Biosensors for Whole-Cell Bacterial Detection
Rushworth, Jo V.; Hirst, Natalie A.; Millner, Paul A.
2014-01-01
SUMMARY Bacterial pathogens are important targets for detection and identification in medicine, food safety, public health, and security. Bacterial infection is a common cause of morbidity and mortality worldwide. In spite of the availability of antibiotics, these infections are often misdiagnosed or there is an unacceptable delay in diagnosis. Current methods of bacterial detection rely upon laboratory-based techniques such as cell culture, microscopic analysis, and biochemical assays. These procedures are time-consuming and costly and require specialist equipment and trained users. Portable stand-alone biosensors can facilitate rapid detection and diagnosis at the point of care. Biosensors will be particularly useful where a clear diagnosis informs treatment, in critical illness (e.g., meningitis) or to prevent further disease spread (e.g., in case of food-borne pathogens or sexually transmitted diseases). Detection of bacteria is also becoming increasingly important in antibioterrorism measures (e.g., anthrax detection). In this review, we discuss recent progress in the use of biosensors for the detection of whole bacterial cells for sensitive and earlier identification of bacteria without the need for sample processing. There is a particular focus on electrochemical biosensors, especially impedance-based systems, as these present key advantages in terms of ease of miniaturization, lack of reagents, sensitivity, and low cost. PMID:24982325
Mass Cytometry for Detection of Silver at the Bacterial Single Cell Level
Directory of Open Access Journals (Sweden)
Yuting Guo
2017-07-01
Full Text Available Background: Mass cytometry (Cytometry by Time of Flight, CyTOF allows single-cell characterization on the basis of specific metal-based cell markers. In addition, other metals in the mass range such as silver can be detected per cell. Bacteria are known to be sensible to silver and a protocol was developed to measure both the number of affected cells per population and the quantities of silver per cell.Methods: For mass cytometry ruthenium red was used as a marker for all cells of a population while parallel application of cisplatin discriminated live from dead cells. Silver quantities per cell and frequencies of silver containing cells in a population were measured by mass cytometry. In addition, live/dead subpopulations were analyzed by flow cytometry and distinguished by cell sorting based on ruthenium red and propidium iodide double staining. Verification of the cells’ silver load was performed on the bulk level by using ICP-MS in combination with cell sorting. The protocol was developed by conveying both, fast and non-growing Pseudomonas putida cells as test organisms.Results: A workflow for labeling bacteria in order to be analyzed by mass cytometry was developed. Three different parameters were tested: ruthenium red provided counts for all bacterial cells in a population while consecutively applied cisplatin marked the frequency of dead cells. Apparent population heterogeneity was detected by different frequencies of silver containing cells. Silver quantities per cell were also well measurable. Generally, AgNP-10 treatment caused higher frequencies of dead cells, higher frequencies of silver containing cells and higher per-cell silver quantities. Due to an assumed chemical equilibrium of free and bound silver ions live and dead cells were associated with silver in equal quantities and this preferably during exponential growth. With ICP-MS up to 1.5 fg silver per bacterial cell were detected.Conclusion: An effective mass cytometry
Sensitive Detection of Deliquescent Bacterial Capsules through Nanomechanical Analysis.
Nguyen, Song Ha; Webb, Hayden K
2015-10-20
Encapsulated bacteria usually exhibit strong resistance to a wide range of sterilization methods, and are often virulent. Early detection of encapsulation can be crucial in microbial pathology. This work demonstrates a fast and sensitive method for the detection of encapsulated bacterial cells. Nanoindentation force measurements were used to confirm the presence of deliquescent bacterial capsules surrounding bacterial cells. Force/distance approach curves contained characteristic linear-nonlinear-linear domains, indicating cocompression of the capsular layer and cell, indentation of the capsule, and compression of the cell alone. This is a sensitive method for the detection and verification of the encapsulation status of bacterial cells. Given that this method was successful in detecting the nanomechanical properties of two different layers of cell material, i.e. distinguishing between the capsule and the remainder of the cell, further development may potentially lead to the ability to analyze even thinner cellular layers, e.g. lipid bilayers.
Real-time Bacterial Detection by Single Cell Based Sensors UsingSynchrotron FTIR Spectromicroscopy
Energy Technology Data Exchange (ETDEWEB)
Veiseh, Mandana; Veiseh, Omid; Martin, Michael C.; Bertozzi,Carolyn; Zhang, Miqin
2005-08-10
Microarrays of single macrophage cell based sensors weredeveloped and demonstrated for real time bacterium detection bysynchrotron FTIR microscopy. The cells were patterned on gold-SiO2substrates via a surface engineering technique by which the goldelectrodes were immobilized with fibronectin to mediate cell adhesion andthe silicon oxide background were passivated with PEG to resist proteinadsorption and cell adhesion. Cellular morphology and IR spectra ofsingle, double, and triple cells on gold electrodes exposed tolipopolysaccharide (LPS) of different concentrations were compared toreveal the detection capabilities of these biosensors. The single-cellbased sensors were found to generate the most significant IR wave numbervariation and thus provide the highest detection sensitivity. Changes inmorphology and IR spectrum for single cells exposed to LPS were found tobe time- and concentration-dependent and correlated with each other verywell. FTIR spectra from single cell arrays of gold electrodes withsurface area of 25 mu-m2, 100 mu-m2, and 400 mu-m2 were acquired usingboth synchrotron and conventional FTIR spectromicroscopes to study thesensitivity of detection. The results indicated that the developedsingle-cell platform can be used with conventional FTIRspectromicroscopy. This technique provides real-time, label-free, andrapid bacterial detection, and may allow for statistic and highthroughput analyses, and portability.
Nasal chemosensory cells use bitter taste signaling to detect irritants and bacterial signals.
Tizzano, Marco; Gulbransen, Brian D; Vandenbeuch, Aurelie; Clapp, Tod R; Herman, Jake P; Sibhatu, Hiruy M; Churchill, Mair E A; Silver, Wayne L; Kinnamon, Sue C; Finger, Thomas E
2010-02-16
The upper respiratory tract is continually assaulted with harmful dusts and xenobiotics carried on the incoming airstream. Detection of such irritants by the trigeminal nerve evokes protective reflexes, including sneezing, apnea, and local neurogenic inflammation of the mucosa. Although free intra-epithelial nerve endings can detect certain lipophilic irritants (e.g., mints, ammonia), the epithelium also houses a population of trigeminally innervated solitary chemosensory cells (SCCs) that express T2R bitter taste receptors along with their downstream signaling components. These SCCs have been postulated to enhance the chemoresponsive capabilities of the trigeminal irritant-detection system. Here we show that transduction by the intranasal solitary chemosensory cells is necessary to evoke trigeminally mediated reflex reactions to some irritants including acyl-homoserine lactone bacterial quorum-sensing molecules, which activate the downstream signaling effectors associated with bitter taste transduction. Isolated nasal chemosensory cells respond to the classic bitter ligand denatonium as well as to the bacterial signals by increasing intracellular Ca(2+). Furthermore, these same substances evoke changes in respiration indicative of trigeminal activation. Genetic ablation of either G alpha-gustducin or TrpM5, essential elements of the T2R transduction cascade, eliminates the trigeminal response. Because acyl-homoserine lactones serve as quorum-sensing molecules for gram-negative pathogenic bacteria, detection of these substances by airway chemoreceptors offers a means by which the airway epithelium may trigger an epithelial inflammatory response before the bacteria reach population densities capable of forming destructive biofilms.
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N
2017-10-01
Quantification of intracellular bacterial colonies is useful in strategies directed against bacterial attachment, subsequent cellular invasion and intracellular proliferation. An automated, high-throughput microscopy-method was established to quantify the number and size of intracellular bacterial colonies in infected host cells (Detection and quantification of intracellular bacterial colonies by automated, high-throughput microscopy, Ernstsen et al., 2017 [1]). The infected cells were imaged with a 10× objective and number of intracellular bacterial colonies, their size distribution and the number of cell nuclei were automatically quantified using a spot detection-tool. The spot detection-output was exported to Excel, where data analysis was performed. In this article, micrographs and spot detection data are made available to facilitate implementation of the method.
DEFF Research Database (Denmark)
Barington, T; Heilmann, C
1992-01-01
Recent advances in the development of conjugate polysaccharide vaccines for human use have stimulated interest in the use of assays detecting antibody-secreting cells (AbSC) with specificity for bacterial antigens. Here we present improved haemolytic plaque-forming cell (PFC) assays detecting Ab......SC with specificity for tetanus and diphtheria toxoid as well as for Haemophilus influenzae type b and pneumococcal capsular polysaccharides. These assays were found to be less time consuming, more economical and yielded 1.9-3.4-fold higher plaque numbers than traditional Jerne-type PFC assays. In the case of anti......-polysaccharide antibodies aggregation of secreted monomeric antibody (IgG) is critical for plaque formation and increases the avidity of binding to target cells....
Thin-layer chromatographic technique for rapid detection of bacterial phospholipases.
Legakis, N J; Papavassiliou, J
1975-11-01
Silica gel thin-layer chromatography was employed to detect lecithinase activity induced from bacterial resting cell preparations induced from bacterial resting cell preparations incubated at 37 C for 4 h in the presence of purified egg yolk lecithin. Bacillus subtilis, Bacillus cereus, Serratia marcescens, and Pseudomonas aeruginosa hydrolyzed lecithin with the formation of free fatty acids as the sole lipid-soluble product. In none of the Escherichia coli and Citrobacter freundii strains tested could lecithinase activity be detected. Four among eight strains of Enterobacter aerogenes and one among 12 strains of Proteus tested produced negligible amounts of free fatty acid.
Micro-magnet arrays for specific single bacterial cell positioning
Energy Technology Data Exchange (ETDEWEB)
Pivetal, Jérémy, E-mail: jeremy.piv@netcmail.com [Ecole Centrale de Lyon, CNRS UMR 5005, Laboratoire Ampère, F-69134 Écully (France); Royet, David [Ecole Centrale de Lyon, CNRS UMR 5005, Laboratoire Ampère, F-69134 Écully (France); Ciuta, Georgeta [Univ. Grenoble Alpes, Inst NEEL, F-38042 Grenoble (France); CNRS, Inst NEEL, F-38042 Grenoble (France); Frenea-Robin, Marie [Université de Lyon, Université Lyon 1, CNRS UMR 5005, Laboratoire Ampère, F-69622 Villeurbanne (France); Haddour, Naoufel [Ecole Centrale de Lyon, CNRS UMR 5005, Laboratoire Ampère, F-69134 Écully (France); Dempsey, Nora M. [Univ. Grenoble Alpes, Inst NEEL, F-38042 Grenoble (France); CNRS, Inst NEEL, F-38042 Grenoble (France); Dumas-Bouchiat, Frédéric [Univ Limoges, CNRS, SPCTS UMR 7513, 12 Rue Atlantis, F-87068 Limoges (France); Simonet, Pascal [Ecole Centrale de Lyon, CNRS UMR 5005, Laboratoire Ampère, F-69134 Écully (France)
2015-04-15
In various contexts such as pathogen detection or analysis of microbial diversity where cellular heterogeneity must be taken into account, there is a growing need for tools and methods that enable microbiologists to analyze bacterial cells individually. One of the main challenges in the development of new platforms for single cell studies is to perform precise cell positioning, but the ability to specifically target cells is also important in many applications. In this work, we report the development of new strategies to selectively trap single bacterial cells upon large arrays, based on the use of micro-magnets. Escherichia coli bacteria were used to demonstrate magnetically driven bacterial cell organization. In order to provide a flexible approach adaptable to several applications in the field of microbiology, cells were magnetically and specifically labeled using two different strategies, namely immunomagnetic labeling and magnetic in situ hybridization. Results show that centimeter-sized arrays of targeted, isolated bacteria can be successfully created upon the surface of a flat magnetically patterned hard magnetic film. Efforts are now being directed towards the integration of a detection tool to provide a complete micro-system device for a variety of microbiological applications. - Highlights: 1.We report a new approach to selectively micropattern bacterial cells individually upon micro-magnet arrays. 2.Permanent micro-magnets of a size approaching that of bacteria could be fabricated using a Thermo-Magnetic Patterning process. 3.Bacterial cells were labeled using two different magnetic labeling strategies providing flexible approach adaptable to several applications in the field of microbiology.
Auer, George K; Weibel, Douglas B
2017-07-25
Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N
2017-08-01
To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. We present an automated microscopy-based, fast, high-throughput method for analyzing size and number of intracellular bacterial colonies in infected tissue culture cells. Cells are seeded in 48-well plates and infected with a GFP-expressing bacterial pathogen. Following gentamicin treatment to remove extracellular pathogens, cells are fixed and cell nuclei stained. This is followed by automated microscopy and subsequent semi-automated spot detection to determine the number of intracellular bacterial colonies, their size distribution, and the average number per host cell. Multiple 48-well plates can be processed sequentially and the procedure can be completed in one working day. As a model we quantified intracellular bacterial colonies formed by uropathogenic Escherichia coli (UPEC) during infection of human kidney cells (HKC-8). Urinary tract infections caused by UPEC are among the most common bacterial infectious diseases in humans. UPEC can colonize tissues of the urinary tract and is responsible for acute, chronic, and recurrent infections. In the bladder, UPEC can form intracellular quiescent reservoirs, thought to be responsible for recurrent infections. In the kidney, UPEC can colonize renal epithelial cells and pass to the blood stream, either via epithelial cell disruption or transcellular passage, to cause sepsis. Intracellular colonies are known to be clonal, originating from single invading UPEC. In our experimental setup, we found UPEC CFT073 intracellular bacterial colonies to be heterogeneous in size and present in nearly one third of the HKC-8 cells. This high-throughput experimental format substantially reduces experimental time and enables fast screening of the intracellular bacterial load and cellular distribution of multiple
Molecular detection of human bacterial pathogens
National Research Council Canada - National Science Library
Liu, Dongyou
2011-01-01
.... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...
Bacterial Biofilm Infection Detected in Breast Implant-Associated Anaplastic Large-Cell Lymphoma.
Hu, Honghua; Johani, Khalid; Almatroudi, Ahmad; Vickery, Karen; Van Natta, Bruce; Kadin, Marshall E; Brody, Garry; Clemens, Mark; Cheah, Chan Yoon; Lade, Stephen; Joshi, Preeti Avinash; Prince, H Miles; Deva, Anand K
2016-06-01
A recent association between breast implants and the development of anaplastic large-cell lymphoma (ALCL) has been observed. The purpose of this study was to identify whether bacterial biofilm is present in breast implant-associated ALCL and, if so, to compare the bacterial microbiome to nontumor capsule samples from breast implants with contracture. Twenty-six breast implant-associated ALCL samples were analyzed for the presence of biofilm by real-time quantitative polymerase chain reaction, next-generation sequencing, fluorescent in situ hybridization, and scanning electron microscopy, and compared to 62 nontumor capsule specimens. Both the breast implant-associated ALCL and nontumor capsule samples yielded high mean numbers of bacteria (breast implant-associated ALCL, 4.7 × 10 cells/mg of tissue; capsule, 4.9 × 10 cells/mg of tissue). Analysis of the microbiome in breast implant-associated ALCL specimens showed significant differences with species identified in nontumor capsule specimens. There was a significantly greater proportion of Ralstonia spp. present in ALCL specimens compared with nontumor capsule specimens (p capsule specimens compared with breast implant-associated ALCL specimens (p < 0.001). Bacterial biofilm was visualized both on scanning electron microscopy and fluorescent in situ hybridization. This novel finding of bacterial biofilm and a distinct microbiome in breast implant-associated ALCL samples points to a possible infectious contributing cause. Breast implants are widely used in both reconstructive and aesthetic surgery, and strategies to reduce their contamination should be more widely studied and practiced. Risk, V.
Real-time detection of antibiotic activity by measuring nanometer-scale bacterial deformation
Iriya, Rafael; Syal, Karan; Jing, Wenwen; Mo, Manni; Yu, Hui; Haydel, Shelley E.; Wang, Shaopeng; Tao, Nongjian
2017-12-01
Diagnosing antibiotic-resistant bacteria currently requires sensitive detection of phenotypic changes associated with antibiotic action on bacteria. Here, we present an optical imaging-based approach to quantify bacterial membrane deformation as a phenotypic feature in real-time with a nanometer scale (˜9 nm) detection limit. Using this approach, we found two types of antibiotic-induced membrane deformations in different bacterial strains: polymyxin B induced relatively uniform spatial deformation of Escherichia coli O157:H7 cells leading to change in cellular volume and ampicillin-induced localized spatial deformation leading to the formation of bulges or protrusions on uropathogenic E. coli CFT073 cells. We anticipate that the approach will contribute to understanding of antibiotic phenotypic effects on bacteria with a potential for applications in rapid antibiotic susceptibility testing.
Current advances in aptamer-assisted technologies for detecting bacterial and fungal toxins.
Alizadeh, N; Memar, M Y; Mehramuz, B; Abibiglou, S S; Hemmati, F; Samadi Kafil, H
2018-03-01
Infectious diseases are among the common leading causes of morbidity and mortality worldwide. Associated with the emergence of new infectious diseases, the increasing number of antimicrobial-resistant isolates presents a serious threat to public health and hospitalized patients. A microbial pathogen may elicit several host responses and use a variety of mechanisms to evade host defences. These methods and mechanisms include capsule, lipopolysaccharides or cell wall components, adhesions and toxins. Toxins inhibit phagocytosis, cause septic shock and host cell damages by binding to host surface receptors and invasion. Bacterial and fungal pathogens are able to apply many different toxin-dependent mechanisms to disturb signalling pathways and the structural integrity of host cells for establishing and maintaining infections Initial techniques for analysis of bacterial toxins were based on in vivo or in vitro assessments. There is a permanent demand for appropriate detection methods which are affordable, practical, careful, rapid, sensitive, efficient and economical. Aptamers are DNA or RNA oligonucleotides that are selected by systematic evolution of ligands using exponential enrichment (SELEX) methods and can be applied in diagnostic applications. This review provides an overview of aptamer-based methods as a novel approach for detecting toxins in bacterial and fungal pathogens. © 2017 The Society for Applied Microbiology.
Bacterial cells with improved tolerance to polyamines
DEFF Research Database (Denmark)
2017-01-01
Provided are bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as polyamines, and methods of preparing and using such bacterial cells for production of polyamines and other compounds.......Provided are bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as polyamines, and methods of preparing and using such bacterial cells for production of polyamines and other compounds....
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
Bacterial cells with improved tolerance to polyols
DEFF Research Database (Denmark)
2017-01-01
The present invention relates to bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as diols and other polyols, and to methods of preparing and using such bacterial cells for production of polyols and other compounds.......The present invention relates to bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as diols and other polyols, and to methods of preparing and using such bacterial cells for production of polyols and other compounds....
Biosensors of bacterial cells.
Burlage, Robert S; Tillmann, Joshua
2017-07-01
Biosensors are devices which utilize both an electrical component (transducer) and a biological component to study an environment. They are typically used to examine biological structures, organisms and processes. The field of biosensors has now become so large and varied that the technology can often seem impenetrable. Yet the principles which underlie the technology are uncomplicated, even if the details of the mechanisms are elusive. In this review we confine our analysis to relatively current advancements in biosensors for the detection of whole bacterial cells. This includes biosensors which rely on an added labeled component and biosensors which do not have a labeled component and instead detect the binding event or bound structure on the transducer. Methods to concentrate the bacteria prior to biosensor analysis are also described. The variety of biosensor types and their actual and potential uses are described. Copyright © 2016 Elsevier B.V. All rights reserved.
Adenylate Cyclase Toxin promotes bacterial internalisation into non phagocytic cells.
Martín, César; Etxaniz, Asier; Uribe, Kepa B; Etxebarria, Aitor; González-Bullón, David; Arlucea, Jon; Goñi, Félix M; Aréchaga, Juan; Ostolaza, Helena
2015-09-08
Bordetella pertussis causes whooping cough, a respiratory infectious disease that is the fifth largest cause of vaccine-preventable death in infants. Though historically considered an extracellular pathogen, this bacterium has been detected both in vitro and in vivo inside phagocytic and non-phagocytic cells. However the precise mechanism used by B. pertussis for cell entry, or the putative bacterial factors involved, are not fully elucidated. Here we find that adenylate cyclase toxin (ACT), one of the important toxins of B. pertussis, is sufficient to promote bacterial internalisation into non-phagocytic cells. After characterization of the entry route we show that uptake of "toxin-coated bacteria" proceeds via a clathrin-independent, caveolae-dependent entry pathway, allowing the internalised bacteria to survive within the cells. Intracellular bacteria were found inside non-acidic endosomes with high sphingomyelin and cholesterol content, or "free" in the cytosol of the invaded cells, suggesting that the ACT-induced bacterial uptake may not proceed through formation of late endolysosomes. Activation of Tyr kinases and toxin-induced Ca(2+)-influx are essential for the entry process. We hypothesize that B. pertussis might use ACT to activate the endocytic machinery of non-phagocytic cells and gain entry into these cells, in this way evading the host immune system.
Khairnar, Krishna; Sanmukh, Swapnil; Chandekar, Rajshree; Paunikar, Waman
2014-07-01
The comet assay is the widely used method for in vitro toxicity testing which is also an alternative to the use of animal models for in vivo testing. Since, its inception in 1984 by Ostling and Johansson, it is being modified frequently for a wide range of application. In spite of its wide applicability, unfortunately there is no report of its application in bacteriophages research. In this study, a novel application of comet assay for the detection of bacteriophage mediated bacterial cell lysis was described. The conventional methods in bacteriophage research for studying bacterial lysis by bacteriophages are plaque assay method. It is time consuming, laborious and costly. The lytic activity of bacteriophage devours the bacterial cell which results in the release of bacterial genomic material that gets detected by ethidium bromide staining method by the comet assay protocol. The objective of this study was to compare efficacy of comet assay with different assay used to study phage mediated bacterial lysis. The assay was performed on culture isolates (N=80 studies), modified comet assay appear to have relatively higher sensitivity and specificity than other assay. The results of the study showed that the application of comet assay can be an economical, time saving and less laborious alternative to conventional plaque assay for the detection of bacteriophage mediated bacterial cell lysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Probing bacterial adhesion at the single-cell level
DEFF Research Database (Denmark)
Zeng, Guanghong; Müller, Torsten; Meyer, Rikke Louise
be considered. We have developed a simple and versatile method to make single-cell bacterial probes for measuring single cell adhesion by force spectroscopy using atomic force microscopy (AFM). A single-cell probe was readily made by picking up a bacterial cell from a glass surface by approaching a tipless AFM...... cantilever coated with the commercial cell adhesive CellTakTM. We applied the method to study adhesion of living cells to abiotic surfaces at the single-cell level. Immobilisation of single bacterial cells to the cantilever was stable for several hours, and viability was confirmed by Live/Dead staining...... on the adhesion force, we explored the bond formation and adhesive strength of four different bacterial strains towards three abiotic substrates with variable hydrophobicity and surface roughness. The adhesion force and final rupture length were dependent on bacterial strains, surfaces properties, and time...
Bacterial cells with improved tolerance to isobutyric acid
DEFF Research Database (Denmark)
2017-01-01
Bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as isobutyric acid and related compounds, and methods of preparing and using such bacterial cells for production of isobutyric acid and related compounds.......Bacterial cells genetically modified to improve their tolerance to certain commodity chemicals, such as isobutyric acid and related compounds, and methods of preparing and using such bacterial cells for production of isobutyric acid and related compounds....
Disinfection byproduct formation from chlorination of pure bacterial cells and pipeline biofilms.
Wang, Jun-Jian; Liu, Xin; Ng, Tsz Wai; Xiao, Jie-Wen; Chow, Alex T; Wong, Po Keung
2013-05-15
Disinfection byproduct (DBP) formation is commonly attributed to the reaction between natural organic matters and disinfectants, yet few have considered the contribution from disinfecting bacterial materials - the essential process of water disinfection. Here, we explored the DBP formation from chlorination and chloramination of Escherichia coli and found that most selected DBPs were detectable, including trihalomethanes, haloacetonitriles, chloral hydrate, chloropicrin, and 1,1,1-trichloro-2-propanone. A positive correlation (P = 0.08-0.09) between DBP formation and the log reduction of E. coli implied that breaking down of bacterial cells released precursors for DBP formation. As Pseudomonas aeruginosa is a dominant bacterial species in pipeline biofilms, the DBP formation potentials (DBPFPs) from its planktonic cells and biofilms were characterized. Planktonic cells formed 7-11 times greater trihalomethanes per carbon of those from biofilms but significantly lower (P biofilms on polyvinyl chloride compared to that on galvanized zinc. This study revealed both the in situ disinfection of bacterial planktonic cells in source water and ex situ reaction between biofilms and residual chlorine in pipeline networks as hitherto unknown DBP sources in drinking water. Copyright © 2013 Elsevier Ltd. All rights reserved.
Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems
Directory of Open Access Journals (Sweden)
Carl A. Batt
2009-05-01
Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.
One bacterial cell, one complete genome.
Directory of Open Access Journals (Sweden)
Tanja Woyke
2010-04-01
Full Text Available While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200-900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA. Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs, indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.
One Bacterial Cell, One Complete Genome
Energy Technology Data Exchange (ETDEWEB)
Woyke, Tanja; Tighe, Damon; Mavrommatis, Konstantinos; Clum, Alicia; Copeland, Alex; Schackwitz, Wendy; Lapidus, Alla; Wu, Dongying; McCutcheon, John P.; McDonald, Bradon R.; Moran, Nancy A.; Bristow, James; Cheng, Jan-Fang
2010-04-26
While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200?900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA). Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs), indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.
Boix-Amorós, Alba; Collado, Maria C; Mira, Alex
2016-01-01
Human breast milk is considered the optimal nutrition for infants, providing essential nutrients and a broad range of bioactive compounds, as well as its own microbiota. However, the interaction among those components and the biological role of milk microorganisms is still uncovered. Thus, our aim was to identify the relationships between milk microbiota composition, bacterial load, macronutrients, and human cells during lactation. Bacterial load was estimated in milk samples from a total of 21 healthy mothers through lactation time by bacteria-specific qPCR targeted to the single-copy gene fusA. Milk microbiome composition and diversity was estimated by 16S-pyrosequencing and the structure of these bacteria in the fluid was studied by flow cytometry, qPCR, and microscopy. Fat, protein, lactose, and dry extract of milk as well as the number of somatic cells were also analyzed. We observed that milk bacterial communities were generally complex, and showed individual-specific profiles. Milk microbiota was dominated by Staphylococcus, Pseudomonas, Streptococcus, and Acinetobacter. Staphylococcus aureus was not detected in any of these samples from healthy mothers. There was high variability in composition and number of bacteria per milliliter among mothers and in some cases even within mothers at different time points. The median bacterial load was 10(6) bacterial cells/ml through time, higher than those numbers reported by 16S gene PCR and culture methods. Furthermore, milk bacteria were present in a free-living, "planktonic" state, but also in equal proportion associated to human immune cells. There was no correlation between bacterial load and the amount of immune cells in milk, strengthening the idea that milk bacteria are not sensed as an infection by the immune system.
Smart phone based bacterial detection using bio functionalized fluorescent nanoparticles
International Nuclear Information System (INIS)
Rajendran, Vinoth Kumar; Bakthavathsalam, Padmavathy; Ali, Baquir Mohammed Jaffar
2014-01-01
We are describing immunochromatographic test strips with smart phone-based fluorescence readout. They are intended for use in the detection of the foodborne bacterial pathogens Salmonella spp. and Escherichia coli O157. Silica nanoparticles (SiNPs) were doped with FITC and Ru(bpy), conjugated to the respective antibodies, and then used in a conventional lateral flow immunoassay (LFIA). Fluorescence was recorded by inserting the nitrocellulose strip into a smart phone-based fluorimeter consisting of a light weight (40 g) optical module containing an LED light source, a fluorescence filter set and a lens attached to the integrated camera of the cell phone in order to acquire high-resolution fluorescence images. The images were analysed by exploiting the quick image processing application of the cell phone and enable the detection of pathogens within few minutes. This LFIA is capable of detecting pathogens in concentrations as low as 10 5 cfu mL −1 directly from test samples without pre-enrichment. The detection is one order of magnitude better compared to gold nanoparticle-based LFIAs under similar condition. The successful combination of fluorescent nanoparticle-based pathogen detection by LFIAs with a smart phone-based detection platform has resulted in a portable device with improved diagnosis features and having potential application in diagnostics and environmental monitoring. (author)
Tiny cells meet big questions: a closer look at bacterial cell biology.
Goley, Erin D
2013-04-01
While studying actin assembly as a graduate student with Matt Welch at the University of California at Berkeley, my interest was piqued by reports of surprising observations in bacteria: the identification of numerous cytoskeletal proteins, actin homologues fulfilling spindle-like functions, and even the presence of membrane-bound organelles. Curiosity about these phenomena drew me to Lucy Shapiro's lab at Stanford University for my postdoctoral research. In the Shapiro lab, and now in my lab at Johns Hopkins, I have focused on investigating the mechanisms of bacterial cytokinesis. Spending time as both a eukaryotic cell biologist and a bacterial cell biologist has convinced me that bacterial cells present the same questions as eukaryotic cells: How are chromosomes organized and accurately segregated? How is force generated for cytokinesis? How is polarity established? How are signals transduced within and between cells? These problems are conceptually similar between eukaryotes and bacteria, although their solutions can differ significantly in specifics. In this Perspective, I provide a broad view of cell biological phenomena in bacteria, the technical challenges facing those of us who peer into bacterial cells, and areas of common ground as research in eukaryotic and bacterial cell biology moves forward.
Patterning bacterial communities on epithelial cells.
Directory of Open Access Journals (Sweden)
Mohammed Dwidar
Full Text Available Micropatterning of bacteria using aqueous two phase system (ATPS enables the localized culture and formation of physically separated bacterial communities on human epithelial cell sheets. This method was used to compare the effects of Escherichia coli strain MG1655 and an isogenic invasive counterpart that expresses the invasin (inv gene from Yersinia pseudotuberculosis on the underlying epithelial cell layer. Large portions of the cell layer beneath the invasive strain were killed or detached while the non-invasive E. coli had no apparent effect on the epithelial cell layer over a 24 h observation period. In addition, simultaneous testing of the localized effects of three different bacterial species; E. coli MG1655, Shigella boydii KACC 10792 and Pseudomonas sp DSM 50906 on an epithelial cell layer is also demonstrated. The paper further shows the ability to use a bacterial predator, Bdellovibriobacteriovorus HD 100, to selectively remove the E. coli, S. boydii and P. sp communities from this bacteria-patterned epithelial cell layer. Importantly, predation and removal of the P. Sp was critical for maintaining viability of the underlying epithelial cells. Although this paper focuses on a few specific cell types, the technique should be broadly applicable to understand a variety of bacteria-epithelial cell interactions.
Isolation of cell-free bacterial inclusion bodies.
Rodríguez-Carmona, Escarlata; Cano-Garrido, Olivia; Seras-Franzoso, Joaquin; Villaverde, Antonio; García-Fruitós, Elena
2010-09-17
Bacterial inclusion bodies are submicron protein clusters usually found in recombinant bacteria that have been traditionally considered as undesirable products from protein production processes. However, being fully biocompatible, they have been recently characterized as nanoparticulate inert materials useful as scaffolds for tissue engineering, with potentially wider applicability in biomedicine and material sciences. Current protocols for inclusion body isolation from Escherichia coli usually offer between 95 to 99% of protein recovery, what in practical terms, might imply extensive bacterial cell contamination, not compatible with the use of inclusion bodies in biological interfaces. Using an appropriate combination of chemical and mechanical cell disruption methods we have established a convenient procedure for the recovery of bacterial inclusion bodies with undetectable levels of viable cell contamination, below 10⁻¹ cfu/ml, keeping the particulate organization of these aggregates regarding size and protein folding features. The application of the developed protocol allows obtaining bacterial free inclusion bodies suitable for use in mammalian cell cultures and other biological interfaces.
Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.
Ireton, Keith
2013-07-17
Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.
Procedures involving lipid media for detection of bacterial contamination in breweries.
Van Vuuren, H J; Louw, H A; Loos, M A; Meisel, R
1977-02-01
The liquid equivalent of universal beer agar, designated universal beer liquid medium, and its beer-free equivalent, universal liquid medium (UL), were equally effective in demonstrating bacterial contamination in 120 of 200 samples from different stages of commercial brewing process. Growth of the contaminants after 3 days was consistently more luxuriant in the UL medium. A yeast-water substrate medium failed to reveal many contaminants detected with UL in 392 samples from three breweries and revealed only a few not detected with UL. The use of UL and a lactose-peptone medium, with microscope examination of the media for bacterial growth, permitted detection of 93% of the known contaminants compared to 87%, detected with UL alone; this combination or universal beer liquid medium plus lactose-peptone medium can therefore be recommended for the detection of bacterial contaminants in brewery samples. Bacterial contamination of pitching yeasts appeared to be a particular problem in the breweries investigated.
Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.
Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R
2014-01-01
MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.
Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.
Directory of Open Access Journals (Sweden)
Yuki Furuse
Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.
Bacterial contamination of platelet components not detected by BacT/ALERT®.
Abela, M A; Fenning, S; Maguire, K A; Morris, K G
2018-02-01
To investigate the possible causes for false negative results in BacT/ALERT ® 3D Signature System despite bacterial contamination of platelet units. The Northern Ireland Blood Transfusion Service (NIBTS) routinely extends platelet component shelf life to 7 days. Components are sampled and screened for bacterial contamination using an automated microbial detection system, the BacT/ALERT ® 3D Signature System. We report on three platelet components with confirmed bacterial contamination, which represent false negative BacT/ALERT ® results and near-miss serious adverse events. NIBTS protocols for risk reduction of bacterial contamination of platelet components are described. The methodology for bacterial detection using BacT/ALERT ® is outlined. Laboratory tests, relevant patient details and relevant follow-up information are analysed. In all three cases, Staphylococcus aureus was isolated from the platelet residue and confirmed on terminal sub-culture using BacT/ALERT ® . In two cases, S. aureus with similar genetic makeup was isolated from the donors. Risk reduction measures for bacterial contamination of platelet components are not always effective. Automated bacterial culture detection does not eliminate the risk of bacterial contamination. Visual inspection of platelet components prior to release, issue and administration remains an important last line of defence. © 2017 British Blood Transfusion Society.
Probes for anionic cell surface detection
Smith, Bradley D.
2013-03-05
Embodiments of the present invention are generally directed to compositions comprising a class of molecular probes for detecting the presence of anionic cell surfaces. Embodiments include compositions that are enriched for these compositions and preparations, particularly preparations suitable for use as laboratory/clinical reagents and diagnostic indicators, either alone or as part of a kit. An embodiment of the invention provides for a highly selective agent useful in the discernment and identification of dead or dying cells, such as apoptotic cells, in a relatively calcium-free environment. An embodiment of the invention provides a selective agent for the identification of bacteria in a mixed population of bacterial cells and nonbacterial cells.
Bacterial spread from cell to cell: beyond actin-based motility.
Kuehl, Carole J; Dragoi, Ana-Maria; Talman, Arthur; Agaisse, Hervé
2015-09-01
Several intracellular pathogens display the ability to propagate within host tissues by displaying actin-based motility in the cytosol of infected cells. As motile bacteria reach cell-cell contacts they form plasma membrane protrusions that project into adjacent cells and resolve into vacuoles from which the pathogen escapes, thereby achieving spread from cell to cell. Seminal studies have defined the bacterial and cellular factors that support actin-based motility. By contrast, the mechanisms supporting the formation of protrusions and their resolution into vacuoles have remained elusive. Here, we review recent advances in the field showing that Listeria monocytogenes and Shigella flexneri have evolved pathogen-specific mechanisms of bacterial spread from cell to cell. Copyright © 2015 Elsevier Ltd. All rights reserved.
Evaluation of vaginal pH for detection of bacterial vaginosis
Directory of Open Access Journals (Sweden)
R Hemalatha
2013-01-01
Full Text Available Background & objectives : Bacterial vaginosis (BV is highly prevalent among women in reproductive age group. Little information exists on routine vaginal p H measurement in women with BV. We undertook this study to assess the utility of vaginal p H determination for initial evaluation of bacterial vaginosis. Methods : In this cross-sectional study vaginal swabs were collected from women with complaints of white discharge, back ache and pain abdomen attending a government hospital and a community health clinic, and subjected to vaginal p H determination, Gram stain, wet mount and whiff test. Nugent score and Amsel criteria were used for BV confirmation. Results : Of the 270 women included in the analysis, 154 had BV based on Nugents′ score. The mean vaginal p H in women with BV measured by p H strips and p H glove was 5 and 4.9, respectively. The vaginal p H was significantly higher in women with BV. Vaginal discharge was prevalent in 84.8 per cent women, however, only 56.8 per cent of these actually had BV by Nugent score (NS. Presence of clue cells and positive whiff test were significant for BV. Vaginal p H >4.5 by p H strips and p H Glove had a sensitivity of 72 and 79 per cent and specificity of 60 and 53 per cent, respectively to detect BV. Among the combination criteria, clue cells and glove p H >4.5 had highest sensitivity and specificity to detect BV. Interpretation & conclusions : Vaginal p H determination is relatively sensitive, but less specific in detecting women with BV. Inclusion of whiff test along with p H test reduced the sensitivity, but improved specificity. Both, the p H strip and p H glove are equally suitable for screening women with BV on outpatient basis.
Detection of Spiroplasma and Wolbachia in the bacterial gonad community of Chorthippus parallelus.
Martínez-Rodríguez, P; Hernández-Pérez, M; Bella, J L
2013-07-01
We have recently detected the endosymbiont Wolbachia in multiple individuals and populations of the grasshopper Chorthippus parallelus (Orthoptera: acrididae). This bacterium induces reproductive anomalies, including cytoplasmic incompatibility. Such incompatibilities may help explain the maintenance of two distinct subspecies of this grasshopper, C. parallelus parallelus and C. parallelus erythropus, which are involved in a Pyrenean hybrid zone that has been extensively studied for the past 20 years, becoming a model system for the study of genetic divergence and speciation. To evaluate whether Wolbachia is the sole bacterial infection that might induce reproductive anomalies, the gonadal bacterial community of individuals from 13 distinct populations of C. parallelus was determined by denaturing gradient gel electrophoresis analysis of bacterial 16S rRNA gene fragments and sequencing. The study revealed low bacterial diversity in the gonads: a persistent bacterial trio consistent with Spiroplasma sp. and the two previously described supergroups of Wolbachia (B and F) dominated the gonad microbiota. A further evaluation of the composition of the gonad bacterial communities was carried out by whole cell hybridization. Our results confirm previous studies of the cytological distribution of Wolbachia in C. parallelus gonads and show a homogeneous infection by Spiroplasma. Spiroplasma and Wolbachia cooccurred in some individuals, but there was no significant association of Spiroplasma with a grasshopper's sex or with Wolbachia infection, although subtle trends might be detected with a larger sample size. This information, together with previous experimental crosses of this grasshopper, suggests that Spiroplasma is unlikely to contribute to sex-specific reproductive anomalies; instead, they implicate Wolbachia as the agent of the observed anomalies in C. parallelus.
Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles.
Chang, Yi-Chung; Yang, Chia-Ying; Sun, Ruei-Lin; Cheng, Yi-Feng; Kao, Wei-Chen; Yang, Pan-Chyr
2013-01-01
Staphylococcus aureus is one of the most important human pathogens, causing more than 500,000 infections in the United States each year. Traditional methods for bacterial culture and identification take several days, wasting precious time for patients who are suffering severe bacterial infections. Numerous nucleic acid-based detection methods have been introduced to address this deficiency; however, the costs and requirement for expensive equipment may limit the widespread use of such technologies. Thus, there is an unmet demand of new platform technology to improve the bacterial detection and identification in clinical practice. In this study, we developed a rapid, ultra-sensitive, low cost, and non-polymerase chain reaction (PCR)-based method for bacterial identification. Using this method, which measures the resonance light-scattering signal of aptamer-conjugated gold nanoparticles, we successfully detected single S. aureus cell within 1.5 hours. This new platform technology may have potential to develop a rapid and sensitive bacterial testing at point-of-care.
Directory of Open Access Journals (Sweden)
Marielle Bouix
1997-03-01
Full Text Available This study presents a rapid and specific microscopie technique for detecting and identifying populations of lactic acid bacteria in musts, wines, and inoculum starter cultures. Through the use of fluorescent antibodies, this procedure can be performed in less than two hours, and it is effective with Leuconostoc, Pediococcus and Lactobacillus concentrations as small as 102 cells/ml. Implementation of this technique will assist winemakers in controlling malolactic fermentations and in preventing lactic acid bacterial spoilage.
Microconductometric Detection of Bacterial Contamination
Directory of Open Access Journals (Sweden)
Sarra EL ICHI
2014-05-01
Full Text Available Several approaches can be used for the electrochemical detection of bacterial contamination. Their performance can be assessed by the ability to detect bacteria at very low concentrations within a short-time response. We have already demonstrated that a conductometric biosensor based on interdigitated thin-film electrodes is adapted to detect bacteria in clinical samples like serum and compatible with microfluidic fabrication. The type of interdigitated microelectrodes influences the performance of the biosensor. This was shown by the results obtained in this work. A magnetic-nanoparticles based immunosensor was designed using gold screen-printed electrodes. The immunosensor was able to specifically detect E. coli in the range of 1-103 CFU mL-1. The new transducer offered a larger active sensing surface with a lower cost and a robust material. Accuracy of the conductance value was enhanced by differential measurements. The immunosensor is compatible with a microfluidic system.
Cai, Shiwei; Zhang, Wenjian; Tribble, Gena; Chen, Wei
2017-01-01
An ideal pulp-capping agent needs to have good biocompatibility and promote reparative dentinogenesis. Although the effects of capping agents on healthy pulp are known, limited data regarding their effects on bacterial contaminated pulp are available. This study aimed to evaluate the reaction of contaminated pulps to various capping agents to assist clinicians in making informed decisions. Human dental pulp (HDP) cell cultures were developed from extracted human molars. The cells were exposed to a bacterial cocktail comprising Porphyromonas gingivalis, Prevotella intermedia, and Streptococcus gordonii before being cocultured with capping agents such as mineral trioxide aggregate (MTA) Portland cement (PC), and Dycal. HDP cell proliferation was assayed by MTS colorimetric cell proliferation assay, and its differentiation was evaluated by real-time PCR for detecting alkaline phosphatase, dentin sialophosphoprotein, and osteocalcin expressions. MTA and PC had no apparent effect, whereas Dycal inhibited HDP cell proliferation. PC stimulated HDP cell differentiation, particularly when they were exposed to bacteria. MTA and Dycal inhibited differentiation, regardless of bacterial infection. In conclusion, PC was the most favorable agent, followed by MTA, and Dycal was the least favorable agent for supporting the functions of bacterial compromised pulp cells.
Intestinal Epithelial Cells Modulate Antigen-Presenting Cell Responses to Bacterial DNA
Campeau, J. L.; Salim, S. Y.; Albert, E. J.; Hotte, N.
2012-01-01
Intestinal epithelial cells and antigen-presenting cells orchestrate mucosal innate immunity. This study investigated the role of bacterial DNA in modulating epithelial and bone marrow-derived antigen-presenting cells (BM-APCs) and subsequent T-lymphocyte responses. Murine MODE-K epithelial cells and BM-APCs were treated with DNA from either Bifidobacterium breve or Salmonella enterica serovar Dublin directly and under coculture conditions with CD4+ T cells. Apical stimulation of MODE-K cells with S. Dublin DNA enhanced secretion of cytokines from underlying BM-APCs and induced interleukin-17 (IL-17) and gamma interferon (IFN-γ) secretion from CD4+ T cells. Bacterial DNA isolated from either strain induced maturation and increased cytokine secretion from BM-APCs. Conditioned medium from S. Dublin-treated MODE-K cells elicited an increase in cytokine secretion similar to that seen for S. Dublin DNA. Treatment of conditioned medium from MODE-K cells with RNase and protease prevented the S. Dublin-induced increased cytokine secretion. Oral feeding of mice with B. breve DNA resulted in enhanced levels of colonic IL-10 and transforming growth factor β (TGFβ) compared with what was seen for mice treated with S. Dublin DNA. In contrast, feeding mice with S. Dublin DNA increased levels of colonic IL-17 and IL-12p70. T cells from S. Dublin DNA-treated mice secreted high levels of IL-12 and IFN-γ compared to controls and B. breve DNA-treated mice. These results demonstrate that intestinal epithelial cells are able to modulate subsequent antigen-presenting and T-cell responses to bacterial DNA with pathogenic but not commensal bacterial DNA inducing effector CD4+ T lymphocytes. PMID:22615241
Coupling Bacterial Activity Measurements with Cell Sorting by Flow Cytometry.
Servais; Courties; Lebaron; Troussellier
1999-08-01
> Abstract A new procedure to investigate the relationship between bacterial cell size and activity at the cellular level has been developed; it is based on the coupling of radioactive labeling of bacterial cells and cell sorting by flow cytometry after SYTO 13 staining. Before sorting, bacterial cells were incubated in the presence of tritiated leucine using a procedure similar to that used for measuring bacterial production by leucine incorporation and then stained with SYTO 13. Subpopulations of bacterial cells were sorted according to their average right-angle light scatter (RALS) and fluorescence. Average RALS was shown to be significantly related to the average biovolume. Experiments were performed on samples collected at different times in a Mediterranean seawater mesocosm enriched with nitrogen and phosphorus. At four sampling times, bacteria were sorted in two subpopulations (cells smaller and larger than 0.25 µm(3)). The results indicate that, at each sampling time, the growth rate of larger cells was higher than that of smaller cells. In order to confirm this tendency, cell sorting was performed on six subpopulations differing in average biovolume during the mesocosm follow-up. A clear increase of the bacterial growth rates was observed with increasing cell size for the conditions met in this enriched mesocosm.http://link.springer-ny.com/link/service/journals/00248/bibs/38n2p180.html
DETECTION OF BACTERIAL SMALL TRANSCRIPTS FROM RNA-SEQ DATA: A COMPARATIVE ASSESSMENT.
Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S
2016-01-01
Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.
Vaginal epithelial cells regulate membrane adhesiveness to co-ordinate bacterial adhesion.
Younes, Jessica A; Klappe, Karin; Kok, Jan Willem; Busscher, Henk J; Reid, Gregor; van der Mei, Henny C
2016-04-01
Vaginal epithelium is colonized by different bacterial strains and species. The bacterial composition of vaginal biofilms controls the balance between health and disease. Little is known about the relative contribution of the epithelial and bacterial cell surfaces to bacterial adhesion and whether and how adhesion is regulated over cell membrane regions. Here, we show that bacterial adhesion forces with cell membrane regions not located above the nucleus are stronger than with regions above the nucleus both for vaginal pathogens and different commensal and probiotic lactobacillus strains involved in health. Importantly, adhesion force ratios over membrane regions away from and above the nucleus coincided with the ratios between numbers of adhering bacteria over both regions. Bacterial adhesion forces were dramatically decreased by depleting the epithelial cell membrane of cholesterol or sub-membrane cortical actin. Thus, epithelial cells can regulate membrane regions to which bacterial adhesion is discouraged, possibly to protect the nucleus. © 2015 John Wiley & Sons Ltd.
Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods
Directory of Open Access Journals (Sweden)
Dana Védy
2009-04-01
Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.
Fazi, Stefano; Amalfitano, Stefano; Pizzetti, Ilaria; Pernthaler, Jakob
2007-09-01
We studied the efficiency of two hybridization techniques for the analysis of benthic bacterial community composition under varying sediment water content. Microcosms were set up with sediments from four European temporary rivers. Wet sediments were dried, and dry sediments were artificially rewetted. The percentage of bacterial cells detected by fluorescence in situ hybridization with fluorescently monolabeled probes (FISH) significantly increased from dry to wet sediments, showing a positive correlation with the community activity measured via incorporation of (3)H leucine. FISH and signal amplification by catalyzed reporter deposition (CARD-FISH) could significantly better detect cells with low activity in dried sediments. Through the application of an optimized cell permeabilization protocol, the percentage of hybridized cells by CARD-FISH showed comparable values in dry and wet conditions. This approach was unrelated to (3)H leucine incorporation rates. Moreover, the optimized protocol allowed a significantly better visualization of Gram-positive Actinobacteria in the studied samples. CARD-FISH is, therefore, proposed as an effective technique to compare bacterial communities residing in sediments with contrasting water content, irrespective of differences in the activity state of target cells. Considering the increasing frequencies of flood and drought cycles in European temporary rivers, our approach may help to better understand the dynamics of microbial communities in such systems.
Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.
Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas
2017-01-01
Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.
Growth mechanics of bacterial cell wall and morphology of bacteria
Jiang, Hongyuan; Sun, Sean
2010-03-01
The peptidoglycan cell wall of bacteria is responsible for maintaining the cell shape and integrity. During the bacterial life cycle, the growth of the cell wall is affected by mechanical stress and osmotic pressure internal to the cell. We develop a theory to describe cell shape changes under the influence of mechanical forces. We find that the theory predicts a steady state size and shape for bacterial cells ranging from cocci to spirillum. Moreover, the theory suggest a mechanism by which bacterial cytoskeletal proteins such as MreB and crescentin can maintain the shape of the cell. The theory can also explain the several recent experiments on growing bacteria in micro-environments.
Wynn, Daniel; Deo, Sapna; Daunert, Sylvia
2017-01-01
Bacterial whole cell-based biosensors have been genetically engineered to achieve selective and reliable detection of a wide range of hazardous chemicals. Although whole-cell biosensors demonstrate many advantages for field-based detection of target analytes, there are still some challenges that need to be addressed. Most notably, their often modest shelf life and need for special handling and storage make them challenging to use in situations where access to reagents, instrumentation, and expertise are limited. These problems can be circumvented by developing biosensors in Bacillus spores, which can be engineered to address all of these concerns. In its sporulated state, a whole cell-based biosensor has a remarkably long life span and is exceptionally resistant to environmental insult. When these spores are germinated for use in analytical techniques, they show no loss in performance, even after long periods of storage under harsh conditions. In this chapter, we will discuss the development and use of whole cell-based sensors, their adaptation to spore-based biosensors, their current applications, and future directions in the field. © 2017 Elsevier Inc. All rights reserved.
Dykman, Lev A; Staroverov, Sergei A; Guliy, Olga I; Ignatov, Oleg V; Fomin, Alexander S; Vidyasheva, Irina V; Karavaeva, Olga A; Bunin, Viktor D; Burygin, Gennady L
2012-01-01
This article reports the first preparation of miniantibodies to Azospirillum brasilense Sp245 surface antigens by using a combinatorial phage library of sheep antibodies. The prepared phage antibodies were used for the first time for lipopolysaccharide and flagellin detection by dot assay, electro-optical analysis of cell suspensions, and transmission electron microscopy. Interaction of A. brasilense Sp245 with antilipopolysaccharide and antiflagellin phage-displayed miniantibodies caused the magnitude of the electro-optical signal to change considerably. The electro-optical results were in good agreement with the electron microscopic data. This is the first reported possibility of employing phage-displayed miniantibodies in bacterial detection aided by electro-optical analysis of cell suspensions.
PMA-Linked Fluorescence for Rapid Detection of Viable Bacterial Endospores
LaDuc, Myron T.; Venkateswaran, Kasthuri; Mohapatra, Bidyut
2012-01-01
The most common approach for assessing the abundance of viable bacterial endospores is the culture-based plating method. However, culture-based approaches are heavily biased and oftentimes incompatible with upstream sample processing strategies, which make viable cells/spores uncultivable. This shortcoming highlights the need for rapid molecular diagnostic tools to assess more accurately the abundance of viable spacecraft-associated microbiota, perhaps most importantly bacterial endospores. Propidium monoazide (PMA) has received a great deal of attention due to its ability to differentiate live, viable bacterial cells from dead ones. PMA gains access to the DNA of dead cells through compromised membranes. Once inside the cell, it intercalates and eventually covalently bonds with the double-helix structures upon photoactivation with visible light. The covalently bound DNA is significantly altered, and unavailable to downstream molecular-based manipulations and analyses. Microbiological samples can be treated with appropriate concentrations of PMA and exposed to visible light prior to undergoing total genomic DNA extraction, resulting in an extract comprised solely of DNA arising from viable cells. This ability to extract DNA selectively from living cells is extremely powerful, and bears great relevance to many microbiological arenas.
Incidence and Predictors of Bacterial infection in Febrile Children with Sickle Cell Disease.
Morrissey, Benita J; Bycroft, Thomas P; Almossawi, Ofran; Wilkey, Olufunke B; Daniels, Justin G
2015-01-01
Children with sickle cell disease are at increased risk of developing bacteremia and other serious bacterial infections. Fever is a common symptom in sickle cell disease and can also occur with sickle cell crises and viral infections. We aimed to evaluate the incidence and predictors of bacteremia and bacterial infection in children with sickle cell disease presenting with fever to a district hospital and sickle cell center in London. A retrospective analysis was performed on all attendances of children (aged under 16 years) with sickle cell disease presenting with a fever of 38.5 °C or higher over a 1-year period. Confirmed bacterial infection was defined as bacteremia, bacterial meningitis, urinary tract infection (UTI), pneumonia, osteomyelitis or other bacterial infection with positive identification of organism. Children were defined as having a suspected bacterial infection if a bacterial infection was suspected clinically, but no organism was identified. Over a 1-year period there were 88 episodes analyzed in 59 children. Bacteremia occurred in 3.4% of episodes and confirmed bacterial infection in 7.0%. Suspected bacterial infection occurred in 33.0%. One death occurred from Salmonella typhirium septicemia. C-reactive protein (CRP) level and white blood cell (WBC) count were both significantly associated with bacterial infection (p = 0.004 and 0.02, respectively.) In conclusion, bacterial infections continue to be a significant problem in children with sickle cell disease. C-reactive protein was significantly associated with bacterial infections, and could be included in clinical risk criteria for febrile children with sickle cell disease.
A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins
Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.
2005-11-01
A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.
Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan
2017-01-01
ABSTRACT Objective To measure the role of enterovirus detection in cerebrospinal fluid compared with the Bacterial Meningitis Score in children with meningitis. Methods A retrospective cohort based on analysis of medical records of pediatric patients diagnosed as meningitis, seen at a private and tertiary hospital in São Paulo, Brazil, between 2011 and 2014. Excluded were patients with critical illness, purpura, ventricular shunt or recent neurosurgery, immunosuppression, concomitant bacterial infection requiring parenteral antibiotic therapy, and those who received antibiotics 72 hours before lumbar puncture. Results The study included 503 patients. Sixty-four patients were excluded and 94 were not submitted to all tests for analysis. Of the remaining 345 patients, 7 were in the Bacterial Meningitis Group and 338 in the Aseptic Meningitis Group. There was no statistical difference between the groups. In the Bacterial Meningitis Score analysis, of the 338 patients with possible aseptic meningitis (negative cultures), 121 of them had one or more points in the Bacterial Meningitis Score, with sensitivity of 100%, specificity of 64.2%, and negative predictive value of 100%. Of the 121 patients with positive Bacterial Meningitis Score, 71% (86 patients) had a positive enterovirus detection in cerebrospinal fluid. Conclusion Enterovirus detection in cerebrospinal fluid was effective to differentiate bacterial from viral meningitis. When the test was analyzed together with the Bacterial Meningitis Score, specificity was higher when compared to Bacterial Meningitis Score alone. PMID:28767914
Bacterial Cell Surface Damage Due to Centrifugal Compaction
Peterson, Brandon W.; Sharma, Prashant K.; van der Mei, Henny C.; Busscher, Henk J.
Centrifugal damage has been known to alter bacterial cell surface properties and interior structures, including DNA. Very few studies exist on bacterial damage caused by centrifugation because of the difficulty in relating centrifugation speed and container geometry to the damage caused. Here, we
Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.
Keane, O M; Budd, K E; Flynn, J; McCoy, F
2013-09-21
Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.
Lebaron, P; Servais, P; Agogué, H; Courties, C; Joux, F
2001-04-01
The nucleic acid contents of individual bacterial cells as determined with three different nucleic acid-specific fluorescent dyes (SYBR I, SYBR II, and SYTO 13) and flow cytometry were compared for different seawater samples. Similar fluorescence patterns were observed, and bacteria with high apparent nucleic acid contents (HNA) could be discriminated from bacteria with low nucleic acid contents (LNA). The best discrimination between HNA and LNA cells was found when cells were stained with SYBR II. Bacteria in different water samples collected from seven freshwater, brackish water, and seawater ecosystems were prelabeled with tritiated leucine and then stained with SYBR II. After labeling and staining, HNA, LNA, and total cells were sorted by flow cytometry, and the specific activity of each cellular category was determined from leucine incorporation rates. The HNA cells were responsible for most of the total bacterial production, and the specific activities of cells in the HNA population varied between samples by a factor of seven. We suggest that nucleic acid content alone can be a better indicator of the fraction of growing cells than total counts and that this approach should be combined with other fluorescent physiological probes to improve detection of the most active cells in aquatic systems.
Probing living bacterial adhesion by single cell force spectroscopy using atomic force microscopy
DEFF Research Database (Denmark)
Zeng, Guanghong; Ogaki, Ryosuke; Regina, Viduthalai R.
be considered. We have therefore developed a simple and versatile method to make single-cell bacterial probes for measuring single cell adhesion with atomic force microscopy (AFM).[1] A single-cell probe was readily made by picking up a bacterial cell from a glass surface using a tipless AFM cantilever coated...... random immobilization is obtained by submerging the cantilever in a bacterial suspension. The reported method provides a general platform for investigating single cell interactions of bacteria with different surfaces and other cells by AFM force spectroscopy, thus improving our understanding....... The strain-dependent susceptibility to bacterial colonization on conventional PLL-g-PEG illustrates how bacterial diversity challenges development of “universal” antifouling coatings, and AFM single-cell force spectroscopy was proven to be a powerful tool to provide insights into the molecular mechanisms...
gfp-based N-acyl homoserine-lactone sensor systems for detection of bacterial communication
DEFF Research Database (Denmark)
Andersen, Jens Bo; Heydorn, Arne; Hentzer, Morten
2001-01-01
In order to perform single-cell analysis and online studies of N-acyl homoserine lactone (AHL)-mediated communication among bacteria, components of the Vibrio fischeri quorum sensor encoded by luxR-P-luxI have been fused to modified versions of gfpmut3* genes encoding unstable green fluorescent...... proteins. Bacterial strains harboring this green fluorescent sensor detected a broad spectrum of AHL molecules and were capable of sensing the presence of 5 nM N-3-oxohexanoyl-L-homoserine lactone in the surroundings. In combination with epifluorescent microscopy, the sensitivity of the sensor enabled AHL...
Studying biomolecule localization by engineering bacterial cell wall curvature.
Directory of Open Access Journals (Sweden)
Lars D Renner
Full Text Available In this article we describe two techniques for exploring the relationship between bacterial cell shape and the intracellular organization of proteins. First, we created microchannels in a layer of agarose to reshape live bacterial cells and predictably control their mean cell wall curvature, and quantified the influence of curvature on the localization and distribution of proteins in vivo. Second, we used agarose microchambers to reshape bacteria whose cell wall had been chemically and enzymatically removed. By combining microstructures with different geometries and fluorescence microscopy, we determined the relationship between bacterial shape and the localization for two different membrane-associated proteins: i the cell-shape related protein MreB of Escherichia coli, which is positioned along the long axis of the rod-shaped cell; and ii the negative curvature-sensing cell division protein DivIVA of Bacillus subtilis, which is positioned primarily at cell division sites. Our studies of intracellular organization in live cells of E. coli and B. subtilis demonstrate that MreB is largely excluded from areas of high negative curvature, whereas DivIVA localizes preferentially to regions of high negative curvature. These studies highlight a unique approach for studying the relationship between cell shape and intracellular organization in intact, live bacteria.
Rasmussen, J L; Kikkert, J R; Roy, M K; Sanford, J C
1994-01-01
We have used both Escherichia coli cells and Agrobacterium tumefaciens cells as microprojectiles to deliver DNA into suspension-cultured tobacco (Nicotiana tabacum L. line NT1) cells using a helium powered biolistic device. In addition, E. coli cells were used as microprojectiles for the transformation of suspension-cultured maize (Zea mays cv. Black Mexican Sweet) cells. Pretreating the bacterial cells with phenol at a concentration of 1.0%, and combining the bacterial cells with tungsten particles increased the rates of transformation. In N. tabacum, we obtained hundreds of transient transformants per bombardment, but were unable to recover any stable transformants. In Z. mays we obtained thousands of transient transformants and an average of six stable transformants per bombardment. This difference is discussed.
Applications of whole-cell bacterial sensors in biotechnology and environmental science
Energy Technology Data Exchange (ETDEWEB)
Yagi, Kiyohito [Osaka Univ., Suita (Japan). Graduate School of Pharmaceutical Sciences
2007-01-15
Biosensors have major advantages over chemical or physical analyses with regard to specificity, sensitivity, and portability. Recently, many types of whole-cell bacterial biosensors have been developed using recombinant DNA technology. The bacteria are genetically engineered to respond to the presence of chemicals or physiological stresses by synthesizing a reporter protein, such as luciferase, {beta}-galactosidase, or green fluorescent protein. In addition to an overview of conventional biosensors, this minireview discusses a novel type of biosensor using a photosynthetic bacterium as the sensor strain and the crtA gene, which is responsible for carotenoid synthesis, as the reporter. Since bacteria possess a wide variety of stress-response mechanisms, including antioxidation, heat-shock responses, nutrient-starvation, and membrane-damage responses, DNA response elements for several stress-response proteins can be fused with various reporter genes to construct a versatile set of bacterial biosensors for a variety of analytes. Portable biosensors for on-site monitoring have been developed using a freeze-dried biosensing strain, and cell array biosensors have been designed for high-throughput analysis. Moreover, in the future, the use of single-cell biosensors will permit detailed analyses of samples. Signals from such sensors could be detected with digital imaging, epifluorescence microscopy, and/or flow cytometry. (orig.)
Vaginal epithelial cells regulate membrane adhesiveness to co-ordinate bacterial adhesion
Younes, Jessica A.; Klappe, Karin; Kok, Jan Willem; Busscher, Henk J.; Reid, Gregor; van der Mei, Henny C.
Vaginal epithelium is colonized by different bacterial strains and species. The bacterial composition of vaginal biofilms controls the balance between health and disease. Little is known about the relative contribution of the epithelial and bacterial cell surfaces to bacterial adhesion and whether
Grossi , Marco; Riccò , Bruno; Parolin , Carola; Vitali , Beatrice
2017-01-01
International audience; The detection of bacterial concentration is important in different fields since high microbial contamination or the presence of particular pathogens can seriously endanger human health. The reference technique to measure bacterial concentration is Standard Plate Count (SPC) that, however, has long response times (24 to 72 hours) and is not suitable for automatic implementation. This paper presents a portable embedded system for bacterial concentration measurement based...
Measuring bacterial cells size with AFM
Directory of Open Access Journals (Sweden)
Denise Osiro
2012-03-01
Full Text Available Atomic Force Microscopy (AFM can be used to obtain high-resolution topographical images of bacteria revealing surface details and cell integrity. During scanning however, the interactions between the AFM probe and the membrane results in distortion of the images. Such distortions or artifacts are the result of geometrical effects related to bacterial cell height, specimen curvature and the AFM probe geometry. The most common artifact in imaging is surface broadening, what can lead to errors in bacterial sizing. Several methods of correction have been proposed to compensate for these artifacts and in this study we describe a simple geometric model for the interaction between the tip (a pyramidal shaped AFM probe and the bacterium (Escherichia coli JM-109 strain to minimize the enlarging effect. Approaches to bacteria immobilization and examples of AFM images analysis are also described.
Elucidating Duramycin’s Bacterial Selectivity and Mode of Action on the Bacterial Cell Envelope
Directory of Open Access Journals (Sweden)
Sahar Hasim
2018-02-01
Full Text Available The use of naturally occurring antimicrobial peptides provides a promising route to selectively target pathogenic agents and to shape microbiome structure. Lantibiotics, such as duramycin, are one class of bacterially produced peptidic natural products that can selectively inhibit the growth of other bacteria. However, despite longstanding characterization efforts, the microbial selectivity and mode of action of duramycin are still obscure. We describe here a suite of biological, chemical, and physical characterizations that shed new light on the selective and mechanistic aspects of duramycin activity. Bacterial screening assays have been performed using duramycin and Populus-derived bacterial isolates to determine species selectivity. Lipidomic profiles of selected resistant and sensitive strains show that the sensitivity of Gram-positive bacteria depends on the presence of phosphatidylethanolamine (PE in the cell membrane. Further the surface and interface morphology were studied by high resolution atomic force microscopy and showed a progression of cellular changes in the cell envelope after treatment with duramycin for the susceptible bacterial strains. Together, these molecular and cellular level analyses provide insight into duramycin’s mode of action and a better understanding of its selectivity.
Molecular analysis of cross-bacterial contamination detected in ...
African Journals Online (AJOL)
... the isolate Delftia acidovorans BP(R2) and it is also coupled to protein with molecular weight 25-26 KDa. As well as, this bacterial contamination was the reason for the false positive results observed during the detection of HCV infections. Journal of Applied Sciences and Environmental Management Vol. 9(1) 2005: 5-10.
Bacteriophages for detection of bacterial pathogens
International Nuclear Information System (INIS)
Kutateladze, M.
2009-01-01
The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary
International Nuclear Information System (INIS)
Nomura, Toshiyuki; Fujisawa, Eri; Itoh, Shikibu; Konishi, Yasuhiro
2016-01-01
The cytotoxic effect of positively charged polystyrene latex nanoparticles (PSL NPs) was compared between planktonic bacterial cells and bacterial biofilms using confocal laser scanning microscopy, atomic force microscopy, and a colony counting method. Pseudomonas fluorescens, which is commonly used in biofilm studies, was employed as the model bacteria. We found that the negatively charged bacterial surface of the planktonic cells was almost completely covered with positively charged PSL NPs, leading to cell death, as indicated by the NP concentration being greater than that required to achieve single layer coverage. In addition, the relationship between surface coverage and cell viability of P. fluorescens cells correlated well with the findings in other bacterial cells (Escherichia coli and Lactococcuslactis). However, most of the bacterial cells that formed the biofilm were viable despite the positively charged PSL NPs being highly toxic to planktonic bacterial cells. This indicated that bacterial cells embedded in the biofilm were protected by self-produced extracellular polymeric substances (EPS) that provide resistance to antibacterial agents. In conclusion, mature biofilms covered with EPS exhibit resistance to NP toxicity as well as antibacterial agents.
Energy Technology Data Exchange (ETDEWEB)
Nomura, Toshiyuki, E-mail: nomura@chemeng.osakafu-u.ac.jp; Fujisawa, Eri; Itoh, Shikibu; Konishi, Yasuhiro [Osaka Prefecture University, Department of Chemical Engineering (Japan)
2016-06-15
The cytotoxic effect of positively charged polystyrene latex nanoparticles (PSL NPs) was compared between planktonic bacterial cells and bacterial biofilms using confocal laser scanning microscopy, atomic force microscopy, and a colony counting method. Pseudomonas fluorescens, which is commonly used in biofilm studies, was employed as the model bacteria. We found that the negatively charged bacterial surface of the planktonic cells was almost completely covered with positively charged PSL NPs, leading to cell death, as indicated by the NP concentration being greater than that required to achieve single layer coverage. In addition, the relationship between surface coverage and cell viability of P. fluorescens cells correlated well with the findings in other bacterial cells (Escherichia coli and Lactococcuslactis). However, most of the bacterial cells that formed the biofilm were viable despite the positively charged PSL NPs being highly toxic to planktonic bacterial cells. This indicated that bacterial cells embedded in the biofilm were protected by self-produced extracellular polymeric substances (EPS) that provide resistance to antibacterial agents. In conclusion, mature biofilms covered with EPS exhibit resistance to NP toxicity as well as antibacterial agents.
Nomura, Toshiyuki; Fujisawa, Eri; Itoh, Shikibu; Konishi, Yasuhiro
2016-06-01
The cytotoxic effect of positively charged polystyrene latex nanoparticles (PSL NPs) was compared between planktonic bacterial cells and bacterial biofilms using confocal laser scanning microscopy, atomic force microscopy, and a colony counting method. Pseudomonas fluorescens, which is commonly used in biofilm studies, was employed as the model bacteria. We found that the negatively charged bacterial surface of the planktonic cells was almost completely covered with positively charged PSL NPs, leading to cell death, as indicated by the NP concentration being greater than that required to achieve single layer coverage. In addition, the relationship between surface coverage and cell viability of P. fluorescens cells correlated well with the findings in other bacterial cells ( Escherichia coli and Lactococcus lactis). However, most of the bacterial cells that formed the biofilm were viable despite the positively charged PSL NPs being highly toxic to planktonic bacterial cells. This indicated that bacterial cells embedded in the biofilm were protected by self-produced extracellular polymeric substances (EPS) that provide resistance to antibacterial agents. In conclusion, mature biofilms covered with EPS exhibit resistance to NP toxicity as well as antibacterial agents.
DEFF Research Database (Denmark)
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H
2017-01-01
To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. We present an automated microscopy-based, fast, high-throughput method for analy...
Electrostatic behavior of the charge-regulated bacterial cell surface.
Hong, Yongsuk; Brown, Derick G
2008-05-06
The electrostatic behavior of the charge-regulated surfaces of Gram-negative Escherichia coli and Gram-positive Bacillus brevis was studied using numerical modeling in conjunction with potentiometric titration and electrophoretic mobility data as a function of solution pH and electrolyte composition. Assuming a polyelectrolytic polymeric bacterial cell surface, these experimental and numerical analyses were used to determine the effective site numbers of cell surface acid-base functional groups and Ca(2+) sorption coefficients. Using effective site concentrations determined from 1:1 electrolyte (NaCl) experimental data, the charge-regulation model was able to replicate the effects of 2:1 electrolyte (CaCl(2)), both alone and as a mixture with NaCl, on the measured zeta potential using a single Ca(2+) surface binding constant for each of the bacterial species. This knowledge is vital for understanding how cells respond to changes in solution pH and electrolyte composition as well as how they interact with other surfaces. The latter is especially important due to the widespread use of the Derjaguin-Landau-Verwey-Overbeek (DLVO) theory in the interpretation of bacterial adhesion. As surface charge and surface potential both vary on a charge-regulated surface, accurate modeling of bacterial interactions with surfaces ultimately requires use of an electrostatic model that accounts for the charge-regulated nature of the cell surface.
Harnessing cell-to-cell variations to probe bacterial structure and biophysics
Cass, Julie A.
Advances in microscopy and biotechnology have given us novel insights into cellular biology and physics. While bacteria were long considered to be relatively unstructured, the development of fluorescence microscopy techniques, and spatially and temporally resolved high-throughput quantitative studies, have uncovered that the bacterial cell is highly organized, and its structure rigorously maintained. In this thesis I will describe our gateTool software, designed to harness cell-to-cell variations to probe bacterial structure, and discuss two exciting aspects of structure that we have employed gateTool to investigate: (i) chromosome organization and the cellular mechanisms for controlling DNA dynamics, and (ii) the study of cell wall synthesis, and how the genes in the synthesis pathway impact cellular shape. In the first project, we develop a spatial and temporal mapping of cell-cycle-dependent chromosomal organization, and use this quantitative map to discover that chromosomal loci segregate from midcell with universal dynamics. In the second project, I describe preliminary time- lapse and snapshot imaging analysis suggesting phentoypical coherence across peptidoglycan synthesis pathways.
Van Nevel, S.
2017-02-08
Drinking water utilities and researchers continue to rely on the century-old heterotrophic plate counts (HPC) method for routine assessment of general microbiological water quality. Bacterial cell counting with flow cytometry (FCM) is one of a number of alternative methods that challenge this status quo and provide an opportunity for improved water quality monitoring. After more than a decade of application in drinking water research, FCM methodology is optimised and established for routine application, supported by a considerable amount of data from multiple full-scale studies. Bacterial cell concentrations obtained by FCM enable quantification of the entire bacterial community instead of the minute fraction of cultivable bacteria detected with HPC (typically < 1% of all bacteria). FCM measurements are reproducible with relative standard deviations below 3% and can be available within 15 min of samples arriving in the laboratory. High throughput sample processing and complete automation are feasible and FCM analysis is arguably less expensive than HPC when measuring more than 15 water samples per day, depending on the laboratory and selected staining procedure(s). Moreover, many studies have shown FCM total (TCC) and intact (ICC) cell concentrations to be reliable and robust process variables, responsive to changes in the bacterial abundance and relevant for characterising and monitoring drinking water treatment and distribution systems. The purpose of this critical review is to initiate a constructive discussion on whether FCM could replace HPC in routine water quality monitoring. We argue that FCM provides a faster, more descriptive and more representative quantification of bacterial abundance in drinking water.
Van Nevel, S.; Koetzsch, S.; Proctor, C.R.; Besmer, M.D.; Prest, E.I.; Vrouwenvelder, Johannes S.; Knezev, A.; Boon, N.; Hammes, F.
2017-01-01
Drinking water utilities and researchers continue to rely on the century-old heterotrophic plate counts (HPC) method for routine assessment of general microbiological water quality. Bacterial cell counting with flow cytometry (FCM) is one of a number of alternative methods that challenge this status quo and provide an opportunity for improved water quality monitoring. After more than a decade of application in drinking water research, FCM methodology is optimised and established for routine application, supported by a considerable amount of data from multiple full-scale studies. Bacterial cell concentrations obtained by FCM enable quantification of the entire bacterial community instead of the minute fraction of cultivable bacteria detected with HPC (typically < 1% of all bacteria). FCM measurements are reproducible with relative standard deviations below 3% and can be available within 15 min of samples arriving in the laboratory. High throughput sample processing and complete automation are feasible and FCM analysis is arguably less expensive than HPC when measuring more than 15 water samples per day, depending on the laboratory and selected staining procedure(s). Moreover, many studies have shown FCM total (TCC) and intact (ICC) cell concentrations to be reliable and robust process variables, responsive to changes in the bacterial abundance and relevant for characterising and monitoring drinking water treatment and distribution systems. The purpose of this critical review is to initiate a constructive discussion on whether FCM could replace HPC in routine water quality monitoring. We argue that FCM provides a faster, more descriptive and more representative quantification of bacterial abundance in drinking water.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
Energy Technology Data Exchange (ETDEWEB)
Yu, L.D., E-mail: yuld@thep-center.org [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Prakrajang, K. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Faculty of Science, Maejo University, Chiang Mai 50290 (Thailand); Phanchaisri, B. [Institute of Science and Technology Research, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongkumkoon, P. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thopan, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Singkarat, S. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2014-05-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
International Nuclear Information System (INIS)
Yu, L.D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.
2014-01-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence
Detection of Bacterial Pathogens from Broncho-Alveolar Lavage by Next-Generation Sequencing.
Leo, Stefano; Gaïa, Nadia; Ruppé, Etienne; Emonet, Stephane; Girard, Myriam; Lazarevic, Vladimir; Schrenzel, Jacques
2017-09-20
The applications of whole-metagenome shotgun sequencing (WMGS) in routine clinical analysis are still limited. A combination of a DNA extraction procedure, sequencing, and bioinformatics tools is essential for the removal of human DNA and for improving bacterial species identification in a timely manner. We tackled these issues with a broncho-alveolar lavage (BAL) sample from an immunocompromised patient who had developed severe chronic pneumonia. We extracted DNA from the BAL sample with protocols based either on sequential lysis of human and bacterial cells or on the mechanical disruption of all cells. Metagenomic libraries were sequenced on Illumina HiSeq platforms. Microbial community composition was determined by k-mer analysis or by mapping to taxonomic markers. Results were compared to those obtained by conventional clinical culture and molecular methods. Compared to mechanical cell disruption, a sequential lysis protocol resulted in a significantly increased proportion of bacterial DNA over human DNA and higher sequence coverage of Mycobacterium abscessus , Corynebacterium jeikeium and Rothia dentocariosa , the bacteria reported by clinical microbiology tests. In addition, we identified anaerobic bacteria not searched for by the clinical laboratory. Our results further support the implementation of WMGS in clinical routine diagnosis for bacterial identification.
Detection of Bacterial Endospores in Soil by Terbium Fluorescence
Directory of Open Access Journals (Sweden)
Andrea Brandes Ammann
2011-01-01
Full Text Available Spore formation is a survival mechanism of microorganisms when facing unfavorable environmental conditions resulting in “dormant” states. We investigated the occurrence of bacterial endospores in soils from various locations including grasslands (pasture, meadow, allotment gardens, and forests, as well as fluvial sediments. Bacterial spores are characterized by their high content of dipicolinic acid (DPA. In the presence of terbium, DPA forms a complex showing a distinctive photoluminescence spectrum. DPA was released from soil by microwaving or autoclaving. The addition of aluminium chloride reduced signal quenching by interfering compounds such as phosphate. The highest spore content (up to 109 spores per gram of dry soil was found in grassland soils. Spore content is related to soil type, to soil depth, and to soil carbon-to-nitrogen ratio. Our study might provide a basis for the detection of “hot spots” of bacterial spores in soil.
Ebrahimi, Aida; Alam, Muhammad A.
Rapid detection of bacterial pathogens is of great importance in healthcare, food safety, environmental monitoring, and homeland security. Most bacterial detection platforms rely on binary fission (i.e. cell growth) to reach a threshold cell population that can be resolved by the sensing method. Since cell division depends on the bacteria type, the detection time of such methods can vary from hours to days. In contrast, in this work, we show that bacteria cells can be detected within minutes by relying on activation of specific protein channels, i.e. mechanosensitive channels (MS channels). When cells are exposed to hypotonic solutions, MS channels allow efflux of solutes to the external solution which leads to release the excessive membrane tension. Release of the cytoplasmic solutes, in turn, results in increase of the electrical conductance measured by droplet-based impedance sensing. The approach can be an effective technique for fast, pre-screening of bacterial contamination at ultra-low concentration.
Role of innate T cells in anti-bacterial immunity
Directory of Open Access Journals (Sweden)
Yifang eGao
2015-06-01
Full Text Available Innate T cells are a heterogeneous group of αβ and γδ T cells that respond rapidly (<2 hours upon activation. These innate T cells also share a non MHC class I or II restriction requirement for antigen recognition. Three major populations within the innate T cell group are recognized, namely Invariant NKT cells (iNKT; Mucosal associated invariant T cells (MAIT and gamma delta T cells. These cells recognize foreign/self-lipid presented by non-classical MHC molecules, such as CD1d, MR1 and CD1a.They are activated during the early stages of bacterial infection and act as a bridge between the innate and adaptive immune systems. In this review we focus on the functional properties of these 3 innate T cell populations and how they are purposed for antimicrobial defense. Furthermore we address the mechanisms through which their effector functions are targeted for bacterial control and compare this in human and murine systems. Lastly we speculate on future roles of these cell types in therapeutic settings such as vaccination.
Facile method to stain the bacterial cell surface for super-resolution fluorescence microscopy
Energy Technology Data Exchange (ETDEWEB)
Gunsolus, Ian L.; Hu, Dehong; Mihai, Cosmin; Lohse, Samuel E.; Lee, Chang-Soo; Torelli, Marco; Hamers, Robert J.; Murphy, Catherine; Orr, Galya; Haynes, Christy L.
2014-01-01
A method to fluorescently stain the surfaces of both Gram-negative and Gram-positive bacterial cells compatible with super-resolution fluorescence microscopy is presented. This method utilizes a commercially-available fluorescent probe to label primary amines at the surface of the cell. We demonstrate efficient staining of two bacterial strains, the Gram-negative Shewanella oneidensis MR-1 and the Gram-positive Bacillus subtilis 168. Using structured illumination microscopy and stochastic optical reconstruction microscopy, which require high quantum yield or specialized dyes, we show that this staining method may be used to resolve the bacterial cell surface with sub-diffraction-limited resolution. We further use this method to identify localization patterns of nanomaterials, specifically cadmium selenide quantum dots, following interaction with bacterial cells.
International Nuclear Information System (INIS)
Decho, Alan W; Beckman, Erin M; Chandler, G Thomas; Kawaguchi, Tomohiro
2008-01-01
An indirect immunofluorescence approach was developed using semiconductor quantum dot nanocrystals to label and detect a specific bacterial serotype of the bacterial human pathogen Vibrio parahaemolyticus, attached to small marine animals (i.e. benthic harpacticoid copepods), which are suspected pathogen carriers. This photostable labeling method using nanotechnology will potentially allow specific serotypes of other bacterial pathogens to be detected with high sensitivity in a range of systems, and can be easily applied for sensitive detection to other Vibrio species such as Vibrio cholerae
Bacterial cell curvature through mechanical control of cell growth
DEFF Research Database (Denmark)
Cabeen, M.; Charbon, Godefroid; Vollmer, W.
2009-01-01
The cytoskeleton is a key regulator of cell morphogenesis. Crescentin, a bacterial intermediate filament-like protein, is required for the curved shape of Caulobacter crescentus and localizes to the inner cell curvature. Here, we show that crescentin forms a single filamentous structure...... that collapses into a helix when detached from the cell membrane, suggesting that it is normally maintained in a stretched configuration. Crescentin causes an elongation rate gradient around the circumference of the sidewall, creating a longitudinal cell length differential and hence curvature. Such curvature...... can be produced by physical force alone when cells are grown in circular microchambers. Production of crescentin in Escherichia coli is sufficient to generate cell curvature. Our data argue for a model in which physical strain borne by the crescentin structure anisotropically alters the kinetics...
Bacterial cell wall preservation during organic matter diagenesis in sediments off Peru
DEFF Research Database (Denmark)
Lomstein, Bente Aagaard; Niggemann, Jutta; Jørgensen, Bo Barker
BACTERIAL CELL WALL PRESERVATION DURING ORGANIC MATTER DIAGENESIS IN SEDIMENTS OFF PERU The spatial distribution of total hydrolysable amino acids, total hydrolysable amino sugars and amino acid enantiomers (D- and L-forms) were investigated in surface sediments at 20 stations in the Peru margin: 9......°45 S - 13º32 S. The objective of this study was to assess the preservation of bacterial cell walls during diagenesis of organic matter. Bacterial cell walls were traced by analysis of biomarkers uniquely produced by bacteria (D-amino acids and muramic acid). The diagenetic status of the sediments......:00 Presentation is given by student: No...
Koyama, Kento; Hokunan, Hidekazu; Hasegawa, Mayumi; Kawamura, Shuso; Koseki, Shigenobu
2016-12-01
We investigated a bacterial sample preparation procedure for single-cell studies. In the present study, we examined whether single bacterial cells obtained via 10-fold dilution followed a theoretical Poisson distribution. Four serotypes of Salmonella enterica, three serotypes of enterohaemorrhagic Escherichia coli and one serotype of Listeria monocytogenes were used as sample bacteria. An inoculum of each serotype was prepared via a 10-fold dilution series to obtain bacterial cell counts with mean values of one or two. To determine whether the experimentally obtained bacterial cell counts follow a theoretical Poisson distribution, a likelihood ratio test between the experimentally obtained cell counts and Poisson distribution which parameter estimated by maximum likelihood estimation (MLE) was conducted. The bacterial cell counts of each serotype sufficiently followed a Poisson distribution. Furthermore, to examine the validity of the parameters of Poisson distribution from experimentally obtained bacterial cell counts, we compared these with the parameters of a Poisson distribution that were estimated using random number generation via computer simulation. The Poisson distribution parameters experimentally obtained from bacterial cell counts were within the range of the parameters estimated using a computer simulation. These results demonstrate that the bacterial cell counts of each serotype obtained via 10-fold dilution followed a Poisson distribution. The fact that the frequency of bacterial cell counts follows a Poisson distribution at low number would be applied to some single-cell studies with a few bacterial cells. In particular, the procedure presented in this study enables us to develop an inactivation model at the single-cell level that can estimate the variability of survival bacterial numbers during the bacterial death process. Copyright © 2016 Elsevier Ltd. All rights reserved.
Histo-FISH protocol to detect bacterial compositions and biofilms formation in vivo.
Madar, M; Slizova, M; Czerwinski, J; Hrckova, G; Mudronova, D; Gancarcikova, S; Popper, M; Pistl, J; Soltys, J; Nemcova, R
2015-01-01
The study of biofilm function in vivo in various niches of the gastrointestinal tract (GIT) is rather limited. It is more frequently used in in vitro approaches, as an alternative to the studies focused on formation mechanisms and function of biofilms, which do not represent the actual in vivo complexity of microbial structures. Additionally, in vitro tests can sometimes lead to unreliable results. The goal of this study was to develop a simple approach to detect bacterial populations, particularly Lactobacillus and Bifidobacterium in biofilms, in vivo by the fluorescent in situ hybridisation (FISH) method. We standardised a new Histo-FISH method based on specific fluorochrome labelling probes which are able to detect Lactobacillus spp. and Bifidobacterium spp. within biofilms on the mucosal surface of the GIT embedded in paraffin in histological slices. This method is also suitable for visualisation of bacterial populations in the GIT internal content. Depending on the labelling probes, the Histo-FISH method has the potential to detect other probiotic strains or pathogenic bacteria. This original approach permits us to analyse bacterial colonisation processes as well as biofilm formation in stomach and caecum of BALB/c and germ-free mice.
Baumstummler, A; Lehmann, D; Janjic, N; Ochsner, U A
2014-10-01
Slow off-rate modified aptamer (SOMAmer) reagents were generated to several Staphylococcus aureus cell surface-associated proteins via SELEX with multiple modified DNA libraries using purified recombinant or native proteins. High-affinity binding agents with sub-nanomolar Kd 's were obtained for staphylococcal protein A (SpA), clumping factors (ClfA, ClfB), fibronectin-binding proteins (FnbA, FnbB) and iron-regulated surface determinants (Isd). Further screening revealed several SOMAmers that specifically bound to Staph. aureus cells from all strains that were tested, but not to other staphylococci or other bacteria. SpA and ClfA SOMAmers proved useful for the selective capture and enrichment of Staph. aureus cells, as shown by culture and PCR, leading to improved limits of detection and efficient removal of PCR inhibitors. Detection of Staph. aureus cells was enhanced by several orders of magnitude when the bacterial cell surface was coated with SOMAmers followed by qPCR of the SOMAmers. Furthermore, fluorescence-labelled SpA SOMAmers demonstrated their utility as direct detection agents in flow cytometry. Significance and impact of the study: Monitoring for microbial contamination of food, water, nonsterile products or the environment is typically based on culture, PCR or antibodies. Aptamers that bind with high specificity and affinity to well-conserved cell surface epitopes represent a promising novel type of reagents to detect bacterial cells without the need for culture or cell lysis, including for the capture and enrichment of bacteria present at low cell densities and for the direct detection via qPCR or fluorescent staining. © 2014 Soma Logic, Inc. published by John Wiley & Sons Ltd On behalf of the society for Applied Microbiology.
Probing interaction of Gram-positive and Gram-negative bacterial cells with ZnO nanorods
Energy Technology Data Exchange (ETDEWEB)
Jain, Aanchal; Bhargava, Richa; Poddar, Pankaj, E-mail: p.poddar@ncl.res.in
2013-04-01
In the present work, the physiological effects of the ZnO nanorods on the Gram positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli and Aerobacter aerogenes) bacterial cells have been studied. The analysis of bacterial growth curves for various concentrations of ZnO nanorods indicates that Gram positive and Gram negative bacterial cells show inhibition at concentrations of ∼ 64 and ∼ 256 μg/mL respectively. The marked difference in susceptibility towards nanorods was also validated by spread plate and disk diffusion methods. In addition, the scanning electron micrographs show a clear damage to the cells via changed morphology of the cells from rod to coccoid etc. The confocal optical microscopy images of these cells also demonstrate the reduction in live cell count in the presence of ZnO nanorods. These, results clearly indicate that the antibacterial activity of ZnO nanorods is higher towards Gram positive bacterium than Gram negative bacterium which indicates that the structure of the cell wall might play a major role in the interaction with nanostructured materials and shows high sensitivity to the particle concentration. Highlights: ► Effect of ZnO nanorods on the growth cycles of four bacterial strains. ► A relation has been established between growth rate of bacteria and concentration. ► Serious damage in the morphology of bacterial cells in the presence of ZnO nanorods. ► Microscopic studies to see the time dependent effect on bacterial cells.
Bacterial Cell Wall Growth, Shape and Division
Derouaux, A.; Terrak, M.; den Blaauwen, T.; Vollmer, W.; Remaut, H.; Fronzes, R.
2014-01-01
The shape of a bacterial cell is maintained by its peptidoglycan sacculus that completely surrounds the cytoplasmic membrane. During growth the sacculus is enlarged by peptidoglycan synthesis complexes that are controlled by components linked to the cytoskeleton and, in Gram-negative bacteria, by
Electrochemical characterization of the bacterial cell surface
Wal, van der A.
1996-01-01
Bacterial cells are ubiquitous in natural environments and also play important roles in domestic and industrial processes. They are found either suspended in the aqueous phase or attached to solid particles. The adhesion behaviour of bacteria is influenced by the physico-chemical
Metabolic Regulation of a Bacterial Cell System with Emphasis on Escherichia coli Metabolism
Shimizu, Kazuyuki
2013-01-01
It is quite important to understand the overall metabolic regulation mechanism of bacterial cells such as Escherichia coli from both science (such as biochemistry) and engineering (such as metabolic engineering) points of view. Here, an attempt was made to clarify the overall metabolic regulation mechanism by focusing on the roles of global regulators which detect the culture or growth condition and manipulate a set of metabolic pathways by modulating the related gene expressions. For this, it was considered how the cell responds to a variety of culture environments such as carbon (catabolite regulation), nitrogen, and phosphate limitations, as well as the effects of oxygen level, pH (acid shock), temperature (heat shock), and nutrient starvation. PMID:25937963
Single-bacterium nanomechanics in biomedicine: unravelling the dynamics of bacterial cells
International Nuclear Information System (INIS)
Aguayo, S; Bozec, L; Donos, N; Spratt, D
2015-01-01
The use of the atomic force microscope (AFM) in microbiology has progressed significantly throughout the years since its first application as a high-resolution imaging instrument. Modern AFM setups are capable of characterizing the nanomechanical behaviour of bacterial cells at both the cellular and molecular levels, where elastic properties and adhesion forces of single bacterium cells can be examined under different experimental conditions. Considering that bacterial and biofilm-mediated infections continue to challenge the biomedical field, it is important to understand the biophysical events leading towards bacterial adhesion and colonization on both biological and non-biological substrates. The purpose of this review is to present the latest findings concerning the field of single-bacterium nanomechanics, and discuss future trends and applications of nanoindentation and single-cell force spectroscopy techniques in biomedicine. (topical review)
[Sizes of bacterial cells in soils determined by cascade filtration technique].
Polianskaia, L M; Gorodnichev, R B; Zviagintsev, D G
2013-01-01
This paper studies the number of bacteria in typical chernozem and mountain-meadow soil by the traditional method and the cascade filtration technique. The total number of bacteria in these soils, which was obtained in filters of different diameters during filtering the suspension of a certain amount, is 1.5-5 times higher than that obtained by the traditional method. In the structure of the bacterial biomass in both soils, the biomass of bacterial cells with a diameter of 0.38-0.43 microm was dominating by 8-90%. In the typical chernozem, the biomass of cells with a diameter of 0.17 microm was slightly more than 1%; in the mountain-meadow soil, the percentage of the biomass of cells with a diameter of 0.17 microm increased by 5%. The average volume and diameter of the bacteria in the studied soils were calculated. In typical chernozem, the average volume of bacterial cells was equal to 0.0046 microm3 and the diameter was 0.206 microm. In the mountain-meadow soils, these values were slightly lower, 0.0038 microm3 and 0.194 microm, respectively. The biomass of the bacterial cells, which is usually calculated based on the cell volume of 0.1 microm3, is overestimated by about five times when counting the number on the filters. The percentage of the real biomass of soil bacteria is traditionally much lower than that estimated.
Genetic reprogramming of host cells by bacterial pathogens.
Tran Van Nhieu, Guy; Arbibe, Laurence
2009-10-29
During the course of infection, pathogens often induce changes in gene expression in host cells and these changes can be long lasting and global or transient and of limited amplitude. Defining how, when, and why bacterial pathogens reprogram host cells represents an exciting challenge that opens up the opportunity to grasp the essence of pathogenesis and its molecular details.
MECHANISM OF ACTION OF ANTIBIOTICS WHICH INHIBIT SYNTHESIS OF BACTERIAL CELL WALL
Directory of Open Access Journals (Sweden)
Indira Mujezinović
2013-03-01
Full Text Available Bacterial cell possess a cell wall, which is a main difference from mammalian cells. Its basic function is to provide the strength of bacteria, keeps its shape and provides an unusually high internal osmotic pressure. Synthesis of (construction of bacterial cell wall occurs in at least three phases. All of these three phases can be influence by a variety of antibiotics in way to inhibit its synthesis. The most important drugs that act in this manner are ß-lactam antibiotics (penicillins, cephalosporins, cephamycins and other ß-lactams. They interfere with the synthesis of the bacterial cell wall peptidoglycan. After attachment to penicillin binding proteins (PBP on bacteria, they inhibit the transpeptidation enzyme that cross-links the peptide chain attached to the backbone of the peptidoglycan. The final bactericidal event is the inactivation of an inhibitor of autolytic enzymes in the cell wall, wich leads to lysis of the bacteria. Vancomycin inhibits the release of the building block unit from the carrier, thus preventing its addition to the growing end of the peptidoglycan. Cycloserine, which is a structural analogue of D-alanine, prevents the addition of the two terminal alanine residue to the initial tripeptide side-chain on N-acetylmuramic acid by competitive inhibition. Bacitracin interferes with the regeneration of the lipid carrier by blocking its dephosphorylation. Key words: bacterial cell wall, paptidoglycan, antibiotics, ß-lactams
Kaushik, Sharbani; Goswami, Pranab
2018-06-06
The biosensing application of microbial fuel cell (MFC) is hampered by its long response time, poor selectivity, and technical difficulty in developing portable devices. Herein, a novel signal form for rapid detection of ethanol was generated in a photosynthetic MFC (PMFC). First, a dual chambered (100 mL each) PMFC was fabricated by using cyanobacteria-based anode and abiotic cathode, and its performance was examined for detection of alcohols. A graphene-based nanobiocomposite matrix was layered over graphite anode to support cyanobacterial biofilm growth and to facilitate electron transfer. Injection of alcohols into the anodic chamber caused a transient potential burst of the PMFC within 60 s (load 1000 Ω), and the magnitude of potential could be correlated to the ethanol concentrations in the range 0.001-20% with a limit of detection (LOD) of 0.13% ( R 2 = 0.96). The device exhibited higher selectivity toward ethanol than methanol as discerned from the corresponding cell-alcohol interaction constant ( K i ) of 780 and 1250 mM. The concept was then translated to a paper-based PMFC (p-PMFC) (size ∼20 cm 2 ) wherein, the cells were merely immobilized over the anode. The device with a shelf life of ∼3 months detected ethanol within 10 s with a dynamic range of 0.005-10% and LOD of 0.02% ( R 2 = 0.99). The fast response time was attributed to the higher wettability of ethanol on the immobilized cell surface as validated by the contact angle data. Alcohols degraded the cell membrane on the order of ethanol > methanol, enhanced the redox current of the membrane-bound electron carrier proteins, and pushed the anodic band gap toward more negative value. The consequence was the potential burst, the magnitude of which was correlated to the ethanol concentrations. This novel approach has a great application potential for selective, sensitive, rapid, and portable detection of ethanol.
Fluorescence immunoassay for detecting periodontal bacterial pathogens in plaque.
Wolff, L F; Anderson, L; Sandberg, G P; Aeppli, D M; Shelburne, C E
1991-01-01
A particle concentration fluorescence immunoassay has been modified into a bacterial concentration fluorescence immunoassay (BCFIA) to rapidly detect periodontopathic bacteria in human plaque samples. The BCFIA utilizes fluorescently tagged monoclonal antibodies (MAbs) directed against the lipopolysaccharide of selected gram-negative plaque bacteria. Microorganisms closely associated with periodontal disease that can be identified in plaque with the BCFIA include Porphyromonas gingivalis, Bac...
Bacterial cell wall composition and the influence of antibiotics by cell-wall and whole-cell NMR
Romaniuk, Joseph A. H.; Cegelski, Lynette
2015-01-01
The ability to characterize bacterial cell-wall composition and structure is crucial to understanding the function of the bacterial cell wall, determining drug modes of action and developing new-generation therapeutics. Solid-state NMR has emerged as a powerful tool to quantify chemical composition and to map cell-wall architecture in bacteria and plants, even in the context of unperturbed intact whole cells. In this review, we discuss solid-state NMR approaches to define peptidoglycan composition and to characterize the modes of action of old and new antibiotics, focusing on examples in Staphylococcus aureus. We provide perspectives regarding the selected NMR strategies as we describe the exciting and still-developing cell-wall and whole-cell NMR toolkit. We also discuss specific discoveries regarding the modes of action of vancomycin analogues, including oritavancin, and briefly address the reconsideration of the killing action of β-lactam antibiotics. In such chemical genetics approaches, there is still much to be learned from perturbations enacted by cell-wall assembly inhibitors, and solid-state NMR approaches are poised to address questions of cell-wall composition and assembly in S. aureus and other organisms. PMID:26370936
Directory of Open Access Journals (Sweden)
Andrew S Brown
2016-06-01
Full Text Available Legionella pneumophila is the causative agent of Legionnaires' disease, a potentially fatal lung infection. Alveolar macrophages support intracellular replication of L. pneumophila, however the contributions of other immune cell types to bacterial killing during infection are unclear. Here, we used recently described methods to characterise the major inflammatory cells in lung after acute respiratory infection of mice with L. pneumophila. We observed that the numbers of alveolar macrophages rapidly decreased after infection coincident with a rapid infiltration of the lung by monocyte-derived cells (MC, which, together with neutrophils, became the dominant inflammatory cells associated with the bacteria. Using mice in which the ability of MC to infiltrate tissues is impaired it was found that MC were required for bacterial clearance and were the major source of IL12. IL12 was needed to induce IFNγ production by lymphoid cells including NK cells, memory T cells, NKT cells and γδ T cells. Memory T cells that produced IFNγ appeared to be circulating effector/memory T cells that infiltrated the lung after infection. IFNγ production by memory T cells was stimulated in an antigen-independent fashion and could effectively clear bacteria from the lung indicating that memory T cells are an important contributor to innate bacterial defence. We also determined that a major function of IFNγ was to stimulate bactericidal activity of MC. On the other hand, neutrophils did not require IFNγ to kill bacteria and alveolar macrophages remained poorly bactericidal even in the presence of IFNγ. This work has revealed a cooperative innate immune circuit between lymphoid cells and MC that combats acute L. pneumophila infection and defines a specific role for IFNγ in anti-bacterial immunity.
A system for the rapid detection of bacterial contamination in cell-based therapeutica
Bolwien, Carsten; Erhardt, Christian; Sulz, Gerd; Thielecke, Hagen; Johann, Robert; Pudlas, Marieke; Mertsching, Heike; Koch, Steffen
2010-02-01
Monitoring the sterility of cell or tissue cultures is of major concern, particularly in the fields of regenerative medicine and tissue engineering when implanting cells into the human body. Our sterility-control system is based on a Raman micro-spectrometer and is able to perform fast sterility testing on microliters of liquid samples. In conventional sterility control, samples are incubated for weeks to proliferate the contaminants to concentrations above the detection limit of conventional analysis. By contrast, our system filters particles from the liquid sample. The filter chip fabricated in microsystem technology comprises a silicon nitride membrane with millions of sub-micrometer holes to retain particles of critical sizes and is embedded in a microfluidic cell specially suited for concomitant microscopic observation. After filtration, identification is carried out on the single particle level: image processing detects possible contaminants and prepares them for Raman spectroscopic analysis. A custom-built Raman-spectrometer-attachment coupled to the commercial microscope uses 532nm or 785nm Raman excitation and records spectra up to 3400cm-1. In the final step, the recorded spectrum of a single particle is compared to an extensive library of GMP-relevant organisms, and classification is carried out based on a support vector machine.
Microbial Fuels Cell-Based Biosensor for Toxicity Detection: A Review
Directory of Open Access Journals (Sweden)
Tuoyu Zhou
2017-09-01
Full Text Available With the unprecedented deterioration of environmental quality, rapid recognition of toxic compounds is paramount for performing in situ real-time monitoring. Although several analytical techniques based on electrochemistry or biosensors have been developed for the detection of toxic compounds, most of them are time-consuming, inaccurate, or cumbersome for practical applications. More recently, microbial fuel cell (MFC-based biosensors have drawn increasing interest due to their sustainability and cost-effectiveness, with applications ranging from the monitoring of anaerobic digestion process parameters (VFA to water quality detection (e.g., COD, BOD. When a MFC runs under correct conditions, the voltage generated is correlated with the amount of a given substrate. Based on this linear relationship, several studies have demonstrated that MFC-based biosensors could detect heavy metals such as copper, chromium, or zinc, as well as organic compounds, including p-nitrophenol (PNP, formaldehyde and levofloxacin. Both bacterial consortia and single strains can be used to develop MFC-based biosensors. Biosensors with single strains show several advantages over systems integrating bacterial consortia, such as selectivity and stability. One of the limitations of such sensors is that the detection range usually exceeds the actual pollution level. Therefore, improving their sensitivity is the most important for widespread application. Nonetheless, MFC-based biosensors represent a promising approach towards single pollutant detection.
Wheeler, Richard; Turner, Robert D; Bailey, Richard G; Salamaga, Bartłomiej; Mesnage, Stéphane; Mohamad, Sharifah A S; Hayhurst, Emma J; Horsburgh, Malcolm; Hobbs, Jamie K; Foster, Simon J
2015-07-28
Most bacterial cells are enclosed in a single macromolecule of the cell wall polymer, peptidoglycan, which is required for shape determination and maintenance of viability, while peptidoglycan biosynthesis is an important antibiotic target. It is hypothesized that cellular enlargement requires regional expansion of the cell wall through coordinated insertion and hydrolysis of peptidoglycan. Here, a group of (apparent glucosaminidase) peptidoglycan hydrolases are identified that are together required for cell enlargement and correct cellular morphology of Staphylococcus aureus, demonstrating the overall importance of this enzyme activity. These are Atl, SagA, ScaH, and SagB. The major advance here is the explanation of the observed morphological defects in terms of the mechanical and biochemical properties of peptidoglycan. It was shown that cells lacking groups of these hydrolases have increased surface stiffness and, in the absence of SagB, substantially increased glycan chain length. This indicates that, beyond their established roles (for example in cell separation), some hydrolases enable cellular enlargement by making peptidoglycan easier to stretch, providing the first direct evidence demonstrating that cellular enlargement occurs via modulation of the mechanical properties of peptidoglycan. Understanding bacterial growth and division is a fundamental problem, and knowledge in this area underlies the treatment of many infectious diseases. Almost all bacteria are surrounded by a macromolecule of peptidoglycan that encloses the cell and maintains shape, and bacterial cells must increase the size of this molecule in order to enlarge themselves. This requires not only the insertion of new peptidoglycan monomers, a process targeted by antibiotics, including penicillin, but also breakage of existing bonds, a potentially hazardous activity for the cell. Using Staphylococcus aureus, we have identified a set of enzymes that are critical for cellular enlargement. We
Directory of Open Access Journals (Sweden)
Monika WEBER
2016-08-01
Full Text Available Fluid-Screen, Inc. presents a bacterial concentration and filtration method based on dielectrophoresis and alternating current kinetics. Dielectrophoresis has been previously shown to induce particle motion; however, bacterial capture efficiency and reproducibility have consistently been low, reducing its potential for practical applications. In this study, we introduce a novel, patent-pending electrode system optimized to simultaneously capture a wide range of bacterial species from a variety of aqueous solutions. Specifically, we show that the method of dielectrophoresis used induces responses in both characteristic Gram- negative Escherichia coli and Gram-positive Enterococcus faecalis bacteria, as well as with Bacillus subtilis and Aestuariimicrobium kwangyangense. We have adapted the electrode design to create a bacterial sample preparatio unit, termed the sample sorter, that is able to capture multiple bacterial species and release them simultaneously for bacterial concentration and exchange from complex matrices to defined buffer media. This technology can be used on its own or in conjunction with standard bacterial detection methods such as mass spectroscopy. The Fluid-Screen product will dramatically improve testing and identification of bacterial contaminants in various industrial settings by eliminating the need for amplification of samples and by reducing the time to identification.
Transcriptional activity around bacterial cell death reveals molecular biomarkers for cell viability
Kort, R.; Keijser, B.J.; Caspers, M.P.M.; Schuren, F.H.; Montijn, R.
2008-01-01
Background: In bacteriology, the ability to grow in selective media and to form colonies on nutrient agar plates is routinely used as a retrospective criterion for the detection of living bacteria. However, the utilization of indicators for bacterial viability-such as the presence of specific
Tan, Michelle S F; Rahman, Sadequr; Dykes, Gary A
2017-04-01
This study investigated the removal of bacterial surface structures, particularly flagella, using sonication, and examined its effect on the attachment of Salmonella Typhimurium ATCC 14028 cells to plant cell walls. S. Typhimurium ATCC 14028 cells were subjected to sonication at 20 kHz to remove surface structures without affecting cell viability. Effective removal of flagella was determined by staining flagella of sonicated cells with Ryu's stain and enumerating the flagella remaining by direct microscopic counting. The attachment of sonicated S. Typhimurium cells to bacterial cellulose-based plant cell wall models and cut plant material (potato, apple, lettuce) was then evaluated. Varying concentrations of pectin and/or xyloglucan were used to produce a range of bacterial cellulose-based plant cell wall models. As compared to the non-sonicated controls, sonicated S. Typhimurium cells attached in significantly lower numbers (between 0.5 and 1.0 log CFU/cm 2 ) to all surfaces except to the bacterial cellulose-only composite without pectin and xyloglucan. Since attachment of S. Typhimurium to the bacterial cellulose-only composite was not affected by sonication, this suggests that bacterial surface structures, particularly flagella, could have specific interactions with pectin and xyloglucan. This study indicates that sonication may have potential applications for reducing Salmonella attachment during the processing of fresh produce. Copyright © 2016 Elsevier Ltd. All rights reserved.
Jiang, Donglei; Liu, Yan; Jiang, Hui; Rao, Shengqi; Fang, Wu; Wu, Mangang; Yuan, Limin; Fang, Weiming
2018-04-15
A novel screen-printed cell-based electrochemical sensor was developed to assess bacterial quorum signaling molecules, N-acylhomoserine lactones (AHLs). Screen-printed carbon electrode (SPCE), which possesses excellent properties such as low-cost, disposable and energy-efficient, was modified with multi-walled carbon nanotubes (MWNTs) to improve electrochemical signals and enhance the sensitivity. Rat basophilic leukemia (RBL-2H3) mast cells encapsulated in alginate/graphene oxide (NaAgl/GO) hydrogel were immobilized on the MWNTs/SPCE to serve as recognition element. Electrochemical impedance spectroscopy (EIS) was employed to record the cell impedance signal as-influenced by Pseudomonas aeruginosa quorum-sensing molecule, N-3-oxododecanoyl homoserine lactone (3OC 12 -HSL). Experimental results show that 3OC 12 -HSL caused a significant decrease in cell viability in a dose dependent manner. The EIS value decreased with concentrations of 3OC 12 -HSL in the range of 0.1-1μM, and the detection limit for 3OC 12 -HSL was calculated to be 0.094μM. These results were confirmed via cell viability, SEM, TEM analysis. Next, the sensor was successfully applied to monitoring the production of AHLs by spoilage bacteria in three different freshwater fish juice samples which efficiently proved the practicability of this cell based method. Therefore, the proposed cell sensor may serve as an innovative and effective approach to the measurement of quorum signaling molecule and thus provides a new avenue for real-time monitoring the spoilage bacteria in freshwater fish production. Copyright © 2017 Elsevier B.V. All rights reserved.
Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J
2018-04-01
Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.
Primo, Emiliano D; Otero, Lisandro H; Ruiz, Francisco; Klinke, Sebastián; Giordano, Walter
2018-01-01
The bacterial cell wall, a structural unit of peptidoglycan polymer comprised of glycan strands consisting of a repeating disaccharide motif [N-acetylglucosamine (NAG) and N-acetylmuramylpentapeptide (NAM pentapeptide)], encases bacteria and provides structural integrity and protection. Lysozymes are enzymes that break down the bacterial cell wall and disrupt the bacterial life cycle by cleaving the linkage between the NAG and NAM carbohydrates. Lab exercises focused on the effects of lysozyme on the bacterial cell wall are frequently incorporated in biochemistry classes designed for undergraduate students in diverse fields as biology, microbiology, chemistry, agronomy, medicine, and veterinary medicine. Such exercises typically do not include structural data. We describe here a sequence of computer tasks designed to illustrate and reinforce both physiological and structural concepts involved in lysozyme effects on the bacterial cell-wall structure. This lab class usually lasts 3.5 hours. First, the instructor presents introductory concepts of the bacterial cell wall and the effect of lysozyme on its structure. Then, students are taught to use computer modeling to visualize the three-dimensional structure of a lysozyme in complex with bacterial cell-wall fragments. Finally, the lysozyme inhibitory effect on a bacterial culture is optionally proposed as a simple microbiological assay. The computer lab exercises described here give students a realistic understanding of the disruptive effect of lysozymes on the bacterial cell wall, a crucial component in bacterial survival. © 2017 by The International Union of Biochemistry and Molecular Biology, 46(1):83-90, 2018. © 2017 The International Union of Biochemistry and Molecular Biology.
Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11
DEFF Research Database (Denmark)
Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe
2016-01-01
Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...
Detection of mastitis pathogens by analysis of volatile bacterial metabolites.
Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M
2008-10-01
The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.
The actin homologue MreB organizes the bacterial cell membrane.
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W
2014-03-07
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.
Yadhav Ml, Kala
2014-04-01
Bacterial meningitis is one of the most serious infections seen in infants and children, which is associated with acute complications and chronic morbidity. Infections of Central Nervous System (CNS) still dominate the scene of childhood neurological disorders in most of the developing tropical countries. To isolate, identify and determine the antibiotic susceptibility patterns of pathogens associated with bacterial meningitis. We also aimed to comparatively evaluate of Gram staining, culture and bacterial antigen detection in cerebrospinal fluid samples. Present comparative study included 100 CSF samples of children below the age of 5 years, who were clinically suspected meningitis cases. The samples were subjected to Gram staining, culture and Latex agglutination test (LAT). The organisms isolated in the study were characterized and antibiotic susceptibility test was done according to standard guidelines. It was done by using Gaussian test. Of the 100 cases, 24 were diagnosed as Acute bacterial meningitis (ABM) cases by. Gram staining, culture and latex agglutination test. 21 (87.5%) cases were culture positive, with 2 cases being positive for polymicrobial isolates. Gram staining was positive in 17 (70.53%) cases and LAT was positive in 18 (33.33%) cases. Streptococcus pneumoniae was the predominant organism which was isolated and it was sensitive to antibiotics. In the present study, male to female ratio was 1.27:1, which showed a male preponderance. With the combination of Gram staining, culture, and LAT, 100% sensitivity and specificity can be achieved (p Gram staining and LAT can detect 85% of cases of ABM. Bacterial meningitis is a medical emergency and making an early diagnosis and providing treatment early are life saving and they reduce chronic morbidity.
Directory of Open Access Journals (Sweden)
Peng Tian
2017-08-01
Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E
Detection of organic compounds with whole-cell bioluminescent bioassays.
Xu, Tingting; Close, Dan; Smartt, Abby; Ripp, Steven; Sayler, Gary
2014-01-01
Natural and manmade organic chemicals are widely deposited across a diverse range of ecosystems including air, surface water, groundwater, wastewater, soil, sediment, and marine environments. Some organic compounds, despite their industrial values, are toxic to living organisms and pose significant health risks to humans and wildlife. Detection and monitoring of these organic pollutants in environmental matrices therefore is of great interest and need for remediation and health risk assessment. Although these detections have traditionally been performed using analytical chemical approaches that offer highly sensitive and specific identification of target compounds, these methods require specialized equipment and trained operators, and fail to describe potential bioavailable effects on living organisms. Alternatively, the integration of bioluminescent systems into whole-cell bioreporters presents a new capacity for organic compound detection. These bioreporters are constructed by incorporating reporter genes into catabolic or signaling pathways that are present within living cells and emit a bioluminescent signal that can be detected upon exposure to target chemicals. Although relatively less specific compared to analytical methods, bioluminescent bioassays are more cost-effective, more rapid, can be scaled to higher throughput, and can be designed to report not only the presence but also the bioavailability of target substances. This chapter reviews available bacterial and eukaryotic whole-cell bioreporters for sensing organic pollutants and their applications in a variety of sample matrices.
Choudhry, M A; Fazal, N; Namak, S Y; Haque, F; Ravindranath, T; Sayeed, M M
2001-09-01
Increased gut bacterial translocation in burn and trauma patients has been demonstrated in a number of previous studies, however, the mechanism for such an increased gut bacterial translocation in injured patients remains poorly understood. Utilizing a rat model of burn injury, in the present study we examined the role of intestinal immune defense by analyzing the T cell functions. We investigated if intestinal T cells dysfunction contributes to bacterial translocation after burn injury. Also our study determined if burn-mediated alterations in intestinal T cell functions are related to enhanced release of PGE2. Finally, we examined whether or not burn-related alterations in intestinal T cell function are due to inappropriate activation of signaling molecule P59fyn, which is required for T cell activation and proliferation. The results presented here showed an increase in gut bacterial accumulation in mesenteric lymph nodes after thermal injury. This was accompanied by a decrease in the intestinal T cell proliferative responses. Furthermore, the treatments of burn-injured animals with PGE2 synthesis blocker (indomethacin or NS398) prevented both the decrease in intestinal T cell proliferation and enhanced bacterial translocation. Finally, our data suggested that the inhibition of intestinal T cell proliferation could result via PGE2-mediated down-regulation of the T cell activation-signaling molecule P59fyn. These findings support a role of T cell-mediated immune defense against bacterial translocation in burn injury.
Streptomyces sporulation - Genes and regulators involved in bacterial cell differentiation
Larsson, Jessica
2010-01-01
Streptomycetes are Gram-positive bacteria with a complex developmental life cycle. They form spores on specialized cells called aerial hyphae, and this sporulation involves alterations in growth, morphogenesis and cell cycle processes like cell division and chromosome segregation. Understanding the developmental mechanisms that streptomycetes have evolved for regulating for example cell division is of general interest in bacterial cell biology. It can also be valuable in the design of new dru...
Spatial Patterning of Newly-Inserted Material during Bacterial Cell Growth
Ursell, Tristan
2012-02-01
In the life cycle of a bacterium, rudimentary microscopy demonstrates that cell growth and elongation are essential characteristics of cellular reproduction. The peptidoglycan cell wall is the main load-bearing structure that determines both cell shape and overall size. However, simple imaging of cellular growth gives no indication of the spatial patterning nor mechanism by which material is being incorporated into the pre-existing cell wall. We employ a combination of high-resolution pulse-chase fluorescence microscopy, 3D computational microscopy, and detailed mechanistic simulations to explore how spatial patterning results in uniform growth and maintenance of cell shape. We show that growth is happening in discrete bursts randomly distributed over the cell surface, with a well-defined mean size and average rate. We further use these techniques to explore the effects of division and cell wall disrupting antibiotics, like cephalexin and A22, respectively, on the patterning of cell wall growth in E. coli. Finally, we explore the spatial correlation between presence of the bacterial actin-like cytoskeletal protein, MreB, and local cell wall growth. Together these techniques form a powerful method for exploring the detailed dynamics and involvement of antibiotics and cell wall-associated proteins in bacterial cell growth.[4pt] In collaboration with Kerwyn Huang, Stanford University.
Cruz-Adalia, Aránzazu; Ramirez-Santiago, Guillermo; Osuna-Pérez, Jesús; Torres-Torresano, Mónica; Zorita, Virgina; Martínez-Riaño, Ana; Boccasavia, Viola; Borroto, Aldo; Martínez Del Hoyo, Gloria; González-Granado, José María; Alarcón, Balbino; Sánchez-Madrid, Francisco; Veiga, Esteban
2017-11-17
Bacterial phagocytosis and antigen cross-presentation to activate CD8 + T cells are principal functions of professional antigen presenting cells. However, conventional CD4 + T cells also capture and kill bacteria from infected dendritic cells in a process termed transphagocytosis (also known as transinfection). Here, we show that transphagocytic T cells present bacterial antigens to naive CD8 + T cells, which proliferate and become cytotoxic in response. CD4 + T-cell-mediated antigen presentation also occurs in vivo in the course of infection, and induces the generation of central memory CD8 + T cells with low PD-1 expression. Moreover, transphagocytic CD4 + T cells induce protective anti-tumour immune responses by priming CD8 + T cells, highlighting the potential of CD4 + T cells as a tool for cancer immunotherapy.
Osmotic Pressure, Bacterial Cell Walls, and Penicillin: A Demonstration.
Lennox, John E.
1984-01-01
An easily constructed apparatus that models the effect of penicillin on the structure of bacterial cells is described. Background information and procedures for using the apparatus during a classroom demonstration are included. (JN)
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Rajavel, Krishnamoorthy; Gomathi, Rajkumar; Manian, Sellamuthu; Rajendra Kumar, Ramasamy Thangavelu
2014-01-21
Understanding the bacterial cytotoxicity of CNTs is important for a wide variety of applications in the biomedical, environmental, and health sectors. A majority of the earlier reports attributed the bactericidal cytotoxicity of CNTs to bacterial cell membrane damage by direct physical puncturing. Our results reveal that bacterial cell death via bacterial cell membrane damage is induced by reactive oxygen species (ROS) produced from CNTs and is not due to direct physical puncturing by CNTs. To understand the actual mechanism of bacterial killing, we elucidated the bacterial cytotoxicity of SWCNTs and MWCNTs against Gram-negative human pathogenic bacterial species Escherichia coli, Shigella sonnei, Klebsiella pneumoniae, and Pseudomonas aeruginosa and its amelioration upon functionalizing the CNTs with antioxidant tannic acid (TA). Interestingly, the bacterial cells treated with CNTs exhibited severe cell damage under laboratory (ambient) and sunlight irradiation conditions. However, CNTs showed no cytotoxicity to the bacterial cells when incubated in the dark. The quantitative assessments carried out by us made it explicit that CNTs are effective generators of ROS such as (1)O2, O2(•-), and (•)OH in an aqueous medium under both ambient and sunlight-irradiated conditions. Both naked and TA-functionalized CNTs showed negligible ROS production in the dark. Furthermore, strong correlations were obtained between ROS produced by CNTs and the bacterial cell mortality (with the correlation coefficient varying between 0.7618 and 0.9891) for all four tested pathogens. The absence of bactericidal cytotoxicity in both naked and functionalized CNTs in the dark reveals that the presence of ROS is the major factor responsible for the bactericidal action compared to direct physical puncturing. This understanding of the bactericidal activity of the irradiated CNTs, mediated through the generation of ROS, could be interesting for novel applications such as regulated ROS delivery
The bacterial cell cycle checkpoint protein Obg and its role in programmed cell death
Directory of Open Access Journals (Sweden)
Liselot Dewachter
2016-03-01
Full Text Available The phenomenon of programmed cell death (PCD, in which cells initiate their own demise, is not restricted to multicellular organisms. Unicellular organisms, both eukaryotes and prokaryotes, also possess pathways that mediate PCD. We recently identified a PCD mechanism in Escherichia coli that is triggered by a mutant isoform of the essential GTPase ObgE (Obg of E. coli. Importantly, the PCD pathway mediated by mutant Obg (Obg* differs fundamentally from other previously described bacterial PCD pathways and thus constitutes a new mode of PCD. ObgE was previously proposed to act as a cell cycle checkpoint protein able to halt cell division. The implication of ObgE in the regulation of PCD further increases the similarity between this protein and eukaryotic cell cycle regulators that are capable of doing both. Moreover, since Obg is conserved in eukaryotes, the elucidation of this cell death mechanism might contribute to the understanding of PCD in higher organisms. Additionally, if Obg*-mediated PCD is conserved among different bacterial species, it will be a prime target for the development of innovative antibacterials that artificially induce this pathway.
Baral, Pankaj; Umans, Benjamin D; Li, Lu; Wallrapp, Antonia; Bist, Meghna; Kirschbaum, Talia; Wei, Yibing; Zhou, Yan; Kuchroo, Vijay K; Burkett, Patrick R; Yipp, Bryan G; Liberles, Stephen D; Chiu, Isaac M
2018-05-01
Lung-innervating nociceptor sensory neurons detect noxious or harmful stimuli and consequently protect organisms by mediating coughing, pain, and bronchoconstriction. However, the role of sensory neurons in pulmonary host defense is unclear. Here, we found that TRPV1 + nociceptors suppressed protective immunity against lethal Staphylococcus aureus pneumonia. Targeted TRPV1 + -neuron ablation increased survival, cytokine induction, and lung bacterial clearance. Nociceptors suppressed the recruitment and surveillance of neutrophils, and altered lung γδ T cell numbers, which are necessary for immunity. Vagal ganglia TRPV1 + afferents mediated immunosuppression through release of the neuropeptide calcitonin gene-related peptide (CGRP). Targeting neuroimmunological signaling may be an effective approach to treat lung infections and bacterial pneumonia.
Heterotrophic free-living and particle-bound bacterial cell size in the ...
Indian Academy of Sciences (India)
PRAKASH
the heterotrophic bacterial cell size in the various water bodies studied in this investigation. The possible ... seasonal changes in abundance and cell size of heterotrophic ... data, 1995) physiological stress indicated by the presence of small ...
A cell-based fluorescent assay to detect the activity of AB toxins that inhibit protein synthesis
AB-type protein toxins, produced by numerous bacterial pathogens and some plants, elicit a cytotoxic effect involving the inhibition of protein synthesis. To develop an improved method to detect the inhibition of protein synthesis by AB-type toxins, the present study characterized a Vero cell line t...
Directory of Open Access Journals (Sweden)
Nafise Sadat Majidi
2016-09-01
Full Text Available Background: Chitosan is unbranched polysaccharide composed of D-glucosamine and N-acetyl-D-glucosamine. Chitosan, derived from shrimp shell, has broad antimicrobial properties against Gram-negative, Gram-positive bacteria and fungi. Methods: Chitosan was extracted from shrimp shell and studied for cell entrapment and anti-bacterial properties. The hydrogel chitosan was used as the beads for cell entrapment and chitosan beads were designed to deliver cells and nutrients. These data confirmed with flow cytometric analyses. Results: Experimental results exhibited that internal diffusion through the chitosan matrix was the main mechanism for whole gelation by TPP (Tri-polyphosphate. The minimum inhibitory concentration (MIC for chitosan against Staphylococcus aureus and Escherichia coli was 16 and 32 μg/ml respectively. Conclusion: Despite the antimicrobial properties of chitosan, trapped bacteria in the gel network were alive and were chelated indicating that their access to the outside was limited.
The interaction of bacterial magnetosomes and human liver cancer cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Wang, Pingping, E-mail: wangpp@mail.iee.ac.cn [Beijing Key Laboratory of Bioelectromagnetism, Institute of Electrical Engineering, Chinese Academy of Sciences, Beijing 100190 (China); Chen, Chuanfang [Beijing Key Laboratory of Bioelectromagnetism, Institute of Electrical Engineering, Chinese Academy of Sciences, Beijing 100190 (China); Chen, Changyou [Beijing Key Laboratory of Bioelectromagnetism, Institute of Electrical Engineering, Chinese Academy of Sciences, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Li, Yue; Pan, Weidong; Song, Tao [Beijing Key Laboratory of Bioelectromagnetism, Institute of Electrical Engineering, Chinese Academy of Sciences, Beijing 100190 (China)
2017-04-01
As the biogenic magnetic nanomaterial, bacterial magnetic nanoparticles, namely magnetosomes, provide many advantages for potential biomedical applications. As such, interactions among magnetosomes and target cells should be elucidated to develop their bioapplications and evaluate their biocompatibilities. In this study, the interaction of magnetosomes and human liver cancer HepG2 cells was examined. Prussian blue staining revealed numerous stained particles in or on the cells. Intracellular iron concentrations, measured through inductively coupled plasma optical emission spectroscopy, increased with the increasing concentration of the magnetosomes. Transmission electron microscopy images showed that magnetosomes could be internalized in cells, mainly encapsulated in membrane vesicles, such as endosomes and lysosomes, and partly found as free particles in the cytosol. Some of the magnetosomes on cellular surfaces were encapsulated through cell membrane ruffling, which is the initiating process of endocytosis. Applying low temperature treatment and using specific endocytic inhibitors, we validated that macropinocytosis and clathrin-mediated endocytosis were involved in magnetosome uptake by HepG2 cells. Consequently, we revealed the interaction and intrinsic endocytic mechanisms of magnetosomes and HepG2 cells. This study provides a basis for the further research on bacterial magnetosome applications in liver diseases. - Highlights: • Bacterial magnetosomes interact with HepG2 cells in a dose-dependent manner. • Magnetosomes are wrapped by membrane ruffling on cell surface. • Internalized magnetosomes mainly localize in endosomes and lysosomes. • Macropinocytosis and CME are involved in the cellular uptake of magnetosomes.
Directory of Open Access Journals (Sweden)
Kim Suk
2009-12-01
Full Text Available Abstract Background The uptake of abortion-inducing pathogens by trophoblast giant (TG cells is a key event in infectious abortion. However, little is known about phagocytic functions of TG cells against the pathogens. Here we show that heat shock cognate protein 70 (Hsc70 contributes to bacterial uptake by TG cells and the EEVD motif of Hsc70 plays an important role in this. Methods Brucella abortus and Listeria monocytogenes were used as the bacterial antigen in this study. Recombinant proteins containing tetratricopeptide repeat (TPR domains were constructed and confirmation of the binding capacity to Hsc70 was assessed by ELISA. The recombinant TPR proteins were used for investigation of the effect of TPR proteins on bacterial uptake by TG cells and on pregnancy in mice. Results The monoclonal antibody that inhibits bacterial uptake by TG cells reacted with the EEVD motif of Hsc70. Bacterial TPR proteins bound to the C-terminal of Hsc70 through its EEVD motif and this binding inhibited bacterial uptake by TG cells. Infectious abortion was also prevented by blocking the EEVD motif of Hsc70. Conclusions Our results demonstrate that surface located Hsc70 on TG cells mediates the uptake of pathogenic bacteria and proteins containing the TPR domain inhibit the function of Hsc70 by binding to its EEVD motif. These molecules may be useful in the development of methods for preventing infectious abortion.
On the challenges of detecting whole Staphylococcus aureus cells with biosensors.
Templier, V; Roupioz, Y
2017-11-01
Due to the increasing number of nosocomial infections and multidrug-resistant bacterial strains, Staphylococcus aureus is now a major worldwide concern. Rapid detection and characterization of this bacterium has become an important issue for biomedical applications. Biosensors are increasingly appearing as low-cost, easy-to-operate and fast alternatives for rapid detection. In this review, we will introduce the main characteristics of S. aureus and will focus on the interest of biosensors for a faster detection of whole S. aureus cells. In particular, we will review the most promising strategies in the choice of ligand for the design of selective and efficient biosensors. Their specific characteristics as well as their advantages and/or disadvantages will also be commented. © 2017 The Society for Applied Microbiology.
Cell shape can mediate the spatial organization of the bacterial cytoskeleton
Wang, Siyuan; Wingreen, Ned
2013-03-01
The bacterial cytoskeleton guides the synthesis of cell wall and thus regulates cell shape. Since spatial patterning of the bacterial cytoskeleton is critical to the proper control of cell shape, it is important to ask how the cytoskeleton spatially self-organizes in the first place. In this work, we develop a quantitative model to account for the various spatial patterns adopted by bacterial cytoskeletal proteins, especially the orientation and length of cytoskeletal filaments such as FtsZ and MreB in rod-shaped cells. We show that the combined mechanical energy of membrane bending, membrane pinning, and filament bending of a membrane-attached cytoskeletal filament can be sufficient to prescribe orientation, e.g. circumferential for FtsZ or helical for MreB, with the accuracy of orientation increasing with the length of the cytoskeletal filament. Moreover, the mechanical energy can compete with the chemical energy of cytoskeletal polymerization to regulate filament length. Notably, we predict a conformational transition with increasing polymer length from smoothly curved to end-bent polymers. Finally, the mechanical energy also results in a mutual attraction among polymers on the same membrane, which could facilitate tight polymer spacing or bundling. The predictions of the model can be verified through genetic, microscopic, and microfluidic approaches.
Morphology, Growth, and Size Limit of Bacterial Cells
Jiang, Hongyuan; Sun, Sean X.
2010-07-01
Bacterial cells utilize a living peptidoglycan network (PG) to separate the cell interior from the surroundings. The shape of the cell is controlled by PG synthesis and cytoskeletal proteins that form bundles and filaments underneath the cell wall. The PG layer also resists turgor pressure and protects the cell from osmotic shock. We argue that mechanical influences alter the chemical equilibrium of the reversible PG assembly and determine the cell shape and cell size. Using a mechanochemical approach, we show that the cell shape can be regarded as a steady state of a growing network under the influence of turgor pressure and mechanical stress. Using simple elastic models, we predict the size of common spherical and rodlike bacteria. The influence of cytoskeletal bundles such as crescentin and MreB are discussed within the context of our model.
Utility of the serum C-reactive protein for detection of occult bacterial infection in children.
Isaacman, Daniel J; Burke, Bonnie L
2002-09-01
To assess the utility of serum C-reactive protein (CRP) as a screen for occult bacterial infection in children. Febrile children ages 3 to 36 months who visited an urban children's hospital emergency department and received a complete blood cell count and blood culture as part of their evaluation were prospectively enrolled from February 2, 2000, through May 30, 2001. Informed consent was obtained for the withdrawal of an additional 1-mL aliquot of blood for use in CRP evaluation. Logistic regression and receiver operator characteristic (ROC) curves were modeled for each predictor to identify optimal test values, and were compared using likelihood ratio tests. Two hundred fifty-six patients were included in the analysis, with a median age of 15.3 months (range, 3.1-35.2 months) and median temperature at triage 40.0 degrees C (range, 39.0 degrees C-41.3 degrees C). Twenty-nine (11.3%) cases of occult bacterial infection (OBI) were identified, including 17 cases of pneumonia, 9 cases of urinary tract infection, and 3 cases of bacteremia. The median white blood cell count in this data set was 12.9 x 10(3)/ micro L [corrected] (range, 3.6-39.1 x10(3)/ micro L) [corrected], the median absolute neutrophil count (ANC) was 7.12 x 10(3)/L [corrected] (range, 0.56-28.16 x10(3)/L) [corrected], and the median CRP level was 1.7 mg/dL (range, 0.2-43.3 mg/dL). The optimal cut-off point for CRP in this data set (4.4 mg/dL) achieved a sensitivity of 63% and a specificity of 81% for detection of OBI in this population. Comparing models using cut-off values from individual laboratory predictors (ANC, white blood cell count, and CRP) that maximized sensitivity and specificity revealed that a model using an ANC of 10.6 x10(3)/L [corrected] (sensitivity, 69%; specificity, 79%) was the best predictive model. Adding CRP to the model insignificantly increased sensitivity to 79%, while significantly decreasing specificity to 50%. Active monitoring of emergency department blood cultures
Energy Technology Data Exchange (ETDEWEB)
Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca
2008-07-15
Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.
Detection of antibiotic resistance in clinical bacterial strains from pets
Poeta, P.; Rodrigues, J.
2008-01-01
The identification of different bacterial strains and the occurrence of antibiotic resistance were investigated in several infection processes of pets as skin abscess with purulent discharge, bronco alveolar fluid, earwax, urine, mammary, and eye fluid. Streptococcus spp. and Staphylococcus spp. were the most detected in the different samples. A high frequency of antimicrobial resistance has been observed and this could reflect the wide use of antimicrobials in pets, making the effectiveness ...
Directory of Open Access Journals (Sweden)
In Jeong Kang
2016-12-01
Full Text Available Burkholderia glumae (bacterial grain rot, Xanthomonas oryzae pv. oryzae (bacterial leaf blight, and Acidovorax avenae subsp. avenae (bacterial brown stripe are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.
Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi
2016-12-01
Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae , and transposase A gene sequence for X. oryzae pv. oryzae , three sets of primers had been designed to produce 402 bp for B. glumae , 490 bp for X. oryzae , and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.
Misra, Hari S; Maurya, Ganesh K; Chaudhary, Reema; Misra, Chitra S
2018-03-01
Cell division and genome segregation are mutually interdependent processes, which are tightly linked with bacterial multiplication. Mechanisms underlying cell division and the cellular machinery involved are largely conserved across bacteria. Segregation of genome elements on the other hand, follows different pathways depending upon its type and the functional components encoded on these elements. Small molecules, that are known to inhibit cell division and/or resolution of intertwined circular chromosome and maintenace of DNA topology have earlier been tested as antibacterial agents. The utility of such drugs in controlling bacterial infections has witnessed only partial success, possibly due to functional redundancy associated with targeted components. However, in due course, literature has grown with newer information. This review has brought forth some recent findings on bacterial cell division with special emphasis on crosstalk between cell division and genome segregation that could be explored as novel targets in drug development. Copyright © 2018 Elsevier GmbH. All rights reserved.
Berchebru, Laurent; Rameil, Pascal; Gaudin, Jean-Christophe; Gausson, Sabrina; Larigauderie, Guilhem; Pujol, Céline; Morel, Yannick; Ramisse, Vincent
2014-10-01
Test and evaluation of engineered biothreat agent detection systems ("biodetectors") are a challenging task for government agencies and industries involved in biosecurity and biodefense programs. In addition to user friendly features, biodetectors need to perform both highly sensitive and specific detection, and must not produce excessive false alerts. In fact, the atmosphere displays a number of variables such as airborne bacterial content that can interfere with the detection process, thus impeding comparative tests when carried out at different times or places. To overcome these bacterial air content fluctuations, a standardized reagent bacterial mixture (SRBM), consisting in a collection of selected cultivable environmental species that are prevalent in temperate climate bioaerosols, was designed to generate a stable, reproducible, and easy to use surrogate of bioaerosol sample. The rationale, design, and production process are reported. The results showed that 8.59; CI 95%: 8.46-8.72 log cfu distributed into vials underwent a 0.95; CI 95%: 0.65-1.26 log viability decay after dehydration and subsequent reconstitution, thus advantageously mimicking a natural bioaerosol sample which is typically composed of cultivable and uncultivable particles. Dehydrated SRBM was stable for more than 12months at 4°C and allowed the reconstitution of a dead/live cells aqueous suspension that is stable for 96h at +4°C, according to plate counts. Specific detection of a simulating biothreat agent (e.g. Bacillus atrophaeus) by immuno-magnetic or PCR assays did not display any significant loss of sensitivity, false negative or positive results in the presence of SRBM. This work provides guidance on testing and evaluating detection devices, and may contribute to the establishment of suitable standards and normalized procedures. Copyright © 2014 Elsevier B.V. All rights reserved.
Tu, Qiang; Yin, Jia; Fu, Jun; Herrmann, Jennifer; Li, Yuezhong; Yin, Yulong; Stewart, A Francis; Müller, Rolf; Zhang, Youming
2016-04-20
Bacterial competent cells are essential for cloning, construction of DNA libraries, and mutagenesis in every molecular biology laboratory. Among various transformation methods, electroporation is found to own the best transformation efficiency. Previous electroporation methods are based on washing and electroporating the bacterial cells in ice-cold condition that make them fragile and prone to death. Here we present simple temperature shift based methods that improve DNA transformation and recombineering efficiency in E. coli and several other gram-negative bacteria thereby economizing time and cost. Increased transformation efficiency of large DNA molecules is a significant advantage that might facilitate the cloning of large fragments from genomic DNA preparations and metagenomics samples.
SuperSegger: robust image segmentation, analysis and lineage tracking of bacterial cells.
Stylianidou, Stella; Brennan, Connor; Nissen, Silas B; Kuwada, Nathan J; Wiggins, Paul A
2016-11-01
Many quantitative cell biology questions require fast yet reliable automated image segmentation to identify and link cells from frame-to-frame, and characterize the cell morphology and fluorescence. We present SuperSegger, an automated MATLAB-based image processing package well-suited to quantitative analysis of high-throughput live-cell fluorescence microscopy of bacterial cells. SuperSegger incorporates machine-learning algorithms to optimize cellular boundaries and automated error resolution to reliably link cells from frame-to-frame. Unlike existing packages, it can reliably segment microcolonies with many cells, facilitating the analysis of cell-cycle dynamics in bacteria as well as cell-contact mediated phenomena. This package has a range of built-in capabilities for characterizing bacterial cells, including the identification of cell division events, mother, daughter and neighbouring cells, and computing statistics on cellular fluorescence, the location and intensity of fluorescent foci. SuperSegger provides a variety of postprocessing data visualization tools for single cell and population level analysis, such as histograms, kymographs, frame mosaics, movies and consensus images. Finally, we demonstrate the power of the package by analyzing lag phase growth with single cell resolution. © 2016 John Wiley & Sons Ltd.
Pönisch, Wolfram; Weber, Christoph A.; Juckeland, Guido; Biais, Nicolas; Zaburdaev, Vasily
2017-01-01
Neisseria gonorrhoeae is the causative agent of one of the most common sexually transmitted diseases, gonorrhea. Over the past two decades there has been an alarming increase of reported gonorrhea cases where the bacteria were resistant to the most commonly used antibiotics thus prompting for alternative antimicrobial treatment strategies. The crucial step in this and many other bacterial infections is the formation of microcolonies, agglomerates consisting of up to several thousands of cells. The attachment and motility of cells on solid substrates as well as the cell-cell interactions are primarily mediated by type IV pili, long polymeric filaments protruding from the surface of cells. While the crucial role of pili in the assembly of microcolonies has been well recognized, the exact mechanisms of how they govern the formation and dynamics of microcolonies are still poorly understood. Here, we present a computational model of individual cells with explicit pili dynamics, force generation and pili-pili interactions. We employ the model to study a wide range of biological processes, such as the motility of individual cells on a surface, the heterogeneous cell motility within the large cell aggregates, and the merging dynamics and the self-assembly of microcolonies. The results of numerical simulations highlight the central role of pili generated forces in the formation of bacterial colonies and are in agreement with the available experimental observations. The model can quantify the behavior of multicellular bacterial colonies on biologically relevant temporal and spatial scales and can be easily adjusted to include the geometry and pili characteristics of various bacterial species. Ultimately, the combination of the microbiological experimental approach with the in silico model of bacterial colonies might provide new qualitative and quantitative insights on the development of bacterial infections and thus pave the way to new antimicrobial treatments.
In situ probing the interior of single bacterial cells at nanometer scale
International Nuclear Information System (INIS)
Liu, Boyin; Wah Ng, Tuck; Fu, Jing; Hemayet Uddin, Md; Paterson, David L; Velkov, Tony; Li, Jian
2014-01-01
We report a novel approach to probe the interior of single bacterial cells at nanometre resolution by combining focused ion beam (FIB) and atomic force microscopy (AFM). After removing layers of pre-defined thickness in the order of 100 nm on the target bacterial cells with FIB milling, AFM of different modes can be employed to probe the cellular interior under both ambient and aqueous environments. Our initial investigations focused on the surface topology induced by FIB milling and the hydration effects on AFM measurements, followed by assessment of the sample protocols. With fine-tuning of the process parameters, in situ AFM probing beneath the bacterial cell wall was achieved for the first time. We further demonstrate the proposed method by performing a spatial mapping of intracellular elasticity and chemistry of the multi-drug resistant strain Klebsiella pneumoniae cells prior to and after it was exposed to the ‘last-line’ antibiotic polymyxin B. Our results revealed increased stiffness occurring in both surface and interior regions of the treated cells, suggesting loss of integrity of the outer membrane from polymyxin treatments. In addition, the hydrophobicity measurement using a functionalized AFM tip was able to highlight the evident hydrophobic portion of the cell such as the regions containing cell membrane. We expect that the proposed FIB–AFM platform will help in gaining deeper insights of bacteria–drug interactions to develop potential strategies for combating multi-drug resistance. (paper)
ARCURI, P.B.; THONNEY, M.L.; SCHOFIELD, P.; PELL, A.N.
2003-01-01
In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/...
In-vitro analysis of APA microcapsules for oral delivery of live bacterial cells.
Chen, H; Ouyang, W; Jones, M; Haque, T; Lawuyi, B; Prakash, S
2005-08-01
Oral administration of microcapsules containing live bacterial cells has potential as an alternative therapy for several diseases. This article evaluates the suitability of the alginate-poly-L-lysine-alginate (APA) microcapsules for oral delivery of live bacterial cells, in-vitro, using a dynamic simulated human gastro-intestinal (GI) model. Results showed that the APA microcapsules were morphologically stable in the simulated stomach conditions, but did not retain their structural integrity after a 3-day exposure in simulated human GI media. The microbial populations of the tested bacterial cells and the activities of the tested enzymes in the simulated human GI suspension were not substantially altered by the presence of the APA microcapsules, suggesting that there were no significant adverse effects of oral administration of the APA microcapsules on the flora of the human gastrointestinal tract. When the APA microcapsules containing Lactobacillus plantarum 80 (LP80) were challenged in the simulated gastric medium (pH = 2.0), 80.0% of the encapsulated cells remained viable after a 5-min incubation; however, the viability decreased considerably (8.3%) after 15 min and dropped to 2.6% after 30 min and lower than 0.2% after 60 min, indicating the limitations of the currently obtainable APA membrane for oral delivery of live bacteria. Further in-vivo studies are required before conclusions can be made concerning the inadequacy of APA microcapsules for oral delivery of live bacterial cells.
Directory of Open Access Journals (Sweden)
Maria Mallén-Alberdi
2016-03-01
Full Text Available Impedance-based biosensors for bacterial detection offer a rapid and cost-effective alternative to conventional techniques that are time-consuming and require specialized equipment and trained users. In this work, a new bacteria detection scheme is presented based on impedance measurements with antibody-modified polysilicon interdigitated electrodes (3 μm pitch, IDEs. The detection approach was carried out taking advantage of the E. coli structure which, in electrical terms, is constituted by two insulating cell membranes that separate a conductive cytoplasmatic medium and a more conductive periplasm. Impedance detection of bacteria is usually analyzed using electrical equivalent circuit models that show limitations for the interpretation of such complex cell structure. Here, a differential impedance spectrum representation is used to study the unique fingerprint that arises when bacteria attach to the surface of IDEs. That fingerprint shows the dual electrical behavior, insulating and conductive, at different frequency ranges. In parallel, finite-element simulations of this system using a three-shell bacteria model are performed to explain such phenomena. Overall, a new approach to detect bacteria is proposed that also enables to differentiate viable bacteria from other components non-specifically attached to the IDE surface by just detecting their spectral fingerprints. Keywords: Impedance spectroscopy, Bacterial detection, Interdigitated electrodes, Label-free detection, Immuno-detection, E. coli O157:H7
Flanagan, Judith Louise; Khandekar, Neeta; Zhu, Hua; Watanabe, Keizo; Markoulli, Maria; Flanagan, John Terence; Papas, Eric
2016-02-01
We sought to determine the relative lipase production of a range of ocular bacterial isolates and to assess the efficacy of glycerol monolaurate (GML) in inhibiting this lipase production in high lipase-producing bacteria without affecting bacterial cell growth. Staphylococcus aureus,Staphylococcus epidermidis,Propionibacterium acnes, and Corynebacterium spp. were inoculated at a density of 10(6)/mL in varying concentrations of GML up to 25 μg/mL for 24 hours at 37 °C with constant shaking. Bacterial suspensions were centrifuged, bacterial cell density was determined, and production of bacterial lipase was quantified using a commercial lipase assay kit. Staphylococcus spp. produced high levels of lipase activity compared with P. acnes and Corynebacterium spp. GML inhibited lipase production by Staphylococcal spp. in a dose-dependent manner, with S. epidermidis lipase production consistently more sensitive to GML than S. aureus. Glycerol monolaurate showed significant (P < 0.05) lipase inhibition above concentrations of 15 μg/mL in S. aureus and was not cytotoxic up to 25 μg/mL. For S. epidermidis, GML showed significant (P < 0.05) lipase inhibition above 7.5 μg/mL. Lipase activity varied between species and between strains. Staphylococcal spp. produced higher lipase activity compared with P. acnes and Corynebacterium spp. Glycerol monolaurate inhibited lipase production by S. aureus and S. epidermidis at concentrations that did not adversely affect bacterial cell growth. GML can be used to inhibit ocular bacterial lipase production without proving detrimental to commensal bacteria viability.
Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan
2017-01-01
To measure the role of enterovirus detection in cerebrospinal fluid compared with the Bacterial Meningitis Score in children with meningitis. A retrospective cohort based on analysis of medical records of pediatric patients diagnosed as meningitis, seen at a private and tertiary hospital in São Paulo, Brazil, between 2011 and 2014. Excluded were patients with critical illness, purpura, ventricular shunt or recent neurosurgery, immunosuppression, concomitant bacterial infection requiring parenteral antibiotic therapy, and those who received antibiotics 72 hours before lumbar puncture. The study included 503 patients. Sixty-four patients were excluded and 94 were not submitted to all tests for analysis. Of the remaining 345 patients, 7 were in the Bacterial Meningitis Group and 338 in the Aseptic Meningitis Group. There was no statistical difference between the groups. In the Bacterial Meningitis Score analysis, of the 338 patients with possible aseptic meningitis (negative cultures), 121 of them had one or more points in the Bacterial Meningitis Score, with sensitivity of 100%, specificity of 64.2%, and negative predictive value of 100%. Of the 121 patients with positive Bacterial Meningitis Score, 71% (86 patients) had a positive enterovirus detection in cerebrospinal fluid. Enterovirus detection in cerebrospinal fluid was effective to differentiate bacterial from viral meningitis. When the test was analyzed together with the Bacterial Meningitis Score, specificity was higher when compared to Bacterial Meningitis Score alone. Avaliar o papel da pesquisa de enterovírus no líquido cefalorraquidiano em comparação com o Escore de Meningite Bacteriana em crianças com meningite. Coorte retrospectiva, realizada pela análise de prontuários, incluindo pacientes pediátricos, com diagnóstico de meningite e atendidos em um hospital privado e terciário, localizado em São Paulo, entre 2011 e 2014. Foram excluídos os pacientes com doença crítica, púrpura, deriva
Estimating Bacterial and Cellular Load in FCFM Imaging
Directory of Open Access Journals (Sweden)
Sohan Seth
2018-01-01
Full Text Available We address the task of estimating bacterial and cellular load in the human distal lung with fibered confocal fluorescence microscopy (FCFM. In pulmonary FCFM some cells can display autofluorescence, and they appear as disc like objects in the FCFM images, whereas bacteria, although not autofluorescent, appear as bright blinking dots when exposed to a targeted smartprobe. Estimating bacterial and cellular load becomes a challenging task due to the presence of background from autofluorescent human lung tissues, i.e., elastin, and imaging artifacts from motion etc. We create a database of annotated images for both these tasks where bacteria and cells were annotated, and use these databases for supervised learning. We extract image patches around each pixel as features, and train a classifier to predict if a bacterium or cell is present at that pixel. We apply our approach on two datasets for detecting bacteria and cells respectively. For the bacteria dataset, we show that the estimated bacterial load increases after introducing the targeted smartprobe in the presence of bacteria. For the cell dataset, we show that the estimated cellular load agrees with a clinician’s assessment.
Bacterial identification and subtyping using DNA microarray and DNA sequencing.
Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D
2012-01-01
The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.
Nonmalignant T cells stimulate growth of T-cell lymphoma cells in the presence of bacterial toxins
DEFF Research Database (Denmark)
Woetmann, Anders; Lovato, Paola; Eriksen, Karsten W
2007-01-01
Bacterial toxins including staphylococcal enterotoxins (SEs) have been implicated in the pathogenesis of cutaneous T-cell lymphomas (CTCLs). Here, we investigate SE-mediated interactions between nonmalignant T cells and malignant T-cell lines established from skin and blood of CTCL patients....... The malignant CTCL cells express MHC class II molecules that are high-affinity receptors for SE. Although treatment with SE has no direct effect on the growth of the malignant CTCL cells, the SE-treated CTCL cells induce vigorous proliferation of the SE-responsive nonmalignant T cells. In turn, the nonmalignant...... T cells enhance proliferation of the malignant cells in an SE- and MHC class II-dependent manner. Furthermore, SE and, in addition, alloantigen presentation by malignant CTCL cells to irradiated nonmalignant CD4(+) T-cell lines also enhance proliferation of the malignant cells. The growth...
Bacterial Urease and its Role in Long-Lasting Human Diseases
Konieczna, Iwona; Żarnowiec, Paulina; Kwinkowski, Marek; Kolesińska, Beata; Frączyk, Justyna; Kamiński, Zbigniew; Kaca, Wiesław
2012-01-01
Urease is a virulence factor found in various pathogenic bacteria. It is essential in colonization of a host organism and in maintenance of bacterial cells in tissues. Due to its enzymatic activity, urease has a toxic effect on human cells. The presence of ureolytic activity is an important marker of a number of bacterial infections. Urease is also an immunogenic protein and is recognized by antibodies present in human sera. The presence of such antibodies is connected with progress of several long-lasting diseases, like rheumatoid arthritis, atherosclerosis or urinary tract infections. In bacterial ureases, motives with a sequence and/or structure similar to human proteins may occur. This phenomenon, known as molecular mimicry, leads to the appearance of autoantibodies, which take part in host molecules destruction. Detection of antibodies-binding motives (epitopes) in bacterial proteins is a complex process. However, organic chemistry tools, such as synthetic peptide libraries, are helpful in both, epitope mapping as well as in serologic investigations. In this review, we present a synthetic report on a molecular organization of bacterial ureases - genetic as well as structural. We characterize methods used in detecting urease and ureolytic activity, including techniques applied in disease diagnostic processes and in chemical synthesis of urease epitopes. The review also provides a summary of knowledge about a toxic effect of bacterial ureases on human body and about occurrence of anti-urease antibodies in long-lasting diseases. PMID:23305365
Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M
2018-04-01
Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was
Energy Technology Data Exchange (ETDEWEB)
Van Der Hofstadt, M. [Institut de Bioenginyeria de Catalunya (IBEC), C/ Baldiri i Reixac 11-15, 08028 Barcelona (Spain); Hüttener, M.; Juárez, A. [Institut de Bioenginyeria de Catalunya (IBEC), C/ Baldiri i Reixac 11-15, 08028 Barcelona (Spain); Departament de Microbiologia, Universitat de Barcelona, Avinguda Diagonal 645, 08028 Barcelona (Spain); Gomila, G., E-mail: ggomila@ibecbarcelona.eu [Institut de Bioenginyeria de Catalunya (IBEC), C/ Baldiri i Reixac 11-15, 08028 Barcelona (Spain); Departament d' Electronica, Universitat de Barcelona, C/ Marti i Franqués 1, 08028 Barcelona (Spain)
2015-07-15
With the use of the atomic force microscope (AFM), the Nanomicrobiology field has advanced drastically. Due to the complexity of imaging living bacterial processes in their natural growing environments, improvements have come to a standstill. Here we show the in situ nanoscale imaging of the growth and division of single bacterial cells on planar substrates with the atomic force microscope. To achieve this, we minimized the lateral shear forces responsible for the detachment of weakly adsorbed bacteria on planar substrates with the use of the so called dynamic jumping mode with very soft cantilever probes. With this approach, gentle imaging conditions can be maintained for long periods of time, enabling the continuous imaging of the bacterial cell growth and division, even on planar substrates. Present results offer the possibility to observe living processes of untrapped bacteria weakly attached to planar substrates. - Highlights: • Gelatine coatings used to weakly attach bacterial cells onto planar substrates. • Use of the dynamic jumping mode as a non-perturbing bacterial imaging mode. • Nanoscale resolution imaging of unperturbed single living bacterial cells. • Growth and division of single bacteria cells on planar substrates observed.
DEFF Research Database (Denmark)
Ahmed, Shakil
Due to an increased public concern for food safety and quality, food processing industries have an urgent need for fast and reliable contaminant detection technologies. Conventional pathogen detection methods are time consuming, cost intensive, require skilled laboratory workers and are inappropr...... and detect pathogens in food, feed or beverage industries in real-time and has the potential to offer significant advantages compared to conventional systems.......Due to an increased public concern for food safety and quality, food processing industries have an urgent need for fast and reliable contaminant detection technologies. Conventional pathogen detection methods are time consuming, cost intensive, require skilled laboratory workers...... diacetate (CFDA) was used to evaluate the viability of the cell. Under final optimized condition, the developed method showed 98 % capture efficiency towards the specific antigen Salmonella Typhimurium and very low (target bacterial strains. Subsequently, IMS was implemented...
Apfel, C M; Evers, S; Hubschwerlen, C; Pirson, W; Page, M G; Keck, W
2001-04-01
An assay was developed to determine the activity of peptide deformylase (PDF) inhibitors under conditions as close as possible to the physiological situation. The assay principle is the detection of N-terminal [35S]methionine labeling of a protein that contains no internal methionine. If PDF is active, the deformylation of the methionine renders the peptide a substrate for methionine aminopeptidase, resulting in the removal of the N-terminal methionine label. In the presence of a PDF inhibitor, the deformylation is blocked so that the N-formylated peptide is not processed and the label is detected. Using this assay, it is possible to determine the PDF activity under near-physiological conditions in a cell-free transcription-translation system as well as in intact bacterial cells.
Jinadasa, Rasika N; Bloom, Stephen E; Weiss, Robert S; Duhamel, Gerald E
2011-07-01
Cytolethal distending toxin (CDT) is a heterotrimeric AB-type genotoxin produced by several clinically important Gram-negative mucocutaneous bacterial pathogens. Irrespective of the bacterial species of origin, CDT causes characteristic and irreversible cell cycle arrest and apoptosis in a broad range of cultured mammalian cell lineages. The active subunit CdtB has structural homology with the phosphodiesterase family of enzymes including mammalian DNase I, and alone is necessary and sufficient to account for cellular toxicity. Indeed, mammalian cells treated with CDT initiate a DNA damage response similar to that elicited by ionizing radiation-induced DNA double strand breaks resulting in cell cycle arrest and apoptosis. The mechanism of CDT-induced apoptosis remains incompletely understood, but appears to involve both p53-dependent and -independent pathways. While epithelial, endothelial and fibroblast cell lines respond to CDT by undergoing arrest of cell cycle progression resulting in nuclear and cytoplasmic distension that precedes apoptotic cell death, cells of haematopoietic origin display rapid apoptosis following a brief period of cell cycle arrest. In this review, the ecology of pathogens producing CDT, the molecular biology of bacterial CDT and the molecular mechanisms of CDT-induced cytotoxicity are critically appraised. Understanding the contribution of a broadly conserved bacterial genotoxin that blocks progression of the mammalian cell cycle, ultimately causing cell death, should assist with elucidating disease mechanisms for these important pathogens.
The SOS chromotest: bacterial cells to detect and characterize genotoxic products and radiations
International Nuclear Information System (INIS)
Quillardet, P.; Hofnung, M.
1994-01-01
The advanced knowledge we have on the bacterium Escherichia coli has facilitated the development of the colorimetric and fast assay, the SOS chromotest, which involves a single tester strain and gives a qualitative and a quantitative assay of the action of a genotoxic agent. We discuss a number of possibilities opened by this test in order to make a genetic diagnosis of the chemical nature of the damages caused in the genetic material by means of a battery of strains which have been genetically modified for that purpose. In order to give an idea of the accuracy of the bacterial responses and of the way they can be used to characterize the DNA damage by a genetic approach, the case of alkylating agents is described in a relatively detailed fashion, and the case of oxidative agents is rapidly mentioned. The sensitivity to ionizing radiation is such that the test is able to detect doses of the order of 1 Gy. We discuss briefly how it could be possible to increase this sensitivity by genetically inactivating repair systems which process the injuries caused by these agents, and how the use of a battery of tester strains could also give information on the nature of injuries caused by various types of ionizing radiation. (authors). 39 refs. 4 figs. 1 tab
Potential effect of cationic liposomes on interactions with oral bacterial cells and biofilms.
Sugano, Marika; Morisaki, Hirobumi; Negishi, Yoichi; Endo-Takahashi, Yoko; Kuwata, Hirotaka; Miyazaki, Takashi; Yamamoto, Matsuo
2016-01-01
Although oral infectious diseases have been attributed to bacteria, drug treatments remain ineffective because bacteria and their products exist as biofilms. Cationic liposomes have been suggested to electrostatically interact with the negative charge on the bacterial surface, thereby improving the effects of conventional drug therapies. However, the electrostatic interaction between oral bacteria and cationic liposomes has not yet been examined in detail. The aim of the present study was to examine the behavior of cationic liposomes and Streptococcus mutans in planktonic cells and biofilms. Liposomes with or without cationic lipid were prepared using a reverse-phase evaporation method. The zeta potentials of conventional liposomes (without cationic lipid) and cationic liposomes were -13 and 8 mV, respectively, and both had a mean particle size of approximately 180 nm. We first assessed the interaction between liposomes and planktonic bacterial cells with a flow cytometer. We then used a surface plasmon resonance method to examine the binding of liposomes to biofilms. We confirmed the binding behavior of liposomes with biofilms using confocal laser scanning microscopy. The interactions between cationic liposomes and S. mutans cells and biofilms were stronger than those of conventional liposomes. Microscopic observations revealed that many cationic liposomes interacted with the bacterial mass and penetrated the deep layers of biofilms. In this study, we demonstrated that cationic liposomes had higher affinity not only to oral bacterial cells, but also biofilms than conventional liposomes. This electrostatic interaction may be useful as a potential drug delivery system to biofilms.
Taumer, Christoph; Griesbaum, Lena; Kovacevic, Alen; Soufi, Boumediene; Nalpas, Nicolas C; Macek, Boris
2018-03-29
Increasing number of studies report the relevance of protein Ser/Thr/Tyr phosphorylation in bacterial physiology, yet the analysis of this type of modification in bacteria still presents a considerable challenge. Unlike in eukaryotes, where tens of thousands of phosphorylation events likely occupy more than two thirds of the proteome, the abundance of protein phosphorylation is much lower in bacteria. Even the state-of-the-art phosphopeptide enrichment protocols fail to remove the high background of abundant unmodified peptides, leading to low signal intensity and undersampling of phosphopeptide precursor ions in consecutive data-dependent MS runs. Consequently, large-scale bacterial phosphoproteomic datasets often suffer from poor reproducibility and a high number of missing values. Here we explore the application of parallel reaction monitoring (PRM) on a Q Exactive mass spectrometer in bacterial phosphoproteome analysis, focusing especially on run-to-run sampling reproducibility. In multiple measurements of identical phosphopeptide-enriched samples, we show that PRM outperforms data-dependent acquisition (DDA) in terms of detection frequency, reaching almost complete sampling efficiency, compared to 20% in DDA. We observe a similar trend over multiple heterogeneous phosphopeptide-enriched samples and conclude that PRM shows a great promise in bacterial phosphoproteomics analyses where reproducible detection and quantification of a relatively small set of phosphopeptides is desired. Bacterial phosphorylated peptides occur in low abundance compared to their unmodified counterparts, and are therefore rarely reproducibly detected in shotgun (DDA) proteomics measurements. Here we show that parallel reaction monitoring complements DDA analyses and makes detection of known, targeted phosphopeptides more reproducible. This will be of significance in replicated MS measurements that have a goal to reproducibly detect and quantify phosphopeptides of interest. Copyright
Development of a Premature Stop Codon-detection method based on a bacterial two-hybrid system
Directory of Open Access Journals (Sweden)
Mayorga Luis S
2006-09-01
Full Text Available Abstract Background The detection of Premature Stop Codons (PSCs in human genes is very useful for the genetic diagnosis of different hereditary cancers, e.g. Familial Breast Cancer and Hereditary Non-Polyposis Colorectal Cancer (HNPCC. The products of these PSCs are truncated proteins, detectable in vitro by the Protein Truncation Test and in vivo by using the living translation machinery of yeast or bacteria. These living strategies are based on the construction of recombinant plasmids where the human sequence of interest is inserted upstream of a reporter gene. Although simple, these assays have their limitations. The yeast system requires extensive work to enhance its specificity, and the bacterial systems yield many false results due to translation re-initiation events occurring post PSCs. Our aim was to design a recombinant plasmid useful for detecting PSCs in human genes and resistant to bacterial translation re-initiation interferences. Results A functional recombinant plasmid (pREAL was designed based on a bacterial two-hybrid system. In our design, the in vivo translation of fused fragments of the Bordetella pertussis adenylate cyclase triggers the production of cAMP giving rise to a selectable bacterial phenotype. When a gene of interest is inserted between the two fragments, any PSC inhibits the enzymatic activity of the product, and translation re-initiation events post-PSC yield separated inactive fragments. We demonstrated that the system can accurately detect PSCs in human genes by inserting mutated fragments of the brca1 and msh2 gene. Western Blot assays revealed translation re-initiation events in all the tested colonies, implying that a simpler plasmid would not be resistant to this source of false negative results. The application of the system to a HNPCC family with a nonsense mutation in the msh2 gene correctly diagnosed wild type homozygous and heterozygous patients. Conclusion The developed pREAL is applicable to the
International Nuclear Information System (INIS)
Kamnev, Alexander A.; Tugarova, Anna V.; Antonyuk, Lyudmila P.; Tarantilis, Petros A.; Kulikov, Leonid A.; Perfiliev, Yurii D.; Polissiou, Moschos G.; Gardiner, Philip H.E.
2006-01-01
In biosciences and biotechnology, the expanding application of physicochemical approaches using modern instrumental techniques is an efficient strategy to obtain valuable and often unique information at the molecular level. In this work, we applied a combination of vibrational (Fourier transform infrared (FTIR), FT-Raman) spectroscopic techniques, useful in overall structural and compositional analysis of bacterial cells of the rhizobacterium Azospirillum brasilense, with 57 Co emission Moessbauer spectroscopy (EMS) used for sensitive monitoring of metal binding and further transformations in live bacterial cells. The information obtained, together with ICP-MS analyses for metals taken up by the bacteria, is useful in analysing the impact of the environmental conditions (heavy metal stress) on the bacterial metabolism and some differences in the heavy metal stress-induced behaviour of non-endophytic (Sp7) and facultatively endophytic (Sp245) strains. The results show that, while both strains Sp7 and Sp245 take up noticeable and comparable amounts of heavy metals from the medium (0.12 and 0.13 mg Co, 0.48 and 0.44 mg Cu or 4.2 and 2.1 mg Zn per gram of dry biomass, respectively, at a metal concentration of 0.2 mM in the medium), their metabolic responses differ essentially. Whereas for strain Sp7 the FTIR measurements showed significant accumulation of polyhydroxyalkanoates as storage materials involved in stress endurance, strain Sp245 did not show any major changes in cellular composition. Nevertheless, EMS measurements showed rapid binding of cobalt(II) by live bacterial cells (chemically similar to metal binding by dead bacteria) and its further transformation in the live cells within an hour
Energy Technology Data Exchange (ETDEWEB)
Kamnev, Alexander A. [Laboratory of Biochemistry of Plant-Bacterial Symbioses, Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences, 410049 Saratov (Russian Federation)]. E-mail: aakamnev@ibppm.sgu.ru; Tugarova, Anna V. [Laboratory of Biochemistry of Plant-Bacterial Symbioses, Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences, 410049 Saratov (Russian Federation); Antonyuk, Lyudmila P. [Laboratory of Biochemistry of Plant-Bacterial Symbioses, Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences, 410049 Saratov (Russian Federation); Tarantilis, Petros A. [Laboratory of Chemistry, Department of Science, Agricultural University of Athens, 11855 Athens (Greece); Kulikov, Leonid A. [Laboratory of Nuclear Chemistry Techniques, Department of Radiochemistry, Faculty of Chemistry, M.V. Lomonosov Moscow State University, 119992 Moscow (Russian Federation); Perfiliev, Yurii D. [Laboratory of Nuclear Chemistry Techniques, Department of Radiochemistry, Faculty of Chemistry, M.V. Lomonosov Moscow State University, 119992 Moscow (Russian Federation); Polissiou, Moschos G. [Laboratory of Chemistry, Department of Science, Agricultural University of Athens, 11855 Athens (Greece); Gardiner, Philip H.E. [Division of Chemistry, School of Science and Mathematics, Sheffield Hallam University, Sheffield S1 1WB (United Kingdom)
2006-07-28
In biosciences and biotechnology, the expanding application of physicochemical approaches using modern instrumental techniques is an efficient strategy to obtain valuable and often unique information at the molecular level. In this work, we applied a combination of vibrational (Fourier transform infrared (FTIR), FT-Raman) spectroscopic techniques, useful in overall structural and compositional analysis of bacterial cells of the rhizobacterium Azospirillum brasilense, with {sup 57}Co emission Moessbauer spectroscopy (EMS) used for sensitive monitoring of metal binding and further transformations in live bacterial cells. The information obtained, together with ICP-MS analyses for metals taken up by the bacteria, is useful in analysing the impact of the environmental conditions (heavy metal stress) on the bacterial metabolism and some differences in the heavy metal stress-induced behaviour of non-endophytic (Sp7) and facultatively endophytic (Sp245) strains. The results show that, while both strains Sp7 and Sp245 take up noticeable and comparable amounts of heavy metals from the medium (0.12 and 0.13 mg Co, 0.48 and 0.44 mg Cu or 4.2 and 2.1 mg Zn per gram of dry biomass, respectively, at a metal concentration of 0.2 mM in the medium), their metabolic responses differ essentially. Whereas for strain Sp7 the FTIR measurements showed significant accumulation of polyhydroxyalkanoates as storage materials involved in stress endurance, strain Sp245 did not show any major changes in cellular composition. Nevertheless, EMS measurements showed rapid binding of cobalt(II) by live bacterial cells (chemically similar to metal binding by dead bacteria) and its further transformation in the live cells within an hour.
Rapid detection of bacterial contamination in cell or tissue cultures based on Raman spectroscopy
Bolwien, Carsten; Sulz, Gerd; Becker, Sebastian; Thielecke, Hagen; Mertsching, Heike; Koch, Steffen
2008-02-01
Monitoring the sterility of cell or tissue cultures is an essential task, particularly in the fields of regenerative medicine and tissue engineering when implanting cells into the human body. We present a system based on a commercially available microscope equipped with a microfluidic cell that prepares the particles found in the solution for analysis, a Raman-spectrometer attachment optimized for non-destructive, rapid recording of Raman spectra, and a data acquisition and analysis tool for identification of the particles. In contrast to conventional sterility testing in which samples are incubated over weeks, our system is able to analyze milliliters of supernatant or cell suspension within hours by filtering relevant particles and placing them on a Raman-friendly substrate in the microfluidic cell. Identification of critical particles via microscopic imaging and subsequent image analysis is carried out before micro-Raman analysis of those particles is then carried out with an excitation wavelength of 785 nm. The potential of this setup is demonstrated by results of artificial contamination of samples with a pool of bacteria, fungi, and spores: single-channel spectra of the critical particles are automatically baseline-corrected without using background data and classified via hierarchical cluster analysis, showing great promise for accurate and rapid detection and identification of contaminants.
The influence of radiation on bacterial cells and their proteolytic properties
International Nuclear Information System (INIS)
Szulc, M.; Stefaniakowa, A.; Stanczak, B.; Peconek, J.
1980-01-01
The suspension of bacterial cells and their spores were exposed to X rays in the environment with and without protein. The doses of radiation ranged from 1 to 100 Gy and in case of spores of B. subtilis from 50 to 1000 Gy. It was found that irradiation to Proteus vulgaris, Pseudomonas fluorescens and Ps. aeruginosa caused an inconsiderable decrease of proteolytic properties of the generation originated from irradiated bacteria. Irradiation of B. subtilis spores did not influence the proteolytic activity of bacterial cells derived from the exposed spores. The degree of wasting away of bacteria exposed to the same radiation was higher than the rate of proteolytic properties decrease. The presence of protein in the surroundings had no influence on proteolytic characteristics of new generations. (author)
Directory of Open Access Journals (Sweden)
Nakanishi Koichi
2012-06-01
Full Text Available Abstract Background Despite the availability of conventional devices for making single-cell manipulations, determining the hardness of a single cell remains difficult. Here, we consider the cell to be a linear elastic body and apply Young’s modulus (modulus of elasticity, which is defined as the ratio of the repulsive force (stress in response to the applied strain. In this new method, a scanning probe microscope (SPM is operated with a cantilever in the “contact-and-push” mode, and the cantilever is applied to the cell surface over a set distance (applied strain. Results We determined the hardness of the following bacterial cells: Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and five Bacillus spp. In log phase, these strains had a similar Young’s modulus, but Bacillus spp. spores were significantly harder than the corresponding vegetative cells. There was a positive, linear correlation between the hardness of bacterial spores and heat or ultraviolet (UV resistance. Conclusions Using this technique, the hardness of a single vegetative bacterial cell or spore could be determined based on Young’s modulus. As an application of this technique, we demonstrated that the hardness of individual bacterial spores was directly proportional to heat and UV resistance, which are the conventional measures of physical durability. This technique allows the rapid and direct determination of spore durability and provides a valuable and innovative method for the evaluation of physical properties in the field of microbiology.
The antimicrobial polymer PHMB enters cells and selectively condenses bacterial chromosomes
DEFF Research Database (Denmark)
Chindera, Kantaraja; Mahato, Manohar; Sharma, Ashwani Kumar
2016-01-01
To combat infection and antimicrobial resistance, it is helpful to elucidate drug mechanism(s) of action. Here we examined how the widely used antimicrobial polyhexamethylene biguanide (PHMB) kills bacteria selectively over host cells. Contrary to the accepted model of microbial membrane disrupti...... to bacterial and mammalian cellular DNA and selectively binds and condenses bacterial chromosomes. Because acquired resistance to PHMB has not been reported, selective chromosome condensation provides an unanticipated paradigm for antimicrobial action that may not succumb to resistance....
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
International Nuclear Information System (INIS)
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Energy Technology Data Exchange (ETDEWEB)
Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)
2017-01-15
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Development of a bacterial bioassay for atrazine and cyanuric acid detection
Directory of Open Access Journals (Sweden)
Anna eHUA
2015-03-01
Full Text Available The s-triazine herbicides are compounds which can disseminate into soils and water. Due to their toxic effects on living organisms, their concentrations in drinking water are legislated by WHO recommendations. Here we have developed for the first time, to the best of our knowledge, an alternative method for physicochemical quantification using two bioluminescent bacterial biosensors: E. coli SM003 for cyanuric acid detection and E. coli SM004 for both atrazine and cyanuric acid detection. The concentration of cyanuric acid detection for E. coli SM003 ranges from 7.83 µM to 2.89 mM, and for E. coli SM004 ranges from 0.22 µM to 15 µM. Moreover, atrazine detection by E. coli SM004 ranges from 1.08 µM to 15 µM. According to WHO recommendations, the cyanuric acid detection range is sensitive enough to discriminate between polluted and drinking water. Nevertheless, the detection of atrazine by E. coli SM004 is only applicable for high concentrations of contaminants.
Leydet, Brian F; Liang, Fang-Ting
2013-04-01
There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.
Bacterial actin MreB assembles in complex with cell shape protein RodZ.
van den Ent, Fusinita; Johnson, Christopher M; Persons, Logan; de Boer, Piet; Löwe, Jan
2010-03-17
Bacterial actin homologue MreB is required for cell shape maintenance in most non-spherical bacteria, where it assembles into helical structures just underneath the cytoplasmic membrane. Proper assembly of the actin cytoskeleton requires RodZ, a conserved, bitopic membrane protein that colocalises to MreB and is essential for cell shape determination. Here, we present the first crystal structure of bacterial actin engaged with a natural partner and provide a clear functional significance of the interaction. We show that the cytoplasmic helix-turn-helix motif of Thermotoga maritima RodZ directly interacts with monomeric as well as filamentous MreB and present the crystal structure of the complex. In vitro and in vivo analyses of mutant T. maritima and Escherichia coli RodZ validate the structure and reveal the importance of the MreB-RodZ interaction in the ability of cells to propagate as rods. Furthermore, the results elucidate how the bacterial actin cytoskeleton might be anchored to the membrane to help constrain peptidoglycan synthesis in the periplasm.
Moghtader, Farzaneh; Tomak, Aysel; Zareie, Hadi M; Piskin, Erhan
2018-03-27
This study attemps to develop bacterial detection strategies using bacteriophages and gold nanorods (GNRs) by Raman spectral analysis. Escherichia coli was selected as the target and its specific phage was used as the bioprobe. Target bacteria and phages were propagated/purified by traditional techniques. GNRs were synthesized by using hexadecyltrimethyl ammonium bromide (CTAB) as stabilizer. A two-step detection strategy was applied: Firstly, the target bacteria were interacted with GNRs in suspensions, and then they were dropped onto silica substrates for detection. It was possible to obtain clear surface-enchanced Raman spectroscopy (SERS) peaks of the target bacteria, even without using phages. In the second step, the phage nanoemulsions were droped onto the bacterial-GNRs complexes on those surfaces and time-dependent changes in the Raman spectra were monitored at different time intervals upto 40 min. These results demonstrated that how one can apply phages with plasmonic nanoparticles for detection of pathogenic bacteria very effectively in a quite simple test.
Preparation of Pd/Bacterial Cellulose Hybrid Nanofibers for Dopamine Detection
Directory of Open Access Journals (Sweden)
Dawei Li
2016-05-01
Full Text Available Palladium nanoparticle-bacterial cellulose (PdBC hybrid nanofibers were synthesized by in-situ chemical reduction method. The obtained PdBC nanofibers were characterized by a series of analytical techniques. The results revealed that Pd nanoparticles were evenly dispersed on the surfaces of BC nanofibers. Then, the as-prepared PdBC nanofibers were mixed with laccase (Lac and Nafion to obtain mixture suspension, which was further modified on electrode surface to construct novel biosensing platform. Finally, the prepared electrochemical biosensor was employed to detect dopamine. The analysis result was satisfactory, the sensor showed excellent electrocatalysis towards dopamine with high sensitivity (38.4 µA·mM−1, low detection limit (1.26 µM, and wide linear range (5–167 µM. Moreover, the biosensor also showed good repeatability, reproducibility, selectivity and stability and was successfully used in the detection of dopamine in human urine, thus providing a promising method for dopamine analysis in clinical application.
Hybrid Bacterial Foraging and Particle Swarm Optimization for detecting Bundle Branch Block.
Kora, Padmavathi; Kalva, Sri Ramakrishna
2015-01-01
Abnormal cardiac beat identification is a key process in the detection of heart diseases. Our present study describes a procedure for the detection of left and right bundle branch block (LBBB and RBBB) Electrocardiogram (ECG) patterns. The electrical impulses that control the cardiac beat face difficulty in moving inside the heart. This problem is termed as bundle branch block (BBB). BBB makes it harder for the heart to pump blood effectively through the heart circulatory system. ECG feature extraction is a key process in detecting heart ailments. Our present study comes up with a hybrid method combining two heuristic optimization methods: Bacterial Forging Optimization (BFO) and Particle Swarm Optimization (PSO) for the feature selection of ECG signals. One of the major controlling forces of BFO algorithm is the chemotactic movement of a bacterium that models a test solution. The chemotaxis process of the BFO depends on random search directions which may lead to a delay in achieving the global optimum solution. The hybrid technique: Bacterial Forging-Particle Swarm Optimization (BFPSO) incorporates the concepts from BFO and PSO and it creates individuals in a new generation. This BFPSO method performs local search through the chemotactic movement of BFO and the global search over the entire search domain is accomplished by a PSO operator. The BFPSO feature values are given as the input for the Levenberg-Marquardt Neural Network classifier.
Primo, Emiliano D.; Otero, Lisandro H.; Ruiz, Francisco; Klinke, Sebastián; Giordano, Walter
2018-01-01
The bacterial cell wall, a structural unit of peptidoglycan polymer comprised of glycan strands consisting of a repeating disaccharide motif [N-acetylglucosamine (NAG) and N-acetylmuramylpentapeptide (NAM pentapeptide)], encases bacteria and provides structural integrity and protection. Lysozymes are enzymes that break down the bacterial cell wall…
Modeling base excision repair in Escherichia coli bacterial cells
International Nuclear Information System (INIS)
Belov, O.V.
2011-01-01
A model describing the key processes in Escherichia coli bacterial cells during base excision repair is developed. The mechanism is modeled of damaged base elimination involving formamidopyrimidine DNA glycosylase (the Fpg protein), which possesses several types of activities. The modeling of the transitions between DNA states is based on a stochastic approach to the chemical reaction description
Muir, Elizabeth; Raza, Mansoor; Ellis, Clare; Burnside, Emily; Love, Fiona; Heller, Simon; Elliot, Matthew; Daniell, Esther; Dasgupta, Debayan; Alves, Nuno; Day, Priscilla; Fawcett, James; Keynes, Roger
2017-01-01
There is very little reported in the literature about the relationship between modifications of bacterial proteins and their secretion by mammalian cells that synthesize them. We previously reported that the secretion of the bacterial enzyme Chondroitinase ABC by mammalian cells requires the strategic removal of at least three N-glycosylation sites. The aim of this study was to determine if it is possible to enhance the efficacy of the enzyme as a treatment for spinal cord injury by increasing the quantity of enzyme secreted or by altering its cellular location. To determine if the efficiency of enzyme secretion could be further increased, cells were transfected with constructs encoding the gene for chondroitinase ABC modified for expression by mammalian cells; these contained additional modifications of strategic N-glycosylation sites or alternative signal sequences to direct secretion of the enzyme from the cells. We show that while removal of certain specific N-glycosylation sites enhances enzyme secretion, N-glycosylation of at least two other sites, N-856 and N-773, is essential for both production and secretion of active enzyme. Furthermore, we find that the signal sequence directing secretion also influences the quantity of enzyme secreted, and that this varies widely amongst the cell types tested. Last, we find that replacing the 3'UTR on the cDNA encoding Chondroitinase ABC with that of β-actin is sufficient to target the enzyme to the neuronal growth cone when transfected into neurons. This also enhances neurite outgrowth on an inhibitory substrate. Some intracellular trafficking pathways are adversely affected by cryptic signals present in the bacterial gene sequence, whilst unexpectedly others are required for efficient secretion of the enzyme. Furthermore, targeting chondroitinase to the neuronal growth cone promotes its ability to increase neurite outgrowth on an inhibitory substrate. These findings are timely in view of the renewed prospects for
Directory of Open Access Journals (Sweden)
Elizabeth Muir
Full Text Available There is very little reported in the literature about the relationship between modifications of bacterial proteins and their secretion by mammalian cells that synthesize them. We previously reported that the secretion of the bacterial enzyme Chondroitinase ABC by mammalian cells requires the strategic removal of at least three N-glycosylation sites. The aim of this study was to determine if it is possible to enhance the efficacy of the enzyme as a treatment for spinal cord injury by increasing the quantity of enzyme secreted or by altering its cellular location.To determine if the efficiency of enzyme secretion could be further increased, cells were transfected with constructs encoding the gene for chondroitinase ABC modified for expression by mammalian cells; these contained additional modifications of strategic N-glycosylation sites or alternative signal sequences to direct secretion of the enzyme from the cells. We show that while removal of certain specific N-glycosylation sites enhances enzyme secretion, N-glycosylation of at least two other sites, N-856 and N-773, is essential for both production and secretion of active enzyme. Furthermore, we find that the signal sequence directing secretion also influences the quantity of enzyme secreted, and that this varies widely amongst the cell types tested. Last, we find that replacing the 3'UTR on the cDNA encoding Chondroitinase ABC with that of β-actin is sufficient to target the enzyme to the neuronal growth cone when transfected into neurons. This also enhances neurite outgrowth on an inhibitory substrate.Some intracellular trafficking pathways are adversely affected by cryptic signals present in the bacterial gene sequence, whilst unexpectedly others are required for efficient secretion of the enzyme. Furthermore, targeting chondroitinase to the neuronal growth cone promotes its ability to increase neurite outgrowth on an inhibitory substrate. These findings are timely in view of the renewed
Bacterial toxin-antitoxin gene system as containment control in yeast cells
DEFF Research Database (Denmark)
Kristoffersen, P.; Jensen, G. B.; Gerdes, K.
2000-01-01
The potential of a bacterial toxin-antitoxin gene system for use in containment control in eukaryotes was explored. The Escherichia coli relE and relB genes were expressed in the yeast Saccharomyces cerevisiae, Expression of the relE gene was highly toxic to yeast cells. However, expression...... fermentation processes in which the escape of genetically modified cells would be considered highly risky....
Homogenizing bacterial cell factories: Analysis and engineering of phenotypic heterogeneity.
Binder, Dennis; Drepper, Thomas; Jaeger, Karl-Erich; Delvigne, Frank; Wiechert, Wolfgang; Kohlheyer, Dietrich; Grünberger, Alexander
2017-07-01
In natural habitats, microbes form multispecies communities that commonly face rapidly changing and highly competitive environments. Thus, phenotypic heterogeneity has evolved as an innate and important survival strategy to gain an overall fitness advantage over cohabiting competitors. However, in defined artificial environments such as monocultures in small- to large-scale bioreactors, cell-to-cell variations are presumed to cause reduced production yields as well as process instability. Hence, engineering microbial production toward phenotypic homogeneity is a highly promising approach for synthetic biology and bioprocess optimization. In this review, we discuss recent studies that have unraveled the cell-to-cell heterogeneity observed during bacterial gene expression and metabolite production as well as the molecular mechanisms involved. In addition, current single-cell technologies are briefly reviewed with respect to their applicability in exploring cell-to-cell variations. We highlight emerging strategies and tools to reduce phenotypic heterogeneity in biotechnological expression setups. Here, strain or inducer modifications are combined with cell physiology manipulations to achieve the ultimate goal of equalizing bacterial populations. In this way, the majority of cells can be forced into high productivity, thus reducing less productive subpopulations that tend to consume valuable resources during production. Modifications in uptake systems, inducer molecules or nutrients represent valuable tools for diminishing heterogeneity. Finally, we address the challenge of transferring homogeneously responding cells into large-scale bioprocesses. Environmental heterogeneity originating from extrinsic factors such as stirring speed and pH, oxygen, temperature or nutrient distribution can significantly influence cellular physiology. We conclude that engineering microbial populations toward phenotypic homogeneity is an increasingly important task to take biotechnological
Celik, Nermin; Webb, Chaille T.; Leyton, Denisse L.; Holt, Kathryn E.; Heinz, Eva; Gorrell, Rebecca; Kwok, Terry; Naderer, Thomas; Strugnell, Richard A.; Speed, Terence P.; Teasdale, Rohan D.; Likić, Vladimir A.; Lithgow, Trevor
2012-01-01
Autotransporters are secreted proteins that are assembled into the outer membrane of bacterial cells. The passenger domains of autotransporters are crucial for bacterial pathogenesis, with some remaining attached to the bacterial surface while others are released by proteolysis. An enigma remains as to whether autotransporters should be considered a class of secretion system, or simply a class of substrate with peculiar requirements for their secretion. We sought to establish a sensitive search protocol that could identify and characterize diverse autotransporters from bacterial genome sequence data. The new sequence analysis pipeline identified more than 1500 autotransporter sequences from diverse bacteria, including numerous species of Chlamydiales and Fusobacteria as well as all classes of Proteobacteria. Interrogation of the proteins revealed that there are numerous classes of passenger domains beyond the known proteases, adhesins and esterases. In addition the barrel-domain-a characteristic feature of autotransporters-was found to be composed from seven conserved sequence segments that can be arranged in multiple ways in the tertiary structure of the assembled autotransporter. One of these conserved motifs overlays the targeting information required for autotransporters to reach the outer membrane. Another conserved and diagnostic motif maps to the linker region between the passenger domain and barrel-domain, indicating it as an important feature in the assembly of autotransporters. PMID:22905239
Dynamic laser speckle to detect motile bacterial response of Pseudomonas aeruginosa
International Nuclear Information System (INIS)
Sendra, H; Murialdo, S; Passoni, L
2007-01-01
This proposal deals with the technique for detection of motile response of Pseudomonas aeruginosa using dynamic laser speckle or biospeckle as an alternative method. The study of bacterial displacement plays an essential role in biocatalysts processes and biodegradation. Hence, some biodegrading enzymes are benign catalytic that could be used for the production of industrially useful compounds as well as in wastewater treatments. This work presents an experimental set up and a computational process using frame sequences of dynamic laser speckle as a novel application. The objective was the detection of different levels of motility in bacteria. The encouraging results were achieved through a direct and non invasive observation method of the phenomenon
Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles
2003-01-01
Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032
Disposable bioluminescence-based biosensor for detection of bacterial count in food.
Luo, Jinping; Liu, Xiaohong; Tian, Qing; Yue, Weiwei; Zeng, Jing; Chen, Guangquan; Cai, Xinxia
2009-11-01
A biosensor for rapid detection of bacterial count based on adenosine 5'-triphosphate (ATP) bioluminescence has been developed. The biosensor is composed of a key sensitive element and a photomultiplier tube used as a detector element. The disposable sensitive element consists of a sampler, a cartridge where intracellular ATP is chemically extracted from bacteria, and a microtube where the extracted ATP reacts with the luciferin-luciferase reagent to produce bioluminescence. The bioluminescence signal is transformed into relevant electrical signal by the detector and further measured with a homemade luminometer. Parameters affecting the amount of the extracted ATP, including the types of ATP extractants, the concentrations of ATP extractant, and the relevant neutralizing reagent, were optimized. Under the optimal experimental conditions, the biosensor showed a linear response to standard bacteria in a concentration range from 10(3) to 10(8) colony-forming units (CFU) per milliliter with a correlation coefficient of 0.925 (n=22) within 5min. Moreover, the bacterial count of real food samples obtained by the biosensor correlated well with those by the conventional plate count method. The proposed biosensor, with characteristics of low cost, easy operation, and fast response, provides potential application to rapid evaluation of bacterial contamination in the food industry, environment monitoring, and other fields.
Directory of Open Access Journals (Sweden)
Tanner M Johanns
2010-08-01
Full Text Available The pathogenesis of persistent infection is dictated by the balance between opposing immune activation and suppression signals. Herein, virulent Salmonella was used to explore the role and potential importance of Foxp3-expressing regulatory T cells in dictating the natural progression of persistent bacterial infection. Two distinct phases of persistent Salmonella infection are identified. In the first 3-4 weeks after infection, progressively increasing bacterial burden was associated with delayed effector T cell activation. Reciprocally, at later time points after infection, reductions in bacterial burden were associated with robust effector T cell activation. Using Foxp3(GFP reporter mice for ex vivo isolation of regulatory T cells, we demonstrate that the dichotomy in infection tempo between early and late time points is directly paralleled by drastic changes in Foxp3(+ Treg suppressive potency. In complementary experiments using Foxp3(DTR mice, the significance of these shifts in Treg suppressive potency on infection outcome was verified by enumerating the relative impacts of regulatory T cell ablation on bacterial burden and effector T cell activation at early and late time points during persistent Salmonella infection. Moreover, Treg expression of CTLA-4 directly paralleled changes in suppressive potency, and the relative effects of Treg ablation could be largely recapitulated by CTLA-4 in vivo blockade. Together, these results demonstrate that dynamic regulation of Treg suppressive potency dictates the course of persistent bacterial infection.
Chemical and Enzymatic Strategies for Bacterial and Mammalian Cell Surface Engineering.
Bi, Xiaobao; Yin, Juan; Chen Guanbang, Ashley; Liu, Chuan-Fa
2018-06-07
The cell surface serves important functions such as the regulation of cell-cell and cell-environment interactions. The understanding and manipulation of the cell surface is important for a wide range of fundamental studies of cellular behavior and for biotechnological and medical applications. With the rapid advance of biology, chemistry and materials science, many strategies have been developed for the functionalization of bacterial and mammalian cell surfaces. Here, we review the recent development of chemical and enzymatic approaches to cell surface engineering with particular emphasis on discussing the advantages and limitations of each of these strategies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Heim, Kyle P.; Sullan, Ruby May A.; Crowley, Paula J.; El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Tang, Wenxing; Besingi, Richard; Dufrene, Yves F.; Brady, L. Jeannine
2015-01-01
P1 (antigen I/II) is a sucrose-independent adhesin of Streptococcus mutans whose functional architecture on the cell surface is not fully understood. S. mutans cells subjected to mechanical extraction were significantly diminished in adherence to immobilized salivary agglutinin but remained immunoreactive and were readily aggregated by fluid-phase salivary agglutinin. Bacterial adherence was restored by incubation of postextracted cells with P1 fragments that contain each of the two known adhesive domains. In contrast to untreated cells, glutaraldehyde-treated bacteria gained reactivity with anti-C-terminal monoclonal antibodies (mAbs), whereas epitopes recognized by mAbs against other portions of the molecule were masked. Surface plasmon resonance experiments demonstrated the ability of apical and C-terminal fragments of P1 to interact. Binding of several different anti-P1 mAbs to unfixed cells triggered release of a C-terminal fragment from the bacterial surface, suggesting a novel mechanism of action of certain adherence-inhibiting antibodies. We also used atomic force microscopy-based single molecule force spectroscopy with tips bearing various mAbs to elucidate the spatial organization and orientation of P1 on living bacteria. The similar rupture lengths detected using mAbs against the head and C-terminal regions, which are widely separated in the tertiary structure, suggest a higher order architecture in which these domains are in close proximity on the cell surface. Taken together, our results suggest a supramolecular organization in which additional P1 polypeptides, including the C-terminal segment originally identified as antigen II, associate with covalently attached P1 to form the functional adhesive layer. PMID:25666624
Heim, Kyle P; Sullan, Ruby May A; Crowley, Paula J; El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Tang, Wenxing; Besingi, Richard; Dufrene, Yves F; Brady, L Jeannine
2015-04-03
P1 (antigen I/II) is a sucrose-independent adhesin of Streptococcus mutans whose functional architecture on the cell surface is not fully understood. S. mutans cells subjected to mechanical extraction were significantly diminished in adherence to immobilized salivary agglutinin but remained immunoreactive and were readily aggregated by fluid-phase salivary agglutinin. Bacterial adherence was restored by incubation of postextracted cells with P1 fragments that contain each of the two known adhesive domains. In contrast to untreated cells, glutaraldehyde-treated bacteria gained reactivity with anti-C-terminal monoclonal antibodies (mAbs), whereas epitopes recognized by mAbs against other portions of the molecule were masked. Surface plasmon resonance experiments demonstrated the ability of apical and C-terminal fragments of P1 to interact. Binding of several different anti-P1 mAbs to unfixed cells triggered release of a C-terminal fragment from the bacterial surface, suggesting a novel mechanism of action of certain adherence-inhibiting antibodies. We also used atomic force microscopy-based single molecule force spectroscopy with tips bearing various mAbs to elucidate the spatial organization and orientation of P1 on living bacteria. The similar rupture lengths detected using mAbs against the head and C-terminal regions, which are widely separated in the tertiary structure, suggest a higher order architecture in which these domains are in close proximity on the cell surface. Taken together, our results suggest a supramolecular organization in which additional P1 polypeptides, including the C-terminal segment originally identified as antigen II, associate with covalently attached P1 to form the functional adhesive layer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Analysis of gene expression levels in individual bacterial cells without image segmentation
International Nuclear Information System (INIS)
Kwak, In Hae; Son, Minjun; Hagen, Stephen J.
2012-01-01
Highlights: ► We present a method for extracting gene expression data from images of bacterial cells. ► The method does not employ cell segmentation and does not require high magnification. ► Fluorescence and phase contrast images of the cells are correlated through the physics of phase contrast. ► We demonstrate the method by characterizing noisy expression of comX in Streptococcus mutans. -- Abstract: Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly.
Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins
Poshtiban, Somayyeh
Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.
Cerminati, S; Soncini, F C; Checa, S K
2015-04-07
Bacterial biosensors are simple, cost-effective and efficient analytical tools for detecting bioavailable heavy metals in the environment. This work presents the design, construction and calibration of a novel whole-cell fluorescent biosensory device that, simultaneously and with high sensitivity, reports the presence of toxic mercury, lead, cadmium and/or gold ions in aqueous samples. This bio-reporter can be easily applied as an immediate alerting tool for detecting the presence of harmful pollutants in drinking water.
Tuning the Density of Poly(ethylene glycol Chains to Control Mammalian Cell and Bacterial Attachment
Directory of Open Access Journals (Sweden)
Ahmed Al-Ani
2017-08-01
Full Text Available Surface modification of biomaterials with polymer chains has attracted great attention because of their ability to control biointerfacial interactions such as protein adsorption, cell attachment and bacterial biofilm formation. The aim of this study was to control the immobilisation of biomolecules on silicon wafers using poly(ethylene glycol(PEG chains by a “grafting to” technique. In particular, to control the polymer chain graft density in order to capture proteins and preserve their activity in cell culture as well as find the optimal density that would totally prevent bacterial attachment. The PEG graft density was varied by changing the polymer solubility using an increasing salt concentration. The silicon substrates were initially modified with aminopropyl-triethoxysilane (APTES, where the surface density of amine groups was optimised using different concentrations. The results showed under specific conditions, the PEG density was highest with grafting under “cloud point” conditions. The modified surfaces were characterised with X-ray photoelectron spectroscopy (XPS, ellipsometry, atomic force microscopy (AFM and water contact angle measurements. In addition, all modified surfaces were tested with protein solutions and in cell (mesenchymal stem cells and MG63 osteoblast-like cells and bacterial (Pseudomonas aeruginosa attachment assays. Overall, the lowest protein adsorption was observed on the highest polymer graft density, bacterial adhesion was very low on all modified surfaces, and it can be seen that the attachment of mammalian cells gradually increased as the PEG grafting density decreased, reaching the maximum attachment at medium PEG densities. The results demonstrate that, at certain PEG surface coverages, mammalian cell attachment can be tuned with the potential to optimise their behaviour with controlled serum protein adsorption.
Accurate live and dead bacterial cell enumeration using flow cytometry (Conference Presentation)
Ou, Fang; McGoverin, Cushla; Swift, Simon; Vanholsbeeck, Frédérique
2017-03-01
Flow cytometry (FCM) is based on the detection of scattered light and fluorescence to identify cells with particular characteristics of interest. However most FCM cannot precisely control the flow through its interrogation point and hence the volume and concentration of the sample cannot be immediately obtained. The easiest, most reliable and inexpensive way of obtaining absolute counts with FCM is by using reference beads. We investigated a method of using FCM with reference beads to measure live and dead bacterial concentration over the range of 106 to 108 cells/mL and ratio varying from 0 to 100%. We believe we are the first to use this method for such a large cell concentration range while also establishing the effect of varying the live/dead bacteria ratios. Escherichia coli solutions with differing ratios of live:dead cells were stained with fluorescent dyes SYTO 9 and propidium iodide (PI), which label live and dead cells, respectively. Samples were measured using a LSR II Flow Cytometer (BD Biosciences); using 488 nm excitation with 20 mW power. Both SYTO 9 and PI fluorescence were collected and threshold was set to side scatter. Traditional culture-based plate count was done in parallel to the FCM analysis. The concentration of live bacteria from FCM was compared to that obtained by plate counts. Preliminary results show that the concentration of live bacteria obtained by FCM and plate counts correlate well with each other and indicates this may be extended to a wider concentration range or for studying other cell characteristics.
A novel mechanism of bacterial toxin transfer within host blood cell-derived microvesicles.
Directory of Open Access Journals (Sweden)
Anne-lie Ståhl
2015-02-01
Full Text Available Shiga toxin (Stx is the main virulence factor of enterohemorrhagic Escherichia coli, which are non-invasive strains that can lead to hemolytic uremic syndrome (HUS, associated with renal failure and death. Although bacteremia does not occur, bacterial virulence factors gain access to the circulation and are thereafter presumed to cause target organ damage. Stx was previously shown to circulate bound to blood cells but the mechanism by which it would potentially transfer to target organ cells has not been elucidated. Here we show that blood cell-derived microvesicles, shed during HUS, contain Stx and are found within patient renal cortical cells. The finding was reproduced in mice infected with Stx-producing Escherichia coli exhibiting Stx-containing blood cell-derived microvesicles in the circulation that reached the kidney where they were transferred into glomerular and peritubular capillary endothelial cells and further through their basement membranes followed by podocytes and tubular epithelial cells, respectively. In vitro studies demonstrated that blood cell-derived microvesicles containing Stx undergo endocytosis in glomerular endothelial cells leading to cell death secondary to inhibited protein synthesis. This study demonstrates a novel virulence mechanism whereby bacterial toxin is transferred within host blood cell-derived microvesicles in which it may evade the host immune system.
Lee, Chia-Hsun; Gopal, Judy; Wu, Hui-Fen
2012-01-15
Bacterial analysis from food samples is a highly challenging task because food samples contain intensive interferences from proteins and carbohydrates. Three different conditions of yogurt were analyzed: (1) the fresh yogurt immediately after purchasing, (2) the yogurt after expiry date stored in the refrigerator and (3) the yogurt left outside, without refrigeration. The shelf lives of both these yogurt was compared in terms of the decrease in bacterial signals. AB which initially contained 10(9) cells/mL drastically reduced to 10(7) cells/mL. However, Lin (Feng-Yin) yogurt which initially (fresh) had 10(8) cells/mL, even after two weeks beyond the expiry period showed no marked drop in bacterial count. Conventional MALDI-MS analysis showed limited sensitivity for analysis of yogurt bacteria amidst the complex milk proteins present in yogurt. A cost effective ionic solution, CrO(4)(2-) solution was used to enable the successful detection of bacterial signals (40-fold increased in sensitivity) selectively without the interference of the milk proteins. 0.035 mg of Ag nanoparticles (NPs) were also found to improve the detection of bacteria 2-6 times in yogurt samples. The current approach can be further applied as a rapid, sensitive and effective platform for bacterial analysis from food. Copyright © 2011 Elsevier B.V. All rights reserved.
Yeo, Chew Chieng; Abu Bakar, Fauziah; Chan, Wai Ting; Espinosa, Manuel; Harikrishna, Jennifer Ann
2016-01-01
Toxin-antitoxin (TA) systems are found in nearly all prokaryotic genomes and usually consist of a pair of co-transcribed genes, one of which encodes a stable toxin and the other, its cognate labile antitoxin. Certain environmental and physiological cues trigger the degradation of the antitoxin, causing activation of the toxin, leading either to the death or stasis of the host cell. TA systems have a variety of functions in the bacterial cell, including acting as mediators of programmed cell death, the induction of a dormant state known as persistence and the stable maintenance of plasmids and other mobile genetic elements. Some bacterial TA systems are functional when expressed in eukaryotic cells and this has led to several innovative applications, which are the subject of this review. Here, we look at how bacterial TA systems have been utilized for the genetic manipulation of yeasts and other eukaryotes, for the containment of genetically modified organisms, and for the engineering of high expression eukaryotic cell lines. We also examine how TA systems have been adopted as an important tool in developmental biology research for the ablation of specific cells and the potential for utility of TA systems in antiviral and anticancer gene therapies. PMID:26907343
Directory of Open Access Journals (Sweden)
Chew Chieng Yeo
2016-02-01
Full Text Available Toxin-antitoxin (TA systems are found in nearly all prokaryotic genomes and usually consist of a pair of co-transcribed genes, one of which encodes a stable toxin and the other, its cognate labile antitoxin. Certain environmental and physiological cues trigger the degradation of the antitoxin, causing activation of the toxin, leading either to the death or stasis of the host cell. TA systems have a variety of functions in the bacterial cell, including acting as mediators of programmed cell death, the induction of a dormant state known as persistence and the stable maintenance of plasmids and other mobile genetic elements. Some bacterial TA systems are functional when expressed in eukaryotic cells and this has led to several innovative applications, which are the subject of this review. Here, we look at how bacterial TA systems have been utilized for the genetic manipulation of yeasts and other eukaryotes, for the containment of genetically modified organisms, and for the engineering of high expression eukaryotic cell lines. We also examine how TA systems have been adopted as an important tool in developmental biology research for the ablation of specific cells and the potential for utility of TA systems in antiviral and anticancer gene therapies.
Analysis of gene expression levels in individual bacterial cells without image segmentation
Energy Technology Data Exchange (ETDEWEB)
Kwak, In Hae; Son, Minjun [Physics Department, University of Florida, P.O. Box 118440, Gainesville, FL 32611-8440 (United States); Hagen, Stephen J., E-mail: sjhagen@ufl.edu [Physics Department, University of Florida, P.O. Box 118440, Gainesville, FL 32611-8440 (United States)
2012-05-11
Highlights: Black-Right-Pointing-Pointer We present a method for extracting gene expression data from images of bacterial cells. Black-Right-Pointing-Pointer The method does not employ cell segmentation and does not require high magnification. Black-Right-Pointing-Pointer Fluorescence and phase contrast images of the cells are correlated through the physics of phase contrast. Black-Right-Pointing-Pointer We demonstrate the method by characterizing noisy expression of comX in Streptococcus mutans. -- Abstract: Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly.
The Detection of Helicobacter hepaticus Using Whispering-Gallery Mode Microcavity Optical Sensors
Directory of Open Access Journals (Sweden)
Mark E. Anderson
2015-08-01
Full Text Available Current bacterial detection techniques are relatively slow, require bulky instrumentation, and usually require some form of specialized training. The gold standard for bacterial detection is culture testing, which can take several days to receive a viable result. Therefore, simpler detection techniques that are both fast and sensitive could greatly improve bacterial detection and identification. Here, we present a new method for the detection of the bacteria Helicobacter hepaticus using whispering-gallery mode (WGM optical microcavity-based sensors. Due to minimal reflection losses and low material adsorption, WGM-based sensors have ultra-high quality factors, resulting in high-sensitivity sensor devices. In this study, we have shown that bacteria can be non-specifically detected using WGM optical microcavity-based sensors. The minimum detection for the device was 1 × 104 cells/mL, and the minimum time of detection was found to be 750 s. Given that a cell density as low as 1 × 103 cells/mL for Helicobacter hepaticus can cause infection, the limit of detection shown here would be useful for most levels where Helicobacter hepaticus is biologically relevant. This study suggests a new approach for H. hepaticus detection using label-free optical sensors that is faster than, and potentially as sensitive as, standard techniques.
Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G
2017-07-25
We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected
Bacterial reduction by cell salvage washing and leukocyte depletion filtration.
Waters, Jonathan H; Tuohy, Marion J; Hobson, Donna F; Procop, Gary
2003-09-01
Blood conservation techniques are being increasingly used because of the increased cost and lack of availability of allogeneic blood. Cell salvage offers great blood savings opportunities but is thought to be contraindicated in a number of areas (e.g., blood contaminated with bacteria). Several outcome studies have suggested the safety of this technique in trauma and colorectal surgery, but many practitioners are still hesitant to apply cell salvage in the face of frank bacterial contamination. This study was undertaken to assess the efficacy of bacterial removal when cell salvage was combined with leukocyte depletion filtration. Expired packed erythrocytes were obtained and inoculated with a fixed amount of a stock bacteria (Escherichia coli American Type Culture Collections [ATCC] 25922, Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213, or Bacteroides fragilis ATCC 25285) in amounts ranging from 2,000 to 4,000 colony forming units/ml. The blood was processed via a cell salvage machine. The washed blood was then filtered using a leukocyte reduction filter. The results for blood taken during each step of processing were compared using a repeated-measures design. Fifteen units of blood were contaminated with each of the stock bacteria. From the prewash sample to the postfiltration sample, 99.0%, 99.6%, 100%, and 97.6% of E. coli, S. aureus, P. aeruginosa, and B. fragilis were removed, respectively. Significant but not complete removal of contaminating bacteria was seen. An increased level of patient safety may be added to cell salvage by including a leukocyte depletion filter when salvaging blood that might be grossly contaminated with bacteria.
Directory of Open Access Journals (Sweden)
Yun Liu
2018-05-01
Full Text Available Nitroreductases (NTRs are known to be able to metabolize nitro-substituted compounds in the presence of reduced nicotinamide adenine dinucleotide (NADH as an electron donor. NTRs are present in a wide range of bacterial genera and, to a lesser extent, in eukaryotes hypoxic tumour cells and tumorous tissues, which makes it an appropriate biomarker for an imaging target to detect the hypoxic status of cancer cells and potential bacterial infections. To evaluate the specific activation level of NTR, great efforts have been devoted to the development of fluorescent probes to detect NTR activities using fluorogenic methods to probe its behaviour in a cellular context; however, NTR-responsive MRI contrast agents are still by far underexplored. In this study, para-nitrobenzyl substituted T1-weighted magnetic resonance imaging (MRI contrast agent Gd-DOTA-PNB (probe 1 has been designed and explored for the possible detection of NTR. Our experimental results show that probe 1 could serve as an MRI-enhanced contrast agent for monitoring NTR activity. The in vitro response and mechanism of the NTR catalysed reduction of probe 1 have been investigated through LC–MS and MRI. Para-nitrobenzyl substituted probe 1 was catalytically reduced by NTR to the intermediate para-aminobenzyl substituted probe which then underwent a rearrangement elimination reaction to Gd-DOTA, generating the enhanced T1-weighted MR imaging. Further, LC–MS and MRI studies of living Escherichia coli have confirmed the NTR activity detection ability of probe 1 at a cellular level. This method may potentially be used for the diagnosis of bacterial infections. KEY WORDS: Nitroreductase, MRI contrast agent, Smart imaging probes, Bacterial imaging, Bacterial infection
Procalcitonin Identifies Cell Injury, Not Bacterial Infection, in Acute Liver Failure.
Directory of Open Access Journals (Sweden)
Jody A Rule
Full Text Available Because acute liver failure (ALF patients share many clinical features with severe sepsis and septic shock, identifying bacterial infection clinically in ALF patients is challenging. Procalcitonin (PCT has proven to be a useful marker in detecting bacterial infection. We sought to determine whether PCT discriminated between presence and absence of infection in patients with ALF.Retrospective analysis of data and samples of 115 ALF patients from the United States Acute Liver Failure Study Group randomly selected from 1863 patients were classified for disease severity and ALF etiology. Twenty uninfected chronic liver disease (CLD subjects served as controls.Procalcitonin concentrations in most samples were elevated, with median values for all ALF groups near or above a 2.0 ng/mL cut-off that generally indicates severe sepsis. While PCT concentrations increased somewhat with apparent liver injury severity, there were no differences in PCT levels between the pre-defined severity groups-non-SIRS and SIRS groups with no documented infections and Severe Sepsis and Septic Shock groups with documented infections, (p = 0.169. PCT values from CLD patients differed from all ALF groups (median CLD PCT value 0.104 ng/mL, (p ≤0.001. Subjects with acetaminophen (APAP toxicity, many without evidence of infection, demonstrated median PCT >2.0 ng/mL, regardless of SIRS features, while some culture positive subjects had PCT values <2.0 ng/mL.While PCT appears to be a robust assay for detecting bacterial infection in the general population, there was poor discrimination between ALF patients with or without bacterial infection presumably because of the massive inflammation observed. Severe hepatocyte necrosis with inflammation results in elevated PCT levels, rendering this biomarker unreliable in the ALF setting.
Temperate bacterial viruses as double-edged swords in bacterial warfare.
Gama, João Alves; Reis, Ana Maria; Domingues, Iolanda; Mendes-Soares, Helena; Matos, Ana Margarida; Dionisio, Francisco
2013-01-01
It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a "replicating toxin". However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails.
Temperate bacterial viruses as double-edged swords in bacterial warfare.
Directory of Open Access Journals (Sweden)
João Alves Gama
Full Text Available It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a "replicating toxin". However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails.
Enhanced detection and study of murine norovirus-1 using a more efficient microglial cell line
Directory of Open Access Journals (Sweden)
Lu Yuanan
2009-11-01
Full Text Available Abstract Background Human Noroviruses are the predominant cause of non-bacterial gastroenteritis worldwide. To facilitate prevention and control, a norovirus isolated from mice can provide a model to understand human noroviruses. To establish optimal viral infectivity conditions for murine noroviruses, several cell lines of hematopoietic lineage, including murine BV-2, RAW 264.7, and TIB, as well as human CHME-5, were tested comparatively for their sensitivity to murine norovirus-1. Results Except for CHME-5, all three murine-derived cell lines were susceptible to MNV infection. Viral infection of these cells was confirmed by RT-PCR. Using both viral plaque and replication assays, BV-2 and RAW 264.7 cells were determined to have comparable sensitivities to MNV-1 infection. Comparisons of cell growth characteristics, general laboratory handling and potential in-field applications suggest the use of BV-2 to be more advantageous. Conclusion Results obtained from these studies demonstrate that an immortalized microglial cell line can support MNV-1 replication and provides a more efficient method to detect and study murine noroviruses, facilitating future investigations using MNV-1 as a model to study, detect, and control Human Norovirus.
Energy Technology Data Exchange (ETDEWEB)
Myneni, Satish C. [Princeton Univ., NJ (United States); Mishra, Bhoopesh [Princeton Univ., NJ (United States); Fein, Jeremy [Princeton Univ., NJ (United States)
2009-04-01
The goal of this exploratory study is to provide a quantitative and mechanistic understanding of the impact of bacterial sulfhydryl groups on the bacterial uptake, speciation, methylation and bioavailability of Hg and redox changes of uranium. The relative concentration and reactivity of different functional groups present on bacterial surfaces will be determined, enabling quantitative predictions of the role of biosorption of Hg under the physicochemical conditions found at contaminated DOE sites.The hypotheses we propose to test in this investigation are as follows- 1) Sulfhydryl groups on bacterial cell surfaces modify Hg speciation and solubility, and play an important role, specifically in the sub-micromolar concentration ranges of metals in the natural and contaminated systems. 2) Sulfhydryl binding of Hg on bacterial surfaces significantly influences Hg transport into the cell and the methylation rates by the bacteria. 3) Sulfhydryls on cell membranes can interact with hexavalent uranium and convert to insoluble tetravalent species. 4) Bacterial sulfhydryl surface groups are inducible by the presence of metals during cell growth. Our studies focused on the first hypothesis, and we examined the nature of sulfhydryl sites on three representative bacterial species: Bacillus subtilis, a common gram-positive aerobic soil species; Shewanella oneidensis, a facultative gram-negative surface water species; and Geobacter sulfurreducens, an anaerobic iron-reducing gram-negative species that is capable of Hg methylation; and at a range of Hg concentration (and Hg:bacterial concentration ratio) in which these sites become important. A summary of our findings is as follows- Hg adsorbs more extensively to bacteria than other metals. Hg adsorption also varies strongly with pH and chloride concentration, with maximum adsorption occurring under circumneutral pH conditions for both Cl-bearing and Cl-free systems. Under these conditions, all bacterial species tested exhibit
Directory of Open Access Journals (Sweden)
Stella E Autenrieth
2012-02-01
Full Text Available Dendritic cells (DCs as professional antigen-presenting cells play an important role in the initiation and modulation of the adaptive immune response. However, their role in the innate immune response against bacterial infections is not completely defined. Here we have analyzed the role of DCs and their impact on the innate anti-bacterial host defense in an experimental infection model of Yersinia enterocolitica (Ye. We used CD11c-diphtheria toxin (DT mice to deplete DCs prior to severe infection with Ye. DC depletion significantly increased animal survival after Ye infection. The bacterial load in the spleen of DC-depleted mice was significantly lower than that of control mice throughout the infection. DC depletion was accompanied by an increase in the serum levels of CXCL1, G-CSF, IL-1α, and CCL2 and an increase in the numbers of splenic phagocytes. Functionally, splenocytes from DC-depleted mice exhibited an increased bacterial killing capacity compared to splenocytes from control mice. Cellular studies further showed that this was due to an increased production of reactive oxygen species (ROS by neutrophils. Adoptive transfer of neutrophils from DC-depleted mice into control mice prior to Ye infection reduced the bacterial load to the level of Ye-infected DC-depleted mice, suggesting that the increased number of phagocytes with additional ROS production account for the decreased bacterial load. Furthermore, after incubation with serum from DC-depleted mice splenocytes from control mice increased their bacterial killing capacity, most likely due to enhanced ROS production by neutrophils, indicating that serum factors from DC-depleted mice account for this effect. In summary, we could show that DC depletion triggers phagocyte accumulation in the spleen and enhances their anti-bacterial killing capacity upon bacterial infection.
Jarzembowski, T; Wiśniewska, K; Józwik, A; Bryl, E; Witkowski, J
2008-08-01
We studied the usefulness of flow cytometry for detection of penicillin resistance in E. faecalis and S. aureus by direct binding of commercially available fluorescent penicillin, Bocillin FL, to cells obtained from culture. There were significantly lower percentages of fluorescent cells and median and mean fluorescence values per particle in penicillin-resistant than in penicillin-sensitive strains of both species observed. The method allows rapid detection of penicillin resistance in S. aureus and E. faecalis. The results encourage further investigations on the detection of antibiotic resistance in bacteria using flow cytometry.
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
Bacterial Infection Potato Tuber Soft Rot Disease Detection Based on Electronic Nose
Directory of Open Access Journals (Sweden)
Chang Zhiyong
2017-11-01
Full Text Available Soft rot is a severe bacterial disease of potatoes, and soft rot infection can cause significant economic losses during the storage period of potatoes. In this study, potato soft rot was selected as the research object, and a type of potato tuber soft rot disease early detection method based on the electronic nose technology was proposed. An optimized bionic electronic nose gas chamber and a scientific and reasonable sampling device were designed to detect a change in volatile substances of the infected soft rot disease of potato tuber. The infection of soft rot disease in potato tuber samples was detected and identified by using the RBF NN algorithm and SVM algorithm. The results revealed that the proposed bionic electronic nose system can be utilized for early detection of potato tuber soft rot disease. Through comparison and analysis, the recognition rate using the SVM algorithm reached up to 89.7%, and the results were superior to the RBF NN algorithm.
Energy Technology Data Exchange (ETDEWEB)
Baldikova, Eva [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Pospiskova, Kristyna [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Ladakis, Dimitrios; Kookos, Ioannis K. [Department of Chemical Engineering, University of Patras, 26504 Patras, Rio (Greece); Koutinas, Apostolis A. [Department of Food Science and Human Nutrition, Agricultural University of Athens, Iera Odos 75, Athens 11855 (Greece); Safarikova, Mirka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Nanobiotechnology, Biology Centre, ISB, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Safarik, Ivo, E-mail: safarik@nh.cas.cz [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Biology Centre, ISB, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)
2017-02-01
Bacterial cellulose (BC) produced by Komagataeibacter sucrofermentans was magnetically modified using perchloric acid stabilized magnetic fluid. Magnetic bacterial cellulose (MBC) was used as a carrier for the immobilization of affinity ligands, enzymes and cells. MBC with immobilized reactive copper phthalocyanine dye was an efficient adsorbent for crystal violet removal; the maximum adsorption capacity was 388 mg/g. Kinetic and thermodynamic parameters were also determined. Model biocatalysts, namely bovine pancreas trypsin and Saccharomyces cerevisiae cells were immobilized on MBC using several strategies including adsorption with subsequent cross-linking with glutaraldehyde and covalent binding on previously activated MBC using sodium periodate or 1,4-butanediol diglycidyl ether. Immobilized yeast cells retained approximately 90% of their initial activity after 6 repeated cycles of sucrose solution hydrolysis. Trypsin covalently bound after MBC periodate activation was very stable during operational stability testing; it could be repeatedly used for ten cycles of low molecular weight substrate hydrolysis without loss of its initial activity. - Highlights: • Bacterial cellulose was magnetically modified with magnetic fluid. • Magnetic cellulose is an efficient carrier for affinity ligands. • Enzymes and cells can be efficiently immobilized to magnetic cellulose.
Energy Technology Data Exchange (ETDEWEB)
Donmez, Mert [Department of Chemistry, Faculty of Art and Sciences, Duzce University, Duzce 81620 (Turkey); Yilmaz, M. Deniz, E-mail: deniz.yilmaz@gidatarim.edu.tr [Department of Bioengineering, Faculty of Engineering and Architecture, Konya Food and Agriculture University, Konya 42080 (Turkey); Kilbas, Benan, E-mail: benankilbas@duzce.edu.tr [Department of Chemistry, Faculty of Art and Sciences, Duzce University, Duzce 81620 (Turkey)
2017-02-15
Highlights: • The nanosensors based on gold nanoparticles functionalized with lanthanide complexes were synthesized. • The nanosensors selectively and sensitively detected DPA, a biomarker of bacterial spores. • Ratiometric sensing of DPA by a ternary complex was achieved by ligand displacement strategy. - Abstract: Gold nanoparticles (GNPs) functionalized with ethylenediamine-lanthanide complexes (Eu-GNPs and Tb-GNPs) were used for the selective fluorescent detection of dipicolinic acid (DPA), a unique biomarker of bacterial spores, in water. Particles were characterized by transmission electron microscopy and zeta potential measurements. The coordination of DPA to the lanthanides resulted in the enhancement of the fluorescence. A selective response to DPA was observed over the nonselective binding of aromatic ligands. The ligand displacement strategy were also employed for the ratiometric fluorescent detection of DPA. 4,4,4-trifluoro-1-(2-naphthyl)-1,3-butanedion (TFNB) was chosen as an antenna to synthesize ternary complexes. The addition of DPA on EuGNP:TFNB ternary complex quenched the initial emission of the complex at 615 nm and increased the TFNB emission at 450 nm when excited at 350 nm. The results demonstrated that the ratiometric fluorescent detection of DPA was achieved by ligand displacement strategy.
A simple bacterial turbidimetric method for detection of some radurized foods
International Nuclear Information System (INIS)
Gautam, S.; Sharma, Arun; Thomas, Paul
1998-01-01
A simple and quick method for detection of irradiated food is proposed. The method is based on the principle of microbial contribution to the development of turbidity in a clear medium. It employs measurement of absorbance at 600 nm of the medium after the test commodity has been suspended and shaken in it for a fixed interval. The differences in the bacterial turbidity from irradiated and nonirradiated samples are quite marked so as to allow identification of the irradiated foods like fish, lamb meat, chicken and mushroom. (author)
Directory of Open Access Journals (Sweden)
Lingxiang Zhu
Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.
W.I. van der Meijden (Willem)
1987-01-01
textabstractThis thesis deals with several aspects of (abnormal) vaginal discharge, focusing especially on clue cell-positive discharge (bacterial vaginosis, nonspecific vaginitis). It reports data on epidemiology and clinical features, pathogenesis, and treatment of this vaginal disease entity,
Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali
2011-01-01
Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.
Directory of Open Access Journals (Sweden)
Hollants Joke
2011-11-01
Full Text Available Abstract Background The siphonous green macroalga Bryopsis has some remarkable characteristics. Besides hosting a rich endophytic bacterial flora, Bryopsis also displays extraordinary wound repair and propagation mechanisms. This latter feature includes the formation of protoplasts which can survive in the absence of a cell membrane for several minutes before regenerating into new individuals. This transient 'life without a membrane' state, however, challenges the specificity of the endophytic bacterial communities present and raises the question whether these bacteria are generalists, which are repeatedly acquired from the environment, or if there is some specificity towards the Bryopsis host. Results To answer this question, we examined the temporal stability and the uniqueness of endobiotic bacterial communities within Bryopsis samples from the Mexican west coast after prolonged cultivation. DGGE analysis revealed that Bryopsis endophytic bacterial communities are rather stable and clearly distinct from the epiphytic and surrounding cultivation water bacterial communities. Although these endogenous communities consist of both facultative and obligate bacteria, results suggest that Bryopsis owns some intrinsic mechanisms to selectively maintain and/or attract specific bacteria after repeated wounding events in culture. Conclusions This suggests that Bryopsis algae seem to master transient stages of life without a cell membrane well as they harbor specific - and possibly ecological significant - endophytic bacteria.
Directory of Open Access Journals (Sweden)
Senthil R. Kumar
2018-01-01
Full Text Available The present study tested the effect of a bacterial lactone N-(3-oxododecanoyl-homoserine lactone (C12-HSL on the cytoskeletal and transcriptional genes and proteins in prostate adenocarcinoma (PA cells (DU145 and LNCaP and prostate small cell neuroendocrine carcinoma (SCNC PC3 cells including their cellular viability and apoptosis. Our data indicate that cell migration and colony formation were affected in the presence of C12-HSL. C12-HSL induced apoptosis and altered viability of both PA and SCNC cells in a concentration dependent manner as measured by fluorescence and chemiluminescence assays. Compared to PCa cells, noncancerous prostate epithelial cells (RWPE1 were resistant to modification by C12-HSL. Further, the viability of PC3 cells in 3D matrix was suppressed by C12-HSL treatment as detected using calcein AM fluorescence in situ. C12-HSL treatment induced cytoskeletal associated protein expression of vinculin and RhoC, which may have implications in cancer cell motility, adhesion, and metastasis. IQGAP protein expression was reduced in DU145 and RWPE1 cells in the presence of C12-HSL. C12-HSL decreased STAT3 phosphorylation in DU145 cells but increased STAT1 protein phosphorylation in PC3 and LNCaP cells. Overall, these studies indicate that C12-HSL can trigger changes in transcription factors and cytoskeletal proteins and thereby modulate growth and migration properties of PCa cells.
Fate of deposited cells in an aerobic binary bacterial biofilm
International Nuclear Information System (INIS)
Banks, M.K.
1989-01-01
A biofilm is a matrix of microbial cells and their extracellular products that is associated with a solid surface. Previous studies on biofilm development have employed only dissolved compounds as growth limiting substrates, without the influence of microbial species invading from the bulk liquid. The goal of this research project was to quantify the kinetics of processes governing suspended biomass turnover in biofilm systems, and the accompanying effects of suspended cell deposition on biofilm population dynamics. Experiments were conducted with two species of bacteria, Pseudomonas putida ATCC 11172 grown on glucose, and Hyphomicrobium ZV620 grown on methanol. Cryptic growth and particulate hydrolysis studies were evaluated, using combinations of these two bacteria, by measuring the uptake of radiolabelled cell lysis products, under batch conditions. Biofilms studies were performed to investigate bacterial deposition, continual biofilm removal by shear induced erosion, and biofilm ecology. Biofilms were developed in a flow cell reactor, under laminar flow conditions. Bacterial species were differentiated by radioactively labelling each species with their carbon substrate. A mathematical model was developed to predict the biofilm ecology of mixed cultures. The equations developed predict biofilm accumulation, as well as substrate and oxygen consumption. Results indicate that cryptic growth will occur for bacteria growing on their own species soluble lysis products and in some cases, bacteria growing on the soluble lysis products of other species. Particulate hydrolysis only occurred for Pseudomonas putida growing on Pseudomonas putida lysis products, but the lack of particulate hydrolysis occurring in the other studies may have been due to the short experimental period
Directory of Open Access Journals (Sweden)
Andressa Vilas Boas Nogueira
2014-01-01
Full Text Available The present study aimed to evaluate in vitro whether biomechanical loading modulates proinflammatory and bone remodeling mediators production by periodontal ligament (PDL cells in the presence of bacterial challenge. Cells were seeded on BioFlex culture plates and exposed to Fusobacterium nucleatum ATCC 25586 and/or cyclic tensile strain (CTS of low (CTSL and high (CTSH magnitudes for 1 and 3 days. Synthesis of cyclooxygenase-2 (COX2 and prostaglandin E2 (PGE2 was evaluated by ELISA. Gene expression and protein secretion of osteoprotegerin (OPG and receptor activator of nuclear factor kappa-B ligand (RANKL were evaluated by quantitative RT-PCR and ELISA, respectively. F. nucleatum increased the production of COX2 and PGE2, which was further increased by CTS. F. nucleatum-induced increase of PGE2 synthesis was significantly (P<0.05 increased when CTSH was applied at 1 and 3 days. In addition, CTSH inhibited the F. nucleatum-induced upregulation of OPG at 1 and 3 days, thereby increasing the RANKL/OPG ratio. OPG and RANKL mRNA results correlated with the protein results. In summary, our findings provide original evidence that CTS can enhance bacterial-induced syntheses of molecules associated with inflammation and bone resorption by PDL cells. Therefore, biomechanical, such as orthodontic or occlusal, loading may enhance the bacterial-induced inflammation and destruction in periodontitis.
Bacterial Transport in Heterogeneous Porous Media: Laboratory and Field Experiments
Fuller, M. E.
2001-12-01
A fully instrumented research site for examining field-scale bacterial transport has been established on the eastern shore of Virginia. Studies employing intact sediment cores from the South Oyster site have been performed to examine the effects of physical and chemical heterogeneity, to derive transport parameters, and to aid in the selection of bacterial strains for use in field experiments. A variety of innovative methods for tracking bacteria were developed and evaluated under both laboratory and field conditions, providing the tools to detect target cell concentrations in groundwater down to effects of physical and chemical heterogeneity on field-scale bacterial transport. The results of this research not only contribute to the development of more effective bioremediation strategies, but also have implications for a better understanding of bacterial movement in the subsurface as it relates to public health microbiology and general microbial ecology.
Microfabricated ratchet structures for concentrating and patterning motile bacterial cells
International Nuclear Information System (INIS)
Kim, Sang Yub; Lee, Eun Se; Lee, Ho Jae; Lee, Se Yeon; Lee, Sung Kuk; Kim, Taesung
2010-01-01
We present a novel microfabricated concentrator for Escherichia coli that can be a stand-alone and self-contained microfluidic device because it utilizes the motility of cells. First of all, we characterize the motility of E. coli cells and various ratcheting structures that can guide cells to move in a desired direction in straight and circular channels. Then, we combine these ratcheting microstructures with the intrinsic tendency of cells to swim on the right side in microchannels to enhance the concentration rates up to 180 fold until the concentrators are fully filled with cells. Furthermore, we demonstrate that cells can be positioned and concentrated with a constant spacing distance on a surface, allowing spatial patterning of motile cells. These results can be applied to biosorption or biosensor devices that are powered by motile cells because they can be highly concentrated without any external mechanical and electrical energy sources. Hence, we believe that the concentrator design holds considerable potential to be applied for concentrating and patterning other motile microbes and providing a versatile structure for motility study of bacterial cells.
Directory of Open Access Journals (Sweden)
Dan M Close
Full Text Available The bacterial luciferase (lux gene cassette consists of five genes (luxCDABE whose protein products synergistically generate bioluminescent light signals exclusive of supplementary substrate additions or exogenous manipulations. Historically expressible only in prokaryotes, the lux operon was re-synthesized through a process of multi-bicistronic, codon-optimization to demonstrate for the first time self-directed bioluminescence emission in a mammalian HEK293 cell line in vitro and in vivo.Autonomous in vitro light production was shown to be 12-fold greater than the observable background associated with untransfected control cells. The availability of reduced riboflavin phosphate (FMNH(2 was identified as the limiting bioluminescence substrate in the mammalian cell environment even after the addition of a constitutively expressed flavin reductase gene (frp from Vibrio harveyi. FMNH(2 supplementation led to a 151-fold increase in bioluminescence in cells expressing mammalian codon-optimized luxCDE and frp genes. When injected subcutaneously into nude mice, in vivo optical imaging permitted near instantaneous light detection that persisted independently for the 60 min length of the assay with negligible background.The speed, longevity, and self-sufficiency of lux expression in the mammalian cellular environment provides a viable and powerful alternative for real-time target visualization not currently offered by existing bioluminescent and fluorescent imaging technologies.
DEFF Research Database (Denmark)
van Wijk, Xander M.; Döhrmann, Simon; Hallstrom, Bjorn
2017-01-01
cells. Whole-genome sequencing and transcriptome sequencing (RNA-Seq) uncovered a deletion in the gene encoding the laminin subunit α2 (Lama2) that eliminated much of domain L4a. Silencing of the long Lama2 isoform in wild-type cells strongly reduced bacterial invasion, whereas transfection with human...... LAMA2 cDNA significantly enhanced invasion in pgsA745 cells. The addition of exogenous laminin-α2β1γ1/laminin-α2β2γ1 strongly increased bacterial invasion in CHO cells, as well as in human alveolar basal epithelial and human brain microvascular endothelial cells. Thus, the L4a domain in laminin α2...
The Prc and RseP proteases control bacterial cell-surface signalling activity.
Bastiaansen, K.C.J.T.; Ibañez, A.; Ramos, JL; Bitter, W.; Llamas, M.A.
2014-01-01
Summary: Extracytoplasmic function (ECF) sigma factors play a key role in the regulation of vital functions in the bacterial response to the environment. In Gram-negative bacteria, activity of these sigma factors is often controlled by cell-surface signalling (CSS), a regulatory system that also
Cheng, K J; Hironaka, R; Costerton, J W
1976-05-01
Alkaline phosphatase (APase) was present in the bovine rumen in both cell-free and cell-associated states and levels of the enzyme varied with dietary regime. Reaction product deposition showed that the enzyme was associated with the mixed bacterial population. No enzyme was observed to be associated with protozoa. Trace activity of APase was also detected in the saliva. The presence of large amounts of APase in cell-free rumen fluid of cattle fed fine concentrate feed is believed to be due, in part, to the breakage of bacterial cells that occurs in the rumen.
Detecting Release of Bacterial dsDNA into the Host Cytosol Using Fluorescence Microscopy.
Dreier, Roland Felix; Santos, José Carlos; Broz, Petr
2018-01-01
Recognition of pathogens by the innate immune system relies on germline-encoded pattern recognition receptors (PRRs) that recognize unique microbial molecules, so-called pathogen-associated molecular patterns (PAMPs). Nucleic acids and their derivatives are one of the most important groups of PAMPs, and are recognized by a number of surface-associated as well as cytosolic PRRs. Cyclic GMP-AMP synthase (cGAS) recognizes the presence of pathogen- or host-derived dsDNA in the cytosol and initiates type-I-IFN production. Here, we describe a methodology that allows for evaluating the association of cGAS with released bacterial dsDNA during Francisella novicida infection of macrophages, by fluorescence confocal microscopy. This method can be adapted to the study of cGAS-dependent responses elicited by other intracellular bacterial pathogens and in other cell types.
Logsdon, Michelle M; Aldridge, Bree B
2018-01-01
Model bacteria, such as E. coli and B. subtilis , tightly regulate cell cycle progression to achieve consistent cell size distributions and replication dynamics. Many of the hallmark features of these model bacteria, including lateral cell wall elongation and symmetric growth and division, do not occur in mycobacteria. Instead, mycobacterial growth is characterized by asymmetric polar growth and division. This innate asymmetry creates unequal birth sizes and growth rates for daughter cells with each division, generating a phenotypically heterogeneous population. Although the asymmetric growth patterns of mycobacteria lead to a larger variation in birth size than typically seen in model bacterial populations, the cell size distribution is stable over time. Here, we review the cellular mechanisms of growth, division, and cell cycle progression in mycobacteria in the face of asymmetry and inherent heterogeneity. These processes coalesce to control cell size. Although Mycobacterium smegmatis and Mycobacterium bovis Bacillus Calmette-Guérin (BCG) utilize a novel model of cell size control, they are similar to previously studied bacteria in that initiation of DNA replication is a key checkpoint for cell division. We compare the regulation of DNA replication initiation and strategies used for cell size homeostasis in mycobacteria and model bacteria. Finally, we review the importance of cellular organization and chromosome segregation relating to the physiology of mycobacteria and consider how new frameworks could be applied across the wide spectrum of bacterial diversity.
Role of the T cell receptor ligand affinity in T cell activation by bacterial superantigens
DEFF Research Database (Denmark)
Andersen, P S; Geisler, C; Buus, S
2001-01-01
Similar to native peptide/MHC ligands, bacterial superantigens have been found to bind with low affinity to the T cell receptor (TCR). It has been hypothesized that low ligand affinity is required to allow optimal TCR signaling. To test this, we generated variants of Staphylococcus enterotoxin C3...... (SEC3) with up to a 150-fold increase in TCR affinity. By stimulating T cells with SEC3 molecules immobilized onto plastic surfaces, we demonstrate that increasing the affinity of the SEC3/TCR interaction caused a proportional increase in the ability of SEC3 to activate T cells. Thus, the potency...... correlation between ligand affinity and ligand potency indicating that it is the density of receptor-ligand complexes in the T cell contact area that determines TCR signaling strength....
Nikiyan, Hike; Vasilchenko, Alexey; Deryabin, Dmitry
2010-01-01
The effect of a relative humidity (RH) in a range of 93-65% on morphological and elastic properties of Bacillus cereus and Escherichia coli cells was evaluated using atomic force microscopy. It is shown that gradual dehumidification of bacteria environment has no significant effect on cell dimensional features and considerably decreases them only at 65% RH. The increasing of the bacteria cell wall roughness and elasticity occurs at the same time. Observed changes indicate that morphological properties of B. cereus are rather stable in wide range of relative humidity, whereas E. coli are more sensitive to drying, significantly increasing roughness and stiffness parameters at RH = 84% RH. It is discussed the dependence of the response features on differences in cell wall structure of gram-positive and gram-negative bacterial cells.
Directory of Open Access Journals (Sweden)
Hike Nikiyan
2010-01-01
Full Text Available The effect of a relative humidity (RH in a range of 93–65% on morphological and elastic properties of Bacillus cereus and Escherichia coli cells was evaluated using atomic force microscopy. It is shown that gradual dehumidification of bacteria environment has no significant effect on cell dimensional features and considerably decreases them only at 65% RH. The increasing of the bacteria cell wall roughness and elasticity occurs at the same time. Observed changes indicate that morphological properties of B. cereus are rather stable in wide range of relative humidity, whereas E. coli are more sensitive to drying, significantly increasing roughness and stiffness parameters at RH ≤ 84% RH. It is discussed the dependence of the response features on differences in cell wall structure of gram-positive and gram-negative bacterial cells.
New Technologies for Rapid Bacterial Identification and Antibiotic Resistance Profiling.
Kelley, Shana O
2017-04-01
Conventional approaches to bacterial identification and drug susceptibility testing typically rely on culture-based approaches that take 2 to 7 days to return results. The long turnaround times contribute to the spread of infectious disease, negative patient outcomes, and the misuse of antibiotics that can contribute to antibiotic resistance. To provide new solutions enabling faster bacterial analysis, a variety of approaches are under development that leverage single-cell analysis, microfluidic concentration and detection strategies, and ultrasensitive readout mechanisms. This review discusses recent advances in this area and the potential of new technologies to enable more effective management of infectious disease.
Bacterial cell-cell communication in the host via RRNPP peptide-binding regulators
Directory of Open Access Journals (Sweden)
David ePerez-Pascual
2016-05-01
Full Text Available Human microbiomes are composed of complex and dense bacterial consortia. In these environments, bacteria are able to react quickly to change by coordinating their gene expression at the population level via small signaling molecules. In Gram-positive bacteria, cell-cell communication is mostly mediated by peptides that are released into the extracellular environment. Cell-cell communication based on these peptides is especially widespread in the group Firmicutes, in which they regulate a wide array of biological processes, including functions related to host-microbe interactions. Among the different agents of communication, the RRNPP family of cytoplasmic transcriptional regulators, together with their cognate re-internalized signaling peptides, represents a group of emerging importance. RRNPP members that have been studied so far are found mainly in species of bacilli, streptococci, and enterococci. These bacteria are characterized as both human commensal and pathogenic, and share different niches in the human body with other microorganisms. The goal of this mini-review is to present the current state of research on the biological relevance of RRNPP mechanisms in the context of the host, highlighting their specific roles in commensalism or virulence.
Directory of Open Access Journals (Sweden)
Simon M. Dittami
2017-11-01
Full Text Available Modern genome sequencing strategies are highly sensitive to contamination making the detection of foreign DNA sequences an important part of analysis pipelines. Here we use Taxoblast, a simple pipeline with a graphical user interface, for the post-assembly detection of contaminating sequences in the published genome of the kelp Saccharina japonica. Analyses were based on multiple blastn searches with short sequence fragments. They revealed a number of probable bacterial contaminations as well as hybrid scaffolds that contain both bacterial and algal sequences. This or similar types of analysis, in combination with manual curation, may thus constitute a useful complement to standard bioinformatics analyses prior to submission of genomic data to public repositories. Our analysis pipeline is open-source and freely available at http://sdittami.altervista.org/taxoblast and via SourceForge (https://sourceforge.net/projects/taxoblast.
Detection of microbial contamination in platelets
Berg, Tracy L.; Leparc, German; Huffman, Debra E.; Gennaccaro, Angela L.; Garcia-Lopez, Alicia; Klungness, Greta; Stephans, Christie; Garcia-Rubio, Luis H.
2005-03-01
In the United States, approximately 100 patients develop fatal sepsis associated with platelet transfusions every year. Current culture methods take 24-48 hours to acquire results, which in turn decrease the shelf life of platelets. Many of the microorganisms that contaminate platelets can replicate easily at room temperature, which is the necessary storage temperature to keep platelets functional. Therefore, there is a need for in-situ quality control assessment of the platelet quality. For this purpose, a real time spectrophotometric technique has been developed. The Spectral Acquisition Processing Detection (SAPD) method, comprised of a UV-vis spectrophotometer and modeling algorithms, is a rapid method that can be performed prior to platelet transfusion to decrease the risk of bacterial infection to patients. The SAPD method has been used to determine changes in cell suspensions, based on size, shape, chemical composition and internal structure. Changes in these cell characteristics can in turn be used to determine microbial contamination, platelet aging and other physiologic changes. Detection limits of this method for platelet suspensions seeded with bacterial contaminants were identified to be less than 100 cfu/ml of sample. Bacterial counts below 1000 cfu/ml are not considered clinically significant. The SAPD method can provide real-time identification of bacterial contamination of platelets affording patients an increased level of safety without causing undue strain on laboratory budgets or personnel while increasing the time frame that platelets can be used by dramatically shortening contaminant detection time.
Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C
2017-06-01
For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4 CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Loh, Lip Nam; Gao, Geli; Tuomanen, Elaine I
2017-01-03
The Gram-positive bacterial cell wall (CW) peptidoglycan-teichoic acid complex is released into the host environment during bacterial metabolism or death. It is a highly inflammatory Toll-like receptor 2 (TLR2) ligand, and previous in vivo studies have demonstrated its ability to recapitulate pathological features of pneumonia and meningitis. We report that an actin-dependent pathway is involved in the internalization of the CW by epithelial and endothelial cells, in addition to the previously described platelet-activating factor receptor (PAFr)-dependent uptake pathway. Unlike the PAFr-dependent pathway, which is mediated by clathrin and dynamin and does not lead to signaling, the alternative pathway is sensitive to 5-(N-ethyl-N-isopropyl) amiloride (EIPA) and engenders Rac1, Cdc42, and phosphatidylinositol 3-kinase (PI3K) signaling. Upon internalization by this macropinocytosis-like pathway, CW is trafficked to lysosomes. Intracellular CW trafficking is more complex than previously recognized and suggests multiple points of interaction with and without innate immune signaling. Streptococcus pneumoniae is a major human pathogen infecting the respiratory tract and brain. It is an established model organism for understanding how infection injures the host. During infection or bacterial growth, bacteria shed their cell wall (CW) into the host environment and trigger inflammation. A previous study has shown that CW enters and crosses cell barriers by interacting with a receptor on the surfaces of host cells, termed platelet-activating factor receptor (PAFr). In the present study, by using cells that are depleted of PAFr, we identified a second pathway with features of macropinocytosis, which is a receptor-independent fluid uptake mechanism by cells. Each pathway contributes approximately the same amount of cell wall trafficking, but the PAFr pathway is silent, while the new pathway appears to contribute to the host inflammatory response to CW insult. Copyright © 2017
DEFF Research Database (Denmark)
Gram, T.; Ahrens, Peter; Nielsen, J.P.
1996-01-01
strains of A. lignieresii. The lower detection limit of the PCR test was 10(3) A. pleuropneumoniae CFU/PCR test tube and was not affected by addition of 10(6) E. coli CFU/PCR test tube. Mixed bacterial cultures from tonsils of 101 pigs from 9 different herds were tested by culture and by PCR using four...
Kulkarni, Sayali; Misra, Chitra Seetharam; Gupta, Alka; Ballal, Anand
2016-01-01
ABSTRACT Deinococcus radiodurans and Escherichia coli expressing either PhoN, a periplasmic acid phosphatase, or PhoK, an extracellular alkaline phosphatase, were evaluated for uranium (U) bioprecipitation under two specific geochemical conditions (GCs): (i) a carbonate-deficient condition at near-neutral pH (GC1), and (ii) a carbonate-abundant condition at alkaline pH (GC2). Transmission electron microscopy revealed that recombinant cells expressing PhoN/PhoK formed cell-associated uranyl phosphate precipitate under GC1, whereas the same cells displayed extracellular precipitation under GC2. These results implied that the cell-bound or extracellular location of the precipitate was governed by the uranyl species prevalent at that particular GC, rather than the location of phosphatase. MINTEQ modeling predicted the formation of predominantly positively charged uranium hydroxide ions under GC1 and negatively charged uranyl carbonate-hydroxide complexes under GC2. Both microbes adsorbed 6- to 10-fold more U under GC1 than under GC2, suggesting that higher biosorption of U to the bacterial cell surface under GC1 may lead to cell-associated U precipitation. In contrast, at alkaline pH and in the presence of excess carbonate under GC2, poor biosorption of negatively charged uranyl carbonate complexes on the cell surface might have resulted in extracellular precipitation. The toxicity of U observed under GC1 being higher than that under GC2 could also be attributed to the preferential adsorption of U on cell surfaces under GC1. This work provides a vivid description of the interaction of U complexes with bacterial cells. The findings have implications for the toxicity of various U species and for developing biological aqueous effluent waste treatment strategies. IMPORTANCE The present study provides illustrative insights into the interaction of uranium (U) complexes with recombinant bacterial cells overexpressing phosphatases. This work demonstrates the effects of aqueous
Stimulation of bacterial DNA synthesis by algal exudates in attached algal-bacterial consortia
International Nuclear Information System (INIS)
Murray, R.E.; Cooksey, K.E.; Priscu, J.C.
1986-01-01
Algal-bacterial consortia attached to polystyrene surfaces were prepared in the laboratory by using the marine diatom Amphora coffeaeformis and the marine bacterium Vibrio proteolytica (the approved name of this bacterium is Vibrio proteolyticus. The organisms were attached to the surfaces at cell densities of approximately 5 x 10 4 cells cm -2 (diatoms) and 5 x 10 6 cells cm -2 (bacteria). The algal-bacterial consortia consistently exhibited higher rates of [ 3 H]thymidine incorporation than did biofilms composed solely of bacteria. The rates of [ 3 H]thymidine incorporation by the algal-bacterial consortia were fourfold greater than the rates of incorporation by monobacterial biofilms 16 h after biofilm formation and were 16-fold greater 70 h after biofilm formation. Extracellular material released from the attached Amphora cells supported rates of bacterial activity (0.8 x 10 -21 mol to 17.9 x 10 -21 mol of [ 3 H]thymidine incorporated cell -1 h -1 ) and growth (doubling time, 29.5 to 1.4 days) comparable to values reported for a wide variety of marine and freshwater ecosystems. In the presence of sessile diatom populations, DNA synthesis by attached V. proteolytica cells was light dependent and increased with increasing algal abundance. The metabolic activity of diatoms thus appears to be the rate-limiting process in biofilm development on illuminated surfaces under conditions of low bulk-water dissolved organic carbon
Pérez, María Teresa; Hörtnagl, Paul; Sommaruga, Ruben
2010-01-01
We examined the ability of different freshwater bacterial groups to take up leucine and thymidine in two lakes. Utilization of both substrates by freshwater bacteria was examined at the community level by looking at bulk incorporation rates and at the single-cell level by combining fluorescent in situ hybridization and signal amplification by catalysed reporter deposition with microautoradiography. Our results showed that leucine was taken up by 70–80% of Bacteria-positive cells, whereas only 15–43% of Bacteria-positive cells were able to take up thymidine. When a saturating substrate concentration in combination with a short incubation was used, 80–90% of Betaproteobacteria and 67–79% of Actinobacteria were positive for leucine uptake, whereas thymidine was taken up by bacterial group. Bacterial abundance was a good predictor of the relative contribution of bacterial groups to leucine uptake, whereas when thymidine was used Actinobacteria represented the large majority (> 80%) of the cells taking up this substrate. Increasing the substrate concentration to 100 nM did not affect the percentage of R-BT cells taking up leucine (> 90% even at low concentrations), but moderately increased the fraction of thymidine-positive R-BT cells to a maximum of 35% of the hybridized cells. Our results show that even at very high concentrations, thymidine is not taken up by all, otherwise active, bacterial cells. PMID:19725866
Directory of Open Access Journals (Sweden)
Michelle M. Logsdon
2018-03-01
Full Text Available Model bacteria, such as E. coli and B. subtilis, tightly regulate cell cycle progression to achieve consistent cell size distributions and replication dynamics. Many of the hallmark features of these model bacteria, including lateral cell wall elongation and symmetric growth and division, do not occur in mycobacteria. Instead, mycobacterial growth is characterized by asymmetric polar growth and division. This innate asymmetry creates unequal birth sizes and growth rates for daughter cells with each division, generating a phenotypically heterogeneous population. Although the asymmetric growth patterns of mycobacteria lead to a larger variation in birth size than typically seen in model bacterial populations, the cell size distribution is stable over time. Here, we review the cellular mechanisms of growth, division, and cell cycle progression in mycobacteria in the face of asymmetry and inherent heterogeneity. These processes coalesce to control cell size. Although Mycobacterium smegmatis and Mycobacterium bovis Bacillus Calmette-Guérin (BCG utilize a novel model of cell size control, they are similar to previously studied bacteria in that initiation of DNA replication is a key checkpoint for cell division. We compare the regulation of DNA replication initiation and strategies used for cell size homeostasis in mycobacteria and model bacteria. Finally, we review the importance of cellular organization and chromosome segregation relating to the physiology of mycobacteria and consider how new frameworks could be applied across the wide spectrum of bacterial diversity.
Long-Term Bacterial Dynamics in a Full-Scale Drinking Water Distribution System.
Prest, E I; Weissbrodt, D G; Hammes, F; van Loosdrecht, M C M; Vrouwenvelder, J S
2016-01-01
Large seasonal variations in microbial drinking water quality can occur in distribution networks, but are often not taken into account when evaluating results from short-term water sampling campaigns. Temporal dynamics in bacterial community characteristics were investigated during a two-year drinking water monitoring campaign in a full-scale distribution system operating without detectable disinfectant residual. A total of 368 water samples were collected on a biweekly basis at the water treatment plant (WTP) effluent and at one fixed location in the drinking water distribution network (NET). The samples were analysed for heterotrophic plate counts (HPC), Aeromonas plate counts, adenosine-tri-phosphate (ATP) concentrations, and flow cytometric (FCM) total and intact cell counts (TCC, ICC), water temperature, pH, conductivity, total organic carbon (TOC) and assimilable organic carbon (AOC). Multivariate analysis of the large dataset was performed to explore correlative trends between microbial and environmental parameters. The WTP effluent displayed considerable seasonal variations in TCC (from 90 × 103 cells mL-1 in winter time up to 455 × 103 cells mL-1 in summer time) and in bacterial ATP concentrations (water temperature variations. These fluctuations were not detected with HPC and Aeromonas counts. The water in the network was predominantly influenced by the characteristics of the WTP effluent. The increase in ICC between the WTP effluent and the network sampling location was small (34 × 103 cells mL-1 on average) compared to seasonal fluctuations in ICC in the WTP effluent. Interestingly, the extent of bacterial growth in the NET was inversely correlated to AOC concentrations in the WTP effluent (Pearson's correlation factor r = -0.35), and positively correlated with water temperature (r = 0.49). Collecting a large dataset at high frequency over a two year period enabled the characterization of previously undocumented seasonal dynamics in the distribution
Szpilewska, Hanna; Czyz, Agata; Wegrzyn, Grzegorz
2003-11-01
The origin and function of bioluminescence was considered a problematic question of the Charles Darwin theory. Early evolution of bacterial luminescence and its current physiological importance seem to be especially mysterious. Recently, it was proposed that stimulation of DNA repair may be a physiological role for production of light by bacterial cells. On the other hand, it was also proposed that primary role of luminescent systems could be detoxification of the deleterious oxygen derivatives. Although some previous results might suggest that this hypothesis can be correct, until now experimental evidence for such a mechanism operating in bacterial cells and having physiological importance was generally lacking. Here we demonstrate that in the presence of various oxidants (hydrogen peroxide, cumene hydroperoxide, t-butyl hydroperoxide, and ferrous ions) at certain concentrations in the culture medium, growth of Vibrio harveyi mutants luxA and luxB, but not of the mutant luxD, is severely impaired relative to wild-type bacteria. This deleterious effect of oxidants on the mutants luxA and luxB could be significantly reduced by addition of the antioxidants A-TEMPO or 40H-TEMPO. We conclude that bacterial luciferase may indeed play a physiological role in the protection of cells against oxidative stress.
Directory of Open Access Journals (Sweden)
Natália Malaguti
2015-01-01
Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.
Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.
Escobedo-Hinojosa, Wendy; Pardo-López, Liliana
2017-07-31
Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Carlson Petteri
2010-10-01
Full Text Available Abstract Background Arcanobacterium haemolyticum is an emerging bacterial pathogen, causing pharyngitis and more invasive infections. This organism expresses an unusual phospholipase D (PLD, which we propose promotes bacterial pathogenesis through its action on host cell membranes. The pld gene is found on a genomic region of reduced %G + C, suggesting recent horizontal acquisition. Results Recombinant PLD rearranged HeLa cell lipid rafts in a dose-dependent manner and this was inhibited by cholesterol sequestration. PLD also promoted host cell adhesion, as a pld mutant had a 60.3% reduction in its ability to adhere to HeLa cells as compared to the wild type. Conversely, the pld mutant appeared to invade HeLa cells approximately two-fold more efficiently as the wild type. This finding was attributable to a significant loss of host cell viability following secretion of PLD from intracellular bacteria. As determined by viability assay, only 15.6% and 82.3% of HeLa cells remained viable following invasion by the wild type or pld mutant, respectively, as compared to untreated HeLa cells. Transmission electron microscopy of HeLa cells inoculated with A. haemolyticum strains revealed that the pld mutant was contained within intracellular vacuoles, as compared to the wild type, which escaped the vacuole. Wild type-infected HeLa cells also displayed the hallmarks of necrosis. Similarly inoculated HeLa cells displayed no signs of apoptosis, as measured by induction of caspase 3/7, 8 or 9 activities. Conclusions These data indicate that PLD enhances bacterial adhesion and promotes host cell necrosis following invasion, and therefore, may be important in the disease pathogenesis of A. haemolyticum infections.
Laser capture microdissection of bacterial cells targeted by fluorescence in situ hybridization
DEFF Research Database (Denmark)
Schou, Kirstine Klitgaard; Mølbak, Lars; Jensen, Tim Kåre
2005-01-01
RNA gene PCR was performed from the dissected microcolonies, and the subsequent DNA sequence analysis identified the dissected bacterial cells as belonging to the Brachyspira aalborgi cluster 1. The advantage of this technique is the ability to combine the histological recognition of the specific bacteria......Direct cultivation-independent sequence retrieval of unidentified bacteria from histological tissue sections has been limited by the difficulty of selectively isolating specific bacteria from a complex environment. Here, a new DNA isolation approach is presented for prokaryotic cells...
Crowe, Andrew; Bebawy, Mary
2012-08-15
The aim of this project was to show elevated P-glycoprotein (P-gp) expression decreasing bacterial association with LS174T human gastrointestinal cells, and that this effect could be reversed upon blocking functional P-gp efflux. Staphylococcus aureus, Klebsiella pneumoniae, Pseudomonas aeruginosa, Lactobacillus acidophilus and numerous strains of Escherichia coli, from commensal to enteropathogenic and enterohaemorrhagic strains (O157:H7) were fluorescently labelled and incubated on LS174T cultures either with or without P-gp amplification using rifampicin. PSC-833 was used as a potent functional P-gp blocking agent. Staphylococcus and Pseudomonas displayed the greatest association with the LS174T cells. Surprisingly, lactobacilli retained more fluorescence than enteropathogenic-E. coli in this system. Irrespective of attachment differences between the bacterial species, the increase in P-gp protein expression decreased bacterial fluorescence by 25-30%. This included the GFP-labelled E. coli, and enterohaemorrhagic E. coli (O157:H7). Blocking P-gp function through the co-administration of PSC-833 increased the amount of bacteria associated with P-gp expressing LS174T cells back to control levels. As most bacteria were affected to the same degree, irrespective of pathogenicity, it is unlikely that P-gp has a direct influence on adhesion of bacteria, and instead P-gp may be playing an indirect role by secreting a bank of endogenous factors or changing the local environment to one less suited to bacterial growth in general. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
Specific labeling of peptidoglycan precursors as a tool for bacterial cell wall studies
van Dam, V.; Olrichs, N.K.; Breukink, E.J.
2009-01-01
Wall chart: The predominant component of the bacterial cell wall, peptidoglycan, consists of long alternating stretches of aminosugar subunits interlinked in a large three-dimensional network and is formed from precursors through several cytosolic and membrane-bound steps. The high tolerance of the
Bacterial decontamination using ambient pressure nonthermal discharges
Energy Technology Data Exchange (ETDEWEB)
Birmingham, J.G.; Hammerstrom, D.J.
2000-02-01
Atmospheric pressure nonthermal plasmas can efficiently deactivate bacteria in gases, liquids, and on surfaces, as well as can decompose hazardous chemicals. This paper focuses on the changes to bacterial spores and toxic biochemical compounds, such as mycotoxins, after their treatment in ambient pressure discharges. The ability of nonthermal plasmas to decompose toxic chemicals and deactivate hazardous biological materials has been applied to sterilizing medical instruments, ozonating water, and purifying air. In addition, the fast lysis of bacterial spores and other cells has led us to include plasma devices within pathogen detection instruments, where nucleic acids must be accessed. Decontaminating chemical and biological warfare materials from large, high value targets such as building surfaces, after a terrorist attack, are especially challenging. A large area plasma decontamination technology is described.
Directory of Open Access Journals (Sweden)
Andy Hesketh
2017-07-01
Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.
Directory of Open Access Journals (Sweden)
Rohit Mittal
Full Text Available While much of cancer immunology research has focused on anti-tumor immunity both systemically and within the tumor microenvironment, little is known about the impact of pre-existing malignancy on pathogen-specific immune responses. Here, we sought to characterize the antigen-specific CD8+ T cell response following a bacterial infection in the setting of pre-existing pancreatic adenocarcinoma. Mice with established subcutaneous pancreatic adenocarcinomas were infected with Listeria monocytogenes, and antigen-specific CD8+ T cell responses were compared to those in control mice without cancer. While the kinetics and magnitude of antigen-specific CD8+ T cell expansion and accumulation was comparable between the cancer and non-cancer groups, bacterial antigen-specific CD8+ T cells and total CD4+ and CD8+ T cells in cancer mice exhibited increased expression of the coinhibitory receptors BTLA, PD-1, and 2B4. Furthermore, increased inhibitory receptor expression was associated with reduced IFN-γ and increased IL-2 production by bacterial antigen-specific CD8+ T cells in the cancer group. Taken together, these data suggest that cancer's immune suppressive effects are not limited to the tumor microenvironment, but that pre-existing malignancy induces phenotypic exhaustion in T cells by increasing expression of coinhibitory receptors and may impair pathogen-specific CD8+ T cell functionality and differentiation.
The bacterial actin MreB rotates, and rotation depends on cell-wall assembly.
van Teeffelen, Sven; Wang, Siyuan; Furchtgott, Leon; Huang, Kerwyn Casey; Wingreen, Ned S; Shaevitz, Joshua W; Gitai, Zemer
2011-09-20
Bacterial cells possess multiple cytoskeletal proteins involved in a wide range of cellular processes. These cytoskeletal proteins are dynamic, but the driving forces and cellular functions of these dynamics remain poorly understood. Eukaryotic cytoskeletal dynamics are often driven by motor proteins, but in bacteria no motors that drive cytoskeletal motion have been identified to date. Here, we quantitatively study the dynamics of the Escherichia coli actin homolog MreB, which is essential for the maintenance of rod-like cell shape in bacteria. We find that MreB rotates around the long axis of the cell in a persistent manner. Whereas previous studies have suggested that MreB dynamics are driven by its own polymerization, we show that MreB rotation does not depend on its own polymerization but rather requires the assembly of the peptidoglycan cell wall. The cell-wall synthesis machinery thus either constitutes a novel type of extracellular motor that exerts force on cytoplasmic MreB, or is indirectly required for an as-yet-unidentified motor. Biophysical simulations suggest that one function of MreB rotation is to ensure a uniform distribution of new peptidoglycan insertion sites, a necessary condition to maintain rod shape during growth. These findings both broaden the view of cytoskeletal motors and deepen our understanding of the physical basis of bacterial morphogenesis.
Stochastic adaptation and fold-change detection: from single-cell to population behavior
Directory of Open Access Journals (Sweden)
Leier André
2011-02-01
Full Text Available Abstract Background In cell signaling terminology, adaptation refers to a system's capability of returning to its equilibrium upon a transient response. To achieve this, a network has to be both sensitive and precise. Namely, the system must display a significant output response upon stimulation, and later on return to pre-stimulation levels. If the system settles at the exact same equilibrium, adaptation is said to be 'perfect'. Examples of adaptation mechanisms include temperature regulation, calcium regulation and bacterial chemotaxis. Results We present models of the simplest adaptation architecture, a two-state protein system, in a stochastic setting. Furthermore, we consider differences between individual and collective adaptive behavior, and show how our system displays fold-change detection properties. Our analysis and simulations highlight why adaptation needs to be understood in terms of probability, and not in strict numbers of molecules. Most importantly, selection of appropriate parameters in this simple linear setting may yield populations of cells displaying adaptation, while single cells do not. Conclusions Single cell behavior cannot be inferred from population measurements and, sometimes, collective behavior cannot be determined from the individuals. By consequence, adaptation can many times be considered a purely emergent property of the collective system. This is a clear example where biological ergodicity cannot be assumed, just as is also the case when cell replication rates are not homogeneous, or depend on the cell state. Our analysis shows, for the first time, how ergodicity cannot be taken for granted in simple linear examples either. The latter holds even when cells are considered isolated and devoid of replication capabilities (cell-cycle arrested. We also show how a simple linear adaptation scheme displays fold-change detection properties, and how rupture of ergodicity prevails in scenarios where transitions between
Methods for analysis of bacterial autoinducer-2 production.
Taga, Michiko E
2005-07-01
The quorum-sensing signal molecule autoinducer-2 (AI-2) is produced by over 50 diverse bacterial species and controls many different processes, including antibiotic production, biofilm formation, and virulence. AI-2 production often varies according to growth phase, media conditions, and the presence of specific factors. This unit describes a biological assay for AI-2 activity produced by a bacterial strain of interest. The assay employs an AI-2 reporter strain, Vibrio harveyi BB170, which produces light in response to AI-2. In the first stage of the assay, culture fluids of the bacterial strain of interest are collected over a time course of growth and filtered to remove cells. In the next stage, these culture fluids are mixed with BB170, and the light produced in response to AI-2 in the culture fluids is measured using a luminometer. BB170 is exquisitely sensitive to AI-2, and therefore, even low amounts of AI-2 can be detected using this bioassay.
Pashmakova, Medora B; Piccione, Julie; Bishop, Micah A; Nelson, Whitney R; Lawhon, Sara D
2017-05-01
OBJECTIVE To evaluate the agreement between results of microscopic examination and bacterial culture of bile samples from dogs and cats with hepatobiliary disease for detection of bactibilia. DESIGN Cross-sectional study. ANIMALS 31 dogs and 21 cats with hepatobiliary disease for which subsequent microscopic examination and bacterial culture of bile samples was performed from 2004 through 2014. PROCEDURES Electronic medical records of included dogs and cats were reviewed to extract data regarding diagnosis, antimicrobials administered, and results of microscopic examination and bacterial culture of bile samples. Agreement between these 2 diagnostic tests was assessed by calculation of the Cohen κ value. RESULTS 17 (33%) dogs and cats had bactibilia identified by microscopic examination of bile samples, and 11 (21%) had bactibilia identified via bacterial culture. Agreement between these 2 tests was substantial (percentage agreement [positive and negative results], 85%; κ = 0.62; 95% confidence interval, 0.38 to 0.89) and improved to almost perfect when calculated for only animals that received no antimicrobials within 24 hours prior to sample collection (percentage agreement, 94%; κ = 0.84; 95% confidence interval, 0.61 to 1.00). CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that agreement between microscopic examination and bacterial culture of bile samples for detection of bactibilia is optimized when dogs and cats are not receiving antimicrobials at the time of sample collection. Concurrent bacterial culture and microscopic examination of bile samples are recommended for all cats and dogs evaluated for hepatobiliary disease.
Directory of Open Access Journals (Sweden)
Grégory Francius
Full Text Available The physicochemical properties and dynamics of bacterial envelope, play a major role in bacterial activity. In this study, the morphological, nanomechanical and electrohydrodynamic properties of Escherichia coli K-12 mutant cells were thoroughly investigated as a function of bulk medium ionic strength using atomic force microscopy (AFM and electrokinetics (electrophoresis. Bacteria were differing according to genetic alterations controlling the production of different surface appendages (short and rigid Ag43 adhesins, longer and more flexible type 1 fimbriae and F pilus. From the analysis of the spatially resolved force curves, it is shown that cells elasticity and turgor pressure are not only depending on bulk salt concentration but also on the presence/absence and nature of surface appendage. In 1 mM KNO(3, cells without appendages or cells surrounded by Ag43 exhibit large Young moduli and turgor pressures (∼700-900 kPa and ∼100-300 kPa respectively. Under similar ionic strength condition, a dramatic ∼50% to ∼70% decrease of these nanomechanical parameters was evidenced for cells with appendages. Qualitatively, such dependence of nanomechanical behavior on surface organization remains when increasing medium salt content to 100 mM, even though, quantitatively, differences are marked to a much smaller extent. Additionally, for a given surface appendage, the magnitude of the nanomechanical parameters decreases significantly when increasing bulk salt concentration. This effect is ascribed to a bacterial exoosmotic water loss resulting in a combined contraction of bacterial cytoplasm together with an electrostatically-driven shrinkage of the surface appendages. The former process is demonstrated upon AFM analysis, while the latter, inaccessible upon AFM imaging, is inferred from electrophoretic data interpreted according to advanced soft particle electrokinetic theory. Altogether, AFM and electrokinetic results clearly demonstrate the
International Nuclear Information System (INIS)
Economou, Nicoleta J.; Zentner, Isaac J.; Lazo, Edwin; Jakoncic, Jean; Stojanoff, Vivian; Weeks, Stephen D.; Grasty, Kimberly C.; Cocklin, Simon; Loll, Patrick J.
2013-01-01
Using a carrier-protein strategy, the structure of teicoplanin bound to its bacterial cell-wall target has been determined. The structure reveals the molecular determinants of target recognition, flexibility in the antibiotic backbone and intrinsic radiation sensitivity of teicoplanin. Multidrug-resistant bacterial infections are commonly treated with glycopeptide antibiotics such as teicoplanin. This drug inhibits bacterial cell-wall biosynthesis by binding and sequestering a cell-wall precursor: a d-alanine-containing peptide. A carrier-protein strategy was used to crystallize the complex of teicoplanin and its target peptide by fusing the cell-wall peptide to either MBP or ubiquitin via native chemical ligation and subsequently crystallizing the protein–peptide–antibiotic complex. The 2.05 Å resolution MBP–peptide–teicoplanin structure shows that teicoplanin recognizes its ligand through a combination of five hydrogen bonds and multiple van der Waals interactions. Comparison of this teicoplanin structure with that of unliganded teicoplanin reveals a flexibility in the antibiotic peptide backbone that has significant implications for ligand recognition. Diffraction experiments revealed an X-ray-induced dechlorination of the sixth amino acid of the antibiotic; it is shown that teicoplanin is significantly more radiation-sensitive than other similar antibiotics and that ligand binding increases radiosensitivity. Insights derived from this new teicoplanin structure may contribute to the development of next-generation antibacterials designed to overcome bacterial resistance
Measurement of bacterial capture and phagosome maturation of Kupffer cells by intravital microscopy
Surewaard, Bas G.J.; Kubes, Paul
2017-01-01
It is central to the field of bacterial pathogenesis to define how bacteria are killed by phagocytic cells. During phagocytosis, the microbe is localized to the phagolysosome where crucial defense mechanisms such as acidification and production of reactive oxygen species (ROS) are initiated. This
Tian, Qian; Feng, Jian-Jun; Hu, Jie; Zhao, Wen-Jun
2016-10-14
In recent years, use of the DNA-intercalating dye propidium monoazide (PMA) in real-time PCR has been reported as a novel method to detect viable bacteria in different types of samples, such as food, environmental, and microbiological samples. In this study, viable cells of Acidovorax citrulli, the causal agent of bacterial seedling blight and fruit blotch, were selectively detected and differentiated from dead cells by real-time fluorescent polymerase chain reaction amplification after the bacterial solution was treated with the DNA-binding dye PMA. The primers and TaqMan probe were based on the A. citrulli genome (Aave_1909, Gene ID: 4669443) and were highly specific for A. citrulli. The detection threshold of this assay was 10 3 colony-forming units per mL (CFU/mL) in pure cell suspensions containing viable and dead cells and infected watermelon seeds. Application of this assay enables the selective detection of viable cells of A. citrulli and facilitates monitoring of the pathogen in watermelon and melon seeds.
Rugged single domain antibody detection elements for Bacillus anthracis spores and vegetative cells.
Directory of Open Access Journals (Sweden)
Scott A Walper
Full Text Available Significant efforts to develop both laboratory and field-based detection assays for an array of potential biological threats started well before the anthrax attacks of 2001 and have continued with renewed urgency following. While numerous assays and methods have been explored that are suitable for laboratory utilization, detection in the field is often complicated by requirements for functionality in austere environments, where limited cold-chain facilities exist. In an effort to overcome these assay limitations for Bacillus anthracis, one of the most recognizable threats, a series of single domain antibodies (sdAbs were isolated from a phage display library prepared from immunized llamas. Characterization of target specificity, affinity, and thermal stability was conducted for six sdAb families isolated from rounds of selection against the bacterial spore. The protein target for all six sdAb families was determined to be the S-layer protein EA1, which is present in both vegetative cells and bacterial spores. All of the sdAbs examined exhibited a high degree of specificity for the target bacterium and its spore, with affinities in the nanomolar range, and the ability to refold into functional antigen-binding molecules following several rounds of thermal denaturation and refolding. This research demonstrates the capabilities of these sdAbs and their potential for integration into current and developing assays and biosensors.
Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu
2017-08-01
Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Micro Corona Ionizer as an Ozone Source for Bacterial Cell Lysis
Lee, Eun-Hee; Lim, Hyun Jeong; Chua, Beelee; Son, Ahjeong
2015-04-01
DNA extraction is a critical process of DNA assays including polymerase chain reaction (PCR), microarrays, molecular cloning, and DNA hybridization which has been well established and can be implemented by commercial kits. DNA extraction involves cell lysis, precipitation, and purification through the combination of physical and chemical processes. Cell lysis is essential to high DNA recovery yield which can be achieved via a variety of physical, chemical, and enzymatic methods. However, these methods were originally developed for bioassays that were labor intensive, time consuming, and vulnerable to contamination and inhibition. Here, we proposed to employ a micro corona ionizer as an ozone source to lyse bacterial cells. Ozone has been well known and used as a disinfectant which allows cell lysis and DNA extraction. Previously, we have shown that a micro corona ionizer is capable of generating a significant amount of ozone. In this study, we employed the micro corona ionizer for the bacterial cell lysis which consists of a 50 μm diameter cantilever wire as the discharge cathode and a 50 μm thick copper foil as anode. Applied voltages varied from 1900 to 2200 V with corresponding corona currents from 16 to 28 μA. The resultant ozone (concentration > 0.14 ppm) generated from the micro corona ionizer was bubbled into the sample via a miniature pump. We demonstrated the cell lysis of Pseudomonas putida as the target bacterium using the micro corona ionizer. At a flow rate of 38 ml/min and applied corona voltage of 2000 V, 98.5 ± 0.2% lysis (normalized to sonication result) was achieved after 10 min. In comparison, untreated and air-treated samples showed normalized % lysis of 11.9 ± 2.4 and 36.1 ± 1.7%, respectively. We also showed that the cell lysis efficiency could be significantly increased by increasing the flow rate and the applied corona voltage. By comparing the experimental results for continuous and pulsed treatment, we verified that the percentage of
Liu, Hai-Tao; Wen, Zhi-Yu; Xu, Yi; Shang, Zheng-Guo; Peng, Jin-Lan; Tian, Peng
2017-09-01
In this paper, an integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection was purposed based on microfluidic chips dielectrophoresis technique and electrochemical impedance detection principle. The microsystems include microfluidic chip, main control module, and drive and control module, and signal detection and processing modulet and result display unit. The main control module produce the work sequence of impedance detection system parts and achieve data communication functions, the drive and control circuit generate AC signal which amplitude and frequency adjustable, and it was applied on the foodborne pathogens impedance analysis microsystems to realize the capture enrichment and impedance detection. The signal detection and processing circuit translate the current signal into impendence of bacteria, and transfer to computer, the last detection result is displayed on the computer. The experiment sample was prepared by adding Escherichia coli standard sample into chicken sample solution, and the samples were tested on the dielectrophoresis chip capture enrichment and in-situ impedance detection microsystems with micro-array electrode microfluidic chips. The experiments show that the Escherichia coli detection limit of microsystems is 5 × 104 CFU/mL and the detection time is within 6 min in the optimization of voltage detection 10 V and detection frequency 500 KHz operating conditions. The integrated microfluidic analysis microsystems laid the solid foundation for rapid real-time in-situ detection of bacteria.
Development of a cell microarray chip for detection of circulating tumor cells
Yamamura, S.; Yatsushiro, S.; Abe, K.; Baba, Y.; Kataoka, M.
2012-03-01
Detection of circulating tumor cells (CTCs) in the peripheral blood of metastatic cancer patients has clinical significance in earlier diagnosis of metastases. In this study, a novel cell microarray chip for accurate and rapid detection of tumor cells from human leukocytes was developed. The chip with 20,944 microchambers (105 μm diameter and 50 μm depth) was made from polystyrene, and the surface was rendered to hydrophilic by means of reactive-ion etching, which led to the formation of mono-layers of leukocytes on the microchambers. As the model of CTCs detection, we spiked human bronchioalveolar carcinoma (H1650) cells into human T lymphoblastoid leukemia (CEM) cells suspension and detected H1650 cells using the chip. A CEM suspension contained with H1650 cells was dispersed on the chip surface, followed by 10 min standing to allow the cells to settle down into the microchambers. About 30 CEM cells were accommodated in each microchamber, over 600,000 CEM cells in total being on a chip. We could detect 1 H1650 cell per 106 CEM cells on the microarray by staining with fluorescence-conjugated antibody (Anti-Cytokeratin) and cell membrane marker (DiD). Thus, this cell microarray chip has highly potential to be a novel tool of accurate and rapid detection of CTCs.
Cell Phone Detection Techniques
Energy Technology Data Exchange (ETDEWEB)
Pratt, Richard M.; Bunch, Kyle J.; Puzycki, David J.; Slaugh, Ryan W.; Good, Morris S.; McMakin, Douglas L.
2007-10-01
A team composed of Rick Pratt, Dave Puczyki, Kyle Bunch, Ryan Slaugh, Morris Good, and Doug McMakin teamed together to attempt to exploit cellular telephone features and detect if a person was carrying a cellular telephone into a Limited Area. The cell phone’s electromagnetic properties were measured, analyzed, and tested in over 10 different ways to determine if an exploitable signature exists. The method that appears to have the most potential for success without adding an external tag is to measure the RF spectrum, not in the cell phone band, but between 240 and 400MHz. Figures 1- 7 show the detected signal levels from cell phones from three different manufacturers.
Soluble triggering receptor expressed on myeloid cells 1: a biomarker for bacterial meningitis
Determann, Rogier M.; Weisfelt, Martijn; de Gans, Jan; van der Ende, Arie; Schultz, Marcus J.; van de Beek, Diederik
2006-01-01
OBJECTIVE: To evaluate whether soluble triggering receptor expressed on myeloid cells 1 (sTREM-1) in CSF can serve as a biomarker for the presence of bacterial meningitis and outcome in patients with this disease. DESIGN: Retrospective study of diagnostic accuracy. SETTING AND PATIENTS: CSF was
Bacterial biofilms: prokaryotic adventures in multicellularity
DEFF Research Database (Denmark)
Webb, J.S.; Givskov, Michael Christian; Kjelleberg, S.
2003-01-01
The development of bacterial biofilms includes both the initial social behavior of undifferentiated cells, as well as cell death and differentiation in the mature biofilm, and displays several striking similarities with higher organisms. Recent advances in the field provide new insight...... into differentiation and cell death events in bacterial biofilm development and propose that biofilms have an unexpected level of multicellularity....
Detection of antibodies to bacterial cell wall peptidoglycan in human sera
International Nuclear Information System (INIS)
Heymer, B.; Schleifer, K.H.; Read, S.; Zabriskie, J.B.; Krause, R.M.
1976-01-01
A radioimmunoassay has been developed for the measurement of antibodies to peptidoglycan in human sera including patients with rheumatic feaver and juvenile rheumatoid arthritis. The assay is based on the percentage of binding of the hapten 125 I-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala, the major peptide determinant of peptidoglycan. Because of differences in the avidity of the antibodies in different sera, the amount of antibody was expressed as pentapeptide hapten-binding capacity (pentapeptide-HBC in ng/ml of serum). Fourteen out of 105 normal blood donors had a pentapeptide-HBC value greater than or equal to 75 ng/ml serum. Values in healthy children 5 to 18 years of age were less than or equal to 50 ng/ml. Sixty-eight percent of the individuals with rheumatic fever had values greater than or equal to 75 ng/ml, an indication that streptococcal infections can stimulate an immune response to peptidoglycan. Thirty-five percent of the patients with juvenile rheumatoid arthritis had values greater than or equal to 75 ng/ml. Such a finding points to a possible association between bacterial infections and juvenile rheumatoid arthritis
PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor
Directory of Open Access Journals (Sweden)
Leyla Esfandiari
2016-07-01
Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.
Lipid-linked cell wall precursors regulate membrane association of bacterial actin MreB
Schirner, Kathrin; Eun, Ye-Jin; Dion, Mike; Luo, Yun; Helmann, John D.; Garner, Ethan C.; Walker, Suzanne
2014-01-01
Summary The bacterial actin homolog MreB, which is critical for rod shape determination, forms filaments that rotate around the cell width on the inner surface of the cytoplasmic membrane. What determines filament association with the membranes or with other cell wall elongation proteins is not known. Using specific chemical and genetic perturbations while following MreB filament motion, we find that MreB membrane association is an actively regulated process that depends on the presence of li...
Prest, E. I.
2016-01-06
A systematic approach is presented for the assessment of (i) bacterial growth-controlling factors in drinking water and (ii) the impact of distribution conditions on the extent of bacterial growth in full-scale distribution systems. The approach combines (i) quantification of changes in autochthonous bacterial cell concentrations in full-scale distribution systems with (ii) laboratoryscale batch bacterial growth potential tests of drinking water samples under defined conditions. The growth potential tests were done by direct incubation of water samples, without modification of the original bacterial flora, and with flow cytometric quantification of bacterial growth. This method was shown to be reproducible (ca. 4% relative standard deviation) and sensitive (detection of bacterial growth down to 5 μg L-1 of added assimilable organic carbon). The principle of step-wise assessment of bacterial growth-controlling factors was demonstrated on bottled water, shown to be primarily carbon limited at 133 (±18) × 103 cells mL-1 and secondarily limited by inorganic nutrients at 5,500 (±1,700) × 103 cells mL-1. Analysis of the effluent of a Dutch full-scale drinking water treatment plant showed (1) bacterial growth inhibition as a result of end-point chlorination, (2) organic carbon limitation at 192 (±72) × 103 cells mL-1 and (3) inorganic nutrient limitation at 375 (±31) × 103 cells mL-1. Significantly lower net bacterial growth was measured in the corresponding full-scale distribution system (176 (±25) × 103 cells mL-1) than in the laboratory-scale growth potential test of the same water (294 (±35) × 103 cells mL-1), highlighting the influence of distribution on bacterial growth. The systematic approach described herein provides quantitative information on the effect of drinking water properties and distribution system conditions on biological stability, which can assist water utilities in decision-making on treatment or distribution system improvements to
DEFF Research Database (Denmark)
Helweg-Larsen, Jannik; Jensen, Jørgen Skov; Dohn, Birthe
2002-01-01
Pneumocystis jiroveci (formerly known as P. carinii f.sp. hominis) is an opportunistic fungus that causes Pneumocystis pneumonia (PCP) in immunocompromised individuals. Pneumocystis jiroveci can be detected by polymerase chain reaction (PCR). To investigate the clinical importance of a positive P...... Pneumocystis-PCR among HIV-uninfected patients suspected of bacterial pneumonia, a retrospective matched case-control study was conducted....
Directory of Open Access Journals (Sweden)
Law eJodi Woan-Fei
2015-01-01
Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.
International Nuclear Information System (INIS)
Fiedler, Tomas; Salamon, Achim; Adam, Stefanie; Herzmann, Nicole; Taubenheim, Jan; Peters, Kirsten
2013-01-01
Adult mesenchymal stem cells (MSC) are present in several tissues, e.g. bone marrow, heart muscle, brain and subcutaneous adipose tissue. In invasive infections MSC get in contact with bacteria and bacterial components. Not much is known about how bacterial pathogens interact with MSC and how contact to bacteria influences MSC viability and differentiation potential. In this study we investigated the impact of three different wound infection relevant bacteria, Escherichia coli, Staphylococcus aureus, and Streptococcus pyogenes, and the cell wall components lipopolysaccharide (LPS; Gram-negative bacteria) and lipoteichoic acid (LTA; Gram-positive bacteria) on viability, proliferation, and osteogenic as well as adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells (adMSC). We show that all three tested species were able to attach to and internalize into adMSC. The heat-inactivated Gram-negative E. coli as well as LPS were able to induce proliferation and osteogenic differentiation but reduce adipogenic differentiation of adMSC. Conspicuously, the heat-inactivated Gram-positive species showed the same effects on proliferation and adipogenic differentiation, while its cell wall component LTA exhibited no significant impact on adMSC. Therefore, our data demonstrate that osteogenic and adipogenic differentiation of adMSC is influenced in an oppositional fashion by bacterial antigens and that MSC-governed regeneration is not necessarily reduced under infectious conditions. - Highlights: • Staphylococcus aureus, Streptococcus pyogenes and Escherichia coli bind to and internalize into adMSC. • Heat-inactivated cells of these bacterial species trigger proliferation of adMSC. • Heat-inactivated E. coli and LPS induce osteogenic differentiation of adMSC. • Heat-inactivated E. coli and LPS reduce adipogenic differentiation of adMSC. • LTA does not influence adipogenic or osteogenic differentiation of adMSC
Energy Technology Data Exchange (ETDEWEB)
Fiedler, Tomas, E-mail: tomas.fiedler@med.uni-rostock.de [Institute for Medical Microbiology, Virology, and Hygiene, Rostock University Medical Center, Schillingallee 70, D-18057 Rostock (Germany); Salamon, Achim; Adam, Stefanie; Herzmann, Nicole [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany); Taubenheim, Jan [Institute for Medical Microbiology, Virology, and Hygiene, Rostock University Medical Center, Schillingallee 70, D-18057 Rostock (Germany); Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany); Peters, Kirsten [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany)
2013-11-01
Adult mesenchymal stem cells (MSC) are present in several tissues, e.g. bone marrow, heart muscle, brain and subcutaneous adipose tissue. In invasive infections MSC get in contact with bacteria and bacterial components. Not much is known about how bacterial pathogens interact with MSC and how contact to bacteria influences MSC viability and differentiation potential. In this study we investigated the impact of three different wound infection relevant bacteria, Escherichia coli, Staphylococcus aureus, and Streptococcus pyogenes, and the cell wall components lipopolysaccharide (LPS; Gram-negative bacteria) and lipoteichoic acid (LTA; Gram-positive bacteria) on viability, proliferation, and osteogenic as well as adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells (adMSC). We show that all three tested species were able to attach to and internalize into adMSC. The heat-inactivated Gram-negative E. coli as well as LPS were able to induce proliferation and osteogenic differentiation but reduce adipogenic differentiation of adMSC. Conspicuously, the heat-inactivated Gram-positive species showed the same effects on proliferation and adipogenic differentiation, while its cell wall component LTA exhibited no significant impact on adMSC. Therefore, our data demonstrate that osteogenic and adipogenic differentiation of adMSC is influenced in an oppositional fashion by bacterial antigens and that MSC-governed regeneration is not necessarily reduced under infectious conditions. - Highlights: • Staphylococcus aureus, Streptococcus pyogenes and Escherichia coli bind to and internalize into adMSC. • Heat-inactivated cells of these bacterial species trigger proliferation of adMSC. • Heat-inactivated E. coli and LPS induce osteogenic differentiation of adMSC. • Heat-inactivated E. coli and LPS reduce adipogenic differentiation of adMSC. • LTA does not influence adipogenic or osteogenic differentiation of adMSC.
Modeling the cost and benefit of proteome regulation in a growing bacterial cell
Sharma, Pooja; Pratim Pandey, Parth; Jain, Sanjay
2018-07-01
Escherichia coli cells differentially regulate the production of metabolic and ribosomal proteins in order to stay close to an optimal growth rate in different environments, and exhibit the bacterial growth laws as a consequence. We present a simple mathematical model of a growing-dividing cell in which an internal dynamical mechanism regulates the allocation of proteomic resources between different protein sectors. The model allows an endogenous determination of the growth rate of the cell as a function of cellular and environmental parameters, and reproduces the bacterial growth laws. We use the model and its variants to study the balance between the cost and benefit of regulation. A cost is incurred because cellular resources are diverted to produce the regulatory apparatus. We show that there is a window of environments or a ‘niche’ in which the unregulated cell has a higher fitness than the regulated cell. Outside this niche there is a large space of constant and time varying environments in which regulation is an advantage. A knowledge of the ‘niche boundaries’ allows one to gain an intuitive understanding of the class of environments in which regulation is an advantage for the organism and which would therefore favour the evolution of regulation. The model allows us to determine the ‘niche boundaries’ as a function of cellular parameters such as the size of the burden of the regulatory apparatus. This class of models may be useful in elucidating various tradeoffs in cells and in making in-silico predictions relevant for synthetic biology.
Bacterial community affects toxin production by Gymnodinium catenatum.
Directory of Open Access Journals (Sweden)
Maria E Albinsson
Full Text Available The paralytic shellfish toxin (PST-producing dinoflagellate Gymnodinium catenatum grows in association with a complex marine bacterial community that is both essential for growth and can alter culture growth dynamics. Using a bacterial community replacement approach, we examined the intracellular PST content, production rate, and profile of G. catenatum cultures grown with bacterial communities of differing complexity and composition. Clonal offspring were established from surface-sterilized resting cysts (produced by sexual crosses of strain GCDE06 and strain GCLV01 and grown with: 1 complex bacterial communities derived from each of the two parent cultures; 2 simplified bacterial communities composed of the G. catenatum-associated bacteria Marinobacter sp. strain DG879 or Alcanivorax sp. strain DG881; 3 a complex bacterial community associated with an untreated, unsterilized sexual cross of the parents. Toxin content (STX-equivalent per cell of clonal offspring (134-197 fmol STX cell(-1 was similar to the parent cultures (169-206 fmol STX cell(-1, however cultures grown with single bacterial types contained less toxin (134-146 fmol STX cell(-1 than offspring or parent cultures grown with more complex mixed bacterial communities (152-176 fmol STX cell(-1. Specific toxin production rate (fmol STX day(-1 was strongly correlated with culture growth rate. Net toxin production rate (fmol STX cell(-1 day(-1 did not differ among treatments, however, mean net toxin production rate of offspring was 8-fold lower than the parent cultures, suggesting that completion of the sexual lifecycle in laboratory cultures leads to reduced toxin production. The PST profiles of offspring cultures were most similar to parent GCDE06 with the exception of cultures grown with Marinobacter sp. DG879 which produced higher proportions of dcGTX2+3 and GC1+2, and lower proportions of C1+2 and C3+4. Our data demonstrate that the bacterial community can alter intracellular STX
Bacterial community affects toxin production by Gymnodinium catenatum.
Albinsson, Maria E; Negri, Andrew P; Blackburn, Susan I; Bolch, Christopher J S
2014-01-01
The paralytic shellfish toxin (PST)-producing dinoflagellate Gymnodinium catenatum grows in association with a complex marine bacterial community that is both essential for growth and can alter culture growth dynamics. Using a bacterial community replacement approach, we examined the intracellular PST content, production rate, and profile of G. catenatum cultures grown with bacterial communities of differing complexity and composition. Clonal offspring were established from surface-sterilized resting cysts (produced by sexual crosses of strain GCDE06 and strain GCLV01) and grown with: 1) complex bacterial communities derived from each of the two parent cultures; 2) simplified bacterial communities composed of the G. catenatum-associated bacteria Marinobacter sp. strain DG879 or Alcanivorax sp. strain DG881; 3) a complex bacterial community associated with an untreated, unsterilized sexual cross of the parents. Toxin content (STX-equivalent per cell) of clonal offspring (134-197 fmol STX cell(-1)) was similar to the parent cultures (169-206 fmol STX cell(-1)), however cultures grown with single bacterial types contained less toxin (134-146 fmol STX cell(-1)) than offspring or parent cultures grown with more complex mixed bacterial communities (152-176 fmol STX cell(-1)). Specific toxin production rate (fmol STX day(-1)) was strongly correlated with culture growth rate. Net toxin production rate (fmol STX cell(-1) day(-1)) did not differ among treatments, however, mean net toxin production rate of offspring was 8-fold lower than the parent cultures, suggesting that completion of the sexual lifecycle in laboratory cultures leads to reduced toxin production. The PST profiles of offspring cultures were most similar to parent GCDE06 with the exception of cultures grown with Marinobacter sp. DG879 which produced higher proportions of dcGTX2+3 and GC1+2, and lower proportions of C1+2 and C3+4. Our data demonstrate that the bacterial community can alter intracellular STX
Kaur, Ravinder; Wischmeyer, Jareth; Morris, Matthew; Pichichero, Michael E
2017-11-01
We compared the recovery of potential respiratory bacterial pathogens and normal flora from nasopharyngeal specimens collected from children during health and at the onset of acute otitis media (AOM) by selective direct-plating and overnight broth-enrichment. Overall, 3442 nasal wash (NW) samples collected from young children were analysed from a 10-year prospective study. NWs were cultured by (1) direct-plating to TSAII/5 % sheep blood agar and chocolate agar plates and (2) overnight broth-enrichment in BacT/ALERT SA-broth followed by plating. Standard microbiology techniques were applied to identify three dominant respiratory bacterial pathogens: Streptococcus pneumoniae (Spn), Haemophilus influenzae (Hflu) and Moraxella catarrhalis (Mcat) as well as two common nasal flora, Staphylococcus aureus (SA) and alpha-haemolytic Streptococci (AHS).Results/Key findings. Direct-plating of NW resulted in isolation of Spn from 37.8 %, Hflu from 13.6 % and Mcat from 33.2 % of samples. In comparison, overnight broth-enrichment isolated fewer Spn (30.1 %), Hflu (6.2 %) and Mcat (16.2 %) (Penrichment resulted in significant increased isolation of SA (6.0 %) and AHS (30.1 %) (Penrichment when samples were collected from healthy children but not during AOM. In middle ear fluids (MEF) at the onset of AOM, broth-enrichment resulted in higher recovery of Spn (+10.4 %, Penrichment significantly reduces the accurate detection of bacterial respiratory pathogens and increases identification of SA and AHS in NW. Broth-enrichment improves detection of bacterial respiratory pathogens in MEF samples.
Bacterial biofilm mechanical properties persist upon antibiotic treatment and survive cell death
International Nuclear Information System (INIS)
Zrelli, K; Galy, O; Henry, N; Latour-Lambert, P; Ghigo, J M; Beloin, C; Kirwan, L
2013-01-01
Bacteria living on surfaces form heterogeneous three-dimensional consortia known as biofilms, where they exhibit many specific properties one of which is an increased tolerance to antibiotics. Biofilms are maintained by a polymeric network and display physical properties similar to that of complex fluids. In this work, we address the question of the impact of antibiotic treatment on the physical properties of biofilms based on recently developed tools enabling the in situ mapping of biofilm local mechanical properties at the micron scale. This approach takes into account the material heterogeneity and reveals the spatial distribution of all the small changes that may occur in the structure. With an Escherichia coli biofilm, we demonstrate using in situ fluorescent labeling that the two antibiotics ofloxacin and ticarcillin—targeting DNA replication and membrane assembly, respectively—induced no detectable alteration of the biofilm mechanical properties while they killed the vast majority of the cells. In parallel, we show that a proteolytic enzyme that cleaves extracellular proteins into short peptides, but does not alter bacterial viability in the biofilm, clearly affects the mechanical properties of the biofilm structure, inducing a significant increase of the material compliance. We conclude that conventional biofilm control strategy relying on the use of biocides targeting cells is missing a key target since biofilm structural integrity is preserved. This is expected to efficiently promote biofilm resilience, especially in the presence of persister cells. In contrast, the targeting of polymer network cross-links—among which extracellular proteins emerge as major players—offers a promising route for the development of rational multi-target strategies to fight against biofilms. (paper)
Bacterial biofilm mechanical properties persist upon antibiotic treatment and survive cell death
Zrelli, K.; Galy, O.; Latour-Lambert, P.; Kirwan, L.; Ghigo, J. M.; Beloin, C.; Henry, N.
2013-12-01
Bacteria living on surfaces form heterogeneous three-dimensional consortia known as biofilms, where they exhibit many specific properties one of which is an increased tolerance to antibiotics. Biofilms are maintained by a polymeric network and display physical properties similar to that of complex fluids. In this work, we address the question of the impact of antibiotic treatment on the physical properties of biofilms based on recently developed tools enabling the in situ mapping of biofilm local mechanical properties at the micron scale. This approach takes into account the material heterogeneity and reveals the spatial distribution of all the small changes that may occur in the structure. With an Escherichia coli biofilm, we demonstrate using in situ fluorescent labeling that the two antibiotics ofloxacin and ticarcillin—targeting DNA replication and membrane assembly, respectively—induced no detectable alteration of the biofilm mechanical properties while they killed the vast majority of the cells. In parallel, we show that a proteolytic enzyme that cleaves extracellular proteins into short peptides, but does not alter bacterial viability in the biofilm, clearly affects the mechanical properties of the biofilm structure, inducing a significant increase of the material compliance. We conclude that conventional biofilm control strategy relying on the use of biocides targeting cells is missing a key target since biofilm structural integrity is preserved. This is expected to efficiently promote biofilm resilience, especially in the presence of persister cells. In contrast, the targeting of polymer network cross-links—among which extracellular proteins emerge as major players—offers a promising route for the development of rational multi-target strategies to fight against biofilms.
Directory of Open Access Journals (Sweden)
Letícia Christina Pires Gonçalves
Full Text Available In this proof-of-concept study, we describe the use of the main red beet pigment betanin for the quantification of calcium dipicolinate in bacterial spores, including Bacillus anthracis. In the presence of europium(III ions, betanin is converted to a water-soluble, non-luminescent orange 1∶1 complex with a stability constant of 1.4 × 10(5 L mol(-1. The addition of calcium dipicolinate, largely found in bacterial spores, changes the color of the aqueous solution of [Eu(Bn(+] from orange to magenta. The limit of detection (LOD of calcium dipicolinate is around 2.0 × 10(-6 mol L(-1 and the LOD determined for both spores, B. cereus and B. anthracis, is (1.1 ± 0.3× 10(6 spores mL(-1. This simple, green, fast and low cost colorimetric assay was selective for calcium dipicolinate when compared to several analogous compounds. The importance of this work relies on the potential use of betalains, raw natural pigments, as colorimetric sensors for biological applications.
Visual Estimation of Bacterial Growth Level in Microfluidic Culture Systems.
Kim, Kyukwang; Kim, Seunggyu; Jeon, Jessie S
2018-02-03
Microfluidic devices are an emerging platform for a variety of experiments involving bacterial cell culture, and has advantages including cost and convenience. One inevitable step during bacterial cell culture is the measurement of cell concentration in the channel. The optical density measurement technique is generally used for bacterial growth estimation, but it is not applicable to microfluidic devices due to the small sample volumes in microfluidics. Alternately, cell counting or colony-forming unit methods may be applied, but these do not work in situ; nor do these methods show measurement results immediately. To this end, we present a new vision-based method to estimate the growth level of the bacteria in microfluidic channels. We use Fast Fourier transform (FFT) to detect the frequency level change of the microscopic image, focusing on the fact that the microscopic image becomes rough as the number of cells in the field of view increases, adding high frequencies to the spectrum of the image. Two types of microfluidic devices are used to culture bacteria in liquid and agar gel medium, and time-lapsed images are captured. The images obtained are analyzed using FFT, resulting in an increase in high-frequency noise proportional to the time passed. Furthermore, we apply the developed method in the microfluidic antibiotics susceptibility test by recognizing the regional concentration change of the bacteria that are cultured in the antibiotics gradient. Finally, a deep learning-based data regression is performed on the data obtained by the proposed vision-based method for robust reporting of data.
Visual Estimation of Bacterial Growth Level in Microfluidic Culture Systems
Directory of Open Access Journals (Sweden)
Kyukwang Kim
2018-02-01
Full Text Available Microfluidic devices are an emerging platform for a variety of experiments involving bacterial cell culture, and has advantages including cost and convenience. One inevitable step during bacterial cell culture is the measurement of cell concentration in the channel. The optical density measurement technique is generally used for bacterial growth estimation, but it is not applicable to microfluidic devices due to the small sample volumes in microfluidics. Alternately, cell counting or colony-forming unit methods may be applied, but these do not work in situ; nor do these methods show measurement results immediately. To this end, we present a new vision-based method to estimate the growth level of the bacteria in microfluidic channels. We use Fast Fourier transform (FFT to detect the frequency level change of the microscopic image, focusing on the fact that the microscopic image becomes rough as the number of cells in the field of view increases, adding high frequencies to the spectrum of the image. Two types of microfluidic devices are used to culture bacteria in liquid and agar gel medium, and time-lapsed images are captured. The images obtained are analyzed using FFT, resulting in an increase in high-frequency noise proportional to the time passed. Furthermore, we apply the developed method in the microfluidic antibiotics susceptibility test by recognizing the regional concentration change of the bacteria that are cultured in the antibiotics gradient. Finally, a deep learning-based data regression is performed on the data obtained by the proposed vision-based method for robust reporting of data.
Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota.
Bulgarelli, Davide; Rott, Matthias; Schlaeppi, Klaus; Ver Loren van Themaat, Emiel; Ahmadinejad, Nahal; Assenza, Federica; Rauf, Philipp; Huettel, Bruno; Reinhardt, Richard; Schmelzer, Elmon; Peplies, Joerg; Gloeckner, Frank Oliver; Amann, Rudolf; Eickhorst, Thilo; Schulze-Lefert, Paul
2012-08-02
The plant root defines the interface between a multicellular eukaryote and soil, one of the richest microbial ecosystems on Earth. Notably, soil bacteria are able to multiply inside roots as benign endophytes and modulate plant growth and development, with implications ranging from enhanced crop productivity to phytoremediation. Endophytic colonization represents an apparent paradox of plant innate immunity because plant cells can detect an array of microbe-associated molecular patterns (also known as MAMPs) to initiate immune responses to terminate microbial multiplication. Several studies attempted to describe the structure of bacterial root endophytes; however, different sampling protocols and low-resolution profiling methods make it difficult to infer general principles. Here we describe methodology to characterize and compare soil- and root-inhabiting bacterial communities, which reveals not only a function for metabolically active plant cells but also for inert cell-wall features in the selection of soil bacteria for host colonization. We show that the roots of Arabidopsis thaliana, grown in different natural soils under controlled environmental conditions, are preferentially colonized by Proteobacteria, Bacteroidetes and Actinobacteria, and each bacterial phylum is represented by a dominating class or family. Soil type defines the composition of root-inhabiting bacterial communities and host genotype determines their ribotype profiles to a limited extent. The identification of soil-type-specific members within the root-inhabiting assemblies supports our conclusion that these represent soil-derived root endophytes. Surprisingly, plant cell-wall features of other tested plant species seem to provide a sufficient cue for the assembly of approximately 40% of the Arabidopsis bacterial root-inhabiting microbiota, with a bias for Betaproteobacteria. Thus, this root sub-community may not be Arabidopsis-specific but saprophytic bacteria that would naturally be found
International Nuclear Information System (INIS)
Umehara, Senkei; Hattori, Akihiro; Inoue, Ippei; Yasuda, Kenji
2007-01-01
Knowing how individual cells respond to environmental changes helps one understand phenotypic diversity in a bacterial cell population, so we simultaneously monitored the growth and motility of isolated motile Escherichia coli cells over several generations by using a method called on-chip single-cell cultivation. Starved cells quickly stopped growing but remained motile for several hours before gradually becoming immotile. When nutrients were restored the cells soon resumed their growth and proliferation but remained immotile for up to six generations. A flagella visualization assay suggested that deflagellation underlies the observed loss of motility. This set of results demonstrates that single-cell transgenerational study under well-characterized environmental conditions can provide information that will help us understand distinct functions within individual cells
High resolution imaging of surface patterns of single bacterial cells
International Nuclear Information System (INIS)
Greif, Dominik; Wesner, Daniel; Regtmeier, Jan; Anselmetti, Dario
2010-01-01
We systematically studied the origin of surface patterns observed on single Sinorhizobium meliloti bacterial cells by comparing the complementary techniques atomic force microscopy (AFM) and scanning electron microscopy (SEM). Conditions ranged from living bacteria in liquid to fixed bacteria in high vacuum. Stepwise, we applied different sample modifications (fixation, drying, metal coating, etc.) and characterized the observed surface patterns. A detailed analysis revealed that the surface structure with wrinkled protrusions in SEM images were not generated de novo but most likely evolved from similar and naturally present structures on the surface of living bacteria. The influence of osmotic stress to the surface structure of living cells was evaluated and also the contribution of exopolysaccharide and lipopolysaccharide (LPS) by imaging two mutant strains of the bacterium under native conditions. AFM images of living bacteria in culture medium exhibited surface structures of the size of single proteins emphasizing the usefulness of AFM for high resolution cell imaging.
Accurate detection of carcinoma cells by use of a cell microarray chip.
Directory of Open Access Journals (Sweden)
Shohei Yamamura
Full Text Available BACKGROUND: Accurate detection and analysis of circulating tumor cells plays an important role in the diagnosis and treatment of metastatic cancer treatment. METHODS AND FINDINGS: A cell microarray chip was used to detect spiked carcinoma cells among leukocytes. The chip, with 20,944 microchambers (105 µm width and 50 µm depth, was made from polystyrene; and the formation of monolayers of leukocytes in the microchambers was observed. Cultured human T lymphoblastoid leukemia (CCRF-CEM cells were used to examine the potential of the cell microarray chip for the detection of spiked carcinoma cells. A T lymphoblastoid leukemia suspension was dispersed on the chip surface, followed by 15 min standing to allow the leukocytes to settle down into the microchambers. Approximately 29 leukocytes were found in each microchamber when about 600,000 leukocytes in total were dispersed onto a cell microarray chip. Similarly, when leukocytes isolated from human whole blood were used, approximately 89 leukocytes entered each microchamber when about 1,800,000 leukocytes in total were placed onto the cell microarray chip. After washing the chip surface, PE-labeled anti-cytokeratin monoclonal antibody and APC-labeled anti-CD326 (EpCAM monoclonal antibody solution were dispersed onto the chip surface and allowed to react for 15 min; and then a microarray scanner was employed to detect any fluorescence-positive cells within 20 min. In the experiments using spiked carcinoma cells (NCI-H1650, 0.01 to 0.0001%, accurate detection of carcinoma cells was achieved with PE-labeled anti-cytokeratin monoclonal antibody. Furthermore, verification of carcinoma cells in the microchambers was performed by double staining with the above monoclonal antibodies. CONCLUSION: The potential application of the cell microarray chip for the detection of CTCs was shown, thus demonstrating accurate detection by double staining for cytokeratin and EpCAM at the single carcinoma cell level.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Long-Term Bacterial Dynamics in a Full-Scale Drinking Water Distribution System
Prest, E. I.; Weissbrodt, D. G.; Hammes, F.; Van Loosdrecht, M. C M; Vrouwenvelder, Johannes S.
2016-01-01
Large seasonal variations in microbial drinking water quality can occur in distribution networks, but are often not taken into account when evaluating results from short-term water sampling campaigns. Temporal dynamics in bacterial community characteristics were investigated during a two-year drinking water monitoring campaign in a full-scale distribution system operating without detectable disinfectant residual. A total of 368 water samples were collected on a biweekly basis at the water treatment plant (WTP) effluent and at one fixed location in the drinking water distribution network (NET). The samples were analysed for heterotrophic plate counts (HPC), Aeromonas plate counts, adenosine-tri-phosphate (ATP) concentrations, and flow cytometric (FCM) total and intact cell counts (TCC, ICC), water temperature, pH, conductivity, total organic carbon (TOC) and assimilable organic carbon (AOC). Multivariate analysis of the large dataset was performed to explore correlative trends between microbial and environmental parameters. The WTP effluent displayed considerable seasonal variations in TCC (from 90 × 103 cells mL-1 in winter time up to 455 × 103 cells mL-1 in summer time) and in bacterial ATP concentrations (<1–3.6 ng L-1), which were congruent with water temperature variations. These fluctuations were not detected with HPC and Aeromonas counts. The water in the network was predominantly influenced by the characteristics of the WTP effluent. The increase in ICC between the WTP effluent and the network sampling location was small (34 × 103 cells mL-1 on average) compared to seasonal fluctuations in ICC in the WTP effluent. Interestingly, the extent of bacterial growth in the NET was inversely correlated to AOC concentrations in the WTP effluent (Pearson’s correlation factor r = -0.35), and positively correlated with water temperature (r = 0.49). Collecting a large dataset at high frequency over a two year period enabled the characterization of previously
Long-Term Bacterial Dynamics in a Full-Scale Drinking Water Distribution System.
Directory of Open Access Journals (Sweden)
E I Prest
Full Text Available Large seasonal variations in microbial drinking water quality can occur in distribution networks, but are often not taken into account when evaluating results from short-term water sampling campaigns. Temporal dynamics in bacterial community characteristics were investigated during a two-year drinking water monitoring campaign in a full-scale distribution system operating without detectable disinfectant residual. A total of 368 water samples were collected on a biweekly basis at the water treatment plant (WTP effluent and at one fixed location in the drinking water distribution network (NET. The samples were analysed for heterotrophic plate counts (HPC, Aeromonas plate counts, adenosine-tri-phosphate (ATP concentrations, and flow cytometric (FCM total and intact cell counts (TCC, ICC, water temperature, pH, conductivity, total organic carbon (TOC and assimilable organic carbon (AOC. Multivariate analysis of the large dataset was performed to explore correlative trends between microbial and environmental parameters. The WTP effluent displayed considerable seasonal variations in TCC (from 90 × 103 cells mL-1 in winter time up to 455 × 103 cells mL-1 in summer time and in bacterial ATP concentrations (<1-3.6 ng L-1, which were congruent with water temperature variations. These fluctuations were not detected with HPC and Aeromonas counts. The water in the network was predominantly influenced by the characteristics of the WTP effluent. The increase in ICC between the WTP effluent and the network sampling location was small (34 × 103 cells mL-1 on average compared to seasonal fluctuations in ICC in the WTP effluent. Interestingly, the extent of bacterial growth in the NET was inversely correlated to AOC concentrations in the WTP effluent (Pearson's correlation factor r = -0.35, and positively correlated with water temperature (r = 0.49. Collecting a large dataset at high frequency over a two year period enabled the characterization of previously
Long-Term Bacterial Dynamics in a Full-Scale Drinking Water Distribution System
Prest, E. I.
2016-10-28
Large seasonal variations in microbial drinking water quality can occur in distribution networks, but are often not taken into account when evaluating results from short-term water sampling campaigns. Temporal dynamics in bacterial community characteristics were investigated during a two-year drinking water monitoring campaign in a full-scale distribution system operating without detectable disinfectant residual. A total of 368 water samples were collected on a biweekly basis at the water treatment plant (WTP) effluent and at one fixed location in the drinking water distribution network (NET). The samples were analysed for heterotrophic plate counts (HPC), Aeromonas plate counts, adenosine-tri-phosphate (ATP) concentrations, and flow cytometric (FCM) total and intact cell counts (TCC, ICC), water temperature, pH, conductivity, total organic carbon (TOC) and assimilable organic carbon (AOC). Multivariate analysis of the large dataset was performed to explore correlative trends between microbial and environmental parameters. The WTP effluent displayed considerable seasonal variations in TCC (from 90 × 103 cells mL-1 in winter time up to 455 × 103 cells mL-1 in summer time) and in bacterial ATP concentrations (<1–3.6 ng L-1), which were congruent with water temperature variations. These fluctuations were not detected with HPC and Aeromonas counts. The water in the network was predominantly influenced by the characteristics of the WTP effluent. The increase in ICC between the WTP effluent and the network sampling location was small (34 × 103 cells mL-1 on average) compared to seasonal fluctuations in ICC in the WTP effluent. Interestingly, the extent of bacterial growth in the NET was inversely correlated to AOC concentrations in the WTP effluent (Pearson’s correlation factor r = -0.35), and positively correlated with water temperature (r = 0.49). Collecting a large dataset at high frequency over a two year period enabled the characterization of previously
Utada, Andrew
2014-03-01
Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.
Bacterial glycobiology: rhamnose-containing cell wall polysaccharides in Gram-positive bacteria.
Mistou, Michel-Yves; Sutcliffe, Iain C; van Sorge, Nina M
2016-07-01
The composition of the Gram-positive cell wall is typically described as containing peptidoglycan, proteins and essential secondary cell wall structures called teichoic acids, which comprise approximately half of the cell wall mass. The cell walls of many species within the genera Streptococcus, Enterococcus and Lactococcus contain large amounts of the sugar rhamnose, which is incorporated in cell wall-anchored polysaccharides (CWP) that possibly function as homologues of well-studied wall teichoic acids (WTA). The presence and chemical structure of many rhamnose-containing cell wall polysaccharides (RhaCWP) has sometimes been known for decades. In contrast to WTA, insight into the biosynthesis and functional role of RhaCWP has been lacking. Recent studies in human streptococcal and enterococcal pathogens have highlighted critical roles for these complex polysaccharides in bacterial cell wall architecture and pathogenesis. In this review, we provide an overview of the RhaCWP with regards to their biosynthesis, genetics and biological function in species most relevant to human health. We also briefly discuss how increased knowledge in this field can provide interesting leads for new therapeutic compounds and improve biotechnological applications. © FEMS 2016.
Bacterial computing with engineered populations.
Amos, Martyn; Axmann, Ilka Maria; Blüthgen, Nils; de la Cruz, Fernando; Jaramillo, Alfonso; Rodriguez-Paton, Alfonso; Simmel, Friedrich
2015-07-28
We describe strategies for the construction of bacterial computing platforms by describing a number of results from the recently completed bacterial computing with engineered populations project. In general, the implementation of such systems requires a framework containing various components such as intracellular circuits, single cell input/output and cell-cell interfacing, as well as extensive analysis. In this overview paper, we describe our approach to each of these, and suggest possible areas for future research. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
International Nuclear Information System (INIS)
Godoy-Gallardo, Maria; Guillem-Marti, Jordi; Sevilla, Pablo; Manero, José M.; Gil, Francisco J.
2016-01-01
Bacterial infection in dental implants along with osseointegration failure usually leads to loss of the device. Bioactive molecules with antibacterial properties can be attached to titanium surfaces with anchoring molecules such as silanes, preventing biofilm formation and improving osseointegration. Properties of silanes as molecular binders have been thoroughly studied, but research on the biological effects of these coatings is scarce. The aim of the present study was to determine the in vitro cell response and antibacterial effects of triethoxysilypropyl succinic anhydride (TESPSA) silane anchored on titanium surfaces. X-ray photoelectron spectroscopy confirmed a successful silanization. The silanized surfaces showed no cytotoxic effects. Gene expression analyses of Sarcoma Osteogenic (SaOS-2) osteoblast-like cells cultured on TESPSA silanized surfaces reported a remarkable increase of biochemical markers related to induction of osteoblastic cell differentiation. A manifest decrease of bacterial adhesion and biofilm formation at early stages was observed on treated substrates, while favoring cell adhesion and spreading in bacteria–cell co-cultures. Surfaces treated with TESPSA could enhance a biological sealing on implant surfaces against bacteria colonization of underlying tissues. Furthermore, it can be an effective anchoring platform of biomolecules on titanium surfaces with improved osteoblastic differentiation and antibacterial properties. - Highlights: • TESPSA silane induces osteoblast differentiation. • TESPSA reduces bacterial adhesion and biofilm formation. • TESPSA is a promising anchoring platform of biomolecules onto titanium.
Energy Technology Data Exchange (ETDEWEB)
Godoy-Gallardo, Maria, E-mail: maria.godoy.gallardo@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgy, Technical University of Catalonia (UPC), ETSEIB, Av. Diagonal 647, 08028 Barcelona (Spain); Centre for Research in NanoEngineering (CRNE) — UPC, C/ Pascual i Vila 15, 08028 Barcelona (Spain); Guillem-Marti, Jordi, E-mail: jordi.guillem.marti@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgy, Technical University of Catalonia (UPC), ETSEIB, Av. Diagonal 647, 08028 Barcelona (Spain); Centre for Research in NanoEngineering (CRNE) — UPC, C/ Pascual i Vila 15, 08028 Barcelona (Spain); Sevilla, Pablo, E-mail: psevilla@euss.es [Department of Mechanics, Escola Universitària Salesiana de Sarrià (EUSS), C/ Passeig de Sant Bosco, 42, 08017 Barcelona (Spain); Manero, José M., E-mail: jose.maria.manero@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgy, Technical University of Catalonia (UPC), ETSEIB, Av. Diagonal 647, 08028 Barcelona (Spain); Centre for Research in NanoEngineering (CRNE) — UPC, C/ Pascual i Vila 15, 08028 Barcelona (Spain); Gil, Francisco J., E-mail: francesc.xavier.gil@upc.edu [Biomaterials, Biomechanics and Tissue Engineering Group, Department of Materials Science and Metallurgy, Technical University of Catalonia (UPC), ETSEIB, Av. Diagonal 647, 08028 Barcelona (Spain); Centre for Research in NanoEngineering (CRNE) — UPC, C/ Pascual i Vila 15, 08028 Barcelona (Spain); and others
2016-02-01
Bacterial infection in dental implants along with osseointegration failure usually leads to loss of the device. Bioactive molecules with antibacterial properties can be attached to titanium surfaces with anchoring molecules such as silanes, preventing biofilm formation and improving osseointegration. Properties of silanes as molecular binders have been thoroughly studied, but research on the biological effects of these coatings is scarce. The aim of the present study was to determine the in vitro cell response and antibacterial effects of triethoxysilypropyl succinic anhydride (TESPSA) silane anchored on titanium surfaces. X-ray photoelectron spectroscopy confirmed a successful silanization. The silanized surfaces showed no cytotoxic effects. Gene expression analyses of Sarcoma Osteogenic (SaOS-2) osteoblast-like cells cultured on TESPSA silanized surfaces reported a remarkable increase of biochemical markers related to induction of osteoblastic cell differentiation. A manifest decrease of bacterial adhesion and biofilm formation at early stages was observed on treated substrates, while favoring cell adhesion and spreading in bacteria–cell co-cultures. Surfaces treated with TESPSA could enhance a biological sealing on implant surfaces against bacteria colonization of underlying tissues. Furthermore, it can be an effective anchoring platform of biomolecules on titanium surfaces with improved osteoblastic differentiation and antibacterial properties. - Highlights: • TESPSA silane induces osteoblast differentiation. • TESPSA reduces bacterial adhesion and biofilm formation. • TESPSA is a promising anchoring platform of biomolecules onto titanium.
Directory of Open Access Journals (Sweden)
Owen Higgins
2018-02-01
Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.
Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert
2018-01-01
Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124
Bacterial mutagenicity and mammalian cell DNA damage by several substituted anilines.
Zimmer, D; Mazurek, J; Petzold, G; Bhuyan, B K
1980-04-01
Several substituted alkyl- and haloanilines were tested for their ability to mutate Salmonella typhimurium and to damage the DNA of mammalian (V79) cells. These results were correlated with their reported carcinogenicity. Of 9 suspected carcinogens, 4 were bacterial mutagens and 4 (out of 7 tested) damaged DNA of V79 cells. The following compounds were weakly mutagenic (less than 150 revertants/mumole): 4-fluoroaniline, 2,3-, 2,4-, 2,5- and 3,4-dimethylaniline, and 2-methyl-4-fluoroaniline. The following compounds were strong mutagens: 2,4,5-trimethylaniline, 2-methyl-4-chloro-, and 2-methyl-4-bromo-, 4-methyl-2-chloro-, 4-methyl-2-bromo- and 2-ethyl-4-chloroaniline. The compounds which damaged DNA in V79 cells were: 2 methyl-4-chloroaniline, 2-methyl-4-bromoaniline, 2,4,5- and 2,4,6-trimethylaniline.
Bacterial Communities: Interactions to Scale
Directory of Open Access Journals (Sweden)
Reed M. Stubbendieck
2016-08-01
Full Text Available In the environment, bacteria live in complex multispecies communities. These communities span in scale from small, multicellular aggregates to billions or trillions of cells within the gastrointestinal tract of animals. The dynamics of bacterial communities are determined by pairwise interactions that occur between different species in the community. Though interactions occur between a few cells at a time, the outcomes of these interchanges have ramifications that ripple through many orders of magnitude, and ultimately affect the macroscopic world including the health of host organisms. In this review we cover how bacterial competition influences the structures of bacterial communities. We also emphasize methods and insights garnered from culture-dependent pairwise interaction studies, metagenomic analyses, and modeling experiments. Finally, we argue that the integration of multiple approaches will be instrumental to future understanding of the underlying dynamics of bacterial communities.
Ranjan, R K; Singh, Dinesh; Baranwal, V K
2016-11-01
Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.
Simultaneous detection of mRNA and protein stem cell markers in live cells
Directory of Open Access Journals (Sweden)
Bao Gang
2009-04-01
Full Text Available Abstract Background Biological studies and medical application of stem cells often require the isolation of stem cells from a mixed cell population, including the detection of cancer stem cells in tumor tissue, and isolation of induced pluripotent stem cells after eliciting the expression of specific genes in adult cells. Here we report the detection of Oct-4 mRNA and SSEA-1 protein in live carcinoma stem cells using respectively molecular beacon and dye-labeled antibody, aiming to establish a new method for stem cells detection and isolation. Results Quantification of Oct-4 mRNA and protein in P19 mouse carcinoma stem cells using respectively RT-PCR and immunocytochemistry confirmed that their levels drastically decreased after differentiation. To visualize Oct-4 mRNA in live stem cells, molecular beacons were designed, synthesized and validated, and the detection specificity was confirmed using control studies. We found that the fluorescence signal from Oct-4-targeting molecular beacons provides a clear discrimination between undifferentiated and retinoic acid-induced differentiated cells. Using deconvolution fluorescence microscopy, Oct-4 mRNAs were found to reside on one side of the cytosol. We demonstrated that, using a combination of Oct-4 mRNA-targeting molecular beacon with SSEA-1 antibody in flow cytometric analysis, undifferentiated stem cells can be clearly distinguished from differentiated cells. We revealed that Oct-4 targeting molecular beacons do not seem to affect stem cell biology. Conclusion Molecular beacons have the potential to provide a powerful tool for highly specific detection and isolation of stem cells, including cancer stem cells and induced pluripotent stem (iPS cells without disturbing cell physiology. It is advantageous to perform simultaneous detection of intracellular (mRNA and cell-surface (protein stem cell markers in flow cytometric analysis, which may lead to high detection sensitivity and efficiency.
Energy Technology Data Exchange (ETDEWEB)
Myneni, Satish C. B. [Princeton Univ., NJ (United States). Dept. of Geosciences; Fein, Jeremy [Univ. of Notre Dame, IN (United States). Dept. of Civil Engineering and Geological Sciences; Mishra, Bhoopesh [Argonne National Lab. (ANL), Argonne, IL (United States)
2016-09-16
Bacteria are ubiquitous in a wide-range of low temperature aqueous systems, and can strongly affect the distribution and transport of metals and radionuclides in the environment. However, the role of metal adsorption onto bacteria, via the reactive cell wall functional groups, has been largely overlooked. Previous macroscale metal sorption, and XAS studies have shown that carboxyl and phosphoryl functional groups to be the important metal binding groups on bacterial cell walls and the sulfhydryl groups were not considered. The goal of our investigation was to evaluate the density of the sulfhydryl sites on different bacterial cell membranes that are common to soil systems, the binding affinities of these reactive groups towards Hg, and how this binding modifies the speciation of Hg in the natural waters.
Bankier, Claire; Cheong, Yuen; Mahalingam, Suntharavathanan; Edirisinghe, Mohan; Ren, Guogang; Cloutman-Green, Elaine; Ciric, Lena
2018-01-01
Background Bacterial cell quantification after exposure to antimicrobial compounds varies widely throughout industry and healthcare. Numerous methods are employed to quantify these antimicrobial effects. With increasing demand for new preventative methods for disease control, we aimed to compare and assess common analytical methods used to determine antimicrobial effects of novel nanoparticle combinations on two different pathogens. Methods Plate counts of total viable cells, flow cytometry (...
Bacterial Protein-Tyrosine Kinases
DEFF Research Database (Denmark)
Shi, Lei; Kobir, Ahasanul; Jers, Carsten
2010-01-01
in exopolysaccharide production, virulence, DNA metabolism, stress response and other key functions of the bacterial cell. BY-kinases act through autophosphorylation (mainly in exopolysaccharide production) and phosphorylation of other proteins, which have in most cases been shown to be activated by tyrosine......Bacteria and Eukarya share essentially the same family of protein-serine/threonine kinases, also known as the Hanks-type kinases. However, when it comes to protein-tyrosine phosphorylation, bacteria seem to have gone their own way. Bacterial protein-tyrosine kinases (BY-kinases) are bacterial...... and highlighted their importance in bacterial physiology. Having no orthologues in Eukarya, BY-kinases are receiving a growing attention from the biomedical field, since they represent a particularly promising target for anti-bacterial drug design....
Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles
Chang, Yi-Chung; Yang, Chia-Ying; Sun, Ruei-Lin; Cheng, Yi-Feng; Kao, Wei-Chen; Yang, Pan-Chyr
2013-01-01
Staphylococcus aureus is one of the most important human pathogens, causing more than 500,000 infections in the United States each year. Traditional methods for bacterial culture and identification take several days, wasting precious time for patients who are suffering severe bacterial infections. Numerous nucleic acid-based detection methods have been introduced to address this deficiency; however, the costs and requirement for expensive equipment may limit the widespread use of such technol...
Boybeyi-Turer, Ozlem; Kacmaz, Birgul; Arat, Esra; Atasoy, Pınar; Kisa, Ucler; Gunal, Yasemin Dere; Aslan, Mustafa Kemal; Soyer, Tutku
2018-04-01
To investigate the effects of penile tourniquet (PT) application on bacterial adhesion to urothelium. Fifty-six rats were allocated into control group (CG), sham group (SG), PT group (PTG). No intervention was applied in CG. A 5mm-length urethral repair was performed in SG and PTG. In PTG, a 10-min duration of PT was applied during the procedure and the tissue oxygenation monitor was used to adjust the same degree of ischemia in all subjects. Samples were examined for wound healing parameters and tissue levels of inflammatory markers, eNOS, e-selectin, and ICAM-1antibodies. The adhesion of Escherichia coli to urothelium was investigated with in vitro adhesion assay. Inflammation was higher and wound healing was worse in SG than CG and in PTG in comparison to CG and SG (pcaused endothelial corruption and prevented cell proliferation in cell culture. The PT application does not improve wound healing and increases bacterial adhesion molecules in penile tissue. The in vitro assays showed that PT causes severe endothelial damage and inhibits endothelial cell proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.
Analysis of bone marrow stromal cell transferred bacterial {beta}-galactosidase gene by PIXE
Energy Technology Data Exchange (ETDEWEB)
Kumakawa, Toshiro [Tokyo Metropolitan Geriatric Hospital, Tokyo (Japan). Dept. of Blood Transfusion and Hematology; Hibino, Hitoshi; Tani, Kenzaburo; Asano, Shigetaka; Futatugawa, Shouji; Sera, Kouichiro
1997-12-31
PIXE, Particle Induced X-ray Emission, is a powerful, multi-elemental analysis method which has many distinguishing features and has been used in varies research fields. Recently the method of applying baby cyclotrons for nuclear medicine to PIXE has been developed. This enables us to study biomedical phenomena from the physical point of view. Mouse bone marrow stromal cells were transferred bacterial {beta}-galactosidase gene (LacZ gene) by murine retroviral vectors. Analysis of the bone marrow stromal cells with the LacZ gene by PIXE revealed remarkable changes of intracellular trace elements compared with the normal control cells. These results indicate that gene transfer by retroviral vectors may bring about a dynamic change of intracellular circumstances of the target cell. (author)
Real time imaging of live cell ATP leaking or release events by chemiluminescence microscopy
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yun [Iowa State Univ., Ames, IA (United States)
2008-12-18
The purpose of this research was to expand the chemiluminescence microscopy applications in live bacterial/mammalian cell imaging and to improve the detection sensitivity for ATP leaking or release events. We first demonstrated that chemiluminescence (CL) imaging can be used to interrogate single bacterial cells. While using a luminometer allows detecting ATP from cell lysate extracted from at least 10 bacterial cells, all previous cell CL detection never reached this sensitivity of single bacteria level. We approached this goal with a different strategy from before: instead of breaking bacterial cell membrane and trying to capture the transiently diluted ATP with the firefly luciferase CL assay, we introduced the firefly luciferase enzyme into bacteria using the modern genetic techniques and placed the CL reaction substrate D-luciferin outside the cells. By damaging the cell membrane with various antibacterial drugs including antibiotics such as Penicillins and bacteriophages, the D-luciferin molecules diffused inside the cell and initiated the reaction that produces CL light. As firefly luciferases are large protein molecules which are retained within the cells before the total rupture and intracellular ATP concentration is high at the millmolar level, the CL reaction of firefly luciferase, ATP and D-luciferin can be kept for a relatively long time within the cells acting as a reaction container to generate enough photons for detection by the extremely sensitive intensified charge coupled device (ICCD) camera. The result was inspiring as various single bacterium lysis and leakage events were monitored with 10-s temporal resolution movies. We also found a new way of enhancing diffusion D-luciferin into cells by dehydrating the bacteria. Then we started with this novel single bacterial CL imaging technique, and applied it for quantifying gene expression levels from individual bacterial cells. Previous published result in single cell gene expression quantification
International Nuclear Information System (INIS)
Tiwary, Bhupendra Nath; Das, Reena
2013-01-01
Beams of high-energy particles are useful for both fundamental and applied research in the sciences, and also in many technical and industrial fields unrelated to fundamental research. It has been estimated that there are approximately 26,000 accelerators world. Of these, only about 1% are research machines with energies above 1 GeV, while about 44% are for radiotherapy, 41% for ion implantation, 9% for industrial processing and research, and 4% for biomedical and other low-energy research. One aspect of these radiations can be studied for examining their effect in altering the viability of bacterial cells. The radiations generated by the simple technology of a single static high voltage to accelerate charged particles are known to produce reactive oxygen intermediates such as hydrogen peroxide or superoxide anions and target several cellular components of bacterial cells including the DNA. As a result of this interaction with the DNA the phosphodiester backbone of the DNA may break leading to single or double strand fission. Endogenous pigments, such as carotenoids and melanins, might provide a selective advantage to these microorganisms by photoprotection or shielding from UV radiation, including the UV-C and full UV-B range. The pigment, as an antioxidant scavenges reactive oxygen species generated by UV-A radiation and protect various microorganisms against oxidative damage caused by UV or ionizing radiation by scavenging free radicals. Environmental UV radiation is polychromatic and comprises the full spectrum of UV-A and UV-B radiation at wavelengths of λ > 290 nm. Accelerators, solar simulators and natural insulation can also prove to be a better alternate for understanding the responses of bacterial cells to the terrestrial UV radiation climate. (author)
Quantifying bacterial adhesion on antifouling polymer brushes via single-cell force spectroscopy
Czech Academy of Sciences Publication Activity Database
Rodriguez-Emmenegger, Cesar; Janel, S.; de los Santos Pereira, Andres; Bruns, M.; Lafont, F.
2015-01-01
Roč. 6, č. 31 (2015), s. 5740-5751 ISSN 1759-9954 R&D Projects: GA ČR(CZ) GJ15-09368Y; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:OPPK(XE) CZ.2.16/3.1.00/21545 Program:OPPK Institutional support: RVO:61389013 Keywords : antifouling polymer brushes * single-cell force spectroscopy * bacterial adhesion Subject RIV: BO - Biophysics Impact factor: 5.687, year: 2015
Cytosolic Access of Intracellular Bacterial Pathogens: The Shigella Paradigm.
Mellouk, Nora; Enninga, Jost
2016-01-01
Shigella is a Gram-negative bacterial pathogen, which causes bacillary dysentery in humans. A crucial step of Shigella infection is its invasion of epithelial cells. Using a type III secretion system, Shigella injects several bacterial effectors ultimately leading to bacterial internalization within a vacuole. Then, Shigella escapes rapidly from the vacuole, it replicates within the cytosol and spreads from cell-to-cell. The molecular mechanism of vacuolar rupture used by Shigella has been studied in some detail during the recent years and new paradigms are emerging about the underlying molecular events. For decades, bacterial effector proteins were portrayed as main actors inducing vacuolar rupture. This includes the effector/translocators IpaB and IpaC. More recently, this has been challenged and an implication of the host cell in the process of vacuolar rupture has been put forward. This includes the bacterial subversion of host trafficking regulators, such as the Rab GTPase Rab11. The involvement of the host in determining bacterial vacuolar integrity has also been found for other bacterial pathogens, particularly for Salmonella. Here, we will discuss our current view of host factor and pathogen effector implications during Shigella vacuolar rupture and the steps leading to it.
Longnecker, K; Sherr, B F; Sherr, E B
2005-12-01
We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.
Chiellini, Carolina; Bacci, Giovanni; Fani, Renato; Mocali, Stefano
2016-04-01
Different bacteria have evolved strategies to transfer electrons over their cell surface to (or from) their extracellular environment. This electron transfer enables the use of these bacteria in bioelectrochemical systems (BES) such as Microbial Fuel Cells (MFCs). In MFC research the biological reactions at the cathode have long been a secondary point of interest. However, bacterial biocathodes in MFCs represent a potential advantage compared to traditional cathodes, for both their low costs and their low impact on the environment. The main challenge in biocathode set-up is represented by the selection of a bacterial community able to efficiently accept electrons from the electrode, starting from an environmental matrix. In this work, a constant voltage was supplied on a two-chamber MFC filled up with soil over three weeks in order to simultaneously select an electron donor bacterial biomass on the anode and an electron acceptor biomass on the cathode, starting from the same soil. Next Generation Sequencing (NGS) analysis was performed to characterize the bacterial community of the initial soil, in the anode, in the cathode and in the control chamber not supplied with any voltage. Results highlighted that both the MFC conditions and the voltage supply affected the soil bacterial communities, providing a selection of different bacterial groups preferentially associated to the anode (Betaproteobacteria, Bacilli and Clostridia) and to the cathode (Actinobacteria and Alphaproteobacteria). These results confirmed that several electroactive bacteria are naturally present within a top soil and, moreover, different soil bacterial genera could provide different electrical properties.
Analysis of gene expression levels in individual bacterial cells without image segmentation.
Kwak, In Hae; Son, Minjun; Hagen, Stephen J
2012-05-11
Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly. Copyright © 2012 Elsevier Inc. All rights reserved.
Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.
Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A
2011-11-01
To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.
Detection of Enterotoxigenic Clostridium perfringens in Meat Samples by Using Molecular Methods▿
Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A.
2011-01-01
To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >103 cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates. PMID:21890671
Chandra, Ram; Abhishek, Amar; Sankhwar, Monica
2011-06-01
This study deals with the decolorization of black liquor (BL) by isolated potential bacterial consortium comprising Serratia marcescens (GU193982), Citrobacter sp. (HQ873619) and Klebsiella pneumoniae (GU193983). The decolorization of BL was studied by using the different nutritional as well as environmental parameters. In this study, result revealed that the ligninolytic activities were found to be growth associated and the developed bacterial consortium was efficient for the reduction of COD, BOD and color up to 83%, 74% and 85%, respectively. The HPLC analysis of degraded samples of BL has shown the reduction in peak area compared to control. Further, the GC-MS analysis showed that, most of the compounds detected in control were diminished after bacterial treatment while, formic acid hydrazide, 4-cyclohexane-1,2-dicarboxylic acid, carbamic acid, 1,2-benzenedicarboxylic acid and erythropentanoic acid were found as new metabolites. Further, the seed germination test using Phaseolus aureus has supported the detoxification of bacterial decolorized BL. Copyright © 2011 Elsevier Ltd. All rights reserved.
Jun, Suckjoon; Si, Fangwei; Pugatch, Rami; Scott, Matthew
2018-05-01
Bacterial physiology is a branch of biology that aims to understand overarching principles of cellular reproduction. Many important issues in bacterial physiology are inherently quantitative, and major contributors to the field have often brought together tools and ways of thinking from multiple disciplines. This article presents a comprehensive overview of major ideas and approaches developed since the early 20th century for anyone who is interested in the fundamental problems in bacterial physiology. This article is divided into two parts. In the first part (sections 1–3), we review the first ‘golden era’ of bacterial physiology from the 1940s to early 1970s and provide a complete list of major references from that period. In the second part (sections 4–7), we explain how the pioneering work from the first golden era has influenced various rediscoveries of general quantitative principles and significant further development in modern bacterial physiology. Specifically, section 4 presents the history and current progress of the ‘adder’ principle of cell size homeostasis. Section 5 discusses the implications of coarse-graining the cellular protein composition, and how the coarse-grained proteome ‘sectors’ re-balance under different growth conditions. Section 6 focuses on physiological invariants, and explains how they are the key to understanding the coordination between growth and the cell cycle underlying cell size control in steady-state growth. Section 7 overviews how the temporal organization of all the internal processes enables balanced growth. In the final section 8, we conclude by discussing the remaining challenges for the future in the field.
Rapid microbiological testing: monitoring the development of bacterial stress.
Directory of Open Access Journals (Sweden)
Boris Zavizion
2010-10-01
Full Text Available The ability to respond to adverse environments effectively along with the ability to reproduce are sine qua non conditions for all sustainable cellular forms of life. Given the availability of an appropriate sensing modality, the ubiquity and immediacy of the stress response could form the basis for a new approach for rapid biological testing. We have found that measuring the dielectric permittivity of a cellular suspension, an easily measurable electronic property, is an effective way to monitor the response of bacterial cells to adverse conditions continuously. The dielectric permittivity of susceptible and resistant strains of Escherichia coli and Staphylococcus aureus, treated with gentamicin and vancomycin, were measured directly using differential impedance sensing methods and expressed as the Normalized Impedance Response (NIR. These same strains were also heat-shocked and chemically stressed with Triton X-100 or H(2O(2. The NIR profiles obtained for antibiotic-treated susceptible organisms showed a strong and continuous decrease in value. In addition, the intensity of the NIR value decrease for susceptible cells varied in proportion to the amount of antibiotic added. Qualitatively similar profiles were found for the chemically treated and heat-shocked bacteria. In contrast, antibiotic-resistant cells showed no change in the NIR values in the presence of the drug to which it is resistant. The data presented here show that changes in the dielectric permittivity of a cell suspension are directly correlated with the development of a stress response as well as bacterial recovery from stressful conditions. The availability of a practical sensing modality capable of monitoring changes in the dielectric properties of stressed cells could have wide applications in areas ranging from the detection of bacterial infections in clinical specimens to antibiotic susceptibility testing and drug discovery.
Directory of Open Access Journals (Sweden)
Divya T George
Full Text Available S. flexneri strains, most frequently linked with endemic outbreaks of shigellosis, invade the colonic and rectal epithelium of their host and cause severe tissue damage. Here we have attempted to elucidate the contribution of the periplasmic enzyme, L-asparaginase (AnsB to the pathogenesis of S. flexneri. Using a reverse genetic approach we found that ansB mutants showed reduced adherence to epithelial cells in vitro and attenuation in two in vivo models of shigellosis, the Caenorhabditis elegans and the murine pulmonary model. To investigate how AnsB affects bacterial adherence, we compared the proteomes of the ansB mutant with its wild type parental strain using two dimensional differential in-gel electrophoresis and identified the outer membrane protein, OmpA as up-regulated in ansB mutant cells. Bacterial OmpA, is a prominent outer membrane protein whose activity has been found to be required for bacterial pathogenesis. Overexpression of OmpA in wild type S. flexneri serotype 3b resulted in decreasing the adherence of this virulent strain, suggesting that the up-regulation of OmpA in ansB mutants contributes to the reduced adherence of this mutant strain. The data presented here is the first report that links the metabolic enzyme AnsB to S. flexneri pathogenesis.
Brinkman, Cassandra L; Schmidt-Malan, Suzannah M; Karau, Melissa J; Greenwood-Quaintance, Kerryl; Hassett, Daniel J; Mandrekar, Jayawant N; Patel, Robin
2016-01-01
Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the 'electricidal effect', in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS.
Directory of Open Access Journals (Sweden)
Yifan Chen
2013-01-01
Full Text Available We propose a new approach to microwave breast tumor sensing and diagnosis based on the use of biocompatible flagellated magnetotactic bacteria (MTB adapted to operate in human microvasculature. It has been verified experimentally by Martel et al. that externally generated magnetic gradients could be applied to guide the MTB along preplanned routes inside the human body, and a nanoload could be attached to these bacterial microbots. Motivated by these useful properties, we suggest loading a nanoscale microwave contrast agent such as carbon nanotubes (CNTs or ferroelectric nanoparticles (FNPs onto the MTB in order to modify the dielectric properties of tissues near the agent-loaded bacteria. Subsequently, we propose a novel differential microwave imaging (DMI technique to track simultaneously multiple swarms of MTB microbots injected into the breast. We also present innovative strategies to detect and localize a breast tissue malignancy and estimate its size via this DMI-trackable bacterial microrobotic system. Finally, we use an anatomically realistic numerical breast phantom as a platform to demonstrate the feasibility of this tumor diagnostic method.
Slaninova, Eva; Sedlacek, Petr; Mravec, Filip; Mullerova, Lucie; Samek, Ota; Koller, Martin; Hesko, Ondrej; Kucera, Dan; Marova, Ivana; Obruca, Stanislav
2018-02-01
Numerous prokaryotes accumulate polyhydroxyalkanoates (PHA) in the form of intracellular granules. The primary function of PHA is the storage of carbon and energy. Nevertheless, there are numerous reports that the presence of PHA granules in microbial cells enhances their stress resistance and fitness when exposed to various stress factors. In this work, we studied the protective mechanism of PHA granules against UV irradiation employing Cupriavidus necator as a model bacterial strain. The PHA-accumulating wild type strain showed substantially higher UV radiation resistance than the PHA non-accumulating mutant. Furthermore, the differences in UV-Vis radiation interactions with both cell types were studied using various spectroscopic approaches (turbidimetry, absorption spectroscopy, and nephelometry). Our results clearly demonstrate that intracellular PHA granules efficiently scatter UV radiation, which provides a substantial UV-protective effect for bacterial cells and, moreover, decreases the intracellular level of reactive oxygen species in UV-challenged cells. The protective properties of the PHA granules are enhanced by the fact that granules specifically bind to DNA, which in turn provides shield-like protection of DNA as the most UV-sensitive molecule. To conclude, the UV-protective action of PHA granules adds considerable value to their primary storage function, which can be beneficial in numerous environments.
Total bacterial count and somatic cell count in refrigerated raw milk stored in communal tanks
Directory of Open Access Journals (Sweden)
Edmar da Costa Alves
2014-09-01
Full Text Available The current industry demand for dairy products with extended shelf life has resulted in new challenges for milk quality maintenance. The processing of milk with high bacterial counts compromises the quality and performance of industrial products. The study aimed to evaluate the total bacteria counts (TBC and somatic cell count (SCC in 768 samples of refrigerated raw milk, from 32 communal tanks. Samples were collected in the first quarter of 2010, 2011, 2012 and 2013 and analyzed by the Laboratory of Milk Quality - LQL. Results showed that 62.5%, 37.5%, 15.6% and 27.1% of the means for TBC in 2010, 2011, 2012 and 2013, respectively, were above the values established by legislation. However, we observed a significant reduction in the levels of total bacterial count (TBC in the studied periods. For somatic cell count, 100% of the means indicated values below 600.000 cells/mL, complying with the actual Brazilian legislation. The values found for the somatic cell count suggests the adoption of effective measures for the sanitary control of the herd. However, the results must be considered with caution as it highlights the need for quality improvements of the raw material until it achieves reliable results effectively.
Directory of Open Access Journals (Sweden)
Frank B. Dazzo
2012-05-01
Full Text Available This paper describes how the quantitative analytical tools of CMEIAS image analysis software can be used to investigate in situ microbial interactions involving cell-to-cell communication within biofilms. Various spatial pattern analyses applied to the data extracted from the 2-dimensional coordinate positioning of individual bacterial cells at single-cell resolution indicate that microbial colonization within natural biofilms is not a spatially random process, but rather involves strong positive interactions between communicating cells that influence their neighbors’ aggregated colonization behavior. Geostatistical analysis of the data provide statistically defendable estimates of the micrometer scale and interpolation maps of the spatial heterogeneity and local intensity at which these microbial interactions autocorrelate with their spatial patterns of distribution. Including in situ image analysis in cell communication studies fills an important gap in understanding the spatially dependent microbial ecophysiology that governs the intensity of biofilm colonization and its unique architecture.
Copper effects on bacterial activity of estuarine silty sediments
Almeida, Adelaide; Cunha, Ângela; Fernandes, Sandra; Sobral, Paula; Alcântara, Fernanda
2007-07-01
Bacteria of silty estuarine sediments were spiked with copper to 200 μg Cu g -1 dry weight sediment in order to assess the impact of copper on bacterial degradation of organic matter and on bacterial biomass production. Bacterial density was determined by direct counting under epifluorescence microscopy and bacterial production by the incorporation of 3H-Leucine. Leucine turnover rate was evaluated by 14C-leucine incorporation and ectoenzymatic activities were estimated as the hydrolysis rate of model substrates for β-glucosidase and leucine-aminopeptidase. The presence of added copper in the microcosms elicited, after 21 days of incubation, generalised anoxia and a decrease in organic matter content. The non-eroded surface of the copper-spiked sediment showed, when compared to the control, a decrease in bacterial abundance and significant lower levels of bacterial production and of leucine turnover rate. Bacterial production and leucine turnover rate decreased to 1.4% and 13% of the control values, respectively. Ectoenzymatic activities were also negatively affected but by smaller factors. After erosion by the water current in laboratory flume conditions, the eroded surface of the control sediment showed a generalised decline in all bacterial activities. The erosion of the copper-spiked sediment showed, however, two types of responses with respect to bacterial activities at the exposed surface: positive responses of bacterial production and leucine turnover rate contrasting with slight negative responses of ectoenzymatic activities. The effects of experimental erosion in the suspended cells were also different in the control and in the copper-spiked sediment. Bacterial cells in the control microcosm exhibited, when compared to the non-eroded sediment cells, decreases in all activities after the 6-h suspension. The response of the average suspended copper-spiked sediment cell differed from the control by a less sharp decrease in ectoenzymatic activities and
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Nielsen, Dennis S.; Arneborg, Nils
2009-01-01
of the bacterium. In situ analyses of Listeria monocytogenes single cells were performed during exposure to different concentrations of the disinfectant Incimaxx DES to study a possible population subdivision. Bacterial survival was quantified with plate counting and disinfection stress at the single-cell level...... by measuring intracellular pH (pHi) over time by fluorescence ratio imaging microscopy. pHi values were initially 7 to 7.5 and decreased in both attached and planktonic L. monocytogenes cells during exposure to sublethal and lethal concentrations of Incimaxx DES. The response of the bacterial population...... was homogenous; hence, subpopulations were not detected. However, pregrowth with NaCl protected the planktonic bacterial cells during disinfection with Incimaxx (0.0015%) since pHi was higher (6 to 6.5) for the bacterial population pregrown with NaCl than for cells grown without NaCl (pHi 5 to 5.5) (P
Biosynthesis of CdS nanoparticles: A fluorescent sensor for sulfate-reducing bacteria detection.
Qi, Peng; Zhang, Dun; Zeng, Yan; Wan, Yi
2016-01-15
CdS nanoparticles were synthesized with an environmentally friendly method by taking advantage of the characteristic metabolic process of sulfate-reducing bacteria (SRB), and used as fluorescence labels for SRB detection. The presence of CdS nanoparticles was observed within and immediately surrounded bacterial cells, indicating CdS nanoparticles were synthesized both intracellularly and extracellularly. Moreover, fluorescent properties of microbial synthesized CdS nanoparticles were evaluated for SRB detection, and a linear relationship between fluorescence intensity and the logarithm of bacterial concentration was obtained in the range of from 1.0×10(2) to 1.0×10(7)cfu mL(-1). The proposed SRB detection method avoided the use of biological bio-recognition elements which are easy to lose their specific recognizing abilities, and the bacterial detection time was greatly shortened compared with the widely used MPN method which would take up to 15 days to accomplish the detection process. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Takahashi, Hiroki; Bardet, Michel; De Paepe, Gael; Hediger, Sabine; Ayala, Isabel; Simorre, Jean-Pierre
2013-01-01
Dynamic nuclear polarization (DNP) enhanced solid-state nuclear magnetic resonance (NMR) has recently emerged as a powerful technique for the study of material surfaces. In this study, we demonstrate its potential to investigate cell surface in intact cells. Using Bacillus subtilis bacterial cells as an example, it is shown that the polarizing agent 1-(TEMPO-4-oxy)-3-(TEMPO-4-amino)propan-2-ol (TOTAPOL) has a strong binding affinity to cell wall polymers (peptidoglycan). This particular interaction is thoroughly investigated with a systematic study on extracted cell wall materials, disrupted cells, and entire cells, which proved that TOTAPOL is mainly accumulating in the cell wall. This property is used on one hand to selectively enhance or suppress cell wall signals by controlling radical concentrations and on the other hand to improve spectral resolution by means of a difference spectrum. Comparing DNP-enhanced and conventional solid-state NMR, an absolute sensitivity ratio of 24 was obtained on the entire cell sample. This important increase in sensitivity together with the possibility of enhancing specifically cell wall signals and improving resolution really opens new avenues for the use of DNP-enhanced solid-state NMR as an on-cell investigation tool. (authors)
Takahashi, Hiroki; Ayala, Isabel; Bardet, Michel; De Paëpe, Gaël; Simorre, Jean-Pierre; Hediger, Sabine
2013-04-03
Dynamic nuclear polarization (DNP) enhanced solid-state nuclear magnetic resonance (NMR) has recently emerged as a powerful technique for the study of material surfaces. In this study, we demonstrate its potential to investigate cell surface in intact cells. Using Bacillus subtilis bacterial cells as an example, it is shown that the polarizing agent 1-(TEMPO-4-oxy)-3-(TEMPO-4-amino)propan-2-ol (TOTAPOL) has a strong binding affinity to cell wall polymers (peptidoglycan). This particular interaction is thoroughly investigated with a systematic study on extracted cell wall materials, disrupted cells, and entire cells, which proved that TOTAPOL is mainly accumulating in the cell wall. This property is used on one hand to selectively enhance or suppress cell wall signals by controlling radical concentrations and on the other hand to improve spectral resolution by means of a difference spectrum. Comparing DNP-enhanced and conventional solid-state NMR, an absolute sensitivity ratio of 24 was obtained on the entire cell sample. This important increase in sensitivity together with the possibility of enhancing specifically cell wall signals and improving resolution really opens new avenues for the use of DNP-enhanced solid-state NMR as an on-cell investigation tool.
Mutations That Alter the Bacterial Cell Envelope Increase Lipid Production
Energy Technology Data Exchange (ETDEWEB)
Lemmer, Kimberly C.; Zhang, Weiping; Langer, Samantha J.; Dohnalkova, Alice; Hu, Dehong; Lemke, Rachelle A.; Piotrowski, Jeff S.; Orr, Galya; Noguera, Daniel R.; Donohue, Timothy J.
2017-05-23
Lipids from microbes offer a promising source of renewable alternatives to petroleum-derived compounds. In particular, oleaginous microbes are of interest because they accumulate a large fraction of their biomass as lipids. In this study, we analyzed genetic changes that alter lipid accumulation in
Evaluation of quantitative PCR measurement of bacterial colonization of epithelial cells.
Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Myszka, Kamila; Borkowska, Monika; Grajek, Włodzimierz
2010-01-01
Microbial colonization is an important step in establishing pathogenic or probiotic relations to host cells and in biofilm formation on industrial or medical devices. The aim of this work was to verify the applicability of quantitative PCR (Real-Time PCR) to measure bacterial colonization of epithelial cells. Salmonella enterica and Caco-2 intestinal epithelial cell line was used as a model. To verify sensitivity of the assay a competition of the pathogen cells to probiotic microorganism was tested. The qPCR method was compared to plate count and radiolabel approach, which are well established techniques in this area of research. The three methods returned similar results. The best quantification accuracy had radiolabel method, followed by qPCR. The plate count results showed coefficient of variation two-times higher than this of qPCR. The quantitative PCR proved to be a reliable method for enumeration of microbes in colonization assay. It has several advantages that make it very useful in case of analyzing mixed populations, where several different species or even strains can be monitored at the same time.
Early cell death detection with digital holographic microscopy.
Directory of Open Access Journals (Sweden)
Nicolas Pavillon
Full Text Available BACKGROUND: Digital holography provides a non-invasive measurement of the quantitative phase shifts induced by cells in culture, which can be related to cell volume changes. It has been shown previously that regulation of cell volume, in particular as it relates to ionic homeostasis, is crucially involved in the activation/inactivation of the cell death processes. We thus present here an application of digital holographic microscopy (DHM dedicated to early and label-free detection of cell death. METHODS AND FINDINGS: We provide quantitative measurements of phase signal obtained on mouse cortical neurons, and caused by early neuronal cell volume regulation triggered by excitotoxic concentrations of L-glutamate. We show that the efficiency of this early regulation of cell volume detected by DHM, is correlated with the occurrence of subsequent neuronal death assessed with the widely accepted trypan blue method for detection of cell viability. CONCLUSIONS: The determination of the phase signal by DHM provides a simple and rapid optical method for the early detection of cell death.
Indian Academy of Sciences (India)
First page Back Continue Last page Graphics. Bacterial stress. Physicochemical and chemical parameters: temperature, pressure, pH, salt concentration, oxygen, irradiation. Nutritional depravation: nutrient starvation, water shortage. Toxic compounds: Antibiotics, heavy metals, toxins, mutagens. Interactions with other cells: ...
Plummer, E L; Garland, S M; Bradshaw, C S; Law, M G; Vodstrcil, L A; Hocking, J S; Fairley, C K; Tabrizi, S N
2017-02-01
We investigated the utility of quantitative PCR assays for diagnosis of bacterial vaginosis and found that while the best model utilized bacterial copy number adjusted for total bacterial load (sensitivity=98%, specificity=93%, AUC=0.95[95%CI=0.93,0.97]), adjusting for total bacterial or human cell load did not consistently increase the diagnostic performance of the assays. Copyright © 2017 Elsevier B.V. All rights reserved.
Cytosolic access of intracellular bacterial pathogens: the Shigella paradigm
Directory of Open Access Journals (Sweden)
Nora eMellouk
2016-04-01
Full Text Available Shigella is a Gram-negative bacterial pathogen, which causes bacillary dysentery in humans. A crucial step of Shigella infection is its invasion of epithelial cells. Using a type III secretion system, Shigella injects several bacterial effectors ultimately leading to bacterial internalization within a vacuole. Then, Shigella escapes rapidly from the vacuole, it replicates within the cytosol and spreads from cell-to-cell. The molecular mechanism of vacuolar rupture used by Shigella has been studied in some detail during the recent years and new paradigms are emerging about the underlying molecular events. For decades, bacterial effector proteins were portrayed as main actors inducing vacuolar rupture. This includes the effector/translocators IpaB and IpaC. More recently, this has been challenged and an implication of the host cell in the process of vacuolar rupture has been put forward. This includes the bacterial subversion of host trafficking regulators, such as the Rab GTPase Rab11. The involvement of the host in determining bacterial vacuolar integrity has also been found for other bacterial pathogens, particularly for Salmonella. Here, we will discuss our current view of host factor and pathogen effector implications during Shigella vacuolar rupture and the steps leading to it.
Evaluation of an x-ray microprobe technique as a possible aid to detect salmonellae
International Nuclear Information System (INIS)
Richter, E.R.; Banwart, G.J.
1982-01-01
Specific bacterial antigen (Salmonella) increased in phosphorus and sqlfur after reaction with the flukrescain isothiocyanate-tagged anti-Salmonella antibody, while nonspecific antigen (Escherichia coli) did not. X-ray microprobe analysis may be useful in detecting salmonellae or other bacteria by determining increases in the elemental constituents of bacterial cells when reacted with elemental-tagged antibodies
Koop, G.; Dik, N.; Nielen, M.; Lipman, L.J.A.
2010-01-01
The aims of this study were to assess how different bacterial groups in bulk milk are related to bulk milk somatic cell count (SCC), bulk milk total bacterial count (TBC), and bulk milk standard plate count (SPC) and to measure the repeatability of bulk milk culturing. On 53 Dutch dairy goat farms,
Yan, Zheng-Yu; Ai, Xiao-Xia; Su, Yi-Long; Liu, Xin-Ying; Shan, Xiao-Hui; Wu, Sheng-Mei
2016-02-01
In this work, fluorescent Bacillus subtilis (B. subtilis) cells were developed as probes for imaging applications and to explore behaviorial interaction between B. subtilis and Staphylococcus aureus (S. aureus). A novel biological strategy of coupling intracellular biochemical reactions for controllable biosynthesis of CdSe quantum dots by living B. subtilis cells was demonstrated, through which highly luminant and photostable fluorescent B. subtilis cells were achieved with good uniformity. With the help of the obtained fluorescent B. subtilis cells probes, S. aureus cells responded to co-cultured B. subtilis and to aggregate. The degree of aggregation was calculated and nonlinearly fitted to a polynomial model. Systematic investigations of their interactions implied that B. subtilis cells inhibit the growth of neighboring S. aureus cells, and this inhibition was affected by both the growth stage and the amount of surrounding B. subtilis cells. Compared to traditional methods of studying bacterial interaction between two species, such as solid culture medium colony observation and imaging mass spectrometry detection, the procedures were more simple, vivid, and photostable due to the efficient fluorescence intralabeling with less influence on the cells' surface, which might provide a new paradigm for future visualization of microbial behavior.
Shi, Xin; Wei, Shengcai; Simms, Kevin J; Cumpston, Devan N; Ewing, Thomas J; Zhang, Ping
2018-01-01
Activation and reprogramming of hematopoietic stem/progenitor cells play a critical role in the granulopoietic response to bacterial infection. Our current study determined the significance of Sonic hedgehog (SHH) signaling in the regulation of hematopoietic precursor cell activity during the host defense response to systemic bacterial infection. Bacteremia was induced in male Balb/c mice via intravenous injection (i.v.) of Escherichia coli (5 × 10 7 CFUs/mouse). Control mice received i.v. saline. SHH protein level in bone marrow cell (BMC) lysates was markedly increased at both 24 and 48 h of bacteremia. By contrast, the amount of soluble SHH ligand in marrow elutes was significantly reduced. These contrasting alterations suggested that SHH ligand release from BMCs was reduced and/or binding of soluble SHH ligand to BMCs was enhanced. At both 12 and 24 h of bacteremia, SHH mRNA expression by BMCs was significantly upregulated. This upregulation of SHH mRNA expression was followed by a marked increase in SHH protein expression in BMCs. Activation of the ERK1/2-SP1 pathway was involved in mediating the upregulation of SHH gene expression. The major cell type showing the enhancement of SHH expression in the bone marrow was lineage positive cells. Gli1 positioned downstream of the SHH receptor activation serves as a key component of the hedgehog (HH) pathway. Primitive hematopoietic precursor cells exhibited the highest level of baseline Gli1 expression, suggesting that they were active cells responding to SHH ligand stimulation. Along with the increased expression of SHH in the bone marrow, expression of Gli1 by marrow cells was significantly upregulated at both mRNA and protein levels following bacteremia. This enhancement of Gli1 expression was correlated with activation of hematopoietic stem/progenitor cell proliferation. Mice with Gli1 gene deletion showed attenuation in activation of marrow hematopoietic stem/progenitor cell proliferation and inhibition
Lipid-linked cell wall precursors regulate membrane association of bacterial actin MreB.
Schirner, Kathrin; Eun, Ye-Jin; Dion, Mike; Luo, Yun; Helmann, John D; Garner, Ethan C; Walker, Suzanne
2015-01-01
The bacterial actin homolog MreB, which is crucial for rod shape determination, forms filaments that rotate around the cell width on the inner surface of the cytoplasmic membrane. What determines filament association with the membranes or with other cell wall elongation proteins is not known. Using specific chemical and genetic perturbations while following MreB filament motion, we find that MreB membrane association is an actively regulated process that depends on the presence of lipid-linked peptidoglycan precursors. When precursors are depleted, MreB filaments disassemble into the cytoplasm, and peptidoglycan synthesis becomes disorganized. In cells that lack wall teichoic acids but continue to make peptidoglycan, dynamic MreB filaments are observed, although their presence is not sufficient to establish a rod shape. We propose that the cell regulates MreB filament association with the membrane, allowing rapid and reversible inactivation of cell wall enzyme complexes in response to the inhibition of cell wall synthesis.
DEFF Research Database (Denmark)
Kaartokallio, H.; Sogaard, D. H.; Norman, L.
2013-01-01
Sea ice is a biome of immense size and provides a range of habitats for diverse microbial communities, many of which are adapted to living at low temperatures and high salinities in brines. We measured simultaneous incorporation of thymidine (TdR) and leucine (Leu), bacterial cell abundance...... and cell population properties (by flow cytometry) in subarctic sea ice in SW Greenland. Short-term temporal variability was moderate, and steep environmental gradients, typical for sea ice, were the main drivers of the variability in bacterial cell properties and activity. Low nucleic acid (LNA) bacteria...... and marine biofilm systems. Leu: TdR ratios were high (up to >300) in lowermost ice layers, and when compared to published respiration measurements, these results suggest non-specific Leu incorporation. There was evidence of polyhydroxyalkanoate (PHA)-containing bacteria in the sea ice, shown by brightly...
Antibiotic Discovery: Combatting Bacterial Resistance in Cells and in Biofilm Communities
Directory of Open Access Journals (Sweden)
Anahit Penesyan
2015-03-01
Full Text Available Bacterial resistance is a rapidly escalating threat to public health as our arsenal of effective antibiotics dwindles. Therefore, there is an urgent need for new antibiotics. Drug discovery has historically focused on bacteria growing in planktonic cultures. Many antibiotics were originally developed to target individual bacterial cells, being assessed in vitro against microorganisms in a planktonic mode of life. However, towards the end of the 20th century it became clear that many bacteria live as complex communities called biofilms in their natural habitat, and this includes habitats within a human host. The biofilm mode of life provides advantages to microorganisms, such as enhanced resistance towards environmental stresses, including antibiotic challenge. The community level resistance provided by biofilms is distinct from resistance mechanisms that operate at a cellular level, and cannot be overlooked in the development of novel strategies to combat infectious diseases. The review compares mechanisms of antibiotic resistance at cellular and community levels in the light of past and present antibiotic discovery efforts. Future perspectives on novel strategies for treatment of biofilm-related infectious diseases are explored.
BACTERIAL INFECTIONS IN HEMATOPOIETIC STEM CELL TRANSPLANT RECIPIENTS
Directory of Open Access Journals (Sweden)
Elisa Balletto
2015-07-01
Full Text Available Bacterial infections are major complications after Hematopoietic Stem Cell Transplant (HSCT. They consist mainly of bloodstream infections (BSI, followed by pneumonia and gastrointestinal infections, including typhlitis and Clostridium difficile infection. Microbiological data come mostly from BSI. Coagulase negative staphylococci and Enterobacteriaceae are the most frequent pathogens causing approximately 25% of BSI each, followed by enterococci, P. aeruginosa and viridans streptococci. Bacterial pneumonia is frequent after HSCT, and Gram-negatives are predominant. Clostridium difficile infection affects approximately 15% of HSCT recipients, being more frequent in case of allogeneic than autologous HSCT. The epidemiology and the prevalence of resistant strains vary significantly between transplant centres. In some regions, multi-drug resistant Gram-negative rods are increasingly frequent. In others, vancomycin-resistant enterococci are predominant. In the era of an increasing resistance to antibiotics, the efficacy of fluoroquinolone prophylaxis and standard treatment of febrile neutropenia have been questioned. Therefore, thorough evaluation of local epidemiology is mandatory in order to decide the need for prophylaxis and the choice of the best regimen for empirical treatment of febrile neutropenia. For the latter, individualised approach has been proposed, consisting of either escalation or de-escalation strategy. De-escalation strategy is recommended is resistant bacteria should be covered upfront, mainly in patients with severe clinical presentation and previous infection or colonisation with a resistant pathogens. Non-pharmacological interventions, such as screening for resistant bacteria, applying isolation and contact precautions should be put in place in order to limit the spread of MDR bacteria. Antimicrobial stewardship program should be implemented in transplant centres.
Sparwasser, T; Vabulas, R M; Villmow, B; Lipford, G B; Wagner, H
2000-12-01
Receptors for conserved molecular patterns associated with microbial pathogens induce synthesis of co-stimulatory molecules and cytokines in immature dendritic cells (DC), as do antigen-reactive CD4 T helper cells via CD40 signaling. Once activated, antigen-presenting DC may activate CD8 T cell responses in a T helper cell-independent fashion. Using immunostimulatory CpG-oligonucleotides (ODN) mimicking bacterial CpG-DNA, we tested whether CpG-DNA bypasses the need for T helper cells in CTL responses towards proteins by directly activating antigen-presenting DC to transit into professional APC. We describe that immature DC in situ constitutively process soluble proteins and generate CD8 T cell determinants yet CD8 T cell responses remain abortive. Induction of primary antigen-specific CD8 cytotoxic T lymphocyte (CTL)-mediated responses becomes initiated in wild-type as well as T helper cell-deficient mice, provided soluble protein and CpG-ODN are draining into the same lymph node. Specifically we show that CpG-ODN trigger antigen-presenting immature DC within the draining lymph node to acutely up-regulate co-stimulatory molecules and produce IL-12. These results provide new insights for generating in vivo efficient CTL responses to soluble proteins which may influence vaccination strategies.
Directory of Open Access Journals (Sweden)
B. Stephen Inbaraj
2016-01-01
Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.
Sana, Santanu; Datta, Sriparna; Biswas, Dipa; Sengupta, Dipanjan
2018-02-01
Besides potential surface activity and some beneficial physical properties, biosurfactants express antibacterial activity. Bacterial cell membrane disrupting ability of rhamnolipid produced by Pseudomonas aeruginosa C2 and a lipopeptide type biosurfactant, BS15 produced by Bacillus stratosphericus A15 was examined against Staphylococcus aureus ATCC 25923 and Escherichia coli K8813. Broth dilution technique was followed to examine minimum inhibitory concentration (MIC) of both the biosurfactants. The combined effect of rhamnolipid and BS15 against S. aureus and E. coli showed synergistic activity by expressing fractional inhibitory concentration (FIC) index of 0.43 and 0.5. Survival curve of both the bacteria showed bactericidal activity after treating with biosurfactants at their MIC obtained from FIC index study as it killed >90% of initial population. The lesser value of MIC than minimum bactericidal concentration (MBC) of the biosurfactants also supported their bactericidal activity against both the bacteria. Membrane permeability against both the bacteria was supported by amplifying protein release, increasing of cell surface hydrophobicity, withholding capacity of crystal violet dye and leakage of intracellular materials. Finally cell membrane disruption was confirmed by scanning electron microscopy (SEM). All these experiments expressed synergism and effective bactericidal activity of the combination of rhamnolipid and BS15 by enhancing the bacterial cell membrane permeability. Such effect of the combination of rhamnolipid and BS15 could make them promising alternatives to traditional antibiotic in near future. Copyright © 2017 Elsevier B.V. All rights reserved.
Bacterial cell motility of Burkholderia gut symbiont is required to colonize the insect gut.
Lee, Jun Beom; Byeon, Jin Hee; Jang, Ho Am; Kim, Jiyeun Kate; Yoo, Jin Wook; Kikuchi, Yoshitomo; Lee, Bok Luel
2015-09-14
We generated a Burkholderia mutant, which is deficient of an N-acetylmuramyl-l-alanine amidase, AmiC, involved in peptidoglycan degradation. When non-motile ΔamiC mutant Burkholderia cells harboring chain form were orally administered to Riptortus insects, ΔamiC mutant cells were unable to establish symbiotic association. But, ΔamiC mutant complemented with amiC gene restored in vivo symbiotic association. ΔamiC mutant cultured in minimal medium restored their motility with single-celled morphology. When ΔamiC mutant cells harboring single-celled morphology were administered to the host insect, this mutant established normal symbiotic association, suggesting that bacterial motility is essential for the successful symbiosis between host insect and Burkholderia symbiont. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Beckstrom, A C; Cleman, P E; Cassis-Ghavami, F L; Kamitsuka, M D
2013-12-01
To determine the bacterial contamination rate of the parent's cell phone and the effectiveness of anti-microbial gel in reducing transmission of bacteria from cell phone to hands. Cross-sectional study of cultures from the cell phone and hands before and after applying anti-microbial gel (n=50). All cell phones demonstrated bacterial contamination. Ninety percent had the same bacteria on the cell phone and their cleaned hands. Twenty two percent had no growth on their hands after applying anti-microbial gel after they had the same bacteria on the cell phone and hands. Ninety-two percent of parents were aware that cell phones carried bacteria, but only 38% cleaned their cell phones at least weekly. Bacterial contamination of cell phones may serve as vectors for nosocomial infection in the neonatal intensive care unit. Bacteria transmitted from cell phone to hands may not be eliminated using anti-microbial gel. Development of hand hygiene and cell phone cleaning guidelines are needed regarding bedside cell phone use.
Wang, Liyun; Keatch, Robert; Zhao, Qi; Wright, John A; Bryant, Clare E; Redmann, Anna L; Terentjev, Eugene M
2018-01-12
Biofilm formation on abiotic surfaces in food and medical industry can cause severe contamination and infection, yet how biological and physical factors determine cellular architecture of early biofilms and bacterial behavior of the constituent cells remains largely unknown. In this study we examine the specific role of type-I fimbriae in nascent stages of biofilm formation and the response of micro-colonies to environmental flow shear at single-cell resolution. The results show that type-I fimbriae are not required for reversible adhesion from plankton, but critical for irreversible adhesion of Escherichia coli ( E.coli ) MG1655 forming biofilms on polyethylene terephthalate (PET) surfaces. Besides establishing a firm cell-surface contact, the irreversible adhesion seems necessary to initiate the proliferation of E.coli on the surface. After application of shear stress, bacterial retention is dominated by the 3D architecture of colonies independent of the population and the multi-layered structure could protect the embedded cells from being insulted by fluid shear, while cell membrane permeability mainly depends on the biofilm population and the duration time of the shear stress. Importance Bacterial biofilms could lead to severe contamination problems in medical devices and food processing equipment. However, biofilms are usually studied at a rough macroscopic level, thus little is known about how individual bacterial behavior within biofilms and multicellular architecture are influenced by bacterial appendages (e.g. pili/fimbriae) and environmental factors during early biofilm formation. We apply Confocal Laser Scanning Microscopy (CLSM) to visualize E.coli micro-colonies at single-cell resolution. Our findings suggest that type-I fimbriae are vital to the initiation of bacterial proliferation on surfaces and that the responses of biofilm architecture and cell membrane permeability of constituent bacteria to fluid shear stress are different, which are
Energy Technology Data Exchange (ETDEWEB)
Gutiérrez-Hernández, José Manuel [Coordination for Innovation and Application of Science and Technology, Autonomous University San Luis Potosi, 78000 San Luis Potosi (Mexico); Department of Wood, Cellulose and Paper Research, University Guadalajara, 45110 Guadalajara (Mexico); Escobar-García, Diana María [Laboratory of Basic Sciences, Faculty of Dentistry, Autonomous University San Luis Potosi, 78000 San Luis Potosi (Mexico); Escalante, Alfredo [Department of Wood, Cellulose and Paper Research, University Guadalajara, 45110 Guadalajara (Mexico); Flores, Hector [Laboratory of Basic Sciences, Faculty of Dentistry, Autonomous University San Luis Potosi, 78000 San Luis Potosi (Mexico); González, Francisco Javier [Coordination for Innovation and Application of Science and Technology, Autonomous University San Luis Potosi, 78000 San Luis Potosi (Mexico); Gatenholm, Paul [Chalmers University of Technology, Department of Chemistry and Chemical Engineering, Biopolymer Technology, SE-412 96 Göteborg (Sweden); Toriz, Guillermo, E-mail: gtoriz@dmcyp.cucei.udg.mx [Department of Wood, Cellulose and Paper Research, University Guadalajara, 45110 Guadalajara (Mexico); Chalmers University of Technology, Department of Chemistry and Chemical Engineering, Biopolymer Technology, SE-412 96 Göteborg (Sweden)
2017-06-01
In this paper we explore the use of native bacterial cellulose (BC) in combination with functionalized multi-walled carbon nanotubes (MWNTs) as an original biomaterial, suitable three-dimensional (3D) scaffold for osteoblastic cell culture. Functionalized MWNTs were mixed with native BC (secreted by Gluconacetobacter xylinus) with the aim of reinforcing the mechanical properties of BC. The results indicate that BC-MWNTs scaffolds support osteoblast viability, adhesion and proliferation at higher levels as compared to traditional culture substrates. Chemically functionalized MWNTs are also an excellent material to be used as scaffold because these did not affect cell viability and showed an enhanced osteoblast adhesion. These results suggest the potential for this combination of biomaterials, i.e. BC and carbon nanomaterials, as scaffolds for bone regeneration. - Highlights: • Functionalization of multiwalled carbon nanotubes with carboxyl groups for reduces their toxicity against osteoblastic cells. • Use of native bacterial cellulose with functionalized multi-walled carbon nanotubes as scaffolds for tissue engineering. • Bacterial cellulose with multi-walled carbon nanotubes as scaffolds give an excellent option to be used in bone regeneration.
International Nuclear Information System (INIS)
Gutiérrez-Hernández, José Manuel; Escobar-García, Diana María; Escalante, Alfredo; Flores, Hector; González, Francisco Javier; Gatenholm, Paul; Toriz, Guillermo
2017-01-01
In this paper we explore the use of native bacterial cellulose (BC) in combination with functionalized multi-walled carbon nanotubes (MWNTs) as an original biomaterial, suitable three-dimensional (3D) scaffold for osteoblastic cell culture. Functionalized MWNTs were mixed with native BC (secreted by Gluconacetobacter xylinus) with the aim of reinforcing the mechanical properties of BC. The results indicate that BC-MWNTs scaffolds support osteoblast viability, adhesion and proliferation at higher levels as compared to traditional culture substrates. Chemically functionalized MWNTs are also an excellent material to be used as scaffold because these did not affect cell viability and showed an enhanced osteoblast adhesion. These results suggest the potential for this combination of biomaterials, i.e. BC and carbon nanomaterials, as scaffolds for bone regeneration. - Highlights: • Functionalization of multiwalled carbon nanotubes with carboxyl groups for reduces their toxicity against osteoblastic cells. • Use of native bacterial cellulose with functionalized multi-walled carbon nanotubes as scaffolds for tissue engineering. • Bacterial cellulose with multi-walled carbon nanotubes as scaffolds give an excellent option to be used in bone regeneration.
CRISPR-mediated control of the bacterial initiation of replication
Wiktor, J.M.; Lesterlin, Christian; Sherratt, David J.; Dekker, C.
2016-01-01
Programmable control of the cell cycle has been shown to be a powerful tool in cell-biology studies. Here, we develop a novel system for controlling the bacterial cell cycle, based on binding of CRISPR/dCas9 to the origin-of-replication locus. Initiation of replication of bacterial chromosomes is
Antibiotic resistance of bacterial biofilms
DEFF Research Database (Denmark)
Hoiby, N.; Bjarnsholt, T.; Givskov, M.
2010-01-01
A biofilm is a structured consortium of bacteria embedded in a self-produced polymer matrix consisting of polysaccharide, protein and DNA. Bacterial biofilms cause chronic infections because they show increased tolerance to antibiotics and disinfectant chemicals as well as resisting phagocytosis...... and other components of the body's defence system. The persistence of, for example, staphylococcal infections related to foreign bodies is due to biofilm formation. Likewise, chronic Pseudomonas aeruginosa lung infection in cystic fibrosis patients is caused by biofilm-growing mucoid strains....... Characteristically, gradients of nutrients and oxygen exist from the top to the bottom of biofilms and these gradients are associated with decreased bacterial metabolic activity and increased doubling times of the bacterial cells; it is these more or less dormant cells that are responsible for some of the tolerance...
Energy Technology Data Exchange (ETDEWEB)
Holt, Allison M [ORNL; Standaert, Robert F [ORNL; Jubb, Aaron M [ORNL; Katsaras, John [ORNL; Johs, Alexander [ORNL
2017-01-01
Biological membranes, formed primarily by the self-assembly of complex mixtures of phospholipids, provide a structured scaffold for compartmentalization and structural processes in living cells. The specific physical properties of phospholipid species present in a given membrane play a key role in mediating these processes. Phosphatidylethanolamine (PE), a zwitterionic lipid present in bacterial, yeast, and mammalian cell membranes, is exceptional. In addition to undergoing the standard lipid polymorphic transition between the gel and liquid-crystalline phase, it can also assume an unusual polymorphic state, the inverse hexagonal phase (HII). Divalent cations are among the factors that drive the formation of the HII phase, wherein the lipid molecules form stacked tubular structures by burying the hydrophilic head groups and exposing the hydrophobic tails to the bulk solvent. Most biological membranes contain a lipid species capable of forming the HII state suggesting that such lipid polymorphic structural states play an important role in structural biological processes such as membrane fusion. In this study, the interactions between Mg2+ and biomimetic bacterial cell membranes composed of PE and phosphatidylglycerol (PG) were probed using differential scanning calorimetry (DSC), small-angle x-ray scattering (SAXS), and fluorescence spectroscopy. The lipid phase transitions were examined at varying ratios of PE to PG and upon exposure to physiologically relevant concentrations of Mg2+. An understanding of these basic interactions enhances our understanding of membrane dynamics and how membrane-mediated structural changes may occur in vivo.
Spradling, Emily M.; Viator, John A.
2009-02-01
Melanoma is the deadliest form of skin cancer. Although the initial malignant cells are removed, it is impossible to determine whether or not the cancer has metastasized until a secondary tumor forms that is large enough to detect with conventional imaging. Photoacoustic detection of circulating melanoma cells in the bloodstream has shown promise for early detection of metastasis that may aid in treatment of this aggressive cancer. When blood is irradiated with energy from an Nd:YAG laser at 532 nm, photoacoustic signals are created and melanoma cells can be differentiated from the surrounding cells based on waveforms produced by an oscilloscope. Before this can be used as a diagnostic technique, however, we needed to investigate several parameters. Specifically, the current technique involves the in vitro separation of blood through centrifugation to isolate and test only the white blood cell layer. Using this method, we have detected a single cultured melanoma cell among a suspension of white blood cells. However, the process could be made simpler if the plasma layer were used for detection instead of the white blood cell layer. This layer is easier to obtain after blood separation, the optical difference between plasma and melanoma cells is more pronounced in this layer than in the white blood cell layer, and the possibility that any stray red blood cells could distort the results is eliminated. Using the photoacoustic apparatus, we detected no melanoma cells within the plasma of whole blood samples spiked with cultured melanoma cells.
Wang, Li; Chen, Siyuan; Ding, Yiming; Zhu, Qiang; Zhang, Nijia; Yu, Shuqing
2018-01-01
The present work determines the anticancer activity of bio-mediated synthesized cadmium sulfide nanoparticles using the ionic liquid and bacterial cells (Shewanella oneidensis). Bacterial cells have been exposed to be important resources that hold huge potential as ecofriendly, cost-effective, evading toxic of dangerous chemicals and the alternative of conventional physiochemical synthesis. The Shewanella oneidensis is an important kind of metal reducing bacterium, known as its special anaerobic respiratory and sulfate reducing capacity. The crystalline nature, phase purity and surface morphology of biosynthesized cadmium sulfide nanoparticles were analyzed by Fourier transform infrared spectroscopy, X-ray diffraction, Field emission scanning electron microscopy, Energy dispersive spectroscopy and Transmission electron microscopy. The use of imidazolium based ionic liquids as soft templating agent for controlling self-assembly and crystal growth direction of metal sulfide nanoparticles has also advanced as an important method. The microscopic techniques showed that the nanoparticles are designed on the nano form and have an excellent spherical morphology, due to the self-assembled mechanism of ionic liquid assistance. The antitumor efficiency of the cadmium sulfide nanoparticles was investigated against brain cancer cell lines using rat glioma cell lines. The effectively improved nano-crystalline and morphological structure of CdS nanoparticles in the presence of IL exhibit excellent cytotoxicity and dispersion ability on the cell shape is completely spread out showing a nice toxic environment against cancer cells. The cytotoxicity effect of cadmium sulfide nanoparticles was discussed with a diagrammatic representation. Copyright © 2017. Published by Elsevier B.V.
Chronic bacterial prostatitis in men with spinal cord injury.
Krebs, Jörg; Bartel, Peter; Pannek, Jürgen
2014-12-01
Recurrent urinary tract infections (UTI) are a major problem affecting spinal cord injury (SCI) patients and may stem from chronic bacterial prostatitis. We have therefore investigated the presence of chronic bacterial prostatitis and its role in the development of recurrent symptomatic UTI in SCI men. This study is a prospective cross-sectional investigation of bacterial prostatitis in SCI men in a single SCI rehabilitation center. In 50 men with chronic SCI presenting for a routine urologic examination, urine samples before and after prostate massage were taken for microbiologic investigation and white blood cell counting. Furthermore, patient characteristics, bladder diary details, and the annual rate of symptomatic UTI were collected retrospectively. No participant reported current symptoms of UTI or prostatitis. In most men (39/50, 78 %), the microbiologic analysis of the post-massage urine sample revealed growth of pathogenic bacteria. The majority of these men (32/39, 82 %) also presented with mostly (27/39, 69 %) the same pathogenic bacteria in the pre-massage sample. There was no significant (p = 0.48) difference in the number of symptomatic UTI in men with a positive post-massage culture compared with those with a negative culture. No significant (p = 0.67) difference in the frequency distribution of positive versus negative post-massage cultures was detected between men with recurrent and sporadic UTI. Most SCI men are affected by asymptomatic bacterial prostatitis; however, bacterial prostatitis does not play a major role in the development of recurrent UTI. The indication for antibiotic treatment of chronic bacterial prostatitis in asymptomatic SCI men with recurrent UTI is questionable.
Fang, J.
2015-12-01
Marine sediments cover more than two-thirds of the Earth's surface and represent a major part of the deep biosphere. Microbial cells and microbial activity appear to be widespread in these sediments. Recently, we reported the isolation of gram-positive anaerobic spore-forming piezophilic bacteria and detection of bacterial endospores in marine subsurface sediment from the Shimokita coalbed, Japan. However, the modern molecular microbiological methods (e.g., DNA-based microbial detection techniques) cannot detect bacterial endospore, because endospores are impermeable and are not stained by fluorescence DNA dyes or by ribosomal RNA staining techniques such as catalysed reporter deposition fluorescence in situ hybridization. Thus, the total microbial cell abundance in the deep biosphere may has been globally underestimated. This emphasizes the need for a new cultivation independent approach for the quantification of bacterial endospores in the deep subsurface. Dipicolinic acid (DPA, pyridine-2,6-dicarboxylic acid) is a universal and specific component of bacterial endospores, representing 5-15wt% of the dry spore, and therefore is a useful indicator and quantifier of bacterial endospores and permits to estimate total spore numbers in the subsurface biosphere. We developed a sensitive analytical method to quantify DPA content in environmental samples using gas chromatography-mass spectrometry. The method is sensitive and more convenient in use than other traditional methods. We applied this method to analyzing sediment samples from the South China Sea (obtained from IODP Exp. 349) to determine the abundance of spore-forming bacteria in the deep marine subsurface sediment. Our results suggest that gram-positive, endospore-forming bacteria may be the "unseen majority" in the deep biosphere.
Metallization of bacterial cellulose for electrical and electronic device manufacture
Evans, Barbara R [Oak Ridge, TN; O'Neill, Hugh M [Knoxville, TN; Jansen, Valerie Malyvanh [Memphis, TN; Woodward, Jonathan [Knoxville, TN
2010-09-28
A method for the deposition of metals in bacterial cellulose and for the employment of the metallized bacterial cellulose in the construction of fuel cells and other electronic devices is disclosed. The method for impregnating bacterial cellulose with a metal comprises placing a bacterial cellulose matrix in a solution of a metal salt such that the metal salt is reduced to metallic form and the metal precipitates in or on the matrix. The method for the construction of a fuel cell comprises placing a hydrated bacterial cellulose support structure in a solution of a metal salt such that the metal precipitates in or on the support structure, inserting contact wires into two pieces of the metal impregnated support structure, placing the two pieces of metal impregnated support structure on opposite sides of a layer of hydrated bacterial cellulose, and dehydrating the three layer structure to create a fuel cell.
The Evolution of the Bacterial Luciferase Gene Cassette (lux as a Real-Time Bioreporter
Directory of Open Access Journals (Sweden)
Gary Sayler
2012-01-01
Full Text Available The bacterial luciferase gene cassette (lux is unique among bioluminescent bioreporter systems due to its ability to synthesize and/or scavenge all of the substrate compounds required for its production of light. As a result, the lux system has the unique ability to autonomously produce a luminescent signal, either continuously or in response to the presence of a specific trigger, across a wide array of organismal hosts. While originally employed extensively as a bacterial bioreporter system for the detection of specific chemical signals in environmental samples, the use of lux as a bioreporter technology has continuously expanded over the last 30 years to include expression in eukaryotic cells such as Saccharomyces cerevisiae and even human cell lines as well. Under these conditions, the lux system has been developed for use as a biomedical detection tool for toxicity screening and visualization of tumors in small animal models. As the technologies for lux signal detection continue to improve, it is poised to become one of the first fully implantable detection systems for intra-organismal optical detection through direct marriage to an implantable photon-detecting digital chip. This review presents the basic biochemical background that allows the lux system to continuously autobioluminesce and highlights the important milestones in the use of lux-based bioreporters as they have evolved from chemical detection platforms in prokaryotic bacteria to rodent-based tumorigenesis study targets. In addition, the future of lux imaging using integrated circuit microluminometry to image directly within a living host in real-time will be introduced and its role in the development of dose/response therapeutic systems will be highlighted.
Prediction of bacterial meningitis based on cerebrospinal fluid pleocytosis in children
Directory of Open Access Journals (Sweden)
Sofia Águeda
Full Text Available Children with cerebrospinal fluid pleocytosis are frequently treated with parenteral antibiotics, but only a few have bacterial meningitis. Although some clinical prediction rules, such as bacterial meningitis score, are of well-known value, the cerebrospinal fluid white blood cells count can be the initial available information. Our aim was to establish a cutoff point of cerebrospinal fluid white blood cell count that could distinguish bacterial from viral and aseptic meningitis. A retrospective study of children aged 29 days to 17 years who were admitted between January 1st and December 31th, 2009, with cerebrospinal fluid pleocytosis (white blood cell > 7 µL-1 was conducted. The cases of traumatic lumbar puncture and of antibiotic treatment before lumbar puncture were excluded. There were 295 patients with cerebrospinal fluid pleocytosis, 60.3% females, medium age 5.0 ± 4.3 years distributed as: 12.2% 1-3 months; 10.5% 3-12 months; 29.8% 12 months to 5 years; 47.5% >5 years. Thirty one children (10.5% were diagnosed with bacterial meningitis, 156 (52.9% viral meningitis and 108 (36.6% aseptic meningitis. Bacterial meningitis was caused by Neisseria meningi tidis (48.4%, Streptococcus pneumoniae (32.3%, other Streptococcus species (9.7%, and other agents (9.7%. cerebrospinal fluid white blood cell count was significantly higher in patients with bacterial meningitis (mean, 4839 cells/µL compared to patients with aseptic meningitis (mean, 159 cells/µL, p < 0.001, with those with aseptic meningitis (mean, 577 cells/µL, p < 0.001 and with all non-bacterial meningitis cases together (p < 0.001. A cutoff value of 321 white blood cell/µL showed the best combination of sensitivity (80.6% and specificity (81.4% for the diagnosis of bacterial meningitis (area under receiver operating characteristic curve 0.837. Therefore, the value of cerebrospinal fluid white blood cell count was found to be a useful and rapid diagnostic test to distinguish
Pett, S L; Carey, C; Lin, E; Wentworth, D; Lazovski, J; Miró, J M; Gordin, F; Angus, B; Rodriguez-Barradas, M; Rubio, R; Tambussi, G; Cooper, D A; Emery, S
2011-04-01
Bacterial pneumonia still contributes to morbidity/mortality in HIV infection despite effective combination antiretroviral therapy (cART). Evaluation of Subcutaneous Interleukin-2 in a Randomized International Trial (ESPRIT), a trial of intermittent recombinant interleukin-2 (rIL-2) with cART vs. cART alone (control arm) in HIV-infected adults with CD4 counts ≥300cells/μL, offered the opportunity to explore associations between bacterial pneumonia and rIL-2, a cytokine that increases the risk of some bacterial infections. Baseline and time-updated factors associated with first-episode pneumonia on study were analysed using multivariate proportional hazards regression models. Information on smoking/pneumococcal vaccination history was not collected. IL-2 cycling was most intense in years 1-2. Over ≈7 years, 93 IL-2 [rate 0.67/100 person-years (PY)] and 86 control (rate 0.63/100 PY) patients experienced a pneumonia event [hazard ratio (HR) 1.06; 95% confidence interval (CI) 0.79, 1.42; P=0.68]. Median CD4 counts prior to pneumonia were 570cells/μL (IL-2 arm) and 463cells/μL (control arm). Baseline risks for bacterial pneumonia included older age, injecting drug use, detectable HIV viral load (VL) and previous recurrent pneumonia; Asian ethnicity was associated with decreased risk. Higher proximal VL (HR for 1 log(10) higher VL 1.28; 95% CI 1.11, 1.47; P<0.001) was associated with increased risk; higher CD4 count prior to the event (HR per 100 cells/μL higher 0.94; 95% CI 0.89, 1.0; P=0.04) decreased risk. Compared with controls, the hazard for a pneumonia event was higher if rIL-2 was received <180 days previously (HR 1.66; 95% CI 1.07, 2.60; P=0.02) vs.≥180 days previously (HR 0.98; 95% CI 0.70, 1.37; P=0.9). Compared with the control group, pneumonia risk in the IL-2 arm decreased over time, with HRs of 1.41, 1.71, 1.16, 0.62 and 0.84 in years 1, 2, 3-4, 5-6 and 7, respectively. Bacterial pneumonia rates in cART-treated adults with moderate
Engineering nanoparticles to silence bacterial communication
Directory of Open Access Journals (Sweden)
Kristen Publicover Miller
2015-03-01
Full Text Available The alarming spread of bacterial resistance to traditional antibiotics has warranted the study of alternative antimicrobial agents. Quorum sensing is a chemical cell-to-cell communication mechanism utilized by bacteria to coordinate group behaviors and establish infections. Quorum sensing is integral to bacterial survival, and therefore provides a unique target for antimicrobial therapy. In this study, silicon dioxide nanoparticles (Si-NP were engineered to target the signaling molecules (i.e. acylhomoserine lactones (HSL used for quorum sensing in order to halt bacterial communication. Specifically, when Si-NP were surface functionalized with beta-cyclodextrin (beta-CD, then added to cultures of bacteria (Vibrio fischeri, whose luminous output depends upon HSL-mediated quorum sensing, the cell-to-cell communication was dramatically reduced. Reductions in luminescence were further verified by quantitative polymerase chain reaction (qPCR analyses of luminescence genes. Binding of AHLs to Si-NPs was examined using nuclear magnetic resonance (NMR spectroscopy. The results indicated that by delivering high concentrations of engineered NPs with associated quenching compounds, the chemical signals were removed from the immediate bacterial environment. In actively-metabolizing cultures, this treatment blocked the ability of bacteria to communicate and regulate quorum sensing, effectively silencing and isolating the cells. Si-NPs provide a scaffold and critical stepping-stone for more pointed developments in antimicrobial therapy, especially with regard to quorum sensing – a target that will reduce resistance pressures imposed by traditional antibiotics.
DEFF Research Database (Denmark)
Wendel, Sofie; Christian Fischer, Emil; Martinez, Virginia
2016-01-01
Background: Bacterial surface display is an attractive technique for the production of cell-anchored, functional proteins and engineering of whole-cell catalysts. Although various outer membrane proteins have been used for surface display, an easy and versatile high-throughput-compatible assay...... to displaying the nanobody alone. We used flow cytometry to analyse display capability on single-cell versus population level and found that the signal peptide of the anchor has great effect on display efficiency.Conclusions: We have developed an inexpensive and easy read-out assay for surface display using...... nanobody: GFP interactions. The assay is compatible with the most common fluorescence detection methods, including multi-well plate whole-cell fluorescence detection, SDS-PAGE in-gel fluorescence, microscopy and flow cytometry. We anticipate that the platform will facilitate future in-depth studies...
Viral-bacterial associations in acute apical abscesses.
Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F
2011-08-01
Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.
Nest Material Shapes Eggs Bacterial Environment.
Directory of Open Access Journals (Sweden)
Cristina Ruiz-Castellano
Full Text Available Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus of eggshells in nests of spotless starlings (Sturnus unicolor at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and
Nest Material Shapes Eggs Bacterial Environment.
Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José
2016-01-01
Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically
DEFF Research Database (Denmark)
O'Connor, Jemma; Vjecha, Michael J; Phillips, Andrew N
2017-01-01
BACKGROUND: The effects of antiretroviral therapy on risk of severe bacterial infections in people with high CD4 cell counts have not been well described. In this study, we aimed to quantify the effects of immediate versus deferred ART on the risk of severe bacterial infection in people with high...... μL. We used Cox proportional hazards regression to model time to severe bacterial infection, which was defined as a composite endpoint of bacterial pneumonia (confirmed by the endpoint review committee), pulmonary or extrapulmonary tuberculosis, or any bacterial infectious disorder of grade 4...... had severe bacterial infections (immediate-initiation group n=34, deferred-initiation group n=86; median 2·8 years of follow-up). Immediate ART was associated with a reduced risk of severe bacterial infection compared with deferred ART (hazard ratio [HR] 0·39, 95% CI 0·26-0·57, p
Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A
2010-01-01
Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.
Biocompatible and detectable carboxylated nanodiamond on human cell
Energy Technology Data Exchange (ETDEWEB)
Liu, K-K [Institute of Pharmacology and Toxicology, Tzu Chi University, Hualien 970, Taiwan (China); Cheng, C-L [Department of Physics, National Dong Hwa University, Hualien 974, Taiwan (China); Chang, C-C [Department of Biological Science and Technology, National Chiao Tung University, Hsin-Chu 300, Taiwan (China); Chao, J-I [Institute of Pharmacology and Toxicology, Tzu Chi University, Hualien 970, Taiwan (China)
2007-08-15
Surface-modified carboxylated nanometre-sized diamond (cND) has been applied for the conjugation of biological molecules such as DNA and protein. In this study, we evaluated the biocompatibility and detection of cNDs and carbon nanotubes on human lung A549 epithelial cells and HFL-1 normal fibroblasts. Treatment with 5 or 100 nm cND particles, 0.1-100 {mu}g ml{sup -1}, did not reduce the cell viability and alter the protein expression profile in lung cells; however, carbon nanotubes induced cytotoxicity in these cells. The cNDs particles were accumulated in A549 cells, which were observed by atomic force microscopy and laser scanning confocal microscopy. Both 5 and 100 nm cNDs particles exhibited the green fluorescence and were ingested into cells. Moreover, the fluorescence intensities were increased in cells via a concentration-dependent manner after treatment with 5 and 100 nm cNDs, which can be detected by flow cytometer analysis. The fluorescence intensities of 5 nm cNDs were relative higher than 100 nm cNDs in cells at equal concentration treatment. The observation demonstrated that cND-interacting with cell is detectable by a confocal microscope, flow cytometer and atomic force microscope. These nanoparticles may be useful for further biomedical applications based on the properties of uptake ability, detectability and little cytotoxicity in human cells.
Biocompatible and detectable carboxylated nanodiamond on human cell
International Nuclear Information System (INIS)
Liu, K-K; Cheng, C-L; Chang, C-C; Chao, J-I
2007-01-01
Surface-modified carboxylated nanometre-sized diamond (cND) has been applied for the conjugation of biological molecules such as DNA and protein. In this study, we evaluated the biocompatibility and detection of cNDs and carbon nanotubes on human lung A549 epithelial cells and HFL-1 normal fibroblasts. Treatment with 5 or 100 nm cND particles, 0.1-100 μg ml -1 , did not reduce the cell viability and alter the protein expression profile in lung cells; however, carbon nanotubes induced cytotoxicity in these cells. The cNDs particles were accumulated in A549 cells, which were observed by atomic force microscopy and laser scanning confocal microscopy. Both 5 and 100 nm cNDs particles exhibited the green fluorescence and were ingested into cells. Moreover, the fluorescence intensities were increased in cells via a concentration-dependent manner after treatment with 5 and 100 nm cNDs, which can be detected by flow cytometer analysis. The fluorescence intensities of 5 nm cNDs were relative higher than 100 nm cNDs in cells at equal concentration treatment. The observation demonstrated that cND-interacting with cell is detectable by a confocal microscope, flow cytometer and atomic force microscope. These nanoparticles may be useful for further biomedical applications based on the properties of uptake ability, detectability and little cytotoxicity in human cells
Membrane rafts: a potential gateway for bacterial entry into host cells.
Hartlova, Anetta; Cerveny, Lukas; Hubalek, Martin; Krocova, Zuzana; Stulik, Jiri
2010-04-01
Pathogenic bacteria have developed various mechanisms to evade host immune defense systems. Invasion of pathogenic bacteria requires interaction of the pathogen with host receptors, followed by activation of signal transduction pathways and rearrangement of the cytoskeleton to facilitate bacterial entry. Numerous bacteria exploit specialized plasma membrane microdomains, commonly called membrane rafts, which are rich in cholesterol, sphingolipids and a special set of signaling molecules which allow entry to host cells and establishment of a protected niche within the host. This review focuses on the current understanding of the raft hypothesis and the means by which pathogenic bacteria subvert membrane microdomains to promote infection.
Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes
Directory of Open Access Journals (Sweden)
Toome Kadri
2011-02-01
Full Text Available Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.
Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes
LENUS (Irish Health Repository)
Scheler, Ott
2011-02-28
Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification) amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal\\/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.
Cellular reprogramming by gram-positive bacterial components: a review.
LENUS (Irish Health Repository)
Buckley, Julliette M
2012-02-03
LPS tolerance has been the focus of extensive scientific and clinical research over the last several decades in an attempt to elucidate the sequence of changes that occur at a molecular level in tolerized cells. Tolerance to components of gram-positive bacterial cell walls such as bacterial lipoprotein and lipoteichoic acid is a much lesser studied, although equally important, phenomenon. This review will focus on cellular reprogramming by gram-positive bacterial components and examines the alterations in cell surface receptor expression, changes in intracellular signaling, gene expression and cytokine production, and the phenomenon of cross-tolerance.
Directory of Open Access Journals (Sweden)
Claire Battin
Full Text Available Sensing of pathogens by innate immune cells is essential for the initiation of appropriate immune responses. Toll-like receptors (TLRs, which are highly sensitive for various structurally and evolutionary conserved molecules derived from microbes have a prominent role in this process. TLR engagement results in the activation of the transcription factor NF-κB, which induces the expression of cytokines and other inflammatory mediators. The exquisite sensitivity of TLR signalling can be exploited for the detection of bacteria and microbial contaminants in tissue cultures and in protein preparations. Here we describe a cellular reporter system for the detection of TLR ligands in biological samples. The well-characterized human monocytic THP-1 cell line was chosen as host for an NF-ᴋB-inducible enhanced green fluorescent protein reporter gene. We studied the sensitivity of the resultant reporter cells for a variety of microbial components and observed a strong reactivity towards TLR1/2 and TLR2/6 ligands. Mycoplasma lipoproteins are potent TLR2/6 agonists and we demonstrate that our reporter cells can be used as reliable and robust detection system for mycoplasma contaminations in cell cultures. In addition, a TLR4-sensitive subline of our reporters was engineered, and probed with recombinant proteins expressed in different host systems. Bacterially expressed but not mammalian expressed proteins induced strong reporter activity. We also tested proteins expressed in an E. coli strain engineered to lack TLR4 agonists. Such preparations also induced reporter activation in THP-1 cells highlighting the importance of testing recombinant protein preparations for microbial contaminations beyond endotoxins. Our results demonstrate the usefulness of monocytic reporter cells for high-throughput screening for microbial contaminations in diverse biological samples, including tissue culture supernatants and recombinant protein preparations. Fluorescent reporter
Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang
2016-11-01
Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10 3 to 1 × 10 7 cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.
Autophagy and bacterial clearance: a not so clear picture
Mostowy, Serge
2012-01-01
Autophagy, an intracellular degradation process highly conserved from yeast to humans, is viewed as an important defence mechanism to clear intracellular bacteria. However, recent work has shown that autophagy may have different roles during different bacterial infections that restrict bacterial replication (antibacterial autophagy), act in cell autonomous signalling (non-bacterial autophagy) or support bacterial replication (pro-bacterial autophagy). This review will focus on newfound intera...
Mayer, Letícia Eichstaedt; Hörner, Rosmari; Tizotti, Maisa Kräulich; Martini, Rosiéli; Roehrs, Magda Cristina Souza Marques; Kempfer, Cláudia Barbisan
2012-01-01
Metallo-β-lactamase (MBL) has been reported all over the world. The inhibitory effect of mercaptopropionic acid (MPA) on bacterial growth was evaluated by comparison between disk diffusion and broth dilution methodology with determination of the minimum inhibitory concentration (MIC) for multidrug-resistant Acinetobacter baumanni strains. MPA significantly inhibited growth of the strains. The use of MPA can affect the results in phenotypic methods of MBL detection.
Francisco, Gerardo D; Li, Zhong; Albright, J Donald; Eudy, Nancy H; Katz, Alan H; Petersen, Peter J; Labthavikul, Pornpen; Singh, Guy; Yang, Youjun; Rasmussen, Beth A; Lin, Yang-I; Mansour, Tarek S
2004-01-05
Over 50 phenyl thiazolyl urea and carbamate derivatives were synthesized for evaluation as new inhibitors of bacterial cell-wall biosynthesis. Many of them demonstrated good activity against MurA and MurB and gram-positive bacteria including MRSA, VRE and PRSP. 3,4-Difluorophenyl 5-cyanothiazolylurea (3p) with clog P of 2.64 demonstrated antibacterial activity against both gram-positive and gram-negative bacteria.
TBK1 protects vacuolar integrity during intracellular bacterial infection.
Directory of Open Access Journals (Sweden)
Andrea L Radtke
2007-03-01
Full Text Available TANK-binding kinase-1 (TBK1 is an integral component of Type I interferon induction by microbial infection. The importance of TBK1 and Type I interferon in antiviral immunity is well established, but the function of TBK1 in bacterial infection is unclear. Upon infection of murine embryonic fibroblasts with Salmonella enterica serovar Typhimurium (Salmonella, more extensive bacterial proliferation was observed in tbk1(-/- than tbk1(+/+ cells. TBK1 kinase activity was required for restriction of bacterial infection, but interferon regulatory factor-3 or Type I interferon did not contribute to this TBK1-dependent function. In tbk1(-/-cells, Salmonella, enteropathogenic Escherichia coli, and Streptococcus pyogenes escaped from vacuoles into the cytosol where increased replication occurred, which suggests that TBK1 regulates the integrity of pathogen-containing vacuoles. Knockdown of tbk1 in macrophages and epithelial cells also resulted in increased bacterial localization in the cytosol, indicating that the role of TBK1 in maintaining vacuolar integrity is relevant in different cell types. Taken together, these data demonstrate a requirement for TBK1 in control of bacterial infection distinct from its established role in antiviral immunity.
TBK1 Protects Vacuolar Integrity during Intracellular Bacterial Infection
Radtke, Andrea L; Delbridge, Laura M; Balachandran, Siddharth; Barber, Glen N; O'Riordan, Mary X. D
2007-01-01
TANK-binding kinase-1 (TBK1) is an integral component of Type I interferon induction by microbial infection. The importance of TBK1 and Type I interferon in antiviral immunity is well established, but the function of TBK1 in bacterial infection is unclear. Upon infection of murine embryonic fibroblasts with Salmonella enterica serovar Typhimurium (Salmonella), more extensive bacterial proliferation was observed in tbk1−/− than tbk1+/+ cells. TBK1 kinase activity was required for restriction of bacterial infection, but interferon regulatory factor-3 or Type I interferon did not contribute to this TBK1-dependent function. In tbk1−/−cells, Salmonella, enteropathogenic Escherichia coli, and Streptococcus pyogenes escaped from vacuoles into the cytosol where increased replication occurred, which suggests that TBK1 regulates the integrity of pathogen-containing vacuoles. Knockdown of tbk1 in macrophages and epithelial cells also resulted in increased bacterial localization in the cytosol, indicating that the role of TBK1 in maintaining vacuolar integrity is relevant in different cell types. Taken together, these data demonstrate a requirement for TBK1 in control of bacterial infection distinct from its established role in antiviral immunity. PMID:17335348
Directory of Open Access Journals (Sweden)
Yu Yang
2012-01-01
Full Text Available We have developed novel Bio-Plex assays for simultaneous detection of Bacillus anthracis, Yersinia pestis, Brucella spp., Francisella tularensis, and Burkholderia pseudomallei. Universal primers were used to amplify highly conserved region located within the 16S rRNA amplicon, followed by hybridized to pathogen-specific probes for identification of these five organisms. The other assay is based on multiplex PCR to simultaneously amplify five species-specific pathogen identification-targeted regions unique to individual pathogen. Both of the two arrays are validated to be flexible and sensitive for simultaneous detection of bioterrorism bacteria. However, universal primer PCR-based array could not identify Bacillus anthracis, Yersinia pestis, and Brucella spp. at the species level because of the high conservation of 16S rDNA of the same genus. The two suspension arrays can be utilized to detect Bacillus anthracis sterne spore and Yersinia pestis EV76 from mimic “write powder” samples, they also proved that the suspension array system will be valuable tools for diagnosis of bacterial biothreat agents in environmental samples.
Vargas, Ignacio T.; Albert, Istvan U.; Regan, John M.
2013-01-01
Pyrosequencing was used to characterize bacterial communities in air-cathode microbial fuel cells across a volumetric (graphite fiber brush) and a planar (carbon cloth) anode, where different physical and chemical gradients would be expected
Pérez, María Teresa; Sommaruga, Ruben
2007-09-01
We studied the interactive effects of dissolved organic matter (DOM) and solar radiation on the activity and community structure of bacteria from an alpine lake. Activity was assessed both at the community level as leucine incorporation rates and at the single-cell level by microautoradiography. Fluorescent in situ hybridization and signal amplification by catalysed reporter deposition (CARD-FISH) was used to track changes in the bacterial community composition. Bacteria-free filtrates of different DOM sources (lake, algae or soil) were incubated either in the dark or exposed to solar radiation. Afterwards, the natural bacterial assemblage was inoculated and the cultures incubated in the dark for 24-48 h. Bacterial activity was enhanced in the first 24 h in the soil and algal DOM amendments kept in the dark. After 48 h, the enhancement effect was greatly reduced. The initial bacterial community was dominated by Betaproteobacteria followed by Actinobacteria. The relative abundance (expressed as a percentage of DAPI-stained cells) of Betaproteobacteria increased first in dark incubated DOM amendments, but after 48 h no significant differences were detected among treatments. In contrast, the relative abundance of Actinobacteria increased in pre-irradiated DOM treatments. Although Betaproteobacteria dominated at the end of the experiment, the relative abundance of their R-BT subgroup differed among treatments. Changes in bacterial community activity were significantly correlated with those of the relative abundance and activity of Betaproteobacteria, whereas the contribution of Actinobacteria to the bulk activity was very modest. Our results indicate a negative effect of DOM photoalteration on the bulk bacterial activity. The magnitude of this effect was time-dependent and related to rapid changes in the bacterial assemblage composition.
Fungal innate immunity induced by bacterial microbe-associated molecular patterns (MAMPs)
DEFF Research Database (Denmark)
Ip Cho, Simon; Sundelin, Thomas; Erbs, Gitte
2016-01-01
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal-bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposin...
Bacterial toxins as pathogen weapons against phagocytes
Directory of Open Access Journals (Sweden)
Ana edo Vale
2016-02-01
Full Text Available Bacterial toxins are virulence factors that manipulate host cell functions and take over the control of vital processes of living organisms to favour microbial infection. Some toxins directly target innate immune cells, thereby annihilating a major branch of the host immune response. In this review we will focus on bacterial toxins that act from the extracellular milieu and hinder the function of macrophages and neutrophils. In particular, we will concentrate on toxins from Gram-positive and Gram-negative bacteria that manipulate cell signalling or induce cell death by either imposing direct damage to the host cells cytoplasmic membrane or enzymatically modifying key eukaryotic targets. Outcomes regarding pathogen dissemination, host damage and disease progression will be discussed.
van der Heijden, I. M.; Wilbrink, B.; Tchetverikov, I.; Schrijver, I. A.; Schouls, L. M.; Hazenberg, M. P.; Breedveld, F. C.; Tak, P. P.
2000-01-01
The continuous presence of bacteria or their degraded antigens in the synovium may be involved in the pathogenesis of rheumatoid arthritis (RA). The aim of this study was to determine the presence of bacterial nucleic acids and bacterial cell wall constituents in the joints of patients with RA and
Szymańska-Chargot, Monika; Cybulska, Justyna; Zdunek, Artur
2011-01-01
Raman and Fourier Transform Infrared (FT-IR) spectroscopy was used for assessment of structural differences of celluloses of various origins. Investigated celluloses were: bacterial celluloses cultured in presence of pectin and/or xyloglucan, as well as commercial celluloses and cellulose extracted from apple parenchyma. FT-IR spectra were used to estimate of the Iβ content, whereas Raman spectra were used to evaluate the degree of crystallinity of the cellulose. The crystallinity index (XCRAMAN%) varied from −25% for apple cellulose to 53% for microcrystalline commercial cellulose. Considering bacterial cellulose, addition of xyloglucan has an impact on the percentage content of cellulose Iβ. However, addition of only xyloglucan or only pectins to pure bacterial cellulose both resulted in a slight decrease of crystallinity. However, culturing bacterial cellulose in the presence of mixtures of xyloglucan and pectins results in an increase of crystallinity. The results confirmed that the higher degree of crystallinity, the broader the peak around 913 cm−1. Among all bacterial celluloses the bacterial cellulose cultured in presence of xyloglucan and pectin (BCPX) has the most similar structure to those observed in natural primary cell walls. PMID:22163913
Lin, Yunfeng
2015-01-01
Bacteria such as Salmonella and E. coli present a great challenge in public health care in today’s society. Protection of public safety against bacterial contamination and rapid diagnosis of infection require simple and fast assays for the detection and elimination of bacterial pathogens. After utilizing Salmonella DT104 as an example bacterial strain for our investigation, we report a rapid and sensitive assay for the qualitative and quantitative detection of bacteria by using antibody affinity binding, popcorn shaped gold nanoparticle (GNPOPs) labeling, surfance enchanced Raman spectroscopy (SERS), and inductively coupled plasma mass spectrometry (ICP-MS) detection. For qualitative analysis, our assay can detect Salmonella within 10 min by Raman spectroscopy; for quantitative analysis, our assay has the ability to measure as few as 100 Salmonella DT104 in a 1 mL sample (100 CFU/mL) within 40 min. Based on the quantitative detection, we investigated the quantitative destruction of Salmonella DT104, and the assay’s photothermal efficiency in order to reduce the amount of GNPOPs in the assay to ultimately to eliminate any potential side effects/toxicity to the surrounding cells in vivo. Results suggest that our assay may serve as a promising candidate for qualitative and quantitative detection and elimination of a variety of bacterial pathogens. PMID:26417447
Shrivastava, Sajal; Lee, Won-Il; Lee, Nae-Eung
2018-06-30
A critical unmet need in the diagnosis of bacterial infections, which remain a major cause of human morbidity and mortality, is the detection of scarce bacterial pathogens in a variety of samples in a rapid and quantitative manner. Herein, we demonstrate smartphone-based detection of Staphylococcus aureus in a culture-free, rapid, quantitative manner from minimally processed liquid samples using aptamer-functionalized fluorescent magnetic nanoparticles. The tagged S. aureus cells were magnetically captured in a detection cassette, and then fluorescence was imaged using a smartphone camera with a light-emitting diode as the excitation source. Our results showed quantitative detection capability with a minimum detectable concentration as low as 10 cfu/ml by counting individual bacteria cells, efficiently capturing S. aureus cells directly from a peanut milk sample within 10 min. When the selectivity of detection was investigated using samples spiked with other pathogenic bacteria, no significant non-specific detection occurred. Furthermore, strains of S. aureus from various origins showed comparable results, ensuring that the approach can be widely adopted. Therefore, the quantitative fluorescence imaging platform on a smartphone could allow on-site detection of bacteria, providing great potential assistance during major infectious disease outbreaks in remote and resource-limited settings. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Hagan, Bethany S.; Bruckner-Lea, Cynthia J.
2002-12-01
This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.
Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture
Directory of Open Access Journals (Sweden)
Jyoti Kumar
2015-09-01
Full Text Available Aim: This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. Introduction: M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA, Rpt2 and 12S ribosomal RNA (rRNA genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. Materials and Methods: A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. Results: All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631. Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S r
[Analysis of the bacterial community developing in the course of Sphagnum moss decomposition].
Kulichevskaia, I S; Belova, S E; Kevbrin, V V; Dedysh, S N; Zavarzin, G A
2007-01-01
Slow degradation of organic matter in acidic Sphagnum peat bogs suggests a limited activity of organotrophic microorganisms. Monitoring of the Sphagnum debris decomposition in a laboratory simulation experiment showed that this process was accompanied by a shift in the water color to brownish due to accumulation of humic substances and by the development of a specific bacterial community with a density of 2.4 x 10(7) cells ml(-1). About half of these organisms are metabolically active and detectable with rRNA-specific oligonucleotide probes. Molecular identification of the components of this microbial community showed the numerical dominance of bacteria affiliated with the phyla Alphaproteobacteria, Actinobacteria, and Phanctomycetes. The population sizes of Firmicutes and Bacteroidetes, which are believed to be the main agents of bacterially-mediated decomposition in eutrophic wetlands, were low. The numbers of planctomycetes increased at the final stage of Sphagnum decomposition. The representative isolates of Alphaproteobacteria were able to utilize galacturonic acid, the only low-molecular-weight organic compound detected in the water samples; the representatives of Planctomycetes were able to decompose some heteropolysaccharides, which points to the possible functional role of these groups of microorganisms in the community under study. Thus, the composition of the bacterial community responsible for Sphagnum decomposition in acidic and low-mineral oligotrophic conditions seems to be fundamentally different from that of the bacterial community which decomposes plant debris in eutrophic ecosystems at neutral pH.
[A cell-based detection of ciguatoxin using sodium fluorescence probe].
Yuan, Jian-hui; Yang, Hui; Tang, Huan-wen; Huang, Wei; Xu, Xin-yun; Liu, Jian-jun; Ke, Yue-bin; Cheng, Jin-quan; Zhuang, Zhi-xiong
2011-04-01
To establish a cell-based detection method of ciguatoxin using fluorescence assay. Mouse neuroblastoma N-2A cells were exposed to ouabain and veratridine and different concentrations of standard ciguatoxin samples (P-CTX-1) to establish the curvilinear relationship between the toxin dosage and fluorescence intensity using the sodium fluorescence probe CoroNaTM Green. The toxicity curvilinear relationship was also generated between the toxin dosage and cell survival using CCK-8 method. Based on these standard curves, the presence of ciguatoxin was detected in 33 samples of deep-sea coral fish. A correlation was found between the detection results of cell-based fluorescence assay and cytotoxicity assay, whose detection limit reached 103 g/ml and 1012 g/ml, respectively. The cell-based fluorescent assay sensitivity showed a higher sensitivity than cytotoxicity assay with a 2-4 h reduction of the detection time. The cell-based fluorescent assay can quickly and sensitively detect ciguatoxin and may serve as a good option for preliminary screening of the toxin.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Synthetic and biogenic magnetite nanoparticles for tracking of stem cells and dendritic cells
International Nuclear Information System (INIS)
Schwarz, Sebastian; Fernandes, Fabiana; Sanroman, Laura; Hodenius, Michael; Lang, Claus; Himmelreich, Uwe; Schmitz-Rode, Thomas; Schueler, Dirk; Hoehn, Mathias
2009-01-01
Accurate delivery of cells to target organs is critical for success of cell-based therapies with stem cells or immune cells such as antigen-presenting dendritic cells (DC). Labeling with contrast agents before implantation provides a powerful means for monitoring cellular migration using magnetic resonance imaging (MRI). In this study, we investigated the uptake of fully synthesized or bacterial magnetic nanoparticles (MNPs) into hematopoietic Flt3 + stem cells and DC from mouse bone marrow. We show that (i) uptake of both synthetic and biogenic nanoparticles into cells endow magnetic activity and (ii) low numbers of MNP-loaded cells are readily detected by MRI.
International Nuclear Information System (INIS)
Singh, B.B.; Srinivasan, V.T.; Shenoy, M.A.; George, K.C.; Maniar, H.S.; Rawat, K.P.
1987-01-01
The present report deals with the results on phenothiazine derivatives such as promethazine (PMZ), trimeprazine (TMZ), trifluoperazine (TFP) and prochlorperazine (PCP) and their comparison with that of chlorpromazine (CPZ). Their efficiency in combination with hyperthermia, radiation and other anti-cancer drugs in treating murine tumors has also been presented herein. In addition, results on bacterial cells dealing with their mechanistic aspects are also included. (author). 57 refs., 27 figures, 13 tables
FISH DETECTION OF CAMPYLOBACTER AND ARCOBACTER ADHERED TO STAINLESS STEEL COUPONS
Directory of Open Access Journals (Sweden)
Lucie Šilhová
2015-02-01
Full Text Available This study focuses on detecting biofilm and planktonic bacterial cells of the genera Arcobacter and Campylobacter. This study is, to our knowledge, the first study deals with application of FISH procedure to detect biofilm formation on stainless steel coupons of Arcobacter-isolates from real-world environments. These bacteria can cause a lot of diseases. Especially, in the last decade, arcobacters have been increasingly isolated from feces of clinically healthy and ill animals, foods of animal origin and various types of water. Fluorescence in situ hybridization was used to detect biofilm and planktonic cells of selected microorganisms. This method was optimized and subsequently applied to biofilm samples prepared on stainless steel coupons. The study results indicate that fluorescence in situ hybridization is suitable for detecting biofilm and planktonic cells of the studied bacteria.
Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.
2009-01-01
Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009
In vitro behaviors of rat mesenchymal stem cells on bacterial celluloses with different moduli
International Nuclear Information System (INIS)
Taokaew, Siriporn; Phisalaphong, Muenduen; Zhang Newby, Bi-min
2014-01-01
Compressive moduli of bacteria-synthesized cellulose (BC) were altered by two drying techniques: ambient-air drying and freeze drying. While no significant differences in dry weight were found, their cross-sectional structures and thickness varied greatly. Freeze dried BCs had loose cross-sectional structures and a thickness of ∼ 4.7 mm, whereas air dried BCs had more compacted cross-sectional structures and a thickness of ∼ 0.1 mm. The compressive moduli of the rehydrated freeze dried and rehydrated air dried BCs were measured to be 21.06 ± 0.22 kPa and 90.09 ± 21.07 kPa, respectively. When rat mesenchymal stem cells (rMSCs) were seeded on these BCs, they maintained a round morphology in the first 3 days of cultivation. More spread-out morphology and considerable proliferation on freeze dried BCs were observed in 7 days, but not on air-dried BCs. The cells were further grown for 3 weeks in the absence and presence of differentiation agents. Without using any differentiation agents, no detectable differentiation was noticed for rMSCs further cultivated on both types of BC. With differentiation inducing agents, chondrogenic differentiation, visualized by histological staining, was observed in some area of the rehydrated freeze dried BCs; while osteogenic differentiation was noticed on the stiffer rehydrated air dried BCs. - Graphical abstract: In the presence of induction agents, rat mesenchymal stem cells (rMSCs) preferentially differentiated into osteocytes on stiffer air dried BC films. - Highlights: • Bacterial cellulose (BC) sheets with different moduli generated by drying differently • Air-dried BC exhibited a modulus similar to that of bone. • Freeze-dried BC showed a modulus in the range of that of muscle. • Air-dried BC promoted the differentiation of rMSCs into osteocytes. • Freeze-dried BC promoted the differentiation of rMSCs into chondrocytes
In vitro behaviors of rat mesenchymal stem cells on bacterial celluloses with different moduli
Energy Technology Data Exchange (ETDEWEB)
Taokaew, Siriporn [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Bangkok 10330 (Thailand); Department of Chemical and Biomolecular Engineering, The University of Akron, Akron, OH 44325-3906 (United States); Phisalaphong, Muenduen [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Bangkok 10330 (Thailand); Zhang Newby, Bi-min, E-mail: bimin@uakron.edu [Department of Chemical and Biomolecular Engineering, The University of Akron, Akron, OH 44325-3906 (United States)
2014-05-01
Compressive moduli of bacteria-synthesized cellulose (BC) were altered by two drying techniques: ambient-air drying and freeze drying. While no significant differences in dry weight were found, their cross-sectional structures and thickness varied greatly. Freeze dried BCs had loose cross-sectional structures and a thickness of ∼ 4.7 mm, whereas air dried BCs had more compacted cross-sectional structures and a thickness of ∼ 0.1 mm. The compressive moduli of the rehydrated freeze dried and rehydrated air dried BCs were measured to be 21.06 ± 0.22 kPa and 90.09 ± 21.07 kPa, respectively. When rat mesenchymal stem cells (rMSCs) were seeded on these BCs, they maintained a round morphology in the first 3 days of cultivation. More spread-out morphology and considerable proliferation on freeze dried BCs were observed in 7 days, but not on air-dried BCs. The cells were further grown for 3 weeks in the absence and presence of differentiation agents. Without using any differentiation agents, no detectable differentiation was noticed for rMSCs further cultivated on both types of BC. With differentiation inducing agents, chondrogenic differentiation, visualized by histological staining, was observed in some area of the rehydrated freeze dried BCs; while osteogenic differentiation was noticed on the stiffer rehydrated air dried BCs. - Graphical abstract: In the presence of induction agents, rat mesenchymal stem cells (rMSCs) preferentially differentiated into osteocytes on stiffer air dried BC films. - Highlights: • Bacterial cellulose (BC) sheets with different moduli generated by drying differently • Air-dried BC exhibited a modulus similar to that of bone. • Freeze-dried BC showed a modulus in the range of that of muscle. • Air-dried BC promoted the differentiation of rMSCs into osteocytes. • Freeze-dried BC promoted the differentiation of rMSCs into chondrocytes.
Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.
Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G
2016-03-15
During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nawrocki-Raby Béatrice
2010-01-01
Full Text Available Abstract Background Staphylococcus aureus releases virulence factors (VF that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting β2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal combined with a corticosteroid (fluticasone propionate, FP was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. Methods A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. Results When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFα. Conclusions Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting β2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of β2 adrenergic receptor agonist and glucocorticoid.
Czech Academy of Sciences Publication Activity Database
Baldíková, E.; Pospíšková, K.; Ladakis, D.; Kookos, I.K.; Koutinas, A.A.; Šafaříková, Miroslava; Šafařík, Ivo
2017-01-01
Roč. 71, February (2017), s. 214-221 ISSN 0928-4931 Institutional support: RVO:60077344 Keywords : bacterial cellulose * Komagataeibacter sucrofermentans * copper phthalocyanine * crystal violet * yeast cells * trypsin Subject RIV: EI - Biotechnology ; Bionics OBOR OECD: Bioproducts (products that are manufactured using biological material as feedstock) biomaterials, bioplastics, biofuels, bioderived bulk and fine chemicals, bio-derived novel materials Impact factor: 4.164, year: 2016
Aminiahidashti, Hamed; Hosseininejad, Seyed Mohammad; Montazer, Hosein; Bozorgi, Farzad; Goli Khatir, Iraj; Jahanian, Fateme; Raee, Behnaz
2014-01-01
Spontaneous bacterial peritonitis (SBP) as a monomicrobial infection of ascites fluid is one of the most important causes of morbidity and mortality in cirrhotic patients. This study was aimed to determine the diagnostic accuracy of ascites fluid color in detection of SBP in cirrhotic cases referred to the emergency department. Cirrhotic patients referred to the ED for the paracentesis of ascites fluid were enrolled. For all studied patients, the results of laboratory analysis and gross appearance of ascites fluid registered and reviewed by two emergency medicine specialists. The sensitivity, specificity, positive and negative predictive value, and positive and negative likelihood ration of the ascites fluid gross appearance in detection of SBP were measured with 95% confidence interval. The present project was performed in 80 cirrhotic patients with ascites (52.5 female). The mean of the subjects' age was 56.25±12.21 years (35-81). Laboratory findings revealed SBP in 23 (29%) cases. Fifty nine (73%) cases had transparent ascites fluid appearance of whom 17 (29%) ones suffered from SBP. From 21 (26%) cases with opaque ascites appearance, 15 (71%) had SBP. The sensitivity and specificity of the ascites fluid appearance in detection of SBP were 46.88% (Cl: 30.87-63.55) and 87.50% (95% Cl: 75.3-94.14), respectively. It seems that the gross appearance of ascites fluid had poor diagnostic accuracy in detection of SBP and considering its low sensitivity, it could not be used as a good screening tool for this propose.
Directory of Open Access Journals (Sweden)
Hamed Aminiahidashti
2014-08-01
Full Text Available Introduction: Spontaneous bacterial peritonitis (SBP as a monomicrobial infection of ascites fluid is one of the most important causes of morbidity and mortality in cirrhotic patients. This study was aimed to determine the diagnostic accuracy of ascites fluid color in detection of SBP in cirrhotic cases referred to the emergency department. Methods: Cirrhotic patients referred to the ED for the paracentesis of ascites fluid were enrolled. For all studied patients, the results of laboratory analysis and gross appearance of ascites fluid registered and reviewed by two emergency medicine specialists. The sensitivity, specificity, positive and negative predictive value, and positive and negative likelihood ration of the ascites fluid gross appearance in detection of SBP were measured with 95% confidence interval. Results: The present project was performed in 80 cirrhotic patients with ascites (52.5 female. The mean of the subjects’ age was 56.25±12.21 years (35-81. Laboratory findings revealed SBP in 23 (29% cases. Fifty nine (73% cases had transparent ascites fluid appearance of whom 17 (29% ones suffered from SBP. From 21 (26% cases with opaque ascites appearance, 15 (71% had SBP. The sensitivity and specificity of the ascites fluid appearance in detection of SBP were 46.88% (Cl: 30.87-63.55 and 87.50% (95% Cl: 75.3-94.14, respectively. Conclusion: It seems that the gross appearance of ascites fluid had poor diagnostic accuracy in detection of SBP and considering its low sensitivity, it could not be used as a good screening tool for this propose.
The Membrane Steps of Bacterial Cell Wall Synthesis as Antibiotic Targets
Directory of Open Access Journals (Sweden)
Yao Liu
2016-08-01
Full Text Available Peptidoglycan is the major component of the cell envelope of virtually all bacteria. It has structural roles and acts as a selective sieve for molecules from the outer environment. Peptidoglycan synthesis is therefore one of the most important biogenesis pathways in bacteria and has been studied extensively over the last twenty years. The pathway starts in the cytoplasm, continues in the cytoplasmic membrane and finishes in the periplasmic space, where the precursor is polymerized into the peptidoglycan layer. A number of proteins involved in this pathway, such as the Mur enzymes and the penicillin binding proteins (PBPs, have been studied and regarded as good targets for antibiotics. The present review focuses on the membrane steps of peptidoglycan synthesis that involve two enzymes, MraY and MurG, the inhibitors of these enzymes and the inhibition mechanisms. We also discuss the challenges of targeting these two cytoplasmic membrane (associated proteins in bacterial cells and the perspectives on how to overcome the issues.
Electrical conductivity measurements of bacterial nanowires from Pseudomonas aeruginosa
International Nuclear Information System (INIS)
Maruthupandy, Muthusamy; Anand, Muthusamy; Beevi, Akbar Sait Hameedha; Priya, Radhakrishnan Jeeva; Maduraiveeran, Govindhan
2015-01-01
The extracellular appendages of bacteria (flagella) that transfer electrons to electrodes are called bacterial nanowires. This study focuses on the isolation and separation of nanowires that are attached via Pseudomonas aeruginosa bacterial culture. The size and roughness of separated nanowires were measured using transmission electron microscopy (TEM) and atomic force microscopy (AFM), respectively. The obtained bacterial nanowires indicated a clear image of bacterial nanowires measuring 16 nm in diameter. The formation of bacterial nanowires was confirmed by microscopic studies (AFM and TEM) and the conductivity nature of bacterial nanowire was investigated by electrochemical techniques. Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS), which are nondestructive voltammetry techniques, suggest that bacterial nanowires could be the source of electrons—which may be used in various applications, for example, microbial fuel cells, biosensors, organic solar cells, and bioelectronic devices. Routine analysis of electron transfer between bacterial nanowires and the electrode was performed, providing insight into the extracellular electron transfer (EET) to the electrode. CV revealed the catalytic electron transferability of bacterial nanowires and electrodes and showed excellent redox activities. CV and EIS studies showed that bacterial nanowires can charge the surface by producing and storing sufficient electrons, behave as a capacitor, and have features consistent with EET. Finally, electrochemical studies confirmed the development of bacterial nanowires with EET. This study suggests that bacterial nanowires can be used to fabricate biomolecular sensors and nanoelectronic devices. (paper)
Bacterial Community Shift Drives Antibiotic Resistance Promotion during Drinking Water Chlorination.
Jia, Shuyu; Shi, Peng; Hu, Qing; Li, Bing; Zhang, Tong; Zhang, Xu-Xiang
2015-10-20
For comprehensive insights into the effects of chlorination, a widely used disinfection technology, on bacterial community and antibiotic resistome in drinking water, this study applied high-throughput sequencing and metagenomic approaches to investigate the changing patterns of antibiotic resistance genes (ARGs) and bacterial community in a drinking water treatment and distribution system. At genus level, chlorination could effectively remove Methylophilus, Methylotenera, Limnobacter, and Polynucleobacter, while increase the relative abundance of Pseudomonas, Acidovorax, Sphingomonas, Pleomonas, and Undibacterium in the drinking water. A total of 151 ARGs within 15 types were detectable in the drinking water, and chlorination evidently increased their total relative abundance while reduced their diversity in the opportunistic bacteria (p < 0.05). Residual chlorine was identified as the key contributing factor driving the bacterial community shift and resistome alteration. As the dominant persistent ARGs in the treatment and distribution system, multidrug resistance genes (mainly encoding resistance-nodulation-cell division transportation system) and bacitracin resistance gene bacA were mainly carried by chlorine-resistant bacteria Pseudomonas and Acidovorax, which mainly contributed to the ARGs abundance increase. The strong correlation between bacterial community shift and antibiotic resistome alteration observed in this study may shed new light on the mechanism behind the chlorination effects on antibiotic resistance.
The role of nanotechnology in single-cell detection: a review.
Wang, Changling; Zhang, Yuxiang; Xia, Mingdian; Zhu, Xingxi; Qi, Shitao; Shen, Huaqiang; Liu, Tiebing; Tang, Liming
2014-10-01
Biological processes in single cells, such as signal transduction, DNA duplication, and protein synthesis and trafficking, occur in subcellular compartments at nanoscale level. Achieving high spatial-temporal resolution, high sensitivity, and high specificity in single-cell detection poses a great challenge. Nanotechnology, which has been widely applied in the fields of medicine, electronics, biomaterials, and energy production, has the potential to provide solutions for single-cell detection. Here we present a review of the use of nanotechnology in single-cell detection over the past two decades. First, we review the main areas of scientific interest, including morphology, ion concentration, DNA, RNA, protein, intracellular temperature, elements, and mechanical properties. Second, four categories of application of nanotechnology to single-cell detection are described: nanomanipulation, nanodevices, nanomaterials as labels, and nano Secondary ion mass spectrometry. Finally, the prospects and future trends in single-cell detection and analysis are discussed.
The use of a cloned bacterial gene to study mutation in mammalian cells
International Nuclear Information System (INIS)
Thacker, J.; Debenham, P.G.; Stretch, A.; Webb, M.B.T.
1983-01-01
The recombinant DNA molecule pSV2-gpt, which contains the bacterial gene coding for xanthine-guanine phosphoribosyl transferase (XGPRT) activity, was introduced into a hamster cell line lacking the equivalent mammalian enzyme (HGPRT). Hamster cell sublines were found with stable expression of XGPRT activity and were used to study mutation of the integrated pSV2-gpt DNA sequence. Mutants were selected by their resistance to 6-thioguanine (TG) under optimal conditions which were found to be very similar to those for selection of HGPRT-deficient mutants of mammalian cells. The frequency of XGPRT-deficient mutants was increased by treatment with X-rays, ethyl methanesulphonate and ethyl nitrosourea. X-Ray induction of mutants increased approximately linearly with dose up to about 500 rad, but the frequency of mutants per rad was very much higher than that usually found for 'native' mammalian genes. (orig./AJ)
Single walled carbon nanotube-based junction biosensor for detection of Escherichia coli.
Directory of Open Access Journals (Sweden)
Kara Yamada
Full Text Available Foodborne pathogen detection using biomolecules and nanomaterials may lead to platforms for rapid and simple electronic biosensing. Integration of single walled carbon nanotubes (SWCNTs and immobilized antibodies into a disposable bio-nano combinatorial junction sensor was fabricated for detection of Escherichia coli K-12. Gold tungsten wires (50 µm diameter coated with polyethylenimine (PEI and SWCNTs were aligned to form a crossbar junction, which was functionalized with streptavidin and biotinylated antibodies to allow for enhanced specificity towards targeted microbes. In this study, changes in electrical current (ΔI after bioaffinity reactions between bacterial cells (E. coli K-12 and antibodies on the SWCNT surface were monitored to evaluate the sensor's performance. The averaged ΔI increased from 33.13 nA to 290.9 nA with the presence of SWCNTs in a 10(8 CFU/mL concentration of E. coli, thus showing an improvement in sensing magnitude. Electrical current measurements demonstrated a linear relationship (R2 = 0.973 between the changes in current and concentrations of bacterial suspension in range of 10(2-10(5 CFU/mL. Current decreased as cell concentrations increased, due to increased bacterial resistance on the bio-nano modified surface. The detection limit of the developed sensor was 10(2 CFU/mL with a detection time of less than 5 min with nanotubes. Therefore, the fabricated disposable junction biosensor with a functionalized SWCNT platform shows potential for high-performance biosensing and application as a detection device for foodborne pathogens.
Directory of Open Access Journals (Sweden)
Letícia Eichstaedt Mayer
2012-04-01
Full Text Available INTRODUCTION: Metallo-β-lactamase (MBL has been reported all over the world. METHODS: The inhibitory effect of mercaptopropionic acid (MPA on bacterial growth was evaluated by comparison between disk diffusion and broth dilution methodology with determination of the minimum inhibitory concentration (MIC for multidrug-resistant Acinetobacter baumanni strains. RESULTS: MPA significantly inhibited growth of the strains. CONCLUSIONS: The use of MPA can affect the results in phenotypic methods of MBL detection.
Jiang, Gao-peng; Zhang, Jing; Qiao, Jin-li; Jiang, Yong-ming; Zarrin, Hadis; Chen, Zhongwei; Hong, Feng
2015-01-01
Novel nanocomposite membranes aimed for both proton-exchange membrane fuel cell (PEMFC) and direct methanol fuel cell (DMFC) are presented in this work. The membranes are based on blending bacterial nanocellulose pulp and Nafion (abbreviated as BxNy, where x and y indicates the mass ratio of bacterial cellulose to Nafion). The structure and properties of BxNy membranes are characterized by FTIR, SEM, TG, DMA and EIS, along with water uptake, swelling behavior and methanol permeability tests. It is found that the BxNy composite membranes with reinforced concrete-like structure show excellent mechanical and thermal stability regardless of annealing. The water uptake plus area and volume swelling ratios are all decreased compared to Nafion membranes. The proton conductivities of pristine and annealed B1N9 are 0.071 and 0.056 S cm-1, respectively, at 30 °C and 100% humidity. Specifically, annealed B1N1 exhibited the lowest methanol permeability of 7.21 × 10-7 cm2 s-1. Through the selectivity analysis, pristine and annealed B1N7 are selected to assemble the MEAs. The performances of annealed B1N7 in PEMFC and DMFC show the maximum power densities of 106 and 3.2 mW cm-2, respectively, which are much higher than those of pristine B1N7 at 25 °C. The performances of the pristine and annealed B1N7 reach a level as high as 21.1 and 20.4 mW cm-2 at 80 °C in DMFC, respectively.
Qi, Lei; Lv, Xiujuan; Zhang, Tongwei; Jia, Peina; Yan, Ruiying; Li, Shuli; Zou, Ruitao; Xue, Yuhua; Dai, Liming
2016-06-01
A variety of nanomaterials have been developed for ocular diseases. The ability of these nanomaterials to pass through the blood-ocular barrier and their biocompatibility are essential characteristics that must be considered. Bacterial magnetosomes (BMs) are a type of biogenic magnetic nanomaterials synthesized by magnetotactic bacteria. Due to their unique biomolecular membrane shell and narrow size distribution of approximately 30 nm, BMs can pass through the blood-brain barrier. The similarity of the blood-ocular barrier to the blood-brain barrier suggests that BMs have great potential as treatments for ocular diseases. In this work, BMs were isolated from magnetotactic bacteria and evaluated in various cytotoxicity and genotoxicity studies in human retinal pigment epithelium (ARPE-19) cells. The BMs entered ARPE-19 cells by endocytosis after a 6-h incubation and displayed much lower cytotoxicity than chemically synthesized magnetic nanoparticles (MNPs). MNPs exhibited significantly higher genotoxicity than BMs and promoted the expression of Bax (the programmed cell death acceleration protein) and the induction of greater cell necrosis. In BM-treated cells, apoptosis tended to be suppressed via increased expression of the Bcl-2 protein. In conclusion, BMs display excellent biocompatibility and potential for use in the treatment of ocular diseases.
Low temperature anaerobic bacterial diagenesis of ferrous monosulfide to pyrite
Donald, Ravin; Southam, Gordon
1999-07-01
In vitro enrichment cultures of dissimilatory sulfate-reducing bacteria precipitated FeS and catalyzed its transformation into FeS 2 at ambient temperature and pressure under anaerobic conditions. When compared to purely abiotic processes, the bacterially mediated transformation was shown to be more efficient in transforming FeS into FeS 2. This occurred due to the large, reactive surface area available for bacterially catalyzed diagenesis, where the biogenic FeS precursor was immobilized as a thin film (˜25 nm thick) on the μm-scale bacteria. The bacteria also contained the source(s) of sulfur for diagenesis to occur. Using a radiolabeled organic-sulfur tracer study, sulfur was released during cell autolysis and was immobilized at the bacterial cell surface forming FeS 2. The formation of FeS 2 occurred on both the inner and outer surfaces of the cell envelope and represented the first step of bacterial mineral diagenesis. Pyrite crystals, having linear dimensions of ˜1 μm, grew outward from the bacterial cell surfaces. These minerals were several orders of magnitude larger in volume than those originating abiotically.
Bacterial Associates Modify Growth Dynamics of the Dinoflagellate Gymnodinium catenatum.
Bolch, Christopher J S; Bejoy, Thaila A; Green, David H
2017-01-01
Marine phytoplankton cells grow in close association with a complex microbial associate community known to affect the growth, behavior, and physiology of the algal host. The relative scale and importance these effects compared to other major factors governing algal cell growth remain unclear. Using algal-bacteria co-culture models based on the toxic dinoflagellate Gymnodinium catenatum , we tested the hypothesis that associate bacteria exert an independent effect on host algal cell growth. Batch co-cultures of G. catenatum were grown under identical environmental conditions with simplified bacterial communities composed of one-, two-, or three-bacterial associates. Modification of the associate community membership and complexity induced up to four-fold changes in dinoflagellate growth rate, equivalent to the effect of a 5°C change in temperature or an almost six-fold change in light intensity (20-115 moles photons PAR m -2 s -1 ). Almost three-fold changes in both stationary phase cell concentration and death rate were also observed. Co-culture with Roseobacter sp. DG874 reduced dinoflagellate exponential growth rate and led to a more rapid death rate compared with mixed associate community controls or co-culture with either Marinobacter sp. DG879, Alcanivorax sp. DG881. In contrast, associate bacteria concentration was positively correlated with dinoflagellate cell concentration during the exponential growth phase, indicating growth was limited by supply of dinoflagellate-derived carbon. Bacterial growth increased rapidly at the onset of declining and stationary phases due to either increasing availability of algal-derived carbon induced by nutrient stress and autolysis, or at mid-log phase in Roseobacter co-cultures potentially due to the onset of bacterial-mediated cell lysis. Co-cultures with the three bacterial associates resulted in dinoflagellate and bacterial growth dynamics very similar to more complex mixed bacterial community controls, suggesting that
Subtractive Inhibition Assay for the Detection of E. coli O157:H7 Using Surface Plasmon Resonance
Directory of Open Access Journals (Sweden)
Chengyan Si
2011-03-01
Full Text Available A surface plasmon resonance (SPR immunosensor was developed for the detection of E. coli O157:H7 by means of a new subtractive inhibition assay. In the subtractive inhibition assay, E. coli O157:H7 cells and goat polyclonal antibodies for E. coli O157:H7 were incubated for a short of time, and then the E. coli O157:H7 cells which bound antibodies were removed by a stepwise centrifugation process. The remaining free unbound antibodies were detected through interaction with rabbit anti-goat IgG polyclonal antibodies immobilized on the sensor chip using a BIAcore 3000 biosensor. The results showed that the signal was inversely correlated with the concentration of E. coli O157:H7 cells in a range from 3.0 × 104 to 3.0 × 108 cfu/mL with a detection limit of 3.0 × 104 cfu/mL. Compared with direct SPR by immobilizing antibodies on the chip surface to capture the bacterial cells and ELISA for E. coli O157:H7 (detection limit: both 3.0 × 105 cfu/mL in this paper, the detection limit of subtractive inhibition assay method was reduced by one order of magnitude. The method simplifies bacterial cell detection to protein-protein interaction, which has the potential for providing a practical alternative for the monitoring of E. coli O157:H7 and other pathogens.
8.3 Microbiology and Biodegradation: A New Bacterial Communication System
2014-04-09
Approved for Public Release; Distribution Unlimited 8.3 Microbiology and Biodegradation: A new bacterial communication system The views, opinions and...JB.01479-10 Federico E. Rey, Caroline S. Harwood. FixK, a global regulator of microaerobic growth, controls photosynthesis in Rhodopseudomonas...Quorum sensing is a term used to describe bacterial cell-to-cell communication that allows cell-density-dependent gene expression. There are many
Kumar, Keshav; Cava, Felipe
2018-04-10
In the present work, Principal coordinate analysis (PCoA) is introduced to develop a robust model to classify the chromatographic data sets of peptidoglycan sample. PcoA captures the heterogeneity present in the data sets by using the dissimilarity matrix as input. Thus, in principle, it can even capture the subtle differences in the bacterial peptidoglycan composition and can provide a more robust and fast approach for classifying the bacterial collection and identifying the novel cell wall targets for further biological and clinical studies. The utility of the proposed approach is successfully demonstrated by analysing the two different kind of bacterial collections. The first set comprised of peptidoglycan sample belonging to different subclasses of Alphaproteobacteria. Whereas, the second set that is relatively more intricate for the chemometric analysis consist of different wild type Vibrio Cholerae and its mutants having subtle differences in their peptidoglycan composition. The present work clearly proposes a useful approach that can classify the chromatographic data sets of chromatographic peptidoglycan samples having subtle differences. Furthermore, present work clearly suggest that PCoA can be a method of choice in any data analysis workflow. Copyright © 2018 Elsevier Inc. All rights reserved.
Quantification of total phosphorothioate in bacterial DNA by a bromoimane-based fluorescent method.
Xiao, Lu; Xiang, Yu
2016-06-01
The discovery of phosphorothioate (PT) modifications in bacterial DNA has challenged our understanding of conserved phosphodiester backbone structure of cellular DNA. This exclusive DNA modification in bacteria is not found in animal cells yet, and its biological function in bacteria is still poorly understood. Quantitative information about the bacterial PT modifications is thus important for the investigation of their possible biological functions. In this study, we have developed a simple fluorescence method for selective quantification of total PTs in bacterial DNA, based on fluorescent labeling of PTs and subsequent release of the labeled fluorophores for absolute quantification. The method was highly selective to PTs and not interfered by the presence of reactive small molecules or proteins. The quantification of PTs in an E. coli DNA sample was successfully achieved using our method and gave a result of about 455 PTs per million DNA nucleotides, while almost no detectable PTs were found in a mammalian calf thymus DNA. With this new method, the content of phosphorothioate in bacterial DNA could be successfully quantified, serving as a simple method suitable for routine use in biological phosphorothioate related studies. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Hoshino, Tatsuhiko; Schramm, Andreas
2010-01-01
target site. Finally, the RCA product inside the cells was detected by standard fluorescence in situ hybridization (FISH). The optimized protocol showed high specificity and signal-to-noise ratio but low detection frequency (up to 15% for single-copy genes and up to 43% for the multi-copy 16S rRNA gene...... as Candidatus Accumulibacter phosphatis by combining in situ RCA-FISH with 16S rRNA-targeted FISH. While not suitable for quantification because of its low detection frequency, in situ RCA-FISH will allow to link metabolic potential with 16S rRNA (gene)-based identification of single microbial cells.......). Nevertheless, multiple genes (nirS and nosZ; nirS and the 16S rRNA gene) could be detected simultaneously in P. stutzeri. Environmental application of in situ RCA-FISH was demonstrated on activated sludge by the differential detection of two types of nirS-defined denitrifiers; one of them was identified...
Campoccia, Davide; Montanaro, Lucio; Ravaioli, Stefano; Cangini, Ilaria; Testoni, Francesca; Visai, Livia; Arciola, Carla Renata
2018-04-03
Complete eradication of bacterial infections is often a challenging task, especially in presence of prosthetic devices. Invasion of non-phagocytic host cells appears to be a critical mechanism of microbial persistence in host tissues. Hidden within host cells, bacteria elude host defences and antibiotic treatments that are intracellularly inactive. The intracellular invasiveness of bacteria is generally measured by conventional gentamicin protection assays. The efficiency of invasion, however, markedly differs across bacterial species and adjustments to the titre of the microbial inocula used in the assays are often needed to enumerate intracellular bacteria. Such changes affect the standardisation of the method and hamper a direct comparison of bacteria on a same scale. This study aims at investigating the precise relation between inoculum, in terms of multiplicity of infection (MOI), and internalised bacteria. The investigation included nine Staphylococcus aureus , seven Staphylococcus epidermidis , five Staphylococcus lugdunensis and two Enterococcus faecalis clinical strains, which are co-cultured with MG63 human osteoblasts. Unprecedented insights are offered on the relations existing between MOI, number of internalised bacteria and per cent of internalised bacteria. New parameters are identified that are of potential use for qualifying the efficiency of internalization and compare the behaviour of bacterial strains.
Directory of Open Access Journals (Sweden)
Davide Campoccia
2018-04-01
Full Text Available Complete eradication of bacterial infections is often a challenging task, especially in presence of prosthetic devices. Invasion of non-phagocytic host cells appears to be a critical mechanism of microbial persistence in host tissues. Hidden within host cells, bacteria elude host defences and antibiotic treatments that are intracellularly inactive. The intracellular invasiveness of bacteria is generally measured by conventional gentamicin protection assays. The efficiency of invasion, however, markedly differs across bacterial species and adjustments to the titre of the microbial inocula used in the assays are often needed to enumerate intracellular bacteria. Such changes affect the standardisation of the method and hamper a direct comparison of bacteria on a same scale. This study aims at investigating the precise relation between inoculum, in terms of multiplicity of infection (MOI, and internalised bacteria. The investigation included nine Staphylococcus aureus, seven Staphylococcus epidermidis, five Staphylococcus lugdunensis and two Enterococcus faecalis clinical strains, which are co-cultured with MG63 human osteoblasts. Unprecedented insights are offered on the relations existing between MOI, number of internalised bacteria and per cent of internalised bacteria. New parameters are identified that are of potential use for qualifying the efficiency of internalization and compare the behaviour of bacterial strains.
Directory of Open Access Journals (Sweden)
Philipp Weise
2017-08-01
Full Text Available Background Leukocyte concentrations follow a circadian pattern in mammals, with elevated values at times of potential contact with pathogens and parasites. We hypothesized that this pattern is disturbed after an immune challenge. Methods In Thailand, we captured wrinkle-lipped bats (Chaerephon plicatus, when they returned to their colony at dawn. We challenged half of the animals (experimental group with bacterial lipopolysaccharides and treated the others only with the carrier liquid (control group. We then compared body mass changes and differences in circulating immune cell counts at 8 h post-treatment. Results In experimental animals, we observed an increase in total leukocyte and neutrophil numbers of 17% and 95%, respectively. In control animals, concentrations of leukocytes decreased by 44% and those of neutrophils remained constant. Experimental treatment had no effect on lymphocytes, yet changes in eosinophil numbers were explained by sex. Eosinophils decreased by 66% in females and by 62% in males. Basophils and monocytes were rarest among all observed cell types and analysis was either impossible because of low numbers or yielded no significant effects, respectively. Discussion Our findings show that a simulated bacterial infection triggered a neutrophil-associated immune response in wrinkle-lipped bats, indicating a disruption of the diurnal fluctuation of immune cells. Our study suggests that bats exhibit circadian rhythms in immune cell counts. The magnitude of these fluctuations may vary across species according to specific-specific infection risks associated with colony sizes or specific roosting habits.
Changes in the repertoire of natural antibodies caused by immunization with bacterial antigens
DEFF Research Database (Denmark)
Shilova, N V; Navakouski, M J; Huflejt, M
2011-01-01
The repertoire of natural anti-glycan antibodies in naïve chickens and in chickens immunized with bacteria Burkholderia mallei, Burkholderia pseudomallei, and Francisella tularensis as well as with peptides from an outer membrane protein of B. pseudomallei was studied. A relatively restricted pat...... pattern of natural antibodies (first of all IgY against bacterial cell wall peptidoglycan fragments, L-Rha, and core N-acetyllactosamine) shrank and, moreover, the level of detectable antibodies decreased as a result of immunization....
Vancomycin added to the wash solution of the cell-saver. Effect on bacterial contamination.
Perez-Ferrer, A; Gredilla-Díaz, E; de Vicente-Sánchez, J; Navarro-Suay, R; Gilsanz-Rodríguez, F
2017-04-01
The aim of this study is to test whether the addition of a low-dose of antibiotic (vancomycin) to the wash solution (saline) of the cell-saver reduces the incidence of bacterial contamination of the autologous red blood cell (RBCs) concentrate recovered. Experimental, randomized, double-blind, parallel group study performed on 20 consecutive patients scheduled for posterior spinal fusion surgery. Intraoperative bleeding was processed through a cell-saver: HaemoLite ® 2+, in which the RBCs were washed according to randomization group, with saline (control group) or saline+10μg/ml -1 vancomycin (vanco group). Data regarding age, weight, processed and recovered volume, blood count, blood culture, and vancomycin concentration in RBCs concentrates obtained and incidence of fever after reinfusion were collected. Processed volume was 843±403ml and recovered volume 121±29ml, with haemoglobin concentration 10.4±5.0g/dl -1 and haematocrit 29.1±15.9% (mean±SD). Recovered RBC concentrate cultures were positive for coagulase-negative Staphylococcus in 5 cases (50%) of the control group while all cultures were negative in the vanco group (P=.016). The difference between the theoretical concentration of vancomycin administered and the concentration determined in the recovered RBC concentrate was 1.31μg/ml -1 (95% CI 1.19 to 1.43; P=.074). The addition of vancomycin at a concentration of 10ug/ml -1 to the wash solution of the cell-saver achieved similar concentrations in the autologous blood concentrate recovered allowing for bacterial removal, with negative blood cultures in all cases. Copyright © 2016 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.
Bacterial Biosensors for Measuring Availability of Environmental Pollutants
Directory of Open Access Journals (Sweden)
Jan Roelof van der Meer
2008-07-01
Full Text Available Traditionally, pollution risk assessment is based on the measurement of a pollutant’s total concentration in a sample. The toxicity of a given pollutant in the environment, however, is tightly linked to its bioavailability, which may differ significantly from the total amount. Physico-chemical and biological parameters strongly influence pollutant fate in terms of leaching, sequestration and biodegradation. Bacterial sensorreporters, which consist of living micro-organisms genetically engineered to produce specific output in response to target chemicals, offer an interesting alternative to monitoring approaches. Bacterial sensor-reporters detect bioavailable and/or bioaccessible compound fractions in samples. Currently, a variety of environmental pollutants can be targeted by specific biosensor-reporters. Although most of such strains are still confined to the lab, several recent reports have demonstrated utility of bacterial sensing-reporting in the field, with method detection limits in the nanomolar range. This review illustrates the general design principles for bacterial sensor-reporters, presents an overview of the existing biosensor-reporter strains with emphasis on organic compound detection. A specific focus throughout is on the concepts of bioavailability and bioaccessibility, and how bacteria-based sensing-reporting systems can help to improve our basic understanding of the different processes at work.
DEFF Research Database (Denmark)
Weber, N. R.; Nielsen, J. P.; Hjulsager, Charlotte Kristiane
2017-01-01
Enterotoxigenic E. coli (ETEC) are a major cause of diarrhoea in weaned pigs. The objective of this study was to evaluate the agreement at pen level among three different diagnostic approaches for the detection of ETEC in groups of nursery pigs with diarrhoea. The diagnostic approaches used were...... to determine the quantity of F18 and F4 genes. The study was carried out in three Danish pig herds and included 31 pens with a pen-level diarrhoea prevalence of > 25%, as well as samples from 93 diarrhoeic nursery pigs from these pens. All E. coli isolates were analysed by PCR and classified as ETEC when genes...... was observed between the detection of ETEC by bacterial culture and qPCR in the same pen floor sample in 26 (83.9%, Kappa = 0.679) pens. Conclusion: We observed an acceptable agreement for the detection of ETEC-positive diarrhoeic nursery pigs in pen samples for both bacterial culture of pen floor samples...
How to Build a Bacterial Cell: MreB as the Foreman of E. coli Construction.
Shi, Handuo; Bratton, Benjamin P; Gitai, Zemer; Huang, Kerwyn Casey
2018-03-08
Cell shape matters across the kingdoms of life, and cells have the remarkable capacity to define and maintain specific shapes and sizes. But how are the shapes of micron-sized cells determined from the coordinated activities of nanometer-sized proteins? Here, we review general principles that have surfaced through the study of rod-shaped bacterial growth. Imaging approaches have revealed that polymers of the actin homolog MreB play a central role. MreB both senses and changes cell shape, thereby generating a self-organizing feedback system for shape maintenance. At the molecular level, structural and computational studies indicate that MreB filaments exhibit tunable mechanical properties that explain their preference for certain geometries and orientations along the cylindrical cell body. We illustrate the regulatory landscape of rod-shape formation and the connectivity between cell shape, cell growth, and other aspects of cell physiology. These discoveries provide a framework for future investigations into the architecture and construction of microbes. Copyright © 2018 Elsevier Inc. All rights reserved.
Methods to classify bacterial pathogens in cystic fibrosis
DEFF Research Database (Denmark)
Bjarnsholt, Thomas; Nielsen, Xiaohui Chen; Johansen, Ulla
2011-01-01
for identification of isolates from the Burkholderia complex to the species level. DNA typing by PFGE, which can be used for any bacterial pathogen, is described as it is employed for Pseudomonas aeruginosa. A commercially available ELISA method is described for measuring IgG antibodies against P. aeruginosa in CF......Many bacteria can be detected in CF sputum, pathogenic and commensal. Modified Koch's criteria for identification of established and emerging CF pathogens are therefore described. Methods are described to isolate bacteria and to detect bacterial biofilms in sputum or lung tissue from CF patients...
Obruca, Stanislav; Sedlacek, Petr; Mravec, Filip; Krzyzanek, Vladislav; Nebesarova, Jana; Samek, Ota; Kucera, Dan; Benesova, Pavla; Hrubanova, Kamila; Milerova, Miluse; Marova, Ivana
2017-10-25
Numerous prokaryotes accumulate polyhydroxybutyrate (PHB) intracellularly as a storage material. It has also been proposed that PHB accumulation improves bacterial stress resistance. Cupriavidus necator and its PHB non-accumulating mutant were employed to investigate the protective role of PHB under hypertonic conditions. The presence of PHB granules enhanced survival of the bacteria after exposure to hypertonic conditions. Surprisingly, when coping with such conditions, the bacteria did not utilize PHB to harvest carbon or energy, suggesting that, in the osmotic upshock of C. necator, the protective mechanism of PHB granules is not associated with their hydrolysis. The presence of PHB granules influenced the overall properties of the cells, since challenged PHB-free cells underwent massive plasmolysis accompanied by damage to the cell membrane and the leakage of cytoplasm content, while no such effects were observed in PHB containing bacteria. Moreover, PHB granules demonstrated "liquid-like" properties indicating that they can partially repair and stabilize cell membranes by plugging small gaps formed during plasmolysis. In addition, the level of dehydration and changes in intracellular pH in osmotically challenged cells were less pronounced for PHB-containing cultures, demonstrating the important role of PHB for bacterial survival under hyperosmotic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Martin S Davey
2011-05-01
Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in
Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias
2011-01-01
Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early
Mechanical Homogenization Increases Bacterial Homogeneity in Sputum
Stokell, Joshua R.; Khan, Ammad
2014-01-01
Sputum obtained from patients with cystic fibrosis (CF) is highly viscous and often heterogeneous in bacterial distribution. Adding dithiothreitol (DTT) is the standard method for liquefaction prior to processing sputum for molecular detection assays. To determine if DTT treatment homogenizes the bacterial distribution within sputum, we measured the difference in mean total bacterial abundance and abundance of Burkholderia multivorans between aliquots of DTT-treated sputum samples with and without a mechanical homogenization (MH) step using a high-speed dispersing element. Additionally, we measured the effect of MH on bacterial abundance. We found a significant difference between the mean bacterial abundances in aliquots that were subjected to only DTT treatment and those of the aliquots which included an MH step (all bacteria, P = 0.04; B. multivorans, P = 0.05). There was no significant effect of MH on bacterial abundance in sputum. Although our results are from a single CF patient, they indicate that mechanical homogenization increases the homogeneity of bacteria in sputum. PMID:24759710
Koop, G.; Dik, N.; Nielen, M.; Lipman, L.J.A.
2010-01-01
The aims of this study were to assess how different bacterial groups in bulk milk are related to bulk milk somatic cell count (SCC), bulk milk total bacterial count (TBC), and bulk milk standard plate count (SPC) and to measure the repeatability of bulk milk culturing. On 53 Dutch dairy goat farms, 3 bulk milk samples were collected at intervals of 2 wk. The samples were cultured for SPC, coliform count, and staphylococcal count and for the presence of Staphylococcus aureus. Furthermore, SCC ...
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs
Directory of Open Access Journals (Sweden)
Simon Ipcho
2016-06-01
Full Text Available Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals.
Bacterial carbon cycling in a subarctic fjord
DEFF Research Database (Denmark)
Middelboe, Mathias; Glud, Ronnie Nøhr; Sejr, M.K.
2012-01-01
of viruses on bacterial mortality (4–36% of cell production) and carbon cycling. Heterotrophic bacterial consumption was closely coupled with autochthonous BDOC production, and the majority of the primary production was consumed by pelagic bacteria at all seasons. The relatively low measured BGE emphasized......In this seasonal study, we examined the environmental controls and quantitative importance of bacterial carbon consumption in the water column and the sediment in the subarctic Kobbefjord, Greenland. Depth-integrated bacterial production in the photic zone varied from 5.0 ± 2.7 mg C m−2 d−1...... in February to 42 ± 28 mg C m−2 d−1 in May and 34 ± 7 mg C m−2 d−1 in September, corresponding to a bacterial production to primary production ratio of 0.34 ± 0.14, 0.07 ± 0.04, and 0.08 ± 0.06, respectively. Based on measured bacterial growth efficiencies (BGEs) of 0.09–0.10, pelagic bacterial carbon...
Winata, Patrick; Williams, Marissa; McGowan, Eileen; Nassif, Najah; van Zandwijk, Nico; Reid, Glen
2017-11-17
MicroRNAs are frequently downregulated in cancer, and restoring expression has tumour suppressive activity in tumour cells. Our recent phase I clinical trial investigated microRNA-based therapy in patients with malignant pleural mesothelioma. Treatment with TargomiRs, microRNA mimics with novel sequence packaged in EGFR antibody-targeted bacterial minicells, revealed clear signs of clinical activity. In order to detect delivery of microRNA mimics to tumour cells in future clinical trials, we tested hydrolysis probe-based assays specific for the sequence of the novel mimics in transfected mesothelioma cell lines using RT-qPCR. The custom assays efficiently and specifically amplified the consensus mimics. However, we found that these assays gave a signal when total RNA from untransfected and control mimic-transfected cells were used as templates. Further investigation revealed that the reverse transcription step using stem-loop primers appeared to introduce substantial non-specific amplification with either total RNA or synthetic RNA templates. This suggests that reverse transcription using stem-loop primers suffers from an intrinsic lack of specificity for the detection of highly similar microRNAs in the same family, especially when analysing total RNA. These results suggest that RT-qPCR is unlikely to be an effective means to detect delivery of microRNA mimic-based drugs to tumour cells in patients.
Prado Acosta, Mariano; Ruzal, Sandra M; Cordo, Sandra M
2016-11-01
Many species of Lactobacillus sp. possess Surface(s) layer proteins in their envelope. Among other important characteristics S-layer from Lactobacillus acidophilus binds to the cellular receptor DC-SIGN (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin; CD209), which is involved in adhesion and infection of several families of bacteria. In this report we investigate the activity of new S-layer proteins from the Lactobacillus family (Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus helveticus and Lactobacillus kefiri) over the infection of representative microorganisms important to human health. After the treatment of DC-SIGN expressing cells with these proteins, we were able to diminish bacterial infection by up to 79% in both gram negative and mycobacterial models. We discovered that pre-treatment of the bacteria with S-layers from Lactobacillus acidophilus and Lactobacillus brevis reduced bacteria viability but also prevent infection by the pathogenic bacteria. We also proved the importance of the glycosylation of the S-layer from Lactobacillus kefiri in the binding to the receptor and thus inhibition of infection. This novel characteristic of the S-layers proteins may contribute to the already reported pathogen exclusion activity for these Lactobacillus probiotic strains; and might be also considered as a novel enzymatic antimicrobial agents to inhibit bacterial infection and entry to host cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of honeycomb cell walls from measurement data based on Harris corner detection algorithm
Qin, Yan; Dong, Zhigang; Kang, Renke; Yang, Jie; Ayinde, Babajide O.
2018-06-01
A honeycomb core is a discontinuous material with a thin-wall structure—a characteristic that makes accurate surface measurement difficult. This paper presents a cell wall detection method based on the Harris corner detection algorithm using laser measurement data. The vertexes of honeycomb cores are recognized with two different methods: one method is the reduction of data density, and the other is the optimization of the threshold of the Harris corner detection algorithm. Each cell wall is then identified in accordance with the neighboring relationships of its vertexes. Experiments were carried out for different types and surface shapes of honeycomb cores, where the proposed method was proved effective in dealing with noise due to burrs and/or deformation of cell walls.
Directory of Open Access Journals (Sweden)
Young-Tak Kim
2015-06-01
Full Text Available The specific and sensitive nested-PCR method to detect Acidovorax citrulli, a causal agent of bacterial fruit blotch on cucurbitaceae, was developed. PCR primers were designed from the draft genome sequence which was obtained with the Next Generation Sequencing of A. citrulli KACC10651, and the nested-PCR primer set (Ac-ORF 21F/Ac-ORF 21R were selected by checking of specificity to A. citrulli with PCR assays. The selected nested-PCR primer amplified the 140 bp DNA only from A. citrulli strains, and detection sensitivity of the nested PCR increased 10,000 times of 1st PCR detection limit (10 ng genomic DNA/PCR. The nested PCR detected A. citrulli from the all samples of seed surface wash (external seed detection of the artificially inoculated watermelon seeds with 101 cfu/ml and above population of A. citrulli while the nested PCR could not detected A. citrulli from the mashed seed suspension (internal seed detection of the all artificially inoculated watermelon seeds. When the naturally infested watermelon seeds (10% seed infested rate with grow-out test used, the nested PCR detected A. citrulli from 2 seed samples out of 10 replication samples externally and 5 seed samples out of 10 replication samples internally. We believe that the nested-PCR developed in this study will be useful method to detect A. citrulli from the Cucurbitaceae seeds.
Anti-bacterial activity of Achatina CRP and its mechanism of action.
Mukherjee, Sandip; Barman, Soma; Mandal, Narayan Chandra; Bhattacharya, Shelley
2014-07-01
The physiological role of C-reactive protein (CRP), the classical acute-phase protein, is not well documented, despite many reports on biological effects of CRP in vitro and in model systems in vivo. It has been suggested that CRP protects mice against lethal toxicity of bacterial infections by implementing immunological responses. In Achatina fulica CRP is a constitutive multifunctional protein in haemolymph and considered responsible for their survival in the environment for millions of years. The efficacy of Achatina CRP (ACRP) was tested against both Salmonella typhimurium and Bacillus subtilis infections in mice where endogenous CRP level is negligible even after inflammatory stimulus. Further, growth curves of the bacteria revealed that ACRP (50 microg/mL) is bacteriostatic against gram negative salmonellae and bactericidal against gram positive bacilli. ACRP induced energy crises in bacterial cells, inhibited key carbohydrate metabolic enzymes such as phosphofructokinase in glycolysis, isocitrate dehydrogenase in TCA cycle, isocitrate lyase in glyoxylate cycle and fructose-1,6-bisphosphatase in gluconeogenesis. ACRP disturbed the homeostasis of cellular redox potential as well as reduced glutathione status, which is accompanied by an enhanced rate of lipid peroxidation. Annexin V-Cy3/CFDA dual staining clearly showed ACRP induced apoptosis-like death in bacterial cell population. Moreover, immunoblot analyses also indicated apoptosis-like death in ACRP treated bacterial cells, where activation of poly (ADP-ribose) polymerase-1 (PARP) and caspase-3 was noteworthy. It is concluded that metabolic impairment by ACRP in bacterial cells is primarily due to generation of reactive oxygen species and ACRP induced anti-bacterial effect is mediated by metabolic impairment leading to apoptosis-like death in bacterial cells.
Directory of Open Access Journals (Sweden)
G Subbiahdoss
2010-05-01
Full Text Available Biomaterials-associated-infections (BAI are serious complications in modern medicine. Although non-adhesive coatings, like polymer-brush coatings, have been shown to prevent bacterial adhesion, they do not support cell growth. Bi-functional coatings are supposed to prevent biofilm formation while supporting tissue integration. Here, bacterial and cellular responses to poly(ethylene glycol (PEG brush-coatings on titanium oxide presenting the integrin-active peptide RGD (arginine-glycine-aspartic acid (bioactive “PEG-RGD” were compared to mono-functional PEG brush-coatings (biopassive “PEG” and bare titanium oxide (TiO2 surfaces under flow. Staphylococcus epidermidis ATCC 35983 was deposited on the surfaces under a shear rate of 11 s-1 for 2 h followed by seeding of U2OS osteoblasts. Subsequently, both S. epidermidis and U2OS cells were grown simultaneously on the surfaces for 48 h under low shear (0.14 s-1. After 2 h, staphylococcal adhesion was reduced to 3.6±1.8 × 103 and 6.0±3.9 × 103 cm-2 on PEG and PEG-RGD coatings respectively, compared to 1.3±0.4 × 105 cm-2 for the TiO2 surface. When allowed to grow for 48 h, biofilms formed on all surfaces. However, biofilms detached from the PEG and PEG-RGD coatings when exposed to an elevated shear (5.6 s-1 U2OS cells neither adhered nor spread on PEG brush-coatings, regardless of the presence of biofilm. In contrast, in the presence of biofilm, U2OS cells adhered and spread on PEG-RGD coatings with a significantly higher surface coverage than on bare TiO2. The detachment of biofilm and the high cell surface coverage revealed the potential significance of PEG-RGD coatings in the context of the “race for the surface” between bacteria and mammalian cells.
New-found fundamentals of bacterial persistence.
Kint, Cyrielle I; Verstraeten, Natalie; Fauvart, Maarten; Michiels, Jan
2012-12-01
Persister cells display tolerance to high doses of bactericidal antibiotics and typically comprise a small fraction of a bacterial population. Recently, evidence was provided for a causal link between therapy failure and the presence of persister cells in chronic infections, underscoring the need for research on bacterial persistence. A series of recent breakthroughs have shed light on the multiplicity of persister genes, the contribution of gene expression noise to persister formation, the importance of active responses to antibiotic tolerance and heterogeneity among persister cells. Moreover, the development of in vivo model systems has highlighted the clinical relevance of persistence. This review discusses these recent advances and how this knowledge fundamentally changes the way in which we will perceive the problem of antibiotic tolerance in years to come. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zahra Armingohar
2014-05-01
Full Text Available Background: Several studies have reported an association between chronic periodontitis (CP and cardiovascular diseases. Detection of periodontopathogens, including red complex bacteria (RCB, in vascular lesions has suggested these bacteria to be involved in the pathogenesis of atherosclerosis and abdominal aortic aneurysms. Objective: In this study, we investigate bacteria and their DNA in vascular biopsies from patients with vascular diseases (VD; i.e. abdominal aortic aneurysms, atherosclerotic carotid, and common femoral arteries, with and without CP. Methods: DNA was extracted from vascular biopsies selected from 40 VD patients: 30 with CP and 10 without CP. The V3-V5 region of the 16S rDNA (V3-V5 was polymerase chain reaction (PCR-amplified, and the amplicons were cloned into Escherichia coli, sequenced, and classified (GenBank and the Human Oral Microbiome database. Species-specific primers were used for the detection of Porphyromonas gingivalis. In addition, 10 randomly selected vascular biopsies from the CP group were subjected to scanning electron microscopy (SEM for visualization of bacteria. Checkerboard DNA–DNA hybridization was performed to assess the presence of RCB in 10 randomly selected subgingival plaque samples from CP patients. Results: A higher load and mean diversity of bacteria were detected in vascular biopsies from VD patients with CP compared to those without CP. Enterobacteriaceae were frequently detected in vascular biopsies together with cultivable, commensal oral, and not-yet-cultured bacterial species. While 70% of the subgingival plaque samples from CP patients showed presence of RCB, only P. gingivalis was detected in one vascular biopsy. Bacterial cells were seen in all 10 vascular biopsies examined by SEM. Conclusions: A higher bacterial load and more diverse colonization were detected in VD lesions of CP patients as compared to patients without CP. This indicated that a multitude of bacterial species both
International Nuclear Information System (INIS)
Watkins, D.C.; Northup, J.K.; Malbon, C.C.
1987-01-01
Cultures of 3T3-L1 cells were incubated with either 10 ng/ml cholera toxin or 10 ng/ml pertussis toxin from 4 days prior to the initiation of differentiation and throughout the subsequent incubation. Toxin concentrations were sufficient to completely prevent the labelling of alpha-subunits with [ 32 P]NAD + and pertussis toxin and to prevent by more than 90% the labelling with [ 32 P]NAD + and cholera toxin in membranes prepared from these cells. Neither toxin prevented the differentiation to the adipocyte phenotype. Neither toxin prevented the increases in the relative amounts of G-proteins which occur upon differentiation. Both toxins dramatically decreased the amount of beta-subunits. As measured by quantitative immunoblotting with antisera specific for both the 35 kDa and 36 kDa beta-subunits, levels of beta-subunit were decreased by more than 50% of steady-state level of control cells. Thus, bacterial toxins which modifies G-protein alpha-subunits are capable of modulating the levels of beta-subunits in vivo. The basis for the regulation of G-protein subunit expression by bacterial toxins is under study
Biomimicry of quorum sensing using bacterial lifecycle model.
Niu, Ben; Wang, Hong; Duan, Qiqi; Li, Li
2013-01-01
Recent microbiologic studies have shown that quorum sensing mechanisms, which serve as one of the fundamental requirements for bacterial survival, exist widely in bacterial intra- and inter-species cell-cell communication. Many simulation models, inspired by the social behavior of natural organisms, are presented to provide new approaches for solving realistic optimization problems. Most of these simulation models follow population-based modelling approaches, where all the individuals are updated according to the same rules. Therefore, it is difficult to maintain the diversity of the population. In this paper, we present a computational model termed LCM-QS, which simulates the bacterial quorum-sensing (QS) mechanism using an individual-based modelling approach under the framework of Agent-Environment-Rule (AER) scheme, i.e. bacterial lifecycle model (LCM). LCM-QS model can be classified into three main sub-models: chemotaxis with QS sub-model, reproduction and elimination sub-model and migration sub-model. The proposed model is used to not only imitate the bacterial evolution process at the single-cell level, but also concentrate on the study of bacterial macroscopic behaviour. Comparative experiments under four different scenarios have been conducted in an artificial 3-D environment with nutrients and noxious distribution. Detailed study on bacterial chemotatic processes with quorum sensing and without quorum sensing are compared. By using quorum sensing mechanisms, artificial bacteria working together can find the nutrient concentration (or global optimum) quickly in the artificial environment. Biomimicry of quorum sensing mechanisms using the lifecycle model allows the artificial bacteria endowed with the communication abilities, which are essential to obtain more valuable information to guide their search cooperatively towards the preferred nutrient concentrations. It can also provide an inspiration for designing new swarm intelligence optimization algorithms
Detecting bacterial endophytes in tropical grasses of the Brachiaria ...
African Journals Online (AJOL)
Plant-growth-promoting (PGP) bacteria include a diverse group of soil bacteria thought to stimulate plant growth by various mechanisms. Brachiaria forage grasses, of African origin, are perennials that often grow under low-input conditions and are likely to harbour unique populations of PGP bacteria. Three bacterial strains ...
Directory of Open Access Journals (Sweden)
Mari Narusaka
Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.
Directory of Open Access Journals (Sweden)
Carolina Sanitá Tafner Ferreira
Full Text Available ABSTRACT CONTEXT AND OBJECTIVE: Bacterial vaginosis occurs frequently in pregnancy and increases susceptibility to sexually transmitted infections (STI. Considering that adolescents are disproportionally affected by STI, the aim of this study was to evaluate the cervicovaginal levels of interleukin (IL-1 beta, IL-6, IL-8 and bacterial sialidase in pregnant adolescents with bacterial vaginosis. DESIGN AND SETTING: Cross-sectional study at mother and child referral units in Belém, Pará, Brazil. METHODS: Vaginal samples from 168 pregnant adolescents enrolled were tested for trichomoniasis and candidiasis. Their vaginal microbiota was classified according to the Nugent criteria (1991 as normal, intermediate or bacterial vaginosis. Cervical infection due to Chlamydia trachomatisand Neisseria gonorrhoeae was also assessed. Cytokine and sialidase levels were measured, respectively, using enzyme-linked immunosorbent assays and MUAN conversion in cervicovaginal lavages. Forty-eight adolescents (28.6% were excluded because they tested positive for some of the infections investigated. The remaining 120 adolescents were grouped according to vaginal flora type: normal (n = 68 or bacterial vaginosis (n = 52. Their cytokine and sialidase levels were compared between the groups using the Mann-Whitney test (P < 0.05. RESULTS: The pregnant adolescents with bacterial vaginosis had higher levels of IL-1 beta, IL-6 and IL-8 (P < 0.05. Sialidase was solely detected in 35 adolescents (67.2% with bacterial vaginosis. CONCLUSIONS: Not only IL-1 beta and sialidase levels, but also IL-6 and IL-8 levels are higher in pregnant adolescents with bacterial vaginosis, thus indicating that this condition elicits a more pronounced inflammatory response in this population, which potentially increases vulnerability to STI acquisition.
Directory of Open Access Journals (Sweden)
Lupotto Manuel
2011-06-01
Full Text Available Abstract Background Bacterial cell lysis is a widely studied mechanism that can be achieved through the intracellular expression of phage native lytic proteins. This mechanism can be exploited for programmed cell death and for gentle cell disruption to release recombinant proteins when in vivo secretion is not feasible. Several genetic parts for cell lysis have been developed and their quantitative characterization is an essential step to enable the engineering of synthetic lytic systems with predictable behavior. Results Here, a BioBrick™ lysis device present in the Registry of Standard Biological Parts has been quantitatively characterized. Its activity has been measured in E. coli by assembling the device under the control of a well characterized N-3-oxohexanoyl-L-homoserine lactone (HSL -inducible promoter and the transfer function, lysis dynamics, protein release capability and genotypic and phenotypic stability of the device have been evaluated. Finally, its modularity was tested by assembling the device to a different inducible promoter, which can be triggered by heat induction. Conclusions The studied device is suitable for recombinant protein release as 96% of the total amount of the intracellular proteins was successfully released into the medium. Furthermore, it has been shown that the device can be assembled to different input devices to trigger cell lysis in response to a user-defined signal. For this reason, this lysis device can be a useful tool for the rational design and construction of complex synthetic biological systems composed by biological parts with known and well characterized function. Conversely, the onset of mutants makes this device unsuitable for the programmed cell death of a bacterial population.
A novel bacterial symbiont in the nematode Spirocerca lupi
Directory of Open Access Journals (Sweden)
Gottlieb Yuval
2012-07-01
Full Text Available Abstract Background The parasitic nematode Spirocerca lupi (Spirurida: Thelaziidae, the canine esophageal worm, is the causative agent of spirocercosis, a disease causing morbidity and mortality in dogs. Spirocerca lupi has a complex life cycle, involving an obligatory coleopteran intermediate host (vector, an optional paratenic host, and a definitive canid host. The diagnosis of spirocercosis is challenging, especially in the early disease stages, when adult worms and clinical signs are absent. Thus, alternative approaches are needed to promote early diagnosis. The interaction between nematodes and their bacterial symbionts has recently become a focus of novel treatment regimens for other helminthic diseases. Results Using 16S rDNA-based molecular methods, here we found a novel bacterial symbiont in S. lupi that is closely related to Comamonas species (Brukholderiales: Comamonadaceae of the beta-proteobacteria. Its DNA was detected in eggs, larvae and adult stages of S. lupi. Using fluorescent in situ hybridization technique, we localized Comamonas sp. to the gut epithelial cells of the nematode larvae. Specific PCR enabled the detection of this symbiont's DNA in blood obtained from dogs diagnosed with spirocercosis. Conclusions The discovery of a new Comamonas sp. in S. lupi increase the complexity of the interactions among the organisms involved in this system, and may open innovative approaches for diagnosis and control of spirocercosis in dogs.
Katsura, Kazushige; Matsuda, Takayoshi; Tomabechi, Yuri; Yonemochi, Mayumi; Hanada, Kazuharu; Ohsawa, Noboru; Sakamoto, Kensaku; Takemoto, Chie; Shirouzu, Mikako
2017-11-01
Cell-free protein synthesis is a useful method for preparing proteins for functional or structural analyses. However, batch-to-batch variability with regard to protein synthesis activity remains a problem for large-scale production of cell extract in the laboratory. To address this issue, we have developed a novel procedure for large-scale preparation of bacterial cell extract with high protein synthesis activity. The developed procedure comprises cell cultivation using a fermentor, harvesting and washing of cells by tangential flow filtration, cell disruption with high-pressure homogenizer and continuous diafiltration. By optimizing and combining these methods, ∼100 ml of the cell extract was prepared from 150 g of Escherichia coli cells. The protein synthesis activities, defined as the yield of protein per unit of absorbance at 260 nm of the cell extract, were shown to be reproducible, and the average activity of several batches was twice that obtained using a previously reported method. In addition, combinatorial use of the high-pressure homogenizer and diafiltration increased the scalability, indicating that the cell concentration at disruption varies from 0.04 to 1 g/ml. Furthermore, addition of Gam protein and examinations of the N-terminal sequence rendered the extract prepared here useful for rapid screening with linear DNA templates. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
DEFF Research Database (Denmark)
Gerdes, Kenn; Møller-Jensen, Jakob; Ebersbach, Gitte
2004-01-01
Here, we review recent progress that yields fundamental new insight into the molecular mechanisms behind plasmid and chromosome segregation in prokaryotic cells. In particular, we describe how prokaryotic actin homologs form mitotic machineries that segregate DNA before cell division. Thus, the P......M protein of plasmid R1 forms F actin-like filaments that separate and move plasmid DNA from mid-cell to the cell poles. Evidence from three different laboratories indicate that the morphogenetic MreB protein may be involved in segregation of the bacterial chromosome.......Here, we review recent progress that yields fundamental new insight into the molecular mechanisms behind plasmid and chromosome segregation in prokaryotic cells. In particular, we describe how prokaryotic actin homologs form mitotic machineries that segregate DNA before cell division. Thus, the Par...
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Molecular bacterial diversity and bioburden of commercial airliner cabin air
Energy Technology Data Exchange (ETDEWEB)
La Duc, M.T.; Stuecker, T.; Venkateswaran, K. [California Inst. of Technology, Pasadena, CA (United States). Jet Propulsion Laboratory, Biotechnology and Planetary Protection Group
2007-11-15
Microorganisms that exist in aircraft air systems are considered to be the primary source of microbial contamination that can lead to illness shortly after flying. More than 600 million passengers board commercial airline flights annually in the United States alone. In this study, culture-independent, biomarker-targeted bacterial enumeration and identification strategies were used to estimate total bacterial burden and diversity within the cabin air of commercial airliners. Air-impingement was used to collect samples of microorganisms from 4 flights on 2 commercial carriers. The total viable microbial population ranged from below detection limits to 4.1 x 10{sup 6} cells/m{sup 3} of air. Microbes were found to gradually accumulate from the time of passenger boarding through mid-flight. A sharp decline in bacterial abundance was then observed. Representatives of the {alpha}, {beta} and {gamma} Proteobacteria, as well as Gram-positive bacteria, were isolated in varying abundance. Airline A had large abundances of Neisseria meningitidis rRNA gene sequences and Streptococcus oralis/mitis sequences. Airline B was dominated by pseudomonas synxantha sequences as well as N. meningitidis and S. oralis/mitis. The cabin air samples housed low bacterial diversity and were typically dominated by a particular subset of bacteria, notably opportunistic pathogenic inhabitants of the human respiratory tract and oral cavity. The microbes were found largely around the ventilation ducts and gasper conduits that supply cabin air. 45 refs., 4 tabs., 3 figs.
Izoré, Thierry; van den Ent, Fusinita
2017-01-01
A diverse set of protein polymers, structurally related to actin filaments contributes to the organization of bacterial cells as cytomotive or cytoskeletal filaments. This chapter describes actin homologs encoded by bacterial chromosomes. MamK filaments, unique to magnetotactic bacteria, help establishing magnetic biological compasses by interacting with magnetosomes. Magnetosomes are intracellular membrane invaginations containing biomineralized crystals of iron oxide that are positioned by MamK along the long-axis of the cell. FtsA is widespread across bacteria and it is one of the earliest components of the divisome to arrive at midcell, where it anchors the cell division machinery to the membrane. FtsA binds directly to FtsZ filaments and to the membrane through its C-terminus. FtsA shows altered domain architecture when compared to the canonical actin fold. FtsA's subdomain 1C replaces subdomain 1B of other members of the actin family and is located on the opposite side of the molecule. Nevertheless, when FtsA assembles into protofilaments, the protofilament structure is preserved, as subdomain 1C replaces subdomain IB of the following subunit in a canonical actin filament. MreB has an essential role in shape-maintenance of most rod-shaped bacteria. Unusually, MreB filaments assemble from two protofilaments in a flat and antiparallel arrangement. This non-polar architecture implies that both MreB filament ends are structurally identical. MreB filaments bind directly to membranes where they interact with both cytosolic and membrane proteins, thereby forming a key component of the elongasome. MreB filaments in cells are short and dynamic, moving around the long axis of rod-shaped cells, sensing curvature of the membrane and being implicated in peptidoglycan synthesis.
Epithelial cell pro-inflammatory cytokine response differs across dental plaque bacterial species.
Stathopoulou, Panagiota G; Benakanakere, Manjunatha R; Galicia, Johnah C; Kinane, Denis F
2010-01-01
The dental plaque is comprised of numerous bacterial species, which may or may not be pathogenic. Human gingival epithelial cells (HGECs) respond to perturbation by various bacteria of the dental plaque by production of different levels of inflammatory cytokines, which is a putative reflection of their virulence. The aim of the current study was to determine responses in terms of interleukin (IL)-1beta, IL-6, IL-8 and IL-10 secretion induced by Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum and Streptococcus gordonii in order to gauge their virulence potential. HGECs were challenged with the four bacterial species, live or heat killed, at various multiplicity of infections and the elicited IL-1beta, IL-6, IL-8 and IL-10 responses were assayed by enzyme-linked immunosorbent assay. Primary HGECs challenged with live P. gingivalis produced high levels of IL-1beta, while challenge with live A. actinomycetemcomitans gave high levels of IL-8. The opportunistic pathogen F. nucleatum induces the highest levels of pro-inflammatory cytokines, while the commensal S. gordonii is the least stimulatory. We conclude that various dental plaque biofilm bacteria induce different cytokine response profiles in primary HGECs that may reflect their individual virulence or commensal status.
Vargas, Ignacio T.
2013-05-29
Pyrosequencing was used to characterize bacterial communities in air-cathode microbial fuel cells across a volumetric (graphite fiber brush) and a planar (carbon cloth) anode, where different physical and chemical gradients would be expected associated with the distance between anode location and the air cathode. As expected, the stable operational voltage and the coulombic efficiency (CE) were higher for the volumetric anode than the planar anode (0.57V and CE=22% vs. 0.51V and CE=12%). The genus Geobacter was the only known exoelectrogen among the observed dominant groups, comprising 57±4% of recovered sequences for the brush and 27±5% for the carbon-cloth anode. While the bacterial communities differed between the two anode materials, results showed that Geobacter spp. and other dominant bacterial groups were homogenously distributed across both planar and volumetric anodes. This lends support to previous community analysis interpretations based on a single biofilm sampling location in these systems. © 2013 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Bae, Euiwon; Hirleman, E Daniel; Aroonnual, Amornrat; Bhunia, Arun K; Robinson, J Paul
2009-01-01
A system design and automation of a microbiological instrument that locates bacterial colonies and captures the forward-scattering signatures are presented. The proposed instrument integrates three major components: a colony locator, a forward scatterometer and a motion controller. The colony locator utilizes an off-axis light source to illuminate a Petri dish and an IEEE1394 camera to capture the diffusively scattered light to provide the number of bacterial colonies and two-dimensional coordinate information of the bacterial colonies with the help of a segmentation algorithm with region-growing. Then the Petri dish is automatically aligned with the respective centroid coordinate with a trajectory optimization method, such as the Traveling Salesman Algorithm. The forward scatterometer automatically computes the scattered laser beam from a monochromatic image sensor via quadrant intensity balancing and quantitatively determines the centeredness of the forward-scattering pattern. The final scattering signatures are stored to be analyzed to provide rapid identification and classification of the bacterial samples
Nanobiocomposite platform based on polyaniline-iron oxide-carbon nanotubes for bacterial detection.
Singh, Renu; Verma, Rachna; Sumana, G; Srivastava, Avanish Kumar; Sood, Seema; Gupta, Rajinder K; Malhotra, B D
2012-08-01
The nanocomposite based on polyaniline (PANI)-iron oxide nanoparticles (nFe(3)O(4)) and multi walled carbon-nanotubes (CNT) has been fabricated onto indium tin oxide (ITO) coated glass plate via facile electrochemical synthesis of polyaniline in presence of nFe(3)O(4) (~20 nm) and CNT (20-80 nm in diameter). The results of transmission electron microscopic studies show evidence of coating of PANI and nFe(3)O(4) onto the CNT. The PANI-nFe(3)O(4)-CNT/ITO nanoelectrode has been characterized by Fourier transform infrared spectroscopy, X-ray diffraction and scanning electron microscopy studies. The biotinylated nucleic acid probe sequence consisting of 20 bases has been immobilized onto PANI-nFe(3)O(4)-CNT/ITO nanoelectrode using biotin-avidin coupling. It is shown that the PANI-nFe(3)O(4)-CNT platform based biosensor can be used to specifically detect bacteria (N. gonorrhoeae) at minute concentration as low as (1×10(-19) M) indicating high sensitivity within 45 s of hybridization time at 298 K by differential pulse voltammetry using methylene blue as electroactive indicator. This bacterial sensor has also been tested with 4 positive and 4 negative PCR amplicons of gonorrhoea affected patient samples. The results of these studies have implications towards the fabrication of a handheld device for Neisseria gonorrhoeae detection that may perhaps result in a decrease in the human immunodeficiency virus infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis
2014-06-01
Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.
Truong-Bolduc, Q C; Khan, N S; Vyas, J M; Hooper, D C
2017-02-01
We previously reported that the Tet38 efflux pump is involved in internalization of Staphylococcus aureus by A549 lung epithelial cells. A lack of tet38 reduced bacterial uptake by A549 cells to 36% of that of the parental strain RN6390. Using invasion assays coupled with confocal microscopy imaging, we studied the host cell receptor(s) responsible for bacterial uptake via interaction with Tet38. We also assessed the ability of S. aureus to survive following alkalinization of the phagolysosomes by chloroquine. Antibody to the scavenger receptor CD36 reduced the internalization of S. aureus RN6390 by A549 cells, but the dependence on CD36 was reduced in QT7 tet38, suggesting that an interaction between Tet38 and CD36 contributed to S. aureus internalization. Following fusion of the S. aureus-associated endosomes with lysosomes, alkalinization of the acidic environment with chloroquine led to a rapid increase in the number of S. aureus RN6390 bacteria in the cytosol, followed by a decrease shortly thereafter. This effect of chloroquine was not seen in the absence of intact Tet38 in mutant QT7. These data taken together suggest that Tet38 plays a role both in bacterial internalization via interaction with CD36 and in bacterial escape from the phagolysosomes. Copyright © 2017 American Society for Microbiology.
Identifying essential genes in bacterial metabolic networks with machine learning methods
2010-01-01
Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628
Directory of Open Access Journals (Sweden)
Vidlak Debbie
2012-06-01
Full Text Available Abstract Although IL-17A (commonly referred to as IL-17 has been implicated in the pathogenesis of central nervous system (CNS autoimmune disease, its role during CNS bacterial infections remains unclear. To evaluate the broader impact of IL-17 family members in the context of CNS infection, we utilized IL-17 receptor (IL-17R knockout (KO mice that lack the ability to respond to IL-17, IL-17F and IL-17E (IL-25. In this article, we demonstrate that IL-17R signaling regulates bacterial clearance as well as natural killer T (NKT cell and gamma-delta (γδ T cell infiltrates during Staphylococcus aureus-induced brain abscess formation. Specifically, when compared with wild-type (WT animals, IL-17R KO mice exhibited elevated bacterial burdens at days 7 and 14 following S. aureus infection. Additionally, IL-17R KO animals displayed elevated neutrophil chemokine production, revealing the ability to compensate for the lack of IL-17R activity. Despite these differences, innate immune cell recruitment into brain abscesses was similar in IL-17R KO and WT mice, whereas IL-17R signaling exerted a greater influence on adaptive immune cell recruitment. In particular, γδ T cell influx was increased in IL-17R KO mice at day 7 post-infection. In addition, NK1.1high infiltrates were absent in brain abscesses of IL-17R KO animals and, surprisingly, were rarely detected in the livers of uninfected IL-17R KO mice. Although IL-17 is a key regulator of neutrophils in other infection models, our data implicate an important role for IL-17R signaling in regulating adaptive immunity during CNS bacterial infection.
Nano and Microscale Topographies for the Prevention of Bacterial Surface Fouling
Directory of Open Access Journals (Sweden)
Mary V. Graham
2014-01-01
Full Text Available Bacterial surface fouling is problematic for a wide range of applications and industries, including, but not limited to medical devices (implants, replacement joints, stents, pacemakers, municipal infrastructure (pipes, wastewater treatment, food production (food processing surfaces, processing equipment, and transportation (ship hulls, aircraft fuel tanks. One method to combat bacterial biofouling is to modify the topographical structure of the surface in question, thereby limiting the ability of individual cells to attach to the surface, colonize, and form biofilms. Multiple research groups have demonstrated that micro and nanoscale topographies significantly reduce bacterial biofouling, for both individual cells and bacterial biofilms. Antifouling strategies that utilize engineered topographical surface features with well-defined dimensions and shapes have demonstrated a greater degree of controllable inhibition over initial cell attachment, in comparison to undefined, texturized, or porous surfaces. This review article will explore the various approaches and techniques used by researches, including work from our own group, and the underlying physical properties of these highly structured, engineered micro/nanoscale topographies that significantly impact bacterial surface attachment.
Impact of hydrodynamic stresses on bacterial flagella
Das, Debasish; Riley, Emily; Lauga, Eric
2017-11-01
The locomotion of bacteria powered by helical filaments, such as Escherichia coli, critically involves the generation of flows and hydrodynamic stresses which lead to forces and moments balanced by the moment applied by the bacterial rotary motor (which is embedded in the cell wall) and the deformation of the short flexible hook. In this talk we use numerical computations to accurately compute these hydrodynamic stresses, to show how they critically lead to fluid-structure instabilities at the whole-cell level, and enquire if they can be used to rationalise experimental measurements of bacterial motor torques. ERC Consolidator Grant.
Pett, SL; Carey, C; Lin, E; Wentworth, D; Lazovski, J; Miró, JM; Gordin, F; Angus, B; Rodriguez-Barradas, M; Rubio, R; Tambussi, G; Cooper, DA; Emery, S
2010-01-01
Background and Objectives Bacterial pneumonia still contributes to morbidity/mortality in HIV-infection despite effective combination antiretroviral therapy (cART). ESPRIT, a trial of intermittent recombinant interleukin-2 (rIL-2) with cART vs.cART alone (control arm) in HIV-infected adults with CD4+≥300 offered the opportunity to explore associations between bacterial pneumonia and rIL-2, a cytokine which increases some bacterial infections. Methods Baseline and time-updated factors associated with first-episode pneumonia on study were analysed using multivariate proportional hazards regression models. Smoking/pneumococcal vaccination history was not collected. Results IL-2 cycling was most intense in years 1-2. Over ≈7 years, 93 IL-2 (rate 0.67/100PY) and 86 control (rate 0.63/100PY) patients experienced a pneumonia-event, (HR=1.06,95%CI=0.79,1.42,p=0.68). Median CD4+ prior to pneumonia was 570 (IL-2 arm) and 463cells/uL (control arm). Baseline risks for bacterial pneumonia included older age, IVDU, detectable HIV viral load (VL), previous recurrent pneumonia; Asian ethnicity was associated with decreased risk. Higher proximal VL (HR for 1 log10 higher VL=1.28,95%CI=1.11,1.47,p=<.001) was associated with increased risk; higher CD4+ prior to the event (HR per 100 cells higher=0.94,95%CI0.89,1.0,p=0.04) decreased risk. Compared to controls, the hazard for a pneumonia-event was higher if rIL-2 was received <180 days prior (HR=1.66,95%CI=1.07,2.60,p=0.02) vs.≥180 days (HR=0.98,95%CI=0.70,1.37,p=0.9). Compared to the control group, pneumonia-risk in the IL-2 arm decreased over time with HRs of 1.41, 1.71, 1.16, 0.62 and 0.84 in years 1, 2, 3-4,5-6 and 7, respectively. Conclusions Bacterial pneumonia rates in cART-treated adults with moderate immunodeficiency are high. The mechanism of the association between bacterial pneumonia and recent IL-2 receipt and/or detectable HIV-viraemia deserves further exploration. PMID:20812949
Directory of Open Access Journals (Sweden)
Xian-Ming Chu
Full Text Available Recent researches revealed that asymptomatic bacterial colonization on PMs might be ubiquitous and increase the risk of clinical PM infection. Early diagnosis of patients with asymptomatic bacterial colonization could provide opportunity for targeted preventive measures.The present study explores the incidence of bacterial colonization of generator pockets in pacemaker replacement patients without signs of infection, and to analyze risk factors for asymptomatic bacterial colonization.From June 2011 to December 2013, 118 patients underwent pacemaker replacement or upgrade. Identification of bacteria was carried out by bacterial culture and 16S rRNA sequencing. Clinical risk characteristics were analyzed.The total bacterial positive rate was 37.3% (44 cases, and the coagulase-negative Staphylococcus aureus detection rate was the highest. Twenty two (18.6% patients had positive bacterial culture results, of which 50% had coagulase-negative staphylococcus. The bacterial DNA detection rate was 36.4 % (43 cases. Positive bacterial DNA results from pocket tissues and the surface of the devices were 22.0% and 29.7%, respectively. During follow-up (median, 27.0 months, three patients (6.8%, 3/44 became symptomatic with the same genus of microorganism, S. aureus (n=2 and S. epidermidis (n=1. Multivariable logistic regression analysis showed that history of bacterial infection, use of antibiotics, application of antiplatelet drugs, replacement frequency were independent risk factors for asymptomatic bacterial colonization.There was a high incidence of asymptomatic bacterial colonization in pacemaker patients with independent risk factors. Bacterial culture combined genetic testing could improve the detection rate.
Ma, Qin-Yun; Huang, Da-Yu; Zhang, Hui-Jun; Wang, Shaohua; Chen, Xiao-Feng
2017-11-01
The microbial community in the mucosal surfaces is involved in the development of human cancers, including gastric cancer and colorectal cancer. The respiratory tract in the lung also hosts a distinctive microbial community, but the correlation between this community and lung cancer is largely unknown. Here, we examined the Th1 and Th17 responses toward several bacterial antigens, in CD4 + T cells sourced from the peripheral blood (PB), the lung cancer (LC) tissue, and the gastrointestinal (GI) tract of non-small cell lung cancer (NSCLC) patients. Compared to healthy controls, the NSCLC patients presented significantly higher frequencies of Th1 and Th17 cells reacting to Streptococcus salivarius and S. agalactiae, in the PB, LC, and GI tract. Further investigation showed that the upregulation in anti-bacteria response was likely antigen-specific for two reasons. Firstly, the frequencies of Th1 and Th17 cells reacting to Escherichia coli, a typical GI bacterium, were not upregulated in the PB and the LC of NSCLC patients. Secondly, the S. salivarius and S. agalactiae responses could be partially blocked by Tü39, a MHC class II blocking antibody, suggesting that antigen-specific interaction between CD4 + T cells and antigen-presenting cells was required. We also found that S. salivarius and S. agalactiae could potently activate the monocytes to secrete higher levels of interleukin (IL)-6, IL-12, and tumor necrosis factor, which were Th1- and Th17-skewing cytokines. Interestingly, whereas CXCR5 + CD4 + T cells represented <20% of total CD4 + T cells, they represented 17%-82% of bacteria-specific Th1 or Th17 cells. Together, these data demonstrated that NSCLC patients presented a significant upregulation of bacterial-specific Th1 and Th17 responses that were enriched in CXCR5 + CD4 + T cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Identification of prophages in bacterial genomes by dinucleotide relative abundance difference.
Directory of Open Access Journals (Sweden)
K V Srividhya
Full Text Available BACKGROUND: Prophages are integrated viral forms in bacterial genomes that have been found to contribute to interstrain genetic variability. Many virulence-associated genes are reported to be prophage encoded. Present computational methods to detect prophages are either by identifying possible essential proteins such as integrases or by an extension of this technique, which involves identifying a region containing proteins similar to those occurring in prophages. These methods suffer due to the problem of low sequence similarity at the protein level, which suggests that a nucleotide based approach could be useful. METHODOLOGY: Earlier dinucleotide relative abundance (DRA have been used to identify regions, which deviate from the neighborhood areas, in genomes. We have used the difference in the dinucleotide relative abundance (DRAD between the bacterial and prophage DNA to aid location of DNA stretches that could be of prophage origin in bacterial genomes. Prophage sequences which deviate from bacterial regions in their dinucleotide frequencies are detected by scanning bacterial genome sequences. The method was validated using a subset of genomes with prophage data from literature reports. A web interface for prophage scan based on this method is available at http://bicmku.in:8082/prophagedb/dra.html. Two hundred bacterial genomes which do not have annotated prophages have been scanned for prophage regions using this method. CONCLUSIONS: The relative dinucleotide distribution difference helps detect prophage regions in genome sequences. The usefulness of this method is seen in the identification of 461 highly probable loci pertaining to prophages which have not been annotated so earlier. This work emphasizes the need to extend the efforts to detect and annotate prophage elements in genome sequences.
Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E
2015-08-08
The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the
Detection of apoptotic cells in tumour paraffin sections
International Nuclear Information System (INIS)
Pizem, J.; Coer, A.
2003-01-01
Apoptosis is a distinct form of cell death characterised by specific morphological features and regulated by complex molecular mechanisms. Its deregulation is fundamental for tumour growth and progression and, moreover, anticancer therapies suppress tumour growth mainly by induction of apoptosis. Since the extent of apoptosis in a tumour may have prognostic as well as therapeutic implications, much effort has been invested in developing specific methods that can be routinely used to detect apoptotic cells in archival formalin- fixed paraffin-embedded tissue. Complex molecular pathways are involved in the regulation of apoptosis. Pro-apoptotic signals trigger activation of caspases that specifically cleave target proteins. Cleavage of proteins (caspase substrates) is responsible for morphological changes of apoptotic cells and DNA fragmentation. In the last decade, detection of apoptotic cells in formalin-fixed tumour tissue sections has been based mainly on morphology and characteristic DNA fragmentation. Recently, specific antibodies to activated caspases and cleaved target proteins (including cytokeratin 18, actin and PARP) have been produced that enable accurate detection of apoptosis in paraffin sections. (author)
Bacterial whole-cell biocatalysts by surface display of enzymes: toward industrial application.
Schüürmann, Jan; Quehl, Paul; Festel, Gunter; Jose, Joachim
2014-10-01
Despite the first report on the bacterial display of a recombinant peptide appeared almost 30 years ago, industrial application of cells with surface-displayed enzymes is still limited. To display an enzyme on the surface of a living cell bears several advantages. First of all, neither the substrate nor the product of the enzymatic reaction needs to cross a membrane barrier. Second, the enzyme being linked to the cell can be separated from the reaction mixture and hence the product by simple centrifugation. Transfer to a new substrate preparation results in multiple cycles of enzymatic conversion. Finally, the anchoring in a matrix, in this case, the cell envelope stabilizes the enzyme and makes it less accessible to proteolytic degradation and material adsorption resulting in continuous higher activities. These advantages in common need to balance some disadvantages before this application can be taken into account for industrial processes, e.g., the exclusion of the enzyme from the cellular metabolome and hence from redox factors or other co-factors that need to be supplied. Therefore, this digest describes the different systems in Gram-positive and Gram-negative bacteria that have been used for the surface display of enzymes so far and focuses on examples among these which are suitable for industrial purposes or for the production of valuable resources, not least in order to encourage a broader application of whole-cell biocatalysts with surface-displayed enzymes.
Bedrossian, Manuel; Lindensmith, Chris; Nadeau, Jay L
2017-09-01
Detection of extant microbial life on Earth and elsewhere in the Solar System requires the ability to identify and enumerate micrometer-scale, essentially featureless cells. On Earth, bacteria are usually enumerated by culture plating or epifluorescence microscopy. Culture plates require long incubation times and can only count culturable strains, and epifluorescence microscopy requires extensive staining and concentration of the sample and instrumentation that is not readily miniaturized for space. Digital holographic microscopy (DHM) represents an alternative technique with no moving parts and higher throughput than traditional microscopy, making it potentially useful in space for detection of extant microorganisms provided that sufficient numbers of cells can be collected. Because sample collection is expected to be the limiting factor for space missions, especially to outer planets, it is important to quantify the limits of detection of any proposed technique for extant life detection. Here we use both laboratory and field samples to measure the limits of detection of an off-axis digital holographic microscope (DHM). A statistical model is used to estimate any instrument's probability of detection at various bacterial concentrations based on the optical performance characteristics of the instrument, as well as estimate the confidence interval of detection. This statistical model agrees well with the limit of detection of 10 3 cells/mL that was found experimentally with laboratory samples. In environmental samples, active cells were immediately evident at concentrations of 10 4 cells/mL. Published estimates of cell densities for Enceladus plumes yield up to 10 4 cells/mL, which are well within the off-axis DHM's limits of detection to confidence intervals greater than or equal to 95%, assuming sufficient sample volumes can be collected. The quantitative phase imaging provided by DHM allowed minerals to be distinguished from cells. Off-axis DHM's ability for
Edge Detection Based On the Characteristic of Primary Visual Cortex Cells
Zhu, M. M.; Xu, Y. L.; Ma, H. Q.
2018-01-01
Aiming at the problem that it is difficult to balance the accuracy of edge detection and anti-noise performance, and referring to the dynamic and static perceptions of the primary visual cortex (V1) cells, a V1 cell model is established to perform edge detection. A spatiotemporal filter is adopted to simulate the receptive field of V1 simple cells, the model V1 cell is obtained after integrating the responses of simple cells by half-wave rectification and normalization, Then the natural image edge is detected by using static perception of V1 cells. The simulation results show that, the V1 model can basically fit the biological data and has the universality of biology. What’s more, compared with other edge detection operators, the proposed model is more effective and has better robustness
Development of aptamers for use as radiopharmaceuticals in the bacterial infection identification
International Nuclear Information System (INIS)
Ferreira, Ieda Mendes
2013-01-01
The difficulty in early detection of specific foci caused by bacteria in the bacterial infection has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy had the advantage that a whole body image could be obtained, since specific tracers were available. This study aims to obtain aptamers specific for bacteria identification for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as 99 mTc, 18 F and 32 P. In this study, aptamers anti-peptidoglycan, the main component of the bacterial outer cell wall, were obtained through SELEX. Whole cells of Staphylococcus aureus were also used to perform the SELEX to cells (cell-SELEX). The selection of aptamers was performed by two different procedures (A and B). The A process has been accomplished by 15 SELEX rounds in which the separation of the oligonucleotides bound to the peptidoglycan of unbound ones was performed by filtration. In the B process 15 SELEX rounds were performed using the centrifugation for this separation, followed by 5 rounds cell-SELEX. The SELEX started with a pool of ssDNA (single stranded DNA). For A process, initially a library of ssDNA was incubated with peptidoglycan and the amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reation). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 selection rounds the selected oligonucleotides were cloned
High level bacterial contamination of secondary school students' mobile phones.
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-06-01
While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.
Directory of Open Access Journals (Sweden)
Mostafa Seifan
2017-10-01
Full Text Available Microbially induced mineral precipitation is recognized as a widespread phenomenon in nature. A diverse range of minerals including carbonate, sulphides, silicates, and phosphates can be produced through biomineralization. Calcium carbonate (CaCO3 is one of the most common substances used in various industries and is mostly extracted by mining. In recent years, production of CaCO3 by bacteria has drawn much attention because it is an environmentally- and health-friendly pathway. Although CaCO3 can be produced by some genera of bacteria through autotrophic and heterotrophic pathways, the possibility of producing CaCO3 in different environmental conditions has remained a challenge to determine. In this study, calcium alginate was proposed as a protective carrier to increase the bacterial tolerance to extreme environmental conditions. The model showed that the highest concentration of CaCO3 is achieved when the bacterial cells are immobilized in the calcium alginate beads fabricated using 1.38% w/v Na-alginate and 0.13 M CaCl2.
Bacterial cytoskeleton and implications for new antibiotic targets.
Wang, Huan; Xie, Longxiang; Luo, Hongping; Xie, Jianping
2016-01-01
Traditionally eukaryotes exclusive cytoskeleton has been found in bacteria and other prokaryotes. FtsZ, MreB and CreS are bacterial counterpart of eukaryotic tubulin, actin filaments and intermediate filaments, respectively. FtsZ can assemble to a Z-ring at the cell division site, regulate bacterial cell division; MreB can form helical structure, and involve in maintaining cell shape, regulating chromosome segregation; CreS, found in Caulobacter crescentus (C. crescentus), can form curve or helical filaments in intracellular membrane. CreS is crucial for cell morphology maintenance. There are also some prokaryotic unique cytoskeleton components playing crucial roles in cell division, chromosome segregation and cell morphology. The cytoskeleton components of Mycobacterium tuberculosis (M. tuberculosis), together with their dynamics during exposure to antibiotics are summarized in this article to provide insights into the unique organization of this formidable pathogen and druggable targets for new antibiotics.
Characterization and use of crystalline bacterial cell surface layers
Sleytr, Uwe B.; Sára, Margit; Pum, Dietmar; Schuster, Bernhard
2001-10-01
Crystalline bacterial cell surface layers (S-layers) are one of the most common outermost cell envelope components of prokaryotic organisms (archaea and bacteria). S-layers are monomolecular arrays composed of a single protein or glycoprotein species and represent the simplest biological membranes developed during evolution. S-layers as the most abundant of prokaryotic cellular proteins are appealing model systems for studying the structure, synthesis, genetics, assembly and function of proteinaceous supramolecular structures. The wealth of information existing on the general principle of S-layers have revealed a broad application potential. The most relevant features exploited in applied S-layer research are: (i) pores passing through S-layers show identical size and morphology and are in the range of ultrafiltration membranes; (ii) functional groups on the surface and in the pores are aligned in well-defined positions and orientations and accessible for chemical modifications and binding functional molecules in very precise fashion; (iii) isolated S-layer subunits from a variety of organisms are capable of recrystallizing as closed monolayers onto solid supports (e.g., metals, polymers, silicon wafers) at the air-water interface, on lipid films or onto the surface of liposomes; (iv) functional domains can be incorporated in S-layer proteins by genetic engineering. Thus, S-layer technologies particularly provide new approaches for biotechnology, biomimetics, molecular nanotechnology, nanopatterning of surfaces and formation of ordered arrays of metal clusters or nanoparticles as required for nanoelectronics.
An individual-based approach to explain plasmid invasion in bacterial populations
DEFF Research Database (Denmark)
Seoane, Jose Miguel; Yankelevich, Tatiana; Dechesne, Arnaud
2011-01-01
We present an individual-based experimental framework to identify and estimate the main parameters governing bacterial conjugation at the individual cell scale. From this analysis, we have established that transient periods of unregulated plasmid transfer within newly formed transconjugant cells...... of the growth cycle and that nongrowing cells, even when exposed to high nutrient concentrations, do not display conjugal activity. These results do not support previous hypotheses relating conjugation decay in the deeper cell layers of bacterial biofilms to nutrient depletion and low physiological activity. We...
Demodex-associated bacterial proteins induce neutrophil activation.
LENUS (Irish Health Repository)
2012-02-01
Background: Patients with rosacea demonstrate a higher density of Demodex mites in their skin than controls. A bacterium isolated from a Demodex mite from a patient with papulopustular rosacea (PPR) was previously shown to provoke an immune response in patients with PPR or ocular rosacea thus suggesting a possible role for bacterial proteins in the etiology of this condition. Objectives: To examine the response of neutrophils to proteins derived from a bacterium isolated from a Demodex mite. Methods: Bacterial cells were lysed and proteins were partially purified by AKTA-FPLC. Isolated neutrophils were exposed to bacterial proteins and monitored for alterations in migration, degranulation and cytokine production. Results: Neutrophils exposed to proteins from Bacillus cells demonstrated increased levels of migration and elevated release of MMP-9, an enzyme known to degrade collagen and cathelicidin, an antimicrobial peptide. In addition neutrophils exposed to the bacterial proteins demonstrated elevated rates of Il-8 and TNF-alpha production. Conclusions: Proteins produced by a bacterium isolated from a Demodex mite have the ability to increase the migration, degranulation and cytokine production abilities of neutrophils. These results suggest that bacteria may play a role in the inflammatory erythema associated with rosacea.