
Sample records for cell-specific ribosomal rna


    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  2. Viral IRES RNA structures and ribosome interactions


    Kieft, Jeffrey S.


    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  3. Viral IRES RNA structures and ribosome interactions. (United States)

    Kieft, Jeffrey S


    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  4. Nucleolar dominance and ribosomal RNA gene silencing


    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.


    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  5. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige


    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  6. Structure of a mitochondrial ribosome with minimal RNA


    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.


    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  7. Nonenzymatic microorganism identification based on ribosomal RNA (United States)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.


    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  8. Regulating the Ribosome: A Spotlight on RNA Dark Matter


    Lintner, Nathanael G.; Cate, Jamie H. D.


    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  9. Structure of a mitochondrial ribosome with minimal RNA. (United States)

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K


    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  10. An overview of pre-ribosomal RNA processing in eukaryotes


    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel


    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  11. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun


    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  12. Eukaryotic ribosomes that lack a 5.8S RNA (United States)

    Vossbrinck, C. R.; Woese, C. R.


    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  13. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei


    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  14. The role of human ribosomal proteins in the maturation of rRNA and ribosome production


    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica


    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  15. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly. (United States)

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra


    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  16. Structural Insights into tRNA Dynamics on the Ribosome

    Directory of Open Access Journals (Sweden)

    Xabier Agirrezabala


    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  17. Structural Insights into tRNA Dynamics on the Ribosome. (United States)

    Agirrezabala, Xabier; Valle, Mikel


    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  18. Structural Insights into tRNA Dynamics on the Ribosome


    Xabier Agirrezabala; Mikel Valle


    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  19. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer


    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  20. Visualization of ribosomal RNA operon copy number distribution


    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E


    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  1. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  2. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Directory of Open Access Journals (Sweden)

    Tan Bertrand


    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  3. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells. (United States)

    Lochmann, E R; Ehrlich, W; Mangir, M


    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  4. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)


    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  5. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    International Nuclear Information System (INIS)

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  6. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)


    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  7. Heritability and Variability in Ribosomal RNA Genes of Vicia faba


    Rogers, Scott O; Bendich, Arnold J.


    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  8. Footprinting of ribosomal RNA genes by transcription initiation factor and RNA polymerase I.


    Bateman, E.; Iida, C T; Kownin, P; Paule, M R


    The binding of a species-specific transcription initiation factor (TIF) and purified RNA polymerase I to the promoter region of the 39S ribosomal RNA gene from Acanthamoeba were studied by using DNase I "footprinting." Conditions were chosen such that the footprints obtained could be correlated with the transcriptional activity of the TIF-containing fractions used and that the labeled DNA present would itself serve as a template for transcription. The transcription factor binds upstream from ...

  9. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides. (United States)

    Doi, Yohei; Arakawa, Yoshichika


    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  10. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel. (United States)

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun


    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  11. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter


    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  12. Visualization of ribosomal RNA operon copy number distribution

    Directory of Open Access Journals (Sweden)

    DasGupta Indrani


    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  13. Mechanism of translocation: relative arrangement of tRNA and mRNA on the ribosome.


    Matzke, A J; Barta, A; Kuechler, E


    AcPhe-tRNAPhe from yeast can be photocross-linked to poly(U) on Escherichia coli ribosomes. The photoreaction occurs at the wybutine base situated next to the 3' side of the anticodon. The kinetics and efficiency of crosslinking of AcPhe-Phe-tRNA are the same at both the acceptor site and the peptidyl site. Therefore, the orientation of wybutine with respect to the mRNA is similar in both the pretranslocational and posttranslocational states. AcPhe-Phe-tRNA crosslinked at the acceptor site ca...

  14. Controlling translation elongation efficiency: tRNA regulation of ribosome flux on the mRNA. (United States)

    Gorgoni, Barbara; Marshall, Elizabeth; McFarland, Matthew R; Romano, M Carmen; Stansfield, Ian


    Gene expression can be regulated by a wide variety of mechanisms. One example concerns the growing body of evidence that the protein-production rate can be regulated at the level of translation elongation by controlling ribosome flux across the mRNA. Variations in the abundance of tRNA molecules cause different rates of translation of their counterpart codons. This, in turn, produces a variable landscape of translational rate across each and every mRNA, with the dynamic formation and deformation of ribosomal queues being regulated by both tRNA availability and the rates of translation initiation and termination. In the present article, a range of examples of tRNA control of gene expression are reviewed, and the use of mathematical modelling to develop a predictive understanding of the consequences of that regulation is discussed and explained. These findings encourage a view that predicting the protein-synthesis rate of each mRNA requires a holistic understanding of how each stage of translation, including elongation, contributes to the overall protein-production rate. PMID:24450645

  15. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.


    Felske, A; B. Engelen; Nübel, U; Backhaus, H


    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  16. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA


    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.


    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  17. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K


    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  18. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”


    Cesarini, Elisa


    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  19. Modeling of ribosome dynamics on a ds-mRNA under an external load (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid


    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  20. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid


    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  1. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism. (United States)

    Espah Borujeni, Amin; Salis, Howard M


    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  2. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen


    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  3. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis


    Surovtseva, Yulia V; Shadel, Gerald S.


    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  4. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection


    Zaher, Hani S.; Green, Rachel


    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  5. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  6. RNA-DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA. (United States)

    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan


    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA-DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the reads in all tested samples). The 2617 RDDs appeared already at the precursor polycistrone mitochondrial transcript. By using traditional Sanger sequencing, we identified the A-to-U RDD in six different cell lines and representative primates (Gorilla gorilla, Pongo pigmaeus, and Macaca mulatta), suggesting conservation of the mechanism generating such RDD. Phylogenetic analysis of more than 1700 vertebrate mtDNA sequences supported a thymine as the primate ancestral allele at position 2617, suggesting that the 2617 RDD recapitulates the ancestral 16S rRNA. Modeling U or G (the RDDs) at position 2617 stabilized the large ribosomal subunit structure in contrast to destabilization by an A (the pre-RDDs). Hence, these mitochondrial RDDs are likely functional. PMID:23913925

  7. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo Lazaro, Luis Ignacio; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel


    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recrui...

  8. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA (United States)

    Ikeuchi, Ken; Inada, Toshifumi


    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  9. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis. (United States)

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L


    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  10. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study. (United States)

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald


    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  11. Research Techniques Made Simple: Bacterial 16S Ribosomal RNA Gene Sequencing in Cutaneous Research. (United States)

    Jo, Jay-Hyun; Kennedy, Elizabeth A; Kong, Heidi H


    Skin serves as a protective barrier and also harbors numerous microorganisms collectively comprising the skin microbiome. As a result of recent advances in sequencing (next-generation sequencing), our understanding of microbial communities on skin has advanced substantially. In particular, the 16S ribosomal RNA gene sequencing technique has played an important role in efforts to identify the global communities of bacteria in healthy individuals and patients with various disorders in multiple topographical regions over the skin surface. Here, we describe basic principles, study design, and a workflow of 16S ribosomal RNA gene sequencing methodology, primarily for investigators who are not familiar with this approach. This article will also discuss some applications and challenges of 16S ribosomal RNA sequencing as well as directions for future development. PMID:26902128

  12. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing. (United States)

    Balzer, M; Wagner, R


    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  13. The long noncoding RNA RNCR2 directs mouse retinal cell specification

    Directory of Open Access Journals (Sweden)

    Blackshaw Seth


    Full Text Available Abstract Background Recent work has identified that many long mRNA-like noncoding RNAs (lncRNAs are expressed in the developing nervous system. Despite their abundance, the function of these ncRNAs has remained largely unexplored. We have investigated the highly abundant lncRNA RNCR2 in regulation of mouse retinal cell differentiation. Results We find that the RNCR2 is selectively expressed in a subset of both mitotic progenitors and postmitotic retinal precursor cells. ShRNA-mediated knockdown of RNCR2 results in an increase of both amacrine cells and Müller glia, indicating a role for this lncRNA in regulating retinal cell fate specification. We further report that RNCR2 RNA, which is normally nuclear-retained, can be exported from the nucleus when fused to an IRES-GFP sequence. Overexpression of RNCR2-IRES-GFP phenocopies the effects of shRNA-mediated knockdown of RNCR2, implying that forced mislocalization of RNCR2 induces a dominant-negative phenotype. Finally, we use the IRES-GFP fusion approach to identify specific domains of RNCR2 that are required for repressing both amacrine and Müller glial differentiation. Conclusion These data demonstrate that the lncRNA RNCR2 plays a critical role in regulating mammalian retinal cell fate specification. Furthermore, we present a novel approach for generating dominant-negative constructs of lncRNAs, which may be generally useful in the functional analysis of this class of molecules.

  14. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Directory of Open Access Journals (Sweden)

    Paul B. Essers


    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  15. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  16. Early life stress inhibits expression of ribosomal RNA in the developing hippocampus.

    Directory of Open Access Journals (Sweden)

    Lan Wei

    Full Text Available Children that are exposed to abuse or neglect show abnormal hippocampal function. However, the developmental mechanisms by which early life stress (ELS impairs normal hippocampal development have not been elucidated. Here we propose that exposure to ELS blunts normal hippocampal growth by inhibiting the availability of ribosomal RNA (rRNA. In support of this hypothesis, we show that the normal mouse hippocampus undergoes a growth-spurt during the second week of life, followed by a gradual decrease in DNA and RNA content that persists into adulthood. This developmental pattern is associated with accelerated ribosomal RNA (rRNA synthesis during the second week of life, followed by a gradual decline in rRNA levels that continue into adulthood. Levels of DNA methylation at the ribosomal DNA (rDNA promoter are lower during the second week of life compared to earlier development or adulthood. Exposure to brief daily separation (BDS, a mouse model of early life stress, increased DNA methylation at the ribosomal DNA promoter, decreased rRNA levels, and blunted hippocampal growth during the second week of life. Exposure to acute (3 hrs maternal separation decreased rRNA and increased DNA methylation at the rDNA proximal promoter, suggesting that exposure to stress early in life can rapidly regulate the availability of rRNA levels in the developing hippocampus. Given the critical role that rRNA plays in supporting normal growth and development, these findings suggest a novel molecular mechanism to explain how stress early in life impairs hippocampus development in the mouse.

  17. Ribosome collisions and translation efficiency: optimization by codon usage and mRNA destabilization. (United States)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen


    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of mRNA breakdown is offset by the concomitant increase in translation efficiency. PMID:18619977

  18. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn


    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  19. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  20. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S


    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... in vitro, both drugs strongly protect 23S rRNA bases A2058 and A2451 from dimethyl sulphate and G2505 from kethoxal modification; G2061 is also weakly protected from kethoxal. The modification patterns differ in that A2059 is additionally protected by clindamycin but not by lincomycin. The affinity...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on...

  1. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen


    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  2. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling (United States)

    Jones, Joshua D.; Chung, Betty Y.-W.; Siddell, Stuart G.; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global “snap-shot” of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  3. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling. (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  4. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.


    Hori, H.; Osawa, S; Murao, K.; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  5. An unusual mechanism for EF-Tu activation during tmRNA-mediated ribosome rescue


    Miller, Mickey R; Buskirk, Allen R.


    When ribosomes are stalled on truncated mRNAs in prokaryotes, they are rescued by the tmRNA/SmpB complex. It has been unclear how EF-Tu is activated by this complex. This manuscript analyzes this problem, and the results indicate that the normal EF-Tu GTPase cycle does not appear to apply in this specialized situation.

  6. The human insulin receptor mRNA contains a functional internal ribosome entry segment


    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth


    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5'-UTR of the mRNA encoding human insulin receptor (hIR) contains a functiona...

  7. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting


    Maynard, Nathaniel D.; Macklin, Derek N.; Kirkegaard, Karla; Covert, Markus W


    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNALys uridin...

  8. RNA structure-based ribosome recruitment: Lessons from the Dicistroviridae intergenic region IRESes


    Pfingsten, Jennifer S; Kieft, Jeffrey S.


    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5′ end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by m...

  9. RNA structure-based ribosome recruitment: lessons from the Dicistroviridae intergenic region IRESes. (United States)

    Pfingsten, Jennifer S; Kieft, Jeffrey S


    In eukaryotes, the canonical process of initiating protein synthesis on an mRNA depends on many large protein factors and the modified nucleotide cap on the 5' end of the mRNA. However, certain RNA sequences can bypass the need for these proteins and cap, using an RNA structure-based mechanism called internal initiation of translation. These RNAs are called internal ribosome entry sites (IRESes), and the cap-independent initiation pathway they support is critical for successful infection by many viruses of medical and economic importance. In this review, we briefly describe and compare mechanistic and structural groups of viral IRES RNAs, focusing on those IRESes that are capable of direct ribosome recruitment using specific RNA structures. We then discuss in greater detail some recent advances in our understanding of the intergenic region IRESes of the Dicistroviridae, which use the most streamlined ribosome-recruitment mechanism yet discovered. By combining these findings with knowledge of canonical translation and the behavior of other IRESes, mechanistic models of this RNA structure-based process are emerging. PMID:18515544

  10. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.


    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  11. RNase II is important for A-site mRNA cleavage during ribosome pausing


    Garza-Sánchez, Fernando; Shoji, Shinichiro; Fredrick, Kurt; Hayes, Christopher S.


    In Escherichia coli, translational arrest can elicit cleavage of codons within the ribosomal A site. This A-site mRNA cleavage is independent of RelE, and has been proposed to be an endonucleolytic activity of the ribosome. Here, we show that the 3′→5′ exonuclease RNase II plays an important role in RelE-independent A-site cleavage. Instead of A-site cleavage, translational pausing in ΔRNase II cells produces transcripts that are truncated +12 and +28 nucleotides downstream of the A-site codo...

  12. Redirecting T Cell Specificity Using T Cell Receptor Messenger RNA Electroporation. (United States)

    Koh, Sarene; Shimasaki, Noriko; Bertoletti, Antonio


    Autologous T lymphocytes genetically modified to express T cell receptors or chimeric antigen receptors have shown great promise in the treatment of several cancers, including melanoma and leukemia. In addition to tumor-associated antigens and tumor-specific neoantigens, tumors expressing viral peptides can also be recognized by specific T cells and are attractive targets for cell therapy. Hepatocellular carcinoma cells often have hepatitis B virus DNA integration and can be targeted by hepatitis B virus-specific T cells. Here, we describe a method to engineer hepatitis B virus-specific T cell receptors in primary human T lymphocytes based on electroporation of hepatitis B virus T cell receptor messenger RNA. This method can be extended to a large scale therapeutic T cell production following current good manufacturing practice compliance and is applicable to the redirection of T lymphocytes with T cell receptors of other virus specificities such as Epstein-Barr virus, cytomegalovirus, and chimeric receptors specific for other antigens expressed on cancer cells. PMID:27236807

  13. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip


    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  14. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  15. Nutritional and growth control of ribosomal protein mRNA and rRNA in Neurospora crassa.


    Cujec, T P; Tyler, B M


    The effects of changing growth rates on the levels of 40S pre-rRNA and two r-protein mRNAs were examined to gain insight into the coordinate transcriptional regulation of ribosomal genes in the ascomycete fungus Neurospora crassa. Growth rates were varied either by altering carbon nutritional conditions, or by subjecting the isolates to inositol-limiting conditions. During carbon up- or down-shifts, r-protein mRNA levels were stoichiometrically coordinated. Changes in 40S pre-rRNA levels para...

  16. [Precursors of ribosomal RNA in freely suspended callus cells of parsley (Petroselinum sativum)]. (United States)

    Richter, G


    Six high molecular weight, rapidly labelled RNA species were detected in freely suspended callus cells of Petroselinum sativum by means of isotope labelling and electrophoretic separation in agarose-polyacrylamide gels. On the basis of their migration in the latter the RNA species were calculated to have the following molecular weights: 2.9×10(6), 2,4×10(6), 1.9×10(6), 1.4×10(6), 1.0×10(6) and 0.75×10(6) daltons. Thus they can clearly be distinguished from the two ribosomal RNA species (1.3×10(6) and 0.7×10(6) daltons). During incubation of the cells with [(3)H]methyl-methionine as a methyl donator all six components incorporated radioactivity rapidly. With [(3)H]nucleosides or [(3)H]orotic acid as precursors the 2.9×10(6) and the 2.4×10(6) daltons RNA were labelled within 10 min, while the other high molecular weight species appeared after about 20 min of labelling.Prolongation to 45-120 min resulted in accumulation of radioactivity preferentially in the 1.4×10(6) and 0.75×10(6) daltons RNA and in the ribosomal RNA species. The results of cell fractionation experiments provide evidence that these rapidly labelled high molecular weight RNA species are synthesized in the cell nucleus. The kinetics of their synthesis together with the other data obtained strongly support the suggestion that these RNA species function as precursors in the processing of ribosomal RNA. The possible mechanism of this process is discussed. PMID:24468848

  17. Unusual transcription termination of the ribosomal RNA genes in Ascaris lumbricoides.


    Müller, E; Neuhaus, H; Tobler, H; Müller, F.


    We studied termination of transcription of the ribosomal RNA genes in Ascaris lumbricoides, the first representative in the phylum of nemathelminthes analysed so far. RNase protection experiments in vivo reveal that the 3' end of the precursor rRNA coincides with the end of mature 26S rRNA. Promoter-containing miniplasmids are able to direct unique 3' end formation in vitro at a site identical to that observed in vivo, whereas deletion of these sequences abolishes 3' end formation throughout ...

  18. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne; Støttrup, Josianne; Buchmann, Kurt


    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested to be...... related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  19. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A


    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  20. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.


    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  1. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)


    Triman, K L; Peister, A; R. A. Goel


    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  2. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D;


    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  3. Reduced expression of ribosomal proteins relieves microRNA-mediated repression. (United States)

    Janas, Maja M; Wang, Eric; Love, Tara; Harris, Abigail S; Stevenson, Kristen; Semmelmann, Karlheinz; Shaffer, Jonathan M; Chen, Po-Hao; Doench, John G; Yerramilli, Subrahmanyam V B K; Neuberg, Donna S; Iliopoulos, Dimitrios; Housman, David E; Burge, Christopher B; Novina, Carl D


    MicroRNAs (miRNAs) regulate physiological and pathological processes by inducing posttranscriptional repression of target messenger RNAs (mRNAs) via incompletely understood mechanisms. To discover factors required for human miRNA activity, we performed an RNAi screen using a reporter cell line of miRNA-mediated repression of translation initiation. We report that reduced expression of ribosomal protein genes (RPGs) dissociated miRNA complexes from target mRNAs, leading to increased polysome association, translation, and stability of miRNA-targeted mRNAs relative to untargeted mRNAs. RNA sequencing of polysomes indicated substantial overlap in sets of genes exhibiting increased or decreased polysomal association after Argonaute or RPG knockdowns, suggesting similarity in affected pathways. miRNA profiling of monosomes and polysomes demonstrated that miRNAs cosediment with ribosomes. RPG knockdowns decreased miRNAs in monosomes and increased their target mRNAs in polysomes. Our data show that most miRNAs repress translation and that the levels of RPGs modulate miRNA-mediated repression of translation initiation. PMID:22541556

  4. Protein-RNA cross-linking in the ribosomes of yeast under oxidative stress. (United States)

    Mirzaei, Hamid; Regnier, Fred


    Living systems have efficient degradative pathways for dealing with the fact that reactive oxygen species (ROS) derived from cellular metabolism and the environment oxidatively damage proteins and DNA. But aggregation and cross-linking can occur as well, leading to a series of problems including disruption of cellular regulation, mutations, and even cell death. The mechanism(s) by which protein aggregation occurs and the macromolecular species involved are poorly understood. In the study reported here, evidence is provided for a new type of aggregate between proteins and RNA in ribosomes. While studying the effect of oxidative stress induced in the yeast proteome it was noted that ribosomal proteins were widely oxidized. Eighty six percent of the proteins in yeast ribosomes were found to be carbonylated after stressing yeast cell cultures with hydrogen peroxide. Moreover, many of these proteins appeared to be cross-linked based on their coelution patterns during RPC separation. Since they were not in direct contact, it was not clear how this could occur unless it was through the RNA separating them in the ribosome. This was confirmed in a multiple-step process, the first being derivatization of all carbonylated proteins in cell lysates with biotin hydrazide through Schiff base formation. Following reduction of Schiff bases with sodium cyanoborohydride, biotinylated proteins were selected from cell lysates with avidin affinity chromatography. Oxidized proteins thus captured were then selected again using boronate affinity chromatography to capture vicinal diol-containing proteins. This would include proteins cross-linked to an RNA fragment containing a ribose residue with 2',3'-hydroxyl groups. Some glycoproteins would also be selected by this process. LC/MS/MS analyses of tryptic peptides derived from proteins captured by this process along with MASCOT searches resulted in the identification of 37 ribosomal proteins that appear to be cross-linked to RNA

  5. A pathogenic non-coding RNA induces changes in dynamic DNA methylation of ribosomal RNA genes in host plants. (United States)

    Martinez, German; Castellano, Mayte; Tortosa, Maria; Pallas, Vicente; Gomez, Gustavo


    Viroids are plant-pathogenic non-coding RNAs able to interfere with as yet poorly known host-regulatory pathways and to cause alterations recognized as diseases. The way in which these RNAs coerce the host to express symptoms remains to be totally deciphered. In recent years, diverse studies have proposed a close interplay between viroid-induced pathogenesis and RNA silencing, supporting the belief that viroid-derived small RNAs mediate the post-transcriptional cleavage of endogenous mRNAs by acting as elicitors of symptoms expression. Although the evidence supporting the role of viroid-derived small RNAs in pathogenesis is robust, the possibility that this phenomenon can be a more complex process, also involving viroid-induced alterations in plant gene expression at transcriptional levels, has been considered. Here we show that plants infected with the 'Hop stunt viroid' accumulate high levels of sRNAs derived from ribosomal transcripts. This effect was correlated with an increase in the transcription of ribosomal RNA (rRNA) precursors during infection. We observed that the transcriptional reactivation of rRNA genes correlates with a modification of DNA methylation in their promoter region and revealed that some rRNA genes are demethylated and transcriptionally reactivated during infection. This study reports a previously unknown mechanism associated with viroid (or any other pathogenic RNA) infection in plants providing new insights into aspects of host alterations induced by the viroid infectious cycle. PMID:24178032

  6. Quantitative studies of mRNA recruitment to the eukaryotic ribosome. (United States)

    Fraser, Christopher S


    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  7. Possible genetic consequences of epigenetic interactions between ribosomal RNA loci in Nicotiana allopolyploids

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, K.Y.; Součková Skalická, Kamila; Matyášek, Roman; Grandbastien, M.-A.; Leitch, A.

    Clermont-Ferrand, 2007. s. 1-1. [Réunion du Groupe de travail Cytogénétique & Polyploidie du DGAP. 18.04.2007-20.04.2007, Clermont-Ferrand] R&D Projects: GA ČR(CZ) GA521/07/0116; GA ČR(CZ) GA204/05/0687 Institutional research plan: CEZ:AV0Z50040507 Keywords : allopolyploidy * epigenetic silencing * ribosomal RNA gene Subject RIV: BO - Biophysics

  8. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  9. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region. (United States)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko; Lo Svenningsen, Sine; Sneppen, Kim; Pedersen, Steen


    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described. Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction of the functional half-life of a given mRNA sequence. PMID:21255584

  10. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons. (United States)

    Rausch, H; Larsen, N; Schmitt, R


    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  11. Ribosomal pausing at a frameshifter RNA pseudoknot is sensitive to reading phase but shows little correlation with frameshift efficiency. (United States)

    Kontos, H; Napthine, S; Brierley, I


    Here we investigated ribosomal pausing at sites of programmed -1 ribosomal frameshifting, using translational elongation and ribosome heelprint assays. The site of pausing at the frameshift signal of infectious bronchitis virus (IBV) was determined and was consistent with an RNA pseudoknot-induced pause that placed the ribosomal P- and A-sites over the slippery sequence. Similarly, pausing at the simian retrovirus 1 gag/pol signal, which contains a different kind of frameshifter pseudoknot, also placed the ribosome over the slippery sequence, supporting a role for pausing in frameshifting. However, a simple correlation between pausing and frameshifting was lacking. Firstly, a stem-loop structure closely related to the IBV pseudoknot, although unable to stimulate efficient frameshifting, paused ribosomes to a similar extent and at the same place on the mRNA as a parental pseudoknot. Secondly, an identical pausing pattern was induced by two pseudoknots differing only by a single loop 2 nucleotide yet with different functionalities in frameshifting. The final observation arose from an assessment of the impact of reading phase on pausing. Given that ribosomes advance in triplet fashion, we tested whether the reading frame in which ribosomes encounter an RNA structure (the reading phase) would influence pausing. We found that the reading phase did influence pausing but unexpectedly, the mRNA with the pseudoknot in the phase which gave the least pausing was found to promote frameshifting more efficiently than the other variants. Overall, these experiments support the view that pausing alone is insufficient to mediate frameshifting and additional events are required. The phase dependence of pausing may be indicative of an activity in the ribosome that requires an optimal contact with mRNA secondary structures for efficient unwinding. PMID:11713298

  12. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;


    codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described....... Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...

  13. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress (United States)


    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels.

  14. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress. (United States)

    Yoshikawa, Masaru; Fujii, Yoichi Robertus


    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  15. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana. (United States)

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D


    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  16. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display. (United States)

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh


    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  17. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization (United States)

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen


    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  18. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale


    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  19. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells (United States)

    Endoh, Tamaki; Sugimoto, Naoki


    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5‧ untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5‧ UTR. The results suggested that difference in motion of ribosome at the 5‧ UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock.

  20. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation. (United States)

    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine


    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3'-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein, TbNCP1. RNAi targeting PUF7 reduced trypanosome growth and inhibited two steps in ribosomal RNA processing. PMID:20153321

  1. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.


    Takaiwa, F; Sugiura, M


    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  2. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  3. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA. (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T


    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps. PMID:27016627

  4. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno


    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  5. The ribosome triggers the stringent response by RelA via a highly distorted tRNA. (United States)

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel


    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  6. Phylogenetic evidence for the acquisition of ribosomal RNA introns subsequent to the divergence of some of the major Tetrahymena groups

    DEFF Research Database (Denmark)

    Sogin, M L; Ingold, A; Karlok, M;


    Previous work has demonstrated the presence of a self-splicing intron in the large subunit ribosomal RNA coding region in some strains of the ciliate protozoan Tetrahymena. Sequence comparisons of the intron regions from six Tetrahymena species showed these to fall into three homology groups. In an...... attempt to evaluate the evolutionary origins of the intervening sequences, we have now determined complete small subunit ribosomal RNA gene sequences from 13 species of Tetrahymena and the absolute number of nucleotide differences between the sequences was used to construct a phylogenetic tree. This...

  7. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4


    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  8. The human insulin receptor mRNA contains a functional internal ribosome entry segment (United States)

    Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth


    Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

  9. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9. (United States)

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G


    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  10. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9 (United States)

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.


    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  11. Model of EF4-induced ribosomal state transitions and mRNA translocation

    International Nuclear Information System (INIS)

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region. (paper)

  12. In situ isolation of mRNA from individual plant cells: creation of cell-specific cDNA libraries

    NARCIS (Netherlands)

    Karrer, E.E.; Lincoln, J.E.; Hogenhout, S.A.; Bennett, A.B.; Bostock, R.M.; Martineau, B.; Lucas, W.J.; Gilchrist, D.G.; Alexander, D.


    A method for isolating and cloning mRNA populations from individual cells in living, intact plant tissues is described. The contents of individual cells were aspirated into micropipette tips filled with RNA extraction buffer. The mRNA from these cells was purified by binding to oligo(dT)-linked magn

  13. Regulation of ribosomal RNA expression across the lifespan is fine-tuned by maternal diet before implantation. (United States)

    Denisenko, Oleg; Lucas, Emma S; Sun, Congshan; Watkins, Adam J; Mar, Daniel; Bomsztyk, Karol; Fleming, Tom P


    Cells and organisms respond to nutrient deprivation by decreasing global rates of transcription, translation and DNA replication. To what extent such changes can be reversed is largely unknown. We examined the effect of maternal dietary restriction on RNA synthesis in the offspring. Low protein diet fed either throughout gestation or for the preimplantation period alone reduced cellular RNA content across fetal somatic tissues during challenge and increased it beyond controls in fetal and adult tissues after challenge release. Changes in transcription of ribosomal RNA, the major component of cellular RNA, were responsible for this phenotype as evidenced by matching alterations in RNA polymerase I density and DNA methylation at ribosomal DNA loci. Cellular levels of the ribosomal transcription factor Rrn3 mirrored the rRNA expression pattern. In cell culture experiments, Rrn3 overexpression reduced rDNA methylation and increased rRNA expression; the converse occurred after inhibition of Rrn3 activity. These observations define novel mechanism where poor nutrition before implantation irreversibly alters basal rates of rRNA transcription thereafter in a process mediated by rDNA methylation and Rrn3 factor. PMID:27060415

  14. Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species. (United States)

    Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans


    Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

  15. Purification and properties of new ribosome-inactivating proteins with RNA N-glycosidase activity. (United States)

    Bolognesi, A; Barbieri, L; Abbondanza, A; Falasca, A I; Carnicelli, D; Battelli, M G; Stirpe, F


    Ribosome-inactivating proteins (RIPs) similar to those already known (Stirpe & Barbieri (1986) FEBS Lett. 195, 1-8) were purified from the seeds of Asparagus officinalis (two proteins, asparin 1 and 2), of Citrullus colocynthis (two proteins, colocin 1 and 2), of Lychnis chalcedonica (lychnin) and of Manihot palmata (mapalmin), from the roots of Phytolacca americana (pokeweed antiviral protein from roots, PAP-R) and from the leaves of Bryonia dioica (bryodin-L). The two latter proteins can be considered as isoforms, respectively, of previously purified PAP, from the leaves of P. americana, and of bryodin-R, from the roots of B. dioica. All proteins have an Mr at approx, 30,000, and an alkaline isoelectric point. Bryodin-L, colocins, lychnin and mapalmin are glycoproteins. All RIPs inhibit protein synthesis by a rabbit reticulocyte lysate and phenylalanine polymerization by isolated ribosomes and alter rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). PMID:2248976

  16. Biodiversity characterization of cellulolytic bacteria present on native Chaco soil by comparison of ribosomal RNA genes. (United States)

    Talia, Paola; Sede, Silvana M; Campos, Eleonora; Rorig, Marcela; Principi, Dario; Tosto, Daniela; Hopp, H Esteban; Grasso, Daniel; Cataldi, Angel


    Sequence analysis of the 16S ribosomal RNA gene was used to study bacterial diversity of a pristine forest soil and of two cultures of the same soil enriched with cellulolytic bacteria. Our analysis revealed high bacterial diversity in the native soil sample, evidencing at least 10 phyla, in which Actinobacteria, Proteobacteria and Acidobacteria accounted for more than 76% of all sequences. In both enriched samples, members of Proteobacteria were the most frequently represented. The majority of bacterial genera in both enriched samples were identified as Brevundimonas and Caulobacter, but members of Devosia, Sphingomonas, Variovorax, Acidovorax, Pseudomonas, Xanthomonas, Stenotrophomonas, Achromobacter and Delftia were also found. In addition, it was possible to identify cellulolytic taxa such as Acidothermus, Micromonospora, Streptomyces, Paenibacillus and Pseudomonas, which indicates that this ecosystem could be an attractive source for study of novel enzymes for cellulose degradation. PMID:22202170

  17. Competing pathways control host resistance to virus via tRNA modification and programmed ribosomal frameshifting. (United States)

    Maynard, Nathaniel D; Macklin, Derek N; Kirkegaard, Karla; Covert, Markus W


    Viral infection depends on a complex interplay between host and viral factors. Here, we link host susceptibility to viral infection to a network encompassing sulfur metabolism, tRNA modification, competitive binding, and programmed ribosomal frameshifting (PRF). We first demonstrate that the iron-sulfur cluster biosynthesis pathway in Escherichia coli exerts a protective effect during lambda phage infection, while a tRNA thiolation pathway enhances viral infection. We show that tRNA(Lys) uridine 34 modification inhibits PRF to influence the ratio of lambda phage proteins gpG and gpGT. Computational modeling and experiments suggest that the role of the iron-sulfur cluster biosynthesis pathway in infection is indirect, via competitive binding of the shared sulfur donor IscS. Based on the universality of many key components of this network, in both the host and the virus, we anticipate that these findings may have broad relevance to understanding other infections, including viral infection of humans. PMID:22294093

  18. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence (United States)

    Ortega, Maya


    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  19. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F


    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  20. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.


    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  1. The ribosome triggers the stringent response by RelA via a highly distorted tRNA


    Agirrezabala, Xabier; Fernández, Israel S.; Kelley, Ann C.; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel


    The bacterial stringent response is initiated by RelA and links nutrient starvation with the transcriptional control of genes. Cryo-EM now shows that RelA on the ribosome stabilizes an unusual distorted form of cognate, deacylated tRNA.

  2. Cell-specific detection of microRNA expression during cardiomyogenesis by combined in situ hybridization and immunohistochemistry

    DEFF Research Database (Denmark)

    Schneider, Mikael; Andersen, Ditte Caroline; Silahtaroglu, Asli;


    MicroRNAs (miRNAs) regulate gene expression by mediating translational repression or mRNA degradation of their targets, and several miRNAs control developmental decisions through embryogenesis. In the developing heart, miRNA targets comprise key players mediating cardiac lineage determination. Ho...

  3. The trypanosome Pumilio-domain protein PUF7 associates with a nuclear cyclophilin and is involved in ribosomal RNA maturation


    Droll, Dorothea; Archer, Stuart; Fenn, Katelyn; Delhi, Praveen; Matthews, Keith; Clayton, Christine


    Proteins with Pumilio RNA binding domains (Puf proteins) are ubiquitous in eukaryotes. Some Puf proteins bind to the 3′-untranslated regions of mRNAs, acting to repress translation and promote degradation; others are involved in ribosomal RNA maturation. The genome of Trypanosoma brucei encodes eleven Puf proteins whose function cannot be predicted by sequence analysis. We show here that epitope-tagged TbPUF7 is located in the nucleolus, and associated with a nuclear cyclophilin-like protein,...

  4. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection


    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric


    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  5. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate. (United States)

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M


    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  6. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.


    Melançon, P; Lemieux, C; Brakier-Gingras, L


    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  7. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina


    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  8. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W;


    The distribution and repair of 8-methoxypsoralen-DNA interstrand cross-links in the ribosomal RNA genes (rDNA) in Tetrahymena thermophila have been studied in vivo by Southern blot analysis. It is found that the cross-links at a density of < or = 1/2 x 10(4) base pairs (bp) are distributed equall...

  9. Redirecting T-Cell Specificity to EGFR Using mRNA to Self-limit Expression of Chimeric Antigen Receptor. (United States)

    Caruso, Hillary G; Torikai, Hiroki; Zhang, Ling; Maiti, Sourindra; Dai, Jianliang; Do, Kim-Anh; Singh, Harjeet; Huls, Helen; Lee, Dean A; Champlin, Richard E; Heimberger, Amy B; Cooper, Laurence J N


    Potential for on-target, but off-tissue toxicity limits therapeutic application of genetically modified T cells constitutively expressing chimeric antigen receptors (CARs) from tumor-associated antigens expressed in normal tissue, such as epidermal growth factor receptor (EGFR). Curtailing expression of CAR through modification of T cells by in vitro-transcribed mRNA species is one strategy to mitigate such toxicity. We evaluated expression of an EGFR-specific CAR coded from introduced mRNA in human T cells numerically expanded ex vivo to clinically significant numbers through coculture with activating and propagating cells (AaPC) derived from K562 preloaded with anti-CD3 antibody. The density of AaPC could be adjusted to affect phenotype of T cells such that reduced ratio of AaPC resulted in higher proportion of CD8 and central memory T cells that were more conducive to electrotransfer of mRNA than T cells expanded with high ratios of AaPC. RNA-modified CAR T cells produced less cytokine, but demonstrated similar cytolytic capacity as DNA-modified CAR T cells in response to EGFR-expressing glioblastoma cells. Expression of CAR by mRNA transfer was transient and accelerated by stimulation with cytokine and antigen. Loss of CAR abrogated T-cell function in response to tumor and normal cells expressing EGFR. We describe a clinically applicable method to propagate and modify T cells to transiently express EGFR-specific CAR to target EGFR-expressing tumor cells that may be used to limit on-target, off-tissue toxicity to normal tissue. PMID:27163741

  10. Cell-Specific mRNA Profiling of the Caenorhabditis elegans Somatic Gonadal Precursor Cells Identifies Suites of Sex-Biased and Gonad-Enriched Transcripts. (United States)

    Kroetz, Mary B; Zarkower, David


    The Caenorhabditis elegans somatic gonad differs greatly between the two sexes in its pattern of cell divisions, migration, and differentiation. Despite decades of study, the genetic pathways directing early gonadal development and establishing sexual dimorphism in the gonad remain largely unknown. To help define the genetic networks that regulate gonadal development, we employed cell-specific RNA-seq. We identified transcripts present in the somatic gonadal precursor cells and their daughter cells of each sex at the onset of sexual differentiation. We identified several hundred gonad-enriched transcripts, including the majority of known regulators of early gonadal development, and transgenic reporter analysis confirmed the effectiveness of this approach. Before the division of the somatic gonad precursors, few sex-biased gonadal transcripts were detectable; less than 6 hr later, after their division, we identified more than 250 sex-biased transcripts, of which about a third were enriched in the somatic gonad compared to the whole animal. This indicates that a robust sex-biased developmental program, some of it gonad-specific, initiates in the somatic gonadal precursor cells around the time of their first division. About 10% of male-biased transcripts had orthologs with male-biased expression in the early mouse gonad, suggesting possible conservation of gonad sex differentiation. Cell-specific analysis also identified approximately 70 previously unannotated mRNA isoforms that are enriched in the somatic gonad. Our data illustrate the power of cell-specific transcriptome analysis and suggest that early sex differentiation in the gonad is controlled by a relatively small suite of differentially expressed genes, even after dimorphism has become apparent. PMID:26497144

  11. Designed Regular Tetragon-Shaped RNA-Protein Complexes with Ribosomal Protein L1 for Bionanotechnology and Synthetic Biology. (United States)

    Ohno, Hirohisa; Inoue, Tan


    RNA nanotechnology has been established by employing the molecular architecture of RNA structural motifs. Here, we report two designed RNA-protein complexes (RNPs) composed of ribosomal protein L1 (RPL1) and its RNA-binding motif that are square-shaped nano-objects. The formation and the shape of the objects were confirmed by gel electrophoresis analysis and atomic force microscopy, respectively. Any protein can be attached to the RNA via a fusion protein with RPL1, indicating that it can be used as a scaffold for loading a variety of functional proteins or for building higher-order structures. In summary, the RNP object will serve as a useful tool in the fields of bionanotechnology and synthetic biology. Moreover, the RNP interaction enhances the RNA stability against nucleases, rendering these complexes stable in cells. PMID:25933202

  12. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria


    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C


    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  13. Identification of a third region of cell-specific alternative splicing in human fibronectin mRNA

    International Nuclear Information System (INIS)

    The authors describe here a third region of variability in human fibronectin (FN) due to alternative RNA splicing. Two other positions of alternative splicing have been reported previously (ED and IIICS). The third region involves a 273-nucleotide exon encoding exactly one 91-amino acid repeat of type III homology, located between the DNA- and the cell-binding domains of FN, which is either included in or excluded from FN mRNA. The two mRNA variants arising by an exon-skipping mechanism are present in cells known to synthesize the cellular form of FN. However, liver cells, which are the source of plasma FN, produce only messengers without the extra type III sequence. Therefore, the region described here resembles, both structurally and functionally, the previously described ED (for extra domain) region, located toward the C terminus of the molecule between the cell- and heparin- (hep 2) binding domains. The authors conclude that both the extra type III repeat (names EDII) and ED represent sequences restricted to cellular FN. Combination of all the possible patterns of splicing in the three regions described to date may generate up to 20 distinct FN polypeptides from a single gene

  14. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li


    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  15. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán


    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  16. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S


    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  17. Casein Kinase 2 Associates with Initiation-Competent RNA Polymerase I and Has Multiple Roles in Ribosomal DNA Transcription


    Panova, Tatiana B; Panov, Kostya I.; Russell, Jackie; Zomerdijk, Joost C. B. M.


    Mammalian RNA polymerase I (Pol I) complexes contain a number of associated factors, some with undefined regulatory roles in transcription. We demonstrate that casein kinase 2 (CK2) in human cells is associated specifically only with the initiation-competent Pol Iβ isoform and not with Pol Iα. Chromatin immunoprecipitation analysis places CK2 at the ribosomal DNA (rDNA) promoter in vivo. Pol Iβ-associated CK2 can phosphorylate topoisomerase IIα in Pol Iβ, activator upstream binding factor (UB...

  18. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans. (United States)

    Tomioka, N; Sugiura, M


    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  19. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu


    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  20. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A


    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  1. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W


    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  2. A transgenic mouse line for collecting ribosome-bound mRNA using the tetracycline transactivator system

    Directory of Open Access Journals (Sweden)

    Laurel Drane


    Full Text Available Acquiring the gene expression profiles of specific neuronal cell-types is important for understanding their molecular identities. Genome-wide gene expression profiles of genetically defined cell-types can be acquired by collecting and sequencing mRNA that is bound to epitope-tagged ribosomes (TRAP; Translating Ribosome Affinity Purification. Here, we introduce a transgenic mouse model that combines the TRAP technique with the tetracycline transactivator (tTA system by expressing EGFP-tagged ribosomal protein L10a (EGFP-L10a under control of the tetracycline response element (tetO-TRAP. This allows both spatial control of EGFP-L10a expression through cell-type specific tTA expression, as well as temporal regulation by inhibiting transgene expression through the administration of doxycycline. We show that crossing tetO-TRAP mice with transgenic mice expressing tTA under the Camk2a promoter (Camk2a-tTA results in offspring with cell-type specific expression of EGFP-L10a in CA1 pyramidal neurons and medium spiny neurons in the striatum. Co-immunoprecipitation confirmed that EGFP-L10a integrates into a functional ribosomal complex. In addition, collection of ribosome-bound mRNA from the hippocampus yielded the expected enrichment of genes expressed in CA1 pyramidal neurons, as well as a depletion of genes expressed in other hippocampal cell-types. Finally, we show that crossing tetO-TRAP mice with transgenic Fos-tTA mice enables the expression of EGFP-L10a in CA1 pyramidal neurons that are activated during a fear conditioning trial. The tetO-TRAP mouse can be combined with other tTA mouse lines to enable gene expression profiling of a variety of different cell-types.

  3. ColE1 cloning of a ribosomal RNA promoter region from lambdarifsup(d)18 by selection for lambda integration and excision functions

    International Nuclear Information System (INIS)

    The expression of the ribosomal RNA gene carried by the lambda transducing phage lambdarifsup(d)18 is shown to be subject to stringent amino acid control. lambdarifsup(d)18 DNA was digested with endonuclease EcoRI and ligated to similarly restricted ColE1 plasmid DNA. Selection for expression of lambda integration and excision gene activity carried by the same DNA fragment results in cloning of the promoter proximal portion of the 16S ribosomal RNA gene. The resulting chimera expresses lambda integration and excision functions as well as encoding the promoter proximal half of a 16S ribosomal RNA gene. The effect of ultraviolet dose on stringent control of phage lambdarifsup(d)18 dependent ribosomal RNA synthesis is included in the investigation. (Auth.)

  4. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis


    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M


    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website ( RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  5. NMR structure of the A. aeolicus tmRNA pseudoknot PK1: new insights into the recoding event of the ribosomal trans-translation.


    Nonin-Lecomte, Sylvie; Felden, Brice; Dardel, Frédéric


    The transfer-messenger RNA (tmRNA) pseudoknot PK1 is essential for bacterial trans-translation, a ribosomal rescue mechanism. We report the solution structure of PK1 from Aquifex aeolicus, which despite an unprecedented small number of nucleotides and thus an unprecented compact size, displays a very high thermal stability. Several unusual structural features account for these properties and indicate that PK1 belongs to the class of ribosomal frameshift pseudoknots. This suggests a similarity...

  6. Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

    Directory of Open Access Journals (Sweden)

    Vincent J Denef


    Full Text Available Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP. Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.

  7. Seasonal Succession Leads to Habitat-Dependent Differentiation in Ribosomal RNA:DNA Ratios among Freshwater Lake Bacteria (United States)

    Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; Schmidt, Marian L.


    Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA gene sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. However, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors. PMID:27199936

  8. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu


    Agirrezabala, Xabier; Frank, Joachim


    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 Å, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as ...

  9. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli. (United States)

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L


    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  10. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig;


    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... were equal proportions of transcriptionally active and inactive embryos and essentially all embryos that developed to the 16-cell stage (n = 21) and further to the blastocyst stage (n = 19) contained only transcriptionally active cells. In conclusion, porcine embryos produced in vitro had an......-cell stage (n = 45), 38% of the embryos contained 1-3 nuclei with signs of rRNA transcription, indicating an asynchronous transcription initiation. This pattern continued in the following stages, as 78% (n = 47), 47% (n = 42) and 83% (n = 37) of the embryos revealed a mixture of transcriptionally inactive...

  11. Recovery from ultraviolet light-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and cockayne syndrome cells

    International Nuclear Information System (INIS)

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of 3H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. (author)

  12. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu. (United States)

    Agirrezabala, Xabier; Frank, Joachim


    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 A, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as elongation factors EF-Tu and EF-G - GTPases that catalyze tRNA delivery and translocation, respectively. This review focuses on the structural data related to the dynamics of the ribosomal machinery, which are the basis, in conjunction with existing biochemical, kinetic, and fluorescence resonance energy transfer data, of our knowledge of the decoding and translocation steps of protein elongation. PMID:20025795

  13. Effect of ultraviolet irradiation on 30-S ribosomal subunits. Identification of the RNA region crosslinked to protein S7

    International Nuclear Information System (INIS)

    The effects of ultraviolet irradiation on Escherichia coli 30-S ribosomal subunits were studied. At the doses of radiation used in this work (0-4.5 x 105 quanta/30-S subunit), only protein S7 was found to be significantly crosslinked to the 16-S RNA. In conditions where 25% of the protein was covalently crosslinked, the ability of the irradiated 30-S subunits to reassociate with 50-S subunits and their activity in polyphenylalanine synthesis decreased strongly. Similar results were obtained by irradiation with a germicide lamp (254 nm) or with a monochromatic ultraviolet light at 248 nm. No additional proteins were crosslinked to the 16-S RNA by irradiating 30-S subunits depleted in protein S1 or 70-S ribosomes. The covalent complex of 16-S RNA and protein S7 was isolated and digested by T1 ribonuclease. The oligonucleotide remaining attached to the crosslinked protein was characterised as A-C-C-U-C-G (position 1261-1266, see the sequence published by Carbon et al. (1979) Eur. J. Biochem. 160, 399-410). Analysis of this fragment suggests that protein S7 was linked to the cytosine at position 1265 in the RNA sequence. (orig.)

  14. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B;


    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are...... strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...

  15. Slow formation of stable complexes during coincubation of minimal rRNA and ribosomal protein S4. (United States)

    Mayerle, Megan; Bellur, Deepti L; Woodson, Sarah A


    Ribosomal protein S4 binds and stabilizes a five-helix junction or five-way junction (5WJ) in the 5' domain of 16S ribosomal RNA (rRNA) and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and 5WJ reorganize their structures. We show that labile S4 complexes rearrange into stable complexes within a few minutes at 42 °C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show that this structural change depends only on 16S residues within the S4 binding site. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing experiments showed that S4 strongly stabilizes 5WJ and the helix (H) 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in H16 that makes specific contacts with the S4 N-terminal extension, as well as a right-angle motif between H3, H4, and H18, requires a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of H3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  16. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin


    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  17. Conservation and loss of ribosomal RNA gene sites in diploid and polyploid Fragaria (Rosaceae

    Directory of Open Access Journals (Sweden)

    Liu Bo


    Full Text Available Abstract Background The genus Fragaria comprises species at ploidy levels ranging from diploid (2n = 2x = 14 to decaploid (2n = 10x = 70. Fluorescence in situ hybridization with 5S and 25S rDNA probes was performed to gather cytogenetic information that illuminates genomic divergence among different taxa at multiple ploidy levels, as well as to explore the evolution of ribosomal RNA genes during polyploidization in Fragaria. Results Root tip cells of diploid taxa were typified by two 5S and six 25S rDNA hybridization signals of varying intensities, providing a baseline for comparisons within the genus. In three exceptional diploid genotypes, F. nilgerrensis (CFRA 1358 and CFRA 1825 and F. vesca 'Yellow Wonder', two 5S but only four 25S rDNA sites were found but with differing site losses. The numbers of 5S and 25S rDNA signals, respectively were three and nine in a triploid F. ×bifera accession, and were four and twelve in three tetraploids, thus occurring in proportional 1.5× and 2× multiples of the typical diploid pattern. In hexaploid F. moschata, a proportional multiple of six 5S rDNA sites was observed, but the number of 25S rDNA sites was one or two less than the proportionate prediction of eighteen. This apparent tendency toward rDNA site loss at higher ploidy was markedly expanded in octoploids, which displayed only two 5S and ten 25S rDNA sites. In the two decaploids examined, the numbers of 5S and 25S rDNA signals, respectively, were four and fifteen in F. virginiana subsp. platypetala, and six and twelve in F. iturupensis. Conclusions Among diploid Fragaria species, a general consistency of rDNA site numbers implies conserved genomic organization, but highly variable 25S signal sizes and intensities and two instances of site loss suggest concurrent high dynamics of rDNA copy numbers among both homologs and non-homologs. General conservation of rDNA site numbers in lower ploidy, but marked site number reductions at higher ploidy

  18. Detection of Aspergillus fumigatus pulmonary fungal infections in mice with 99mTc-labeled MORF oligomers targeting ribosomal RNA

    International Nuclear Information System (INIS)

    Purpose: Invasive aspergillosis is a major cause of infectious morbidity and mortality in immunocompromised patients. The fungus Aspergillus fumigatus (A. fumigatus) is the primary causative agent of invasive aspergillosis. However, A. fumigatus infections remain difficult to diagnose particularly in the early stages due to the lack of a rapid, sensitive and specific diagnostic approach. In this study, we investigated 99mTc labeled MORF oligomers targeting fungal ribosomal RNA (rRNA) for the imaging detection of fungal infections. Procedures: Three phosphorodiamidate morpholino (MORF) oligomer (a DNA analogue) probes were designed: AGEN, complementary to a sequence of the fungal 28S ribosomal RNA (rRNA) of Aspergillus, as a genus-specific probe; AFUM, complementary to the 28S rRNA sequence of A. fumigatus, as a fungus species-specific probe; and cMORF, irrelevant to all fungal species, as a control probe. The probes were conjugated with Alexa Fluor 633 carboxylic acid succinimidyl ester (AF633) for fluorescence imaging or with NHS-mercaptoacetyl triglycine (NHS-MAG3) for nuclear imaging with 99mTc and then evaluated in vitro and in vivo. Results: The specific binding of AGEN and AFUM to fungal total RNA was confirmed by dot blot hybridization while specific binding of AGEN and AFUM in fixed and live A. fumigatus was demonstrated by both fluorescent in situ hybridization (FISH) analysis and accumulation in live cells. SPECT imaging of BALB/c mice with pulmonary A. fumigatus infections and administered 99mTc labeled AGEN and AFUM showed immediate and obvious accumulation in the infected lungs, while no significant accumulation of the control 99mTc-cMORF in the infected lung was observed. Compared to non-infected mice, with sacrifice at 1 h, the accumulation of 99mTc-AGEN and 99mTc-AFUM in the lungs of mice infected with A. fumigatus was 2 and 2.7 fold higher respectively. Conclusions: In vivo targeting fungal ribosomal RNA with 99mTc labeled MORF probes AGEN and AFUM

  19. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  20. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4 (United States)

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.


    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  1. Physical Mapping of the 5S Ribosomal RNA Gene in Citreae of Aurantioideae Species using Fluorescence in situ Hybridization


    Yamamoto, Masashi; Asad Asadi Abkenar; Matsumoto, Ryoji; KUBO, Tatsuya; TOMINAGA, Shigeto; ヤマモト, マサシ; マツモト, リョウジ; クボ, タツヤ; トミナガ, シゲト; 山本, 雅史; 松本, 亮司; 久保, 達也; 冨永, 茂人


    The location of the 5S ribosomal RNA gene (rDNA) in species from six genera of the Citreae of Aurantioideae was determined using fluorescence in situ hybridization (FISH). A 5S rDNA probe was labeled with biotin-16-dUTP. The probe was detected using a fluorescein isothiocyanate (FITC)-avidin conjugate with chromosomes counterstained with propidium iodide (PI). When the chromosomes were observed under a G filter, PI-stained chromosomes were classified into the following five types based on the...

  2. Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by complementarity to 18S rRNA


    Yueh, Andrew; Schneider, Robert J.


    Translation initiation on eukaryotic mRNAs involves 40S ribosome association with mRNA caps (m7GpppN), mediated by initiation factor eIF4F. 40S eukaryotic ribosomes and initiation factors undergo 5′ scanning to the initiation codon, with no known role for complementarity between eukaryotic 18S rRNA and the 5′ noncoding region of mRNAs. We demonstrate that the 5′ noncoding region of human adenovirus late mRNAs, known as the tripartite leader, utilizes a striking complementarity to 18S rRNA to ...

  3. Genetic Analysis of the Invariant Residue G791 in Escherichia coli 16S rRNA Implicates RelA in Ribosome Function▿


    Kim, Hong-Man; Ryou, Sang-Mi; Song, Woo-Seok; Sim, Se-Hoon; Cha, Chang-Jun; Han, Seung Hyun; Ha, Nam-Chul; Kim, Jae-Hong; BAE, Jeehyeon; Cunningham, Philip R.; Lee, Kangseok


    Previous studies identified G791 in Escherichia coli 16S rRNA as an invariant residue for ribosome function. In order to establish the functional role of this residue in protein synthesis, we searched for multicopy suppressors of the mutant ribosomes that bear a G-to-U substitution at position 791. We identified relA, a gene whose product has been known to interact with ribosomes and trigger a stringent response. Overexpression of RelA resulted in the synthesis of approximately 1.5 times more...

  4. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq


    Smagin, Dmitry A.; Kovalenko, Irina L.; Galyamina, Anna G.; Bragin, Anatoly O.; Orlov, Yuriy L.; Natalia N. Kudryavtseva


    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. T...

  5. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish


    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  6. Ribosome recycling induces optimal translation rate at low ribosomal availability


    Marshall, E.; Stansfield, I; Romano, M. C.


    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  7. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei. (United States)

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit


    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  8. Stem–loop structures can effectively substitute for an RNA pseudoknot in −1 ribosomal frameshifting


    Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.


    −1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base–base and base–sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in −1 PRF. Here, we investigated the efficiency of ...

  9. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice


    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long

  10. The Structure of Aquifex aeolicus Ribosomal Protein S8 Reveals a Unique Subdomain That Contributes to Extremely-Tight Association With 16S rRNA


    Menichelli, Elena; Edgcomb, Stephen P.; Recht, Michael I.; Williamson, James R.


    The assembly of ribonucleoprotein complexes occurs in a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from the hyperthemophilic bacterium Aquifex aeolicus (AS8) is unique in that there is a 41 residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually-high affinity for the 16S ribosomal RNA (rRNA), characterized by a picomolar dissociation constant that is a...

  11. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony


    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally....... In addition, a G2502----A transition caused a decreased growth rate, probably due to a partial selection against mutant ribosome incorporation into polysomes, while an A2503----C transversion produced a decreased growth rate and conferred resistance to chloramphenicol. All of the mutant RNAs were...

  12. The complete nucleotide sequence of the rat 18S ribosomal RNA gene and comparison with the respective yeast and frog genes.


    Torczynski, R; Bollon, A P; Fuke, M


    The complete nucleotide sequence of the rat 18S ribosomal RNA gene has been determined. A comparison of the rat 18S ribosomal RNA gene sequence with the known sequences of yeast and frog revealed three conserved (stable) regions, two unstable regions, and three large inserts. (A,T) leads to (G,C) changes were more frequent than (G,C) leads to (A,T) changes for three comparisons (yeast leads to frog, frog leads to rat, and yeast leads to rat). GC pairs were inserted preferentially over AT pair...

  13. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data. (United States)

    Agrawal, Saumya; Ganley, Austen R D


    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  14. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq. (United States)

    Smagin, Dmitry A; Kovalenko, Irina L; Galyamina, Anna G; Bragin, Anatoly O; Orlov, Yuriy L; Kudryavtseva, Natalia N


    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. There were no differentially expressed ribosomal genes in the ventral tegmental area, midbrain raphe nuclei, or striatum. This approach may be used to identify a pharmacological treatment of ribosome biogenesis abnormalities in the brain of patients with "ribosomopathies." PMID:26839715

  15. Physical and biochemical nature of the bacterial cytoplasm: movement and localization of mRNA and the 30S subunits of ribosomes. (United States)

    Trevors, J T


    There is a paucity of knowledge on how mRNA transcripts in the spatially crowded, but molecularly organized bacterial cytoplasm contact the 30S ribosomal subunits. Does simple diffusion in the cytoplasm account for transcript-ribosome interactions given that a large number of ribosomes (e.g., about 72,000 in Escherichia coli during exponential growth) can be present in the cytoplasm? Or are undiscovered mechanisms present where specific transcripts are directed to specific ribosomes at specific cytoplasmic locations, while others are mobilized in a random manner? Moreover, is it possible that cytoplasmic mobilization occurs in bacteria, driven possibly by thermal infrared (IR) radiation and the generation of exclusion zone (EZ) water? These aspects will be discussed in this article and hypotheses presented. PMID:22710107

  16. Photochemical cross-linking of tRNA/sup Phe/ modified at A76 and A73 to the Escherichia coli ribosome

    International Nuclear Information System (INIS)

    [5'-32P]-8-azidoadenosine 3',5'-bisphosphate ([5'-32P]p(N3)Ap) has been prepared using a simple two-step procedure: alkaline hydrolysis of 8-azidoadenosine 3',5'-cyclic monophosphate followed by labeling of the resulting 3'-mononucleotide with 32P at the 5' position using [γ-32P]ATP and T4 polynucleotide kinase. [5'-32P]p(N3)Ap has proven to be an excellent substrate for T4 RNA ligase. To study the environment of the 3' end of tRNA on bacterial ribosomes, nucleosides A76 and A73 in yeast tRNA/sup Phe/ were replaced with their 8-azido derivatives. This was achieved by stepwise removal of 3'-terminal nucleosides from the tRNA using the Whitfield procedure, incorporation of [5'-32P]p(N3)Ap into appropriately degraded tRNA with T4 RNA ligase, and restoration of the CCA/sub OH/ terminus with yeast nucleotidyl transferase. The modified tRNAs were bound to the A or P site of Escherichia coli ribosomes programmed with poly(U). UV irradiation produced covalent, zero-length cross-links between the tRNA and neighboring ribosomal components. The tRNA derivative containing (N3)A73 became attached exclusively to proteins of the 50S subunit whose identity is currently under investigation

  17. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M


    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  18. Structural insights into ribosome translocation. (United States)

    Ling, Clarence; Ermolenko, Dmitri N


    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  19. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina


    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert



  20. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys. (United States)

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  1. Prokaryote phylogeny based on ribosomal proteins and aminoacyl tRNA synthetases by using the compositional distance approach

    Institute of Scientific and Technical Information of China (English)

    WEI; Haibin; QI; Ji; HAO; Bailin


    In order to show that the newly developed K-string composition distance method,based on counting oligopeptide frequencies,for inferring phylogenetic relations of prokaryotes works equally well without requiring the whole proteome data,we used all ribosomal proteins and the set of aminoacyl tRNA synthetases for each species.The latter group has been known to yield inconsistent trees if used individually.Our trees are obtained without making any sequence alignment.Altogether 16 Archaea,105 Bacteria and 2 Eucarya are represented on the tree.Most of the lower branchings agree well with the latest,2003,Outline of the second edition of the Bergey's Manual of Systematic Bacteriology and the trees also suggest some relationships among higher taxa.

  2. Rapid identification of Helicoverpa armigera and Helicoverpa zea (Lepidoptera: Noctuidae) using ribosomal RNA internal transcribed spacer 1. (United States)

    Perera, Omaththage P; Allen, Kerry C; Jain, Devendra; Purcell, Matthew; Little, Nathan S; Luttrell, Randall G


    Rapid identification of invasive species is crucial for deploying management strategies to prevent establishment. Recent Helicoverpa armigera (Hübner) invasions and subsequent establishment in South America has increased the risk of this species invading North America. Morphological similarities make differentiation of H. armigera from the native Helicoverpa zea (Boddie) difficult. Characteristics of adult male genitalia and nucleotide sequence differences in mitochondrial DNA are two of the currently available methods to differentiate these two species. However, current methods are likely too slow to be employed as rapid detection methods. In this study, conserved differences in the internal transcribed spacer 1 (ITS1) of the ribosomal RNA genes were used to develop species-specific oligonucleotide primers that amplified ITS1 fragments of 147 and 334 bp from H. armigera and H. zea, respectively. An amplicon (83 bp) from a conserved region of 18S ribosomal RNA subunit served as a positive control. Melting temperature differences in ITS1 amplicons yielded species-specific dissociation curves that could be used in high resolution melt analysis to differentiate the two Helicoverpa species. In addition, a rapid and inexpensive procedure for obtaining amplifiable genomic DNA from a small amount of tissue was identified. Under optimal conditions, the process was able to detect DNA from one H. armigera leg in a pool of 25 legs. The high resolution melt analysis combined with rapid DNA extraction could be used as an inexpensive method to genetically differentiate large numbers of H. armigera and H. zea using readily available reagents. PMID:26516166

  3. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S


    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA. Ev...

  4. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.


    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  5. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    Ribonucleic acids (RNAs) take centre stage in gene expression. In eukaryotes, most RNAs are transcribed as precursors, and these precursors are co- or post-transcriptionally processed and assemble with particular proteins to form ribonucleoproteins (RNPs). Mature RNPs participate in various gene...... expression events, are then subject to recycling, disassembly or degradation. RNA helicases are highly conserved enzymes that use ATP to bind or remodel RNA or RNPs. They function in nearly every aspect of eukaryotic RNA metabolism. The spliceosome catalyzes pre-mRNAs splicing, which removes introns and...

  6. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P


    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  7. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim;


    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...... febrile neutropenia. Testing for the A1555G mutation is recommended in patients frequently treated with aminoglycosides....

  8. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter; Callesen, Henrik; Hyttel, Poul; Thomsen, Preben D


    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization of...... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...... phase during the third cell cycle....

  9. Sequence requirements for self-splicing of the Tetrahymena thermophila pre-ribosomal RNA.


    Price, J V; Kieft, G L; Kent, J R; Sievers, E L; Cech, T R


    The sequence requirements for splicing of the Tetrahymena pre-rRNA have been examined by altering the rRNA gene to produce versions that contain insertions and deletions within the intervening sequence (IVS). The altered genes were transcribed and the RNA tested for self-splicing in vitro. A number of insertions (8-54 nucleotides) at three locations had no effect on self-splicing activity. Two of these insertions, located at a site 5 nucleotides preceding the 3'-end of the IVS, did not alter ...

  10. RNA–DNA differences in human mitochondria restore ancestral form of 16S ribosomal RNA


    Bar-Yaacov, Dan; Avital, Gal; Levin, Liron; Richards, Allison L.; Hachen, Naomi; Rebolledo Jaramillo, Boris; Nekrutenko, Anton; Zarivach, Raz; Mishmar, Dan


    RNA transcripts are generally identical to the underlying DNA sequences. Nevertheless, RNA–DNA differences (RDDs) were found in the nuclear human genome and in plants and animals but not in human mitochondria. Here, by deep sequencing of human mitochondrial DNA (mtDNA) and RNA, we identified three RDD sites at mtDNA positions 295 (C-to-U), 13710 (A-to-U, A-to-G), and 2617 (A-to-U, A-to-G). Position 2617, within the 16S rRNA, harbored the most prevalent RDDs (>30% A-to-U and ∼15% A-to-G of the...

  11. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing


    Naveed, Muhammad; Mubeen, Samavia; Khan, Samiullah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relat...

  12. FRET Characterization of Complex Conformational Changes in a Large 16S Ribosomal RNA Fragment Site-Specifically Labeled Using Unnatural Base Pairs. (United States)

    Lavergne, Thomas; Lamichhane, Rajan; Malyshev, Denis A; Li, Zhengtao; Li, Lingjun; Sperling, Edit; Williamson, James R; Millar, David P; Romesberg, Floyd E


    Ribosome assembly has been studied intensively using Förster resonance energy transfer (FRET) with fluorophore-labeled fragments of RNA produced by chemical synthesis. However, these studies are limited by the size of the accessible RNA fragments. We have developed a replicable unnatural base pair (UBP) formed between (d)5SICS and (d)MMO2 or (d)NaM, which efficiently directs the transcription of RNA containing unnatural nucleotides. We now report the synthesis and evaluation of several of the corresponding ribotriphosphates bearing linkers that enable the chemoselective attachment of different functionalities. We found that the RNA polymerase from T7 bacteriophage does not incorporate NaM derivatives but does efficiently incorporate 5SICS(CO), whose linker enables functional group conjugation via Click chemistry, and when combined with the previously identified MMO2(A), whose amine side chains permits conjugation via NHS coupling chemistry, enables site-specific double labeling of transcribed RNA. To study ribosome assembly, we transcribed RNA corresponding to a 243-nt fragment of the central domain of Thermus thermophilus 16S rRNA containing 5SICS(CO) and MMO2(A) at defined locations and then site-specifically attached the fluorophores Cy3 and Cy5. FRET was characterized using single-molecule total internal reflection fluorescence (smTIRF) microscopy in the presence of various combinations of added ribosomal proteins. We demonstrate that each of the fragment's two three-helix junctions exist in open and closed states, with the latter favored by sequential protein binding. These results elucidate early and previously uncharacterized folding events underlying ribosome assembly and demonstrate the applicability of UBPs for biochemical, structural, and functional studies of RNAs. PMID:26942998

  13. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2


    Occhipinti, L.; Chang, Y.; Altvater, M.; Menet, A. M.; Kemmler, S.; Panse, V. G.


    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a sec...

  14. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species. (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I


    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. PMID:23622485

  15. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan. (United States)

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  16. Species-specific repeat units in the intergenic spacer of the ribosomal RNA cistron of Anopheles aquasalis Curry. (United States)

    Perera, O P; Cockburn, A F; Mitchell, S E; Conn, J; Seawright, J A


    A genomic DNA library of Anopheles aquasalis Curry was screened for clones that hybridized more intensely to DNA from A. aquasalis than to DNA from A. benarrochi Gabaldon, Cova Garcia, and Lopez, A. konderi Galvao and Damasceno, A. nuneztovari Gabaldon cytotypes A, B, and C, A. oswaldoi (Peryassu), A. rangeli Gabaldon, Cova Garcia, and Lopez, or A. trinkae Faran. Two specific clones (2.5 kilobasepairs [kbp] and 3.0 kbp) from A. aquasalis were isolated. Both A. aquasalis-specific clones were from the intergenic spacer region of the ribosomal RNA (rRNA) cistron. Upon digestion with Rsa I, a 900-bp fragment from the clone AA-1 hybridized specifically to A. aquasalis DNA. Analysis of the DNA sequence of this fragment revealed four tandemly repeated 36-bp units. Three of these repeat units were identical, and the fourth was 94% identical to the others. The DNA sequence of a highly conserved region of these repeats was used to synthesize an oligonucleotide probe specific to A. aquasalis. PMID:9840580

  17. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Directory of Open Access Journals (Sweden)



    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  18. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming; Lamentowicz, Mariusz; Mitchell, Edward A D


    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...... causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  19. Preparative-scale isolation and purification of procaryotic and eucaryotic ribosomal 5 S RNA: Bacillus subtilis, Neurospora crassa, and wheat germ. (United States)

    Li, S J; Chang, L H; Chen, S; Marshall, A G


    Ribosomal 5 S RNA from three different organisms has been isolated in high yield and purity. Without prior isolation of ribosomes, a presoak in buffer followed by phenol extraction, DE-32 ion-exchange chromatography, and Sephadex G-75 gel-permeation chromatography yields at least 5-10 mg of electrophoretically homogeneous 5 S RNA from 100 g of cells. Ribonuclease activity is eliminated by various combinations of low temperature, sodium dodecyl sulfate, phenol, and bentonite. High-molecular-weight contaminants are suppressed by either 65 degrees C heat treatment or lowered sodium dodecyl sulfate concentration. For the eucaryotes, 5.8 S RNA contamination is reduced either by low temperature in the initial solubilization or by postponing 65 degrees C heat treatment until after the phenol extraction step. PMID:6204554

  20. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    DEFF Research Database (Denmark)

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;


    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  1. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P


    that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is...

  2. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Czech Academy of Sciences Publication Activity Database

    Krásný, Libor; Gourse, Richard. L.


    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  3. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S


    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  4. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    International Nuclear Information System (INIS)

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  5. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's


    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT


    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  7. Phylogenetic relationships within the Mysidae (Crustacea, Peracarida, Mysida) based on nuclear 18S ribosomal RNA sequences


    Remerie, T.; Bulckaen, B.; Calderon, J; Deprez, T.; Mees, J.; J. Vanfleteren; Vanreusel, A.; Vierstraete, A; Vincx, M.; Wittmann, K.J.; Wooldridge, T.


    Species of the order Mysida (Crustacea, Peracarida) are shrimp-like animals that occur in vast numbers in coastal regions of the world. The order Mysida comprises 1053 species and 165 genera. The present study covers 25 species of the well-defined Mysidae, the most speciose family within the order Mysida. 18S rRNA sequence analysis confirms that the subfamily Siriellinae is monophyletic. On the other hand the subfamily Gastrosaccinae is paraphyletic and the subfamily Mysinae, represented in t...

  8. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole


    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  9. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C1400 was preserved. Changing C1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  10. Ribosome-inactivating proteins


    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M.


    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with oth...

  11. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA. (United States)

    Goggin, C L; Barker, S C


    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates. PMID:8366895

  12. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing. (United States)

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad


    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  13. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed


    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  14. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li


    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  15. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.


    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  16. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.


    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  17. Quantification of uncultured Ruminococcus obeum-like bacteria in human fecal samples with fluorescent in situ hybridization and flow cytometry using 16S ribosomal RNA targeted probes


    Zoetendal, E.G.; Ben-Amor, K.; Harmsen, H. J. M.; Schut, F; Akkermans, A. D. L.; Vos, de, N.M.


    A 16S rRNA-targeted probe was designed and validated in order to quantify the number of uncultured Ruminococcus obeum-like bacteria by fluorescent in situ hybridization (FISH). These bacteria have frequently been found in 16S ribosomal DNA clone libraries prepared from bacterial communities in the human intestine. Thirty-two reference strains from the human intestine, including a phylogenetically related strain and strains of some other Ruminococcus species, were used as negative controls and...

  18. RNA:protein ratio of the unicellular organism as a characteristic of phosphorous and nitrogen stoichiometry and of the cellular requirement of ribosomes for protein synthesis


    Sams Carl E; Greenwood Duncan J; Karpinets Tatiana V; Ammons John T


    Abstract Background Mean phosphorous:nitrogen (P:N) ratios and relationships of P:N ratios with the growth rate of organisms indicate a surprising similarity among and within microbial species, plants, and insect herbivores. To reveal the cellular mechanisms underling this similarity, the macromolecular composition of seven microorganisms and the effect of specific growth rate (SGR) on RNA:protein ratio, the number of ribosomes, and peptide elongation rate (PER) were analyzed under different ...

  19. A novel protein-RNA binding assay: functional interactions of the foot-and-mouth disease virus internal ribosome entry site with cellular proteins.


    Stassinopoulos, I A; Belsham, G J


    Translation initiation on foot-and-mouth disease virus (FMDV) RNA occurs by a cap-independent mechanism directed by a highly structured element (approximately 435 nt) termed an internal ribosome entry site (IRES). A functional assay to identify proteins that bind to the FMDV IRES and are necessary for FMDV IRES-mediated translation initiation has been developed. In vitro-transcribed polyadenylated RNAs corresponding to the whole or part of the FMDV IRES were immobilized on oligo-dT Dynabeads ...

  20. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.


    Roč. 8, JUN 19 2015 (2015), s. 336. ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant ostatní: GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.430, year: 2014

  1. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii


    Khairnar Krishna; Parija Subhash


    Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR) amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand con...

  2. A local role for the small ribosomal subunit primary binder rpS5 in final 18S rRNA processing in yeast.

    Directory of Open Access Journals (Sweden)

    Andreas Neueder

    Full Text Available In vivo depletion of the yeast small ribosomal subunit (SSU protein S5 (rpS5 leads to nuclear degradation of nascent SSUs and to a perturbed global assembly state of the SSU head domain. Here, we report that rpS5 plays an additional local role at the head/platform interface in efficient SSU maturation. We find that yeast small ribosomal subunits which incorporated an rpS5 variant lacking the seven C-terminal amino acids have a largely assembled head domain and are exported to the cytoplasm. On the other hand, 3' processing of 18S rRNA precursors is inhibited in these ribosomal particles, although they associate with the putative endonuclease Nob1p and other late acting 40S biogenesis factors. We suggest that the SSU head component rpS5 and platform components as rpS14 are crucial constituents of a highly defined spatial arrangement in the head-platform interface of nascent SSUs, which is required for efficient processing of the therein predicted SSU rRNA 3' end. Positioning of rpS5 in nascent SSUs, including its relative orientation towards platform components in the head-platform cleft, will depend on the general assembly and folding state of the head domain. Therefore, the suggested model can explain 18S precursor rRNA 3' processing phenotypes observed in many eukaryotic SSU head assembly mutants.

  3. Graphical representation of ribosomal RNA probe accessibility data using ARB software package

    Directory of Open Access Journals (Sweden)

    Amann Rudolf


    Full Text Available Abstract Background Taxon specific hybridization probes in combination with a variety of commonly used hybridization formats nowadays are standard tools in microbial identification. A frequently applied technology, fluorescence in situ hybridization (FISH, besides single cell identification, allows the localization and functional studies of the microbial community composition. Careful in silico design and evaluation of potential oligonucleotide probe targets is therefore crucial for performing successful hybridization experiments. Results The PROBE Design tools of the ARB software package take into consideration several criteria such as number, position and quality of diagnostic sequence differences while designing oligonucleotide probes. Additionally, new visualization tools were developed to enable the user to easily examine further sequence associated criteria such as higher order structure, conservation, G+C content, transition-transversion profiles and in situ target accessibility patterns. The different types of sequence associated information (SAI can be visualized by user defined background colors within the ARB primary and secondary structure editors as well as in the PROBE Match tool. Conclusion Using this tool, in silico probe design and evaluation can be performed with respect to in situ probe accessibility data. The evaluation of proposed probe targets with respect to higher-order rRNA structure is of importance for successful design and performance of in situ hybridization experiments. The entire ARB software package along with the probe accessibility data is available from the ARB home page

  4. Attachment sites of primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, Jan; Christiansen, Jan; Garrett, Roger Antony


    The attachment sites of the primary binding proteins L1, L2 and L23 on 23 S ribosomal RNA of Escherichia coli were examined by a chemical and ribonuclease footprinting method using several probes with different specificities. The results show that the sites are confined to localized RNA regions...... within the large ribonuclease-protected ribonucleoprotein fragments that were characterized earlier. They are as follows: 1. (1) L1 recognizes a tertiary structural motif in domain V centred on two interacting internal loops; the main protein interaction sites occur at the internal loop/helix junctions.2...

  5. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan


    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.


    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  6. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S;


    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  7. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA. (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R


    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA. PMID:22079365

  8. DsRNA-mediated targeting of ribosomal transcripts RPS6 and RPL26 induces long-lasting and significant reductions in fecundity of the vector Aedes aegypti. (United States)

    Estep, A S; Sanscrainte, N D; Becnel, J J


    Ribosomal transcripts produce critical proteins that are involved in most cellular production processes. Targeting ribosomal transcripts has produced mortality in mites and ticks but the effect of ribosomal transcript knockdown has not been thoroughly examined in mosquitoes. We examine the effects of triggers targeting four ribosomal proteins (RP) transcripts. Although no significant mortality was observed after dsRNA microinjection and subsequent blood feeding, significant contrasts were observed on fecundity. Triggers targeting RPS6 and RPL26 effectively reduced gene expression but more importantly, reduced reproductive output by more than 96% and 91% at the first oviposition while triggers targeting RPL1 and RPS2 did not cause a reduction although gene expression was reduced. Significantly reduced fecundity continued through a second oviposition cycle in dsRPS6 and dsRPL26 cohorts, although the effect was not as strong. Relative gene expression levels confirmed specific transcript knockdown up to 20days post-injection in mosquitoes that did not oviposit or produced reduced clutch sizes. Dissections at 36h post-blood meal indicated defects in oocyte provisioning. The strong phenotype produced by dsRPS6 allowed us to examine the effects in various tissues as well as the dose response, trigger format, delivery method and trigger specificity in Aedes aegypti. Strong knockdown was observed in the abdomen and the ovaries. Greater than 50ng of dsRPS6 significantly reduced fecundity but not when delivered in a sugar meal or as an siRNA. Similar bioassays with mutated dsRPS6 triggers indicates that up to three mismatches per possible siRNA are still effective in reducing fecundity. These studies indicate that while active and effective triggers can be developed for vector species, the lack of an efficient delivery method is the biggest barrier to use as a potential control method. PMID:27180677

  9. Expression of Ribosomal RNA and Protein Genes in Human Embryonic Stem Cells Is Associated With the Activating H3K4me3 Histone Mark. (United States)

    Zaidi, Sayyed K; Boyd, Joseph R; Grandy, Rodrigo A; Medina, Ricardo; Lian, Jane B; Stein, Gary S; Stein, Janet L


    Embryonic stem cells (ESCs) exhibit unrestricted and indefinite, but stringently controlled, proliferation, and can differentiate into any lineage in the body. In the current study, we test the hypothesis that expression of ribosomal RNA (rRNA) and ribosomal protein genes (RPGs) contribute to the ability of hESCs to proliferate indefinitely. Consistent with the accelerated growth rate of hESCs, we find that hESC lines H1 and H9 both exhibit significantly higher levels of rRNA when compared to a panel of normal and cancer human cell lines. Although many RPGs are expressed at levels that comparable to other human cell lines, a few RPGs also exhibit higher expression levels. In situ nuclear run-on assays reveal that both nucleoli in hESCs actively transcribe nascent rRNA. Employing genome-wide chromatin immunoprecipitation-deep sequencing and bioinformatics approaches, we discovered that, RPGs are dominantly marked by the activating H3K4me3 histone mark in the G1, M, and G2 phases of the cell cycle. Interestingly, the rDNA repeats are marked by the activating H3K4me3 only in the M phase, and repressive H3K27me3 histone mark in all three cell cycle phases. Bioinformatics analyses also reveal that Myc, a known regulator of cell growth and proliferation, occupies both the rRNA genes and RPGs. Functionally, down-regulation of Myc expression by siRNA results in a concomitant decrease in rRNA levels. Together, our results show that expression of rRNA, which is regulated by the Myc pluripotency transcription factor, and of RPGs in hESCs is associated with the activating H3K4me3 modification. J. Cell. Physiol. 231: 2007-2013, 2016. © 2016 Wiley Periodicals, Inc. PMID:26755341

  10. Ribosome recycling induces optimal translation rate at low ribosomal availability. (United States)

    Marshall, E; Stansfield, I; Romano, M C


    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  11. Purification and properties of a new ribosome-inactivating protein with RNA N-glycosidase activity suitable for immunotoxin preparation from the seeds of Momordica cochinchinensis. (United States)

    Bolognesi, A; Barbieri, L; Carnicelli, D; Abbondanza, A; Cenini, P; Falasca, A I; Dinota, A; Stirpe, F


    A ribosome-inactivating protein similar to those already known (Stirpe and Barbieri (1986) FEBS Lett. 195, 1-8) was purified from the seeds of Momordica cochinchinensis. This protein, for which the name of momorcochin-S is proposed, is a glycoprotein, has an Mr of approx. 30,000, and an alkaline isoelectric point and can be considered as an iso-form of the previously purified momorcochin from the roots of M. cochinchinensis. Momorcochin-S inhibits protein synthesis by a rabbit-reticulocyte lysate and phenylalanine polymerization by isolated ribosomes, and alters rRNA in a similar manner as the A-chain of ricin and related toxins (Endo et al. (1987) J. Biol. Chem. 262, 5908-5912). Momorcochin-S was linked to a monoclonal antibody (8A) against human plasma cells, and the resulting immunotoxin was selectively toxic to target cells. PMID:2597699

  12. Identification of the oligonucleotide and oligopeptide involved in an RNA-protein crosslink induced by ultraviolet irradiation of Escherichia coli 30 S ribosomal subunits

    International Nuclear Information System (INIS)

    When 30 S ribosomal subunits are irradiated with ultraviolet light, it has been found that an RNA-protein crosslinking reaction occurs whose primary target is protein S7. This paper describes the identification of the oligopeptide and oligonucleotide at the crosslinking point, by direct analysis (a) of the peptide remaining attached to an oligonucleotide (after total digestion of the RNA in the crosslinked complex with ribonucleases A and Tperpendicular, followed by digestion with trypsin), and (b) of the nucleotides remaining attached to the crosslinked protein (after digestion of the RNA in the complex with ribonuclease Tperpendicular alone). The crosslinking site was found to lie within a single short peptide, Ser-Met-Ala-Leu-Arg (positions 113 to 117 in the S7 sequence), with methionine as the probable amino acid concerned. The principal RNA site was found to lie within an oligonucleotide three to six bases long, the bracketed portion of the partially ordered sequence C-U-A-C-[A-A-U-G.G.C]-G in section P of the 16 S RNA. The methodology involved has been designed with a view to being generally applicable in future RNA-protein crosslinking studies, where several proteins are simultaneously attached to the RNA. (author)

  13. Exploring accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel at various steps of translation initiation. (United States)

    Sharifulin, Dmitri E; Bartuli, Yulia S; Meschaninova, Maria I; Ven'yaminova, Aliya G; Graifer, Dmitri M; Karpova, Galina G


    In this work, we studied how the accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel, ribosomal protein (rp) uS3 and helix (h) 16 of the 18S rRNA, changes upon the translation initiation. In particular, we examined the accessibility of rp uS3 for binding of unstructured RNAs and of riboses in h16 towards attack with benzoyl cyanide (BzCN) in complexes assembled in rabbit reticulocyte lysate utilizing synthetic oligoribonucleotides as well as full-length and truncated up to the initiation AUG codon hepatitis C virus IRES as model mRNAs. With both mRNA types, the rp uS3 peptide recognizing single-stranded RNAs was shown to become shielded only in those 48S preinitiation complexes (PICs) that contained eIF3j bound to 40S subunit in the area between the decoding site and the mRNA entry channel. Chemical probing with BzCN revealed that h16 in the 48S PICs containing eIF3j or scanning factor DHX29 is strongly shielded; the effect was observed with all the mRNAs used, and h16 remained protected as well in 80S post-initiation complexes lacking these factors. Altogether, the obtained results allowed us to suggest that eIF3j bound at the 48S PICs makes the rp uS3 inaccessible for binding of RNAs and this factor subunit is responsible for the decrease of h16 conformational flexibility; the latter is manifested as reduced accessibility of h16 to BzCN. Thus, our findings provide new insights into how eIF3j is implicated in ensuring the proper conformation of the mRNA entry channel, thereby facilitating mRNA loading. PMID:27346718

  14. The trp RNA-binding attenuation protein of Bacillus subtilis regulates translation of the tryptophan transport gene trpP (yhaG) by blocking ribosome binding. (United States)

    Yakhnin, Helen; Zhang, Hong; Yakhnin, Alexander V; Babitzke, Paul


    Expression of the Bacillus subtilis tryptophan biosynthetic genes (trpEDCFBA and pabA [trpG]) is regulated in response to tryptophan by TRAP, the trp RNA-binding attenuation protein. TRAP-mediated regulation of the tryptophan biosynthetic genes includes a transcription attenuation and two distinct translation control mechanisms. TRAP also regulates translation of trpP (yhaG), a single-gene operon that encodes a putative tryptophan transporter. Its translation initiation region contains triplet repeats typical of TRAP-regulated mRNAs. We found that regulation of trpP and pabA is unaltered in a rho mutant strain. Results from filter binding and gel mobility shift assays demonstrated that TRAP binds specifically to a segment of the trpP transcript that includes the untranslated leader and translation initiation region. While the affinities of TRAP for the trpP and pabA transcripts are similar, TRAP-mediated translation control of trpP is much more extensive than for pabA. RNA footprinting revealed that the trpP TRAP binding site consists of nine triplet repeats (five GAG, three UAG, and one AAG) that surround and overlap the trpP Shine-Dalgarno (S-D) sequence and translation start codon. Results from toeprint and RNA-directed cell-free translation experiments indicated that tryptophan-activated TRAP inhibits TrpP synthesis by preventing binding of a 30S ribosomal subunit. Taken together, our results establish that TRAP regulates translation of trpP by blocking ribosome binding. Thus, TRAP coordinately regulates tryptophan synthesis and transport by three distinct mechanisms: attenuation transcription of the trpEDCFBA operon, promoting formation of the trpE S-D blocking hairpin, and blocking ribosome binding to the pabA and trpP transcripts. PMID:14702295

  15. A key role for the mRNA leader structure in translational control of ribosomal protein S1 synthesis in γ-proteobacteria


    Tchufistova, Ludmila S.; Komarova, Anastassia V.; Boni, Irina V.


    The translation initiation region (TIR) of the Escherichia coli rpsA mRNA coding for ribosomal protein S1 is characterized by a remarkable efficiency in driving protein synthesis despite the absence of the canonical Shine–Dalgarno element, and by a strong and specific autogenous repression in the presence of free S1 in trans. The efficient and autoregulated E.coli rpsA TIR comprises not less than 90 nt upstream of the translation start and can be unambiguously folded into three irregular hair...

  16. The 5' leader of the mRNA encoding the mouse neurotrophin receptor TrkB contains two internal ribosomal entry sites that are differentially regulated.

    Directory of Open Access Journals (Sweden)

    Stephanie L Timmerman

    Full Text Available A single internal ribosomal entry site (IRES in conjunction with IRES transactivating factors (ITAFs is sufficient to recruit the translational machinery to a eukaryotic mRNA independent of the cap structure. However, we demonstrate that the mouse TrkB mRNA contains two independent IRESes. The mouse TrkB mRNA consists of one of two 5' leaders (1428 nt and 448 nt, both of which include the common 3' exon (Ex2, 344 nt. Dicistronic RNA transfections and in vitro translation of monocistronic RNA demonstrated that both full-length 5' leaders, as well as Ex2, exhibit IRES activity indicating the IRES is located within Ex2. Additional analysis of the upstream sequences demonstrated that the first 260 nt of exon 1 (Ex1a also contains an IRES. Dicistronic RNA transfections into SH-SY5Y cells showed the Ex1a IRES is constitutively active. However, the Ex2 IRES is only active in response to retinoic acid induced neural differentiation, a state which correlates with the synthesis of the ITAF polypyrimidine tract binding protein (PTB1. Correspondingly, addition or knock-down of PTB1 altered Ex2, but not Ex1a IRES activity in vitro and ex vivo, respectively. These results demonstrate that the two functionally independent IRESes within the mouse TrkB 5' leader are differentially regulated, in part by PTB1.

  17. The 5' leader of the mRNA encoding the mouse neurotrophin receptor TrkB contains two internal ribosomal entry sites that are differentially regulated. (United States)

    Timmerman, Stephanie L; Pfingsten, Jennifer S; Kieft, Jeffrey S; Krushel, Les A


    A single internal ribosomal entry site (IRES) in conjunction with IRES transactivating factors (ITAFs) is sufficient to recruit the translational machinery to a eukaryotic mRNA independent of the cap structure. However, we demonstrate that the mouse TrkB mRNA contains two independent IRESes. The mouse TrkB mRNA consists of one of two 5' leaders (1428 nt and 448 nt), both of which include the common 3' exon (Ex2, 344 nt). Dicistronic RNA transfections and in vitro translation of monocistronic RNA demonstrated that both full-length 5' leaders, as well as Ex2, exhibit IRES activity indicating the IRES is located within Ex2. Additional analysis of the upstream sequences demonstrated that the first 260 nt of exon 1 (Ex1a) also contains an IRES. Dicistronic RNA transfections into SH-SY5Y cells showed the Ex1a IRES is constitutively active. However, the Ex2 IRES is only active in response to retinoic acid induced neural differentiation, a state which correlates with the synthesis of the ITAF polypyrimidine tract binding protein (PTB1). Correspondingly, addition or knock-down of PTB1 altered Ex2, but not Ex1a IRES activity in vitro and ex vivo, respectively. These results demonstrate that the two functionally independent IRESes within the mouse TrkB 5' leader are differentially regulated, in part by PTB1. PMID:18779873

  18. Ribosomal P3 protein AtP3B of Arabidopsis acts as both protein and RNA chaperone to increase tolerance of heat and cold stresses. (United States)

    Kang, Chang Ho; Lee, Young Mee; Park, Joung Hun; Nawkar, Ganesh M; Oh, Hun Taek; Kim, Min Gab; Lee, Soo In; Kim, Woe Yeon; Yun, Dae-Jin; Lee, Sang Yeol


    The P3 proteins are plant-specific ribosomal P-proteins; however, their molecular functions have not been characterized. In a screen for components of heat-stable high-molecular weight (HMW) complexes, we isolated the P3 protein AtP3B from heat-treated Arabidopsis suspension cultures. By size-exclusion chromatography (SEC), SDS-PAGE and native PAGE followed by immunoblotting with anti-AtP3B antibody, we showed that AtP3B was stably retained in HMW complexes following heat shock. The level of AtP3B mRNA increased in response to both high- and low-temperature stresses. Bacterially expressed recombinant AtP3B protein exhibited both protein and RNA chaperone activities. Knockdown of AtP3B by RNAi made plants sensitive to both high- and low-temperature stresses, whereas overexpression of AtP3B increased tolerance of both conditions. Together, our results suggest that AtP3B protects cells against both high- and low-temperature stresses. These findings provide novel insight into the molecular functions and in vivo roles of acidic ribosomal P-proteins, thereby expanding our knowledge of the protein production machinery. PMID:27004478

  19. Non-FG mediated transport of the large pre-ribosomal subunit through the nuclear pore complex by the mRNA export factor Gle2. (United States)

    Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M; Kemmler, Stefan; Panse, Vikram G


    Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2's interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389

  20. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Directory of Open Access Journals (Sweden)

    Ghosh Sujit K


    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  1. Short hairpin RNA library-based functional screening identified ribosomal protein L31 that modulates prostate cancer cell growth via p53 pathway.

    Directory of Open Access Journals (Sweden)

    Yojiro Maruyama

    Full Text Available Androgen receptor is a primary transcription factor involved in the proliferation of prostate cancer cells. Thus, hormone therapy using antiandrogens, such as bicalutamide, is a first-line treatment for the disease. Although hormone therapy initially reduces the tumor burden, many patients eventually relapse, developing tumors with acquired endocrine resistance. Elucidation of the molecular mechanisms underlying endocrine resistance is therefore a fundamental issue for the understanding and development of alternative therapeutics for advanced prostate cancer. In the present study, we performed short hairpin RNA (shRNA-mediated functional screening to identify genes involved in bicalutamide-mediated effects on LNCaP prostate cancer cells. Among such candidate genes selected by screening using volcano plot analysis, ribosomal protein L31 (RPL31 was found to be essential for cell proliferation and cell-cycle progression in bicalutamide-resistant LNCaP (BicR cells, based on small interfering RNA (siRNA-mediated knockdown experiments. Of note, RPL31 mRNA is more abundantly expressed in BicR cells than in parental LNCaP cells, and clinical data from ONCOMINE and The Cancer Genome Altas showed that RPL31 is overexpressed in prostate carcinomas compared with benign prostate tissues. Intriguingly, protein levels of the tumor suppressor p53 and its targets, p21 and MDM2, were increased in LNCaP and BicR cells treated with RPL31 siRNA. We observed decreased degradation of p53 protein after RPL31 knockdown. Moreover, the suppression of growth and cell cycle upon RPL31 knockdown was partially recovered with p53 siRNA treatment. These results suggest that RPL31 is involved in bicalutamide-resistant growth of prostate cancer cells. The shRNA-mediated functional screen in this study provides new insight into the molecular mechanisms and therapeutic targets of advanced prostate cancer.



    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F.; Green, Rachel; Frank, Joachim


    A crucial step in protein translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunits is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and part...

  3. mRNA decay factor AUF1 binds the internal ribosomal entry site of enterovirus 71 and inhibits virus replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available AU-rich element binding factor 1 (AUF1 has a role in the replication cycles of different viruses. Here we demonstrate that AUF1 binds the internal ribosome entry site (IRES of enterovirus 71 (EV71 and negatively regulates IRES-dependent translation. During EV71 infection, AUF1 accumulates in the cytoplasm where viral replication occurs, whereas AUF1 localizes predominantly in the nucleus in mock-infected cells. AUF1 knockdown in infected cells increases IRES activity and synthesis of viral proteins. Taken together, the results suggest that AUF1 interacts with the EV71 IRES to negatively regulate viral translation and replication.

  4. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly


    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G.


    eLife digest The production of a protein in a cell starts with a region of DNA being transcribed to produce a molecule of messenger RNA. A large molecular machine called ribosome then reads the information in the messenger RNA molecule to produce a protein. Ribosomes themselves are made of RNA and several different proteins called r-proteins. The construction of a ribosome starts with the assembly of a pre-ribosome inside the cell nucleus, and the ribosome is completed in the cytosol of the c...

  5. Characterization of Aquifex aeolicus ribonuclease III and the reactivity epitopes of its pre-ribosomal RNA substrates


    Shi, Zhongjie; Nicholson, Rhonda H.; Jaggi, Ritu; Nicholson, Allen W.


    Ribonuclease III cleaves double-stranded (ds) structures in bacterial RNAs and participates in diverse RNA maturation and decay pathways. Essential insight on the RNase III mechanism of dsRNA cleavage has been provided by crystallographic studies of the enzyme from the hyperthermophilic bacterium, Aquifex aeolicus. However, the biochemical properties of A. aeolicus (Aa)-RNase III and the reactivity epitopes of its substrates are not known. The catalytic activity of purified recombinant Aa-RNa...

  6. The Escherichia coli OxyS regulatory RNA represses fhlA translation by blocking ribosome binding.


    Altuvia, S; Zhang, A.; Argaman, L; Tiwari, A; Storz, G.


    OxyS is a small untranslated RNA which is induced in response to oxidative stress in Escherichia coli. This novel RNA acts as a global regulator to activate or repress the expression of as many as 40 genes, including the fhlA-encoded transcriptional activator and the rpoS-encoded sigma(s) subunit of RNA polymerase. Deletion analysis of OxyS showed that different domains of the small RNA are required for the regulation of fhlA and rpoS. We examined the mechanism of OxyS repression of fhlA and ...

  7. Repair of UV induced DNA lesions in ribosomal gene chromatin and the role of "Odd" RNA polymerases (I and III). (United States)

    Charton, Romain; Guintini, Laetitia; Peyresaubes, François; Conconi, Antonio


    In fast growing eukaryotic cells, a subset of rRNA genes are transcribed at very high rates by RNA polymerase I (RNAPI). Nuclease digestion-assays and psoralen crosslinking have shown that they are open; that is, largely devoid of nucleosomes. In the yeast Saccharomyces cerevisae, nucleotide excision repair (NER) and photolyase remove UV photoproducts faster from open rRNA genes than from closed and nucleosome-loaded inactive rRNA genes. After UV irradiation, rRNA transcription declines because RNAPI halt at UV photoproducts and are then displaced from the transcribed strand. When the DNA lesion is quickly recognized by NER, it is the sub-pathway transcription-coupled TC-NER that removes the UV photoproduct. If dislodged RNAPI are replaced by nucleosomes before NER recognizes the lesion, then it is the sub-pathway global genome GG-NER that removes the UV photoproducts from the transcribed strand. Also, GG-NER maneuvers in the non-transcribed strand of open genes and in both strands of closed rRNA genes. After repair, transcription resumes and elongating RNAPI reopen the rRNA gene. In higher eukaryotes, NER in rRNA genes is inefficient and there is no evidence for TC-NER. Moreover, TC-NER does not occur in RNA polymerase III transcribed genes of both, yeast and human fibroblast. PMID:26411875

  8. Visualization of the hybrid state of tRNA binding promoted by spontaneous ratcheting of the ribosome. (United States)

    Agirrezabala, Xabier; Lei, Jianlin; Brunelle, Julie L; Ortiz-Meoz, Rodrigo F; Green, Rachel; Frank, Joachim


    A crucial step in translation is the translocation of tRNAs through the ribosome. In the transition from one canonical site to the other, the tRNAs acquire intermediate configurations, so-called hybrid states. At this stage, the small subunit is rotated with respect to the large subunit, and the anticodon stem loops reside in the A and P sites of the small subunit, while the acceptor ends interact with the P and E sites of the large subunit. In this work, by means of cryo-EM and particle classification procedures, we visualize the hybrid state of both A/P and P/E tRNAs in an authentic factor-free ribosome complex during translocation. In addition, we show how the repositioning of the tRNAs goes hand in hand with the change in the interplay between S13, L1 stalk, L5, H68, H69, and H38 that is caused by the ratcheting of the small subunit. PMID:18951087

  9. Identification and characterization of anaerobic gut fungi using molecular methodologies based on ribosomal ITS1 and 185 rRNA. (United States)

    Brookman, J L; Mennim, G; Trinci, A P; Theodorou, M K; Tuckwell, D S


    The gut fungi are an unusual group of zoosporic fungi occupying a unique ecological niche, the anaerobic environment of the rumen. They exhibit two basic forms, with nuclear migration throughout the hyphal mass for polycentric species and with concentration of nuclear material in a zoosporangium for monocentric species. Differentiation between isolates of these fungi is difficult using conventional techniques. In this study, DNA-based methodologies were used to examine the relationships within and between two genera of monocentric gut fungi gathered from various geographical locations and host animals. The ribosomal ITS1 sequence from 16 mono- and 4 polycentric isolates was PCR-amplified and sequenced; the sequences obtained were aligned with published sequences and phylogenetic analyses were performed. These analyses clearly differentiate between the two genera and reflect the previously published physiological conclusions that Neocallimastix spp. constitute a more closely related genus than the relatively divergent genus Piromyces. The analyses place two type species N. frontalis and N. hurleyensis together but, contrary to a recent suggestion in the literature, place them apart from the other agreed species N. patriciarum. In situ hybridization and slot-blotting were investigated as potential methods for detection of and differentiation between monocentric gut fungi. DNA slot-blot analysis using ribosomal sequences is able to differentiate between gut fungal genera and thus has considerable potential for use in ecological studies of these organisms. PMID:10708378

  10. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal


    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  11. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L


    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  12. Mutation detection analysis of a region of 16S-like ribosomal RNA gene of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii

    Directory of Open Access Journals (Sweden)

    Khairnar Krishna


    Full Text Available Abstract Background The level of intra-species genetic variation in Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii populations in a localized geographic area, like Puducherry, India, remains unknown. Methods In the present study the existence of genetic variation in the nested multiplex polymerase chain reaction (NM-PCR amplified region of the 16S-like ribosomal RNA genes of E. histolytica, E. dispar and E. moshkovskii was investigated by riboprinting and single strand conformation polymorphism (SSCP analysis. Results We found that 70 stool specimens were positive for E. histolytica, 171 stool specimens were positive for E. dispar, and 37 stool specimens were positive for E. moshkovskii by NM-PCR. Ninety liver abscess pus specimens, 21 urine specimens, and 8 saliva specimens were positive for E. histolytica by NM-PCR. Riboprinting analysis detected a mutation in the PCR product of only one E. histolytica isolate from a stool specimen. However, SSCP analysis detected mutations in the PCR products of five E. histolytica isolates and three E. moshkovskii isolates from stool specimens, and one E. histolytica isolate from a saliva specimen. The mutations detected by riboprinting and SSCP analysis were confirmed by sequencing. All the nucleotide sequences showing mutations in this study have already been deposited into the NCBI GenBank database under accession numbers [GenBank: EF682200 to GenBank: EF682208]. Conclusion The present study has revealed the subsistence of mutations in the ribosomal RNA genes of E. histolytica and E. moshkovskii, which points towards the existence of intra-species genetic variation in E. histolytica and E. moshkovskii isolates infecting humans.

  13. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)


    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  14. Population-level study of ribosomal RNA genes expression in Tragopogon allotetraplopids of recent and recurrent origin

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Matyášek, Roman; Tate, J. A.; Šrubařová, Hana; Yoong, K.Y.; Leitch, A.R.; Soltis, D.E.; Soltis, P.E.

    Prague, 2006. [Groupe Cytogenetique et polyploidie. 05.04.2006-07.04.2006, Bordeaux] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA * Tragopogon * allotetraploids Subject RIV: BO - Biophysics

  15. Molecular paleontology: a biochemical model of the ancestral ribosome


    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov


    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  16. Structural and Functional Characterization of Programmed Ribosomal Frameshift Signals in West Nile Virus Strains Reveals High Structural Plasticity Among cis-Acting RNA Elements. (United States)

    Moomau, Christine; Musalgaonkar, Sharmishtha; Khan, Yousuf A; Jones, John E; Dinman, Jonathan D


    West Nile virus (WNV) is a prototypical emerging virus for which no effective therapeutics currently exist. WNV uses programmed -1 ribosomal frameshifting (-1 PRF) to synthesize the NS1' protein, a C terminally extended version of its non-structural protein 1, the expression of which enhances neuro-invasiveness and viral RNA abundance. Here, the NS1' frameshift signals derived from four WNV strains were investigated to better understand -1 PRF in this quasispecies. Sequences previously predicted to promote -1 PRF strongly promote this activity, but frameshifting was significantly more efficient upon inclusion of additional 3' sequence information. The observation of different rates of -1 PRF, and by inference differences in the expression of NS1', may account for the greater degrees of pathogenesis associated with specific WNV strains. Chemical modification and mutational analyses of the longer and shorter forms of the -1 PRF signals suggests dynamic structural rearrangements between tandem stem-loop and mRNA pseudoknot structures in two of the strains. A model is suggested in which this is employed as a molecular switch to fine tune the relative expression of structural to non-structural proteins during different phases of the viral replication cycle. PMID:27226636

  17. Human Mitochondrial Ribosomal Protein MRPL12 Interacts Directly with Mitochondrial RNA Polymerase to Modulate Mitochondrial Gene Expression*


    Wang, Zhibo; Cotney, Justin; Shadel, Gerald S.


    The core human mitochondrial transcription machinery comprises a single subunit bacteriophage-related RNA polymerase, POLRMT, the high mobility group box DNA-binding protein h-mtTFA/TFAM, and two transcriptional co-activator proteins, h-mtTFB1 and h-mtTFB2 that also have rRNA methyltransferase activity. Recapitulation of specific initiation of transcription in vitro can be achieved by a complex of POLRMT, h-mtTFA, and either h-mtTFB1 or h-mtTFB2. However, the nature of mitochondrial transcrip...

  18. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA


    Milos Patrice; Reaman Gregory; Sorensen Poul HB; Reynolds C Patrick; Ozsolak Fatih; Raz Tal; St Laurent Georges; Kapranov Philipp; Arceci Robert J; Thompson John F; Triche Timothy J


    Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial...

  19. A Step Subsequent to Preinitiation Complex Assembly at the Ribosomal RNA Gene Promoter Is Rate Limiting for Human RNA Polymerase I-Dependent Transcription


    Panov, Kostya I.; Friedrich, J. Karsten; Zomerdijk, Joost C. B. M.


    The assembly, disassembly, and functional properties of transcription preinitiation complexes (PICs) of human RNA polymerase I (Pol I) play a crucial role in the regulation of rRNA gene expression. To study the factors and processes involved, an immobilized-promoter template assay has been developed that allows the isolation from nuclear extracts of functional PICs, which support accurate initiation of transcription. Immunoblotting of template-bound factors showed that these complexes contain...

  20. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Directory of Open Access Journals (Sweden)

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  1. The economics of ribosome biosynthesis in yeast. (United States)

    Warner, J R


    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  2. 16S ribosomal RNA-based methods to monitor changes in the hindgut bacterial community of piglets after oral administration of Lactobacillus sobrius S1. (United States)

    Su, Yong; Yao, Wen; Perez-Gutierrez, Odette N; Smidt, Hauke; Zhu, Wei-Yun


    16S ribosomal RNA (rRNA) gene based PCR/denaturing gradient gel electrophoresis (DGGE) and real-time PCR were used to monitor the changes in the composition of microbiota in the hindgut of piglets after oral administration of Lactobacillus sobrius S1. Six litters of neonatal piglets were divided randomly into control group and treatment group. At 7, 9, and 11 days of age, piglets in the treatment group orally received a preparation of L. sobrius S1. At 7, 14, 21(weaning), 24, and 35 days of age, one piglet from each litter was sacrificed and digesta samples of hindgut were collected. DGGE analysis of 16S rRNA gene V6-V8 region for all bacteria showed that several populations present in the hindgut of piglets, represented by far-migrating bands, disappeared after weaning. Most of these bands corresponded to Lactobacillus spp. as revealed by sequence analysis. Quantitative real-time PCR specific for lactobacilli further demonstrated that the number of lactobacilli population tended to decrease after the piglets were weaned. Drastic changes of L. amylovorus and L. sobrius in total Lactobacillus populations were also observed in the colon of piglets around weaning, as monitored by 16S rRNA gene V2-V3 region based Lactobacillus-specific PCR-DGGE. Species-specific real-time PCR also revealed that the population of L. sobrius declined apparently in the colon of piglets after weaning. No remarkable changes in the overall microbial community in the hindgut were found between control and treatment groups. However, comparison of DGGE profiles between the two groups revealed a specific band related to Clostridium disporicum that was found in treatment group on day 14. On day 35, a specific band appeared only in the control group, representing a population most closely related to Streptococcus suis (99%). Real-time PCR showed that L. sobrius 16S rRNA gene copies in treatment group were relatively higher than in the control group (10(8.45) vs. 10(6.83)) on day 35, but no

  3. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients. (United States)

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D


    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  4. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA in the Asteraceae family

    Directory of Open Access Journals (Sweden)

    Garcia Sònia


    Full Text Available Abstract Background In flowering plants and animals the most common ribosomal RNA genes (rDNA organisation is that in which 35S (encoding 18S-5.8S-26S rRNA and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae, a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing, gene copy number (quantitative PCR and chromosomal position (FISH of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases, tribe Gnaphalieae (100% and in the "Heliantheae alliance" (23%. The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic

  5. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    DEFF Research Database (Denmark)

    Douthwaite, S; Aagaard, C


    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  6. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar


    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  7. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA

    Czech Academy of Sciences Publication Activity Database

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr


    Roč. 46, č. 2 (2014), s. 147-156. ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA ČR(CZ) GPP305/12/P388; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : 5S-rRNA * mitochondrial DNA * nucleic acid import into mitochondria * fluorescent in vivo hybridization of mtDNA * mitochondrial nucleoids Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.212, year: 2014

  8. Ribosome engineering to promote new crystal forms

    International Nuclear Information System (INIS)

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  9. Biological activities of some Acacia spp. (Fabaceae) against new clinical isolates identified by ribosomal RNA gene-based phylogenetic analysis. (United States)

    Mahmoud, Mahmoud Fawzy; Alrumman, Sulaiman Abdullah; Hesham, Abd El-Latif


    Nowadays,most of the pathogenic bacteria become resistant to antibiotics. Therefore,the pharmaceutical properties of the natural plant extracts have become of interest to researchers as alternative antimicrobial agents. In this study,antibacterial activities of extract gained from Acacia etbaica, Acacia laeta, Acacia origena and Acacia pycnantha have been evaluated against isolated pathogenic bacteria (Strains MFM-01, MFM-10 and AH-09) using agar well diffusion methods.The bacterial strains were isolated from infected individuals,and their exact identification was detected on the basis of 16S rRNA gene amplification and sequence determination. Alignment results and the comparison of 16 SrRN A gene sequences of the isolates to 16 SrRN A gene sequences available in Gen Bank data base as well as the phylogenetic analysis confirmed the accurate position of the isolates as Klebsiella oxytoca strain MFM-01, Staphylococcus aureus strain MFM-10 and Klebsiella pneumoniae strain AH-09. Except for cold water, all tested solvents (Chloroform, petroleum ether, methanol, diethyl ether, and acetone) showed variation in their activity against studied bacteria. GC-MS analysis of ethanol extracts showed that four investigated Acacia species have different phyto components. Eight important pharmaceutical components were found in the legume of Acacia etbaica, seven in the legume of Acacia laeta, fifteen in the legume of Acacia origena and nine in the leaves of Acacia pycnantha. A dendrogram was constructed based on chemical composition, revealed that Acacia laeta is more closely related to Acacia etbaica forming on eclade, whereas Acacia origena less similar to other species. Our results demonstrated that, investigated plants and chemical compounds present could be used as promising antibacterial agents. PMID:26826814

  10. Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold.

    Directory of Open Access Journals (Sweden)

    Anna V Lomonosova

    Full Text Available Due to their remarkably high structural stability, proteins from extremophiles are particularly useful in numerous biological applications. Their utility as alternative protein scaffolds could be especially valuable in small antibody mimetic engineering. These artificial binding proteins occupy a specific niche between antibodies and low molecular weight substances, paving the way for development of innovative approaches in therapeutics, diagnostics, and reagent use. Here, the 50S ribosomal RNA-binding protein L35Ae from the extremophilic archaea Pyrococcus horikoshii has been probed for its potential to serve as a backbone in alternative scaffold engineering. The recombinant wild type L35Ae has a native-like secondary structure, extreme thermal stability (mid-transition temperature of 90°C and a moderate resistance to the denaturation by guanidine hydrochloride (half-transition at 2.6 M. Chemical crosslinking and dynamic light scattering data revealed that the wild type L35Ae protein has a propensity for multimerization and aggregation correlating with its non-specific binding to a model cell surface of HEK293 cells, as evidenced by flow cytometry. To suppress these negative features, a 10-amino acid mutant (called L35Ae 10X was designed, which lacks the interaction with HEK293 cells, is less susceptible to aggregation, and maintains native-like secondary structure and thermal stability. However, L35Ae 10X also shows lowered resistance to guanidine hydrochloride (half-transition at 2.0M and is more prone to oligomerization. This investigation of an extremophile protein's scaffolding potential demonstrates that lowered resistance to charged chemical denaturants and increased propensity to multimerization may limit the utility of extremophile proteins as alternative scaffolds.

  11. Cell-specific precursor processing

    DEFF Research Database (Denmark)

    Rehfeld, Jens F; Bundgaard, Jens R


    The singular gene for a peptide hormone is expressed not only in a specific endocrine cell type but also in other endocrine cells as well as in entirely different cells such as neurons, adipocytes, myocytes, immune cells, and cells of the sex-glands. The cellular expression pattern for each gene...... varies with development, time and species. Endocrine regulation is, however, based on the release of a given hormone from an endocrine cell to the general circulation from whose cappilaries the hormone reaches the specific target cell elsewhere in the body. The widespread expression of hormone genes in...... different cells and tissues therefore requires control of biogenesis and secretion in order to avoid interference with the function of a specific hormonal peptide from a particular endocrine cell. Several mechanisms are involved in such control, one of them being cell-specific processing of prohormones. The...

  12. Ribosome dynamics and the evolutionary history of ribosomes (United States)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.


    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  13. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  14. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein. (United States)

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati


    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  15. Structural and functional topography of the human ribosome

    Institute of Scientific and Technical Information of China (English)

    Dmitri Graifer; Galina Karpova


    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  16. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen (1H) for deuterium (2H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.)

  17. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    Koji Tamura


    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  18. Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

    Directory of Open Access Journals (Sweden)

    Ulrich Andergassen


    Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

  19. Profiling of 2'-O-Me in human rRNA reveals a subset of fractionally modified positions and provides evidence for ribosome heterogeneity

    DEFF Research Database (Denmark)

    Krogh, Nicolai; Jansson, Martin D; Häfner, Sophia J; Tehler, Disa; Birkedal, Ulf; Christensen-Dalsgaard, Mikkel; Lund, Anders H; Nielsen, Henrik


    the level of RNA modifications. A comparison to HCT116 cells reveals similar 2'-O-Me profiles with distinct differences at several sites. This study constitutes the first comprehensive mapping of 2'-O-Me sites in human rRNA using a high throughput sequencing approach. It establishes the existence of a...

  20. Identification and assignment of base pairs in four helical segments of Bacillus megaterium ribosomal 5S RNA and its ribonuclease T1 cleavage fragments by means of 500-MHz proton homonuclear Overhauser enhancements

    International Nuclear Information System (INIS)

    Three different fragments of Bacillus megaterium ribosomal 5S RNA have been produced by enzymatic cleavage with ribonuclease T1. Fragment A consists of helices II and III, fragment B contains helix IV, and fragment C contains helix I of the universal 5S rRNA secondary structure. All (eight) imino proton resonances in the downfield region (9-15 ppm) of the 500-MHz proton FT NMR spectrum of fragment B have been identified and assigned as G80·C92·G81·C91-G82·C90-A83·U89-C84·G88 and three unpaired U's in helix IV by proton homonuclear Overhauser enhancement connectivities. The secondary structure in helix IV of the prokaryotic loop is completely demonstrated spectroscopically for the first time in any native or enzyme-cleaved 5S rRNA. In addition, G21·C58-A20·U59-G19·C60-A18·U61 in helix II, U32·A46-G31·C47-C30·G48-C29·G49 in helix III, and G4·C112-G5·C111-U6·G110 in the terminal stem (helix I) have been assigned by means of NOE experiments on intact 5S rRNA and its fragments A and C. Base pairs in helices I-IV of the universal secondary structure of B. megaterium 5S RNA are described

  1. Ribosome Mechanics Informs about Mechanism. (United States)

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L


    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  2. The circadian clock coordinates ribosome biogenesis.

    Directory of Open Access Journals (Sweden)

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  3. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus


    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  4. Ribosome-dependent activation of stringent control. (United States)

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V


    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  5. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly


    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya


    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role...

  6. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA

    Indian Academy of Sciences (India)

    Ankita Srivastava; Alok Bhattacharya; Sudha Bhattacharya; Gagan Deep Jhingan


    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  7. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA. (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep


    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica. PMID:26949087

  8. Amplification of 16S ribosomal RNA genes of autotrophic ammonia-oxidizing bacteria demonstrates the ubiquity of nitrosospiras in the environment. (United States)

    Hiorns, W D; Hastings, R C; Head, I M; McCarthy, A J; Saunders, J R; Pickup, R W; Hall, G H


    Oligonucleotide sequences selected from the 16S rRNA genes of various species of ammonia-oxidizing bacteria were evaluated as specific PCR amplification primers and probes. The specificities of primer pairs for eubacterial, Nitrosospira and Nitrosomonas rRNA genes were established with sequence databases, and the primer pairs were used to amplify DNA from laboratory cultures and environmental samples. Eubacterial rRNA genes amplified from samples of soil and activated sludge hybridized with an oligonucleotide probe specific for Nitrosospira spp., but not with a Nitrosomonas-specific probe. Lakewater and sediment samples were analysed using a nested PCR technique in which eubacterial rRNA genes were subjected to a secondary amplification with Nitrosomonas or Nitrosospira specific primers. Again, the presence of Nitrosospira DNA, but not Nitrosomonas DNA, was detected and this was confirmed by hybridization of the amplified DNA with an internal oligonucleotide probe. Enrichments of lakewater and sediment samples, incubated for two weeks in the presence of ammonium, produced nitrite and were found to contain DNA from both Nitrosospira and Nitrosomonas as determined by nested PCR amplification and probing of 16S rRNA genes. This demonstrates that Nitrosospira spp. are widespread in the environment. The implications of the detection of Nitrosomonas DNA only after enrichment culture are discussed. PMID:8535507

  9. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome


    Prokhorova, Irina V.; Akulich, Kseniya A.; Desislava S. Makeeva; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Gulnara Yusupova; Yusupov, Marat M; Dmitriev, Sergey E


    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a ...

  10. Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction


    Fritz, Brian R; Jamil, Osman K.; Jewett, Michael C


    In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolec...

  11. Ribosomal crystallography: peptide bond formation and its inhibition. (United States)

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada


    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  12. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  13. Regulation of ribosome biogenesis in maize embryonic axes during germination. (United States)

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J


    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  14. 利用线粒体16S rRNA 基因全序列分析直翅目主要类群的系统发生关系%Phylogenetic relationships among Orthoptera insect groups based on complete sequences of 16S ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    崔爱明; 黄原


    In order to reconstruct a robust phylogenetic relationship among major groups of Orthoptera and to explore the phylogenetic utility and performance of 16S Ribosomal RNA gene, complete sequences of 16S Ribosomal RNA were sequenced from 18 species in 9 families and 4 superfamilies of Orthoptera, and analyzed with other 40 species that have been completely sequenced. The result showed that the average length of 16S Ribosomal RNA was 1 310 bp. The positions of Tridactuloidea and Gryllotalpidae in Orthoptera were uncertain based on the 16S rRNA data, and the phylogenetic relationships of other major groups in Orthoptera were rather robust. Except for Oedipodidae and Gomphoceridae, Acrididae, Catantopidae, and Arcypteridae in Xia's taxonomic system were not monophyletic groups, and the genetic distances among the five groups were small. This indicates that the five families should be combined into one family. The genetic distances among Pamphagidae, Chrotogonidae, and Pyigomorphidae were also small. The loops of 16S rRNA gene could provide more information than stems when they were used for phylogenetic analysis. Complete sequence of 16S rRNA gene can be used to reconstruct robust phylogenetic relationship at the taxonomic category of species, genera, and suborder in Orthop-tera, but lack of resolution at family and superfamily levels.%为了构建稳健的直翅目主要类群间的系统发生关系并探讨16S rRNA 基因序列在构建直翅目昆虫不同分类阶元系统发生关系时的可行性、功效以及性能,文章测定了直翅目4 总科9 科18 种昆虫的16S rRNA 基因全序列,联合已知该基因全序列的其他40 种昆虫,构建了直翅目主要类群之间的系统发生关系,并分析了16S rRNA 基因全序列的系统发生性能和功效.结果表明,直翅目昆虫的16S rRNA 基因全长平均为1 310 bp; 除生活方式特化的蚤蝼总科和蝼蛄总科的地位无法确定外,直翅目其他主要类群

  15. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef


    I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...

  16. Cell-specific differences in the requirements for translation quality control


    Reynolds, Noah M.; Ling, Jiqiang; Roy, Hervé; Banerjee, Rajat; Repasky, Sarah E.; Hamel, Patrice; Ibba, Michael


    Protein synthesis has an overall error rate of approximately 10-4 for each mRNA codon translated. The fidelity of translation is mainly determined by two events: synthesis of cognate amino acid:tRNA pairs by aminoacyl-tRNA synthetases (aaRSs) and accurate selection of aminoacyl-tRNAs (aa-tRNAs) by the ribosome. To ensure faithful aa-tRNA synthesis, many aaRSs employ a proofreading (“editing”) activity, such as phenylalanyl-tRNA synthetases (PheRS) that hydrolyze mischarged Tyr-tRNAPhe. Eukary...

  17. Phylogenetic Relationships of the Marine Haplosclerida (Phylum Porifera) Employing Ribosomal (28S rRNA) and Mitochondrial (cox1, nad1) Gene Sequence Data


    Redmond, Niamh E.; Jean Raleigh; Van Soest, Rob W.M.; Michelle Kelly; Travers, Simon A A; Brian Bradshaw; Salla Vartia; Kelly M Stephens; McCormack, Grace P.


    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, ...

  18. Mitochondrial-encoded membrane protein transcripts are pyrimidine-rich while soluble protein transcripts and ribosomal RNA are purine-rich

    Directory of Open Access Journals (Sweden)

    Samuels David C


    Full Text Available Abstract Background Eukaryotic organisms contain mitochondria, organelles capable of producing large amounts of ATP by oxidative phosphorylation. Each cell contains many mitochondria with many copies of mitochondrial DNA in each organelle. The mitochondrial DNA encodes a small but functionally critical portion of the oxidative phosphorylation machinery, a few other species-specific proteins, and the rRNA and tRNA used for the translation of these transcripts. Because the microenvironment of the mitochondrion is unique, mitochondrial genes may be subject to different selectional pressures than those affecting nuclear genes. Results From an analysis of the mitochondrial genomes of a wide range of eukaryotic species we show that there are three simple rules for the pyrimidine and purine abundances in mitochondrial DNA transcripts. Mitochondrial membrane protein transcripts are pyrimidine rich, rRNA transcripts are purine-rich and the soluble protein transcripts are purine-rich. The transitions between pyrimidine and purine-rich regions of the genomes are rapid and are easily visible on a pyrimidine-purine walk graph. These rules are followed, with few exceptions, independent of which strand encodes the gene. Despite the robustness of these rules across a diverse set of species, the magnitude of the differences between the pyrimidine and purine content is fairly small. Typically, the mitochondrial membrane protein transcripts have a pyrimidine richness of 56%, the rRNA transcripts are 55% purine, and the soluble protein transcripts are only 53% purine. Conclusion The pyrimidine richness of mitochondrial-encoded membrane protein transcripts is partly driven by U nucleotides in the second codon position in all species, which yields hydrophobic amino acids. The purine-richness of soluble protein transcripts is mainly driven by A nucleotides in the first codon position. The purine-richness of rRNA is also due to an abundance of A nucleotides. Possible

  19. Ligation-free ribosome profiling of cell type-specific translation in the brain


    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A


    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome...

  20. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome


    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns


    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of rib...

  1. Immunomodulation by microbial ribosomes

    Directory of Open Access Journals (Sweden)

    W. Domzig


    Full Text Available Over the past twenty years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of microorganisms responsible for human and animal diseases. More recently, using monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice, we have studied the mechanism of the protection induced by ribosomes. These studies, in parallel with the development of a technology for the large scale production of ribosomes, have allowed us to achieve a new regard for ribosomal vaccines for use in human. The general concept of ribosomal vaccines in presented and examples of two such vaccines are described with data on the specific protection that they induce in mice against experimental infections with Klebsiella peneumoniae, Streptococcus pneumoniae, S. pyogenes and Haemophilus influenzae for the first one, and against Candida albicans type A and type B for the second one. Because of their high immunogenicity and their innocuity these vaccines represent a decisive improvement over classical microbial vaccines.

  2. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data. (United States)

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P


    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here. PMID:21931685

  3. Cdc42-mediated tubulogenesis controls cell specification

    DEFF Research Database (Denmark)

    Kesavan, Gokul; Sand, Fredrik Wolfhagen; Greiner, Thomas Uwe;


    Understanding how cells polarize and coordinate tubulogenesis during organ formation is a central question in biology. Tubulogenesis often coincides with cell-lineage specification during organ development. Hence, an elementary question is whether these two processes are independently controlled...... later for maintaining apical cell polarity. Finally, we show that Cdc42 controls cell specification non-cell-autonomously by providing the correct microenvironment for proper control of cell-fate choices of multipotent progenitors. For a video summary of this article, see the PaperFlick file with the......, or whether proper cell specification depends on formation of tubes. To address these fundamental questions, we have studied the functional role of Cdc42 in pancreatic tubulogenesis. We present evidence that Cdc42 is essential for tube formation, specifically for initiating microlumen formation and...

  4. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Institute of Scientific and Technical Information of China (English)

    Inderdeep Kaur; R C Gupta; Munish Puri


    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  5. Wide genetic variations at 18S ribosomal RNA locus of Cyclospora cayetanensis isolated from Egyptian patients using high resolution melting curve. (United States)

    Hussein, Eman M; El-Moamly, Amal A; Mahmoud, Moushira A; Ateek, Nayera S


    A variable clinical picture of cyclosporiasis including gastrointestinal tract (GIT) symptomatic or asymptomatic beside extraintestinal consequences suggests a possibility of heterogenicity of Cyclospora cayetanensis. The present work aimed to explore the possibility of genetic variation of C. cayetanensis using high-resolution melting (HRM) curve of polymerase chain reaction (PCR) amplified 18S rRNA genes. DNAs extracted from the stool samples of 70 cyclosporiasis patients were amplified and scanned by PCR/HRM curve. The results showed that there are four different genotypic profiles of C. cayetanensis with presence of mixed ones. Although Tm of all profiles was within the same range, they were discerned by plotting of the temperature-shifted florescence difference between normalized melting curves (dF/dT). Genotypic profile I was found alone in 40 % of patients and mixed with genotypic profile II and/or III in 25.7 % of patients, followed by genotypic profile II in 14.3 % then genotypic profile III and IV (10 % each). A significant relation was found between genotypic profiles and GIT symptomatic status as profile I and profile II were mostly detected in patients with acute GIT symptoms without or with chronic illness, respectively, while profile IV cases only were GIT asymptomatic. Statistical significance relations between genotypic profiles and age, gender, residence and oocyst shape index were determined. In conclusion, PCR/HRM proved a wide variation on C. cayetanensis genes that could be reflected on its pathogenic effects and explaining the variability of the clinical manifestations presented by cyclosporiasis patients. PMID:27041342

  6. Epidemiology of sporadic (non-epidemic) cases of Trichophyton tonsurans infection in Japan based on PCR-RFLP analysis of non-transcribed spacer region of ribosomal RNA gene. (United States)

    Mochizuki, Takashi; Kawasaki, Masako; Anzawa, Kazushi; Fujita, Jun; Ushigami, Tsuyoshi; Takeda, Kiminobu; Sano, Ayako; Takahashi, Yoko; Kamei, Katsuhiko


    A number of cases of Trichophyton tonsurans infection have been reported among sportsmen and women participating in wrestling, judo, and sumo wrestling in Japan, but there have also been sporadic reports of cases with no history of contact with these sports. A molecular method using restriction enzyme analysis of PCR-amplified fragments targeting the non-transcribed spacer region (NTS) of ribosomal RNA gene in fungal nuclei was applied to T. tonsurans strains isolated from sporadic cases in Japan. Five of 6 molecular types recorded in Japan, i.e., NTS types I, II, IV, V, and VI, and two new types, designated NTS VII and NTS VIII, were observed among 10 strains isolated from sporadic cases. The NTS IV strains, considered not to be related to the present epidemic, were found to be the most prevalent molecular type accounting for 4 of the 10 strains isolated. NTS I was the most prevalent type in the current epidemic in Japan, but it was cultured from only one patient who was later noted to be the daughter of a retired judo practitioner. Four subjects had histories of living abroad and were considered to have been infected outside Japan. The strains in these cases were NTS II, V, VI, and VII. The results of this study suggested that the NTS IV strains were originally present in Japan at a low incidence, but that there has been a recent influx of NTS I, II, V, VI, and VII from abroad, which has been accompanied by the secondary spread of strains from wrestlers and practitioners of martial arts to the general community. PMID:18503175

  7. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC


    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  8. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F


    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  9. The Ribosome Comes Alive


    Frank, Joachim


    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as t...

  10. The Ribosome Comes Alive. (United States)

    Frank, Joachim


    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  11. Chaperoning ribosome assembly


    Karbstein, Katrin


    Chaperones help proteins fold in all cellular compartments, and many associate directly with ribosomes, capturing nascent chains to assist their folding and prevent aggregation. In this issue, new data from Koplin et al. (2010. J. Cell Biol. doi: 10.1083/jcb.200910074) and Albanèse et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201001054) suggest that in addition to promoting protein folding, the chaperones ribosome-associated complex (RAC), nascent chain–associated complex (NAC), and Jjj1 also...

  12. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    Directory of Open Access Journals (Sweden)

    Uli Ohmayer

    Full Text Available Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins and ribosomal RNAs (rRNAs. Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs.

  13. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly. (United States)

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A


    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  14. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs. (United States)

    Root-Bernstein, Robert; Root-Bernstein, Meredith


    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  15. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    CERN Document Server

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V


    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  16. Ribosome Assembly as Antimicrobial Target. (United States)

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H


    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  17. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+


    Sturm, Matthew B.; Schramm, Vern L.


    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  18. Cell-specific modulation of surfactant proteins by ambroxol treatment

    International Nuclear Information System (INIS)

    Ambroxol [trans-4-(2-amino-3,5-dibromobenzylamino)-cyclohexanole hydrochloride], a mucolytic agent, was postulated to provide surfactant stimulatory properties and was previously used to prevent surfactant deficiency. Currently, the underlying mechanisms are not exactly clear. Because surfactant homeostasis is regulated by surfactant-specific proteins (SP), we analyzed protein amount and mRNA expression in whole lung tissue, isolated type II pneumocytes and bronchoalveolar lavage of Sprague-Dawley rats treated with ambroxol i.p. (75 mg/kg body weight, twice a day [every 12 h]). The methods used included competitive polymerase chain reaction (RT-PCR), Northern blotting, Western immunoblotting, and immunohistochemistry. In isolated type II pneumocytes of ambroxol-treated animals, SP-C protein and mRNA content were increased, whereas SP-A, -B and -D protein, mRNA, and immunoreactivity remained unaffected. However, ambroxol treatment resulted in a significant increase of SP-B and in a decrease of SP-D in whole lung tissue with enhanced immunostaining for SP-B in Clara Cells. SP-A and SP-D were significantly decreased in BAL fluid of ambroxol-treated animals. The data suggest that surfactant protein expression is modulated in a cell-specific manner by ambroxol, as type II pneumocytes exhibited an increase in SP-C, whereas Clara cells exhibited an increase in the immunoreactivity for SP-B accounting for the increased SP-B content of whole lung tissue. The results indicate that ambroxol may exert its positive effects, observed in the treatment of diseases related to surfactant deficiency, via modulation of surfactant protein expression

  19. Turnover of messenger RNA: Polysome statistics beyond the steady state (United States)

    Valleriani, A.; Ignatova, Z.; Nagar, A.; Lipowsky, R.


    The interplay between turnover or degradation and ribosome loading of messenger RNA (mRNA) is studied theoretically using a stochastic model that is motivated by recent experimental results. Random mRNA degradation affects the statistics of polysomes, i.e., the statistics of the number of ribosomes per mRNA as extracted from cells. Since ribosome loading of newly created mRNA chains requires some time to reach steady state, a fraction of the extracted mRNA/ribosome complexes does not represent steady state conditions. As a consequence, the mean ribosome density obtained from the extracted complexes is found to be inversely proportional to the mRNA length. On the other hand, the ribosome density profile shows an exponential decrease along the mRNA for prokaryotes and becomes uniform in eukaryotic cells.

  20. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †


    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L; Cooper, Rebecca E.; Wilson, Lindsay A; Stoneley, Mark; Coldwell, Mark J; Poncet, Didier; Shen, Ya-Ching; Morley, Simon; Bushell, Martin; Willis, Anne E.


    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5' end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5' untranslated region (5'-UTR) of the mRNA. However, it is not well understood how cellular I...

  1. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  2. Initiation factor 2 stabilizes the ribosome in a semirotated conformation. (United States)

    Ling, Clarence; Ermolenko, Dmitri N


    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  3. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  4. Nucleolus: The ribosome factory

    Czech Academy of Sciences Publication Activity Database

    Cmarko, Dušan; Šmigová, J.; Minichová, L.; Popov, Alexey


    Roč. 23, č. 10 (2008), s. 1291-1298. ISSN 0213-3911 R&D Projects: GA ČR(CZ) GA304/06/1691 Grant ostatní: Wellcome Trust(XE) 075834/04/Z; GA MŠk(CZ) LC535; GA ČR(CZ) GA304/06/1662 Institutional research plan: CEZ:AV0Z50110509 Keywords : nucleolus * nucleolar architecture * ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.194, year: 2008

  5. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  6. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.; Meerwinck, W.; Stuhrmann, H.B.; Pedersen, J.S.; Koch, M.H.J.; Volkov, V.V.; Kozin, M.B.; Svergun, D.I.

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast-vari...

  7. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.;


    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  8. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation. (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C


    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  9. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A


    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  10. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences. (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E


    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. PMID:27071492

  11. Control of ribosome traffic by position-dependent choice of synonymous codons (United States)

    Mitarai, Namiko; Pedersen, Steen


    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  12. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress


    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.


    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucl...

  13. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish


    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  14. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome. (United States)

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui


    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  15. Utilización del patrón de restricción del DNA codificante para el RNA Ribosomal de la subunidad pequeña para la caracterización de Apicomplexa

    Directory of Open Access Journals (Sweden)

    López Adelaida


    Full Text Available Los Apicomplexos constituyen un phylum de protozoarios que se caracterizan por ser parásitos obligados de una gran variedad de huéspedes vertebrados e invertebrados. Hoy en día hay fuertes polémicas en tomo a su clasificación taxonómica, sus relaciones filogenéticas, y los patrones de coevolución con sus hospederos. El gen que codifica para el ARN ribosomal de la subunidad pequeña (ARN-SURp se utiliza como marcador molecular para resolver estas inquietudes. A partir del ADN de las especies de la familia Sarcocystidae (Sarcocystis cruzi, Sarcocystis sp. de Didelphis marsupialis y Sarcocystis sp. de Columbina talpacoti y Toxoplasma gondii, y de especies de la familia Plasmodiidae (Plasmodium de Anolis chloris, P. simium, y P. falciparumi, se amplificó por PCR el gen que codifica para el ARN de la subunidad ribosomal pequeña (ARN- SURp usando los iniciadores P5-P3, 0009-2134 Y566R-567R. Se compararon
    los patrones de restricción Hind III, Eco RI, Sau 3AI y Alw 261 del DNA ribosomal. La prueba de riboprini mostró que además de discriminar entre familias permite caracterizar diferencias a nivel de género y especie.Apicomplexa is a Protozoa phylum in which all members are obliged parasites of a wide range of vertebrate and invertebrate hosts. There is an ongoing controversy on
    systematics, phylogenetic relationships and parasite - host coevolution patterns. The SSU ribosomal gen has been used as a molecular marker in order to solve these issues.
    From DNA of the species of the Sarcocystidae family (Sarcocystis cruzi, Sarcocystis sp. from Didelphis marsupialis, Sarcocystis sp. from Columbina talpacoti and Toxoplasma
    gondii, and from the species of the Plasmodiidae family (Plasmodium from Anolis ehloris, P. simium, and P. falciparum, the SSU ribosomal DNA fragemnt was
    amplified by PCR, using the pair of primers P5-P3, 0009-2134 and 566R-567R. Hind III, Eco RI, Sau 3AI and Alw 261 restriction pattems were compared

  16. Identical ribosomal DNA sequence data from Pfiesteria piscicida (Dinophyceae) isolates with different toxicity phenotypes

    International Nuclear Information System (INIS)

    Complete small subunit ribosomal RNA, internal transcribed spacer 1 and 2, 5.8S, and partial large subunit ribosomal RNA gene sequences were generated from multiple isolates of Pfiesteria piscicida. Sequences were derived from isolates that have been shown to be ichthyotoxic as well as isolates that have no history of toxic behavior. All of the sequences generated were identical for the different cultures, and we therefore conclude that differences in toxicity seen between isolates of P. piscicida are linked to factors other than genetic strain variation detectable by ribosomal gene sequence analyses

  17. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin (United States)



    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  18. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics


    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.


    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid ...

  19. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [3H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  20. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    International Nuclear Information System (INIS)

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were 3H-labeled in vitro and injected back into X. laevis oocytes, most 3H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, 3H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of 3H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide, a cysteine protease inhibitor, resulting in the accumulation of 3H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus

  1. Identification of a novel male germ cell-specific gene TESF-1 in mice

    International Nuclear Information System (INIS)

    Mammalian spermatogenesis is precisely regulated by many germ cell-specific factors. In search for such a germ cell-specific factor, we have identified a novel mouse gene testis-specific factor 1 (TESF-1). Messenger RNA of TESF-1 was found only in the testis and its expression appeared to be regulated in a developmental manner. Further analysis demonstrated that the expression of TESF-1 was specifically in male germ cells, supported by the observation that we were not able to detect the TESF-1 mRNA from at/at homozygous mutant testes, which lack germ cells. The deduced amino acid sequence of TESF-1 contains a leucine-zipper motif, a potential nuclear localization signal, and two cAMP- and cGMP-dependent protein kinase phosphorylation sites. The green fluorescent protein (GFP)-tagged TESF-1 fusion protein was expressed in COS-7 cells and localized primarily in the nucleus. Taken together, these results indicate that TESF-1 is a novel male germ cell-specific gene, and its protein product may function as a nuclear factor involved in the regulation of spermatogenesis

  2. Ribosomal small subunit domains radiate from a central core (United States)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean


    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  3. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus


    LIU, XIAO-DAN; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang; Zhang, Shihong


    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Se...

  4. Structural, biophysical and functional characterization of Nop7-Erb1-Ytm1 complex and its implications in eukaryotic ribosome biogenesis


    Wegrecki, Marcin


    [EN] Ribosome biogenesis is one of the most important and energy-consuming processes in the cell. However, the vast majority of the events and factors that are involved in the synthesis of ribosomal subunits are not well understood. Ribosome maturation comprises multiple steps of rRNA processing that require sequential association and dissociation of numerous assembly factors. These proteins establish a complex network of interactions that are essential for the pathway to continue. Extensive ...

  5. Chloroplast ribosomes and protein synthesis.


    Harris, E. H.; Boynton, J E; Gillham, N W


    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles i...

  6. The ribosome and the mechanism of protein synthesis

    International Nuclear Information System (INIS)

    In virtually all forms of life on earth, proteins in each cell are made according to a genetic blueprint, in the form of DNA. The translation of copies of this genetic blueprint (in the form of messenger RNA) into polypeptides is performed on the ribosome, a highly complex molecular machine composed of RNAs and proteins. To this end, special adaptor molecules called transfer RNAs are lined up by the ribosome in the sequence dictated by the genetic code, such that the amino acids carried by these molecules can be linked into a polypeptide. Several cofactors are involved in these processes, some of which require energy freed up by GTP hydrolysis. Although the ribosome was discovered more than 50 years ago, its structure has only been solved recently by X-ray crystallography. Another technique, cryo-electron microscopy, is starting to contribute toward our understanding of the ribosome's function, by portraying its conformational changes and binding interactions with the cofactors and tRNA

  7. Translation affects YoeB and MazF messenger RNA interferase activities by different mechanisms

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, Mikkel; Gerdes, Kenn


    Prokaryotic toxin-antitoxin loci encode mRNA cleaving enzymes that inhibit translation. Two types are known: those that cleave mRNA codons at the ribosomal A site and those that cleave any RNA site specifically. RelE of Escherichia coli cleaves mRNA at the ribosomal A site in vivo and in vitro but...

  8. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Yingang, E-mail: [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)


    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  9. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    International Nuclear Information System (INIS)

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome. (United States)

    Poirot, Olivier; Timsit, Youri


    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  11. Accommodation of tmRNA–SmpB into stalled ribosomes: A cryo-EM study


    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald


    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-l...

  12. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S. (UCSC); (Colorado)


    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  13. β-Puromycin selection of modified ribosomes for in vitro incorporation of β-amino acids. (United States)

    Dedkova, Larisa M; Fahmi, Nour Eddine; Paul, Rakesh; del Rosario, Melissa; Zhang, Liqiang; Chen, Shengxi; Feder, Glen; Hecht, Sidney M


    Ribosomally mediated protein biosynthesis is limited to α-L-amino acids. A strong bias against β-L-amino acids precludes their incorporation into proteins in vivo and also in vitro in the presence of misacylated β-aminoacyl-tRNAs. Nonetheless, earlier studies provide some evidence that analogues of aminoacyl-tRNAs bearing β-amino acids can be accommodated in the ribosomal A-site. Both functional and X-ray crystallographic data make it clear that the exclusion of β-L-amino acids as participants in protein synthesis is a consequence of the architecture of the ribosomal peptidyltransferase center (PTC). To enable the reorganization of ribosomal PTC architecture through mutagenesis of 23S rRNA, a library of modified ribosomes having modifications in two regions of the 23S rRNA (2057-2063 and 2496-2507 or 2582-2588) was prepared. A dual selection procedure was used to obtain a set of modified ribosomes able to carry out protein synthesis in the presence β-L-amino acids and to provide evidence for the utilization of such amino acids, in addition to α-L-amino acids. β-Puromycin, a putative mimetic for β-aminoacyl-tRNAs, was used to select modified ribosome variants having altered PTC architectures, thus potentially enabling incorporation of β-L-amino acids. Eight types of modified ribosomes altered within the PTC have been selected by monitoring improved sensitivity to β-puromycin in vivo. Two of the modified ribosomes, having 2057AGCGUGA2063 and 2502UGGCAG2507 or 2502AGCCAG2507, were able to suppress UAG codons in E. coli dihydrofolate reductase (DHFR) and scorpion Opisthorcanthus madagascariensis peptide IsCT mRNAs in the presence of β-alanyl-tRNA(CUA). PMID:22145951

  14. A two-step binding model proposed for the electrostatic interactions of ricin A chain with ribosomes


    Li, Xiao-Ping; Chiou, Jia-Chi; Remacha, Miguel; Ballesta, Juan P.G.; Tumer, Nilgun E.


    Ricin is a ribosome inactivating protein that catalytically removes a universally conserved adenine from the α-sarcin/ricin loop (SRL) of the 28S rRNA. We recently showed that ricin A chain (RTA) interacts with the P1 and P2 proteins of the ribosomal stalk to depurinate the SRL in yeast. Here we examined the interaction of RTA with wild type and mutant yeast ribosomes deleted in the stalk proteins by surface plasmon resonance. The interaction between RTA and wild type ribosomes did not follow...

  15. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A


    stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  16. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Porse, B T; Leviev, I; Mankin, A S;


    reduced for the mutant L11-rRNA complexes. These results indicate that although, as shown earlier, thiostrepton binds primarily to 23 S rRNA, the drug probably inhibits peptide elongation by impeding a conformational change within protein L11 that is important for the function of the ribosomal GTPase...

  17. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function. (United States)

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R


    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  18. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes. (United States)

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro


    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  19. Ribosome biogenesis in replicating cells: Integration of experiment and theory. (United States)

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida


    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  20. KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons*S⃞


    Bisbal, Mariano; Wojnacki, José; Peretti, Diego; Ropolo, Andrea; Sesma, Juliana; Jausoro, Ignacio; Cáceres, Alfredo


    In this study, we have used a combination of biochemical and molecular biology techniques to demonstrate that the C-terminal tail domain of KIF4 directly interacts with P0, a major protein component of ribosomes. Besides, in dorsal root ganglion neurons, KIF4 and P0, as well as other ribosomal constituents, colocalize in clusters distributed along axons and neuritic tips. RNA interference suppression of KIF4 or expression of KIF4 variants lacking the tail domain or mut...

  1. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes. (United States)

    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan


    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  2. Structural characterization of mRNA-tRNA translocation intermediates. (United States)

    Agirrezabala, Xabier; Liao, Hstau Y; Schreiner, Eduard; Fu, Jie; Ortiz-Meoz, Rodrigo F; Schulten, Klaus; Green, Rachel; Frank, Joachim


    Cryo-EM analysis of a wild-type Escherichia coli pretranslocational sample has revealed the presence of previously unseen intermediate substates of the bacterial ribosome during the first phase of translocation, characterized by intermediate intersubunit rotations, L1 stalk positions, and tRNA configurations. Furthermore, we describe the domain rearrangements in quantitative terms, which has allowed us to characterize the processivity and coordination of the conformational reorganization of the ribosome, along with the associated changes in tRNA ribosome-binding configuration. The results are consistent with the view of the ribosome as a molecular machine employing Brownian motion to reach a functionally productive state via a series of substates with incremental changes in conformation. PMID:22467828

  3. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.


    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  4. Partial deletion of the RPS0A-binding domain of TIF32/eIF3A affects 40S ribosome-association of the multifactor complex and severely impairs reinitiation on the GCN4 mRNA leader

    Czech Academy of Sciences Publication Activity Database

    Szamecz, Bela; Rutkai, Edit; Nielsen, K. H.; Valášek, Leoš

    Nové Hrady : Verlag, 2006, s. 20-20. [Translational Control and Non-Coding RNA Meeting. Nové Hrady (CZ), 08.12.2006-12.12.2006] Grant ostatní: XE(XE) The Wellcome Trust grant to LV Institutional research plan: CEZ:AV0Z50200510 Keywords : translation * gcn4 Subject RIV: EE - Microbiology, Virology

  5. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S R; Liljas, A; Garrett, R A


    data, were used in a computer graphics approach to build a partial RNA tertiary structural model. The model provides insight into the topography of the L11 binding site. It also provides a structural rationale for the mutually co-operative binding of protein L11 with the antibiotics thiostrepton and...

  6. RNA modifications by oxidation

    DEFF Research Database (Denmark)

    Poulsen, Henrik E; Specht, Elisabeth; Broedbaek, Kasper;


    to encompass various classes of novel regulatory RNAs, including, e.g., microRNAs. It is well known that DNA is constantly oxidized and repaired by complex genome maintenance mechanisms. Analogously, RNA also undergoes significant oxidation, and there are now convincing data suggesting that oxidation......, and the consequent loss of integrity of RNA, is a mechanism for disease development. Oxidized RNA is found in a large variety of diseases, and interest has been especially devoted to degenerative brain diseases such as Alzheimer disease, in which up to 50-70% of specific mRNA molecules are reported oxidized, whereas...... other RNA molecules show virtually no oxidation. The iron-storage disease hemochromatosis exhibits the most prominent general increase in RNA oxidation ever observed. Oxidation of RNA primarily leads to strand breaks and to oxidative base modifications. Oxidized mRNA is recognized by the ribosomes...

  7. Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3

    Indian Academy of Sciences (India)

    Anuradha Seshadri; Umesh Varshney


    Ribosome recycling is a process which dissociates the post-termination complexes (post-TC) consisting of mRNA-bound ribosomes harbouring deacylated tRNA(s). Ribosome recycling factor (RRF), and elongation factor G (EFG) participate in this crucial process to free the ribosomal subunits for a new round of translation. We discuss the overall pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor 3 (IF3) in this process. Depending on the step(s) at which IF3 function is implicated, three models have been proposed. In model 1, RRF and EFG dissociate the post-TCs into the 50S and 30S subunits, mRNA and tRNA(s). In this model, IF3, which binds to the 30S subunit, merely keeps the dissociated subunits apart by its anti-association activity. In model 2, RRF and EFG separate the 50S subunit from the post-TC. IF3 then dissociates the remaining complex of mRNA, tRNA and the 30S subunit, and keeps the ribosomal subunits apart from each other. However, in model 3, both the genetic and biochemical evidence support a more active role for IF3 even at the step of dissociation of the post-TC by RRF and EFG into the 50S and 30S subunits.

  8. Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3

    International Nuclear Information System (INIS)

    The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function

  9. Ribosomal crystallography: from crystal growth to initial phasing (United States)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.


    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  10. Ontogenesis and cell specific localization of Fas ligand expression in the rat testis. (United States)

    D'Abrizio, Piera; Baldini, Enke; Russo, Paola F; Biordi, Leda; Graziano, Filomena M; Rucci, Nadia; Properzi, Giuliana; Francavilla, Sandro; Ulisse, Salvatore


    Over the past few years, a number of experimental evidences suggested the involvement of Fas Ligand (FasL) expressing Sertoli cells to induce apoptosis of Fas bearing germ cells. However, the FasL expression during testicular development and its cell specific localization within the testis is still a matter of debate. In the present study, we have monitored FasL expression during rat testis development by semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and evaluated cell specific localization of FasL expression, by in situ RT-PCR and immunohistochemistry, on adult rat testis. RT-PCR analysis, performed on total RNA from rat testes obtained from 1 day up to 1-year-old animals, demonstrated the presence of FasL transcripts at all developmental stages examined. In situ RT-PCR analysis clearly indicated the presence of FasL mRNA in Sertoli cells of adult testis, while we could never detect FasL transcripts in germ cells. Immunohistochemistry experiments showed a strong immunostaining for FasL in Sertoli cells of adult testis and again, no immunopositivity was observed in germ cells. In conclusion, our data suggest that FasL expression in rat testis is present from the early postnatal days up to the adult, and the Sertoli cells is the main FasL expressing cell within the seminiferous tubule. PMID:15379972

  11. Genetic divergences of South and Southeast Asian frogs: a case study of several taxa based on 16S ribosomal RNA gene data with notes on the generic name Fejervarya


    Hasan, Mahmudul; Islam, Mohammed Mafizul; KHAN, Md. Mukhlesur Rahman; Igawa, Takeshi; ALAM, Mohammad Shafiqul


    To elucidate the genetic divergences of several Asian frog taxa, the mitochondrial 16S rRNA gene (16S) sequences of 81 populations across 6 Asian countries were analyzed. In total, 109 haplotypes were found, and the concept of a 3% difference in 16S sequence corresponding to species threshold was applied to define candidate amphibian species, for which corroborating evidence, such as morphology, ecological characteristics, and/or nuclear gene data, is required. Polypedates leucomystax, Hylara...

  12. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome (United States)

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.


    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  13. Heat shock stabilizes highly unstable transcripts of the Xenopus ribosomal gene spacer.


    Labhart, P; Reeder, R H


    We have shown recently that, in Xenopus laevis oocytes, the 3' end of the longest detectable ribosomal precursor RNA is not formed by transcription termination but by RNA processing and that RNA polymerase I continues to transcribe through the intergenic spacer region. In oocytes, these spacer transcripts are turned over rapidly, and the only apparent transcription termination site is located 215 base pairs upstream of the 5' end of the next transcription unit. In this paper we show that, at ...

  14. Ultrastructure of the extended ribonucleic acid molecules from purified ribosomes of Rous sarcoma virus-induced mouse ascites sarcoma cells

    Directory of Open Access Journals (Sweden)



    Full Text Available To clarify the ultrastructure of the extended ribosomal RNA molecules, electron microscopic observations were carried out on the RNA molecules extracted from purified ribosomes of mouse ascites sarcoma cells. By the treatment with ethylenediamine-tetraacetate agglomerated rRNA molecules were elongated to thread-like structure by partial unfolding. The lengths of thread-like molecules were measured as less than Iii. The strand of RNA molecules stained with uranyl acetate was observed approximately l5A in width.

  15. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA


    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.


    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  16. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome. (United States)

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns


    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  17. Cell-specific regulation of apoptosis by designed enediynes.


    Nicolaou, K. C.; Stabila, P; Esmaeli-Azad, B; Wrasidlo, W; Hiatt, A


    The naturally occurring enediyne antibiotics are a unique class of antitumor drugs that combine reactive enediynes with additional structural features conferring affinity for DNA. Dynemicin A, in which an enediyne core is attached to an anthraquinone group capable of DNA intercalation, readily cleaves double-stranded DNA. This activity is thought to be the basis of its potent antitumor cytotoxicity. To investigate cell-specific mechanisms of cytotoxicity in the absence of DNA affinity, we hav...

  18. Anatomy of a new B-cell-specific enhancer.


    Koch, W; Benoist, C.; Mathis, D


    The major histocompatibility complex class II molecules, like the immunoglobulins, are prominent B-lymphocyte markers. Herein, we describe a B-cell-specific enhancer associated with the murine class II gene, Ek alpha. This enhancer has a complex anatomy that suggests interactions between remotely spaced elements. Of particular interest is the finding that two CCAAT boxes spaced one kilobase apart are important for enhancer activity. Somewhat surprisingly, the E alpha and immunoglobulin enhanc...

  19. Expression of Muscle-Specific Ribosomal Protein L3-Like Impairs Myotube Growth. (United States)

    Chaillou, Thomas; Zhang, Xiping; McCarthy, John J


    The ribosome has historically been considered to have no cell-specific function but rather serve in a "housekeeping" capacity. This view is being challenged by evidence showing that heterogeneity in the protein composition of the ribosome can lead to the functional specialization of the ribosome. Expression profiling of different tissues revealed that ribosomal protein large 3-like (Rpl3l) is exclusively expressed in striated muscle. In response to a hypertrophic stimulus, Rpl3l expression in skeletal muscle was significantly decreased by 82% whereas expression of the ubiquitous paralog Rpl3 was significantly increased by ∼fivefold. Based on these findings, we developed the hypothesis that Rpl3l functions as a negative regulator of muscle growth. To test this hypothesis, we used the Tet-On system to express Rpl3l in myoblasts during myotube formation. In support of our hypothesis, RPL3L expression significantly impaired myotube growth as assessed by myotube diameter (-23%) and protein content (-14%). Further analysis showed that the basis of this impairment was caused by a significant decrease in myoblast fusion as the fusion index was significantly lower (-17%) with RPL3L expression. These findings are the first evidence to support the novel concept of ribosome specialization in skeletal muscle and its role in the regulation of skeletal muscle growth. J. Cell. Physiol. 231: 1894-1902, 2016. © 2015 Wiley Periodicals, Inc. PMID:26684695

  20. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;


    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several...

  1. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann


    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  2. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    Directory of Open Access Journals (Sweden)

    García-Lara Jorge


    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  3. RNA nanoparticles come of age

    Institute of Scientific and Technical Information of China (English)

    John J.Rossi


    @@ RNA has multiple functions in nature, including informa- tional transfer (mRNA) Ill, adaptor function (tRNAs) [2], guide functions (snRNAs, snoRNAs) [3,4]catalytic func- tion (ribozymes and the large ribosomal RNA) [5-7], and environmental sensing (riboswitehes) [8].In contrast, DNA only serves as an information storage molecule, and proteins serve as structural and enzymatic molecules.

  4. Affinity chromatography and capillary electrophoresis for analysis of the yeast ribosomal proteins

    Directory of Open Access Journals (Sweden)

    Miriam S. Goyder


    Full Text Available We present a top down separation platform for yeast ribosomalproteins using affinity chromatography and capillary electrophoresiswhich is designed to allow deposition of proteins ontoa substrate. FLAG tagged ribosomes were affinity purified, andrRNA acid precipitation was performed on the ribosomes followedby capillary electrophoresis to separate the ribosomalproteins. Over 26 peaks were detected with excellent reproducibility(<0.5% RSD migration time. This is the first reportedseparation of eukaryotic ribosomal proteins using capillaryelectrophoresis. The two stages in this workflow, affinity chromatographyand capillary electrophoresis, share the advantagesthat they are fast, flexible and have small sample requirementsin comparison to more commonly used techniques. This methodis a remarkably quick route from cell to separation that hasthe potential to be coupled to high throughput readout platformsfor studies of the ribosomal proteome. [BMB reports2012; 45(4: 233-238

  5. Study of the Ribosomal Stress Pathway in Pluripotency, Cancer and Disease


    Morgado Palacín, Lucía


    Tesis Doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular La vía de estrés ribosomal se describió hace más de una década como una nueva vía activadora de p53. Dicha vía monitoriza la homeostasis de la biogénesis ribosomal. Perturbaciones en cualquiera de las etapas de la biosíntesis del ribosoma, transcripción del DNA ribosomal, procesamiento del RNA ribosomal, ensamblaje o transporte nuclear, conllevan un exceso de prote...

  6. A ribosome-inactivating protein in a Drosophila defensive symbiont. (United States)

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J


    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  7. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin. (United States)

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E


    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  8. Potential cell-specific functions of CXCR4 in atherosclerosis. (United States)

    Weber, Christian; Döring, Yvonne; Noels, Heidi


    The chemokine CXCL12 and its receptor CXCR4 form an important axis contributing to cellular functions in homeostasis and disease. In addition, the atypical CXCL12 receptor CXCR7 may shape the availability and function of CXCL12. Further to their role through progenitor cell mobilization, CXCL12 and CXCR4 may affect native atherogenesis by modifying atherosclerosis-relevant cellular functions. This short review intends to provide a concise summary of current knowledge with regards to cell-specific functions of CXCL12 and its receptors CXCR4 and CXCR7 with potential implications for the initiation and progression of atherosclerosis. PMID:25586789

  9. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung


    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  10. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation (United States)

    Xie, Ping


    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  11. Birthdating studies reshape models for pituitary gland cell specification. (United States)

    Davis, Shannon W; Mortensen, Amanda H; Camper, Sally A


    The intermediate and anterior lobes of the pituitary gland are derived from an invagination of oral ectoderm that forms Rathke's pouch. During gestation proliferating cells are enriched around the pouch lumen, and they appear to delaminate as they exit the cell cycle and differentiate. During late mouse gestation and the postnatal period, anterior lobe progenitors re-enter the cell cycle and expand the populations of specialized, hormone-producing cells. At birth, all cell types are present, and their localization appears stratified based on cell type. We conducted a birth dating study of Rathke's pouch derivatives to determine whether the location of specialized cells at birth is correlated with the timing of cell cycle exit. We find that all of the anterior lobe cell types initiate differentiation concurrently with a peak between e11.5 and e13.5. Differentiation of intermediate lobe melanotropes is delayed relative to anterior lobe cell types. We discovered that specialized cell types are not grouped together based on birth date and are dispersed throughout the anterior lobe. Thus, the apparent stratification of specialized cells at birth is not correlated with cell cycle exit. Thus, the currently popular model of cell specification, dependent upon timing of extrinsic, directional gradients of signaling molecules, needs revision. We propose that signals intrinsic to Rathke's pouch are necessary for cell specification between e11.5 and e13.5 and that cell-cell communication likely plays an important role in regulating this process. PMID:21262217

  12. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina


    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  13. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  14. Nucleolar Clustering of Dispersed tRNA Genes


    Thompson, Martin; Haeusler, Rebecca A.; Good, Paul D.; Engelke, David R.


    Early transfer RNA (tRNA) processing events in Saccharomyces cerevisiae are coordinated in the nucleolus, the site normally associated with ribosome biosynthesis. To test whether spatial organization of the tRNA pathway begins with nucleolar clustering of the genes, we have probed the subnuclear location of five different tRNA gene families. The results show that tRNA genes, though dispersed in the linear genome, colocalize with 5S ribosomal DNA and U14 small nucleolar RNA at the nucleolus. N...

  15. Molecular mechanisms of ribosomal protein gene coregulation. (United States)

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin


    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  16. The Listeria monocytogenes hibernation-promoting factor is required for the formation of 100S ribosomes, optimal fitness, and pathogenesis. (United States)

    Kline, Benjamin C; McKay, Susannah L; Tang, William W; Portnoy, Daniel A


    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gammaproteobacteria produce two relevant proteins, ribosome modulation factor (RMF) and hibernation promoting factor (HPF), while most Gram-positive bacteria produce a single, longer HPF protein. Here, we report the formation of 100S ribosomes by an HPF homolog in Listeria monocytogenes. L. monocytogenes 100S ribosomes were observed by sucrose density gradient centrifugation of bacterial extracts during mid-logarithmic phase, peaked at the transition to stationary phase, and persisted at lower levels during post-exponential-phase growth. 100S ribosomes were undetectable in bacteria carrying an hpf::Himar1 transposon insertion, indicating that HPF is required for ribosome hibernation in L. monocytogenes. Additionally, epitope-tagged HPF cosedimented with 100S ribosomes, supporting its previously described direct role in 100S formation. We examined hpf mRNA by quantitative PCR (qPCR) and identified several conditions that upregulated its expression, including carbon starvation, heat shock, and exposure to high concentrations of salt or ethanol. Survival of HPF-deficient bacteria was impaired under certain conditions both in vitro and during animal infection, providing evidence for the biological relevance of 100S ribosome formation. PMID:25422304

  17. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A


    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecule...

  18. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E; Buurman, Ed T; Squires, Catherine L


    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...... remaining scar sequences, facilitating homologous recombination events, presumably leads to elevated genomic instability...

  19. Protein Folding Activity of the Ribosome (PFAR –– A Target for Antiprion Compounds

    Directory of Open Access Journals (Sweden)

    Debapriya Banerjee


    Full Text Available Prion diseases are fatal neurodegenerative diseases affecting mammals. Prions are misfolded amyloid aggregates of the prion protein (PrP, which form when the alpha helical, soluble form of PrP converts to an aggregation-prone, beta sheet form. Thus, prions originate as protein folding problems. The discovery of yeast prion(s and the development of a red-/white-colony based assay facilitated safe and high-throughput screening of antiprion compounds. With this assay three antiprion compounds; 6-aminophenanthridine (6AP, guanabenz acetate (GA, and imiquimod (IQ have been identified. Biochemical and genetic studies reveal that these compounds target ribosomal RNA (rRNA and inhibit specifically the protein folding activity of the ribosome (PFAR. The domain V of the 23S/25S/28S rRNA of the large ribosomal subunit constitutes the active site for PFAR. 6AP and GA inhibit PFAR by competition with the protein substrates for the common binding sites on the domain V rRNA. PFAR inhibition by these antiprion compounds opens up new possibilities for understanding prion formation, propagation and the role of the ribosome therein. In this review, we summarize and analyze the correlation between PFAR and prion processes using the antiprion compounds as tools.

  20. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove


    Filbin, Megan E.; Kieft, Jeffrey S.


    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subuni...

  1. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  2. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics (United States)

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.


    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G·GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the post-translocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA·EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  3. Single-molecule fluorescence measurements of ribosomal translocation dynamics. (United States)

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E; Cooperman, Barry S


    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3- and Cy5-labeled tRNAs. Pretranslocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G⋅GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the posttranslocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA⋅EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  4. Detecting actively translated open reading frames in ribosome profiling data. (United States)

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe


    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at, a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  5. 云南保山和普洱地区带绦虫线粒体DNA基因编码核糖体RNA小亚基基因序列分析%Analysis of the mitochondrial DNA-gene encoding ribosomal RNA small subunit gene sequence of Taenia cestode from Baoshan and Puer areas in Yunnan Province

    Institute of Scientific and Technical Information of China (English)

    刘爱波; 杨毅梅


    Objective To identify Taenia cestodes specimens collected from Baoshan and Puer regions of Yunnan Province by analyzing mitochondrial DNA gene encoding ribosomal RNA small subunit (mtDNA-12S rRNA) gene sequence. Methods The adult Taenia cestode samples were collected from Baoshan and Puer regions of Yunnan Province. The genomic DNA was extracted and mtDNA-12S rRAN gene was amplified by polymerase chain reaction (PCR), then sequenced.Combined with the known mtDNA-12S rRNA gene sequence of Taenia solium, Taenia saginata,Taenia asiatica in GenBank, homology tree and phylogenetic tree were constructed by DNA MAN software. Results Taenia cestode homology tree and phylogenetic tree showed that gene sequences of BS1, BS2, BS4 and BS5 were most close to YZ with identity of 99% and those of BS3, BS6, BST,PE1 and PE2 were most close to ND with identity of 99%. Conclusions Taenia saginata and Taenia asiatica can be found in Baoshan area, while Taenia saginata can be found in Puer area. The gene sequence of mtDNA-12S rRNA can be used for clarifying the three types of Taenia cestode.%目的 利用线粒体DNA基因编码核糖体RNA小亚基(mtDNA-12S rRNA)基因序列分析对采自云南保山、普洱地区的带绦虫标本进行鉴定.方法 选取保山(7条,BS1-BS7)、普洱(2条,PE1~PE2)带绦虫成虫节片,抽提基因组DNA,PCR扩增mtDNA-12S rRNA基因序列,并测序;结合GenBank中已知的猪带绦虫(ZD)、牛带绦虫(ND)、亚洲带绦虫(YZ)mtDNA-12S rRNA基因序列,经DNA MAN软件处理后构建同源树状图与系统发育树状图.结果 带绦虫同源树与系统发育树状图显示,BS1、BS2、BS4、BS5与YZ的同源性最近(99%).BS3、BS6、BS7、PE1、PE2与ND的同源性最近(99%).结论 云南保山存在牛带绦虫与亚洲带绦虫,普洱存在牛带绦虫,mtDNA-12S rRNA基因序列可用于三种带绦虫的分类研究.

  6. A new low resolution model for the 50S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Neutron low angle scattering studies of the 50S subunit of Escherichia coli ribosomes using the contrast variation method reveals large fluctuations in the scattering density. A region of relatively low scattering density, rich in proteins, surrounds an RNA-rich core of higher scattering density. The centres of mass of the RNA and protein parts of the 50S subunit are separated by a distance that is considerably smaller than that reported in previous studies. (orig.)

  7. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells. (United States)

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory


    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  8. Structural characterization of ribosome recruitment and translocation by type IV IRES. (United States)

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S


    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  9. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells (United States)

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory


    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5′ mRNA-like features, including capping and 5′UTR length. On the other hand, nonpolysomal “free cytoplasmic” lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation. PMID:27090285

  10. Chaperone binding at the ribosomal exit tunnel

    DEFF Research Database (Denmark)

    Kristensen, Ole; Gajhede, Michael


    The exit tunnel region of the ribosome is well established as a focal point for interaction between the components that guide the fate of nascent polypeptides. One of these, the chaperone trigger factor (TF), associates with the 50S ribosomal subunit through its N-terminal domain. Targeting of TF...

  11. Biochemical characterization of three mycobacterial ribosomal fractions. (United States)

    Portelance, V; Beaudet, R


    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  12. Surface topography of the Bacillus stearothermophilus ribosome

    International Nuclear Information System (INIS)

    The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

  13. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ † (United States)

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.


    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  14. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    DEFF Research Database (Denmark)

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.


    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  15. Movement of the 3'-end of tRNA through the peptidyl transferase centre and its inhibition by antibiotics

    DEFF Research Database (Denmark)

    Kirillov, Stanislav; Porse, Bo Torben; Vester, Birthe;


    Determining how antibiotics inhibit ribosomal activity requires a detailed understanding of the interactions and relative movement of tRNA, mRNA and the ribosome. Recent models for the formation of hybrid tRNA binding sites during the elongation cycle have provided a basis for re-evaluating earlier...... experimental data and, especially, those relevant to substrate movements through the peptidyl transferase centre. With the exception of deacylated tRNA, which binds at the E-site, ribosomal interactions of the 3'-ends of the tRNA substrates generate only a small part of the total free energy of tRNA......-ribosome binding. Nevertheless, these relatively weak interactions determine the unidirectional movement of tRNAs through the ribosome and, moreover, they appear to be particularly susceptible to perturbation by antibiotics. Here we summarise current ideas relating particularly to the movement of the 3'-ends of tRNA...

  16. Changes produced by bound tryptophan in the ribosome peptidyl transferase center in response to TnaC, a nascent leader peptide. (United States)

    Cruz-Vera, Luis Rogelio; Gong, Ming; Yanofsky, Charles


    Studies in vitro have established that free tryptophan induces tna operon expression by binding to the ribosome that has just completed synthesis of TnaC-tRNA(Pro), the peptidyl-tRNA precursor of the leader peptide of this operon. Tryptophan acts by inhibiting Release Factor 2-mediated cleavage of this peptidyl-tRNA at the tnaC stop codon. Here we analyze the ribosomal location of free tryptophan, the changes it produces in the ribosome, and the role of the nascent TnaC-tRNA(Pro) peptide in facilitating tryptophan binding and induction. The positional changes of 23S rRNA nucleotides that occur during induction were detected by using methylation protection and binding/competition assays. The ribosome-TnaC-tRNA(Pro) complexes analyzed were formed in vitro; they contained either wild-type TnaC-tRNA(Pro) or its nonfunctional substitute, TnaC(W12R)-tRNA(Pro). Upon comparing these two peptidyl-tRNA-ribosome complexes, free tryptophan was found to block methylation of nucleotide A2572 of wild-type ribosome-TnaC-tRNA(Pro) complexes but not of ribosome-TnaC(W12R)-tRNA(Pro) complexes. Nucleotide A2572 is in the ribosomal peptidyl transferase center. Tryptophanol, a noninducing competitor of tryptophan, was ineffective in blocking A2572 methylation; however, it did reverse the protective effect of tryptophan. Free tryptophan inhibited puromycin cleavage of TnaC-tRNA(Pro); it also inhibited binding of the antibiotic sparsomycin. These effects were not observed with TnaC(W12R)-tRNA(Pro) mutant complexes. These findings establish that Trp-12 of TnaC-tRNA(Pro) is required for introducing specific changes in the peptidyl transferase center of the ribosome that activate free tryptophan binding, resulting in peptidyl transferase inhibition. Free tryptophan appears to act at or near the binding sites of several antibiotics in the peptidyl transferase center. PMID:16505360

  17. Nanometer scale pores similar in size to the entrance of the ribosomal exit cavity are a common feature of large RNAs (United States)

    Rivas, Mario; Tran, Quyen; Fox, George E.


    The highly conserved peptidyl transferase center (PTC) of the ribosome contains an RNA pore that serves as the entrance to the exit tunnel. Analysis of available ribosome crystal structures has revealed the presence of multiple additional well-defined pores of comparable size in the ribosomal (rRNA) RNAs. These typically have dimensions of 1–2 nm, with a total area of ∼100 Å2 or more, and most are associated with one or more ribosomal proteins. The PTC example and the other rRNA pores result from the packing of helices. However, in the non-PTC cases the nitrogenous bases do not protrude into the pore, thereby limiting the potential for hydrogen bonding within the pore. Instead, it is the RNA backbone that largely defines the pore likely resulting in a negatively charged environment. In many but not all cases, ribosomal proteins are associated with the pores to a greater or lesser extent. With the exception of the PTC case, the large subunit pores are not found in what are thought to be the evolutionarily oldest regions of the 23S rRNA. The unusual nature of the PTC pore may reflect a history of being created by hybridization between two or more RNAs early in evolution rather than simple folding of a single RNA. An initial survey of nonribosomal RNA crystal structures revealed additional pores, thereby showing that they are likely a general feature of RNA tertiary structure. PMID:23940386

  18. Mutations in the bacterial ribosomal protein l3 and their association with antibiotic resistance

    DEFF Research Database (Denmark)

    Klitgaard, Rasmus N; Ntokou, Eleni; Nørgaard, Katrine;


    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of...... studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild...

  19. 2.8-Å Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania. (United States)

    Shalev-Benami, Moran; Zhang, Yan; Matzov, Donna; Halfon, Yehuda; Zackay, Arie; Rozenberg, Haim; Zimmerman, Ella; Bashan, Anat; Jaffe, Charles L; Yonath, Ada; Skiniotis, Georgios


    Leishmania is a single-cell eukaryotic parasite of the Trypanosomatidae family, whose members cause an array of tropical diseases. The often fatal outcome of infections, lack of effective vaccines, limited selection of therapeutic drugs, and emerging resistant strains, underline the need to develop strategies to combat these pathogens. The Trypanosomatid ribosome has recently been highlighted as a promising therapeutic target due to structural features that are distinct from other eukaryotes. Here, we present the 2.8-Å resolution structure of the Leishmania donovani large ribosomal subunit (LSU) derived from a cryo-EM map, further enabling the structural observation of eukaryotic rRNA modifications that play a significant role in ribosome assembly and function. The structure illustrates the unique fragmented nature of leishmanial LSU rRNA and highlights the irregular distribution of rRNA modifications in Leishmania, a characteristic with implications for anti-parasitic drug development. PMID:27373148

  20. Male germ cell-specific knockout of cholesterogenic cytochrome P450 lanosterol 14α-demethylase (Cyp51)[S


    Keber, Rok; Ačimovič, Jure; Majdič, Gregor; Motaln, Helena; Rozman, Damjana; Horvat, Simon


    Cytochrome P450 lanosterol 14α-demethylase (CYP51) and its products, meiosis-activating sterols (MASs), were hypothesized by previous in vitro studies to have an important role in regulating meiosis and reproduction. To test this in vivo, we generated a conditional male germ cell-specific knockout of the gene Cyp51 in the mouse. High excision efficiency of Cyp51 allele in germ cells resulted in 85–89% downregulation of Cyp51 mRNA and protein levels in germ cells. Quantitative metabolic profil...

  1. Cell-specific synaptic plasticity induced by network oscillations. (United States)

    Zarnadze, Shota; Bäuerle, Peter; Santos-Torres, Julio; Böhm, Claudia; Schmitz, Dietmar; Geiger, Jörg Rp; Dugladze, Tamar; Gloveli, Tengis


    Gamma rhythms are known to contribute to the process of memory encoding. However, little is known about the underlying mechanisms at the molecular, cellular and network levels. Using local field potential recording in awake behaving mice and concomitant field potential and whole-cell recordings in slice preparations we found that gamma rhythms lead to activity-dependent modification of hippocampal networks, including alterations in sharp wave-ripple complexes. Network plasticity, expressed as long-lasting increases in sharp wave-associated synaptic currents, exhibits enhanced excitatory synaptic strength in pyramidal cells that is induced postsynaptically and depends on metabotropic glutamate receptor-5 activation. In sharp contrast, alteration of inhibitory synaptic strength is independent of postsynaptic activation and less pronounced. Further, we found a cell type-specific, directionally biased synaptic plasticity of two major types of GABAergic cells, parvalbumin- and cholecystokinin-expressing interneurons. Thus, we propose that gamma frequency oscillations represent a network state that introduces long-lasting synaptic plasticity in a cell-specific manner. PMID:27218453

  2. Transient ribosomal attenuation coordinates protein synthesis and co-translational folding. (United States)

    Zhang, Gong; Hubalewska, Magdalena; Ignatova, Zoya


    Clustered codons that pair to low-abundance tRNA isoacceptors can form slow-translating regions in the mRNA and cause transient ribosomal arrest. We report that folding efficiency of the Escherichia coli multidomain protein SufI can be severely perturbed by alterations in ribosome-mediated translational attenuation. Such alterations were achieved by global acceleration of the translation rate with tRNA excess in vitro or by synonymous substitutions to codons with highly abundant tRNAs both in vitro and in vivo. Conversely, the global slow-down of the translation rate modulated by low temperature suppresses the deleterious effect of the altered translational attenuation pattern. We propose that local discontinuous translation temporally separates the translation of segments of the peptide chain and actively coordinates their co-translational folding. PMID:19198590

  3. X-ray Analyses of the Ribosomal A-Site Molecular Switches (United States)

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  4. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin


    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  5. Protein Structure and the Sequential Structure of mRNA

    DEFF Research Database (Denmark)

    Brunak, Søren; Engelbrecht, Jacob


    A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed, We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting pro...... nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome. (C) 1996 Wiley-Liss, Inc....

  6. Melatonin Suppresses the Expression of 45S Preribosomal RNA and Upstream Binding Factor and Enhances the Antitumor Activity of Puromycin in MDA-MB-231 Breast Cancer Cells


    Ji Hoon Jung; Eun Jung Sohn; Eun Ah Shin; Duckgue Lee; Bonglee Kim; Deok-Beom Jung; Ji-Hyun Kim; Miyong Yun; Hyo-Jeong Lee; Yong Koo Park; Sung-Hoon Kim


    Since the dysregulation of ribosome biogenesis is closely associated with tumor progression, in the current study, the critical role of ribosome biogenesis related signaling was investigated in melatonin and/or puromycin induced apoptosis in MDA-MB-231 breast cancer cells. Despite its weak cytotoxicity, melatonin from 3 mM attenuated the expression of 45S pre-ribosomal RNA (pre-rRNA), UBF as a nucleolar transcription factor, and fibrillarin at mRNA level and consistently downregulated nucleol...

  7. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome. (United States)

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A; Donohue, John P; Noller, Harry F; Kieft, Jeffrey S


    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA • mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines. PMID:21245352

  8. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M; Powers, T; Douthwaite, S


    ribosome population, which consequently hinders direct probing of mutant rRNAs. Here, we describe how nonconserved helical regions of plasmid-coded rRNA have been altered in a manner that preserves their secondary structures while creating new sites for primer extension of mutant rRNAs. This facilitates...... specific biochemical probing of mutagenised rRNA regions despite the background of wild-type molecules. Four priming sites have been made to investigate the structural effects of mutations in the GTPase centre, helix 1200-1250, the peptidyl transferase region and the alpha-sarcin loop of 23S rRNA....

  9. Eukaryotic Ribosome Assembly and Nuclear Export. (United States)

    Nerurkar, Purnima; Altvater, Martin; Gerhardy, Stefan; Schütz, Sabina; Fischer, Ute; Weirich, Christine; Panse, Vikram Govind


    Accurate translation of the genetic code into functional polypeptides is key to cellular growth and proliferation. This essential process is carried out by the ribosome, a ribonucleoprotein complex of remarkable size and intricacy. Although the structure of the mature ribosome has provided insight into the mechanism of translation, our knowledge regarding the assembly, quality control, and intracellular targeting of this molecular machine is still emerging. Assembly of the eukaryotic ribosome begins in the nucleolus and requires more than 350 conserved assembly factors, which transiently associate with the preribosome at specific maturation stages. After accomplishing their tasks, early-acting assembly factors are released, preparing preribosomes for nuclear export. Export competent preribosomal subunits are transported through nuclear pore complexes into the cytoplasm, where they undergo final maturation steps, which are closely connected to quality control, before engaging in translation. In this chapter, we focus on the final events that commit correctly assembled ribosomal subunits for translation. PMID:26404467

  10. The immunological properties of Brucella ribosomal preparations. (United States)

    Corbel, M J


    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  11. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G


    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  12. RPG: the Ribosomal Protein Gene database


    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya


    RPG ( is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and informa...

  13. Ribosome biogenesis during skeletal muscle hypertrophy


    von Walden, Ferdinand


    Muscle adaptation to chronic resistance exercise (RE) is the result of a cumulative effect on gene expression and protein content. Following a bout of RE, muscle protein synthesis increases and, if followed by consecutive bouts (training), protein accretion and muscle hypertrophy develops. The protein synthetic capacity of the muscle is dictated by ribosome content. Therefore, the general aim of this thesis is to investigate the regulation of ribosome biogenesis during skeletal muscle hypertr...

  14. Comparative effects of whey protein versus L-leucine on skeletal muscle protein synthesis and markers of ribosome biogenesis following resistance exercise. (United States)

    Mobley, C Brooks; Fox, Carlton D; Thompson, Richard M; Healy, James C; Santucci, Vincent; Kephart, Wesley C; McCloskey, Anna E; Kim, Mike; Pascoe, David D; Martin, Jeffrey S; Moon, Jordan R; Young, Kaelin C; Roberts, Michael D


    We compared immediate post-exercise whey protein (WP, 500 mg) versus L-leucine (LEU, 54 mg) feedings on skeletal muscle protein synthesis (MPS) mechanisms and ribosome biogenesis markers 3 h following unilateral plantarflexor resistance exercise in male, Wistar rats (~250 g). Additionally, in vitro experiments were performed on differentiated C2C12 myotubes to compare nutrient (i.e., WP, LEU) and 'exercise-like' treatments (i.e., caffeine, hydrogen peroxide, and AICAR) on ribosome biogenesis markers. LEU and WP significantly increased phosphorylated-rpS6 (Ser235/236) in the exercised (EX) leg 2.4-fold (P  0.05). Compared to the non-EX leg, MPS levels increased 32 % and 52 % in the EX leg of CTL (P  0.05). Several genes associated with ribosome biogenesis robustly increased in the EX versus non-EX legs of all treatments; specifically, c-Myc mRNA, Nop56 mRNA, Bop1 mRNA, Ncl mRNA, Npm1 mRNA, Fb1 mRNA, and Xpo-5 mRNA. However, only LEU significantly increased 45S pre-rRNA levels in the EX leg (63 %, P < 0.001). In vitro findings confirmed that 'exercise-like' treatments similarly altered markers of ribosome biogenesis, but only LEU increased 47S pre-rRNA levels (P < 0.01). Collectively, our data suggests that resistance exercise, as well as 'exercise-like' signals in vitro, acutely increase the expression of genes associated with ribosome biogenesis independent of nutrient provision. Moreover, while EX with or without WP appears superior for enhancing translational efficiency (i.e., increasing MPS per unit of RNA), LEU administration (or co-administration) may further enhance ribosome biogenesis over prolonged periods with resistance exercise. PMID:26507545

  15. tRNA-mRNA mimicry drives translation initiation from a viral IRES. (United States)

    Costantino, David A; Pfingsten, Jennifer S; Rambo, Robert P; Kieft, Jeffrey S


    Internal ribosome entry site (IRES) RNAs initiate protein synthesis in eukaryotic cells by a noncanonical cap-independent mechanism. IRESes are critical for many pathogenic viruses, but efforts to understand their function are complicated by the diversity of IRES sequences as well as by limited high-resolution structural information. The intergenic region (IGR) IRESes of the Dicistroviridae viruses are powerful model systems to begin to understand IRES function. Here we present the crystal structure of a Dicistroviridae IGR IRES domain that interacts with the ribosome's decoding groove. We find that this RNA domain precisely mimics the transfer RNA anticodon-messenger RNA codon interaction, and its modeled orientation on the ribosome helps explain translocation without peptide bond formation. When combined with a previous structure, this work completes the first high-resolution description of an IRES RNA and provides insight into how RNAs can manipulate complex biological machines. PMID:18157151

  16. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando


    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  17. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics. (United States)

    Sturm, Matthew B; Schramm, Vern L


    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  18. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation (United States)

    Rooijers, Koos; Loayza-Puch, Fabricio; Nijtmans, Leo G.; Agami, Reuven


    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson’s disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations often affect components of the mitochondrial translation machinery. Here we perform ribosome profiling to measure mitochondrial translation at nucleotide resolution. Using a protocol optimized for the retrieval of mitochondrial ribosome protected fragments (RPFs) we show that the size distribution of wild-type mitochondrial RPFs follows a bimodal distribution peaking at 27 and 33 nucleotides, which is distinct from the 30-nucleotide peak of nuclear RPFs. Their cross-correlation suggests generation of mitochondrial RPFs during ribosome progression. In contrast, RPFs from patient-derived mitochondria mutated in tRNA-Tryptophan are centered on tryptophan codons and reduced downstream, indicating ribosome stalling. Intriguingly, long RPFs are enriched in mutated mitochondria, suggesting they characterize stalled ribosomes. Our findings provide the first model for translation in wild-type and disease-triggering mitochondria.

  19. Requirement for SAPK-JNK signaling in the induction of apoptosis by ribosomal stress in REH lymphoid leukemia cells. (United States)

    Johnson, C R; Jiffar, T; Fischer, U M; Ruvolo, P P; Jarvis, W D


    The present studies examined performance of SAPK cascades and apoptotic commitment following ribosomal trauma in REH lymphoid leukemia cells. Ribostatic insults included disruption of ribosomal activity by mechanistically dissimilar agents such as blasticidin-S (BCS) (which binds 28S-rRNA to block peptidyl bond formation), kasugamycin (KSM) (which binds 18S-rRNA to prevent translational initiation), and cycloheximide (CHX) (which blocks A-site to P-site translocation of peptidyl-tRNA). Exposure of REH cells to BCS elicited DNA degradation and apoptotic cytolysis. BCS stimulated JNK1/JNK2 and p38, and their shared targets c-Jun and ATF2. Inhibition of JNK1/JNK2 (but not of p38) antagonized blasticidin-induced apoptosis, whereas targeting alternative ribosomal sites with KSM or CHX limited translation, but failed to activate the SAPK cascade or initiate apoptosis. Our findings indicate that interference with 28S-rRNA by BCS initiates apoptosis in REH cells through recruitment of SAPK-JNK signaling. Disparities between the lethal actions of BCS, KSM, and CHX appear to reflect established differences in the subribosomal targets of these agents. We propose that the SAPK cascade comprises an essential mechanism for the transduction of specific lethal stress signals emanating from active ribosomes, and that interference with the 28S-rRNA, rather than the peptidyl transfer center of the large subunit, is critical to apoptotic commitment. PMID:12970763

  20. The structures of nonprotein-coding RNAs that drive internal ribosome entry site function. (United States)

    Plank, Terra-Dawn M; Kieft, Jeffrey S


    Internal ribosome entry sites (IRESs) are RNA sequences that can recruit the translation machinery independent of the 5' end of the messenger RNA. IRESs are found in both viral and cellular RNAs and are important for regulating gene expression. There is great diversity in the mechanisms used by IRESs to recruit the ribosome and this is reflected in a variety of RNA sequences that function as IRESs. The ability of an RNA sequence to function as an IRES is conferred by structures operating at multiple levels from primary sequence through higher-order three-dimensional structures within dynamic ribonucleoproteins (RNPs). When these diverse structures are compared, some trends are apparent, but overall it is not possible to find universal rules to describe IRES structure and mechanism. Clearly, many different sequences and structures have evolved to perform the function of recruiting, positioning, and activating a ribosome without using the canonical cap-dependent mechanism. However, as our understanding of the specific sequences, structures, and mechanisms behind IRES function improves, more common features may emerge to link these diverse RNAs. PMID:22215521

  1. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences. (United States)

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick


    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  2. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi (United States)

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David


    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  3. Ribosome traffic on mRNAs maps to gene ontology: genome-wide quantification of translation initiation rates and polysome size regulation. (United States)

    Ciandrini, Luca; Stansfield, Ian; Romano, M Carmen


    To understand the complex relationship governing transcript abundance and the level of the encoded protein, we integrate genome-wide experimental data of ribosomal density on mRNAs with a novel stochastic model describing ribosome traffic dynamics during translation elongation. This analysis reveals that codon arrangement, rather than simply codon bias, has a key role in determining translational efficiency. It also reveals that translation output is governed both by initiation efficiency and elongation dynamics. By integrating genome-wide experimental data sets with simulation of ribosome traffic on all Saccharomyces cerevisiae ORFs, mRNA-specific translation initiation rates are for the first time estimated across the entire transcriptome. Our analysis identifies different classes of mRNAs characterised by their initiation rates, their ribosome traffic dynamics, and by their response to ribosome availability. Strikingly, this classification based on translational dynamics maps onto key gene ontological classifications, revealing evolutionary optimisation of translation responses to be strongly influenced by gene function. PMID:23382661

  4. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 ' UTRs and its implications for eukaryotic gene translation regulation


    Pánek, J. (Josef); Kolář, M. (Michal); Vohradský, J; Valášek, L. (Leoš)


    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computat...

  5. Preferential translation of chloroplast ribosomal proteins in Chlamydomonas reinhardtti

    International Nuclear Information System (INIS)

    The nuclear cr-1 mutant of C. reinhardtii is deficient in the 30S subunit of the chloroplast (cp) ribosome and in cp protein synthesis. The cp spectinomycin resistant mutant, spr-u-1-27-3, has a normal level of 70S ribosomes but only a low rate of cp protein synthesis with spectinomycin present. In both mutants there is little accumulation of the large subunit of ribulose 1,5-bisphosphate carboxylase (Rubisco LSU), but near wild-type levels of cp synthesized r-proteins. In cells pulse-labelled with 35SO4 and immunoprecipitated with specific antisera, the ratio of the rate of synthesis of cp r-proteins to that of Rubisco LSU is 7 times greater in both mutants than in wild-type. No difference in the rate of turnover between r-proteins and Rubisco LSU in mutant and wild-type cells was observed during a one hour chase. The mRNA levels for r-protein L1 and Rubisco LSU actually increase slightly in the mutants. These data suggest that C. reinhardtii has a translation mechanism for preferential synthesis of cp r-proteins that operates under conditions of reduced total cp protein synthesis

  6. Dissecting ribosome assembly and transport in budding yeast. (United States)

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind


    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  7. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification. (United States)

    Sharma, Sunny; Lafontaine, Denis L J


    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  8. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction. (United States)

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles


    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  9. Association of a multi-synthetase complex with translating ribosomes in the archaeon Thermococcus kodakarensis

    DEFF Research Database (Denmark)

    Raina, Medha; Elgamal, Sara; Santangelo, Thomas J; Ibba, Michael


    In archaea and eukaryotes aminoacyl-tRNA synthetases (aaRSs) associate in multi-synthetase complexes (MSCs), however the role of such MSCs in translation is unknown. MSC function was investigated in vivo in the archaeon Thermococcus kodakarensis, wherein six aaRSs were affinity co-purified together...... with several other factors involved in protein synthesis, suggesting that MSCs may interact directly with translating ribosomes. In support of this hypothesis, the aminoacyl-tRNA synthetase (aaRS) activities of the MSC were enriched in isolated T. kodakarensis polysome fractions. These data indicate...... that components of the archaeal protein synthesis machinery associate into macromolecular assemblies in vivo and provide the potential to increase translation efficiency by limiting substrate diffusion away from the ribosome, thus facilitating rapid recycling of tRNAs. STRUCTURED SUMMARY OF PROTEIN...

  10. Comparing the three-dimensional structures of Dicistroviridae IGR IRES RNAs with other viral RNA structures


    Kieft, Jeffrey S.


    The intergenic region (IGR) internal ribosome entry site (IRES) RNAs do not require any of the canonical translation initiation factors to recruit the ribosome to the viral RNA, they eliminate the need for initiator tRNA, and they begin translation from the A-site. The function of these IRESs depends on a specific three-dimensional folded RNA structure. Thus, a complete understanding of the mechanisms of action of these IRESs requires that we understand their structure in detail. Recently, th...

  11. Cell-specific monitoring of protein synthesis in vivo.

    Directory of Open Access Journals (Sweden)

    Nikos Kourtis

    Full Text Available Analysis of general and specific protein synthesis provides important information, relevant to cellular physiology and function. However, existing methodologies, involving metabolic labelling by incorporation of radioactive amino acids into nascent polypeptides, cannot be applied to monitor protein synthesis in specific cells or tissues, in live specimens. We have developed a novel approach for monitoring protein synthesis in specific cells or tissues, in vivo. Fluorescent reporter proteins such as GFP are expressed in specific cells and tissues of interest or throughout animals using appropriate promoters. Protein synthesis rates are assessed by following fluorescence recovery after partial photobleaching of the fluorophore at targeted sites. We evaluate the method by examining protein synthesis rates in diverse cell types of live, wild type or mRNA translation-defective Caenorhabditis elegans animals. Because it is non-invasive, our approach allows monitoring of protein synthesis in single cells or tissues with intrinsically different protein synthesis rates. Furthermore, it can be readily implemented in other organisms or cell culture systems.

  12. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    Directory of Open Access Journals (Sweden)

    Maria Serena Fabbrini


    Full Text Available Ribosome-inactivating proteins (RIPs are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential.

  13. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi


    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J L; Levesque, C.A.; W. Chen; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de, R.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.


    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of thre...

  14. Attenuation of Rabies Virus Replication and Virulence by Picornavirus Internal Ribosome Entry Site Elements▿


    Marschalek, Adriane; Finke, Stefan; Schwemmle, Martin; Mayer, Daniel; Heimrich, Bernd; Stitz, Lothar; Conzelmann, Karl-Klaus


    Gene expression of nonsegmented negative-strand RNA viruses is regulated at the transcriptional level and relies on the canonical 5′-end-dependent translation of capped viral mRNAs. Here, we have used internal ribosome entry sites (IRES) from picornaviruses to control the expression level of the phosphoprotein P of the neurotropic rabies virus (RV; Rhabdoviridae), which is critically required for both viral replication and escape from the host interferon response. In a dual luciferase reporte...

  15. Nucleolar Organization, Ribosomal DNA Array Stability, and Acrocentric Chromosome Integrity Are Linked to Telomere Function


    Stimpson, Kaitlin M.; Sullivan, Lori L; Kuo, Molly E.; Sullivan, Beth A.


    The short arms of the ten acrocentric human chromosomes share several repetitive DNAs, including ribosomal RNA genes (rDNA). The rDNA arrays correspond to nucleolar organizing regions that coalesce each cell cycle to form the nucleolus. Telomere disruption by expressing a mutant version of telomere binding protein TRF2 (dnTRF2) causes non-random acrocentric fusions, as well as large-scale nucleolar defects. The mechanisms responsible for acrocentric chromosome sensitivity to dysfunctional tel...

  16. Viral Internal Ribosome Entry Site Structures Segregate into Two Distinct Morphologies


    Beales, Lucy P.; Holzenburg, Andreas; Rowlands, David J


    An increasing number of viruses have been shown to initiate protein synthesis by a cap-independent mechanism involving internal ribosome entry sites (IRESs). Predictions of the folding patterns of these RNA motifs have been based primarily on sequence and biochemical analyses. Biophysical confirmation of the models has been achieved only for the IRES of hepatitis C virus (HCV), which adopts an open structure consisting of two major stems. We have conducted an extensive comparison of flaviviru...

  17. A-Site Residues Move Independently from P-Site Residues in all-Atom Molecular Dynamics Simulations of the 70S Bacterial Ribosome


    Relly Brandman; Yigal Brandman; Pande, Vijay S.


    The ribosome is a large macromolecular machine, and correlated motion between residues is necessary for coordinating function across multiple protein and RNA chains. We ran two all-atom, explicit solvent molecular dynamics simulations of the bacterial ribosome and calculated correlated motion between residue pairs by using mutual information. Because of the short timescales of our simulation (ns), we expect that dynamics are largely local fluctuations around the crystal structure. We hypothes...

  18. Characterization of promoter elements required for cell-specific expression of the neurotensin/neuromedin N gene in a human endocrine cell line.


    Evers, B M; X Wang; Zhou, Z; Townsend, C M; McNeil, G P; Dobner, P R


    Expression of the gene encoding neurotensin/neuromedin N (NT/N) is mostly limited to the brain and specialized enteroendocrine cells (N cells) of the distal small intestine. We have analyzed the NT/N DNA sequences upstream of the RNA start site that direct cell-specific expression using a novel human endocrine cell line, BON, that resembles intestinal N cells in several important aspects, including NT/N precursor protein processing, ratios of different NT/N mRNA forms, and high levels of cons...

  19. Variability in ribosomal DNA genic and spacer regions in Verticillium dahliae isolates from different hosts

    Directory of Open Access Journals (Sweden)

    Otero Laura


    Full Text Available Using PCR-based assays with specific primers for amplification of the ribosomal DNA intergenic spacer region (IGS and a portion of the mitochondrial DNA small subunit ribosomal RNA gene (mtDNA SSU rRNA, the genetic variability among Verticillium dahliae isolates from olive (Olea europaea and other host species from Argentina and Brazil was estimated. The derived UPGMA-generated phenograms based upon the restriction fingerprinting data of rDNA IGS products revealed genetic differences, correlating with the host of origin. Isolates infecting olive genetically distinct from those from cocoa (Theobroma cacao and sunflower (Helianthus annuus. Digestion of mitochondrial DNA SSU rRNA PCR products revealed less variability, distinguishing only one isolate from sunflower. Ribosomal DNA ITS restriction patterns were identical for all isolates of V. dahliae, irrespective of host of origin. These preliminary results may have relevance for Verticillium wilt control practices, possibly reflecting a different evolutionary origin, or reproductive isolation of the pathogen in olive, distinct from populations of other hosts.

  20. Temporal Regulation of Distinct Internal Ribosome Entry Sites of the Dicistroviridae Cricket Paralysis Virus. (United States)

    Khong, Anthony; Bonderoff, Jennifer M; Spriggs, Ruth V; Tammpere, Erik; Kerr, Craig H; Jackson, Thomas J; Willis, Anne E; Jan, Eric


    Internal ribosome entry is a key mechanism for viral protein synthesis in a subset of RNA viruses. Cricket paralysis virus (CrPV), a member of Dicistroviridae, has a positive-sense single strand RNA genome that contains two internal ribosome entry sites (IRES), a 5'untranslated region (5'UTR) and intergenic region (IGR) IRES, that direct translation of open reading frames (ORF) encoding the viral non-structural and structural proteins, respectively. The regulation of and the significance of the CrPV IRESs during infection are not fully understood. In this study, using a series of biochemical assays including radioactive-pulse labelling, reporter RNA assays and ribosome profiling, we demonstrate that while 5'UTR IRES translational activity is constant throughout infection, IGR IRES translation is delayed and then stimulated two to three hours post infection. The delay in IGR IRES translation is not affected by inhibiting global translation prematurely via treatment with Pateamine A. Using a CrPV replicon that uncouples viral translation and replication, we show that the increase in IGR IRES translation is dependent on expression of non-structural proteins and is greatly stimulated when replication is active. Temporal regulation by distinct IRESs within the CrPV genome is an effective viral strategy to ensure optimal timing and expression of viral proteins to facilitate infection. PMID:26797630

  1. Structural characterization of ribosome recruitment and translocation by type IV IRES (United States)

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S


    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: PMID:27159451

  2. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    Energy Technology Data Exchange (ETDEWEB)

    Egyhazi, E.; Pigon, A. (Karolinska Institutet, Stockholm (Sweden)); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. (Univ. of Mississippi Medical Center, Jackson (USA))


    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  3. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    International Nuclear Information System (INIS)

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with 32P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of 32P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of 32P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of 32P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA

  4. La Autoantigen Induces Ribosome Binding Protein 1 (RRBP1) Expression through Internal Ribosome Entry Site (IRES)-Mediated Translation during Cellular Stress Condition. (United States)

    Gao, Wenqing; Li, Qi; Zhu, Ruiyu; Jin, Jian


    The function of ribosome binding protein 1 (RRBP1) is regulating the transportation and secretion of some intracellular proteins in mammalian cells. Transcription of RRBP1 is induced by various cytokines. However, few studies focused on the process of RRPB1 mRNA translation. The RRBP1 mRNA has a long 5' untranslated region that potentially formed a stable secondary structure. In this study, we show that the 5' UTR of RRBP1 mRNA contains an internal ribosome entry site (IRES). Moreover, the RRBP1 expression is induced by chemotherapeutic drug paclitaxel or adriamycin in human hepatocellular carcinoma cells and accompanied with the increased expression of La autoantigen (La), which binds to RRBP1 IRES element and facilitates translation initiation. Interestingly, we found IRES-mediated RRBP1 translation is also activated during serum-starvation condition which can induce cytoplasmic localization of La. After mapping the entire RRBP1 5' UTR, we determine the core IRES activity is located between nt-237 and -58. Furthermore, two apical GARR loops within the functional RRBP1 IRES elements may be important for La binding. These results strongly suggest an important role for IRES-dependent translation of RRBP1 mRNA in hepatocellular carcinoma cells during cellular stress conditions. PMID:27447629

  5. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.;


    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha}-methylgluc......The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  6. The stringent factor RelA adopts an open conformation on the ribosome to stimulate ppGpp synthesis. (United States)

    Arenz, Stefan; Abdelshahid, Maha; Sohmen, Daniel; Payoe, Roshani; Starosta, Agata L; Berninghausen, Otto; Hauryliuk, Vasili; Beckmann, Roland; Wilson, Daniel N


    Under stress conditions, such as nutrient starvation, deacylated tRNAs bound within the ribosomal A-site are recognized by the stringent factor RelA, which converts ATP and GTP/GDP to (p)ppGpp. The signaling molecules (p)ppGpp globally rewire the cellular transcriptional program and general metabolism, leading to stress adaptation. Despite the additional importance of the stringent response for regulation of bacterial virulence, antibiotic resistance and persistence, structural insight into how the ribosome and deacylated-tRNA stimulate RelA-mediated (p)ppGpp has been lacking. Here, we present a cryo-EM structure of RelA in complex with the Escherichia coli 70S ribosome with an average resolution of 3.7 Å and local resolution of 4 to >10 Å for RelA. The structure reveals that RelA adopts a unique 'open' conformation, where the C-terminal domain (CTD) is intertwined around an A/T-like tRNA within the intersubunit cavity of the ribosome and the N-terminal domain (NTD) extends into the solvent. We propose that the open conformation of RelA on the ribosome relieves the autoinhibitory effect of the CTD on the NTD, thus leading to stimulation of (p)ppGpp synthesis by RelA. PMID:27226493

  7. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome. (United States)

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina


    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  8. Structural characterization of mRNA-tRNA translocation intermediates


    Agirrezabala, Xabier; Liao, Hstau Y.; Schreiner, Eduard; Fu, Jie; Ortiz-Meoz, Rodrigo F.; Schulten, Klaus; Green, Rachel; Frank, Joachim


    Cryo-EM analysis of a wild-type Escherichia coli pretranslocational sample has revealed the presence of previously unseen intermediate substates of the bacterial ribosome during the first phase of translocation, characterized by intermediate intersubunit rotations, L1 stalk positions, and tRNA configurations. Furthermore, we describe the domain rearrangements in quantitative terms, which has allowed us to characterize the processivity and coordination of the conformational reorganization of t...

  9. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte


    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  10. The Kissing-Loop T-Shaped Structure Translational Enhancer of Pea Enation Mosaic Virus Can Bind Simultaneously to Ribosomes and a 5′ Proximal Hairpin (United States)

    Gao, Feng; Gulay, Suna P.; Kasprzak, Wojciech; Dinman, Jonathan D.


    The Pea Enation Mosaic Virus (PEMV) 3′ translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5′-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5′ and 3′ PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3′ translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2′-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5′ hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5′ end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  11. Downregulation of rRNA Transcription Triggers Cell Differentiation


    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura


    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  12. 核糖体小亚基RNA和细胞色素氧化酶亚单位Ⅱ基因在中国利什曼原虫系统发育学分析中应用的比较%Comparison on the difference between the analysis of phylogenetic relationships of Leishmania isolates from China with small subunit ribosomal RNA and cytochrome oxidase Ⅱ gene

    Institute of Scientific and Technical Information of China (English)

    曹得萍; 廖琳; 陈达丽; 陈建平


    目的 比较核糖体小亚基RNA(small subunit ribosomal RNA,SSUrRNA)和细胞色素氧化酶亚单位Ⅱ(cytochrome oxidaseⅡ,COXⅡ)这2种分子标志在中国利什曼原虫系统发育学分析中的不同. 方法 提取利什曼原虫各虫株核基因组和线粒体基因组,PCR方法扩增中国不同地区利什曼原虫SSUrRNA和COXⅡ基因,扩增产物送上海生工生物工程技术服务有限公司测序,序列碱基通过Clustal X软件比对,用DAMBE软件进行单倍型分析、Mega4软件计算遗传距离,Mrbayes3.1.2软件构建贝叶斯进化树. 结果 COXⅡ分析结果表明,流行于中国的利什曼原虫虫株未形成一个单系群;GS7和XJ771属于杜氏利什曼原虫复合体;10株利什曼原虫形成的6个单倍型(MHOM/CN/93/GS7,IPHUCN/77/XJ771,MHOM/CN/84/JS1和MGER/CN/60/GS-GER20除外)形成1个单系群;而SSUrRNA分析结果表明:11株利什曼原虫(IPHL/CN/77/XJ771,MH OM/CN/93/GS7,MRHO/CN/88/KXG-2,MHOM/CN/84/JS1,MGER/CN/60/GS-GER20除外)形成一个独立枝;江苏株JS1和热带利什曼原虫聚在一起,不与杜氏利什曼原虫聚在一起. 结论 SSUrRNA和COXⅡ得出的结果较一致,但COXⅡ基因在分析利仟曼原虫的系统发育关系时,可能是一个更可靠的遗传标志.%Objective To compare the difference between the analysis on the phylogenetic relationships of Leishmania isolates from different foci in China with partial fragment of small subunit ribosomal RNA (SSUrRNA) gene sequences or kinetoplast cytochrome oxidase Ⅱ (COX Ⅱ) gene sequences.Methods Genomic DNA and kinetoplast DNA were extracted from the promastigotes.The CO Ⅱ and SSUrRNA genes were amplified using respective primers.Products of PCR were sent to a commercial company for sequencing using the same PCR primer.Combined sequences matrix was aligned using Clustal X (1.8) with default settings and refined manually.Bayesian tree was constructed using Mrbayes-3.1.2.Results Leishmania isolates from different foci in China

  13. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.; Trier Hansen, M.; Pato, M. L.


    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  14. Dynamics of ribosome scanning and recycling revealed by translation complex profiling. (United States)

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas


    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  15. Analogies between the tRNA methylating enzymes and tRNA's in embryonic and tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Borek, E.


    Progress is reported in the following areas of research, role of tRNA in protein synthesis and as a carrier of amino acids; histidine pathway in Salmonella typhimurium; role of tRNA in regulation of translation; ribosomal binding reactions; role of tRNA in hemoglobin synthesis; population of tRNA's in mutant of Drosophila; methylation of tRNA and DNA by dimethylnitrosamine; purification of DNA methylase from HeLa cell nuclei; effects of age on levels of excretion of tRNA breakdown products in cancer patients; and tyrosyl tRNA's in embryonic and adult liver and in hepatomas. (HLW)

  16. Transfer RNA's latest port of call

    DEFF Research Database (Denmark)

    Santos, Manuel A S; Orellana, Omar; Ibba, Michael


    International tRNA Workshop just a few months after the awarding of the Nobel Prize for the structure of the ribosome was particularly fitting. Over 250 scientists gathered from January 28 to February 2, 2010 in the charming town of Aveiro on the Atlantic coast of Portugal to discuss the latest advances in our...

  17. RiboAbacus: a model trained on polyribosome images predicts ribosome density and translational efficiency from mammalian transcriptomes. (United States)

    Lauria, Fabio; Tebaldi, Toma; Lunelli, Lorenzo; Struffi, Paolo; Gatto, Pamela; Pugliese, Andrea; Brigotti, Maurizio; Montanaro, Lorenzo; Ciribilli, Yari; Inga, Alberto; Quattrone, Alessandro; Sanguinetti, Guido; Viero, Gabriella


    Fluctuations in mRNA levels only partially contribute to determine variations in mRNA availability for translation, producing the well-known poor correlation between transcriptome and proteome data. Recent advances in microscopy now enable researchers to obtain high resolution images of ribosomes on transcripts, providing precious snapshots of translation in vivo. Here we propose RiboAbacus, a mathematical model that for the first time incorporates imaging data in a predictive model of transcript-specific ribosome densities and translational efficiencies. RiboAbacus uses a mechanistic model of ribosome dynamics, enabling the quantification of the relative importance of different features (such as codon usage and the 5' ramp effect) in determining the accuracy of predictions. The model has been optimized in the human Hek-293 cell line to fit thousands of images of human polysomes obtained by atomic force microscopy, from which we could get a reference distribution of the number of ribosomes per mRNA with unmatched resolution. After validation, we applied RiboAbacus to three case studies of known transcriptome-proteome datasets for estimating the translational efficiencies, resulting in an increased correlation with corresponding proteomes. RiboAbacus is an intuitive tool that allows an immediate estimation of crucial translation properties for entire transcriptomes, based on easily obtainable transcript expression levels. PMID:26240374

  18. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad


    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  19. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly. (United States)

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G


    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  20. A Stochastic Model of RNA Translation with Frameshifting (United States)

    Bailey, Brenae


    Many viruses can produce different proteins from the same RNA sequence by encoding them in overlapping genes. One mechanism that causes the ribosomes of infected cells to decode both genes is called programmed ribosomal frameshifting (PRF). Although PRF has been recognized for 25 years, the mechanism is not well understood. We have developed a model that treats RNA translation as a stochastic process in which the transition probabilities are based on the free energies of local molecular interactions. The model reproduces observed translation rates and frameshift efficiencies, and can be used to predict the effects of mutations in the viral RNA sequence on both the mean translation rate and the frameshift efficiency.

  1. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A


    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  2. A stochastic model of translation with −1 programmed ribosomal frameshifting

    International Nuclear Information System (INIS)

    Many viruses produce multiple proteins from a single mRNA sequence by encoding overlapping genes. One mechanism to decode both genes, which reside in alternate reading frames, is −1 programmed ribosomal frameshifting. Although recognized for over 25 years, the molecular and physical mechanism of −1 frameshifting remains poorly understood. We have developed a mathematical model that treats mRNA translation and associated −1 frameshifting as a stochastic process in which the transition probabilities are based on the energetics of local molecular interactions. The model predicts both the location and efficiency of −1 frameshift events in HIV-1. Moreover, we compute −1 frameshift efficiencies upon mutations in the viral mRNA sequence and variations in relative tRNA abundances, predictions that are directly testable in experiment. (paper)

  3. Hijacking the translation apparatus by RNA viruses


    Bushell, Martin; Sarnow, Peter


    As invading viruses do not harbor functional ribosomes in their virions, successful amplification of the viral genomes requires that viral mRNAs compete with cellular mRNAs for the host cell translation apparatus. Several RNA viruses have evolved remarkable strategies to recruit the host translation initiation factors required for the first steps in translation initiation by host cell mRNAs. This review describes the ways that three families of RNA viruses effectively usurp limiting translati...

  4. Ribosomal Initiation Complex Assembly within the Wild-Strain of Coxsackievirus B3 and Live-Attenuated Sabin3-like IRESes during the Initiation of Translation

    Directory of Open Access Journals (Sweden)

    Nathalie Chamond


    Full Text Available Coxsackievirus B3 (CVB3 is an enterovirus of the family of Picornaviridae. The Group B coxsackieviruses include six serotypes (B1 to B6 that cause a variety of human diseases, including myocarditis, meningitis, and diabetes. Among the group B, the B3 strain is mostly studied for its cardiovirulence and its ability to cause acute and persistent infections. Translation initiation of CVB3 RNA has been shown to be mediated by a highly ordered structure of the 5’-untranslated region (5’UTR, which harbors an internal ribosome entry site (IRES. Translation initiation is a complex process in which initiator tRNA, 40S and 60S ribosomal subunits are assembled by eukaryotic initiation factors (eIFs into an 80S ribosome at the initiation codon of the mRNA. We have previously addressed the question of whether the attenuating mutations of domain V of the poliovirus IRES were specific for a given genomic context or whether they could be transposed and extrapolated to a genomic related virus, i.e., CVB3 wild-type strain. In this context, we have described that Sabin3-like mutation (U473→C introduced in CVB3 genome led to a defective mutant with a serious reduction in translation efficiency. In this study, we analyzed the efficiency of formation of ribosomal initiation complexes 48S and 80S through 10%–30% and 10%–50% sucrose gradients using rabbit reticulocyte lysates (RRLs and stage-specific translation inhibitors: 5'-Guanylyl-imidodiphosphate (GMP-PNP and Cycloheximide (CHX, respectively. We demonstrated that the interaction of 48S and 80S ribosomal complexes within the mutant CVB3 RNA was abolished compared with the wild-type RNA by ribosome assembly analysis. Taken together, it is possible that the mutant RNA was unable to interact with some trans-acting factors critical for enhanced IRES function.

  5. An automated procedure for covariation-based detection of RNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.


    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  6. An automated procedure for covariation-based detection of RNA structure

    International Nuclear Information System (INIS)

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

  7. Characterization of RNA damage under oxidative stress in Escherichia coli (United States)

    Liu, Min; Gong, Xin; Alluri, Ravi Kumar; Wu, Jinhua; Sablo, Tene’; Li, Zhongwei


    We have examined the level of 8-hydroxyguanosine (8-oxo-G), an oxidized form of guanosine, in RNA in Escherichia coli under normal and oxidative stress conditions. The level of 8-oxo-G in RNA rises rapidly and remains high for hours in response to hydrogen peroxide (H2O2) challenge in a dose-dependent manner. H2O2 induced elevation of 8-oxo-G content is much higher in RNA than that of 8-hydroxydeoxyguanosine (8-oxo-dG) in DNA. Under normal conditions, the 8-oxo-G level is low in RNA isolated from the ribosome and it is nearly three times higher in non-ribosomal RNAs. In contrast, 8-oxo-G generated by a short exposure to H2O2 is almost equally distributed in various RNA species, suggesting that although ribosomal RNAs are normally less oxidized, they are not protected against exogenous H2O2. Interestingly, highly folded RNA is not protected from oxidation because 8-oxo-G generated by H2O2 treatment in vitro increases to approximately the same levels in tRNA and rRNA in both native and denatured forms. Lastly, increased RNA oxidation is closely associated with cell death by oxidative stress. Our data suggests that RNA is a primary target for reactive oxygen species and RNA oxidation is part of the paradox that cells have to deal with under oxidative stress. PMID:22718628

  8. Towards an understanding of cell-specific functions of signal-dependent transcription factors


    Zhang, Dawn X.; Glass, Christopher K.


    The ability to regulate gene expression in a cell-specific manner is a feature of many broadly expressed signal-dependent transcription factors, including nuclear hormone receptors and transcription factors that are activated by cell surface receptors for extracellular signals. As the most plastic cells of the hematopoietic system, macrophages are responsive to a wide spectrum of regulatory molecules and provide a robust model system for investigation of the basis for cell-specific transcript...

  9. Onset of cell-specific gene expression in the developing mouse pancreas.


    Gittes, G K; Rutter, W J


    A central question in developmental biology has been the initiation of cell-specific gene expression and its temporal relationship to morphogenesis. We have coupled embryo microdissection with the exquisite sensitivity of the polymerase chain reaction to define the onset of cell-specific gene expression during pancreatic organogenesis. Using the precise assignment of gestational age by the number of somites in each embryo, we determined the onset of transcription of major genes of the endocri...

  10. Morphological variation of individual Escherichia coli 50S ribosomal subunits in situ, as revealed by cryo-electron tomography

    International Nuclear Information System (INIS)

    Electron tomography (ET) has been used to reconstruct in situ individual 50S ribosomal subunits in Escherichia coli rifampicin-treated cells. Rifampicin inhibits transcription initiation. As a result, rapid degradation of preformed mRNA and dissociation of 70S ribosomes give accumulation of free subunits. In the 50S subunit, the L1 stalk, the L7/L12 stalk, the central protuberance (CP), and the peptidyl transferase center (PTC) cleft are the most dynamic and flexible parts in the reconstructed structures with clear movements indicated. Different locations of the tunnel in the central cross-sections through the in situ 50S subunits indicate the flexible nature of the pathway inside the large ribosomal subunit. In addition, gross morphological heterogeneity was observed in the reconstructions. Our results demonstrate a considerable structural variability among individual 50S subunits in the intracellular environment

  11. Cloning and expression of antiviral/ribosome-inactivating protein from Bougainvillea xbuttiana

    Indian Academy of Sciences (India)

    Nandlal Choudhary; Harish C Kapoor; Madan L Lodha


    A full-length cDNA encoding ribosome-inactivating/antiviral protein (RIP/AVP) from the leaves of Bougainvillea xbuttiana was isolated. The cDNA consisted of 1364 nucleotides with an open reading frame (ORF) of 960 nucleotides encoding a 35.49 kDa protein of 319 amino acids. The deduced amino acid sequence has a putative active domain conserved in RIPs/AVPs and shows a varying phylogenetic relationship to the RIPs from other plant species. The deduced protein has been designated BBAP1 (Bougainvillea xbuttiana antiviral protein1). The ORF was cloned into an expression vector and expressed in E. coli as a fusion protein of ∼78 kDa. The cleaved and purified recombinant BBAP1 exhibited ribosome-inhibiting rRNA -glycosidase activity, and imparted a high level of resistance against the tobacco mosaic virus (TMV).

  12. Neurodegeneration-associated instability of ribosomal DNA


    Hallgren, Justin; Pietrzak, Maciej; Rempala, Grzegorz; Nelson, Peter T.; Hetman, Michal


    Homologous recombination (HR)-mediated instability of the repetitively organized ribosomal DNA (rDNA) has been proposed as a mediator of cell senescence in yeast triggering the DNA damage response. High individual variability in the content of human rDNA suggests that this genomic region remained relatively unstable throughout evolution. Therefore, quantitative real time PCR was used to determine the genomic content of rDNA in post mortem samples of parietal cortex from 14 young- and 9 elderl...

  13. Isolation of antibiotic resistance mutations in the rRNA by using an in vitro selection system


    Cochella, Luisa; Green, Rachel


    Genetic, biochemical, and structural data support an essential role for the ribosomal RNA in all steps of the translation process. Although in vivo genetic selection techniques have been used to identify mutations in the rRNAs that result in various miscoding phenotypes and resistance to known ribosome-targeted antibiotics, these are limited because the resulting mutant ribosomes must be only marginally disabled if they are able to support growth of the cell. Furthermore, in vivo, it is not p...

  14. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.


    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F


    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  15. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides


    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.


    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and...

  16. An RNA editing fingerprint of cancer stem cell reprogramming


    Crews, Leslie A; Jiang, Qingfei; Zipeto, Maria A; de Lazzari, Elisa; Court, Angela C.; Ali, Shawn; Barrett, Christian L.; Frazer, Kelly A; Jamieson, Catriona HM


    Background Deregulation of RNA editing by adenosine deaminases acting on dsRNA (ADARs) has been implicated in the progression of diverse human cancers including hematopoietic malignancies such as chronic myeloid leukemia (CML). Inflammation-associated activation of ADAR1 occurs in leukemia stem cells specifically in the advanced, often drug-resistant stage of CML known as blast crisis. However, detection of cancer stem cell-associated RNA editing by RNA sequencing in these rare cell populatio...

  17. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A


    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  18. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  19. Cleavage of the sarcin–ricin loop of 23S rRNA differentially affects EF-G and EF-Tu binding


    García-Ortega, Lucía; Álvarez-García, Elisa; Gavilanes, José G.; Martínez-del-Pozo, Álvaro; Joseph, Simpson


    Ribotoxins are potent inhibitors of protein biosynthesis and inactivate ribosomes from a variety of organisms. The ribotoxin α-sarcin cleaves the large 23S ribosomal RNA (rRNA) at the universally conserved sarcin–ricin loop (SRL) leading to complete inactivation of the ribosome and cellular death. The SRL interacts with translation factors that hydrolyze GTP, and it is important for their binding to the ribosome, but its precise role is not yet understood. We studied the effect of α-sarcin on...

  20. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T


    The antibiotic chloramphenicol produces modifications in 23S rRNA when bound to ribosomes from the bacterium Escherichia coli and the archaeon Halobacterium halobium and irradiated with 365 nm light. The modifications map to nucleotides m(5)U747 and C2611/C2612, in domains II and V, respectively......, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site on...