Hans J; Coad, Bryan R

    2016-01-01

    The attachment of pathogenic fungal cells onto materials surfaces, which is often followed by biofilm formation, causes adverse consequences in a wide range of areas. Here we have investigated the ability of thin film coatings from chlorinated molecules to deter fungal colonization of solid materials by contact killing of fungal cells reaching the surface of the coating. Coatings were deposited onto various substrate materials via plasma polymerization, which is a substrate-independent process widely used for industrial coating applications, using 1,1,2-trichloroethane as the process vapour. XPS surface analysis showed that the coatings were characterized by a highly chlorinated hydrocarbon polymer nature, with only a very small amount of oxygen incorporated. The activity of these coatings against human fungal pathogens was quantified using a recently developed, modified yeast assay and excellent antifungal activity was observed against Candida albicans and Candida glabrata . Plasma polymer surface coatings derived from chlorinated hydrocarbon molecules may therefore offer a promising solution to preventing yeast and mould biofilm formation on materials surfaces, for applications such as air conditioners, biomedical devices, food processing equipment, and others. (paper)

  15. Cell penetrating peptides to dissect host-pathogen protein-protein interactions in Theileria -transformed leukocytes

    Haidar, Malak; de Laté , Perle Latré ; Kennedy, Eileen J.; Langsley, Gordon

    2017-01-01

    One powerful application of cell penetrating peptides is the delivery into cells of molecules that function as specific competitors or inhibitors of protein-protein interactions. Ablating defined protein-protein interactions is a refined way

  16. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-01-01

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induce...

  17. Proteome data from a host-pathogen interaction study with Staphylococcus aureus and human lung epithelial cells

    Kristin Surmann

    2016-06-01

    Full Text Available To simultaneously obtain proteome data of host and pathogen from an internalization experiment, human alveolar epithelial A549 cells were infected with Staphylococcus aureus HG001 which carried a plasmid (pMV158GFP encoding a continuously expressed green fluorescent protein (GFP. Samples were taken hourly between 1.5 h and 6.5 h post infection. By fluorescence activated cell sorting GFP-expressing bacteria could be enriched from host cell debris, but also infected host cells could be separated from those which did not carry bacteria after contact (exposed. Additionally, proteome data of A549 cells which were not exposed to S. aureus but underwent the same sample processing steps are provided as a control. Time-resolved changes in bacterial protein abundance were quantified in a label-free approach. Proteome adaptations of host cells were monitored by comparative analysis to a stable isotope labeled cell culture (SILAC standard. Proteins were extracted from the cells, digested proteolytically, measured by nanoLC–MS/MS, and subsequently identified by database search and then quantified. The data presented here are related to a previously published research article describing the interplay of S. aureus HG001 and human epithelial cells (Surmann et al., 2015 [1]. They have been deposited to the ProteomeXchange platform with the identifiers PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002384 for the S. aureus HG001 proteome dataset and PRIDE: http://www.ebi.ac.uk/pride/archive/projects/PXD002388 for the A549 proteome dataset.

  18. Pathogen inactivation by riboflavin and ultraviolet light illumination accelerates the red blood cell storage lesion and promotes eryptosis.

    Qadri, Syed M; Chen, Deborah; Schubert, Peter; Perruzza, Darian L; Bhakta, Varsha; Devine, Dana V; Sheffield, William P

    2017-03-01

    Pathogen reduction treatment using riboflavin and ultraviolet light illumination (Mirasol) effectively reduces the risk of transfusion-transmitted infections. This treatment is currently licensed for only platelets and plasma products, while its application to whole blood (WB) to generate pathogen-inactivated red blood cells (RBCs) is under development. RBC storage lesion, constituting numerous morphologic and biochemical changes, influences RBC quality and limits shelf life. Stored RBCs further show enhanced susceptibility to RBC programmed cell death (eryptosis) characterized by increased cytosolic Ca 2+ -provoked membrane phosphatidylserine (PS) externalization. Using a "pool-and-split" approach, we examined multiple variables of RBC storage lesion and eryptosis in RBC units, derived from Mirasol-treated or untreated WB, after 4 to 42 days of storage, under blood bank conditions. In comparison to untreated RBC units, Mirasol treatment significantly altered membrane microvesiculation, supernatant hemoglobin, osmotic fragility, and intracellular adenosine triphosphate levels but did not influence membrane CD47 expression and 2,3-diphosphoglycerate levels. Mirasol-treated RBCs showed significantly higher PS exposure after 42, but not after not more than 21, days of storage, which was accompanied by enhanced cytosolic Ca 2+ activity, ceramide abundance, and oxidative stress, but not p38 kinase activation. Mirasol treatment significantly augmented PS exposure, Ca 2+ entry, and protein kinase C activation after energy depletion, a pathophysiologic cell stressor. Mirasol-treated RBCs were, however, more resistant to cell shrinkage. Prolonged storage of Mirasol-treated RBCs significantly increases the proportion of eryptotic RBCs, while even short-term storage enhances the susceptibility of RBCs to stress-induced eryptosis, which could reduce posttransfusion RBC recovery in patients. © 2016 AABB.

  19. Simulation study of a PEM fuel cell system fed by hydrogen produced by partial oxidation

    Ozdogan, S [Marmara University, Faculty of Engineering, Istanbul (Turkey); Ersoz, A; Olgun, H [TUBITAK Marmara Research Center, Energy Systems and Environmental Research Institute, Kocaeli (Turkey)

    2003-09-01

    Within the frame of sustainable development, efficient and clean, if possible zero emission energy production technologies are of utmost importance in various sectors such as utilities, industry, households and transportation. Low-temperature fuel cell systems are suitable for powering transportation systems such as automobiles and trucks in an efficient and low-emitting manner. Proton exchange membrane (PEM) fuel cell systems constitute the most promising low temperature fuel cell option being developed globally. PEM fuel cells generate electric power from air and hydrogen or from a hydrogen rich gas via electrochemical reactions. Water and waste heat are the only by-products of PEM fuel cells. There is great interest in converting current hydrocarbon based common transportation fuels such as gasoline and diesel into hydrogen rich gases acceptable by PEM fuel cells. Hydrogen rich gases can be produced from conventional transportation fuels via various reforming technologies. Steam reforming, partial oxidation and auto-thermal reforming are the three major reforming technologies. In this paper, we discuss the results of a simulation study for a PEM fuel cell with partial oxidation. The Aspen HYSYS 3.1 code has been used for simulation purposes. Two liquid hydrocarbon fuels have been selected to investigate the effect of average molecular weights of hydrocarbons, on the fuel processing efficiency. The overall system efficiency depends on the fuel preparation and fuel cell efficiencies as well as on the heat integration within the system. It is desired to investigate the overall system efficiencies for net electrical power production at 100 kW considering bigger scale transport applications. Results indicate that fuel properties, fuel preparation system operating parameters and PEM fuel cell polarization curve characteristics all affect the overall system efficiency. (authors)

  20. Release kinetics and cell viability of ibuprofen nanocrystals produced by melt-emulsification.

    Fernandes, A R; Dias-Ferreira, J; Cabral, C; Garcia, M L; Souto, E B

    2018-06-01

    The clinical use of poorly water-soluble drugs has become a big challenge in pharmaceutical development due to the compromised bioavailability of the drugs in vivo. Nanocrystals have been proposed as a formulation strategy to improve the dissolution properties of these drugs. The benefits of using nanocrystals in drug delivery, when compared to other nanoparticles, are related to their production facilities, simple structure, and suitability for a variety of administration routes. High pressure homogenization (HPH) is the most promising production process, which can be employed at low or high temperatures. Ibuprofen nanocrystals with a mean size below 175 nm, and polydispersity below 0.18, have been produced by melt-emulsification, followed by HPH. Two nanocrystal formulations, differing on the surfactant composition, have been produced, their in vitro ibuprofen release tested in Franz diffusion cells and adjusted to several kinetic models (zero order, first order, Higuchi, Hixson-Crowell, Korsmeyer-Peppas, Baker-Lonsdale and Weibull model). Cell viability was assessed at 3, 6 and 24 h of incubation on human epithelial colorectal cells (Caco-2) by AlamarBlue ® colorimetric assay. For both formulations, Caco-2 cells viability was dependent on the drug concentration and time of exposure. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. [Investigation of emergency capacities for occupational hazard accidents in silicon solar cell producing enterprises].

    Yang, D D; Xu, J N; Zhu, B L

    2016-11-20

    Objective: To investigate and analyze the influential factors of occupational hazard acci-dents, emergency facilities and emergency management in Silicon solar cell producing enterprises, then to pro-vide scientific strategies. Methods: The methods of occupationally healthy field investigating, inspecting of ven-tilation effectiveness, setup of emergency program and wearing chemical suit were used. Results: The mainly occupational hazard accidents factors in the process of Silicon solar cell producing included poisoning chemi-cals, high temperature, onizing radiation and some workplaces. The poisoning chemicals included nitric acid, hydrofluoric acid, sulfuric acid, hydrochloric acid, sodium hydroxide, potassium hydroxide, chlorine, phos-phorus oxychloride, phosphorus pentoxide, nitrogen dioxide, ammonia, silane, and so on; the workplaces in-cluded the area of producing battery slides and auxiliary producing area. Among the nine enterprises, gas detec-tors were installed in special gas supplying stations and sites, but the height, location and alarmvalues of gas detectors in six enterprises were not according with standard criteria; emergency shower and eyewash equip-ment were installed in workplaces with strong corrosive chemicals, but the issues of waste water were not solved; ventilation systems were set in the workplaces with ammonia and silane, but not qualified with part lo-cations and parameters in two enterprises; warehouses with materials of acid, alkali, chemical ammonia and phosphorus oxychloride were equipped with positive - pressure air respirator resuscitator and emergency cabi-nets, but with insufficient quantity in seven enterprises and expiration in part of products. The error rate of set-up emergency program and wearing chemical cloth were 30%~100% and 10%~30%, respectively. Among the nine enterprises, there were emergency rescue plans for dangerous chemical accidents, but without profession-al heatstroke and irradiation accident emergency plans

  2. Phenotypic and genomic analysis of serotype 3 Sabin poliovirus vaccine produced in MRC-5 cell substrate.

    Alirezaie, Behnam; Taqavian, Mohammad; Aghaiypour, Khosrow; Esna-Ashari, Fatemeh; Shafyi, Abbas

    2011-05-01

    The cell substrate has a pivotal role in live virus vaccines production. It is necessary to evaluate the effects of the cell substrate on the properties of the propagated viruses, especially in the case of viruses which are unstable genetically such as polioviruses, by monitoring the molecular and phenotypical characteristics of harvested viruses. To investigate the presence/absence of mutation(s), the near full-length genomic sequence of different harvests of the type 3 Sabin strain of poliovirus propagated in MRC-5 cells were determined. The sequences were compared with genomic sequences of different virus seeds, vaccines, and OPV-like isolates. Nearly complete genomic sequencing results, however, revealed no detectable mutations throughout the genome RNA-plaque purified (RSO)-derived monopool of type 3 OPVs manufactured in MRC-5. Thirty-six years of experience in OPV production, trend analysis, and vaccine surveillance also suggest that: (i) different monopools of serotype 3 OPV produced in MRC-5 retained their phenotypic characteristics (temperature sensitivity and neuroattenuation), (ii) MRC-5 cells support the production of acceptable virus yields, (iii) OPV replicated in the MRC-5 cell substrate is a highly efficient and safe vaccine. These results confirm previous reports that MRC-5 is a desirable cell substrate for the production of OPV. Copyright © 2011 Wiley-Liss, Inc.

  3. Polymorphous silicon thin films produced in dusty plasmas: application to solar cells

    Roca i Cabarrocas, Pere; Chaabane, N; Kharchenko, A V; Tchakarov, S

    2004-01-01

    We summarize our current understanding of the optimization of PIN solar cells produced by plasma enhanced chemical vapour deposition from silane-hydrogen mixtures. To increase the deposition rate, the discharge is operated under plasma conditions close to powder formation, where silicon nanocrystals contribute to the deposition of so-called polymorphous silicon thin films. We show that the increase in deposition rate can be achieved via an accurate control of the plasma parameters. However, this also results in a highly defective interface in the solar cells due to the bombardment of the P-layer by positively charged nanocrystals during the deposition of the I-layer. We show that decreasing the ion energy by increasing the total pressure or by using silane-helium mixtures allows us to increase both the deposition rate and the solar cells efficiency, as required for cost effective thin film photovoltaics

  4. New strategies to produce and detect singlet oxygen in a cell

    Gollmer, Anita

    2012-01-01

    of the general methodology to generate and detect singlet oxygen is currently of great importance in order to better understand the roles played by singlet oxygen in photo-induced cell death. From a mechanistic perspective, experiments performed at the level of a single cell provide unique insight......Singlet oxygen, the first excited electronic state of molecular oxygen, plays a major role in oxygen-dependent photo-induced cell death. In such systems, singlet oxygen is generally produced in a photosensitized process wherein light is absorbed by a molecule (the so-called sensitizer) which......, and that is the perspective of this study. Although the direct optical detection of singlet oxygen by its near IR phosphorescence is the ideal way to monitor this species, it suffers from the problem of weak signal intensity. Fluorescent probes can be a more sensitive way to detect singlet oxygen. The photochemical behavior...

  5. Completely ES cell-derived mice produced by tetraploid complementation using inner cell mass (ICM deficient blastocysts.

    Duancheng Wen

    Full Text Available Tetraploid complementation is often used to produce mice from embryonic stem cells (ESCs by injection of diploid (2n ESCs into tetraploid (4n blastocysts (ESC-derived mice. This method has also been adapted to mouse cloning and the derivation of mice from induced pluripotent stem (iPS cells. However, the underlying mechanism(s of the tetraploid complementation remains largely unclear. Whether this approach can give rise to completely ES cell-derived mice is an open question, and has not yet been unambiguously proven. Here, we show that mouse tetraploid blastocysts can be classified into two groups, according to the presence or absence of an inner cell mass (ICM. We designate these as type a (presence of ICM at blastocyst stage or type b (absence of ICM. ESC lines were readily derived from type a blastocysts, suggesting that these embryos retain a pluripotent epiblast compartment; whereas the type b blastocysts possessed very low potential to give rise to ESC lines, suggesting that they had lost the pluripotent epiblast. When the type a blastocysts were used for tetraploid complementation, some of the resulting mice were found to be 2n/4n chimeric; whereas when type b blastocysts were used as hosts, the resulting mice are all completely ES cell-derived, with the newborn pups displaying a high frequency of abdominal hernias. Our results demonstrate that completely ES cell-derived mice can be produced using ICM-deficient 4n blastocysts, and provide evidence that the exclusion of tetraploid cells from the fetus in 2n/4n chimeras can largely be attributed to the formation of ICM-deficient blastocysts.

  6. EPIPOX: Immunoinformatic Characterization of the Shared T-Cell Epitome between Variola Virus and Related Pathogenic Orthopoxviruses

    Magdalena Molero-Abraham

    2015-01-01

    developing new and safer smallpox vaccines. Variola virus genomes are now widely available, allowing computational characterization of the entire T-cell epitome and the use of such information to develop safe and yet effective vaccines. To this end, we identified 124 proteins shared between various species of pathogenic orthopoxviruses including variola minor and major, monkeypox, cowpox, and vaccinia viruses, and we targeted them for T-cell epitope prediction. We recognized 8,106, and 8,483 unique class I and class II MHC-restricted T-cell epitopes that are shared by all mentioned orthopoxviruses. Subsequently, we developed an immunological resource, EPIPOX, upon the predicted T-cell epitome. EPIPOX is freely available online and it has been designed to facilitate reverse vaccinology. Thus, EPIPOX includes key epitope-focused protein annotations: time point expression, presence of leader and transmembrane signals, and known location on outer membrane structures of the infective viruses. These features can be used to select specific T-cell epitopes suitable for experimental validation restricted by single MHC alleles, as combinations thereof, or by MHC supertypes.

  7. Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

    Liechti, George; Kuru, Erkin; Packiam, Mathanraj; Hsu, Yen-Pang; Tekkam, Srinivas; Hall, Edward; Rittichier, Jonathan T; VanNieuwenhze, Michael; Brun, Yves V; Maurelli, Anthony T

    2016-05-01

    The peptidoglycan (PG) cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

  8. Pathogenic Chlamydia Lack a Classical Sacculus but Synthesize a Narrow, Mid-cell Peptidoglycan Ring, Regulated by MreB, for Cell Division.

    George Liechti

    2016-05-01

    Full Text Available The peptidoglycan (PG cell wall is a peptide cross-linked glycan polymer essential for bacterial division and maintenance of cell shape and hydrostatic pressure. Bacteria in the Chlamydiales were long thought to lack PG until recent advances in PG labeling technologies revealed the presence of this critical cell wall component in Chlamydia trachomatis. In this study, we utilize bio-orthogonal D-amino acid dipeptide probes combined with super-resolution microscopy to demonstrate that four pathogenic Chlamydiae species each possess a ≤ 140 nm wide PG ring limited to the division plane during the replicative phase of their developmental cycles. Assembly of this PG ring is rapid, processive, and linked to the bacterial actin-like protein, MreB. Both MreB polymerization and PG biosynthesis occur only in the intracellular form of pathogenic Chlamydia and are required for cell enlargement, division, and transition between the microbe's developmental forms. Our kinetic, molecular, and biochemical analyses suggest that the development of this limited, transient, PG ring structure is the result of pathoadaptation by Chlamydia to an intracellular niche within its vertebrate host.

  9. Lagooning microbial fuel cells: A first approach by coupling electricity-producing microorganisms and algae

    Lobato, Justo; González del Campo, Araceli; Fernández, Francisco J.; Cañizares, Pablo; Rodrigo, Manuel A.

    2013-01-01

    Highlights: • An algae cathode of a MFC has been used without artificial mediators or catalysts. • To perform a lagooning wastewater treatment coupled with energy-producing MFC. • The producing electricity operates under day/night irradiation cycles, is shown. - Abstract: The paper focused on the start-up and performance characterisation of a new type of microbial fuel cell (MFC), in which an algae culture was seeded in the cathodic chamber to produce the oxygen required to complete the electrochemical reactions of the MFC, thus circumventing the need for a mechanical aerator. The system did not use mediators or high cost catalysts and it can be started-up easily using a straightforward three-stage procedure. The start-up consists of the separate production of the electricity-producing microorganisms and the algae cultures (stage I), replacement of the mechanical aeration system by the algae culture (stage II) and a change in the light dosage from a continuous input to a dynamic day/night profile. The MFC was operated under a regime of 12 h light and 12 h dark and was also operated in batch and continuous substrate-feeding modes. The same cell voltage was achieved when the cathode compartment was operated with air supplied by aerators, which means that this configuration can perform as well as the traditional one. The results also show the influence of both the organic load and light irradiation on electricity production and demonstrate that this type MFC is a robust and promising technology that can be considered as a first approach to perform a lagooning wastewater treatment with microbial fuel cells

  10. Drinking water purification by electrosynthesis of hydrogen peroxide in a power-producing PEM fuel cell.

    Li, Winton; Bonakdarpour, Arman; Gyenge, Előd; Wilkinson, David P

    2013-11-01

    The industrial anthraquinone auto-oxidation process produces most of the world's supply of hydrogen peroxide. For applications that require small amounts of H2 O2 or have economically difficult transportation means, an alternate, on-site H2 O2 production method is needed. Advanced drinking water purification technologies use neutral-pH H2 O2 in combination with UV treatment to reach the desired water purity targets. To produce neutral H2 O2 on-site and on-demand for drinking water purification, the electroreduction of oxygen at the cathode of a proton exchange membrane (PEM) fuel cell operated in either electrolysis (power consuming) or fuel cell (power generating) mode could be a possible solution. The work presented here focuses on the H2 /O2 fuel cell mode to produce H2 O2 . The fuel cell reactor is operated with a continuous flow of carrier water through the cathode to remove the product H2 O2 . The impact of the cobalt-carbon composite cathode catalyst loading, Teflon content in the cathode gas diffusion layer, and cathode carrier water flowrate on the production of H2 O2 are examined. H2 O2 production rates of up to 200 μmol h(-1)  cmgeometric (-2) are achieved using a continuous flow of carrier water operating at 30 % current efficiency. Operation times of more than 24 h have shown consistent H2 O2 and power production, with no degradation of the cobalt catalyst. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Intraportal injection of insulin-producing cells generated from human bone marrow mesenchymal stem cells decreases blood glucose level in diabetic rats.

    Tsai, Pei-Jiun; Wang, Hwai-Shi; Lin, Chi-Hung; Weng, Zen-Chung; Chen, Tien-Hua; Shyu, Jia-Fwu

    2014-01-01

    We studied the process of trans-differentiation of human bone marrow mesenchymal stem cells (hBM-MSCs) into insulin-producing cells. Streptozotocin (STZ)-induced diabetic rat model was used to study the effect of portal vein transplantation of these insulin-producing cells on blood sugar levels. The BM-MSCs were differentiated into insulin-producing cells under defined conditions. Real-time PCR, immunocytochemistry and glucose challenge were used to evaluate in vitro differentiation. Flow cytometry showed that hBM-MSCs were strongly positive for CD44, CD105 and CD73 and negative for hematopoietic markers CD34, CD38 and CD45. Differentiated cells expressed C-peptide as well as β-cells specific genes and hormones. Glucose stimulation increased C-peptide secretion in these cells. The insulin-producing, differentiated cells were transplanted into the portal vein of STZ-induced diabetic rats using a Port-A catheter. The insulin-producing cells were localized in the liver of the recipient rat and expressed human C-peptide. Blood glucose levels were reduced in diabetic rats transplanted with insulin-producing cells. We concluded that hBM-MSCs could be trans-differentiated into insulin-producing cells in vitro. Portal vein transplantation of insulin-producing cells alleviated hyperglycemia in diabetic rats.

  12. Putative porcine embryonic stem cell lines derived from aggregated four-celled cloned embryos produced by oocyte bisection cloning.

    Siriboon, Chawalit; Lin, Yu-Hsuan; Kere, Michel; Chen, Chun-Da; Chen, Lih-Ren; Chen, Chien-Hong; Tu, Ching-Fu; Lo, Neng-Wen; Ju, Jyh-Cherng

    2015-01-01

    We attempted to isolate ES cell lines using inner cell masses from high-quality cloned porcine blastocysts. After being seeded onto feeders, embryos had better (P cloned embryos (62.8, 42.6 and 12.8% vs. 76.2, 55.2 and 26.2%, respectively) compared to the non-aggregated group (41.6, 23.4 and 3.9%). Effects of feeder types (STO vs. MEF) and serum sources (FBS vs. KSR) on extraction of cloned embryo-derived porcine ES cells were examined. More (17.1%) ntES cell lines over Passage 3 were generated in the MEF/KSR group. However, ntES cells cultured in KSR-supplemented medium had a low proliferation rate with defective morphology, and eventually underwent differentiation or apoptosis subsequently. Approximately 26.1, 22.7 and 35.7% of primary colonies were formed after plating embryos in DMEM, DMEM/F12 and α-MEM media, respectively. Survival rates of ntES cells cultured in α-MEM, DMEM and DMEM/F12 were 16.7, 4.3 and 6.8%, respectively (P > 0.05). We further examined the beneficial effect of TSA treatment of 3× aggregated cloned embryos on establishment of ntES cell lines. Primary colony numbers and survival rates of ntES cells beyond passage 3 were higher (P cells, remaining undifferentiated over 25 passages, had alkaline phosphatase activity and expressed ES specific markers Oct4, Nanog, Sox2, and Rex01. Moreover, these ntES cells successfully differentiated into embryoid bodies (EBs) that expressed specific genes of all three germ layers after being cultured in LIF-free medium. In conclusion, we have successfully derived putative porcine ntES cells with high efficiency from quality cloned embryos produced by embryo aggregation, and optimized the ES cell culture system suitable for establishing and maintaining ntES cell lines in undifferentiated state.

  13. Anticancer Effects of Geopropolis Produced by Stingless Bees on Canine Osteosarcoma Cells In Vitro

    Naiara Costa Cinegaglia

    2013-01-01

    Full Text Available Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent, and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

  14. Anticancer effects of geopropolis produced by stingless bees on canine osteosarcoma cells in vitro.

    Cinegaglia, Naiara Costa; Bersano, Paulo Ricardo Oliveira; Araújo, Maria José Abigail Mendes; Búfalo, Michelle Cristiane; Sforcin, José Maurício

    2013-01-01

    Geopropolis is produced by indigenous stingless bees from the resinous material of plants, adding soil or clay. Its biological properties have not been investigated, such as propolis, and herein its cytotoxic action on canine osteosarcoma (OSA) cells was evaluated. OSA is a primary bone neoplasm diagnosed in dogs being an excellent model in vivo to study human OSA. spOS-2 primary cultures were isolated from the tumor of a dog with osteosarcoma and incubated with geopropolis, 70% ethanol (geopropolis solvent), and carboplatin after 6, 24, 48, and 72 hours. Cell viability was analyzed by the crystal violet method. Geopropolis was efficient against canine OSA cells in a dose- and time-dependent way, leading to a distinct morphology compared to control. Geopropolis cytotoxic action was exclusively due to its constituents since 70% ethanol (its solvent) had no effect on cell viability. Carboplatin had no effect on OSA cells. Geopropolis exerted a cytotoxic effect on canine osteosarcoma, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment.

  15. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul

    2016-01-01

    V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA...... Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also......-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae....

  16. Allelochemicals Produced by Brown Macroalgae of the Lobophora Genus Are Active against Coral Larvae and Associated Bacteria, Supporting Pathogenic Shifts to Vibrio Dominance.

    Morrow, Kathleen M; Bromhall, Katrina; Motti, Cherie A; Munn, Colin B; Bourne, David G

    2017-01-01

    Pervasive environmental stressors on coral reefs are attributed with shifting the competitive balance in favor of alternative dominants, such as macroalgae. Previous studies have demonstrated that macroalgae compete with corals via a number of mechanisms, including the production of potent primary and secondary metabolites that can influence coral-associated microbial communities. The present study investigates the effects of the Pacific brown macroalga Lobophora sp. (due to the shifting nature of the Lobophora species complex, it will be referred to here as Lobophora sp.) on coral bacterial isolates, coral larvae, and the microbiome associated with the coral Porites cylindrica. Crude aqueous and organic macroalgal extracts were found to inhibit the growth of coral-associated bacteria. Extracts and fractions were also shown to inhibit coral larval settlement and cause mortality at concentrations lower (pathogenic. Macroalgae (e.g., seaweeds) can physically and chemically interact with corals, causing abrasion, bleaching, and overall stress. This study contributes to a growing body of evidence suggesting that macroalgae play a critical role in shifting the coral holobiont equilibrium, which may promote the invasion of opportunistic pathogens and cause coral mortality, facilitating additional macroalgal growth and invasion in the reef. Thus, macroalgae not only contribute to a decline in coral fitness but also influence coral reef ecosystem structure. © Crown copyright 2016.

  17. Serine/Threonine Protein Phosphatase PstP of Mycobacterium tuberculosis Is Necessary for Accurate Cell Division and Survival of Pathogen*

    Sharma, Aditya K.; Arora, Divya; Singh, Lalit K.; Gangwal, Aakriti; Sajid, Andaleeb; Molle, Virginie; Singh, Yogendra; Nandicoori, Vinay Kumar

    2016-01-01

    Protein phosphatases play vital roles in phosphorylation-mediated cellular signaling. Although there are 11 serine/threonine protein kinases in Mycobacterium tuberculosis, only one serine/threonine phosphatase, PstP, has been identified. Although PstP has been biochemically characterized and multiple in vitro substrates have been identified, its physiological role has not yet been elucidated. In this study, we have investigated the impact of PstP on cell growth and survival of the pathogen in the host. Overexpression of PstP led to elongated cells and partially compromised survival. We find that depletion of PstP is detrimental to cell survival, eventually leading to cell death. PstP depletion results in elongated multiseptate cells, suggesting a role for PstP in regulating cell division events. Complementation experiments performed with PstP deletion mutants revealed marginally compromised survival, suggesting that all of the domains, including the extracellular domain, are necessary for complete rescue. On the other hand, the catalytic activity of PstP is absolutely essential for the in vitro growth. Mice infection experiments establish a definitive role for PstP in pathogen survival within the host. Depletion of PstP from established infections causes pathogen clearance, indicating that the continued presence of PstP is necessary for pathogen survival. Taken together, our data suggest an important role for PstP in establishing and maintaining infection, possibly via the modulation of cell division events. PMID:27758870

  18. Prevention of immunodeficiency virus induced CD4+ T-cell depletion by prior infection with a non-pathogenic virus

    TerWee, Julie A.; Carlson, Jennifer K.; Sprague, Wendy S.; Sondgeroth, Kerry S.; Shropshire, Sarah B.; Troyer, Jennifer L.; VandeWoude, Sue

    2008-01-01

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIV PCO ) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is not the primary cause of immunodeficiency. Although this approach was analogous to immunization with a modified live vaccine, correlates of immunity such as a serum-neutralizing antibody or virus-specific T-cell proliferative response were not found in protected animals. Differences in cytokine transcription profile, most notably in interferon gamma, were observed between the protected and unprotected groups. These data provide support for the importance of non-adaptive enhancement of the immune response in the prevention of CD4+ T-cell loss

  19. Conserved host response to highly pathogenic avian influenza virus infection in human cell culture, mouse and macaque model systems

    McDermott Jason E

    2011-11-01

    Full Text Available Abstract Background Understanding host response to influenza virus infection will facilitate development of better diagnoses and therapeutic interventions. Several different experimental models have been used as a proxy for human infection, including cell cultures derived from human cells, mice, and non-human primates. Each of these systems has been studied extensively in isolation, but little effort has been directed toward systematically characterizing the conservation of host response on a global level beyond known immune signaling cascades. Results In the present study, we employed a multivariate modeling approach to characterize and compare the transcriptional regulatory networks between these three model systems after infection with a highly pathogenic avian influenza virus of the H5N1 subtype. Using this approach we identified functions and pathways that display similar behavior and/or regulation including the well-studied impact on the interferon response and the inflammasome. Our results also suggest a primary response role for airway epithelial cells in initiating hypercytokinemia, which is thought to contribute to the pathogenesis of H5N1 viruses. We further demonstrate that we can use a transcriptional regulatory model from the human cell culture data to make highly accurate predictions about the behavior of important components of the innate immune system in tissues from whole organisms. Conclusions This is the first demonstration of a global regulatory network modeling conserved host response between in vitro and in vivo models.

  20. Repression of COUP-TFI Improves Bone Marrow-Derived Mesenchymal Stem Cell Differentiation into Insulin-Producing Cells

    Tao Zhang

    2017-09-01

    Full Text Available Identifying molecular mechanisms that regulate insulin expression in bone marrow-derived mesenchymal stem cells (bmMSCs can provide clues on how to stimulate the differentiation of bmMSCs into insulin-producing cells (IPCs, which can be used as a therapeutic approach against type 1 diabetes (T1D. As repression factors may inhibit differentiation, the efficiency of this process is insufficient for cell transplantation. In this study, we used the mouse insulin 2 (Ins2 promoter sequence and performed a DNA affinity precipitation assay combined with liquid chromatography-mass spectrometry to identify the transcription factor, chicken ovalbumin upstream promoter transcriptional factor I (COUP-TFI. Functionally, bmMSCs were reprogrammed into IPCs via COUP-TFI suppression and MafA overexpression. The differentiated cells expressed higher levels of genes specific for islet endocrine cells, and they released C-peptide and insulin in response to glucose stimulation. Transplantation of IPCs into streptozotocin-induced diabetic mice caused a reduction in hyperglycemia. Mechanistically, COUP-TFI bound to the DR1 (direct repeats with 1 spacer element in the Ins2 promoter, thereby negatively regulating promoter activity. Taken together, the data provide a novel mechanism by which COUP-TFI acts as a negative regulator in the Ins2 promoter. The differentiation of bmMSCs into IPCs could be improved by knockdown of COUP-TFI, which may provide a novel stem cell-based therapy for T1D. Keywords: siRNAs, differentiation, stem cell transplantation, diabetes, mesenchymal stem cells

  1. HCN Producing Bacteria Enable Sensing Of Non-Bioavailable Hg Species by the Whole Cell Biosensor

    Horvat, M.; Rijavec, T.; Koron, N.; Lapanje, A.

    2015-12-01

    Bacteria play an important role in Hg transformation reactions. The production of cyanide (HCN) and other secondary metabolites seems to be key elements involved in these transformations. Current hypotheses link the role of HCN production to growth inhibition of nonHCN producing competitor organisms (role of an antimicrobial agent). Our past investigations showed that HCN production did not correlate with antimicrobial activity and since pK value of HCN is very high (pK = 9,21), it can be expected that most of the produced HCN is removed from the microenvironment. This way, the expected inhibitory concentrations can hardly be reached. Accordingly, we proposed a new concept, where the ability of complexation of transient metals by HCN served as a regulation process for the accessibility of micro-elements. In our study, we focused on the presence of HCN producing bacteria and carried it out in the Hg contaminated environment connected to the Idrija Mercury Mine, Slovenia. We characterised the isolates according to the presence of Hg resistance (HgR), level of HCN production and genetic similarities. In laboratory setups, using our merR whole cell based biosensor, we determined the transformation of low bioavailable Hg0 and HgS forms into bioavailable Hg by these HCN producing bacteria. We observed that HgR strains producing HCN had the highest impact on increased Hg bioavailability. In the proposed ecological strategy HgR HCN producing bacteria increase their competitive edge over non-HgR competitors through the increase of Hg toxicity. Due to their activity, Hg is made available to other organisms as well and thus enters into the ecosystem. Finally, using some of the characteristics of bacteria (e.g. Hg resistance genetic elements), we developed a fully automated sensing approach, combining biosensorics and mechatronics, to measure the bioavailability of Hg in situ.

  2. A novel method for producing target cells and assessing cytotoxic T lymphocyte activity in outbred hosts

    Bendinelli Mauro

    2009-03-01

    Full Text Available Abstract Background Cytotoxic T lymphocytes play a crucial role in the immunological control of microbial infections and in the design of vaccines and immunotherapies. Measurement of cytotoxic T lymphocyte activity requires that the test antigen is presented by target cells having the same or compatible class I major hystocompatibility complex antigens as the effector cells. Conventional assays use target cells labeled with 51chromium and infer cytotoxic T lymphocyte activity by measuring the isotope released by the target cells lysed following incubation with antigen-specific cytotoxic T lymphocytes. This assay is sensitive but needs manipulation and disposal of hazardous radioactive reagents and provides a bulk estimate of the reporter released, which may be influenced by spontaneous release of the label and other poorly controllable variables. Here we describe a novel method for producing target in outbred hosts and assessing cytotoxic T lymphocyte activity by flow cytometry. Results The method consists of culturing skin fibroblasts, immortalizing them with a replication defective clone of simian virus 40, and finally transducing them with a bicistronic vector encoding the target antigen and the reporter green fluorescent protein. When used in a flow cytometry-based assay, the target cells obtained with this method proved valuable for assessing the viral envelope protein specific cytotoxic T lymphocyte activity in domestic cats acutely or chronically infected with feline immunodeficiency virus, a lentivirus similar to human immunodeficiency virus and used as animal model for AIDS studies. Conclusion Given the versatility of the bicistronic vector used, its ability to deliver multiple and large transgenes in target cells, and its extremely wide cell specificity when pseudotyped with the vesicular stomatitis virus envelope protein, the method is potentially exploitable in many animal species.

  3. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  4. Bioelectrochemical Haber-Bosch Process: An Ammonia-Producing H2 /N2 Fuel Cell.

    Milton, Ross D; Cai, Rong; Abdellaoui, Sofiene; Leech, Dónal; De Lacey, Antonio L; Pita, Marcos; Minteer, Shelley D

    2017-03-01

    Nitrogenases are the only enzymes known to reduce molecular nitrogen (N 2 ) to ammonia (NH 3 ). By using methyl viologen (N,N'-dimethyl-4,4'-bipyridinium) to shuttle electrons to nitrogenase, N 2 reduction to NH 3 can be mediated at an electrode surface. The coupling of this nitrogenase cathode with a bioanode that utilizes the enzyme hydrogenase to oxidize molecular hydrogen (H 2 ) results in an enzymatic fuel cell (EFC) that is able to produce NH 3 from H 2 and N 2 while simultaneously producing an electrical current. To demonstrate this, a charge of 60 mC was passed across H 2  /N 2 EFCs, which resulted in the formation of 286 nmol NH 3  mg -1 MoFe protein, corresponding to a Faradaic efficiency of 26.4 %. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Interaction of the pathogenic mold Aspergillus fumigatus with lung epithelial cells

    Nir eOsherov

    2012-09-01

    Full Text Available Aspergillus fumigatus is an opportunistic environmental mold that can cause severe allergic responses in atopic individuals and poses a life-threatening risk for severely immunocompromised patients. Infection is caused by inhalation of fungal spores (conidia into the lungs. The initial point of contact between the fungus and the host is a monolayer of lung epithelial cells. Understanding how these cells react to fungal contact is crucial to elucidating the pathobiology of Aspergillus-related disease states. The experimental systems, both in vitro and in vivo, used to study these interactions, are described. Distinction is made between bronchial and alveolar epithelial cells. The experimental findings suggest that lung epithelial cells are more than just innocent bystanders or a purely physical barrier against infection. They can be better described as an active extension of our innate immune system, operating as a surveillance mechanism that can specifically identify fungal spores and activate an offensive response to block infection. This response includes the internalization of adherent conidia and the release of cytokines, antimicrobial peptides and reactive oxygen species. In the case of allergy, lung epithelial cells can dampen an over-reactive immune response by releasing anti-inflammatory compounds such as kinurenine. This review summarizes our current knowledge regarding the interaction of A. fumigatus with lung epithelial cells. A better understanding of the interactions between A. fumigatus and lung epithelial cells has therapeutic implications, as stimulation or inhibition of the epithelial response may alter disease outcome.

  6. Melanin as a virulence factor of Paracoccidioides brasiliensis and other dimorphic pathogenic fungi: a minireview

    Taborda, Carlos P.; da Silva, Marcelo B.; Nosanchuk, Joshua D.; Travassos, Luiz R.

    2008-01-01

    Melanin pigments are substances produced by a broad variety of pathogenic microorganisms, including bacteria, fungi, and helminths. Microbes predominantly produce melanin pigment via tyrosinases, laccases, catecholases, and the polyketide synthase pathway. In fungi, melanin is deposited in the cell wall and cytoplasm, and melanin particles (“ghosts”) can be isolated from these fungi that have the same size and shape of the original cells. Melanin has been reported in several human pathogenic ...

  7. Insulin-Producing Cells Differentiated from Human Bone Marrow Mesenchymal Stem Cells In Vitro Ameliorate Streptozotocin-Induced Diabetic Hyperglycemia.

    Ying Xin

    Full Text Available The two major obstacles in the successful transplantation of islets for diabetes treatment are inadequate supply of insulin-producing tissue and immune rejection. Induction of the differentiation of human bone marrow-derived mesenchymal stem cells (hMSCs into insulin-producing cells (IPCs for autologous transplantation may alleviate those limitations.hMSCs were isolated and induced to differentiate into IPCs through a three-stage differentiation protocol in a defined media with high glucose, nicotinamide, and exendin-4. The physiological characteristics and functions of IPCs were then evaluated. Next, about 3 × 10(6 differentiated cells were transplanted into the renal sub-capsular space of streptozotocin (STZ-induced diabetic nude mice. Graft survival and function were assessed by immunohistochemistry, TUNEL staining and measurements of blood glucose levels in the mice.The differentiated IPCs were characterized by Dithizone (DTZ positive staining, expression of pancreatic β-cell markers, and human insulin secretion in response to glucose stimulation. Moreover, 43% of the IPCs showed L-type Ca2+ channel activity and similar changes in intracellular Ca2+ in response to glucose stimulation as that seen in pancreatic β-cells in the process of glucose-stimulated insulin secretion. Transplantation of functional IPCs into the renal subcapsular space of STZ-induced diabetic nude mice ameliorated the hyperglycemia. Immunofluorescence staining revealed that transplanted IPCs sustainably expressed insulin, c-peptide, and PDX-1 without apparent apoptosis in vivo.IPCs derived from hMSCs in vitro can ameliorate STZ-induced diabetic hyperglycemia, which indicates that these hMSCs may be a promising approach to overcome the limitations of islet transplantation.

  8. [DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

    D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

    1980-11-01

    A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

  9. Molecular Characterization of Viruses from Clinical Respiratory Samples Producing Unidentified Cytopathic Effects in Cell Culture

    Guy Boivin

    2009-07-01

    Full Text Available The sequence-independent single primer amplification (SISPA method was performed to identify a virus in 17 clinical respiratory samples producing uncharacterized cytopathic effects in LLC-MK2 cells. Sequence analysis of 600-1600 bp amplicons allowed the identification of six viruses (one influenza C, two parechovirus-3 and three cardioviruses. Genomic sequences of the cardioviruses showed similarities with those of the recently-described Saffold virus strain although significant variation was present in the viral surface EF and CD loops. These results demonstrate the usefulness of SISPA for identifying emerging viruses and also known viruses not easily identified by standard virological methods.

  10. Effective chikungunya virus-like particle vaccine produced in insect cells.

    Stefan W Metz

    Full Text Available The emerging arthritogenic, mosquito-borne chikungunya virus (CHIKV causes severe disease in humans and represents a serious public health threat in countries where Aedes spp mosquitoes are present. This study describes for the first time the successful production of CHIKV virus-like particles (VLPs in insect cells using recombinant baculoviruses. This well-established expression system is rapidly scalable to volumes required for epidemic responses and proved well suited for processing of CHIKV glycoproteins and production of enveloped VLPs. Herein we show that a single immunization with 1 µg of non-adjuvanted CHIKV VLPs induced high titer neutralizing antibody responses and provided complete protection against viraemia and joint inflammation upon challenge with the Réunion Island CHIKV strain in an adult wild-type mouse model of CHIKV disease. CHIKV VLPs produced in insect cells using recombinant baculoviruses thus represents as a new, safe, non-replicating and effective vaccine candidate against CHIKV infections.

  11. The development of methods for obtaining monoclonal antibody-producing cells

    Michał Skowicki

    2016-04-01

    Full Text Available Monoclonal antibodies (mAbs are biomolecules of great scientific and practical significance. In contrast to polyclonal antibodies from immune sera, they are homogeneous and monospecific, since they are produced by hybridoma cells representing a clone arising from a single cell. The successful technology was described for the first time in 1975; the inventors were later awarded the Nobel Prize. Currently, mAbs are broadly used as a research tool, in diagnostics and medicine in particular for the treatment of cancer or in transplantology. About 47 therapeutics based on monoclonal antibodies are now available in the US and Europe, and the number is still growing. Production of monoclonal antibodies is a multistage, time-consuming and costly process. Growing demand for these molecules creates space for research focused on improvements in hybridoma technology. Lower costs, human labor, and time are important goals of these attempts. In this article, a brief review of current methods and their advances is given.

  12. Effects of single- and multi-strain probiotics on biofilm formation and in vitro adhesion to bladder cells by urinary tract pathogens.

    Chapman, C M C; Gibson, G R; Rowland, I

    2014-06-01

    There is increasing evidence that probiotic bacteria can inhibit and/or prevent urinary tract infections. Possible mechanisms include prevention of adhesion of pathogens to the bladder epithelium and inhibition of biofilm formation. Currently there is interest in the comparative efficacy of single probiotics vs. strain mixtures. We have therefore tested the inhibitory activity of four single probiotics and four probiotic mixtures towards the urinary tract pathogens Escherichia coli NCTC 9001 and Enterococcus faecalis NCTC 00775. Inhibition of biofilm formation by cell-free supernatants was tested using the Crystal Violet assay, while prevention of pathogen adhesion to host cells was tested by using bladder cancer cells as a model for the human urinary tract. Under pH-controlled conditions, there was no significant inhibition of biofilm formation by any treatment. Without pH control, 5/8 treatments significantly inhibited biofilm production by E. coli, while 5/8 treatments inhibited production by E. faecalis. Using data from all Crystal Violet assays, there was no significant difference in the ability of single- and multi-strain probiotics to inhibit biofilm formation. In the cell culture assays, all treatments were able to significantly reduce numbers of pathogenic cells adhering to host cells by 2.5-3.5 logs. No significant difference was observed between the displacement caused by single strains and mixtures for either pathogen. Inhibition of biofilm seems to be a major mechanism of urinary tract pathogen exclusion, related to, and possibly dependent upon, the probiotic ability to reduce environmental pH. Exclusion via competition of binding sites is a possible in vivo mechanism for these probiotics. If an additive or synergistic effect exists between strains within a mixture, it does not manifest itself in a greater effect through these two inhibitory mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus

    2010-10-01

    1990. Hen egg white lysozyme expressed in, and secreted from, Aspergillus niger is correctly processed and folded. Biotechnology (New York) 8:741–745. 7...in bunyavirus-infected cells. J. Virol. 41:643–648. 18. Garry, C. E., and R. F. Garry. 2004. Proteomics computational analyses suggest that the...2005). Proteomic identification of proteins conjugated to ISG15 in mouse and human cells. Biochem. Biophys. Res. Commun. 336, 496–506. Haas, A.L

  14. Role of adipose tissue derived stem cells differentiated into insulin producing cells in the treatment of type I diabetes mellitus.

    Amer, Mona G; Embaby, Azza S; Karam, Rehab A; Amer, Marwa G

    2018-05-15

    Generation of new β cells is an important approach in the treatment of type 1 diabetes mellitus (type 1 DM). Adipose tissue-derived stem cells (ADSCs) might be one of the best sources for cell replacement therapy for diabetes. Therefore, this work aimed to test the possible role of transplanted insulin-producing cells (IPCs) differentiated from ADSCs in treatment of streptozotocin (STZ) induced type I DM in rats. Type 1 DM was induced by single intra peritoneal injection with STZ (50 mg/kg BW). Half of the diabetic rats were left without treatment and the other half were injected with differentiated IPCs directly into the pancreas. ADSCs were harvested, cultured and identified by testing their phenotypes through flow cytometry. They were further subjected to differentiation into IPCs using differentiation medium. mRNA expression of pancreatic transcription factors (pdx1), insulin and glucose transporter-2 genes by real time PCR was done to detect the cellular differentiation and confirmed by stimulated insulin secretion. The pancreatic tissues from all groups were examined 2 months after IPC transplantation and were subjected to histological, Immunohistochemical and morphometric study. The differentiated IPCs showed significant expression of pancreatic β cell markers and insulin secretion in glucose dependent manner. Treatment with IPCs induced apparent regeneration, diffused proliferated islet cells and significant increase in C-peptide immune reaction. We concluded that transplantation of differentiated IPCs improved function and morphology of Islet cells in diabetic rats. Consequently, this therapy option may be a promising therapeutic approach to patient with type 1 DM if proven to be effective and safe. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Mesenchymal stem cells and differentiated insulin producing cells are new horizons for pancreatic regeneration in type I diabetes mellitus.

    Domouky, Ayat M; Hegab, Ashraf S; Al-Shahat, Amal; Raafat, Nermin

    2017-06-01

    Diabetes mellitus has become the third human killer following cancer and cardiovascular disease. Millions of patients, often children, suffer from type 1 diabetes (T1D). Stem cells created hopes to regenerate damaged body tissues and restore their function. This work aimed at clarifying and comparing the therapeutic potential of differentiated and non-differentiated mesenchymal stem cells (MSCs) as a new line of therapy for T1D. 40 Female albino rats divided into group I (control): 10 rats and group II (diabetic), III and IV, 10 rats in each, were injected with streptozotocin (50mg/kg body weight). Group III (MSCs) were transplanted with bone marrow derived MSCs from male rats and group IV (IPCs) with differentiated insulin producing cells. Blood and pancreatic tissue samples were taken from all rats for biochemical and histological studies. MSCs reduced hyperglycemia in diabetic rats on day 15 while IPCs normalizes blood glucose level on day 7. Histological and morphometric analysis of pancreas of experimental diabetic rats showed improvement in MSCs-treated group but in IPCs-treated group, β-cells insulin immunoreactions were obviously returned to normal, with normal distribution of β-cells in the center and other cells at the periphery. Meanwhile, most of the pathological lesions were still detected in diabetic rats. MSCs transplantation can reduce blood glucose level in recipient diabetic rats. IPCs initiate endogenous pancreatic regeneration by neogenesis of islets. IPCs are better than MSCs in regeneration of β-cells. So, IPCs therapy can be considered clinically to offer a hope for patients suffering from T1D. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Generation of insulin-producing cells from rat mesenchymal stem cells using an aminopyrrole derivative XW4.4.

    Ouyang, Jingfeng; Huang, Wei; Yu, Wanwan; Xiong, Wei; Mula, Ramanjaneya V R; Zou, Hongbin; Yu, Yongping

    2014-02-05

    Type 1 diabetes mellitus (T1DM), a multisystem disease with both biochemical and anatomical/structural consequences, is a major health concern worldwide. Pancreatic islet transplantation provides a promising treatment for T1DM. However, the limited availability of islet tissue or new sources of insulin producing cells (IPCs) that are responsive to glucose hinder this promising approach. Though slow, the development of pancreatic beta-cell lines from rodent or human origin has been steadily progressing. Bone marrow-derived mesenchymal stem cells (MSCs) are multipotent, culture-expanded, non-hematopoietic cells that are currently being investigated as a novel cellular therapy. The in vitro differentiation potential of IPCs has raised hopes for a treatment of clinical diseases associated with autoimmunity. We screened for small molecules that induce pancreatic differentiation of IPCs. There are some compounds which showed positive effects on the DTZ staining. The aminopyrrole derivative compound XW4.4 which shows the best activity among them was found to induce pancreatic differentiation of rat MSCs (rMSCs). The in vitro studies indicated that treatment of rMSCs with compound XW4.4 resulted in differentiated cells with characteristics of IPCs including islet-like clusters, spherical, grape-like morphology, insulin secretion, positive for dithizone, glucose stimulation and expression of pancreatic endocrine cell marker genes. The data has also suggested that hepatocyte nuclear factor 3β (HNF 3β) may be involved in pancreatic differentiation of rMSCs when treated with XW4.4. Results indicate that XW4.4 induced rMSCs support the efforts to derive functional IPCs and serve as a means to alleviate limitations surrounding islet cell transplantation in the treatment of T1DM. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. CD8 T cell memory to a viral pathogen requires trans cosignaling between HVEM and BTLA.

    Rachel Flynn

    Full Text Available Defining the molecular interactions required to program activated CD8 T cells to survive and become memory cells may allow us to understand how to augment anti-viral immunity. HVEM (herpes virus entry mediator is a member of the tumor necrosis factor receptor (TNFR family that interacts with ligands in the TNF family, LIGHT and Lymphotoxin-α, and in the Ig family, B and T lymphocyte attenuator (BTLA and CD160. The Ig family members initiate inhibitory signaling when engaged with HVEM, but may also activate survival gene expression. Using a model of vaccinia virus infection, we made the unexpected finding that deficiency in HVEM or BTLA profoundly impaired effector CD8 T cell survival and development of protective immune memory. Mixed adoptive transfer experiments indicated that BTLA expressed in CD8α+ dendritic cells functions as a trans-activating ligand that delivers positive co-signals through HVEM expressed in T cells. Our data demonstrate a critical role of HVEM-BTLA bidirectional cosignaling system in antiviral defenses by driving the differentiation of memory CD8 T cells.

  18. Lipofection of insulin-producing RINm5F cells: methodological improvements.

    Barbu, Andreea; Welsh, Nils

    2007-01-01

    Cationic lipid/DNA-complexes have been widely used as gene transfer vectors because they are less toxic and immunogenic than viral vectors. The aim of the present study was to improve and characterize lipofection of an insulin-producing cell line. We compared the transfection efficiency of seven commercially available lipid formulations (Lipotaxi, SuperFect, Fugene, TransFast, Dosper, GenePORTER and LipofectAMINE) by flow cytometry analysis of GFP-expression. In addition, we have determined the influences of centrifugation, serum and a nuclear localization signal peptide on the lipofection efficiency. We observed that two lipid formulations, GenePORTER and LipofectAMINE, were able to promote efficient gene transfer in RINm5F cells. However, GenePORTER exhibited the important advantage of being able to transfect cells in the presence of serum and with less cytotoxicity than LipofectAMINE. LipofectAMINE-induced RINm5F cell death could partially be counteracted by TPA, forskolin or fumonisin beta(1). Finally, both centrifugation and a nuclear localization signal peptide increased transfection efficiency.

  19. Characterization and Inducing Melanoma Cell Apoptosis Activity of Mannosylerythritol Lipids-A Produced from Pseudozyma aphidis.

    Linlin Fan

    Full Text Available Mannosylerythritol lipids (MELs are natural glycolipid biosurfactants which have potential applications in the fields of food, cosmetic and medicine. In this study, MELs were produced from vegetable oil by Pseudozyma aphidis. Their structural data through LC/MS, GC/MS and NMR analysis revealed that MEL-A with two acetyls was the major compound and the identified homologs of MEL-A contained a length of C8 to C14 fatty acid chains. This glycolipid exhibited a surface tension of 27.69 mN/m at a critical micelle concentration (CMC, self-assembling into particles in the water solution. It was observed to induce cell growth-inhibition and apoptosis of B16 melanoma cells in a dose-dependent manner, as well as cause cell cycle arrest at the S phase. Further quantitative RT-PCR analysis and western blotting revealed an increasing tendency of both mRNA and protein expressions of Caspase-12, CHOP, GRP78 and Caspase-3, and a down-regulation of protein Bcl-2. Combined with the up regulation of signaling IRE1 and ATF6, it can be speculated that MEL-A-induced B16 melanoma cell apoptosis was associated with the endoplasmic reticulum stress (ERS.

  20. Whole-Cell Biocatalysis for Producing Ginsenoside Rd from Rb1 Using Lactobacillus rhamnosus GG.

    Ku, Seockmo; You, Hyun Ju; Park, Myeong Soo; Ji, Geun Eog

    2016-07-28

    Ginsenosides are the major active ingredients in ginseng used for human therapeutic plant medicines. One of the most well-known probiotic bacteria among the various strains on the functional food market is Lactobacillus rhamnosus GG. Biocatalytic methods using probiotic enzymes for producing deglycosylated ginsenosides such as Rd have a growing significance in the functional food industry. The addition of 2% cellobiose (w/v) to glucose-free de Man-Rogosa-Sharpe broths notably induced β-glucosidase production from L. rhamnosus GG. Enzyme production and activity were optimized at a pH, temperature, and cellobiose concentration of 6.0, 40°C, and 2% (w/v), respectively. Under these controlled conditions, β-glucosidase production in L. rhamnosus GG was enhanced by 25-fold. Additionally, whole-cell homogenates showed the highest β-glucosidase activity when compared with disrupted cell suspensions; the cell disruption step significantly decreased the β-glucosidase activity. Based on the optimized enzyme conditions, whole-cell L. rhamnosus GG was successfully used to convert ginsenoside Rb1 into Rd.

  1. Experimental investigation of solid oxide fuel cells using biomass gasification producer gases

    Norheim, Arnstein

    2005-07-01

    The main objective of this thesis is theoretical and experimental investigations related to utilisation of biomass gasification producer gases as fuel for Solid Oxide Fuel Cells (SOFC). Initial fundamental steps towards a future system of combined heat and power production based on biomass gasification and SOFC are performed and include: 1) Theoretical modeling of the composition of biomass gasification producer gases. 2) Experimental investigation of SOFC performance using biomass gasification producer gas as fuel. 3) Experimental investigation of SOFC performance using biomass gasification producer gas containing high sulphur concentration. The modeling of the composition of gasifier producer gas was performed using the program FactSage. The main objective was to investigate the amount and speciation of trace species in the producer gases as several parameters were varied. Thus, the composition at thermodynamic equilibrium of sulphur, chlorine, potassium, sodium and compounds of these were established. This was done for varying content of the trace species in the biomass material at different temperatures and fuel utilisation i.e. varying oxygen content in the producer gas. The temperature interval investigated was in the range of normal SOFC operation. It was found that sulphur is expected to be found as H2S irrespective of temperature and amount of sulphur. Only at very high fuel utilisation some S02 is formed. Important potassium containing compounds in the gas are gaseous KOH and K. When chlorine is present, the amount of KOH and K will decrease due to the formation of KCI. The level of sodium investigated here was low, but some Na, NaOH and NaCl is expected to be formed. Below a certain temperature, condensation of alkali rich carbonates may occur. The temperature at which condensation begins is mainly depending on the amount of potassium present; the condensation temperature increases with increasing potassium content. In the first experimental work

  2. Cell wall carbohydrates content of pathogenic Candida albicans strain morphological forms.

    Staniszewska, Monika; Bondaryk, Małgorzata; Rabczenko, Daniel; Smoleńska-Sym, Gabriela; Kurzatkowski, Wiesław

    2013-01-01

    The study evaluated the cell wall carbohydrates fraction in blastoconidia grown in YEPD medium at 30 degrees C and in the conglomerate of true hyphae grown in human serum at 37 degrees C. The clinical isolate obtained from a child with widespread C. albicans infection was used in the study. The cells were broken with glass beads, centrifuged to harvest the cell wall followed by subjection to TFA hydrolysis and in the result of that released monosaccharides were detected by HPAEC-PAD. Both, serum and temperature conditions (37 degrees C) affected germination process influencing the cell wall carbohydrates content when incubation in serum was prolonged from 1 to 18 h. The mannan content of blastoconidia was almost twofold higher compared to filamentous forms (149.25 +/- 299.24 vs 77.26 +/- 122.07). The glucan content was threefold lower in blastoconidia compared to hyphae (251.86 +/- 243.44 vs 755.81 +/- 1299.30). The chitin level was fourfold lower in blastoconidia compared to filaments (23.86 +/- 54.09 vs 106.29 +/- 170.12). The reason for the differences in the carbohydrates content may be related to type of morphology induced in different environmental conditions. Among tested carbohydrates, glucan appeared to be present in appreciably larger amounts in both tested morphological fractions. The ultrastructure of the blastoconidial cell wall revealed striking differences compared to the hyphae indicating the carbohydrates content alterations for wall assembly during hyphal growth at alkaline pH and temp. 37 degrees C. The study provided evidence for the relationship between morphogenesis, cell-cell adhesion induced by serum and changes in the level of carbohydrates content.

  3. Recombinant Nox4 cytosolic domain produced by a cell or cell-free base systems exhibits constitutive diaphorase activity

    Nguyen, Minh Vu Chuong, E-mail: mvchuong@yahoo.fr [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France); Zhang, Leilei [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France); Lhomme, Stanislas; Mouz, Nicolas [PX' Therapeutics, MINATEC/Batiment de Haute Technologie, Grenoble (France); Lenormand, Jean-Luc [HumProTher Laboratory, TheReX/TIMC-IMAG UMR 5525 CNRS UJF, Universite Joseph Fourier, UFR de Medecine, Domaine de la Merci, 38706 La Tronche (France); Lardy, Bernard; Morel, Francoise [GREPI AGIM FRE 3405 CNRS-UJF, Universite Joseph Fourier, Grenoble (France)

    2012-03-16

    Highlights: Black-Right-Pointing-Pointer A comparison of two bacterial cell and cell-free protein expression systems is presented. Black-Right-Pointing-Pointer Soluble and active truncated Nox4 proteins are produced. Black-Right-Pointing-Pointer Nox4 has a constitutive diaphorase activity which is independent of cytosolic factors. Black-Right-Pointing-Pointer Isoform Nox4B is unable to initiate the first electronic transfer step. Black-Right-Pointing-Pointer Findings contribute to the understanding of the mechanism of Nox4 oxidase activity. -- Abstract: The membrane protein NADPH (nicotinamide adenine dinucleotide phosphate) oxidase Nox4 constitutively generates reactive oxygen species differing from other NADPH oxidases activity, particularly in Nox2 which needs a stimulus to be active. Although the precise mechanism of production of reactive oxygen species by Nox2 is well characterized, the electronic transfer throughout Nox4 remains unclear. Our study aims to investigate the initial electronic transfer step (diaphorase activity) of the cytosolic tail of Nox4. For this purpose, we developed two different approaches to produce soluble and active truncated Nox4 proteins. We synthesized soluble recombinant proteins either by in vitro translation or by bacteria induction. While proteins obtained by bacteria induction demonstrate an activity of 4.4 {+-} 1.7 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 20.5 {+-} 2.8 nmol/min/nmol with cytochrome c, the soluble proteins produced by cell-free expression system exhibit a diaphorase activity with a turn-over of 26 {+-} 2.6 nmol/min/nmol when measured against iodonitro tetrazolium chloride and 48 {+-} 20.2 nmol/min/nmol with cytochrome c. Furthermore, the activity of the soluble proteins is constitutive and does not need any stimulus. We also show that the cytosolic tail of the isoform Nox4B lacking the first NADPH binding site is unable to demonstrate any diaphorase activity pointing out the

  4. CCR6+ Th cells in the cerebrospinal fluid of persons with multiple sclerosis are dominated by pathogenic non-classic Th1 cells and GM-CSF-only-secreting Th cells.

    Restorick, S M; Durant, L; Kalra, S; Hassan-Smith, G; Rathbone, E; Douglas, M R; Curnow, S J

    2017-08-01

    Considerable attention has been given to CCR6 + IL-17-secreting CD4 + T cells (Th17) in the pathology of a number of autoimmune diseases including multiple sclerosis (MS). However, other Th subsets also play important pathogenic roles, including those that secrete IFNγ and GM-CSF. CCR6 expression by Th17 cells allows their migration across the choroid plexus into the cerebrospinal fluid (CSF), where they are involved in the early phase of experimental autoimmune encephalomyelitis (EAE), and in MS these cells are elevated in the CSF during relapses and contain high frequencies of autoreactive cells. However, the relatively low frequency of Th17 cells suggests they cannot by themselves account for the high percentage of CCR6 + cells in MS CSF. Here we identify the dominant CCR6 + T cell subsets in both the blood and CSF as non-classic Th1 cells, including many that secrete GM-CSF, a key encephalitogenic cytokine. In addition, we show that Th cells secreting GM-CSF but not IFNγ or IL-17, a subset termed GM-CSF-only-secreting Th cells, also accumulate in the CSF. Importantly, in MS the proportion of IFNγ- and GM-CSF-secreting T cells expressing CCR6 was significantly enriched in the CSF, and was elevated in MS, suggesting these cells play a pathogenic role in this disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. The stimulation of EL-4 cells to produce interleukin-2 and its potential use in immunocytotoxicity testing

    Lasek, W.; Steer, S.; Clothier, R.; Balls, M.

    1989-01-01

    The ability of EL-4 thymoma cells to produce interleukin-2 (IL-2) following exposure to phorbol-12-myristate 13-acetate (PMA) and Concanavalin A (Con A) has been studied in vitro using medium containing either 10% or 1% fetal calf serum (FCS). The potent stimulatory effect of PMA on IL-2 production by EL-4 cells has been confirmed by measuring 3H-thymidine incorporation by the IL-2-dependent T cell line, CTLL-2, in the presence of conditioned medium (CM) from stimulated cultures. EL-4 cells produced several times more IL-2 when cultured in medium containing 10% FCS than when only 1% FCS was present. Added together, PMA and Con A acted synergistically in some EL-4 cell cultures. The ability of E:-4 cells to produce IL-2 was maintained after further incubation without stimulants. CM with IL-2 activity from stimulated EL-4 cells could prove useful in immunotoxicity testing

  6. Flow-through immunomagnetic separation system for waterborne pathogen isolation and detection: Application to Giardia and Cryptosporidium cell isolation

    Ramadan, Qasem, E-mail: qasem.alramadan@epfl.ch [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore); Christophe, Lay; Teo, William; ShuJun, Li; Hua, Feng Han [Bioelectronics Program, Institute of Microelectronics, 11 Science Park Road, Singapore 117685 (Singapore)

    2010-07-12

    Simultaneous sample washing and concentration of two waterborne pathogen samples were demonstrated using a rotational magnetic system under continuous flow conditions. The rotation of periodically arranged small permanent magnets close to a fluidic channel carrying magnetic particle suspension allows the trapping and release of particles along the fluidic channel in a periodic manner. Each trapping and release event resembles one washing cycle. The performance of the magnetic separation system (MSS) was evaluated in order to test its functionality to isolate magnetic-labelled protozoan cells from filtered, concentrated tap water, secondary effluent water, and purified water. Experimental protocols described in US Environmental Protection Agency method 1623 which rely on the use of a magnetic particle concentrator, were applied to test and compare our continuous flow cell separation system to the standard magnetic bead-based isolation instruments. The recovery efficiencies for Giardia cysts using the magnetic tube holder and our magnetic separation system were 90.5% and 90.1%, respectively, from a tap water matrix and about 31% and 18.5%, respectively, from a spiked secondary effluent matrix. The recovery efficiencies for Cryptosporidium cells using the magnetic tube holder and our magnetic separation system were 90% and 83.3%, respectively, from a tap water matrix and about 38% and 36%, respectively, from a spiked secondary effluent matrix. Recoveries from all matrices with the continuous flow system were typically higher in glass tubing conduits than in molded plastic conduits.

  7. Generation of clinical grade dendritic cells with capacity to produce biologically active IL-12p70

    Bigalke Iris

    2007-04-01

    Full Text Available Abstract Background For optimal T cell activation it is desirable that dendritic cells (DCs display peptides within MHC molecules as signal 1, costimulatory molecules as signal 2 and, in addition, produce IL-12p70 as signal 3. IL-12p70 polarizes T cell responses towards CD4+ T helper 1 cells, which then support the development of CD8+ cytotoxic T lymphocytes. We therefore developed new maturation cocktails allowing DCs to produce biologically active IL-12p70 for large-scale cancer vaccine development. Methods After elutriation of leukapheresis products in a closed bag system, enriched monocytes were cultured with GM-CSF and IL-4 for six days to generate immature DCs that were then matured with cocktails, containing cytokines, interferon-gamma, prostaglandin E2, and a ligand for Toll-like receptor 8, with or without poly (I:C. Results Mature DCs expressed appropriate maturation markers and the lymph node homing chemokine receptor, CCR7. They retained full maturity after culture for two days without maturation cocktails and following cryopreservation. TLR ligand stimulation induced DCs capable of secreting IL-12p70 in primary cultures and after one day of coculture with CD40L-expressing fibroblasts, mimicking an encounter with T cells. DCs matured with our new cocktails containing TLR8 ligand, with or without poly (I:C, induced alloresponses and stimulated virus-specific T cells after peptide-pulsing. DCs matured in cocktails containing TLR8 ligand without poly (I:C could also be loaded with RNA as a source of antigen, whereas DCs matured in cocktails containing poly (I:C were unable to express proteins following RNA transfer by electroporation. Conclusion Our new maturation cocktails allowed easy DC harvesting, stable maturation and substantial recoveries of mature DCs after cryopreservation. Our procedure for generating DCs is easily adaptable for GMP-compliance and yields IL-12p70-secreting DCs suitable for development of cancer vaccines using

  8. Pneumococcal infections in humans are associated with increased apoptosis and trafficking of type 1 cytokine-producing T cells

    Kemp, Kåre; Bruunsgaard, Helle; Skinhøj, Peter

    2002-01-01

    , little is known regarding the T-cell response during in vivo infections in humans. The purpose of this study was to test the hypothesis that activated T cells producing type 1 cytokines were engaged in the host response to pneumococcal infections. The phenotype and function of T cells were studied in 22...

  9. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  10. Anode microbial communities produced by changing from microbial fuel cell to microbial electrolysis cell operation using two different wastewaters

    Kiely, Patrick D.; Cusick, Roland; Call, Douglas F.; Selembo, Priscilla A.; Regan, John M.; Logan, Bruce E.

    2011-01-01

    Conditions in microbial fuel cells (MFCs) differ from those in microbial electrolysis cells (MECs) due to the intrusion of oxygen through the cathode and the release of H2 gas into solution. Based on 16S rRNA gene clone libraries, anode communities in reactors fed acetic acid decreased in species richness and diversity, and increased in numbers of Geobacter sulfurreducens, when reactors were shifted from MFCs to MECs. With a complex source of organic matter (potato wastewater), the proportion of Geobacteraceae remained constant when MFCs were converted into MECs, but the percentage of clones belonging to G. sulfurreducens decreased and the percentage of G. metallireducens clones increased. A dairy manure wastewater-fed MFC produced little power, and had more diverse microbial communities, but did not generate current in an MEC. These results show changes in Geobacter species in response to the MEC environment and that higher species diversity is not correlated with current. © 2010 Elsevier Ltd.

  11. Regulation of allergic airway inflammation by adoptive transfer of CD4+ T cells preferentially producing IL-10.

    Matsuda, Masaya; Doi, Kana; Tsutsumi, Tatsuya; Fujii, Shinya; Kishima, Maki; Nishimura, Kazuma; Kuroda, Ikue; Tanahashi, Yu; Yuasa, Rino; Kinjo, Toshihiko; Kuramoto, Nobuyuki; Mizutani, Nobuaki; Nabe, Takeshi

    2017-10-05

    Anti-inflammatory pharmacotherapy for asthma has mainly depended on the inhalation of glucocorticoids, which non-specifically suppress immune responses. If the anti-inflammatory cytokine interleukin (IL)-10 can be induced by a specific antigen, asthmatic airway inflammation could be suppressed when individuals are exposed to the antigen. The purpose of this study was to develop cellular immunotherapeutics for atopic diseases using IL-10-producing CD4 + T cells. Spleen cells isolated from ovalbumin (OVA)-sensitized mice were cultured with the antigen, OVA and growth factors, IL-21, IL-27 and TGF-β for 7 days. After the 7-day culture, the CD4 + T cells were purified using a murine CD4 magnetic beads system. When the induced CD4 + T cells were stimulated by OVA in the presence of antigen-presenting cells, IL-10 was preferentially produced in vitro. When CD4 + T cells were adoptively transferred to OVA-sensitized mice followed by intratracheal OVA challenges, IL-10 was preferentially produced in the serum and bronchoalveolar lavage fluid in vivo. IL-10 production coincided with the inhibition of eosinophilic airway inflammation and epithelial mucus plugging. Most of the IL-10-producing CD4 + T cells were negative for Foxp3 and GATA-3, transcription factors of naturally occurring regulatory T cells and Th2 cells, respectively, but double positive for LAG-3 and CD49b, surface markers of inducible regulatory T cells, Tr1 cells. Collectively, most of the induced IL-10-producing CD4 + T cells could be Tr1 cells, which respond to the antigen to produce IL-10, and effectively suppressed allergic airway inflammation. The induced Tr1 cells may be useful for antigen-specific cellular immunotherapy for atopic diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Metal chloride-treated graphene oxide to produce high-performance polymer solar cells

    Choi, Eun-Su; Noh, Yong-Jin; Kwon, Sung-Nam; Na, Seok-In, E-mail: nsi12@jbnu.ac.kr [Professional Graduate School of Flexible and Printable Electronics and Polymer Materials Fusion Research Center, Chonbuk National University, 664-14, Deokjin-dong, Deokjin-gu, Jeonju-si, Jeollabuk-do 561-756 (Korea, Republic of); Jeon, Ye-Jin [School of Materials Science and Engineering, Gwangju Institute of Science and Technology, Gwangju 500-712 (Korea, Republic of); Kim, Seok-Soon, E-mail: sskim@kunsan.ac.kr [Department of Nano and Chemical Engineering, Kunsan National University, Kunsan, Jeollabuk-do 753-701 (Korea, Republic of); Kim, Tae-Wook [Soft Innovative Materials Research Center, Institute of Advanced Composite Materials, Korea Institute of Science and Technology, San 101, Eunha-ri, Bongdong-eup, Wanju-gun, Jeollabuk-do 565-905 (Korea, Republic of)

    2015-07-13

    We introduce a simple but effective graphene oxide (GO) modification with metal chloride treatments to produce high-performance polymer solar cells (PSCs). The role of various metal chlorides on GO and their effects on device performances of PSCs was investigated. X-ray photoelectron spectroscopy, ultraviolet photoemission spectroscopy, and current-voltage measurement studies demonstrated that metal chloride can induce a p-doping effect and increase the GO work-function, thus resulting in an improved built-in potential and interfacial resistance in PSCs. The resultant PSCs with metal chloride exhibited improved device efficiency than those with the neat GO. Furthermore, with the metal chloride-doped GO, we finally achieved an excellent PSC-efficiency of 6.58% and a very desirable device stability, which constitute a highly similar efficiency but much better PSC life-time to conventional device with poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS). This study could be a valuable way to produce various PEDOT:PSS alternatives and beneficial for producing high-performance and cost-efficient polymeric devices.

  13. CD11b⁺, Ly6G⁺ cells produce type I interferon and exhibit tissue protective properties following peripheral virus infection.

    Matthew A Fischer

    2011-11-01

    Full Text Available The goal of the innate immune system is containment of a pathogen at the site of infection prior to the initiation of an effective adaptive immune response. However, effector mechanisms must be kept in check to combat the pathogen while simultaneously limiting undesirable destruction of tissue resulting from these actions. Here we demonstrate that innate immune effector cells contain a peripheral poxvirus infection, preventing systemic spread of the virus. These innate immune effector cells are comprised primarily of CD11b⁺Ly6C⁺Ly6G⁻ monocytes that accumulate initially at the site of infection, and are then supplemented and eventually replaced by CD11b⁺Ly6C⁺Ly6G⁺ cells. The phenotype of the CD11b⁺Ly6C⁺Ly6G⁺ cells resembles neutrophils, but the infiltration of neutrophils typically occurs prior to, rather than following, accumulation of monocytes. Indeed, it appears that the CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrated the site of VACV infection in the ear are phenotypically distinct from the classical description of both neutrophils and monocyte/macrophages. We found that CD11b⁺Ly6C⁺Ly6G⁺ cells produce Type I interferons and large quantities of reactive oxygen species. We also observed that depletion of Ly6G⁺ cells results in a dramatic increase in tissue damage at the site of infection. Tissue damage is also increased in the absence of reactive oxygen species, although reactive oxygen species are typically thought to be damaging to tissue rather than protective. These data indicate the existence of a specialized population of CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrates a site of virus infection late and protects the infected tissue from immune-mediated damage via production of reactive oxygen species. Regulation of the action of this population of cells may provide an intervention to prevent innate immune-mediated tissue destruction.

  14. Hydrogen evolution in enzymatic photoelectrochemical cell using modified seawater electrolytes produced by membrane desalination process

    Joo, Hyunku; Yoon, Jaekyung [Hydrogen Energy Research Center, New and Renewable Energy Research Division, Korea Institute of Energy Research, 71-2 Jang-dong, Yuseong-gu, Daejeon 305-343 (Korea); Bae, Sanghyun [Department of Environmental Engineering, Yonsei University, 234 Maeji-ri, Hungub-myun, Wonju, Gangwon-do 220-710 (Korea); Kim, Chunghwan; Kim, Suhan [Korea Institute of Water and Environment, K-Water, 462-1 Jeonmin-dong, Yuseong-gu, Daejeon 305-730 (Korea)

    2009-09-15

    In the near future, potential water shortages are expected to occur all over the world and this problem will have a significant influence on the availability of water for water-splitting processes, such as photocatalysis and electrolysis, as well as for drinking water. For this reason, it has been suggested that seawater could be used as an alternative for the various water industries including hydrogen production. Seawater contains a large amount of dissolved ion components, thus allowing it to be used as an electrolyte in photoelectrochemical (PEC) systems for producing hydrogen. Especially, the concentrate (retentate) stream shows higher salinity than the seawater fed to the membrane desalination process, because purified water (fresh water) is produced as the permeate stream and the waste brine is more concentrated than the original seawater. In this study, we investigated the hydrogen evolution rate in a photoelectrochemical system, including the preparation and characterization of an anodized tubular TiO{sub 2} electrode (ATTE) as both the photoanode and the cathode with the assistance of an immobilized hydrogenase enzyme and an external bias (solar cell), and the use of various qualities of seawater produced by membrane desalination processes as the electrolyte. The results showed that the rate of hydrogen evolution obtained using the nanofiltration (NF) retentate in the PEC system is ca. 105 {mu}mol/cm{sup 2} h, showing that this is an effective seawater electrolyte for hydrogen production, the optimum amount of enzyme immobilized on the cathode is ca. 3.66 units per geometrical unit area (1 cm x 1 cm), and the optimum external external bias supplied by the solar cell is 2.0 V. (author)

  15. MR1-restricted MAIT cells display ligand discrimination and pathogen selectivity through distinct T cell receptor usage

    Gold, Marielle C.; McLaren, James E.; Reistetter, Joseph A.

    2014-01-01

    Mucosal-associated invariant T (MAIT) cells express a semi-invariant T cell receptor (TCR) that detects microbial metabolites presented by the nonpolymorphic major histocompatibility complex (MHC)-like molecule MR1. The highly conserved nature of MR1 in conjunction with biased MAIT TCRα chain usa...

  16. Hypersensitive cell death in plants : its mechanisms and role in plant defense against pathogens

    Iakimova, E.T.; Michalczuk, L.; Woltering, E.J.

    2005-01-01

    This review is a recent update in the understanding of the hypersensitive response (HR) of plants with special consideration to the physiological and biochemical determinants in different model systems. Hypersensitive response is reviewed as a form of programmed cell death (PCD) representing one of

  17. AMPK in Pathogens.

    Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

    2016-01-01

    During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

  18. MRC5 and QU-DB bystander cells can produce bystander factors and induce radiation bystander effect

    Mohammad Taghi Bahreyni Toossi

    2014-01-01

    Full Text Available Radiation damages initiated by radiation-induced bystander effect (RIBE are not limited to the first or immediate neighbors of the irradiated cells, but the effects have been observed in the cells far from the irradiation site. It has been postulated that bystander cells, by producing bystander factors, are actively involved in the propagation of bystander effect in the regions beyond the initial irradiated site. Current study was planned to test the hypothesis. MRC5 and QU-DB cell lines were irradiated, and successive medium transfer technique was performed to induce bystander effects in two bystander cell groups. Conditioned medium extracted from the target cells was transferred to the bystander cells (first bystander cells. After one hour, conditioned medium was substituted by fresh medium. Two hours later, the fresh medium was transferred to a second group of non-irradiated cells (second bystander cells. Micronucleated cells (MC were counted to quantify damages induced in the first and second bystander cell groups. Radiation effect was observed in the second bystander cells as well as in the first ones. Statistical analyses revealed that the number of MC in second bystander subgroups was significantly more than the corresponding value observed in control groups, but in most cases it was equal to the number of MC observed in the first bystander cells. MRC5 and QU-DB bystander cells can produce and release bystander signals in the culture medium and affect non-irradiated cells. Therefore, they may contribute to the RIBE propagation.

  19. Role of pancreatic polypeptide as a market of transplanted insulin-producing fetal pig cells.

    Tuch, B E; Tabiin, M T; Casamento, F M; Yao, M; Georges, P; Amaratunga, A; Pinto, A N

    2001-01-01

    Transplantation of insulin-producing fetal pancreatic tissue into diabetic recipients has been shown to normalize blood glucose levels after several months. This time period is required for the growth and maturation of the fetal tissue so insulin levels cannot be used as a marker of graft function while the beta-cell is immature. Therefore, we have examined the use of another pancreatic endocrine hormone, pancreatic polypeptide (PP), to monitor graft function. The cell that produces this hormone has been shown to be the first mature endocrine cell in the fetal pancreas. Fetal pig pancreatic tissue, both in the form of 1 mm3 explants and islet-like cell clusters (ICCs), was transplanted into immunodeficient SCID mice and the levels of PP and insulin were measured in plasma and in the graft for up to 12 weeks. PP was detected in the untransplanted explants (0.58 pmol/mg) and ICCs (0.06 pmol/ICC) and the PP to insulin ratio was 2.7% and 5.8%, respectively. PP (but not porcine C-peptide, a marker of insulin secretion) was detectable in the plasma of SCID mice from 4 days to 3 weeks after transplantation, but not thereafter. The highest values were obtained at 4 days to 1 week. In the grafted tissue PP and insulin were present at all time points and the ratio of PP to insulin was 59%, 87%, 75%, 56%, 7%, 8%, and 7% at 4 days, 1, 2, 3, 6, 9, and 12 weeks, respectively. The decline in PP levels 3 weeks after transplantation was associated with beta-cell development in the graft. PP was also secreted by fetal pig pancreatic explants transplanted into diabetic NOD/SCID mice, with plasma levels measurable in the first week after the tissue was grafted. In immunocompetent BALB/c mice transplanted with the tissue, PP was detectable in plasma for 2 days after transplantation but not at 4 days, when cellular rejection commenced, or thereafter. We conclude that plasma PP levels can be used as a marker of the viability of fetal porcine pancreatic tissue in the first 3 weeks after

  20. Thin silicon foils produced by epoxy-induced spalling of silicon for high efficiency solar cells

    Martini, R., E-mail: roberto.martini@imec.be [Department of Electrical Engineering, KU Leuven, Kasteelpark 10, 3001 Leuven (Belgium); imec, Kapeldreef 75, 3001 Leuven (Belgium); Kepa, J.; Stesmans, A. [Department of Physics, KU Leuven, Celestijnenlaan 200 D, 3001 Leuven (Belgium); Debucquoy, M.; Depauw, V.; Gonzalez, M.; Gordon, I. [imec, Kapeldreef 75, 3001 Leuven (Belgium); Poortmans, J. [Department of Electrical Engineering, KU Leuven, Kasteelpark 10, 3001 Leuven (Belgium); imec, Kapeldreef 75, 3001 Leuven (Belgium); Universiteit Hasselt, Martelarenlaan 42, B-3500 Hasselt (Belgium)

    2014-10-27

    We report on the drastic improvement of the quality of thin silicon foils produced by epoxy-induced spalling. In the past, researchers have proposed to fabricate silicon foils by spalling silicon substrates with different stress-inducing materials to manufacture thin silicon solar cells. However, the reported values of effective minority carrier lifetime of the fabricated foils remained always limited to ∼100 μs or below. In this work, we investigate epoxy-induced exfoliated foils by electron spin resonance to analyze the limiting factors of the minority carrier lifetime. These measurements highlight the presence of disordered dangling bonds and dislocation-like defects generated by the exfoliation process. A solution to remove these defects compatible with the process flow to fabricate solar cells is proposed. After etching off less than 1 μm of material, the lifetime of the foil increases by more than a factor of 4.5, reaching a value of 461 μs. This corresponds to a lower limit of the diffusion length of more than 7 times the foil thickness. Regions with different lifetime correlate well with the roughness of the crack surface which suggests that the lifetime is now limited by the quality of the passivation of rough surfaces. The reported values of the minority carrier lifetime show a potential for high efficiency (>22%) thin silicon solar cells.

  1. Thin silicon foils produced by epoxy-induced spalling of silicon for high efficiency solar cells

    Martini, R.; Kepa, J.; Stesmans, A.; Debucquoy, M.; Depauw, V.; Gonzalez, M.; Gordon, I.; Poortmans, J.

    2014-01-01

    We report on the drastic improvement of the quality of thin silicon foils produced by epoxy-induced spalling. In the past, researchers have proposed to fabricate silicon foils by spalling silicon substrates with different stress-inducing materials to manufacture thin silicon solar cells. However, the reported values of effective minority carrier lifetime of the fabricated foils remained always limited to ∼100 μs or below. In this work, we investigate epoxy-induced exfoliated foils by electron spin resonance to analyze the limiting factors of the minority carrier lifetime. These measurements highlight the presence of disordered dangling bonds and dislocation-like defects generated by the exfoliation process. A solution to remove these defects compatible with the process flow to fabricate solar cells is proposed. After etching off less than 1 μm of material, the lifetime of the foil increases by more than a factor of 4.5, reaching a value of 461 μs. This corresponds to a lower limit of the diffusion length of more than 7 times the foil thickness. Regions with different lifetime correlate well with the roughness of the crack surface which suggests that the lifetime is now limited by the quality of the passivation of rough surfaces. The reported values of the minority carrier lifetime show a potential for high efficiency (>22%) thin silicon solar cells.

  2. Case Report: Nodule Development From Subcapsular Aldosterone-Producing Cell Clusters Causes Hyperaldosteronism.

    Nishimoto, Koshiro; Seki, Tsugio; Kurihara, Isao; Yokota, Kenichi; Omura, Masao; Nishikawa, Tetsuo; Shibata, Hirotaka; Kosaka, Takeo; Oya, Mototsugu; Suematsu, Makoto; Mukai, Kuniaki

    2016-01-01

    We previously reported that the human adrenal cortex remodels to form subcapsular aldosterone-producing cell clusters (APCCs). Some APCCs were recently found to carry aldosterone-producing adenoma (APA)-associated somatic mutations in ion channel/pump genes, which implied that APCCs produce aldosterone autonomously and are an origin of APA. However, there has been no report describing an APCC-to-APA transitional lesion. A histological examination revealed unilateral multiple adrenocortical micronodules in the adrenals of two patients with primary aldosteronism (PA). Based on immunohistochemistry for aldosterone synthase, some of the micronodules were identified as possible APCC-to-APA transitional lesions (pAATLs; a tentative term used in this manuscript), which consisted of a subcapsular APCC-like portion and an inner micro-APA-like (mAPA-like) portion without an apparent histological border. Genomic DNA samples prepared from pAATL histological sections were analyzed by next-generation sequencing for the known APA-associated mutations. The mAPA-like portions from two of the three large pAATLs examined harbored mutations (KCNJ5 [p.G151R] in pAATL 3 and ATP1A1 [p.L337M] in pAATL 7), whereas their corresponding APCC-like portions did not, suggesting their role in the formation of mAPA. Another lesion carried novel mutations in ATP1A1 (p.Ile322_Ile325del and p.Ile327Ser) in both the mAPA-like and APCC-like portions, thereby supporting these portions having a clonal origin. A novel aldosterone-producing pathology, pAATL that causes unilateral PA, was detected in the adrenals of two patients. Next-generation sequencing analyses of the large pAATLs suggested that the introduction of APA-associated mutations in the ion channel/pump genes may be involved in the development of mAPA from existing APCCs.

  3. Do we really need to differentiate mesenchymal stem cells into insulin-producing cells for attenuation of the autoimmune responses in type 1 diabetes: immunoprophylactic effects of precursors to insulin-producing cells.

    Sharma, Anshu; Rani, Rajni

    2017-07-12

    Type 1 diabetes (T1D) is a multifactorial autoimmune disorder where pancreatic beta cells are lost before the clinical manifestations of the disease. Administration of mesenchymal stem cells (MSCs) or MSCs differentiated into insulin-producing cells (IPCs) have yielded limited success when used therapeutically. We have evaluated the immunoprophylactic potentials of precursors to insulin-producing cells (pIPCs) and IPCs in nonobese diabetic (NOD) mice to ask a basic question: do we need to differentiate MSCs into IPCs or will pIPCs suffice to attenuate autoimmune responses in T1D? Bone marrow-derived MSCs from Balb/c mice were characterized following the International Society for Cellular Therapy (ISCT) guidelines. MSCs cultured in high-glucose media for 11 to 13 passages were characterized for the expression of pancreatic lineage genes using real-time polymerase chain reaction. Expression of the PDX1 gene in pIPCs was assessed using Western blot and fluorescence-activated cell sorting (FACS). Triple-positive MSCs were differentiated into IPCs using a three-step protocol after sorting them for cell surface markers, i.e. CD29, CD44, and SCA-1. Nonobese diabetic mice were administered pIPCs, IPCs, or phosphate-buffered saline (PBS) into the tail vein at weeks 9 or 10 and followed-up for 29-30 weeks for fasting blood glucose levels. Two consecutive blood sugar levels of more than 250 mg/dl were considered diabetic. MSCs grown in high-glucose media for 11 to 13 passages expressed genes of the pancreatic lineage such as PDX1, beta2, neurogenin, PAX4, Insulin, and glucagon. Furthermore, Western blot and FACS analysis for PDX-1, a transcription factor necessary for beta cell maturation, confirmed that these cells were precursors of insulin-producing cells (pIPCs). NOD mice administered with pIPCs were better protected from developing diabetes with a protective efficacy of 78.4% (p cells seem to have better potential to arrest autoimmune response in type 1 diabetes when

  4. Chromate-reducing activity of Hansenula polymorpha recombinant cells over-producing flavocytochrome b₂.

    Smutok, Oleh; Broda, Daniel; Smutok, Halyna; Dmytruk, Kostyantyn; Gonchar, Mykhailo

    2011-04-01

    b(2) and direct electron transfer from the enzyme to the electrode surface. The application of the chromate-reducing ability of FC b(2)-over-producing recombinant cells of H. polymorpha toward chromate bioremediation and the construction of cells-based biosensor for chromate monitoring in the environment are discussed. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Development of interleukin-17-producing Vγ2+ γδ T cells is reduced by ICOS signaling in the thymus

    Buus, Terkild Brink; Schmidt, Jonas Damgård; Bonefeld, Charlotte Menné

    2016-01-01

    . In this study, we have investigated the role of inducible T cell co-stimulator (ICOS) on the development of γδ T cells. We show that ICOS is expressed by a population of immature Vγ2+CD45RBlow γδ T cells predisposed to interleukin-17 (IL-17) production. We found that treatment with ICOS specific antibodies...... drastically reduces fetal development of IL-17-producing γδ T cells by agonistic actions, and that ICOS deficient mice have a significant increase in the population of IL-17-producing Vγ2+ γδ T cells in the thymus, spleen, lymph nodes and skin and exhibit exacerbated sensitization responses to 2......,4-dinitrofluorobenzene. In conclusion, this study demonstrates that development of IL-17-producing Vγ2+ γδ T cells is reduced by ICOS signaling in the thymus....

  6. Interferon-¿- and tumour necrosis factor-a-producing cells in humans who are immune to cutaneous leishmaniasis

    Kemp, K; Theander, T G; Hviid, L

    1999-01-01

    Individuals infected with Leishmania major usually acquire immunity to cutaneous leishmaniasis. In this study we have investigated peripheral blood mononuclear cells (PBMC) stimulated by Leishmania antigens in two groups of Sudanese individuals, one with a history of cutaneous leishmaniasis and one...... leishmaniasis produced significantly higher levels of IFN-gamma and TNF-alpha than cells from individuals without a history of the disease. Similar levels of IL-10 were found in the two groups. Flow cytometric analysis revealed high numbers of CD3+ cells producing IFN-gamma and TNF-alpha, and only a few CD3......+ cells containing IL-10, in the PBMC cultures from the individuals with a history of cutaneous leishmaniasis. Interferon-gamma and TNF-alpha were predominantly produced by CD4+ T cells rather than CD8+ T cells. The results suggest that cellular immunity against cutaneous leishmaniasis is mediated...

  7. Molecular subtypes of diffuse large B cell lymphoma are associated with distinct pathogenic mechanisms and outcomes.

    Chapuy, Bjoern; Stewart, Chip; Dunford, Andrew J; Kim, Jaegil; Kamburov, Atanas; Redd, Robert A; Lawrence, Mike S; Roemer, Margaretha G M; Li, Amy J; Ziepert, Marita; Staiger, Annette M; Wala, Jeremiah A; Ducar, Matthew D; Leshchiner, Ignaty; Rheinbay, Ester; Taylor-Weiner, Amaro; Coughlin, Caroline A; Hess, Julian M; Pedamallu, Chandra S; Livitz, Dimitri; Rosebrock, Daniel; Rosenberg, Mara; Tracy, Adam A; Horn, Heike; van Hummelen, Paul; Feldman, Andrew L; Link, Brian K; Novak, Anne J; Cerhan, James R; Habermann, Thomas M; Siebert, Reiner; Rosenwald, Andreas; Thorner, Aaron R; Meyerson, Matthew L; Golub, Todd R; Beroukhim, Rameen; Wulf, Gerald G; Ott, German; Rodig, Scott J; Monti, Stefano; Neuberg, Donna S; Loeffler, Markus; Pfreundschuh, Michael; Trümper, Lorenz; Getz, Gad; Shipp, Margaret A

    2018-04-30

    Diffuse large B cell lymphoma (DLBCL), the most common lymphoid malignancy in adults, is a clinically and genetically heterogeneous disease that is further classified into transcriptionally defined activated B cell (ABC) and germinal center B cell (GCB) subtypes. We carried out a comprehensive genetic analysis of 304 primary DLBCLs and identified low-frequency alterations, captured recurrent mutations, somatic copy number alterations, and structural variants, and defined coordinate signatures in patients with available outcome data. We integrated these genetic drivers using consensus clustering and identified five robust DLBCL subsets, including a previously unrecognized group of low-risk ABC-DLBCLs of extrafollicular/marginal zone origin; two distinct subsets of GCB-DLBCLs with different outcomes and targetable alterations; and an ABC/GCB-independent group with biallelic inactivation of TP53, CDKN2A loss, and associated genomic instability. The genetic features of the newly characterized subsets, their mutational signatures, and the temporal ordering of identified alterations provide new insights into DLBCL pathogenesis. The coordinate genetic signatures also predict outcome independent of the clinical International Prognostic Index and suggest new combination treatment stra