WorldWideScience

Sample records for cell-specific ribosomal rna

  1. Reconstitution of functional eukaryotic ribosomes from Dictyostelium discoideum ribosomal proteins and RNA.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S

    1997-08-08

    40 and 60 S ribosomal subunits have been reconstituted in vitro from purified ribosomal RNA and ribosomal proteins of Dictyostelium discoideum. The functionality of the reconstituted ribosomes was demonstrated in in vitro mRNA-directed protein synthesis. The reassembly proceeded well with immature precursors of ribosomal RNA but poorly if at all with mature cytoplasmic RNA species. Reassembly also required a preparation of small nuclear RNA(s), acting as morphopoietic factor(s).

  2. Ribosomal RNA pseudouridines and pseudouridine synthases.

    Science.gov (United States)

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  3. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  4. Reverse Translocation of tRNA in the Ribosome

    OpenAIRE

    2006-01-01

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes ...

  5. Structural features of the tmRNA-ribosome interaction.

    Science.gov (United States)

    Bugaeva, Elizaveta Y; Surkov, Serhiy; Golovin, Andrey V; Ofverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A; Bogdanov, Alexey A; Shpanchenko, Olga V; Dontsova, Olga A

    2009-12-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA-ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation.

  6. Mapping the interaction of SmpB with ribosomes by footprinting of ribosomal RNA

    Science.gov (United States)

    Ivanova, Natalia; Pavlov, Michael Y.; Bouakaz, Elli; Ehrenberg, Måns; Schiavone, Lovisa Holmberg

    2005-01-01

    In trans-translation transfer messenger RNA (tmRNA) and small protein B (SmpB) rescue ribosomes stalled on truncated or in other ways problematic mRNAs. SmpB promotes the binding of tmRNA to the ribosome but there is uncertainty about the number of participating SmpB molecules as well as their ribosomal location. Here, the interaction of SmpB with ribosomal subunits and ribosomes was studied by isolation of SmpB containing complexes followed by chemical modification of ribosomal RNA with dimethyl sulfate, kethoxal and hydroxyl radicals. The results show that SmpB binds 30S and 50S subunits with 1:1 molar ratios and the 70S ribosome with 2:1 molar ratio. SmpB-footprints are similar on subunits and the ribosome. In the 30S subunit, SmpB footprints nucleotides that are in the vicinity of the P-site facing the E-site, and in the 50S subunit SmpB footprints nucleotides that are located below the L7/L12 stalk in the 3D structure of the ribosome. Based on these results, we suggest a mechanism where two molecules of SmpB interact with tmRNA and the ribosome during trans-translation. The first SmpB molecule binds near the factor-binding site on the 50S subunit helping tmRNA accommodation on the ribosome, whereas the second SmpB molecule may functionally substitute for a missing anticodon stem–loop in tmRNA during later steps of trans-translation. PMID:15972795

  7. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  8. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  9. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly

    Directory of Open Access Journals (Sweden)

    Oliver Rackham

    2016-08-01

    Full Text Available The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE and RNA-seq enabled us to identify that in vivo 5′ tRNA cleavage precedes 3′ tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome.

  10. mRNA pseudoknot structures can act as ribosomal roadblocks

    DEFF Research Database (Denmark)

    Hansen, Jesper Tholstrup; Oddershede, Lene Broeng; Sørensen, Michael Askvad

    2012-01-01

    Several viruses utilize programmed ribosomal frameshifting mediated by mRNA pseudoknots in combination with a slippery sequence to produce a well defined stochiometric ratio of the upstream encoded to the downstream-encoded protein. A correlation between the mechanical strength of mRNA pseudoknot...

  11. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  12. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  13. Polyadenylation of ribosomal RNA in human cells

    OpenAIRE

    Slomovic, Shimyn; Laufer, David; Geiger, Dan; Schuster, Gadi

    2006-01-01

    The addition of poly(A)-tails to RNA is a process common to almost all organisms. In eukaryotes, stable poly(A)-tails, important for mRNA stability and translation initiation, are added to the 3′ ends of most nuclear-encoded mRNAs, but not to rRNAs. Contrarily, in prokaryotes and organelles, polyadenylation stimulates RNA degradation. Recently, polyadenylation of nuclear-encoded transcripts in yeast was reported to promote RNA degradation, demonstrating that polyadenylation can play a double-...

  14. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  15. The European database on small subunit ribosomal RNA

    OpenAIRE

    Wuyts, Jan; Van de Peer, Yves; Winkelmans, Tina; De Wachter, Rupert

    2002-01-01

    The European database on SSU rRNA can be consulted via the World WideWeb at http://rrna.uia.ac.be/ssu/ and compiles all complete or nearly complete small subunit ribosomal RNA sequences. Sequences are provided in aligned format. The alignment takes into account the secondary structure information derived by comparative sequence analysis of thousands of sequences. Additional information such as literature references, taxonomy, secondary structure models and nucleotide variability maps, is also...

  16. Depletion of Ribosomal RNA Sequences from Single-Cell RNA-Sequencing Library.

    Science.gov (United States)

    Fang, Nan; Akinci-Tolun, Rumeysa

    2016-07-01

    Recent advances in single-cell RNA sequencing technologies have revealed high heterogeneity of gene expression profiles in individual cells. However, most current single-cell RNA-seq methods use oligo-dT priming in the reverse transcription steps and detect only polyA-positive for more accuracy, since there are also polyA-positive non-coding RNAs transcripts, not other important RNA species, such as polyA-negative noncoding RNA. Reverse transcription using random oligos enables detection of not only the noncoding RNA species without polyA tails, but also ribosomal RNA (rRNA). rRNA comprises more than 90% of the total RNA and should be depleted from the RNA-seq library to ensure efficient usage of the sequencing capacity. Commonly used hybridization-based rRNA depletion methods can preserve noncoding RNA in the standard RNA-seq library. However, such rRNA depletion methods require high input amounts of total RNA and do not work at the single-cell level or with limited input DNA. This unit describes a novel procedure for RNA-seq library construction from single cells or a minimal amount of RNA. A thermostable duplex-specific nuclease is used in this method to effectively remove ribosomal RNA sequences following whole-transcriptome amplification and sequencing library construction. © 2016 by John Wiley & Sons, Inc.

  17. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  18. Traffic of interacting ribosomes on mRNA during protein synthesis: effects of chemo-mechanics of individual ribosomes

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many {\\it ribosomes} simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. In contrast to the earlier models, here {\\it we develope a ``unified'' theoretical model} that not only incorporates the {\\it mutual exclusions} of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze the rates of protein synthesis and the spatio-temporal oraganization of the ribosomes in this model. We also predict how these properties would change with the changes in the rates of the various chemo-mechanical processes in each ribosome. Finally, we illustrate the power of this model by making experimentally testable predictions on the rates of protein synthesis and the density profiles of the ribosomes on some mRNAs in {\\it E-coli}.

  19. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  20. Patterns and regulation of ribosomal RNA transcription in Borrelia burgdorferi

    Directory of Open Access Journals (Sweden)

    Schwartz Ira

    2011-01-01

    Full Text Available Abstract Background Borrelia burgdorferi contains one 16S and two tandem sets of 23S-5S ribosomal (r RNA genes whose patterns of transcription and regulation are unknown but are likely to be critical for survival and persistence in its hosts. Results RT-PCR of B. burgdorferi N40 and B31 revealed three rRNA region transcripts: 16S rRNA-alanine transfer RNA (tRNAAla; tRNAIle; and both sets of 23S-5S rRNA. At 34°C, there were no differences in growth rate or in accumulation of total protein, DNA and RNA in B31 cultured in Barbour-Stoenner-Kelly (BSK-H whether rabbit serum was present or not. At 23°C, B31 grew more slowly in serum-containing BSK-H than at 34°C. DNA per cell was higher in cells in exponential as compared to stationary phase at either temperature; protein per cell was similar at both temperatures in both phases. Similar amounts of rRNA were produced in exponential phase at both temperatures, and rRNA was down-regulated in stationary phase at either temperature. Interestingly, a relBbu deletion mutant unable to generate (pppGpp did not down-regulate rRNA at transition to stationary phase in serum-containing BSK-H at 34°C, similar to the relaxed phenotype of E. coli relA mutants. Conclusions We conclude that rRNA transcription in B. burgdorferi is complex and regulated both by growth phase and by the stringent response but not by temperature-modulated growth rate.

  1. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  2. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    Science.gov (United States)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  3. The Arabidopsis translatome cell-specific mRNA atlas: Mining suberin and cutin lipid monomer biosynthesis genes as an example for data application.

    Science.gov (United States)

    Mustroph, Angelika; Bailey-Serres, Julia

    2010-03-01

    Plants consist of distinct cell types distinguished by position, morphological features and metabolic activities. We recently developed a method to extract cell-type specific mRNA populations by immunopurification of ribosome-associated mRNAs. Microarray profiles of 21 cell-specific mRNA populations from seedling roots and shoots comprise the Arabidopsis Translatome dataset. This gene expression atlas provides a new tool for the study of cell-specific processes. Here we provide an example of how genes involved in a pathway limited to one or few cell-types can be further characterized and new candidate genes can be predicted. Cells of the root endodermis produce suberin as an inner barrier between the cortex and stele, whereas the shoot epidermal cells form cutin as a barrier to the external environment. Both polymers consist of fatty acid derivates, and share biosynthetic origins. We use the Arabidopsis Translatome dataset to demonstrate the significant cell-specific expression patterns of genes involved in those biosynthetic processes and suggest new candidate genes in the biosynthesis of suberin and cutin.

  4. Cyclin-dependent kinase 9 links RNA polymerase II transcription to processing of ribosomal RNA.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

    2013-07-19

    Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3' extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3' processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3' rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing.

  5. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    OpenAIRE

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-01-01

    International audience; Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. He...

  6. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  7. tmRNA-SmpB: a journey to the centre of the bacterial ribosome.

    Science.gov (United States)

    Weis, Félix; Bron, Patrick; Giudice, Emmanuel; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-11-17

    Ribosomes mediate protein synthesis by decoding the information carried by messenger RNAs (mRNAs) and catalysing peptide bond formation between amino acids. When bacterial ribosomes stall on incomplete messages, the trans-translation quality control mechanism is activated by the transfer-messenger RNA bound to small protein B (tmRNA-SmpB ribonucleoprotein complex). Trans-translation liberates the stalled ribosomes and triggers degradation of the incomplete proteins. Here, we present the cryo-electron microscopy structures of tmRNA-SmpB accommodated or translocated into stalled ribosomes. Two atomic models for each state are proposed. This study reveals how tmRNA-SmpB crosses the ribosome and how, as the problematic mRNA is ejected, the tmRNA resume codon is placed onto the ribosomal decoding site by new contacts between SmpB and the nucleotides upstream of the tag-encoding sequence. This provides a structural basis for the transit of the large tmRNA-SmpB complex through the ribosome and for the means by which the tmRNA internal frame is set for translation to resume.

  8. rRNA maturation as a "quality" control step in ribosomal subunit assembly in Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Chiaberge, S; Bulfone, S

    1997-10-31

    In Dictyostelium discoideum, newly assembled ribosomal subunits enter polyribosomes while they still contain immature rRNA. rRNA maturation requires the engagement of the subunits in protein synthesis and leads to stabilization of their structure. Maturation of pre-17 S rRNA occurs only after the newly formed 40 S ribosomal particle has entered an 80 S ribosome and participated at least in the formation of one peptide bond or in one translocation event; maturation of pre-26 S rRNA requires the presence on the 80 S particle of a peptidyl-tRNA containing at least 6 amino acids. Newly assembled particles that cannot fulfill these requirements for structural reasons are disassembled into free immature rRNA and ribosomal proteins.

  9. Dynamics of translation by single ribosomes through mRNA secondary structures

    OpenAIRE

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L.; Reiche, Michael; Farrell, Ian; Cooperman, Barry S.; Goldman, Yale E.

    2013-01-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary (2°) structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we employ single molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem loop or pseudoknot mRNA 2° structures. Downstream ...

  10. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting

    DEFF Research Database (Denmark)

    Hansen, Thomas Møller; Reihani, S Nader S; Oddershede, Lene B;

    2007-01-01

    " that predicts some physical barrier is needed to force the ribosome into the -1 frame. Also, our findings support the recent observation made by cryoelectron microscopy that mechanical interaction between a ribosome and a pseudoknot causes a deformation of the A-site tRNA. The result has implications...... for the understanding of genetic regulation, reading frame maintenance, tRNA movement, and unwinding of mRNA secondary structures by ribosomes.......Programmed ribosomal frameshifting is often used by viral pathogens including HIV. Slippery sequences present in some mRNAs cause the ribosome to shift reading frame. The resulting protein is thus encoded by one reading frame upstream from the slippery sequence and by another reading frame...

  11. Cell-specific detection of microRNA expression during cardiomyogenesis by combined in situ hybridization and immunohistochemistry

    DEFF Research Database (Denmark)

    Schneider, Mikael; Andersen, Ditte Caroline; Silahtaroglu, Asli

    2011-01-01

    . However, although several miRNAs have been identified as differentially regulated during cardiac development and disease, their distinct cell-specific localization remains largely undetermined, likely owing to a lack of adequate methods. We therefore report the development of a markedly improved approach...... combining fluorescence-based miRNA-in situ hybridization (miRNA-ISH) with immunohistochemistry (IHC). We have applied this protocol to differentiating embryoid bodies (EBs) as well as embryonic and adult mouse hearts, to detect miRNAs that were upregulated during EB cardiomyogenesis, as determined by array...... present highlight the importance of determining exact cell-specific localization of miRNAs by sequential miRNA-ISH and IHC in studies aiming at understanding the role of miRNAs and their targets. This approach will hopefully aid in identifying relevant miRNA targets of both the heart and other organs....

  12. Choreography of molecular movements during ribosome progression along mRNA.

    Science.gov (United States)

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines.

  13. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  14. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.

    Science.gov (United States)

    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko

    2007-09-01

    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  15. Synthesis of fluorescent dye-doped silica nanoparticles for target-cell-specific delivery and intracellular microRNA imaging.

    Science.gov (United States)

    Li, Henan; Mu, Yawen; Qian, Shanshan; Lu, Jusheng; Wan, Yakun; Fu, Guodong; Liu, Songqin

    2015-01-21

    MicroRNA (miRNA) is found to be up-regulated in many kinds of cancer and therefore is classified as an oncomiR. Herein, we design a multifunctional fluorescent nanoprobe (FSiNP-AS/MB) with the AS1411 aptamer and a molecular beacon (MB) co-immobilized on the surface of the fluorescent dye-doped silica nanoparticles (FSiNPs) for target-cell-specific delivery and intracellular miRNA imaging. The FSiNPs were prepared by a facile reverse microemulsion method from tetraethoxysilane and silane derivatized coumarin that was previously synthesized by click chemistry. The as-prepared FSiNPs possess uniform size distribution, good optical stability and biocompatibility. In addition, there is a remarkable affinity interaction between the AS1411 aptamer and the nucleolin protein on the cancer cell surface. Thus, a target-cell-specific delivery system by the FSiNP-AS/MB is proposed for effectively transferring a MB into the cancer cells to recognize the target miRNA. Using miRNA-21 in MCF-7 cells (a human breast cancer cell line) as a model, the proposed multifunctional nanosystems not only allow target-cell-specific delivery with the binding affinity of AS1411, but also can track simultaneously the transfected cells and detect intracellular miRNA in situ. The proposed multifunctional nanosystems are a promising platform for a highly sensitive luminescent nonviral vector in biomedical and clinical research.

  16. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  17. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  18. What do we know about ribosomal RNA methylation in Escherichia coli?

    Science.gov (United States)

    Sergeeva, O V; Bogdanov, A A; Sergiev, P V

    2015-10-01

    A ribosome is a ribonucleoprotein that performs the synthesis of proteins. Ribosomal RNA of all organisms includes a number of modified nucleotides, such as base or ribose methylated and pseudouridines. Methylated nucleotides are highly conserved in bacteria and some even universally. In this review we discuss available data on a set of modification sites in the most studied bacteria, Escherichia coli. While most rRNA modification enzymes are known for this organism, the function of the modified nucleotides is rarely identified.

  19. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...... collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m...

  20. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    Science.gov (United States)

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  1. Dynamics of translation by single ribosomes through mRNA secondary structures.

    Science.gov (United States)

    Chen, Chunlai; Zhang, Haibo; Broitman, Steven L; Reiche, Michael; Farrell, Ian; Cooperman, Barry S; Goldman, Yale E

    2013-05-01

    During protein synthesis, the ribosome translates nucleotide triplets in single-stranded mRNA into polypeptide sequences. Strong downstream mRNA secondary structures, which must be unfolded for translation, can slow or even halt protein synthesis. Here we used single-molecule fluorescence resonance energy transfer to determine reaction rates for specific steps within the elongation cycle as the Escherichia coli ribosome encounters stem-loop or pseudoknot mRNA secondary structures. Downstream stem-loops containing 100% GC base pairs decrease the rates of both tRNA translocation within the ribosome and deacylated tRNA dissociation from the ribosomal exit site (E site). Downstream stem-loops or pseudoknots containing both GC and AU pairs also decrease the rate of tRNA dissociation, but they have little effect on tRNA translocation rate. Thus, somewhat unexpectedly, unfolding of mRNA secondary structures is more closely coupled to E-site tRNA dissociation than to tRNA translocation.

  2. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.

    Science.gov (United States)

    Robert, F; Brakier-Gingras, L

    2001-02-01

    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  3. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.

    Science.gov (United States)

    Rozier, C; Mache, R

    1984-10-11

    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  4. Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Douthwaite, S

    1992-01-01

    Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli ribosomes has been compared by chemical footprinting. The protection afforded by both drugs is limited to the peptidyl transferase loop of 23S rRNA. Under conditions of stoichiometric binding at 1 mM drug concentration...... of the two drugs for the ribosome, estimated by footprinting, is approximately the same, giving Kdiss values of 5 microM for lincomycin and 8 microM for clindamycin. The results show that in vitro the drugs are equally potent in blocking their ribosomal target site. Their inhibitory effects on peptide bond...

  5. The Expression of Antibiotic Resistance Methyltransferase Correlates with mRNA Stability Independently of Ribosome Stalling.

    Science.gov (United States)

    Dzyubak, Ekaterina; Yap, M N

    2016-12-01

    Members of the Erm methyltransferase family modify 23S rRNA of the bacterial ribosome and render cross-resistance to macrolides and multiple distantly related antibiotics. Previous studies have shown that the expression of erm is activated when a macrolide-bound ribosome stalls the translation of the leader peptide preceding the cotranscribed erm Ribosome stalling is thought to destabilize the inhibitory stem-loop mRNA structure and exposes the erm Shine-Dalgarno (SD) sequence for translational initiation. Paradoxically, mutations that abolish ribosome stalling are routinely found in hyper-resistant clinical isolates; however, the significance of the stalling-dead leader sequence is largely unknown. Here, we show that nonsense mutations in the Staphylococcus aureus ErmB leader peptide (ErmBL) lead to high basal and induced expression of downstream ErmB in the absence or presence of macrolide concomitantly with elevated ribosome methylation and resistance. The overexpression of ErmB is associated with the reduced turnover of the ermBL-ermB transcript, and the macrolide appears to mitigate mRNA cleavage at a site immediately downstream of the ermBL SD sequence. The stabilizing effect of antibiotics on mRNA is not limited to ermBL-ermB; cationic antibiotics representing a ribosome-stalling inducer and a noninducer increase the half-life of specific transcripts. These data unveil a new layer of ermB regulation and imply that ErmBL translation or ribosome stalling serves as a "tuner" to suppress aberrant production of ErmB because methylated ribosome may impose a fitness cost on the bacterium as a result of misregulated translation.

  6. Extraction of ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial community

    NARCIS (Netherlands)

    Duarte, G.F.; Rosado, A.S.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    1998-01-01

    A method for the indirect (cell extraction followed by nucleic acid extraction) isolation of bacterial ribosomal RNA (rRNA) and genomic DNA from soil was developed. The protocol allowed for the rapid parallel extraction of genomic DNA as well as small and large ribosomal subunit RNA from four soils

  7. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    Science.gov (United States)

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  8. Flipping of the ribosomal A-site adenines provides a basis for tRNA selection

    Science.gov (United States)

    Zeng, Xiancheng; Chugh, Jeetender; Casiano-Negroni, Anette; Al-Hashimi, Hashim M.; Brooks, Charles L.

    2014-01-01

    Ribosomes control the missense error rate of ~10−4 during translation though quantitative contributions of individual mechanistic steps of the conformational changes yet to be fully determined. Biochemical and biophysical studies led to a qualitative tRNA selection model in which ribosomal A-site residues A1492 and A1493 (A1492/3) flip out in response to cognate tRNA binding, promoting the subsequent reactions, but not in the case of near cognate or non-cognate tRNA. However, this model was recently questioned by X-ray structures revealing conformations of extrahelical A1492/3 and domain closure of the decoding center in both cognate and near-cognate tRNA bound ribosome complexes, suggesting that the non-specific flipping of A1492/3 has no active role in tRNA selection. We explore this question by carrying out molecular dynamics (MD) simulations, aided with fluorescence and NMR experiments, to probe the free energy cost of extrahelical flipping of 1492/3 and the strain energy associated with domain conformational change. Our rigorous calculations demonstrate that the A1492/3 flipping is indeed a specific response to the binding of cognate tRNA, contributing 3 kcal/mol to the specificity of tRNA selection. Furthermore, the different A-minor interactions in cognate and near-cognate complexes propagate into the conformational strain and contribute another 4 kcal/mol in domain closure. The recent structure of ribosome with features of extrahelical A1492/3 and closed domain in near-cognate complex is reconciled by possible tautomerization of the wobble base pair in mRNA-tRNA. These results quantitatively rationalize other independent experimental observations and explain the ribosomal discrimination mechanism of selecting cognate versus near-cognate tRNA. PMID:24813122

  9. A detailed view of a ribosomal active site: the structure of the L11-RNA complex.

    Science.gov (United States)

    Wimberly, B T; Guymon, R; McCutcheon, J P; White, S W; Ramakrishnan, V

    1999-05-14

    We report the crystal structure of a 58 nucleotide fragment of 23S ribosomal RNA bound to ribosomal protein L11. This highly conserved ribonucleoprotein domain is the target for the thiostrepton family of antibiotics that disrupt elongation factor function. The highly compact RNA has both familiar and novel structural motifs. While the C-terminal domain of L11 binds RNA tightly, the N-terminal domain makes only limited contacts with RNA and is proposed to function as a switch that reversibly associates with an adjacent region of RNA. The sites of mutations conferring resistance to thiostrepton and micrococcin line a narrow cleft between the RNA and the N-terminal domain. These antibiotics are proposed to bind in this cleft, locking the putative switch and interfering with the function of elongation factors.

  10. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.

    Science.gov (United States)

    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha

    2014-06-01

    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  11. Comment on "Length-dependent translation of messenger RNA by ribosomes"

    CERN Document Server

    Zhang, Yunxin

    2011-01-01

    In recent paper [Phys. Rev. E {\\bf 83}, 042903 (2011)], a simple model for the translation of messenger RNA by ribosomes is provided, and the expression of translational ratio of protein is given. In this comments, varied methods to get this ratio are addressed. Depending on a different method, we find that, roughly speaking, this translational ratio decays exponentially with mRNA length in prokaryotic cell, and reciprocally with mRNA length in eukaryotic cells.

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S rRNA, a...

  13. [Affinity modification of Escherichia coli ribosomes with photoactivated analogs of mRNA].

    Science.gov (United States)

    Gimautdinova, O I; Zenkova, M A; Karpova, G G; Podust, L M

    1984-01-01

    Oligoribonucleotide derivatives containing the photoactivated arylazidogroup at 5'-end of the oligonucleotide fragment [2-(N-2,4-dinitro-5-azidophenyl) aminoethyl] phosphamides of the oligoribonucleotides, azido-NH (CH2)2NHpN (pN) n-1, were prepared. It was demonstrated that azido-NH(CH2)2NHpA(pA)4 and azido-NH (CH2)2NHpU (pU)3 stimulate the binding of the codonspecific aminoacyl-tRNA with ribosome. After irradiation of the ternary complex ribosome-azido-NH (CH2)2NHpU (pU) n-1 X tRNA with UV-light (lambda greater than 350 nm) covalent binding of the reagent to ribosome occurs. Up to 10% of the reagent, bound in the ternary complex with ribosome, is cross-linked with the ribosomal proteins of 30S and 50S subunits. The ribosomal RNA are not modified by azido-NH (CH2)2NHpU (pU) n-1. The proteins of 30S and 50S subunits, modified with azido-NH (CH2)2NHpU (pU) n-1 with n = 4,7 and 8, were identified. It is shown that proteins of 30S subunits S3, S4, S9, S11, S12, S14, S17, S19, S20 undergo modification. The proteins of 50S subunits L2, L13, L16, L27, L32, L33 are modified. The set of the modified proteins essentially depends on the length of the oligonucleotide part of the reagent and on occupancy of ribosome A-site by a molecule of tRNA.

  14. Ribosomal RNA in Alzheimer disease is oxidized by bound redox-active iron.

    Science.gov (United States)

    Honda, Kazuhiro; Smith, Mark A; Zhu, Xiongwei; Baus, Diane; Merrick, William C; Tartakoff, Alan M; Hattier, Thomas; Harris, Peggy L; Siedlak, Sandra L; Fujioka, Hisashi; Liu, Quan; Moreira, Paula I; Miller, Frank P; Nunomura, Akihiko; Shimohama, Shun; Perry, George

    2005-06-03

    Oxidative modification of cytoplasmic RNA in vulnerable neurons is an important, well documented feature of the pathophysiology of Alzheimer disease. Here we report that RNA-bound iron plays a pivotal role for RNA oxidation in vulnerable neurons in Alzheimer disease brain. The cytoplasm of hippocampal neurons showed significantly higher redox activity and iron(II) staining than age-matched controls. Notably, both were susceptible to RNase, suggesting a physical association of iron(II) with RNA. Ultrastructural analysis further suggested an endoplasmic reticulum association. Both rRNA and mRNA showed twice the iron binding as tRNA. rRNA, extremely abundant in neurons, was considered to provide the greatest number of iron binding sites among cytoplasmic RNA species. Interestingly, the difference of iron binding capacity disappeared after denaturation of RNA, suggesting that the higher order structure may contribute to the greater iron binding of rRNA. Reflecting the difference of iron binding capacity, oxidation of rRNA by the Fenton reaction formed 13 times more 8-hydroxyguanosine than tRNA. Consistent with in situ findings, ribosomes purified from Alzheimer hippocampus contained significantly higher levels of RNase-sensitive iron(II) and redox activity than control. Furthermore, only Alzheimer rRNA contains 8-hydroxyguanosine in reverse transcriptase-PCR. Addressing the biological significance of ribosome oxidation by redox-active iron, in vitro translation with oxidized ribosomes from rabbit reticulocyte showed a significant reduction of protein synthesis. In conclusion these results suggest that rRNA provides a binding site for redox-active iron and serves as a redox center within the cytoplasm of vulnerable neurons in Alzheimer disease in advance of the appearance of morphological change indicating neurodegeneration.

  15. The long noncoding RNA RNCR2 directs mouse retinal cell specification

    Directory of Open Access Journals (Sweden)

    Blackshaw Seth

    2010-05-01

    Full Text Available Abstract Background Recent work has identified that many long mRNA-like noncoding RNAs (lncRNAs are expressed in the developing nervous system. Despite their abundance, the function of these ncRNAs has remained largely unexplored. We have investigated the highly abundant lncRNA RNCR2 in regulation of mouse retinal cell differentiation. Results We find that the RNCR2 is selectively expressed in a subset of both mitotic progenitors and postmitotic retinal precursor cells. ShRNA-mediated knockdown of RNCR2 results in an increase of both amacrine cells and Müller glia, indicating a role for this lncRNA in regulating retinal cell fate specification. We further report that RNCR2 RNA, which is normally nuclear-retained, can be exported from the nucleus when fused to an IRES-GFP sequence. Overexpression of RNCR2-IRES-GFP phenocopies the effects of shRNA-mediated knockdown of RNCR2, implying that forced mislocalization of RNCR2 induces a dominant-negative phenotype. Finally, we use the IRES-GFP fusion approach to identify specific domains of RNCR2 that are required for repressing both amacrine and Müller glial differentiation. Conclusion These data demonstrate that the lncRNA RNCR2 plays a critical role in regulating mammalian retinal cell fate specification. Furthermore, we present a novel approach for generating dominant-negative constructs of lncRNAs, which may be generally useful in the functional analysis of this class of molecules.

  16. Detection of tumor cell-specific mRNA and protein in exosome-like microvesicles from blood and saliva.

    Science.gov (United States)

    Yang, Jieping; Wei, Fang; Schafer, Christopher; Wong, David T W

    2014-01-01

    The discovery of disease-specific biomarkers in oral fluids has revealed a new dimension in molecular diagnostics. Recent studies have reported the mechanistic involvement of tumor cells derived mediators, such as exosomes, in the development of saliva-based mRNA biomarkers. To further our understanding of the origins of disease-induced salivary biomarkers, we here evaluated the hypothesis that tumor-shed secretory lipidic vesicles called exosome-like microvesicles (ELMs) that serve as protective carriers of tissue-specific information, mRNAs, and proteins, throughout the vasculature and bodily fluids. RNA content was analyzed in cell free-saliva and ELM-enriched fractions of saliva. Our data confirmed that the majority of extracellular RNAs (exRNAs) in saliva were encapsulated within ELMs. Nude mice implanted with human lung cancer H460 cells expressing hCD63-GFP were used to follow the circulation of tumor cell specific protein and mRNA in the form of ELMs in vivo. We were able to identify human GAPDH mRNA in ELMs of blood and saliva of tumor bearing mice using nested RT-qPCR. ELMs positive for hCD63-GFP were detected in the saliva and blood of tumor bearing mice as well as using electric field-induced release and measurement (EFIRM). Altogether, our results demonstrate that ELMs carry tumor cell-specific mRNA and protein from blood to saliva in a xenografted mouse model of human lung cancer. These results therefore strengthen the link between distal tumor progression and the biomarker discovery of saliva through the ELMs.

  17. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  18. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  19. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    Science.gov (United States)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  20. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  1. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  2. Identification of the methyltransferase targeting C2499 in Deinococcus radiodurans 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Nielsen, Julie Mundus; Flyvbjerg, Karen Freund; Kirpekar, Finn

    2016-01-01

    The bacterium Deinococcus radiodurans-like all other organisms-introduces nucleotide modifications into its ribosomal RNA. We have previously found that the bacterium contains a Carbon-5 methylation on cytidine 2499 of its 23S ribosomal RNA, which is so far the only modified version of cytidine 2...

  3. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  4. Can we estimate bacterial growth rates from ribosomal RNA content?

    Energy Technology Data Exchange (ETDEWEB)

    Kemp, P.F.

    1995-12-31

    Several studies have demonstrated a strong relationship between the quantity of RNA in bacterial cells and their growth rate under laboratory conditions. It may be possible to use this relationship to provide information on the activity of natural bacterial communities, and in particular on growth rate. However, if this approach is to provide reliably interpretable information, the relationship between RNA content and growth rate must be well-understood. In particular, a requisite of such applications is that the relationship must be universal among bacteria, or alternately that the relationship can be determined and measured for specific bacterial taxa. The RNA-growth rate relationship has not been used to evaluate bacterial growth in field studies, although RNA content has been measured in single cells and in bulk extracts of field samples taken from coastal environments. These measurements have been treated as probable indicators of bacterial activity, but have not yet been interpreted as estimators of growth rate. The primary obstacle to such interpretations is a lack of information on biological and environmental factors that affect the RNA-growth rate relationship. In this paper, the available data on the RNA-growth rate relationship in bacteria will be reviewed, including hypotheses regarding the regulation of RNA synthesis and degradation as a function of growth rate and environmental factors; i.e. the basic mechanisms for maintaining RNA content in proportion to growth rate. An assessment of the published laboratory and field data, the current status of this research area, and some of the remaining questions will be presented.

  5. Characterization of recombinant bacteriophages containing mosquito ribosomal RNA genes

    Energy Technology Data Exchange (ETDEWEB)

    Park, Y.J.

    1988-01-01

    A family of nine recombinant bacteriophages containing rRNA genes from cultured cells of the mosquito, Aedes albopictus, has been isolated by screening two different genomic DNA libraries - Charon 30 and EMBL 3 using {sup 32}P-labeled 18S and 28S rRNA as probes. These nine recombinant bacteriophages were characterized by restriction mapping, Southern blotting, and S1 nuclease analysis. The 18S rRNA coding region contains an evolutionarily conserved EcoRI site near the 3{prime}-end, and measures 1800 bp. The 28S rRNA genes were divided into {alpha} and {beta} coding regions measuring 1750 bp and 2000 bp, respectively. The gap between these two regions measures about 340 bp. No insertion sequences were found in the rRNA coding regions. The entire rDNA repeat unit had a minimum length of 15.6 kb, including a nontranscribed spacer region. The non-transcribed spacer region of cloned A. albopictus rDNA contained a common series of seven PvuI sites within a 1250 bp region upstream of the 18S rRNA coding region, and a proportion of this region also showed heterogeneity both in the length and in the restriction sites.

  6. Cell-specific RNA aptamer against human CCR5 specifically targets HIV-1 susceptible cells and inhibits HIV-1 infectivity.

    Science.gov (United States)

    Zhou, Jiehua; Satheesan, Sangeetha; Li, Haitang; Weinberg, Marc S; Morris, Kevin V; Burnett, John C; Rossi, John J

    2015-03-19

    The C-C chemokine receptor type 5 (CCR5) is a receptor expressed by T cells and macrophages that serves as a coreceptor for macrophage-tropic HIV-1. Loss of CCR5 is associated with resistance to HIV-1. Here, we combine the live-cell-based SELEX with high-throughput sequencing technology to generate CCR5 RNA aptamers capable of specifically targeting HIV-1 susceptible cells (as small interfering RNA [siRNA] delivery agent) and inhibiting HIV-1 infectivity (as antiviral agent) via block of the CCR5 required for HIV-1 to enter cells. One of the best candidates, G-3, efficiently bound and was internalized into human CCR5-expressing cells. The G-3 specifically neutralized R5 virus infection in primary peripheral blood mononuclear cells, and in vivo generated human CD4(+) T cells with a nanomolar inhibitory concentration 50%. G-3 was also capable of transferring functional siRNAs to CCR5-expressing cells. Collectively, the cell-specific, internalizing, CCR5-targeted aptamers and aptamer-siRNA conjugates offer promise for overcoming some of the current challenges of drug resistance in HIV-1 by providing cell-type- or tissue-specific delivery of various therapeutic moieties.

  7. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  8. Preparation of Biologically Active Arabidopsis Ribosomes and Comparison with Yeast Ribosomes for Binding to a tRNA-Mimic that Enhances Translation of Plant Plus-Strand RNA Viruses

    Directory of Open Access Journals (Sweden)

    Vera Aleksey Stupina

    2013-07-01

    Full Text Available Isolation of biologically active cell components from multicellular eukaryotic organisms often poses difficult challenges such as low yields and inability to retain the integrity and functionality of the purified compound. We previously identified a cap-independent translation enhancer (3’CITE in the 3’UTR of Turnip crinkle virus (TCV that structurally mimics a tRNA and binds to yeast 80S ribosomes and 60S subunits in the P-site. Yeast ribosomes were used for these studies due to the lack of methods for isolation of plant ribosomes with high yields and integrity. To carry out studies with more natural components, a simple and efficient procedure has been developed for the isolation of large quantities of high quality ribosomes and ribosomal subunits from Arabidopsis thaliana protoplasts prepared from seed-derived callus tissue. Attempts to isolate high quality ribosomes from wheat germ, bean sprouts and evacuolated protoplasts were unsuccessful. Addition of purified Arabidopsis 80S plant ribosomes to ribosome-depleted wheat germ lysates resulted in a greater than 1200-fold enhancement in in vitro translation of a luciferase reporter construct. The TCV 3’CITE bound to ribosomes with a 3 to 7-fold higher efficiency when using plant 80S ribosomes compared with yeast ribosomes, indicating that this viral translational enhancer is adapted to interact more efficiently with host plant ribosomes.

  9. Complementarity between the mRNA 5' untranslated region and 18S ribosomal RNA can inhibit translation.

    Science.gov (United States)

    Verrier, S B; Jean-Jean, O

    2000-04-01

    In eubacteria, base pairing between the 3' end of 16S rRNA and the ribosome-binding site of mRNA is required for efficient initiation of translation. An interaction between the 18S rRNA and the mRNA was also proposed for translation initiation in eukaryotes. Here, we used an antisense RNA approach in vivo to identify the regions of 18S rRNA that might interact with the mRNA 5' untranslated region (5' UTR). Various fragments covering the entire mouse 18S rRNA gene were cloned 5' of a cat reporter gene in a eukaryotic vector, and translation products were analyzed after transient expression in human cells. For the largest part of 18S rRNA, we show that the insertion of complementary fragments in the mRNA 5' UTR do not impair translation of the downstream open reading frame (ORF). When translation inhibition is observed, reduction of the size of the complementary sequence to less than 200 nt alleviates the inhibitory effect. A single fragment complementary to the 18S rRNA 3' domain retains its inhibitory potential when reduced to 100 nt. Deletion analyses show that two distinct sequences of approximately 25 nt separated by a spacer sequence of 50 nt are required for the inhibitory effect. Sucrose gradient fractionation of polysomes reveals that mRNAs containing the inhibitory sequences accumulate in the fractions with 40S ribosomal subunits, suggesting that translation is blocked due to stalling of initiation complexes. Our results support an mRNA-rRNA base pairing to explain the translation inhibition observed and suggest that this region of 18S rRNA is properly located for interacting with mRNA.

  10. Validation of two ribosomal RNA removal methods for microbial metatranscriptomics

    Energy Technology Data Exchange (ETDEWEB)

    He, Shaomei; Wurtzel, Omri; Singh, Kanwar; Froula, Jeff L; Yilmaz, Suzan; Tringe, Susannah G; Wang, Zhong; Chen, Feng; Lindquist, Erika A; Sorek, Rotem; Hugenholtz, Philip

    2010-10-01

    The predominance of rRNAs in the transcriptome is a major technical challenge in sequence-based analysis of cDNAs from microbial isolates and communities. Several approaches have been applied to deplete rRNAs from (meta)transcriptomes, but no systematic investigation of potential biases introduced by any of these approaches has been reported. Here we validated the effectiveness and fidelity of the two most commonly used approaches, subtractive hybridization and exonuclease digestion, as well as combinations of these treatments, on two synthetic five-microorganism metatranscriptomes using massively parallel sequencing. We found that the effectiveness of rRNA removal was a function of community composition and RNA integrity for these treatments. Subtractive hybridization alone introduced the least bias in relative transcript abundance, whereas exonuclease and in particular combined treatments greatly compromised mRNA abundance fidelity. Illumina sequencing itself also can compromise quantitative data analysis by introducing a G+C bias between runs.

  11. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    -rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH...... initiation factor (eIF)4A, a DEAD-box RNA helicase, as well as ancillary factors eIF4B and eIF4G. In higher eukaryotes, scanning of mRNAs containing stable secondary structures in the 5’ UTR furthermore requires DHX29, another DEAH/RHA helicase. I participated in characterizing the synergistic activation...

  12. CED-4 is an mRNA-binding protein that delivers ced-3 mRNA to ribosomes.

    Science.gov (United States)

    Wang, Miao-xing; Itoh, Masanori; Li, Shimo; Hida, Yoko; Ohta, Kazunori; Hayakawa, Miki; Nishida, Emika; Ueda, Masashi; Islam, Saiful; Tana; Nakagawa, Toshiyuki

    2016-01-29

    Cell death abnormal (ced)-3 and ced-4 genes regulate apoptosis to maintain tissue homeostasis in Caenorhabditis elegans. Apoptosome formation and CED-4 translocation drive CED-3 activation. However, the precise role of CED-4 translocation is not yet fully understood. In this study, using a combination of immunoprecipitation and reverse transcription-polymerase chain reaction methods in cells and a glutathione-S-transferase pull down assay in a cell-free system, we show that CED-4 binds ced-3 mRNA. In the presence of ced-3 mRNA, CED-4 protein is enriched in the microsomal fraction and interacts with ribosomal protein L10a in mammalian cells, increasing the levels of CED-3. These results suggest that CED-4 forms a complex with ced-3 mRNA and delivers it to ribosomes for translation.

  13. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  14. Chromosomal localization of the major ribosomal RNA genes in scallop Chlamys farreri

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiaoting; BAO Zhenmin; BI Ke; HU Jingjie; ZHANG Can; ZHANG Quanqi; HU Xiaoli

    2006-01-01

    The chromosomes of Chlamys farreri were analyzed by means of silver staining and fluorescence in situ hybridization ( FISH ) with 18S-28S rDNA probe. Probe was made by PCR amplification of a DNA fragment containing internal transcribed spacers ITS1 between 18S and 5.8S ribosomal RNA gene, ITS2 between 5.8S and 28S ribosomal RNA gene and 5.8S rRNA gene, and labeled by PCR incorporation of bio-16-dUTP. FISH signals were located on the short arm of subtelocentric chromosome 10. After silverstaining, nucleolus organizer regions (NORs) could be observed on the telomere of the short arm of chromosome 10. However,one metaphase spread displayed an additional silver spot on the short arm of subtelocentric chromosome 12.

  15. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading.

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Lohoff, Tim; Jia, Qidong; Satterlee, James; Ke, Kenneth; von Arnim, Albrecht G

    2015-09-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock.

  16. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B;

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are st...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  17. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex

    Directory of Open Access Journals (Sweden)

    Ping Xie

    2015-10-01

    Full Text Available Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA. It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by “hungry” codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  18. Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

    Science.gov (United States)

    Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

    2013-10-01

    Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

  19. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  20. Structure and Function of the Ribosomal Frameshifting Pseudoknot RNA from Beet Western Yellow Virus

    Energy Technology Data Exchange (ETDEWEB)

    Egli, M.; Sarkhel, S.; Minasov, G.; Rich, A.

    2010-03-05

    Many viruses reprogram ribosomes to produce two different proteins from two different reading frames. So-called -1 frameshifting often involves pairwise alignment of two adjacent tRNAs at a 'slippery' sequence in the ribosomal A and P sites such that an overlapping codon is shifted upstream by one base relative to the zero frame. In the majority of cases, an RNA pseudoknot located downstream stimulates this type of frameshift. Crystal structures of the frameshifting RNA pseudoknot from Beet Western Yellow Virus (BWYV) have provided a detailed picture of the tertiary interactions stabilizing this folding motif, including a minor-groove triplex and quadruple-base interactions. The structure determined at atomic resolution revealed the locations of several magnesium ions and provided insights into the role of structured water stabilizing the RNA. Systematic in vitro and in vivo mutational analyses based on the structural results revealed specific tertiary interactions and regions in the pseudoknot that drastically change frameshifting efficiency. Here, we summarize recent advances in our understanding of pseudoknot-mediated ribosomal frameshifting on the basis of the insights gained from structural and functional studies of the RNA pseudoknot from BWYV.

  1. The structure of a ribosomal protein S8/spc operon mRNA complex.

    Science.gov (United States)

    Merianos, Helen J; Wang, Jimin; Moore, Peter B

    2004-06-01

    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  2. Expanded versions of the 16S and 23S ribosomal RNA mutation databases (16SMDBexp and 23SMDBexp)

    OpenAIRE

    Triman, K L; Peister, A; Goel, R A

    1998-01-01

    Expanded versions of the Ribosomal RNA Mutation Databases provide lists of mutated positions in 16S and 16S-like ribosomal RNA (16SMDBexp) and 23S and 23S-like ribosomal RNA (23SMDBexp) and the identity of each alteration. Alterations from organisms other than Escherichia coli are reported at positions according to the E.coli numbering system. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation, (ii) whether a mutant pheno...

  3. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  4. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Directory of Open Access Journals (Sweden)

    Khan Umaer

    Full Text Available RNA binding proteins (RBP play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD. Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  5. Kinetoplastid Specific RNA-Protein Interactions in Trypanosoma cruzi Ribosome Biogenesis.

    Science.gov (United States)

    Umaer, Khan; Williams, Noreen

    2015-01-01

    RNA binding proteins (RBP) play essential roles in the highly conserved and coordinated process of ribosome biogenesis. Our laboratory has previously characterized two essential and abundant RBPs, P34 and P37, in Trypanosoma brucei which are required for several critical steps in ribosome biogenesis. The genes for these proteins have only been identified in kinetoplastid organisms but not in the host genome. We have identified a homolog of the TbP34 and TbP37 in a T. cruzi strain (termed TcP37/NRBD). Although the N-terminal APK-rich domain and RNA recognition motifs are conserved, the C-terminal region which contains putative nuclear and nucleolar localization signals in TbP34 and TbP37 is almost entirely missing from TcP37/NRBD. We have shown that TcP37/NRBD is expressed in T. cruzi epimastigotes at the level of mature mRNA and protein. Despite the loss of the C-terminal domain, TcP37/NRBD is present in the nucleus, including the nucleolus, and the cytoplasm. TcP37/NRBD interacts directly with Tc 5S rRNA, but does not associate with polyadenylated RNA. TcP37/NRBD also associates in vivo and in vitro with large ribosomal protein TcL5 and, unlike the case of T. brucei, this association is strongly enhanced by the presence of 5S rRNA, suggesting that the loss of the C-terminal domain of TcP37/NRBD may alter the interactions within the complex. These results indicate that the unique preribosomal complex comprised of L5, 5S rRNA, and the trypanosome-specific TcP37/NRBD or TbP34 and TbP37 is functionally conserved in trypanosomes despite the differences in the C-termini of the trypanosome-specific protein components.

  6. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    Science.gov (United States)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  7. Detection of Enterobacter sakazakii in neonatal sepsis by PCR on 16S ribosomal RNA

    Directory of Open Access Journals (Sweden)

    Khadijeh Ahmadi

    2014-08-01

    Full Text Available Background: Enterobacter sakazakii is a gram negative, facultative anaerobic, straight rod-shaped bacterium that belongs to the family Enterobacteriaceae. It is also considered an emerging opportunistic pathogen, responsible of cases of neonatal infections including sepsis, meningitis, necrotizing enterocolitis ad bacteremia. The goal of this study was detection of Enterobacter salazakii in neonates with sepsis by PCR on 16S ribosomal RNA gene. Material and Methods: This cross-sectional study was conducted on 405 blood specimens that were taken from hospitalized neonates suspected to sepsis in Ahvaz Abuzar Hospital in 2011. From each neonate 0.5 ml blood sample was taken and placed in CBC tubes containing EDTA at -200C for polymerase chain reaction. For detection of Enterobacter sakazakii, PCR was performed on DNA for amplification of 16S ribosomal RNA gene. Results: In all 405 neonates blood samples’ PCR reactions for Enterobacter sakazakii 16S ribosomal RNA gene were negative. Blood cultures were positive for Streptococcus agalactiae in 8 (1.4 % patients. Conclusion: Because Enterobacter sakazakii is an opportunistic pathogen with high pathogenicity power, more investigation on high risk groups is required. For detection of infection caused by this organism using of different diagnostic methods with high specificity and sensitivity is necessary.

  8. Detection of bacterial 16S ribosomal RNA genes for forensic identification of vaginal fluid.

    Science.gov (United States)

    Akutsu, Tomoko; Motani, Hisako; Watanabe, Ken; Iwase, Hirotaro; Sakurada, Koichi

    2012-05-01

    To preliminarily evaluate the applicability of bacterial DNA as a marker for the forensic identification of vaginal fluid, we developed and performed PCR-based detection of 16S ribosomal RNA genes of Lactobacillus spp. dominating the vagina and of bacterial vaginosis-related bacteria from DNA extracted from body fluids and stains. As a result, 16S ribosomal RNA genes of Lactobacillus crispatus, Lactobacillus jensenii and Atopobium vaginae were specifically detected in vaginal fluid and female urine samples. Bacterial genes detected in female urine might have originated from contaminated vaginal fluid. In addition, those of Lactobacillus iners, Lactobacillus gasseri and Gardnerella vaginalis were also detected in non-vaginal body fluids such as semen. Because bacterial genes were successfully amplified in DNA samples extracted by using the general procedure for animal tissues without any optional treatments, DNA samples prepared for the identification of vaginal fluid can also be used for personal identification. In conclusion, 16S ribosomal RNA genes of L. crispatus, L. jensenii and A. vaginae could be effective markers for forensic identification of vaginal fluid.

  9. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  10. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.

    Science.gov (United States)

    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М

    2012-10-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  11. Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant.

    Science.gov (United States)

    Chen, H; Ferbeyre, G; Cedergren, R

    1997-05-01

    We have evaluated inhibition of the plasmid-born chloramphenicol acetyl transferase gene (CAT) by the hammerhead ribozyme and antisense RNA in Escherichia coli where the translation and transcription rates have been modified. Whereas neither antisense nor the hammerhead had an inhibitory effect on CAT activity in wild-type E. coli, both reduced the level of the messenger RNA and the activity of the CAT gene by almost 60% in a slow ribosome mutant. Streptomycin, which increases the speed of translation in this mutant strain, restored full CAT activity. The level of CAT activity expressed from a T7 RNA polymerase promoter was not affected by the presence of either antisense RNA or the hammerhead ribozyme. When the target gene was expressed from a chromosomal locus in wild-type E. coli, both antisense RNA and the hammerhead ribozyme showed some inhibitory activity, but the level of inhibition was significantly increased in the slow ribosome strain. This bacterial system offers a unique entry to the study of cellular factors which mediate the activity of ribozymes in vivo.

  12. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  13. Functional ribosome biogenesis is a prerequisite for p53 destabilization: impact of chemotherapy on nucleolar functions and RNA metabolism.

    Science.gov (United States)

    Burger, Kaspar; Eick, Dirk

    2013-09-01

    The production and processing of ribosomal RNA is a complex and well-coordinated nucleolar process for ribosome biogenesis. Progress in understanding nucleolar structure and function has lead to the unexpected discovery of the nucleolus as a highly sensitive sensor of cellular stress and an important regulator of the tumor suppressor p53. Inhibition of ribosomal RNA metabolism has been shown to activate a signaling pathway for p53 induction. This review elucidates the potential of classical and recently developed chemotherapeutic drugs to stabilize p53 by inhibiting nucleolar functions.

  14. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    Science.gov (United States)

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  15. RISSC: a novel database for ribosomal 16S-23S RNA genes spacer regions.

    Science.gov (United States)

    García-Martínez, J; Bescós, I; Rodríguez-Sala, J J; Rodríguez-Valera, F

    2001-01-01

    A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S-23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others.

  16. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    Science.gov (United States)

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame.

  17. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    Science.gov (United States)

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  18. Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction

    Science.gov (United States)

    Becker, Matthias M. M.; Lapouge, Karine; Segnitz, Bernd; Wild, Klemens; Sinning, Irmgard

    2017-01-01

    Co-translational protein targeting and membrane protein insertion is a fundamental process and depends on the signal recognition particle (SRP). In mammals, SRP is composed of the SRP RNA crucial for SRP assembly and function and six proteins. The two largest proteins SRP68 and SRP72 form a heterodimer and bind to a regulatory site of the SRP RNA. Despite their essential roles in the SRP pathway, structural information has been available only for the SRP68 RNA-binding domain (RBD). Here we present the crystal structures of the SRP68 protein-binding domain (PBD) in complex with SRP72-PBD and of the SRP72-RBD bound to the SRP S domain (SRP RNA, SRP19 and SRP68) detailing all interactions of SRP72 within SRP. The SRP72-PBD is a tetratricopeptide repeat, which binds an extended linear motif of SRP68 with high affinity. The SRP72-RBD is a flexible peptide crawling along the 5e- and 5f-loops of SRP RNA. A conserved tryptophan inserts into the 5e-loop forming a novel type of RNA kink-turn stabilized by a potassium ion, which we define as K+-turn. In addition, SRP72-RBD remodels the 5f-loop involved in ribosome binding and visualizes SRP RNA plasticity. Docking of the S domain structure into cryo-electron microscopy density maps reveals multiple contact sites between SRP68/72 and the ribosome, and explains the role of SRP72 in the SRP pathway. PMID:27899666

  19. Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

    Directory of Open Access Journals (Sweden)

    Jennifer L Houmani

    Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

  20. Streptomycin binds to the decoding center of 16 S ribosomal RNA.

    Science.gov (United States)

    Spickler, C; Brunelle, M N; Brakier-Gingras, L

    1997-10-31

    Streptomycin, an error-inducing aminoglycoside antibiotic, binds to a single site on the small ribosomal subunit of bacteria, but this site has not yet been defined precisely. Here, we demonstrate that streptomycin binds to E. coli 16 S rRNA in the absence of ribosomal proteins, and protects a set of bases in the decoding region against dimethyl sulfate attack. The binding studies were performed in a high ionic strength buffer containing 20 mM Mg2+. The pattern of protection in the decoding region was similar to that observed when streptomycin binds to the 30 S subunit. However, streptomycin also protects the 915 region of 16 S rRNA within the 30 S subunit, whereas it did not protect the 915 region of the naked 16 S rRNA. The interaction of streptomycin with 16 S rRNA was further defined by using two fragments that correspond to the 3' minor domain of 16 S rRNA and to the decoding analog, a portion of this domain encompassing the decoding center. In the presence of streptomycin, the pattern of protection against dimethyl sulfate attack for the two fragments was similar to that seen with the full-length 16 S rRNA. This indicates that the 3' minor domain as well as the decoding analog contain the recognition signals for the binding of streptomycin. However, streptomycin could not bind to the decoding analog in the absence of Mg2+. This contrasts with neomycin, another error-inducing aminoglycoside antibiotic, that binds to the decoding analog in the absence of Mg2+, but not at 20 mM Mg2+. Our results suggest that both neomycin and streptomycin interact with the decoding center, but recognize alternative conformations of this region.

  1. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale

    2008-08-01

    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  2. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion.

  3. Antibiotic resistance evolved via inactivation of a ribosomal RNA methylating enzyme

    Science.gov (United States)

    Stojković, Vanja; Noda-Garcia, Lianet; Tawfik, Dan S.; Fujimori, Danica Galonić

    2016-01-01

    Modifications of the bacterial ribosome regulate the function of the ribosome and modulate its susceptibility to antibiotics. By modifying a highly conserved adenosine A2503 in 23S rRNA, methylating enzyme Cfr confers resistance to a range of ribosome-targeting antibiotics. The same adenosine is also methylated by RlmN, an enzyme widely distributed among bacteria. While RlmN modifies C2, Cfr modifies the C8 position of A2503. Shared nucleotide substrate and phylogenetic relationship between RlmN and Cfr prompted us to investigate evolutionary origin of antibiotic resistance in this enzyme family. Using directed evolution of RlmN under antibiotic selection, we obtained RlmN variants that mediate low-level resistance. Surprisingly, these variants confer resistance not through the Cfr-like C8 methylation, but via inhibition of the endogenous RlmN C2 methylation of A2503. Detection of RlmN inactivating mutations in clinical resistance isolates suggests that the mechanism used by the in vitro evolved variants is also relevant in a clinical setting. Additionally, as indicated by a phylogenetic analysis, it appears that Cfr did not diverge from the RlmN family but from another distinct family of predicted radical SAM methylating enzymes whose function remains unknown. PMID:27496281

  4. Mutation of the mitochondrial large ribosomal RNA can provide pentamidine resistance to Saccharomyces cerevisiae.

    Science.gov (United States)

    Örs, Ş Tomris; Akdoğan, Emel; Dunn, Cory D

    2014-09-01

    Pentamidine is used to treat several trypanosomal diseases, as well as opportunistic infection by pathogenic fungi. However, the relevant targets of this drug are unknown. We isolated dominant mutations providing pentamidine resistance to Saccharomyces cerevisiae, one of which was localized to mitochondrial DNA. Next-generation sequencing revealed alteration of a widely conserved base at the peptidyl transferase center of the mitochondrial 21S ribosomal RNA. Our results provide a potential rationale for the toxicity of this drug to patients, and we discuss whether blockade of mitochondrial translation is the mechanism by which pathogenic fungi or protists are killed by pentamidine.

  5. Nonstop mRNA Decay: a Special Attribute of Trans-Translation Mediated Ribosome Rescue

    Directory of Open Access Journals (Sweden)

    Krithika eVenkataraman

    2014-03-01

    Full Text Available Decoding of aberrant mRNAs leads to unproductive ribosome stalling and sequestration of components of the translation machinery. Bacteria have evolved three seemingly independent pathways to resolve stalled translation complexes. The trans-translation process, orchestrated by the hybrid transfer-messenger RNA (tmRNA and its essential protein co-factor, SmpB, is the principal translation quality control system for rescuing unproductively stalled ribosomes. Two specialized alternative rescue pathways, coordinated by ArfA and ArfB, have been recently discovered. The SmpB-tmRNA mediated trans-translation pathway, in addition to re-mobilizing stalled translation complexes, co-translationally appends a degradation tag to the associated nascent polypeptides, marking them for proteolysis by various cellular proteases. Another unique feature of trans-translation, not shared by the alternative rescue pathways, is the facility to recruit RNase R for targeted degradation of nonstop mRNAs, thus preventing further futile cycles of translation. The distinct C-terminal lysine-rich (K-rich domain of RNase R is essential for its recruitment to stalled ribosomes. To gain new insights into the structure and function of RNase R, we investigated its global architecture, the spatial arrangement of its distinct domains, and the identities of key functional residues in its unique K-rich domain. Small-angle X-ray scattering (SAXS models of RNase R reveal a tri-lobed structure with flexible N- and C-terminal domains, and suggest intimate contacts between the K-rich domain and the catalytic core of the enzyme. Alanine-scanning mutagenesis of the K-rich domain, in the region spanning residues 735 and 750, has uncovered the precise amino acid determinants required for the productive engagement of RNase R on tmRNA-rescued ribosomes. Theses analyses demonstrate that alanine substitution of conserved residues E740 and K741 result in profound defects, not only in the recruitment

  6. Structural arrangement of tRNA binding sites on Escherichia coli ribosomes, as revealed from data on affinity labelling with photoactivatable tRNA derivatives.

    Science.gov (United States)

    Graifer, D M; Babkina, G T; Matasova, N B; Vladimirov, S N; Karpova, G G; Vlassov, V V

    1989-07-01

    A systematic study of protein environment of tRNA in ribosomes in model complexes representing different translation steps was carried out using the affinity labelling of the ribosomes with tRNA derivatives bearing aryl azide groups scattered statistically over tRNA guanine residues. Analysis of the proteins crosslinked to tRNA derivatives showed that the location of the derivatives in the aminoacyl (A) site led to the labelling of the proteins S5 and S7 in all complexes studied, whereas the labelling of the proteins S2, S8, S9, S11, S14, S16, S17, S18, S19, S21 as well as L9, L11, L14, L15, L21, L23, L24, L29 depended on the state of tRNA in A site. Similarly, the location of tRNA derivatives in the peptidyl (P) site resulted in the labelling of the proteins L27, S11, S13 and S19 in all states, whereas the labelling of the proteins S5, S7, S9, S12, S14, S20, S21 as well as L2, L13, L14, L17, L24, L27, L31, L32, L33 depended on the type of complex. The derivatives of tRNA(fMet) were found to crosslink to S1, S3, S5, S7, S9, S14 and L1, L2, L7/L12, L27. Based on the data obtained, a general principle of the dynamic functioning of ribosomes has been proposed: (i) the formation of each type of ribosomal complex is accompanied by changes in mutual arrangement of proteins - 'conformational adjustment' of the ribosome - and (ii) a ribosome can dynamically change its internal structure at each step of initiation and elongation; on the 70 S ribosome there are no rigidly fixed structures forming tRNA-binding sites (primarily A and P sites).

  7. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    Science.gov (United States)

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L

    2000-11-01

    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  8. Molecular and cytological characterization of ribosomal RNA genes in Chenopodium quinoa and Chenopodium berlandieri.

    Science.gov (United States)

    Maughan, P J; Kolano, B A; Maluszynska, J; Coles, N D; Bonifacio, A; Rojas, J; Coleman, C E; Stevens, M R; Fairbanks, D J; Parkinson, S E; Jellen, E N

    2006-07-01

    The nucleolus organizer region (NOR) and 5S ribosomal RNA (rRNA) genes are valuable as chromosome landmarks and in evolutionary studies. The NOR intergenic spacers (IGS) and 5S rRNA nontranscribed spacers (NTS) were PCR-amplified and sequenced from 5 cultivars of the Andean grain crop quinoa (Chenopodium quinoa Willd., 2n = 4x = 36) and a related wild ancestor (C. berlandieri Moq. subsp. zschackei (Murr) A. Zobel, 2n = 4x = 36). Length heterogeneity observed in the IGS resulted from copy number difference in subrepeat elements, small re arrangements, and species-specific indels, though the general sequence composition of the 2 species was highly similar. Fifteen of the 41 sequence polymorphisms identified among the C. quinoa lines were synapomorphic and clearly differentiated the highland and lowland ecotypes. Analysis of the NTS sequences revealed 2 basic NTS sequence classes that likely originated from the 2 allopolyploid subgenomes of C. quinoa. Fluorescence in situ hybridization (FISH) analysis showed that C. quinoa possesses an interstitial and a terminal pair of 5S rRNA loci and only 1 pair of NOR, suggesting a reduction in the number of rRNA loci during the evolution of this species. C. berlandieri exhibited variation in both NOR and 5S rRNA loci without changes in ploidy.

  9. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    Science.gov (United States)

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  10. Effects of ethidium bromide on the production of ribosomal RNA in cultured mouse cells.

    Science.gov (United States)

    Lange, M; May, P

    1979-06-25

    A treatment of primary mouse kidney cell cultures with 5 microM Ethidium Bromide (Eth Br) reduces the transcription of nuclear-coded genes and especially of ribosomal RNA genes. This effect was consistently observed when comparing drug-treated and control cells for (i), the incorporation of 3H uridine into total nuclear and B RNA polymerases as determined in isolated nuclei. It became more pronounced with exposure time; however, after removal of the drug, there was a progressive recovery of RNA synthesis culminating in the complete reversal of the drug effect. That this effect is probably not due only to the suppression of mitochondrial protein synthesis by the drug, is shown by a comparative study of the effects of chloramphenicol treatment. In addition, in the cytoplasm Eth Br depresses the labeling of 28 S rRNA more than that of 18 S whereas no abnormal accumulation of 28 S rRNA is observed in the nucleus. It is suggested that Eth Br may affect either the stability of the 28 S rRNA or its rate of formation from the 32 S precursor.

  11. [Study of the photoaffinity modification of Escherichia coli ribosomes near the donor tRNA-binding center].

    Science.gov (United States)

    Bausk, E V; Graĭfer, D M; Karpova, G G

    1985-01-01

    Affinity labelling of E. coli ribosomes near the donor tRNA-binding (P) site was studied with the use of photoreactive derivatives of tRNAPhe bearing arylazidogroups on N7 atoms of guanine residues (azido-tRNA). UV-irradiation of complexes 70S ribosome.poly(U).azido- tRNA(P-site) and 70S ribosome.poly(U).azido-tRNA(P-site).Phe- tRNAPhe(A-site) resulted in covalent attachment of azido-tRNA to ribosomes, both subunits being labelled. In both cases modification extent of 30S subunit was two-fold than that of the 50S one. It was shown that when the A-site was free the azido-tRNA located in P-site labelled proteins S9, S11, S12, S13, S21 and L14, L27, L31. Azido-tRNA located in P-site when the A-site was occupied with Phe-tRNAPhe labelled proteins S11, S12, S13, S14, S19, L32/L33 and possibly L23, L25. From the comparison of the sets of proteins labelled when A-site was free or occupied a conclusion was drawn that aminoacyl-tRNA located in ribosomal A-site affects the arrangement of deacylated tRNA in P-site. Data obtained allow to propose that proteins S5, S19, S20 and L24, L33 interact with guanine residues important for the tRNA tertiary structure formation.

  12. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  13. The conserved endoribonuclease YbeY is required for chloroplast ribosomal RNA processing in Arabidopsis.

    Science.gov (United States)

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong; Cheng, Yuxiang

    2015-05-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5' and 3' ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development.

  14. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  15. Ribosomal RNA gene diversity, effective population size, and evolutionary longevity in asexual glomeromycota.

    Science.gov (United States)

    Vankuren, Nicholas W; den Bakker, Henk C; Morton, Joseph B; Pawlowska, Teresa E

    2013-01-01

    Arbuscular mycorrhizal fungi (phylum Glomeromycota) are among the oldest and most successful symbionts of land plants. With no evidence of sexual reproduction, their evolutionary success is inconsistent with the prediction that asexual taxa are vulnerable to extinction due to accumulation of deleterious mutations. To explore why Glomeromycota defy this prediction, we studied ribosomal RNA (rRNA) gene evolution in the Claroideoglomus lineage and estimated effective population size, N(e) , in C. etunicatum. We found that rRNA genes of these fungi exhibit unusual and complex patterns of molecular evolution. In C. etunicatum, these patterns can be collectively explained by an unexpectedly large N(e) combined with imperfect genome-wide and population-level rRNA gene repeat homogenization. The mutations accumulated in rRNA gene sequences indicate that natural selection is effective at purging deleterious mutations in the Claroideoglomus lineage, which is also consistent with the large N(e) of C. etunicatum. We propose that in the near absence of recombination, asexual reproduction involving massively multinucleate spores typical for Glomeromycota is responsible for the improved efficacy of selection relative to drift. We postulate that large effective population sizes contribute to the evolutionary longevity of Glomeromycota.

  16. Label- and amplification-free electrochemical detection of bacterial ribosomal RNA.

    Science.gov (United States)

    Henihan, Grace; Schulze, Holger; Corrigan, Damion K; Giraud, Gerard; Terry, Jonathan G; Hardie, Alison; Campbell, Colin J; Walton, Anthony J; Crain, Jason; Pethig, Ronald; Templeton, Kate E; Mount, Andrew R; Bachmann, Till T

    2016-07-15

    Current approaches to molecular diagnostics rely heavily on PCR amplification and optical detection methods which have restrictions when applied to point of care (POC) applications. Herein we describe the development of a label-free and amplification-free method of pathogen detection applied to Escherichia coli which overcomes the bottleneck of complex sample preparation and has the potential to be implemented as a rapid, cost effective test suitable for point of care use. Ribosomal RNA is naturally amplified in bacterial cells, which makes it a promising target for sensitive detection without the necessity for prior in vitro amplification. Using fluorescent microarray methods with rRNA targets from a range of pathogens, an optimal probe was selected from a pool of probe candidates identified in silico. The specificity of probes was investigated on DNA microarray using fluorescently labeled 16S rRNA target. The probe yielding highest specificity performance was evaluated in terms of sensitivity and a LOD of 20 pM was achieved on fluorescent glass microarray. This probe was transferred to an EIS end point format and specificity which correlated to microarray data was demonstrated. Excellent sensitivity was facilitated by the use of uncharged PNA probes and large 16S rRNA target and investigations resulted in an LOD of 50 pM. An alternative kinetic EIS assay format was demonstrated with which rRNA could be detected in a species specific manner within 10-40min at room temperature without wash steps.

  17. The putative RNA helicase HELZ promotes cell proliferation, translation initiation and ribosomal protein S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Philippe A Hasgall

    Full Text Available The hypoxia-inducible transcription factor (HIF is a key component of the cellular adaptation mechanisms to hypoxic conditions. HIFα subunits are degraded by prolyl-4-hydroxylase domain (PHD enzyme-dependent prolyl-4-hydroxylation of LxxLAP motifs that confer oxygen-dependent proteolytic degradation. Interestingly, only three non-HIFα proteins contain two conserved LxxLAP motifs, including the putative RNA helicase with a zinc finger domain HELZ. However, HELZ proteolytic regulation was found to be oxygen-independent, supporting the notion that a LxxLAP sequence motif alone is not sufficient for oxygen-dependent protein destruction. Since biochemical pathways involving RNA often require RNA helicases to modulate RNA structure and activity, we used luciferase reporter gene constructs and metabolic labeling to demonstrate that HELZ overexpression activates global protein translation whereas RNA-interference mediated HELZ suppression had the opposite effect. Although HELZ interacted with the poly(A-binding protein (PABP via its PAM2 motif, PABP was dispensable for HELZ function in protein translation. Importantly, downregulation of HELZ reduced translational initiation, resulting in the disassembly of polysomes, in a reduction of cell proliferation and hypophosphorylation of ribosomal protein S6.

  18. [Study of the mRNA-binding region of ribosomes at different steps of translation. II. Affinity modification of Escherichia coli ribosomes by benzylidene derivative of AUGU6 in the 70S initiation complex].

    Science.gov (United States)

    Babkina, G T; Karpova, G G; Matasova, N B; Berzin', V M; Gren, E Ia

    1985-01-01

    2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.

  19. Molecular Identification of Ptychodera flava (Hemichordata: Enteropneusta): Reconsideration in Light of Nucleotide Polymorphism in the 18S Ribosomal RNA Gene.

    Science.gov (United States)

    Urata, Makoto

    2015-06-01

    Seven nuclear and mitochondrial DNA markers were examined in 12 specimens of Ptychodera flava, a model acorn worm used in molecular biology, collected in Japan from three local populations with different modes of living. A comparison of intraspecific results did not show genetically isolated populations despite the species' enclave habitats and asexual reproduction. Moreover, both the nuclear 18S ribosomal RNA gene and mitochondrial 16S ribosomal RNA gene sequences were identical to those from Moorea in French Polynesia, nearly 10,000 kilometers away from Japan. I also provide the first definitive information regarding polymorphisms in 18S ribosomal RNA gene, the external transcribed spacer (ETS), internal transcribed spacers (ITS), and mitochondrial cytochrome c oxidase subunit 1 (mtCO1) sequence in hemichordates using newly designed primer sets, and I show both high larval vagility and certain criteria for the molecular identification of this species.

  20. The bacterial toxin RelE induces specific mRNA cleavage in the A site of the eukaryote ribosome

    Science.gov (United States)

    Andreev, Dmitri; Hauryliuk, Vasili; Terenin, Ilya; Dmitriev, Sergey; Ehrenberg, Måns; Shatsky, Ivan

    2008-01-01

    RelE/RelB is a well-characterized toxin–anti-toxin pair involved in nutritional stress responses in Bacteria and Archae. RelE lacks any eukaryote homolog, but we demonstrate here that it efficiently and specifically cleaves mRNA in the A site of the eukaryote ribosome. The cleavage mechanism is similar to that in bacteria, showing the feasibility of A-site cleavage of mRNA for regulatory purposes also in eukaryotes. RelE cleavage in the A-site codon of a stalled eukaryote ribosome is precise and easily monitored, making “RelE printing” a useful complement to toeprinting to determine the exact mRNA location on the eukaryote ribosome and to probe the occupancy of its A site. PMID:18083838

  1. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  2. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Science.gov (United States)

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  3. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    Directory of Open Access Journals (Sweden)

    Markus Buchhaupt

    Full Text Available Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  4. Model of EF4-induced ribosomal state transitions and mRNA translocation

    Science.gov (United States)

    Xie, Ping

    2014-08-01

    EF4, a highly conserved protein present in bacteria, mitochondria and chloroplasts, can bind to both the posttranslocation and pretranslocation ribosomal complexes. When binding to the posttranslocation state, it catalyzes backward translocation to a pretranslocation state. When binding to the pretranslocation state, it catalyzes transition to another pretranslocation state that is similar and possibly identical to that resulting from the posttranslocation state bound by EF4, and competes with EF-G to regulate the elongation cycle. However, the molecular mechanism on how EF4 induces state transitions and mRNA translocation remains unclear. Here, we present both the model for state transitions induced by EF4 binding to the posttranslocation state and that by EF4 binding to the pretranslocation state, based on which we study the kinetics of EF4-induced state transitions and mRNA translocation, giving quantitative explanations of the available experimental data. Moreover, we present some predicted results on state transitions and mRNA translocation induced by EF4 binding to the pretranslocation state complexed with the mRNA containing a duplex region.

  5. Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli.

    Science.gov (United States)

    Knutsson Jenvert, Rose-Marie; Holmberg Schiavone, Lovisa

    2005-02-01

    Stringent factor is a ribosome-dependent ATP:GTP pyrophosphoryl transferase that synthesizes (p)ppGpp upon nutrient deprivation. It is activated by unacylated tRNA in the ribosomal amino-acyl site (A-site) but it is unclear how activation occurs. A His-tagged stringent factor was isolated by affinity-chromatography and precipitation. This procedure yielded a protein of high purity that displayed (a) a low endogenous pyrophosphoryl transferase activity that was inhibited by the antibiotic tetracycline; (b) a low ribosome-dependent activity that was inhibited by the A-site specific antibiotics thiostrepton, micrococcin, tetracycline and viomycin; (c) a tRNA- and ribosome-dependent activity amounting to 4500 pmol pppGpp per pmol stringent factor per minute. Footprinting analysis showed that stringent factor interacted with ribosomes that contained tRNAs bound in classical states. Maximal activity was seen when the ribosomal A-site was presaturated with unacylated tRNA. Less tRNA was required to reach maximal activity when stringent factor and unacylated tRNA were added simultaneously to ribosomes, suggesting that stringent factor formed a complex with tRNA in solution that had higher affinity for the ribosomal A-site. However, tRNA-saturation curves, performed at two different ribosome/stringent factor ratios and filter-binding assays, did not support this hypothesis.

  6. The effect of aminoacyl- or peptidyl-tRNA at the A-site on the arrangement of deacylated tRNA at the ribosomal P-site.

    Science.gov (United States)

    Babkina, G T; Bausk, E V; Graifer, D M; Karpova, G G; Matasova, N B

    1984-05-21

    Photoreactive derivatives of E. coli tRNAPhe bearing arylazido groups on guanine residues (azido-tRNA) were used for affinity labelling of E. coli ribosomes in the region of the P-site when the A-site was either free or occupied by aminoacyl- or peptidyl-tRNA. Corresponding complexes of azido-tRNA with ribosomes and poly(U) were obtained both nonenzymatically and with the use of elongation factors. UV-irradiation of the complexes resulted in labelling of ribosomal proteins (preferentially of 30 S subunit). Proteins S9 and S21 were labelled only when the A-site was free; S14 - only when it was occupied; S11, S13, S19 - in both cases; S5, S7, S12, S20 - in some states.

  7. Genetic characterization of clinical acanthamoeba isolates from Japan using nuclear and mitochondrial small subunit ribosomal RNA.

    Science.gov (United States)

    Rahman, Md Moshiur; Yagita, Kenji; Kobayashi, Akira; Oikawa, Yosaburo; Hussein, Amjad I A; Matsumura, Takahiro; Tokoro, Masaharu

    2013-08-01

    Because of an increased number of Acanthamoeba keratitis (AK) along with associated disease burdens, medical professionals have become more aware of this pathogen in recent years. In this study, by analyzing both the nuclear 18S small subunit ribosomal RNA (18S rRNA) and mitochondrial 16S rRNA gene loci, 27 clinical Acanthamoeba strains that caused AK in Japan were classified into 3 genotypes, T3 (3 strains), T4 (23 strains), and T5 (one strain). Most haplotypes were identical to the reference haplotypes reported from all over the world, and thus no specificity of the haplotype distribution in Japan was found. The T4 sub-genotype analysis using the 16S rRNA gene locus also revealed a clear sub-conformation within the T4 cluster, and lead to the recognition of a new sub-genotype T4i, in addition to the previously reported sub-genotypes T4a-T4h. Furthermore, 9 out of 23 strains in the T4 genotype were identified to a specific haplotype (AF479533), which seems to be a causal haplotype of AK. While heterozygous nuclear haplotypes were observed from 2 strains, the mitochondrial haplotypes were homozygous as T4 genotype in the both strains, and suggested a possibility of nuclear hybridization (mating reproduction) between different strains in Acanthamoeba. The nuclear 18S rRNA gene and mitochondrial 16S rRNA gene loci of Acanthamoeba spp. possess different unique characteristics usable for the genotyping analyses, and those specific features could contribute to the establishment of molecular taxonomy for the species complex of Acanthamoeba.

  8. Sequence and secondary structure of the mitochondrial 16S ribosomal RNA gene of Ixodes scapularis.

    Science.gov (United States)

    Krakowetz, Chantel N; Chilton, Neil B

    2015-02-01

    The complete DNA sequences and secondary structure of the mitochondrial (mt) 16S ribosomal (r) RNA gene were determined for six Ixodes scapularis adults. There were 44 variable nucleotide positions in the 1252 bp sequence alignment. Most (95%) nucleotide alterations did not affect the integrity of the secondary structure of the gene because they either occurred at unpaired positions or represented compensatory changes that maintained the base pairing in helices. A large proportion (75%) of the intraspecific variation in DNA sequence occurred within Domains I, II and VI of the 16S gene. Therefore, several regions within this gene may be highly informative for studies of the population genetics and phylogeography of I. scapularis, a major vector of pathogens of humans and domestic animals in North America.

  9. Ribosome-associated GTPases: the role of RNA for GTPase activation.

    Science.gov (United States)

    Clementi, Nina; Polacek, Norbert

    2010-01-01

    The GTPase super-family comprises a variety of G proteins found in all three domains of life. Although they are participating in completely different processes like signal transduction, protein biosynthesis and regulation of cell proliferation, they all share a highly conserved G domain and use a common mechanism for GTP hydrolysis. Exact timing in hydrolyzing the bound GTP serves as a molecular switch to initiate diverse cellular reactions. Classical GTPases depend on external proteins to fire GTP hydrolysis (GAPs), and following the GTPase reaction to exchange GDP for GTP (GEFs), converting the GTPase into the active state again. In recent years it became clear that there are many GTPases that do not follow this classical switch mode scheme. Certain ribosome-associated GTPases are not reliant on other GEF proteins to exchange GDP for GTP. Furthermore many of these G proteins are not activated by external GAPs, but by evolutionarily ancient molecules, namely by RNA.

  10. Combined heat shock protein 90 and ribosomal RNA sequence phylogeny supports multiple replacements of dinoflagellate plastids.

    Science.gov (United States)

    Shalchian-Tabrizi, Kamran; Minge, Marianne A; Cavalier-Smith, Tom; Nedreklepp, Joachim M; Klaveness, Dag; Jakobsen, Kjetill S

    2006-01-01

    Dinoflagellates harbour diverse plastids obtained from several algal groups, including haptophytes, diatoms, cryptophytes, and prasinophytes. Their major plastid type with the accessory pigment peridinin is found in the vast majority of photosynthetic species. Some species of dinoflagellates have other aberrantly pigmented plastids. We sequenced the nuclear small subunit (SSU) ribosomal RNA (rRNA) gene of the "green" dinoflagellate Gymnodinium chlorophorum and show that it is sister to Lepidodinium viride, indicating that their common ancestor obtained the prasinophyte (or other green alga) plastid in one event. As the placement of dinoflagellate species that acquired green algal or haptophyte plastids is unclear from small and large subunit (LSU) rRNA trees, we tested the usefulness of the heat shock protein (Hsp) 90 gene for dinoflagellate phylogeny by sequencing it from four species with aberrant plastids (G. chlorophorum, Karlodinium micrum, Karenia brevis, and Karenia mikimotoi) plus Alexandrium tamarense, and constructing phylogenetic trees for Hsp90 and rRNAs, separately and together. Analyses of the Hsp90 and concatenated data suggest an ancestral origin of the peridinin-containing plastid, and two independent replacements of the peridinin plastid soon after the early radiation of the dinoflagellates. Thus, the Hsp90 gene seems to be a promising phylogenetic marker for dinoflagellate phylogeny.

  11. Analysis of the interaction between bovine mitochondrial 28 S ribosomal subunits and mRNA.

    Science.gov (United States)

    Farwell, M A; Schirawski, J; Hager, P W; Spremulli, L L

    1996-11-11

    The small subunit of the bovine mitochondrial ribosome forms a tight complex with mRNAs. This [28 S:mRNA] complex forms as readily on circular mRNAs as on linear mRNAs indicating that a free 5' end on the mRNA is not required for the interaction observed. The effects of monovalent cations on the equilibrium association constant and on the forward and reverse rate constants governing this interaction have been determined. Monovalent cations have a strong effect on the forward rate constant. Increasing the KCl concentration from 1 mM to 100 mM reduces kon by nearly 100-fold. Monovalent cations have only a small effect on the reverse rate constant, koff'. Analysis of these data indicates that the rate laws governing the formation and dissociation of the [28 S:mRNA] complex cannot be deduced from the chemical equation. This observation suggests that there are "hidden intermediates' in the formation and dissociation of this complex. The implications of these observations are discussed in terms of a model for the interaction between the mitochondrial 28 S subunit and mRNAs.

  12. Proteins associated with rRNA in the Escherichia coli ribosome.

    Science.gov (United States)

    Bernabeu, C; Vazquez, D; Ballesta, J P

    1978-04-27

    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  13. Wnt5a Signals through DVL1 to Repress Ribosomal DNA Transcription by RNA Polymerase I

    Science.gov (United States)

    Dass, Randall A.; Sarshad, Aishe A.; Feenstra, Jennifer M.; Kaur, Amanpreet; Pietras, Kristian; Serra, Rosa; Blanchard, Scott C.; Percipalle, Piergiorgio; Brown, Anthony M. C.; Vincent, C. Theresa

    2016-01-01

    Ribosome biogenesis is essential for cell growth and proliferation and is commonly elevated in cancer. Accordingly, numerous oncogene and tumor suppressor signaling pathways target rRNA synthesis. In breast cancer, non-canonical Wnt signaling by Wnt5a has been reported to antagonize tumor growth. Here, we show that Wnt5a rapidly represses rDNA gene transcription in breast cancer cells and generates a chromatin state with reduced transcription of rDNA by RNA polymerase I (Pol I). These effects were specifically dependent on Dishevelled1 (DVL1), which accumulates in nucleolar organizer regions (NORs) and binds to rDNA regions of the chromosome. Upon DVL1 binding, the Pol I transcription activator and deacetylase Sirtuin 7 (SIRT7) releases from rDNA loci, concomitant with disassembly of Pol I transcription machinery at the rDNA promoter. These findings reveal that Wnt5a signals through DVL1 to suppress rRNA transcription. This provides a novel mechanism for how Wnt5a exerts tumor suppressive effects and why disruption of Wnt5a signaling enhances mammary tumor growth in vivo. PMID:27500936

  14. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region...

  15. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  16. 微孢子虫核糖体小亚单位RNA(ssUrRNA)基因%Small Subunit Ribosomal RNA Genes of Microsporidia

    Institute of Scientific and Technical Information of China (English)

    王见杨; 黄可威; 毛西成; 赵 昀; 陆长德

    2001-01-01

    微孢子虫是广泛分布于自然界的细胞内原虫类寄生物。它们可寄生于整个生物界。微孢子虫是真核生物,但其核糖体及核糖体RNA(rRNA)为原核生物型。为探讨9种家蚕病原性微孢子虫的种属地位及亲缘关系,对已广泛用于生物进化分类的核糖体小亚单位RNA(asurRNA)基因进行了研究。由微孢子虫ssurRNA基因序列同源性分析所构建的系统进化发育树及Southam杂交分析表明,这9种微孢子虫同为Nosema属,为同属不同种。%Microsporidia are ubiquitous intracellular parasitic protozoa infecting all types of animals. Their ribosomes and rRNAs are of prokaryotic size. In order to better understand their phylogenetic relationship and identify the uncertain species, the sequences of the small subunit ribosomal RNA (ssurRNA, 16 S rRNA) genesof nine microsporidia infectious to the silkworm, Bombyx mori, were determined. The results of phylogenetic trees and Southern blotting suggest all the nine strains of icrosporidia are various species of the genus Nosema.

  17. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  18. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  19. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    . Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...... of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all...

  20. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    OpenAIRE

    2015-01-01

    Viruses use alternate mechanisms to increase the coding capacity of their viral genomes. The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts an RNA structure that can direct translation in 0 and +1 reading frames to produce the viral structural proteins and an overlapping ORFx product. Here we provide structural and biochemical evidence that the PKI domain of the IRES mimics a complete tRNA-like structure to facilitate reading frame selection and allows the viral IR...

  1. The ribosomal RNA transcription unit of Entamoeba invadens: accumulation of unprocessed pre-rRNA and a long non coding RNA during encystation.

    Science.gov (United States)

    Ojha, Sandeep; Singh, Nishant; Bhattacharya, Alok; Bhattacharya, Sudha

    2013-01-01

    The ribosomal RNA genes in Entamoeba spp. are located on extrachromosomal circular molecules. Unlike model organisms where rRNA transcription stops during growth stress, Entamoeba histolytica continues transcription; but unprocessed pre-rRNA accumulates during stress, along with a novel class of circular transcripts from the 5'-external transcribed spacer (ETS). To determine the fate of rRNA transcription during stage conversion between trophozoite to cyst we analyzed Entamoeba invadens, a model system for differentiation studies in Entamoeba. We characterized the complete rDNA transcription unit by mapping the ends of pre-rRNA and mature rRNAs. The 3' end of mature 28S rRNA was located 321 nt downstream of the end predicted by sequence homology with E. histolytica. The major processing sites were mapped in external and internal transcribed spacers. The promoter located within 146 nt upstream of 5' ETS was used to transcribe the pre-rRNA. On the other hand, a second promoter located at the 3' end of 28S rDNA was used to transcribe almost the entire intergenic spacer into a long non coding (nc) RNA (>10 kb). Interestingly we found that the levels of pre-rRNA and long ncRNA, measured by northern hybridization, decreased initially in cells shifted to encystation medium, after which they began to increase and reached high levels by 72 h when mature cysts were formed. Unlike E. histolytica, no circular transcripts were found in E. invadens. E. histolytica and E. invadens express fundamentally different ncRNAs from the rDNA locus, which may reflect their adaptation to different hosts (human and reptiles, respectively). This is the first description of rDNA organization and transcription in E. invadens, and provides the framework for further studies on regulation of rRNA synthesis during cyst formation.

  2. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.

    Science.gov (United States)

    Gorelic, L

    1976-08-10

    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  3. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    OpenAIRE

    1988-01-01

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting relate...

  4. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina

    2015-05-01

    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  5. 18S ribosomal RNA gene sequences of Cochliopodium (Himatismenida) and the phylogeny of Amoebozoa.

    Science.gov (United States)

    Kudryavtsev, Alexander; Bernhard, Detlef; Schlegel, Martin; Chao, Ema E Y; Cavalier-Smith, Thomas

    2005-08-01

    Cochliopodium is a very distinctive genus of discoid amoebae covered by a dorsal tectum of carbohydrate microscales. Its phylogenetic position is unclear, since although sharing many features with naked "gymnamoebae", the tectum sets it apart. We sequenced 18S ribosomal RNA genes from three Cochliopodium species (minus, spiniferum and Cochliopodium sp., a new species resembling C. minutum). Phylogenetic analysis shows Cochliopodium as robustly holophyletic and within Amoebozoa, in full accord with morphological data. Cochliopodium is always one of the basal branches within Amoebozoa but its precise position is unstable. In Bayesian analysis it is sister to holophyletic Glycostylida, but distance trees mostly place it between Dermamoeba and a possibly artifactual long-branch cluster including Thecamoeba. These positions are poorly supported and basal amoebozoan branching ill-resolved, making it unclear whether Discosea (Glycostylida, Himatismenida, Dermamoebida) is holophyletic; however, Thecamoeba seems not specifically related to Dermamoeba. We also sequenced the small-subunit rRNA gene of Vannella persistens, which constantly grouped with other Vannella species, and two Hartmannella strains. Our trees suggest that Vexilliferidae, Variosea and Hartmannella are polyphyletic, confirming the existence of two very distinct Hartmannella clades: that comprising H. cantabrigiensis and another divergent species is sister to Glaeseria, whilst Hartmannella vermiformis branches more deeply.

  6. A study of ribonucleoproteins: The sequence of rabbit 18S ribosomal RNA and the identification of proteins associated with messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Connaughton, J.F. Jr.

    1989-01-01

    This study considers the functional role of ribosomal RNA and messenger ribonucleoproteins in the translational regulation of gene expression. The primary structure of rabbit 18S ribosomal RNA was determined by nucleotide sequence analysis of the RNA directly. Rabbit 18S RNA was cleaved with either T{sub 1} ribonuclease or RNase H, using a Pst 1 DNA linker to generate a unique set of overlapping fragments spanning the entire molecule. Both intact and fragmented 18S RNA were end-labeled with {sup 32}P and base-specifically cleaved enzymatically and chemically. Nucleotide sequences were determined from long polyacrylamide sequencing gels run in formamide. To assess functional roles of RNA in gene expression, specific mRNA-protein interactions were also examined. Eukaryotic mRNA is associated with specific proteins that may be important in translational regulation and mRNA stability; mRNP complexes were reconstituted in a message-dependent, cell-free rabbit reticulocyte translation system, using unique mRNA species transcribed in vitro with SP6 polymerase. Transcripts of both rabbit and human {beta}-globin cDNA were labeled with {sup 32}P either throughout the molecule ore selectively at the 5{prime} and 3{prime} terminus.

  7. Evidence for compensatory evolution of ribosomal proteins in response to rapid divergence of mitochondrial rRNA.

    Science.gov (United States)

    Barreto, Felipe S; Burton, Ronald S

    2013-02-01

    Rapid evolution of mitochondrial DNA (mtDNA) places intrinsic selective pressures on many nuclear genes involved in mitochondrial functions. Mitochondrial ribosomes, for example, are composed of mtDNA-encoded ribosomal RNAs (rRNAs) and a set of more than 60 nuclear-encoded ribosomal proteins (mRP) distinct from the cytosolic RPs (cRP). We hypothesized that the rapid divergence of mt-rRNA would result in rapid evolution of mRPs relative to cRPs, which respond to slowly evolving nuclear-encoded rRNA. In comparisons of rates of nonsynonymous and synonymous substitutions between a pair of divergent populations of the copepod Tigriopus californicus, we found that mRPs showed elevated levels of amino acid changes relative to cRPs. This pattern was equally strong at the interspecific level, between three pairs of sister species (Nasonia vitripennis vs. N. longicornis, Drosophila melanogaster vs. D. simulans, and Saccharomyces cerevisae vs. S. paradoxus). This high rate of mRP evolution may result in intergenomic incompatibilities between taxonomic lineages, and such incompatibilities could lead to dysfunction of mitochondrial ribosomes and the loss of fitness observed among interpopulation hybrids in T. californicus and interspecific hybrids in other species.

  8. A phylogeny of the Passerida (Aves:Passeriformes) based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina Wu; Yanfeng Sun; Juyong Li; Yaqing Li; Yuefeng Wu; and Dongming Li

    2015-01-01

    Background:Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations;however, the phylogenetic relationships within this assemblage have been the subject of many debates. Methods:We analyzed the 12S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group. Results:Our results identified the monophyly of the three superfamilies in Passerida:Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida. Conclusion:Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  9. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  10. Combined large and small subunit ribosomal RNA phylogenies support a basal position of the acoelomorph flatworms.

    Science.gov (United States)

    Telford, Maximilian J; Lockyer, Anne E; Cartwright-Finch, Chloë; Littlewood, D Timothy J

    2003-05-22

    The phylogenetic position of the phylum Platyhelminthes has been re-evaluated in the past decade by analysis of diverse molecular datasets. The consensus is that the Rhabditophora + Catenulida, which includes most of the flatworm taxa, are not primitively simple basal bilaterians but are related to coelomate phyla such as molluscs. The status of two other groups of acoelomate worms, Acoela and Nemertodermatida, is less clear. Although many characteristics unite these two groups, initial molecular phylogenetic studies placed the Nemertodermatida within the Rhabditophora, but placed the Acoela at the base of the Bilateria, distant from other flatworms. This contradiction resulted in scepticism about the basal position of acoels and led to calls for further data. We have sequenced large subunit ribosomal RNA genes from 13 rhabditophorans + catenulids, three acoels and one nemertodermatid, tripling the available data. Our analyses strongly support a basal position of both acoels and nemertodermatids. Alternative hypotheses are significantly less well supported by the data. We conclude that the Nemertodermatida and Acoela are basal bilaterians and, owing to their unique body plan and embryogenesis, should be recognized as a separate phylum, the Acoelomorpha.

  11. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences.

    Science.gov (United States)

    Allsopp, M; Visser, E S; du Plessis, J L; Vogel, S W; Allsopp, B A

    1997-08-01

    Cowdria ruminantium is a rickettsial parasite which causes heartwater, a economically important disease of domestic and wild ruminants in tropical and subtropical Africa and parts of the Caribbean. Because existing diagnostic methods are unreliable, we investigated the small-subunit ribosomal RNA (srRNA) gene from heartwater-infected material to characterise the organisms present and to develop specific oligonucleotide probes for polymerase chain reaction (PCR) based diagnosis. DNA was obtained from ticks and ruminants from heartwater-free and heartwater-endemic areas from Cowdria in tissue culture. PCR was carried out using primers designed to amplify only rickettsial srRNA genes, the target region being the highly variable V1 loop. Amplicons were cloned and sequenced; 51% were C. ruminantium sequences corresponding to four genotypes, two of which were identical to previously reported C. ruminantium sequences while the other two were new. The four different Cowdria genotypes can be correlated with different phenotypes. Tissue-culture samples yielded only Cowdria genotype sequences, but an extraordinary heterogeneity of 16S sequences was obtained from field samples. In addition to Cowdria genotypes we found sequences from previously unknown Ehrlichia spp., sequences showing homology to other Rickettsiales and a variety of Pseudomonadaceae. One Ehrlichia sequence was phylogenetically closely related to Ehrlichia platys (Group II Ehrlichia) and one to Ehrlichia canis (Group III Ehrlichia). This latter sequence was from an isolate (Germishuys) made from a naturally infected sheep which, from brain smear examination and pathology, appeared to be suffering from heartwater; nevertheless no Cowdria genotype sequences were found in this isolate. In addition no Cowdria sequences were obtained from uninfected ticks. Complete 16S rRNA gene sequences were determined for two C. ruminantium genotypes and for two previously uncharacterised heartwater-associated Ehrlichia spp

  12. A new model for the three-dimensional folding of Escherichia coli 16 S ribosomal RNA. II. The RNA-protein interaction data.

    Science.gov (United States)

    Mueller, F; Brimacombe, R

    1997-08-29

    The map of the mass centres of the 21 proteins from the Escherichia coli 30 S ribosomal subunit, as determined by neutron scattering, was fitted to a cryoelectron microscopic (cryo-EM) model at a resolution of 20 A of 70 S ribosomes in the pre-translocational state, carrying tRNA molecules at the A and P sites. The fit to the 30 S moiety of the 70 S particles was accomplished with the help of the well-known distribution of the ribosomal proteins in the head, body and side lobe regions of the 30 S subunit, as determined by immuno electron microscopy (IEM). Most of the protein mass centres were found to lie close to the surface (or even outside) of the cryo-EM contour of the 30 S subunit, supporting the idea that the ribosomal proteins are arranged peripherally around the rRNA. The ribosomal protein distribution was then compared with the corresponding model for the 16 S rRNA, fitted to the same EM contour (described in an accompanying paper), in order to analyse the mutual compatibility of the arrangement of proteins and rRNA in terms of the available RNA-protein interaction data. The information taken into account included the hydroxyl radical and base foot-printing data from Noller's laboratory, and our own in situ cross-linking results. Proteins S1 and S14 were not considered, due to the lack of RNA-protein data. Among the 19 proteins analysed, 12 (namely S2, S4, S5, S7, S8, S9, S10, S11, S12, S15, S17 and S21) showed a fit to the rRNA model that varied from being excellent to at least acceptable. Of the remaining 7, S3 and S13 showed a rather poor fit, as did S18 (which is considered in combination with S6 in the foot-printing experiments). S16 was difficult to evaluate, as the foot-print data for this protein cover a large area of the rRNA. S19 and S20 showed a bad fit in terms of the neutron map, but their foot-print and cross-link sites were clustered into compact groups in the rRNA model in those regions of the 30 S subunit where these proteins have

  13. Asaia bogorensis peritonitis identified by 16S ribosomal RNA sequence analysis in a patient receiving peritoneal dialysis.

    Science.gov (United States)

    Snyder, Richard W; Ruhe, Jorg; Kobrin, Sidney; Wasserstein, Alan; Doline, Christa; Nachamkin, Irving; Lipschutz, Joshua H

    2004-08-01

    Here the authors report a case of refractory peritonitis leading to multiple hospitalizations and the loss of peritoneal dialysis access in a patient on automated peritoneal dialysis, caused by Asaia bogorensis, a bacterium not previously described as a human pathogen. This organism was identified by sequence analysis of the 16S ribosomal RNA gene. Unusual microbial agents may cause peritonitis, and molecular microbiological techniques are important tools for identifying these agents.

  14. Molecular cloning and characterization of SL3: a stem cell-specific SL RNA from the planarian Schmidtea mediterranea.

    Science.gov (United States)

    Rossi, Alessandro; Ross, Eric J; Jack, Antonia; Sánchez Alvarado, Alejandro

    2014-01-01

    Spliced leader (SL) trans-splicing is a biological phenomenon, common among many metazoan taxa, consisting in the transfer of a short leader sequence from a small SL RNA to the 5' end of a subset of pre-mRNAs. While knowledge of the biochemical mechanisms driving this process has accumulated over the years, the functional consequences of such post-transcriptional event at the organismal level remain unclear. In addition, the fact that functional analyses have been undertaken mainly in trypanosomes and nematodes leaves a somehow fragmented picture of the possible biological significance and evolution of SL trans-splicing in eukaryotes. Here, we analyzed the spatial expression of SL RNAs in the planarian flatworm Schmidtea mediterranea, with the goal of identifying novel developmental paradigms for the study of trans-splicing in metazoans. Besides the previously identified SL1 and SL2, S. mediterranea expresses a third SL RNA described here as SL3. While, SL1 and SL2 are collectively expressed in a broad range of planarian cell types, SL3 is highly enriched in a subset of the planarian stem cells engaged in regenerative responses. Our findings provide new opportunities to study how trans-splicing may regulate the phenotype of a cell.

  15. A ribonucleoprotein fragment of the 30 S ribosome of E. coli containing two contiguous domains of the 16 S RNA.

    Science.gov (United States)

    Spitnik-Elson, P; Elson, D; Avital, S; Abramowitz, R

    1982-08-11

    Ribonucleoprotein fragments of the 30 S ribosome of E. coli have been prepared by limited ribonuclease digestion and mild heating of the ribosome in a constant ionic environment. One such fragment has been described previously. A second electrophoretically homogeneous fragment has now been isolated and its RNA and protein moieties have been characterized. It contains the 5' half of the 16 S RNA, encompassing domains I and II except for the extreme 5' terminus and several small gaps. Seven proteins are present: S4, S5, S6, S8, S12, S15 and S20. The RNA binding sites of five of these proteins are known, and all are RNA sequences that are present in the fragment. Published neutron scattering and immuno-electron microscopic data indicate that six of the proteins are clustered together in a cross sectional slice through the center of the subunit. After deproteinization, the RNA moiety gives two bands in gel electrophoresis, one containing domains I and II and the other, essentially only domain II. The former, although larger, migrates faster in gel electrophoresis, indicating that RNA domains I and II interact with each other in such a way as to become more compact than domain II by itself.

  16. Molecular phylogeny of silk-producing insects based on 16S ribosomal RNA and cytochrome oxidase subunit I genes

    Indian Academy of Sciences (India)

    B. Mahendran; S. K. Ghosh; S. C. Kundu

    2006-04-01

    We have examined the molecular-phylogenetic relationships between nonmulberry and mulberry silkwormspecies that belong to the families Saturniidae, Bombycidae and Lasiocampidae using 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (coxI) gene sequences. Aligned nucleotide sequences of 16S rRNA and coxI from 14 silk-producing species were used for construction of phylogenetic trees by maximum likelihood and maximum parsimony methods. The tree topology on the basis of 16S rRNA supports monophyly for members of Saturniidae and Bombycidae. Weighted parsimony analysis weighted towards transversions relative to transitions (ts, tv4) for coxI resulted in more robust bootstrap support over unweighted parsimony and favours the 16S rRNA tree topology. Combined analysis reflected clear biogeographic pattern, and agrees with morphological and cytological data.

  17. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    Science.gov (United States)

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  18. Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

    Science.gov (United States)

    Rinke, J; Ross, A; Brimacombe, R

    1977-06-01

    When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.

  19. Selection of random RNA fragments as method for searching for a site of regulation of translation of E. coli streptomycin mRNA by ribosomal protein S7.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kraal, B; Kopylov, A M

    2008-06-01

    In E. coli cells ribosomal small subunit biogenesis is regulated by RNA-protein interactions involving protein S7. S7 initiates the subunit assembly interacting with 16S rRNA. During shift-down of rRNA synthesis level, free S7 inhibits self-translation by interacting with 96 nucleotides long specific region of streptomycin (str) mRNA between cistrons S12 and S7 (intercistron). Many bacteria do not have the extended intercistron challenging development of specific approaches for searching putative mRNA regulatory regions, which are able to interact with proteins. The paper describes application of SERF approach (Selection of Random RNA Fragments) to reveal regulatory regions of str mRNA. Set of random DNA fragments has been generated from str operon by random hydrolysis and then transcribed into RNA; the fragments being able to bind protein S7 (serfamers) have been selected by iterative rounds. S7 binds to single serfamer, 109 nucleotide long (RNA109), derived from the intercistron. After multiple copying and selection, the intercistronic mutant (RNA109) has been isolated; it has enhanced affinity to S7. RNA109 binds to the protein better than authentic intercistronic str mRNA; apparent dissociation constants are 26 +/- 5 and 60 +/- 8 nM, respectively. Location of S7 binding site on the mRNA, as well as putative mode of regulation of coupled translation of S12 and S7 cistrons have been hypothesized.

  20. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N...... decreases, at one or more rRNA sites but, with the exception of chloramphenicol, did not affect cross-linking to the ribosomal proteins. Moreover, the effects were closely similar for both deacylated and N-Ac-Phe-tRNAs, indicating that the drugs selectively perturb the 3' terminus of the tRNA. The strongest......-ribosome complexes. It is concluded that the antibiotics perturb the relative positioning of the 3' end of the P/P'-site-bound tRNA and the peptidyl transferase loop region of 23S rRNA....

  1. WDR55 is a nucleolar modulator of ribosomal RNA synthesis, cell cycle progression, and teleost organ development.

    Directory of Open Access Journals (Sweden)

    Norimasa Iwanami

    2008-08-01

    Full Text Available The thymus is a vertebrate-specific organ where T lymphocytes are generated. Genetic programs that lead to thymus development are incompletely understood. We previously screened ethylnitrosourea-induced medaka mutants for recessive defects in thymus development. Here we report that one of those mutants is caused by a missense mutation in a gene encoding the previously uncharacterized protein WDR55 carrying the tryptophan-aspartate-repeat motif. We find that WDR55 is a novel nucleolar protein involved in the production of ribosomal RNA (rRNA. Defects in WDR55 cause aberrant accumulation of rRNA intermediates and cell cycle arrest. A mutation in WDR55 in zebrafish also leads to analogous defects in thymus development, whereas WDR55-null mice are lethal before implantation. These results indicate that WDR55 is a nuclear modulator of rRNA synthesis, cell cycle progression, and embryonic organogenesis including teleost thymus development.

  2. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.

  3. Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion

    Science.gov (United States)

    Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.

    2017-01-01

    Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production. PMID:28091612

  4. A novel mutation 3090 G>A of the mitochondrial 16S ribosomal RNA associated with myopathy.

    Science.gov (United States)

    Coulbault, L; Deslandes, B; Herlicoviez, D; Read, M H; Leporrier, N; Schaeffer, S; Mouadil, A; Lombès, A; Chapon, F; Jauzac, P; Allouche, S

    2007-10-26

    We describe a young woman who presented with a progressive myopathy since the age of 9. Spectrophotometric analysis of the respiratory chain in muscle tissue revealed combined and profound complex I, III, II+III, and IV deficiency ranging from 60% to 95% associated with morphological and histochemical abnormalities of the muscle. An exhaustive screening of mitochondrial transfer and ribosomal RNAs showed a novel G>A substitution at nucleotide position 3090 which was detected only in urine sediment and muscle of the patient and was not found in her mother's blood cells and urine sample. We suggest that this novel de novo mutation in the 16S ribosomal RNA, a nucleotide which is highly conserved in different species, would impair mitochondrial protein synthesis and would cause a severe myopathy.

  5. A mutation in the 530 loop of Escherichia coli 16S ribosomal RNA causes resistance to streptomycin.

    Science.gov (United States)

    Melançon, P; Lemieux, C; Brakier-Gingras, L

    1988-10-25

    Oligonucleotide-directed mutagenesis was used to introduce an A to C transversion at position 523 in the 16S ribosomal RNA gene of Escherichia coli rrnB operon cloned in plasmid pKK3535. E. coli cells transformed with the mutated plasmid were resistant to streptomycin. The mutated ribosomes isolated from these cells were not stimulated by streptomycin to misread the message in a poly(U)-directed assay. They were also restrictive to the stimulation of misreading by other error-promoting related aminoglycoside antibiotics such as neomycin, kanamycin or gentamicin, which do not compete for the streptomycin binding site. The 530 loop where the mutation in the 16S rRNA is located has been mapped at the external surface of the 30S subunit, and is therefore distal from the streptomycin binding site at the subunit interface. Our results support the conclusion that the mutation at position 523 in the 16S rRNA does not interfere with the binding of streptomycin, but prevents the drug from inducing conformational changes in the 530 loop which account for its miscoding effect. Since this effect primarily results from a perturbation of the translational proofreading control, our results also provide evidence that the 530 loop of the 16S rRNA is involved in this accuracy control.

  6. Studies on the ability of partially iodinated 16S RNA to participate in 30S ribosome assembly.

    Science.gov (United States)

    Schendel, P L; Craven, G R

    1976-11-01

    Deproteinated 16S RNA was iodinated at pH 5.0 in an aqueous solution containing TlCl3 plus KI for 1-5 hours at 42 degrees C. Under these conditions 33 moles of iodine are incorporated per mole of RNA. As judged by sucrose gradient sedimentation, the iodinated RNA does not exhibit any large alteration in conformation as compared to unmodified 16S. The iodinated RNA was examined for its ability to reconstitute with total 30S proteins. Sedimentation velocity analysis reveals that the reconstituted subunit has a sedimentation constant of approximately 20S. In addition, protein analysis of particles reconstituted with 16S RNA iodinated for 5 hours indicates that proteins S2, S10, S13, S14, S15, S17, S18, S19, and S21 are no longer able to participate in the 30S assembly process and that proteins S6, S16 and S20 are present in reduced amounts. The ramifications of these results concerning protein-RNA and RNA-RNA interactions occurring in ribosome assembly are discussed.

  7. An RNA-binding complex involved in ribosome biogenesis contains a protein with homology to tRNA CCA-adding enzyme.

    Directory of Open Access Journals (Sweden)

    Jinzhong Lin

    2013-10-01

    Full Text Available A multitude of proteins and small nucleolar RNAs transiently associate with eukaryotic ribosomal RNAs to direct their modification and processing and the assembly of ribosomal proteins. Utp22 and Rrp7, two interacting proteins with no recognizable domain, are components of the 90S preribosome or the small subunit processome that conducts early processing of 18S rRNA. Here, we determine the cocrystal structure of Utp22 and Rrp7 complex at 1.97 Å resolution and the NMR structure of a C-terminal fragment of Rrp7, which is not visible in the crystal structure. The structure reveals that Utp22 surprisingly resembles a dimeric class I tRNA CCA-adding enzyme yet with degenerate active sites, raising an interesting evolutionary connection between tRNA and rRNA processing machineries. Rrp7 binds extensively to Utp22 using a deviant RNA recognition motif and an extended linker. Functional sites on the two proteins were identified by structure-based mutagenesis in yeast. We show that Rrp7 contains a flexible RNA-binding C-terminal tail that is essential for association with preribosomes. RNA-protein crosslinking shows that Rrp7 binds at the central domain of 18S rRNA and shares a neighborhood with two processing H/ACA snoRNAs snR30 and snR10. Depletion of snR30 prevents the stable assembly of Rrp7 into preribosomes. Our results provide insight into the evolutionary origin and functional context of Utp22 and Rrp7.

  8. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  9. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    Science.gov (United States)

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  10. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  11. [Mutual effect of human ribosomal proteins S5 and S16 on their binding with 18S rRNA fragment 1203-1236/1521-1698].

    Science.gov (United States)

    Ian'shina, D D; Malygin, A A; Karpova, G G

    2009-01-01

    Human ribosomal proteins S5 and S16 are homologues of prokaryotic ribosomal proteins S7p and S9p, respectively, that according to X-ray crystallography data on the Thermus thermophilus 30S ribosomal subunit contact the 3'-terminal 16S rRNA region formed by helices H28-H30 and H38-H43. In the present work we report studying mutual effect of human ribosomal proteins S5 and S16 on their binding with RNA transcript corresponding to the region 1203-1236/1521-1698 of the 18S rRNA (helices H28-30 and H41-43), which is homologous to thel6S rRNA region known to contain binding site of S7p and part of binding site of S9p. It was shown that simultaneous binding of ribosomal proteins S5 and S16 with this RNA transcript causes conformational changes in it stabilizing the complex by involvement of new parts of the RNA that interact with neither S5 nor S16 in the respective binary complexes.

  12. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    The peptidyl transfer site has been localized at the centre of domain V of 23S-like ribosomal RNA (rRNA) primarily on the basis of a chloramphenicol binding site. The implicated region constitutes an unstructured circle in the current secondary structural model which contains several universally...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...... of highly conserved nucleotides in the chloramphenicol binding region. A mechanistic model is also presented to explain the disruptive effect of chloramphenicol (and other antibiotics) on peptide bond formation at the ribosomal subunit interface....

  13. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A;

    2014-01-01

    recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  14. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH)

    NARCIS (Netherlands)

    Leveau, J.H.J.; Gerards, S.; De Boer, W.; Van Veen, J.A.

    2004-01-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia

  15. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA.

    Science.gov (United States)

    Vyas, Jashmin; Elia, Androulla; Clemens, Michael J

    2003-07-01

    Translation of the hepatitis C genome is mediated by internal ribosome entry on the structurally complex 5' untranslated region of the large viral RNA. Initiation of protein synthesis by this mechanism is independent of the cap-binding factor eIF4E, but activity of the initiator Met-tRNA(f)-binding factor eIF2 is still required. HCV protein synthesis is thus potentially sensitive to the inhibition of eIF2 activity that can result from the phosphorylation of the latter by the interferon-inducible, double-stranded RNA-activated protein kinase PKR. Two virally encoded proteins, NS5A and E2, have been shown to reduce this inhibitory effect of PKR by impairing the activation of the kinase. Here we present evidence for a third viral strategy for PKR inhibition. A region of the viral RNA comprising part of the internal ribosome entry site (IRES) is able to bind to PKR in competition with double-stranded RNA and can prevent autophosphorylation and activation of the kinase in vitro. The HCV IRES itself has no PKR-activating ability. Consistent with these findings, cotransfection experiments employing a bicistronic reporter construct and wild-type PKR indicate that expression of the protein kinase is less inhibitory towards HCV IRES-driven protein synthesis than towards cap-dependent protein synthesis. These data suggest a dual function for the viral IRES, with both a structural role in promoting initiation complex formation and a regulatory role in preventing inhibition of initiation by PKR.

  16. The structure of the archaebacterial ribosomal protein S7 and its possible interaction with 16S rRNA.

    Science.gov (United States)

    Hosaka, H; Yao, M; Kimura, M; Tanaka, I

    2001-11-01

    Ribosomal protein S7 is one of the ubiquitous components of the small subunit of the ribosome. It is a 16S rRNA-binding protein positioned close to the exit of the tRNA, and it plays a role in initiating assembly of the head of the 30S subunit. Previous structural analyses of eubacterial S7 have shown that it has a stable alpha-helix core and a flexible beta-arm. Unlike these eubacterial proteins, archaebacterial or eukaryotic S7 has an N-terminal extension of approximately 60 residues. The crystal structure of S7 from archaebacterium Pyrococcus horikoshii (PhoS7) has been determined at 2.1 A resolution. The final model of PhoS7 consists of six major alpha-helices, a short 3(10)-helix and two beta-stands. The major part (residues 18-45) of the N-terminal extension of PhoS7 reinforces the alpha-helical core by well-extended hydrophobic interactions, while the other part (residues 46-63) is not visible in the crystal and is possibly fixed only by interacting with 16S rRNA. These differences in the N-terminal extension as well as in the insertion (between alpha1 and alpha2) of the archaebacterial S7 structure from eubacterial S7 are such that they do not necessitate a major change in the structure of the currently available eubacterial 16S rRNA. Some of the inserted chains might pass through gaps formed by helices of the 16S rRNA.

  17. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    Science.gov (United States)

    Mishra, Bhavya; Schütz, Gunter M.; Chowdhury, Debashish

    2016-06-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special “slippery” sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obtained from a mean-field analysis of the stochastic dynamics.

  18. Slip of grip of a molecular motor on a crowded track: Modeling shift of reading frame of ribosome on RNA template

    CERN Document Server

    Mishra, Bhavya; Chowdhury, Debashish

    2016-01-01

    We develop a stochastic model for the programmed frameshift of ribosomes synthesizing a protein while moving along a mRNA template. Normally the reading frame of a ribosome decodes successive triplets of nucleotides on the mRNA in a step-by-step manner. We focus on the programmed shift of the ribosomal reading frame, forward or backward, by only one nucleotide which results in a fusion protein; it occurs when a ribosome temporarily loses its grip to its mRNA track. Special "slippery" sequences of nucleotides and also downstream secondary structures of the mRNA strand are believed to play key roles in programmed frameshift. Here we explore the role of an hitherto neglected parameter in regulating -1 programmed frameshift. Specifically, we demonstrate that the frameshift frequency can be strongly regulated also by the density of the ribosomes, all of which are engaged in simultaneous translation of the same mRNA, at and around the slippery sequence. Monte Carlo simulations support the analytical predictions obt...

  19. A Viral mRNA Motif at the 3'-Untranslated Region that Confers Translatability in a Cell-Specific Manner. Implications for Virus Evolution.

    Science.gov (United States)

    Garcia-Moreno, Manuel; Sanz, Miguel Angel; Carrasco, Luis

    2016-01-12

    Sindbis virus (SINV) mRNAs contain several motifs that participate in the regulation of their translation. We have discovered a motif at the 3' untranslated region (UTR) of viral mRNAs, constituted by three repeated sequences, which is involved in the translation of both SINV genomic and subgenomic mRNAs in insect, but not in mammalian cells. These data illustrate for the first time that an element present at the 3'-UTR confers translatability to mRNAs from an animal virus in a cell-specific manner. Sequences located at the beginning of the 5'-UTR may also regulate SINV subgenomic mRNA translation in both cell lines in a context of infection. Moreover, a replicon derived from Sleeping disease virus, an alphavirus that have no known arthropod vector for transmission, is much more efficient in insect cells when the repeated sequences from SINV are inserted at its 3'-UTR, due to the enhanced translatability of its mRNAs. Thus, these findings provide a clue to understand, at the molecular level, the evolution of alphaviruses and their host range.

  20. A tRNA body with high affinity for EF-Tu hastens ribosomal incorporation of unnatural amino acids.

    Science.gov (United States)

    Ieong, Ka-Weng; Pavlov, Michael Y; Kwiatkowski, Marek; Ehrenberg, Måns; Forster, Anthony C

    2014-05-01

    There is evidence that tRNA bodies have evolved to reduce differences between aminoacyl-tRNAs in their affinity to EF-Tu. Here, we study the kinetics of incorporation of L-amino acids (AAs) Phe, Ala allyl-glycine (aG), methyl-serine (mS), and biotinyl-lysine (bK) using a tRNA(Ala)-based body (tRNA(AlaB)) with a high affinity for EF-Tu. Results are compared with previous data on the kinetics of incorporation of the same AAs using a tRNA(PheB) body with a comparatively low affinity for EF-Tu. All incorporations exhibited fast and slow phases, reflecting the equilibrium fraction of AA-tRNA in active ternary complex with EF-Tu:GTP before the incorporation reaction. Increasing the concentration of EF-Tu increased the amplitude of the fast phase and left its rate unaltered. This allowed estimation of the affinity of each AA-tRNA to EF-Tu:GTP during translation, showing about a 10-fold higher EF-Tu affinity for AA-tRNAs formed from the tRNA(AlaB) body than from the tRNA(PheB) body. At ∼1 µM EF-Tu, tRNA(AlaB) conferred considerably faster incorporation kinetics than tRNA(PheB), especially in the case of the bulky bK. In contrast, the swap to the tRNA(AlaB) body did not increase the fast phase fraction of N-methyl-Phe incorporation, suggesting that the slow incorporation of N-methyl-Phe had a different cause than low EF-Tu:GTP affinity. The total time for AA-tRNA release from EF-Tu:GDP, accommodation, and peptidyl transfer on the ribosome was similar for the tRNA(AlaB) and tRNA(PheB) bodies. We conclude that a tRNA body with high EF-Tu affinity can greatly improve incorporation of unnatural AAs in a potentially generalizable manner.

  1. A Genome-Wide Analysis of RNA Pseudoknots That Stimulate Efficient −1 Ribosomal Frameshifting or Readthrough in Animal Viruses

    Directory of Open Access Journals (Sweden)

    Xiaolan Huang

    2013-01-01

    Full Text Available Programmed −1 ribosomal frameshifting (PRF and stop codon readthrough are two translational recoding mechanisms utilized by some RNA viruses to express their structural and enzymatic proteins at a defined ratio. Efficient recoding usually requires an RNA pseudoknot located several nucleotides downstream from the recoding site. To assess the strategic importance of the recoding pseudoknots, we have carried out a large scale genome-wide analysis in which we used an in-house developed program to detect all possible H-type pseudoknots within the genomic mRNAs of 81 animal viruses. Pseudoknots are detected downstream from ~85% of the recoding sites, including many previously unknown pseudoknots. ~78% of the recoding pseudoknots are the most stable pseudoknot within the viral genomes. However, they are not as strong as some designed pseudoknots that exhibit roadblocking effect on the translating ribosome. Strong roadblocking pseudoknots are not detected within the viral genomes. These results indicate that the decoding pseudoknots have evolved to possess optimal stability for efficient recoding. We also found that the sequence at the gag-pol frameshift junction of HIV1 harbors potential elaborated pseudoknots encompassing the frameshift site. A novel mechanism is proposed for possible involvement of the elaborated pseudoknots in the HIV1 PRF event.

  2. Delimitation of the Thoracosphaeraceae (Dinophyceae), including the calcareous dinoflagellates, based on large amounts of ribosomal RNA sequence data.

    Science.gov (United States)

    Gottschling, Marc; Soehner, Sylvia; Zinssmeister, Carmen; John, Uwe; Plötner, Jörg; Schweikert, Michael; Aligizaki, Katerina; Elbrächter, Malte

    2012-01-01

    The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage apparently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear complex, and the assumption of the single origin of the potential to produce calcareous structures is challenged. The application of concatenated ribosomal RNA sequence data may prove promising for phylogenetic reconstructions of the Dinophyceae in future.

  3. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

    Science.gov (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

    2013-03-01

    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  4. Ribosome maturation in E. coli.

    Science.gov (United States)

    Silengo, L; Altruda, F; Dotto, G P; Lacquaniti, F; Perlo, C; Turco, E; Mangiarotti, G

    1977-01-01

    In vivo and in vitro experiments have shown that processing of ribosomal RNA is a late event in ribosome biogenesis. The precursor form of RNA is probably necessary to speed up the assembly of ribomal proteins. Newly formed ribosomal particles which have already entered polyribosomes differ from mature ribosomes not only in their RNA content but also in their susceptibility to unfolding in low Mg concentration and to RNase attack. Final maturation of new ribosomes is probably dependent on their functioning in protein synthesis. Thus only those ribosomes which have proven to be functional may be converted into stable cellular structures.

  5. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    Science.gov (United States)

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  6. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number.

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F; Gaal, Tamas; Posfai, Gyorgy

    2015-02-18

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5-10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7-8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, 'feast and famine' life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology.

  7. Accuracy of initial codon selection by aminoacyl-tRNAs on the mRNA-programmed bacterial ribosome.

    Science.gov (United States)

    Zhang, Jingji; Ieong, Ka-Weng; Johansson, Magnus; Ehrenberg, Måns

    2015-08-04

    We used a cell-free system with pure Escherichia coli components to study initial codon selection of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP on messenger RNA-programmed ribosomes. We took advantage of the universal rate-accuracy trade-off for all enzymatic selections to determine how the efficiency of initial codon readings decreased linearly toward zero as the accuracy of discrimination against near-cognate and wobble codon readings increased toward the maximal asymptote, the d value. We report data on the rate-accuracy variation for 7 cognate, 7 wobble, and 56 near-cognate codon readings comprising about 15% of the genetic code. Their d values varied about 400-fold in the 200-80,000 range depending on type of mismatch, mismatch position in the codon, and tRNA isoacceptor type. We identified error hot spots (d = 200) for U:G misreading in second and U:U or G:A misreading in third codon position by His-tRNA(His) and, as also seen in vivo, Glu-tRNA(Glu). We suggest that the proofreading mechanism has evolved to attenuate error hot spots in initial selection such as those found here.

  8. Neonatal Meningitis by Multidrug Resistant Elizabethkingia meningosepticum Identified by 16S Ribosomal RNA Gene Sequencing

    Directory of Open Access Journals (Sweden)

    V. V. Shailaja

    2014-01-01

    Full Text Available Clinical and microbiological profile of 9 neonates with meningitis by Elizabethkingia meningosepticum identified by 16S ribosomal gene sequencing was studied. All the clinical isolates were resistant to cephalosporins, aminoglycosides, trimethoprim-sulfamethoxazole, β-lactam combinations, carbapenems and only one isolate was susceptible to ciprofloxacin. All the isolates were susceptible to vancomycin. Six of nine neonates died even after using vancomycin, based on susceptibility results. E. meningosepticum meningitis in neonates results in high mortality rate. Though the organism is susceptible to vancomycin in vitro, its efficacy in vivo is questionable and it is difficult to determine the most appropriate antibiotic for treating E. meningosepticum meningitis in neonates.

  9. Posttranscriptional down-regulation of small ribosomal subunit proteins correlates with reduction of 18S rRNA in RPS19 deficiency.

    Science.gov (United States)

    Badhai, Jitendra; Fröjmark, Anne-Sophie; Razzaghian, Hamid Reza; Davey, Edward; Schuster, Jens; Dahl, Niklas

    2009-06-18

    Ribosomal protein S19 (RPS19) is mutated in patients with Diamond-Blackfan anemia (DBA). We hypothesized that decreased levels of RPS19 lead to a coordinated down-regulation of other ribosomal (r-)proteins at the subunit level. We show that small interfering RNA (siRNA) knock-down of RPS19 results in a relative decrease of small subunit (SSU) r-proteins (S20, S21 and S24) when compared to large subunit (LSU) r-proteins (L3, L9, L30 and L38). This correlates with a relative decrease in 18S rRNA with respect to 28S rRNA. The r-protein mRNA levels remain relatively unchanged indicating a post transcriptional regulation of r-proteins at the level of subunit formation.

  10. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    Directory of Open Access Journals (Sweden)

    Iyer Lakshminarayan M

    2010-08-01

    Full Text Available Abstract Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS. We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the

  11. Open complex scrunching before nucleotide addition accounts for the unusual transcription start site of E. coli ribosomal RNA promoters.

    Science.gov (United States)

    Winkelman, Jared T; Chandrangsu, Pete; Ross, Wilma; Gourse, Richard L

    2016-03-29

    Most Escherichia coli promoters initiate transcription with a purine 7 or 8 nt downstream from the -10 hexamer, but some promoters, including the ribosomal RNA promoter rrnB P1, start 9 nt from the -10 element. We identified promoter and RNA polymerase determinants of this noncanonical rrnB P1 start site using biochemical and genetic approaches including mutational analysis of the promoter, Fe(2+) cleavage assays to monitor template strand positions near the active-site, and Bpa cross-linking to map the path of open complex DNA at amino acid and nucleotide resolution. We find that mutations in several promoter regions affect transcription start site (TSS) selection. In particular, we show that the absence of strong interactions between the discriminator region and σ region 1.2 and between the extended -10 element and σ region 3.0, identified previously as a determinant of proper regulation of rRNA promoters, is also required for the unusual TSS. We find that the DNA in the single-stranded transcription bubble of the rrnB P1 promoter complex expands and is "scrunched" into the active site channel of RNA polymerase, similar to the situation in initial transcribing complexes. However, in the rrnB P1 open complex, scrunching occurs before RNA synthesis begins. We find that the scrunched open complex exhibits reduced abortive product synthesis, suggesting that scrunching and unusual TSS selection contribute to the extraordinary transcriptional activity of rRNA promoters by increasing promoter escape, helping to offset the reduction in promoter activity that would result from the weak interactions with σ.

  12. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  13. The major transcripts of the kinetoplast Trypanosoma brucei are very small ribosomal RNA's.

    NARCIS (Netherlands)

    I.C. Eperon; J.W.G. Janssen; J.H.J. Hoeijmakers (Jan); P. Borst (Piet)

    1983-01-01

    textabstractThe nucleotide sequence has been determined of a 2.2 kb segment of kinetoplast DNA, which encodes the major mitochondrial transcripts (12S and 9S) of Trypanosoma brucei. The sequence shows that the 12S RNA is a large subunit rRNA, although sufficiently unusual for resistance to chloramph

  14. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    Science.gov (United States)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  15. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig

    2007-01-01

    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...... nuclear transfer (SCNT) using fluorescence in situ hybridization (FISH) with an rDNA probe and subsequent visualization of the nucleolar proteins by silver staining. In the 205 IVP embryos investigated, all two-cell embryos (n = 34) were categorized as transcriptionally inactive. At the late four-cell...... and active cells at the eight-cell, 16-cell and blastocyst stage, respectively. In the 143 SCNT embryos investigated, all two-cell embryos (n = 34) and early four-cell embryos (n = 12) were also transcriptionally inactive. At the late four-cell stage (n = 33) and at the eight-cell stage (n = 24) there were...

  16. Macrolides and lincomycin susceptibility of Mycoplasma hyorhinis and variable mutation of domain II and V in 23S ribosomal RNA.

    Science.gov (United States)

    Kobayashi, Hideki; Nakajima, Hiromi; Shimizu, Yuka; Eguchi, Masashi; Hata, Eiji; Yamamoto, Koshi

    2005-08-01

    A total of 151 strains of Mycoplasma hyorhinis isolated from porcine lung lesions (weaned pigs, n=71, and finishers, n=80) were investigated for their in vitro susceptibility to 10 antimicrobial agents. Thirty-one strains (28 from weaned pigs and 3 from finishers) showed resistance to 16-membered macrolide antibiotics and lincomycin. The prevalence of the 16-membered macrolide-resistant M. hyorhinis strain in weaned pigs from Japanese herds has approximately quadrupled in the past 10 years. Several of the 31 strains were examined for mutations in the 23S ribosomal RNA (rRNA). All field strains tested showed a transition of A to G at position 2059 of 23S rRNA-rendered Escherichia coli. On the other hand, individual tylosin- and lincomycin-resistant mutants of M. hyorhinis were selected in vitro from the susceptible type strain BTS7 by 3 to 9 serial passages in subinhibitory concentrations of each antibiotic. The 23S rRNA sequences of both tylosin and lincomycin-resistant mutants were compared with that of the radical BTS7 strain. The BTS7 mutant strain selected by tylosin showed the same transition as the field-isolated strains of A2059G. However, the transition selected in lincomycin showed mutations in domains II and V of 23S rRNA, G2597U, C2611U in domain V, and the addition of an adenine at the pentameric adenine loop in domain II. The strain selected by lincomycin showed an additional point mutation of A2062G selected by tylosin.

  17. A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

    Science.gov (United States)

    Kang, H; Tinoco, I

    1997-05-15

    A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.

  18. Mitochondrial 12S Ribosomal RNA A1555G Mutation Associated with Cardiomyopathy and Hearing Loss following High-Dose Chemotherapy and Repeated Aminoglycoside Exposure

    DEFF Research Database (Denmark)

    Skou, Anne-Sofie; Tranebjærg, Lisbeth; Jensen, Tim;

    2014-01-01

    A 19-month-old girl with the A1555G mitochondrial mutation in the 12S ribosomal RNA gene and acute myelogenous leukemia developed dilated cardiomyopathy and bilateral sensorineural hearing loss before undergoing allogeneic stem cell transplantation. She had received gentamicin during episodes of ...

  19. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  20. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    In porcine embryos, nucleoli are first observed during the third postfertilization cell cycle, i.e., at the 4-cell stage. However, direct studies of the initiation of rRNA transcription have not been reported. This transcription was investigated in the present study by simultaneous visualization...... the third cell cycle....... electron microscopy. In general, the 2-cell and 4-cell embryos fixed at 10 and 20 h postcleavage (hpc) showed no signs of rRNA transcription. Four small clusters of fluorescein isothiocyanate (FITC) labeling were visible in interphase nuclei, consistent with hybridization to the rRNA gene clusters only...

  1. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    Science.gov (United States)

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  2. Comment on ``Length-dependent translation of messenger RNA by ribosomes''

    Science.gov (United States)

    Zhang, Yunxin

    2012-02-01

    In a recent paper by Valleriani [Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.83.042903 83, 042903 (2011)], a simple model for the translation of messenger RNA (mRNA) is presented. Using this model, the protein translational ratio r, defined as the ratio of protein translation rate ωtl from mRNA to protein degradation rate ωp, is obtained. The key point in obtaining the translational ratio r is to get the protein translation rate ωtl. In Valleriani 's paper, ωtl is obtained as the mean value of the measured translation rate, which is the ratio of the synthesized protein number to the mRNA lifetime. However, in experiments, different methods might be used to obtain the value of ωtl. Therefore, to apply Valleriani 's model to more general experiments, in this Comment three methods to obtain the translation rate ωtl, and consequently the translational ratio r, are presented. Based on one of the methods which might be employed in most of the experiments, we find that the translational ratio r decays exponentially with mRNA length in prokaryotic cells, and decays reciprocally with mRNA length in eukaryotic cells. This result is slight different from that which was obtained in Valleriani 's paper.

  3. Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage

    Science.gov (United States)

    Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X.; Zhang, Quanwei; Ermolenko, Dmitri N.; Zhang, Zhengdong D.; Gorbunova, Vera; Seluanov, Andrei

    2013-01-01

    The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity. PMID:24082110

  4. Binding of helix-threading peptides to E. coli 16S ribosomal RNA and inhibition of the S15-16S complex.

    Science.gov (United States)

    Gooch, Barry D; Krishnamurthy, Malathy; Shadid, Mohammad; Beal, Peter A

    2005-12-01

    Helix-threading peptides (HTPs) constitute a new class of small molecules that bind selectively to duplex RNA structures adjacent to helix defects and project peptide functionality into the dissimilar duplex grooves. To further explore and develop the capabilities of the HTP design for binding RNA selectively, we identified helix 22 of the prokaryotic ribosomal RNA 16S as a target. This helix is a component of the binding site for the ribosomal protein S15. In addition, the S15-16S RNA interaction is important for the ordered assembly of the bacterial ribosome. Here we present the synthesis and characterization of helix-threading peptides that bind selectively to helix 22 of E. coli 16S RNA. These compounds bind helix 22 by threading intercalation placing the N termini in the minor groove and the C termini in the major groove. Binding is dependent on the presence of a highly conserved purine-rich internal loop in the RNA, whereas removal of the loop minimally affects binding of the classical intercalators ethidium bromide and methidiumpropyl-EDTAFe (MPEFe). Moreover, binding selectivity translates into selective inhibition of formation of the S15-16S complex.

  5. Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene.

    Science.gov (United States)

    Zardoya, R; Meyer, A

    1996-05-28

    The origin of land vertebrates was one of the major transitions in the history of vertebrates. Yet, despite many studies that are based on either morphology or molecules, the phylogenetic relationships among tetrapods and the other two living groups of lobe-finned fishes, the coelacanth and the lungfishes, are still unresolved and debated. Knowledge of the relationships among these lineages, which originated back in the Devonian, has profound implications for the reconstruction of the evolutionary scenario of the conquest of land. We collected the largest molecular data set on this issue so far, about 3,500 base pairs from seven species of the large 28S nuclear ribosomal gene. All phylogenetic analyses (maximum parsimony, neighbor-joining, and maximum likelihood) point toward the hypothesis that lungfishes and coelacanths form a monophyletic group and are equally closely related to land vertebrates. This evolutionary hypothesis complicates the identification of morphological or physiological preadaptations that might have permitted the common ancestor of tetrapods to colonize land. This is because the reconstruction of its ancestral conditions would be hindered by the difficulty to separate uniquely derived characters from shared derived characters in the coelacanth/lungfish and tetrapod lineages. This molecular phylogeny aids in the reconstruction of morphological evolutionary steps by providing a framework; however, only paleontological evidence can determine the sequence of morphological acquisitions that allowed lobe-finned fishes to colonize land.

  6. Native Valve Endocarditis due to Corynebacterium striatum confirmed by 16S Ribosomal RNA Sequencing: A Case Report and Literature Review

    Science.gov (United States)

    2016-01-01

    Corynebacterium species are non-fermentous Gram-positive bacilli that are normal flora of human skin and mucous membranes and are commonly isolated in clinical specimens. Non-diphtheriae Corynebacterium are regarded as contaminants when found in blood culture. Currently, Corynebacterium striatum is considered one of the emerging nosocomial agents implicated in endocarditis and serious infections. We report a case of native-valve infective endocarditis caused by C. striatum, which was misidentified by automated identification system but identified accurately by 16S ribosomal RNA sequencing, in a 55-year-old male patient. The patient had two mobile vegetations on his mitral valve, both of which had high embolic risk. Through surgical valve replacement and an antibiotic regimen, the patient recovered completely. In unusual clinical scenarios, C. striatum should not be simply dismissed as a contaminant when isolated from clinical specimens. The possibility of C. striatum infection should be considered even in an immunocompetent patient, and we suggest a genotypic assay, such as 16S rRNA sequencing, to confirm species identity. PMID:27659439

  7. Insulin receptor substrate-1 (IRS-1 associates with small nucleolar RNA which contributes to ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    Atsufumi eOzoe

    2014-03-01

    Full Text Available Insulin receptor substrates (IRSs are well known to play crucial roles in mediating intracellular signals of insulin-like growth factors (IGFs/insulin. Previously we showed that IRS-1 forms high molecular mass complexes containing RNAs. To identify RNAs in IRS-1 complexes, we performed UV cross-linking and immunoprecipitation (CLIP analysis using HEK293 cells expressing FLAG-IRS-1 and FLAG-IRS-2. We detected the radioactive signals in the immunoprecipitates of FLAG-IRS-1 proportional to the UV irradiation, but not in the immunoprecipitates of FLAG-IRS-2, suggesting the direct contact of RNAs with IRS-1. RNAs cross-linked to IRS-1 were then amplified by RT-PCR, followed by sequence analysis. We isolated sequence tags attributed to 25 messenger RNAs and 8 non-coding RNAs, including small nucleolar RNAs (snoRNAs. We focused on the interaction of IRS-1 with U96A snoRNA (U96A and its host Rack1 (receptor for activated C kinase 1 pre-mRNA. We confirmed the interaction of IRS-1 with U96A, and with RACK1 pre-mRNA by immunoprecipitation with IRS-1 followed by Northern blotting or RT-PCR analyses. Mature U96A in IRS-1-/- mouse embryonic fibroblasts was quantitatively less than WT. We also found that a part of nuclear IRS-1 is localized in the Cajal body, a nuclear subcompartment where snoRNA mature. The unanticipated function of IRS-1 in snoRNA biogenesis highlights the potential of RNA-associated IRS-1 complex to open a new line of investigation to dissect the novel mechanisms regulating IGFs/insulin-mediated biological events.

  8. Ribosomal RNA genes challenge the monophyly of the Hyalospheniidae (Amoebozoa: Arcellinida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Ekelund, Flemming;

    2008-01-01

    To date only five partial and two complete SSU rRNA gene sequences are available for the lobose testate amoebae (Arcellinida). Consequently, the phylogenetic relationships among taxa and the definition of species are still largely dependant on morphological characters of uncertain value, which...... causes confusion in the phylogeny, taxonomy and the debate on cosmopolitanism of free-living protists. Here we present a SSU rRNA-based phylogeny of the Hyalospheniidae including the most common species. Similar to the filose testate amoebae of the order Euglyphida the most basal clades have a terminal...

  9. Study of several factors in RNA-protein cross-link formation induced by ionizing radiations within 70S ribosomes of E. coli MRE 600.

    Science.gov (United States)

    Ekert, B; Giocanti, N; Sabattier, R

    1986-09-01

    The induction of RNA-protein crosslinks in E. coli 70S ribosomes by gamma-irradiation was studied by measuring the dependence of cross-link formation on ribosome concentration. The inverse dependence of cross-link percentage upon concentration up to at least 20 A260 nm units ml-1 indicate that indirect effects seem to play a more major part than direct effects for these ribosome concentrations. The effect of various gases and free radical scavengers was used to determine the roles of the radicals H., CO2-., OH. and e-aq and to estimate their relative efficiencies for cross-links. They were found to be: 7.2(H.), 6(CO2-.), 2(OH.) and 1(e-aq). The extent of RNA-protein cross-link production in 70S ribosomes induced by gamma-rays and neutrons in the presence and absence of oxygen was also investigated. Cross-link formation was estimated by separation of linked and unlinked material on nitrocellulose filters or after separation by SDS-sucrose gradient centrifugation under dissociating conditions. Oxygen inhibited cross-link formation by both neutrons and gamma-rays. However, very few cross-links were formed in de-aerated solutions by exposure to neutrons, compared to those produced by gamma-rays under the same conditions. This suggests that molecular oxygen generated along the secondary particle track can reduce the formation of RNA-protein cross-links.

  10. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  11. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    polymerase I. In conclusion, rRNA transcription is initiated during the third cell cycle at a low level in both in vivo developed and in vitro produced bovine embryos. Transcription seems to be interrupted during the G1 phase of the fourth cell cycle, but reinitiates in the late half of the cycle...

  12. Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis

    Institute of Scientific and Technical Information of China (English)

    SHEN Xiquan; YANG Guanpin; LIU Yongjian

    2007-01-01

    The 18S ribosomal DNA gene (18S rDNA) sequences (approximately 1300 bp in length) were amplified from the DNA extracted from the free-living marine nematodes collected from the inter-tidal sediment of Qingdao coast in bulk with nematode specific primers. The PCR products were cloned, re-amplified, digested with Rsa I and Hin6Ⅰ restriction endonucleases and separated in agarose gel. Among 17 restriction fragment length types, types 1, 2 and 6 covered 61.2%, 14.4% and 9.3% of the clones analyzed, respectively, while the remaining 14 only covered 21 clones, which accounted for 15.1% of the total. Twenty-four representative clones were sequenced and phylogenetically analyzed by referring to those currently available in RDP and GenBank databases. Although it was hard to assign these sequences to known species or genera due to the lack of the 18S rDNA sequence data of known marine free-living nematodes, the obtained sequences were assigned to the nematodes of Adenophorea. Among them, twelve sequences were close to Pontonema vulgare and Adoncholaimus sp., four to Daptonemaprocerus and two (identical) to Enoplus brevis. Our results showed that free-living marine nematode diversities could be determined by PCR retrieving and analysis of the 18S rDNA sequences and an 18S rDNA sequence could be assigned to a species or a genus only if the 18S rDNA sequences of the free-living marine nematodes were accumulated to some extent.

  13. Ribosomal RNA gene silencing in interpopulation hybrids of Tigriopus californicus: nucleolar dominance in the absence of intergenic spacer subrepeats.

    Science.gov (United States)

    Flowers, Jonathan M; Burton, Ronald S

    2006-07-01

    A common feature of interspecific animal and plant hybrids is the uniparental silencing of ribosomal RNA gene transcription, or nucleolar dominance. A leading explanation for the genetic basis of nucleolar dominance in animal hybrids is the enhancer-imbalance model. The model proposes that limiting transcription factors are titrated by a greater number of enhancer-bearing subrepeat elements in the intergenic spacer (IGS) of the dominant cluster of genes. The importance of subrepeats for nucleolar dominance has repeatedly been supported in competition assays between Xenopus laevis and X. borealis minigene constructs injected into oocytes. However, a more general test of the importance of IGS subrepeats for nuclear dominance in vivo has not been conducted. In this report, rRNA gene expression was examined in interpopulation hybrids of the marine copepod Tigriopus californicus. This species offers a rare opportunity to test the role of IGS subrepeats in nucleolar dominance because the internal subrepeat structure, found in the IGS of virtually all animal and plant species, is absent in T. californicus. Our results clearly establish that nucleolar dominance occurs in F1 and F2 interpopulation hybrids of this species. In the F2 generation, nucleolar dominance appears to break down in some hybrids in a fashion that is inconsistent with a transcription factor titration model. These results are significant because they indicate that nucleolar dominance can be established and maintained without enhancer-bearing repeat elements in the IGS. This challenges the generality of the enhancer-imbalance model for nucleolar dominance and suggests that dominance of rRNA transcription in animals may be determined by epigenetic factors as has been established in plants.

  14. TAXONOMIC STATUS OF CAR BACILLUS BASED ON THE SMALL SUBUNIT RIBOSOMAL RNA SEQUENCES

    Institute of Scientific and Technical Information of China (English)

    魏强; TsujiM; TakahashiT; IshiharaC; ItohT

    1995-01-01

    In an attempt to identify the taxonomic relationship between CAR bacillus and other bacteria, the SSU rRNA gene sequences of two CAR bacillus strains, CBM and CBR isolated from mice and rats respectively were used in the present studies. The SSU rRNA gene sequences, approximately 1.5 kb in size amplified from genomic DNAs from both strains, were determined and 96. 8% homologies were found to exist be-tween them. Those sequences were aligned to most euhacteria with a computer search showing high homol-ogy with those of Flavobacter/Flexibacter species especially closed to Fx. sanai and Ft. ferrugineum. Phylogenetic analysts indicated that CAR bacillus belongs to a species close to Fx. sancti and Ft. ferrug-imum subdivision.

  15. New Hosts of Simplicimonas similis and Trichomitus batrachorum Identified by 18S Ribosomal RNA Gene Sequences

    Directory of Open Access Journals (Sweden)

    Kris Genelyn B. Dimasuay

    2013-01-01

    Full Text Available Trichomonads are obligate anaerobes generally found in the digestive and genitourinary tract of domestic animals. In this study, four trichomonad isolates were obtained from carabao, dog, and pig hosts using rectal swab. Genomic DNA was extracted using Chelex method and the 18S rRNA gene was successfully amplified through novel sets of primers and undergone DNA sequencing. Aligned isolate sequences together with retrieved 18S rRNA gene sequences of known trichomonads were utilized to generate phylogenetic trees using maximum likelihood and neighbor-joining analyses. Two isolates from carabao were identified as Simplicimonas similis while each isolate from dog and pig was identified as Pentatrichomonas hominis and Trichomitus batrachorum, respectively. This is the first report of S. similis in carabao and the identification of T. batrachorum in pig using 18S rRNA gene sequence analysis. The generated phylogenetic tree yielded three distinct groups mostly with relatively moderate to high bootstrap support and in agreement with the most recent classification. Pathogenic potential of the trichomonads in these hosts still needs further investigation.

  16. Sequence analysis of mitochondrial 16S ribosomal RNA gene fragment from seven mosquito species

    Indian Academy of Sciences (India)

    Yogesh S Shouche; Milind S Patole

    2000-12-01

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence analysis of the mitochondrial 16S rRNA gene has been used for molecular taxonomy in many insects. In this paper, we have analysed a 450 bp hypervariable region of the mitochondrial 16S rRNA gene in three major genera of mosquitoes, Aedes, Anopheles and Culex. The sequence was found to be unusually A + T rich and in substitutions the rate of transversions was higher than the transition rate. A phylogenetic tree was constructed with these sequences. An interesting feature of the sequences was a stretch of Ts that distinguished between Aedes and Culex on the one hand, and Anopheles on the other. This is the first report of mitochondrial rRNA sequences from these medically important genera of mosquitoes.

  17. SrmB, a DEAD-box helicase involved in Escherichia coli ribosome assembly, is specifically targeted to 23S rRNA in vivo.

    Science.gov (United States)

    Trubetskoy, Dmitrii; Proux, Florence; Allemand, Frédéric; Dreyfus, Marc; Iost, Isabelle

    2009-10-01

    DEAD-box proteins play specific roles in remodeling RNA or ribonucleoprotein complexes. Yet, in vitro, they generally behave as nonspecific RNA-dependent ATPases, raising the question of what determines their specificity in vivo. SrmB, one of the five Escherichia coli DEAD-box proteins, participates in the assembly of the large ribosomal subunit. Moreover, when overexpressed, it compensates for a mutation in L24, the ribosomal protein (r-protein) thought to initiate assembly. Here, using the tandem affinity purification (TAP) procedure, we show that SrmB forms a complex with r-proteins L4, L24 and a region near the 5'-end of 23S rRNA that binds these proteins. In vitro reconstitution experiments show that the stability of this complex reflects cooperative interactions of SrmB with L4, L24 and rRNA. These observations are consistent with an early role of SrmB in assembly and explain the genetic link between SrmB and L24. Besides its catalytic core, SrmB possesses a nonconserved C-terminal extension that, we show, is not essential for SrmB function and specificity. In this regard, SrmB differs from DbpA, another DEAD-box protein involved in ribosome assembly.

  18. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  19. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  20. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3’-Terminal Fragment of 16S rRNA in E. coli

    Science.gov (United States)

    Golovin, A.V.; Khayrullina, G.A.; Kraal, B.; Kopylov, А.М.

    2012-01-01

    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA–protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA–protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV–induced RNA–protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA– protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA – protein cross–link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA–protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit. PMID:23346381

  1. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  2. A phylogeny of the Passerida(Aves: Passeriformes)based on mitochondrial 12S ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    Lina; Wu; Yanfeng; Sun; Juyong; Li; Yaqing; Li; Yuefeng; Wu; Dongming; Li

    2015-01-01

    Background: Passerida is the largest avian radiation within the order Passeriformes. Current understanding of the high-level relationships within Passerida is based on DNA–DNA hybridizations; however, the phylogenetic relationships within this assemblage have been the subject of many debates.Methods: We analyzed the 12 S ribosomal RNA gene from 49 species of Passerida, representing 14 currently recognized families, to outline the phylogenetic relationships within this group.Results: Our results identified the monophyly of the three superfamilies in Passerida: Sylvioidea, Muscicapoidea and Passeroidea. However, current delimitation of some species is at variance with our phylogeny estimate. First, the Parus major, which had been placed as a distinct clade sister to Sylvioidea was identified as a member of the super family;second, the genus Regulus was united with the Sturnidae and nested in the Muscicapoidea clade instead of being a clade of Passerida.Conclusion: Our results were consistent with Johansson’s study of the three superfamilies except for the al ocation of two families, Paridae and Regulidae.

  3. Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA.

    Science.gov (United States)

    Ahyong, Shane T; Lai, Joelle C Y; Sharkey, Deirdre; Colgan, Donald J; Ng, Peter K L

    2007-11-01

    The true crabs, the Brachyura, are generally divided into two major groups: Eubrachyura or 'advanced' crabs, and Podotremata or 'primitive' crabs. The status of Podotremata is one of the most controversial issues in brachyuran systematics. The podotreme crabs, best recognised by the possession of gonopores on the coxae of the pereopods, have variously been regarded as mono-, para- or polyphyletic, or even as non-brachyuran. For the first time, the phylogenetic positions of the podotreme crabs were studied by cladistic analysis of small subunit nuclear ribosomal RNA sequences. Eight of 10 podotreme families were represented along with representatives of 17 eubrachyuran families. Under both maximum parsimony and Bayesian Inference, Podotremata was found to be significantly paraphyletic, comprising three major clades: Dromiacea, Raninoida, and Cyclodorippoida. The most 'basal' is Dromiacea, followed by Raninoida and Cylodorippoida. Notably, Cyclodorippoida was identified as the sister group of the Eubrachyura. Previous hypotheses that the dromiid crab, Hypoconcha, is an anomuran were unsupported, though Dromiidae as presently composed could be paraphyletic. Topologies constrained for podotreme monophyly were found to be significantly worse (P < 0.04) than unconstrained topologies under Templeton and S-H tests. The clear pattern of podotreme paraphyly and robustness of topologies recovered indicates that Podotremata as a formal concept is untenable. Relationships among the eubrachyurans were generally equivocal, though results indicate the majoids or dorippoids were the least derived of the Eubrachyura. A new high level classification of the Brachyura is proposed.

  4. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Science.gov (United States)

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  5. Prevalent ciliate symbiosis on copepods: high genetic diversity and wide distribution detected using small subunit ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Zhiling Guo

    Full Text Available Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups, six (containing 99% of all the sequences belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus, and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally.

  6. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese`s group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  7. Automated insertion of sequences into a ribosomal RNA alignment: An application of computational linguistics in molecular biology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, R.C.

    1991-11-01

    This thesis involved the construction of (1) a grammar that incorporates knowledge on base invariancy and secondary structure in a molecule and (2) a parser engine that uses the grammar to position bases into the structural subunits of the molecule. These concepts were combined with a novel pinning technique to form a tool that semi-automates insertion of a new species into the alignment for the 16S rRNA molecule (a component of the ribosome) maintained by Dr. Carl Woese's group at the University of Illinois at Urbana. The tool was tested on species extracted from the alignment and on a group of entirely new species. The results were very encouraging, and the tool should be substantial aid to the curators of the 16S alignment. The construction of the grammar was itself automated, allowing application of the tool to alignments for other molecules. The logic programming language Prolog was used to construct all programs involved. The computational linguistics approach used here was found to be a useful way to attach the problem of insertion into an alignment.

  8. Sensitivity of Ribosomal RNA Character Sampling in the Phylogeny of Rhabditida.

    Science.gov (United States)

    Holovachov, Oleksandr; Camp, Lauren; Nadler, Steven A

    2015-12-01

    Near-full-length 18S and 28S rRNA gene sequences were obtained for 33 nematode species. Datasets were constructed based on secondary structure and progressive multiple alignments, and clades were compared for phylogenies inferred by Bayesian and maximum likelihood methods. Clade comparisons were also made following removal of ambiguously aligned sites as determined using the program ProAlign. Different alignments of these data produced tree topologies that differed, sometimes markedly, when analyzed by the same inference method. With one exception, the same alignment produced an identical tree topology when analyzed by different methods. Removal of ambiguously aligned sites altered the tree topology and also reduced resolution. Nematode clades were sensitive to differences in multiple alignments, and more than doubling the amount of sequence data by addition of 28S rRNA did not fully mitigate this result. Although some individual clades showed substantially higher support when 28S data were combined with 18S data, the combined analysis yielded no statistically significant increases in the number of clades receiving higher support when compared to the 18S data alone. Secondary structure alignment increased accuracy in positional homology assignment and, when used in combination with paired-site substitution models, these structural hypotheses of characters and improved models of character state change yielded high levels of phylogenetic resolution. Phylogenetic results included strong support for inclusion of Daubaylia potomaca within Cephalobidae, whereas the position of Fescia grossa within Tylenchina varied depending on the alignment, and the relationships among Rhabditidae, Diplogastridae, and Bunonematidae were not resolved.

  9. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    Science.gov (United States)

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  10. Ribosomal RNA phylogeny of bodonid and diplonemid flagellates and the evolution of euglenozoa.

    Science.gov (United States)

    von der Heyden, Sophie; Chao, Ema E; Vickerman, Keith; Cavalier-Smith, Thomas

    2004-01-01

    Euglenozoa is a major phylum of excavate protozoa (comprising euglenoids, kinetoplastids, and diplonemids) with highly unusual nuclear, mitochondrial, and chloroplast genomes. To improve understanding of euglenozoan evolution, we sequenced nuclear small-subunit rRNA genes from 34 bodonids (Bodo, Neobodo, Parabodo, Dimastigella-like, Rhynchobodo, Rhynchomonas, and unidentified strains), nine diplonemids (Diplonema, Rhynchopus), and a euglenoid (Entosiphon). Phylogenetic analysis reveals that diplonemids and bodonids are more diverse than previously recognised, but does not clearly establish the branching order of kinetoplastids, euglenoids, and diplonemids. Rhynchopus is holophyletic; parasitic species arose from within free-living species. Kinetoplastea (bodonids and trypanosomatids) are robustly holophyletic and comprise a major clade including all trypanosomatids and most bodonids ('core bodonids') and a very divergent minor one including Ichthyobodo. The root of the major kinetoplastid clade is probably between trypanosomatids and core bodonids. Core bodonids have three distinct subclades. Clade 1 has two distinct Rhynchobodo-like lineages; a lineage comprising Dimastigella and Rhynchomonas; and another including Cruzella and Neobodo. Clade 2 comprises Cryptobia/ Trypanoplasma, Procryptobia, and Parabodo. Clade 3 is an extensive Bodo saltans species complex. Neobodo designis is a vast genetically divergent species complex with mutually exclusive marine and freshwater subclades. Our analysis supports three phagotrophic euglenoid orders: Petalomonadida (holophyletic), Ploeotiida (probably holophyletic), Peranemida (paraphyletic).

  11. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    DEFF Research Database (Denmark)

    Moazed, D; Van Stolk, B J; Douthwaite, S

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  12. Molecular phylogenetic inference of the woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial cytochrome b and 12S ribosomal RNA genes.

    Science.gov (United States)

    Noro, M; Masuda, R; Dubrovo, I A; Yoshida, M C; Kato, M

    1998-03-01

    Complete sequences of cytochrome b (1,137 bases) and 12S ribosomal RNA (961 bases) genes in mitochondrial DNA were successfully determined from the woolly mammoth (Mammuthus primigenius), African elephant (Loxodonta africana), and Asian elephant (Elephas maximus). From these sequence data, phylogenetic relationships among three genera were examined. Molecular phylogenetic trees reconstructed by the neighbor-joining and the maximum parsimony methods provided an identical topology both for cytochrome b and 12S rRNA genes. These results support the "Mammuthus-Loxodonta" clade, which is contrary to some previous morphological reports that Mammuthus is more closely related to Elephas than to Loxodonta.

  13. Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch: RNA-DEPENDENT CODON SELECTION OUTSIDE THE RIBOSOME.

    Science.gov (United States)

    Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-18

    Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the "Specifier Sequence," in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNA(Gly) anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3' of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system.

  14. The structure of Aquifex aeolicus ribosomal protein S8 reveals a unique subdomain that contributes to an extremely tight association with 16S rRNA.

    Science.gov (United States)

    Menichelli, Elena; Edgcomb, Stephen P; Recht, Michael I; Williamson, James R

    2012-01-20

    The assembly of ribonucleoprotein complexes occurs under a broad range of conditions, but the principles that promote assembly and allow function at high temperature are poorly understood. The ribosomal protein S8 from Aquifex aeolicus (AS8) is unique in that there is a 41-residue insertion in the consensus S8 sequence. In addition, AS8 exhibits an unusually high affinity for the 16S ribosomal RNA, characterized by a picomolar dissociation constant that is approximately 26,000-fold tighter than the equivalent interaction from Escherichia coli. Deletion analysis demonstrated that binding to the minimal site on helix 21 occurred at the same nanomolar affinity found for other bacterial species. The additional affinity required the presence of a three-helix junction between helices 20, 21, and 22. The crystal structure of AS8 was solved, revealing the helix-loop-helix geometry of the unique AS8 insertion region, while the core of the molecule is conserved with known S8 structures. The AS8 structure was modeled onto the structure of the 30S ribosomal subunit from E. coli, suggesting the possibility that the unique subdomain provides additional backbone and side-chain contacts between the protein and an unpaired base within the three-way junction of helices 20, 21, and 22. Point mutations in the protein insertion subdomain resulted in a significantly reduced RNA binding affinity with respect to wild-type AS8. These results indicate that the AS8-specific subdomain provides additional interactions with the three-way junction that contribute to the extremely tight binding to ribosomal RNA.

  15. Characterization of the binding sites of protein L11 and the L10.(L12)4 pentameric complex in the GTPase domain of 23 S ribosomal RNA from Escherichia coli

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S R; Liljas, A;

    1990-01-01

    Ribonuclease and chemical probes were used to investigate the binding sites of ribosomal protein L11 and the pentameric complex L10.(L12)4 on Escherichia coli 23 S RNA. Protein complexes were formed with an RNA fragment constituting most of domains I and II or with 23 S RNA and they were investig...

  16. Inhibitor RNA blocks the protein translation mediated by hepatitis C virus internal ribosome entry site in vivo

    Institute of Scientific and Technical Information of China (English)

    Xue-Song Liang; Jian-Qi Lian; Yong-Xing Zhou; Mo-Bin Wan

    2004-01-01

    AIM: To investigate the inhibitory effect of hepatitis C virus internal ribosome entry site (HCV IRES) specific inhibitor RNA (IRNA) on gene expression mediated by HCV IRES in vivo.METHODS: By using G418 screening system, hepatoma cells constitutively expressing IRNA or mutant IRNA (mIRNA) were established and characterized, and HCV replicons containing the 5' untranslated region (5'UTR) were constructed by using the same method. Cotransfection of pCMVNCRluc containing HCV 5'UTR-luc fusion genes and eukaryotic vector of IRNA into human hepatic carcinoma cells (HepG2) was performed and the eukaryotic expression plasmid of IRNA was transfected transiently into HCV replicons, pCMVNCRluc or pCDNA-luc was cotransfected with pSV40-β Gal into IRNA expressing hepatoma cells by using lipofectamine 2000 in vitro. Then the reporting gene expression level was examined at 48 h after transfection by using a luminometer and the expressing level of HCV C antigen was analysed with a confocal microscope.RESULTS: Transient expression of IRES specific IRNA could significantly inhibit the expression of reporter gene and viral antigen mediated by HCV IRES by 50% to 90% in vivo, but mIRNA lost its inhibitory activity completely. The luciferase gene expression mediated by HCV IRES was blocked in the HHCC constitutively expressing IRNA. At 48 h after transfection, the expression level of reportor gene descreased by 20%, but cap-dependent luciferase gene expression was not affected. IRNA could inhibit the HCV replicon expression 24 h after transfection and the highest inhibitory activity was 80% by 72 h, and the inhibitory activity was not increased until 7d after transfection.CONCLUSION: IRNA can inhibit HCV IRES mediated gene expression in vivo.

  17. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    Directory of Open Access Journals (Sweden)

    Meier Harald

    2006-05-01

    Full Text Available Abstract Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating

  18. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for ‑1 ribosomal frameshifting stimulation

    Science.gov (United States)

    Zhong, Zhensheng; Yang, Lixia; Zhang, Haiping; Shi, Jiahao; Vandana, J. Jeya; Lam, Do Thuy Uyen Ha; Olsthoorn, René C. L.; Lu, Lanyuan; Chen, Gang

    2016-12-01

    Minus-one ribosomal frameshifting is a translational recoding mechanism widely utilized by many RNA viruses to generate accurate ratios of structural and catalytic proteins. An RNA pseudoknot structure located in the overlapping region of the gag and pro genes of Simian Retrovirus type 1 (SRV-1) stimulates frameshifting. However, the experimental characterization of SRV-1 pseudoknot (un)folding dynamics and the effect of the base triple formation is lacking. Here, we report the results of our single-molecule nanomanipulation using optical tweezers and theoretical simulation by steered molecular dynamics. Our results directly reveal that the energetic coupling between loop 2 and stem 1 via minor-groove base triple formation enhances the mechanical stability. The terminal base pair in stem 1 (directly in contact with a translating ribosome at the slippery site) also affects the mechanical stability of the pseudoknot. The ‑1 frameshifting efficiency is positively correlated with the cooperative one-step unfolding force and inversely correlated with the one-step mechanical unfolding rate at zero force. A significantly improved correlation was observed between ‑1 frameshifting efficiency and unfolding rate at forces of 15–35 pN, consistent with the fact that the ribosome is a force-generating molecular motor with helicase activity. No correlation was observed between thermal stability and ‑1 frameshifting efficiency.

  19. Effect of thiostrepton and 3'-terminal fragments of aminoacyl-tRNA on EF-Tu and ribosome-dependent GTP hydrolysis.

    Science.gov (United States)

    Bhuta, P; Chládek, S

    1982-08-30

    The effect of the antibiotics thiostrepton and micrococcin on EF-Tu-catalyzed (ribosome-dependent) GTP hydrolysis in the presence of A-Phe, C-A-Phe, or C-C-A-Phe (related to the sequence of the 3'-terminus of aminoacyl-tRNA)(System I) or by methanol ('uncoupled GTPase', System II) was investigated. In System I, thiostrepton increases the binding affinities of the effectors to the EF-Tu.GTP.70 S ribosome complex, as well as the extent of the GTP hydrolysis, while the KmGTP is virtually unchanged. Similarly, in the uncoupled system (System II) and in the absence of effectors, thiostrepton significantly increases VmaxGTP, whereas KmGTP remains unaffected. Micrococcin is without any effect in both systems. The 'uncoupled GTPase' (in System II) is also strongly inhibited by C-A-Phe. The results indicate the crucial role of the EF-Tu site which binds the aminoacylated C-C-A terminus of aminoacyl-tRNA in promoting GTP hydrolysis. It follows that the binding of the model effectors (such as C-C-A-Phe) to that site is favorably influenced by the interaction of thiostrepton with the 50 S ribosomal subunit, whereas thiostrepton, per se, does not influence the affinity of EF-Tu for GTP.

  20. Interaction of ribosomal proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA.

    Science.gov (United States)

    Stern, S; Powers, T; Changchien, L M; Noller, H F

    1988-06-20

    We have examined the effects of assembly of ribosomal proteins S5, S6, S11, S12, S18 and S21 on the reactivities of residues in 16 S rRNA towards chemical probes. The results show that S6, S18 and S11 interact with the 690-720 and 790 loop regions of 16 S rRNA in a highly co-operative manner, that is consistent with the previously defined assembly map relationships among these proteins. The results also indicate that these proteins, one of which (S18) has previously been implicated as a component of the ribosomal P-site, interact with residues near some of the recently defined P-site (class II tRNA protection) nucleotides in 16 S rRNA. In addition, assembly of protein S12 has been found to result in the protection of residues in both the 530 stem/loop and the 900 stem regions; the latter group is closely juxtaposed to a segment of 16 S rRNA recently shown to be protected from chemical probes by streptomycin. Interestingly, both S5 and S12 appear to protect, to differing degrees, a well-defined set of residues in the 900 stem/loop and 5'-terminal regions. These observations are discussed in terms of the effects of S5 and S12 on streptomycin binding, and in terms of the class III tRNA protection found in the 900 stem of 16 S rRNA. Altogether these results show that many of the small subunit proteins, which have previously been shown to be functionally important, appear to be associated with functionally implicated segments of 16 S rRNA.

  1. Limited portability of G-patch domains in regulators of the Prp43 RNA helicase required for pre-mRNA splicing and ribosomal RNA maturation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Banerjee, Daipayan; McDaniel, Peter M; Rymond, Brian C

    2015-05-01

    The Prp43 DExD/H-box protein is required for progression of the biochemically distinct pre-messenger RNA and ribosomal RNA (rRNA) maturation pathways. In Saccharomyces cerevisiae, the Spp382/Ntr1, Sqs1/Pfa1, and Pxr1/Gno1 proteins are implicated as cofactors necessary for Prp43 helicase activation during spliceosome dissociation (Spp382) and rRNA processing (Sqs1 and Pxr1). While otherwise dissimilar in primary sequence, these Prp43-binding proteins each contain a short glycine-rich G-patch motif required for function and thought to act in protein or nucleic acid recognition. Here yeast two-hybrid, domain-swap, and site-directed mutagenesis approaches are used to investigate G-patch domain activity and portability. Our results reveal that the Spp382, Sqs1, and Pxr1 G-patches differ in Prp43 two-hybrid response and in the ability to reconstitute the Spp382 and Pxr1 RNA processing factors. G-patch protein reconstitution did not correlate with the apparent strength of the Prp43 two-hybrid response, suggesting that this domain has function beyond that of a Prp43 tether. Indeed, while critical for Pxr1 activity, the Pxr1 G-patch appears to contribute little to the yeast two-hybrid interaction. Conversely, deletion of the primary Prp43 binding site within Pxr1 (amino acids 102-149) does not impede rRNA processing but affects small nucleolar RNA (snoRNA) biogenesis, resulting in the accumulation of slightly extended forms of select snoRNAs, a phenotype unexpectedly shared by the prp43 loss-of-function mutant. These and related observations reveal differences in how the Spp382, Sqs1, and Pxr1 proteins interact with Prp43 and provide evidence linking G-patch identity with pathway-specific DExD/H-box helicase activity.

  2. [Mg2+ ions affect the structure of the central domain of the 18S rRNA in the vicinity of the ribosomal protein S13 binding site].

    Science.gov (United States)

    Ivanov, A V; Malygin, A A; Karpova, G G

    2013-01-01

    It is known that Mg2+ ions at high concentrations stabilize the structure of the 16S rRNA in a conformation favorable for binding to the ribosomal proteins in the course of the eubacterial 30S ribosomal subunits assembly in vitro. Effect of Mg2+ on the formation of the 18S rRNA structure at the 40S subunit assembly remains poorly explored. In this paper, we show that the sequentional increase of the Mg2+ concentration from 0.5 mM to 20 mM leads to a significant decrease of the affinity of recombinant human ribosomal protein S13 (rpS13e) to a RNA transcript corresponding to the central domain fragment of the 18S rRNA (18SCD). The regions near the rpS13e binding site in 18SCD (including the nucleotides of helices H20 and H22), whose availabilities to hydroxyl radicals were dependent on the Mg2+ concentration, were determined. It was found that increase of the concentrations of Mg2+ results in the enhanced accessibilities of nucleotides G933-C937 and C1006-A1009 in helix H22 and reduces those of nucleotides A1023, A1024, and A1028-S1026 in the helix H20. Comparison of the results obtained with the crystallographic data on the structure of the central domain of 18S rRNA in the 40S ribosomal subunit led to conclusion that increase of Mg2+ concentrations results in the reorientation of helices H20 and H24 relatively helices H22 and H23 to form a structure, in which these helices are positioned the same way as in 40S subunits. Hence, saturation of the central domain of 18S rRNA with coordinated Mg2+ ions causes the same changes in its structure as rpS13e binding does, and leads to decreasing of this domain affinity to the protein.

  3. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

    Science.gov (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

    2016-07-01

    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc.

  4. Evidence that E. coli ribosomal protein S13 has two separable functional domains involved in 16S RNA recognition and protein S19 binding.

    Science.gov (United States)

    Schwarzbauer, J; Craven, G R

    1985-09-25

    We have found that E. coli ribosomal protein S13 recognizes multiple sites on 16S RNA. However, when protein S19 is included with a mixture of proteins S4, S7, S8, S16/S17 and S20, the S13 binds to the complex with measurably greater strength and with a stoichiometry of 1.5 copies per particle. This suggests that the protein may have two functional domains. We have tested this idea by cleaving the protein into two polypeptides. It was found that one of the fragments, composed of amino acid residues 84-117, retained the capacity to bind 16S RNA at multiple sites. Protein S19 had no affect on the strength or stoichiometry of the binding of this fragment. These data suggest that S13 has a C-terminal domain primarily responsible for RNA recognition and possibly that the N-terminal region is important for association with protein S19.

  5. Expression of gyrB and 16S ribosomal RNA genes as indicators of growth and physiological activities of Legionella pneumophila.

    Science.gov (United States)

    Okuno, Toshihiro; Tani, Katsuji; Yamaguchi, Nobuyasu; Nasu, Masao

    2015-01-01

    To determine whether the DNA gyrase (gyrB) and 16S ribosomal RNA (16S rRNA) genes can be used as indicators of the biological activities of Legionella pneumophila, the expression levels were estimated. The ratio of mRNA/DNA in gyrB was 0.7 in mid log phase and decreased drastically after the log phase. For 16S rRNA, the ratio was highest in mid log phase (7.0×10(3)), and the value that was about 10% of that in the log phase was maintained for six days. The rRNA may be vital in the resting or active but nonculturable cells that are not growing but physiologically active. The expression levels of gyrB mRNA and 16S rRNA can be used as indicators of the growth activity and the physiological activity of L. pneumophila, respectively. Therefore, by measurement of these indicators, we can evaluate the activities of Legionella cells in various environments.

  6. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome.

    Science.gov (United States)

    Mouzakis, Kathryn D; Lang, Andrew L; Vander Meulen, Kirk A; Easterday, Preston D; Butcher, Samuel E

    2013-02-01

    The human immunodeficiency virus (HIV) requires a programmed -1 ribosomal frameshift for Pol gene expression. The HIV frameshift site consists of a heptanucleotide slippery sequence (UUUUUUA) followed by a spacer region and a downstream RNA stem-loop structure. Here we investigate the role of the RNA structure in promoting the -1 frameshift. The stem-loop was systematically altered to decouple the contributions of local and overall thermodynamic stability towards frameshift efficiency. No correlation between overall stability and frameshift efficiency is observed. In contrast, there is a strong correlation between frameshift efficiency and the local thermodynamic stability of the first 3-4 bp in the stem-loop, which are predicted to reside at the opening of the mRNA entrance channel when the ribosome is paused at the slippery site. Insertion or deletions in the spacer region appear to correspondingly change the identity of the base pairs encountered 8 nt downstream of the slippery site. Finally, the role of the surrounding genomic secondary structure was investigated and found to have a modest impact on frameshift efficiency, consistent with the hypothesis that the genomic secondary structure attenuates frameshifting by affecting the overall rate of translation.

  7. Identification of Bacteria Synthesizing Ribosomal RNA in Response to Uranium Addition During Biostimulation at the Rifle, CO Integrated Field Research Site.

    Directory of Open Access Journals (Sweden)

    Lora R McGuinness

    Full Text Available Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this study, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI >2 μM were generally found to inhibit ribosome synthesis. Two active bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites.

  8. Direct crosslinking of the antitumor antibiotic sparsomycin, and its derivatives, to A2602 in the peptidyl transferase center of 23S-like rRNA within ribosome-tRNA complexes

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    of action was investigated by inducing a crosslink between sparsomycin and bacterial, archaeal, and eukaryotic ribosomes complexed with P-site-bound tRNA, on irradiating with low energy ultraviolet light (at 365 nm). The crosslink was localized exclusively to the universally conserved nucleotide A2602...... within the peptidyl transferase loop region of 23S-like rRNA by using a combination of a primer extension approach, RNase H fragment analysis, and crosslinking with radioactive [(125)I]phenol-alanine-sparsomycin. Crosslinking of several sparsomycin derivatives, modified near the sulfoxy group, implicated...

  9. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    Science.gov (United States)

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F

    2000-05-01

    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics.

  10. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  11. Crystal structure of the eukaryotic ribosome.

    Science.gov (United States)

    Ben-Shem, Adam; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2010-11-26

    Crystal structures of prokaryotic ribosomes have described in detail the universally conserved core of the translation mechanism. However, many facets of the translation process in eukaryotes are not shared with prokaryotes. The crystal structure of the yeast 80S ribosome determined at 4.15 angstrom resolution reveals the higher complexity of eukaryotic ribosomes, which are 40% larger than their bacterial counterparts. Our model shows how eukaryote-specific elements considerably expand the network of interactions within the ribosome and provides insights into eukaryote-specific features of protein synthesis. Our crystals capture the ribosome in the ratcheted state, which is essential for translocation of mRNA and transfer RNA (tRNA), and in which the small ribosomal subunit has rotated with respect to the large subunit. We describe the conformational changes in both ribosomal subunits that are involved in ratcheting and their implications in coordination between the two associated subunits and in mRNA and tRNA translocation.

  12. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Science.gov (United States)

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  13. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Eukaryotic 18S ribosomal RNA (rRNA gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  14. Structural Dynamics of the Ribosome

    OpenAIRE

    Korostelev, Andrei; Ermolenko, Dmitri N.; Noller, Harry F.

    2008-01-01

    Protein synthesis is inherently a dynamic process, requiring both small- and large-scale movements of tRNA and mRNA. It has long been suspected that these movements might be coupled to conformational changes in the ribosome, and in its RNA moieties in particular. Recently, the nature of ribosome structural dynamics has begun to emerge from a combination of approaches, most notably cryo-EM, X-ray crystallography and FRET. Ribosome movement occurs both on a grand scale, as in the intersubunit r...

  15. Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen Nuclear Ribosomal RNA Small Subunit (18S rRNA) Nucleotide Sequen cing and Characterization of Sailonggu(Whole Bone of Myospalax baileyi Thomas)cing%塞隆骨原动物高原鼢鼠核基因18S rRNA序列测定与分析

    Institute of Scientific and Technical Information of China (English)

    曹晖; 刘玉萍; 张绍来; 周开亚

    2001-01-01

    目的:测定仓鼠科动物高原鼢鼠Myospalax b aileyi的核rDNA基因序列,为塞隆骨正品基原检定提供分子依据。方法:采用PCR直接测序技术测定高原鼢鼠18S rRNA基因核苷酸序列并作序列特征分析。[ HT5”H〗结果:高原鼢鼠的18S rRNA序列长度为1 851 bp。根据排序比较,高原鼢鼠与2种鼠科动物间的DNA序列同源性 为72.04%~72.18%。结论:通过基因序列分析,DNA测序技术可成为 塞隆骨正品基原检定的准确有效手段。%Objective: Sequencing the nuclear ribosomal RNA small subunit (18S r RNA) gene of Myospalax baileyi (Cricetidae) to develop an ultimate and defi nitive means for origin identification of genuine Sailonggu. Methods: The total DNA wa s prepared from dried tail tissues. The nuclear 18S rRNA gene region was amplifi ed by PCR using a consensus primer set and its nucleotide sequence was determine d by PCR direct sequencing. The characteristic analysis of 18S rRNA sequences wa s generated usin software program Genetyx-SV/R Version 10.1. Results: The entire 18S rRNA gene region of M. baileyi spanned 1851 bp in length. Althou gh m ultiple alignment of sequence indicates that there are only lower homology (72.0 4%~72.18%)comparing with its two alias Mus musculus (GenBank Accession numb er X 00686)and Rattus norvegicus (M11188)(Muridae), their highly conservative dom ain i s located in 1020~1509 nt. There are many variable sites from upstream of 5'-e nd , which coud provide a novel information for molecular recognition of Sailonggu. Conclusion:DNA sequencing could be a useful and reliable tool in the origin identification of genuine Sailonggu.

  16. Epistasis analysis of 16S rRNA ram mutations helps define the conformational dynamics of the ribosome that influence decoding.

    Science.gov (United States)

    Ying, Lanqing; Fredrick, Kurt

    2016-04-01

    The ribosome actively participates in decoding, with a tRNA-dependent rearrangement of the 30S A site playing a key role. Ribosomal ambiguity (ram) mutations have mapped not only to the A site but also to the h12/S4/S5 region and intersubunit bridge B8, implicating other conformational changes such as 30S shoulder rotation and B8 disruption in the mechanism of decoding. Recent crystallographic data have revealed that mutation G299A in helix h12 allosterically promotes B8 disruption, raising the question of whether G299A and/or other ram mutations act mainly via B8. Here, we compared the effects of each of several ram mutations in the absence and presence of mutation h8Δ2, which effectively takes out bridge B8. The data obtained suggest that a subset of mutations including G299A act in part via B8 but predominantly through another mechanism. We also found that G299A in h12 and G347U in h14 each stabilize tRNA in the A site. Collectively, these data support a model in which rearrangement of the 30S A site, inward shoulder rotation, and bridge B8 disruption are loosely coupled events, all of which promote progression along the productive pathway toward peptide bond formation.

  17. Molecular typing of sand fly species (Diptera, Psychodidae, Phlebotominae) from areas endemic for Leishmaniasis in Ecuador by PCR-RFLP of 18S ribosomal RNA gene.

    Science.gov (United States)

    Terayama, Yoshimi; Kato, Hirotomo; Gomez, Eduardo A; Uezato, Hiroshi; Calvopiña, Manuel; Iwata, Hiroyuki; Hashiguchi, Yoshihisa

    2008-09-01

    Surveillance of the distribution of sand fly species is important for prediction of the risk and expansion of Leishmania infection in endemic and surrounding areas. In the present study, a simple and reliable method of typing New World Lutzomyia species circulating in endemic areas in Ecuador was established by using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique. PCR-RFLP of 18S ribosomal RNA (rRNA) genes with the restriction enzyme AfaI and subsequently HinfI successfully identified seven sand fly species in nine endemic areas in Ecuador. Although intraspecific genetic-diversity affecting the RFLP-patterns was detected in a species, the patterns were species specific. The method promises to be a powerful tool for the classification of New World Lutzomyia species.

  18. Mapping contacts of the S12-S7 intercistronic region of str operon mRNA with ribosomal protein S7 of E. coli.

    Science.gov (United States)

    Golovin, Andrey; Spiridonova, Vera; Kopylov, Alexei

    2006-10-30

    In E. coli, S7 initiates 30S ribosome assembly by binding to 16S rRNA. It also regulates translation of the S12 and S7 cistrons of the 'streptomycin' operon transcript by binding to the S12-S7 intercistronic region. Here, we describe the contacts of N-terminally His(6)-tagged S7 with this region as mapped by UV-induced cross-linking. The cross-links are located at U(-34), U(-35), quite distant from the start codons of the two cistrons. In order to explain the mechanism of translational repression of S12-S7, we consider a possible conformational rearrangement of the intercistronic RNA structure induced by S7 binding.

  19. The vhs1 mutant form of herpes simplex virus virion host shutoff protein retains significant internal ribosome entry site-directed RNA cleavage activity.

    Science.gov (United States)

    Lu, P; Saffran, H A; Smiley, J R

    2001-01-01

    The virion host shutoff (vhs) protein of herpes simplex virus (HSV) triggers global shutoff of host protein synthesis and accelerated turnover of host and viral mRNAs during HSV infection. As well, it induces endoribonucleolytic cleavage of RNA substrates when produced in a rabbit reticulocyte lysate (RRL) in vitro translation system. The vhs1 point mutation (Thr 214-->Ile) eliminates vhs function during virus infection and in transiently transfected mammalian cells and was therefore previously considered to abolish vhs activity. Here we demonstrate that the vhs1 mutant protein induces readily detectable endoribonuclease activity on RNA substrates bearing the internal ribosome entry site of encephalomyocarditis virus in the RRL assay system. These data document that the vhs1 mutation does not eliminate catalytic activity and raise the possibility that the vhs-dependent endoribonuclease employs more than one mode of substrate recognition.

  20. Phylogeny-function analysis of (meta)genomic libraries: screening for expression of ribosomal RNA genes by large-insert library fluorescent in situ hybridization (LIL-FISH).

    Science.gov (United States)

    Leveau, Johan H J; Gerards, Saskia; de Boer, Wietse; van Veen, Johannes A

    2004-09-01

    We assessed the utility of fluorescent in situ hybridization (FISH) in the screening of clone libraries of (meta)genomic or environmental DNA for the presence and expression of bacterial ribosomal RNA (rRNA) genes. To establish proof-of-principle, we constructed a fosmid-based library in Escherichia coli of large-sized genomic DNA fragments of the mycophagous soil bacterium Collimonas fungivorans, and hybridized 768 library clones with the Collimonas-specific fluorescent probe CTE998-1015. Critical to the success of this approach (which we refer to as large-insert library FISH or LIL-FISH) was the ability to induce fosmid copy number, the exponential growth status of library clones in the FISH assay and the use of a simple pooling strategy to reduce the number of hybridizations. Twelve out of 768 E. coli clones were suspected to harbour and express Collimonas 16S rRNA genes based on their hybridization to CTE998-1015. This was confirmed by the finding that all 12 clones were also identified in an independent polymerase chain reaction-based screening of the same 768 clones using a primer set for the specific detection of Collimonas 16S ribosomal DNA (rDNA). Fosmids isolated from these clones were grouped by restriction analysis into two distinct contigs, confirming that C. fungivorans harbours at least two 16S rRNA genes. For one contig, representing 1-2% of the genome, the nucleotide sequence was determined, providing us with a narrow but informative view of Collimonas genome structure and content.

  1. Nucleolar Dominance and Repression of 45S Ribosomal RNA Genes in Hybrids between Xenopus borealis and X. muelleri (2n = 36).

    Science.gov (United States)

    Maciak, Sebastian; Michalak, Katarzyna; Kale, Shiv D; Michalak, Pawel

    2016-01-01

    Nucleolar dominance is a dramatic disruption in the formation of nucleoli and the expression of ribosomal RNA (rRNA) genes, characteristic of some plant and animal hybrids. Here, we report that F1 hybrids produced from reciprocal crosses between 2 sister species of Xenopus clawed frogs, X. muelleri and X. borealis, undergo nucleolar dominance somewhat distinct from a pattern previously reported in hybrids between phylogenetically more distant Xenopus species. Patterns of nucleolar development, 45S rRNA expression, and gene copy inheritance were investigated using a combination of immunostaining, pyrosequencing, droplet digital PCR, flow cytometry, and epigenetic inhibition. In X. muelleri × X. borealis hybrids, typically only 1 nucleolus is formed, and 45S rRNA genes are predominantly expressed from 1 progenitor's alleles, X. muelleri, regardless of the cross-direction. These changes are accompanied by an extensive (∼80%) loss of rRNA gene copies in the hybrids relative to their parents, with the transcriptionally underdominant variant (X. borealis) being preferentially lost. Chemical treatment of hybrid larvae with a histone deacetylase inhibitor resulted in a partial derepression of the underdominant variant. Together, these observations shed light on the genetic and epigenetic basis of nucleolar dominance as an underappreciated manifestation of genetic conflicts within a hybrid genome.

  2. Transcriptional Regulation of Mouse Ribosomal RNA Synthesis by Pathways Involving Protein Kinase C, Calcium, Insulin and Serum

    Science.gov (United States)

    1992-05-08

    Arnheim , 1983). These enhancer regions share many of the same characteristics of polymerase II enhancers (Khoury and Grussl,1983). They enhance 6...1979) were kind gifts of Dr. Norman Arnheim . Plasmids pUC9, pUC19, and pUC18, T4 DNA ligase, all restriction enzymes and molecular weight markers were...H.E. Morgan, 1991. Phorbol Ester Stimulation of Protein Kinase C Activity and Ribosomal DNA Transcription, j. ;iol. Chem. 266:22003-22009. Arnheim , N

  3. Affinity of ribosomal protein S8 from mesophilic and (hyper)thermophilic archaea and bacteria for 16S rRNA correlates with the growth temperatures of the organisms.

    Science.gov (United States)

    Gruber, Thomas; Köhrer, Caroline; Lung, Birgit; Shcherbakov, Dmitri; Piendl, Wolfgang

    2003-08-14

    The ribosomal protein S8 plays a pivotal role in the assembly of the 30S ribosomal subunit. Using filter binding assays, S8 proteins from mesophilic, and (hyper)thermophilic species of the archaeal genus Methanococcus and from the bacteria Escherichia coli and Thermus thermophilus were tested for their affinity to their specific 16S rRNA target site. S8 proteins from hyperthermophiles exhibit a 100-fold and S8 from thermophiles exhibit a 10-fold higher affinity than their mesophilic counterparts. Thus, there is a striking correlation of affinity of S8 proteins for their specific RNA binding site and the optimal growth temperatures of the respective organisms. The stability of individual rRNA-protein complexes might modulate the stability of the ribosome, providing a maximum of thermostability and flexibility at the growth temperature of the organism.

  4. Ribosomal targets for antibiotic drug discovery

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  5. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin.

  6. Nonsense-mediated mRNA decay controls the changes in yeast ribosomal protein pre-mRNAs levels upon osmotic stress.

    Directory of Open Access Journals (Sweden)

    Elena Garre

    Full Text Available The expression of ribosomal protein (RP genes requires a substantial part of cellular transcription, processing and translation resources. Thus, the RP expression must be tightly regulated in response to conditions that compromise cell survival. In Saccharomyces cerevisiae cells, regulation of the RP gene expression at the transcriptional, mature mRNA stability and translational levels during the response to osmotic stress has been reported. Reprogramming global protein synthesis upon osmotic shock includes the movement of ribosomes from RP transcripts to stress-induced mRNAs. Using tiling arrays, we show that osmotic stress yields a drop in the levels of RP pre-mRNAs in S. cerevisiae cells. An analysis of the tiling array data, together with transcription rates data, shows a poor correlation, indicating that the drop in the RP pre-mRNA levels is not merely a result of the lowered RP transcription rates. A kinetic study using quantitative RT-PCR confirmed the decrease in the levels of several RP-unspliced transcripts during the first 15 minutes of osmotic stress, which seems independent of MAP kinase Hog1. Moreover, we found that the mutations in the components of the nonsense-mediated mRNA decay (NMD, Upf1, Upf2, Upf3 or in exonuclease Xrn1, eliminate the osmotic stress-induced drop in RP pre-mRNAs. Altogether, our results indicate that the degradation of yeast RP unspliced transcripts by NMD increases during osmotic stress, and suggest that this might be another mechanism to control RP synthesis during the stress response.

  7. Mutations of EXOSC3/Rrp40p associated with neurological diseases impact ribosomal RNA processing functions of the exosome in S. cerevisiae

    Science.gov (United States)

    Gillespie, Abby; Gabunilas, Jason; Jen, Joanna C.; Chanfreau, Guillaume F.

    2017-01-01

    The RNA exosome is a conserved multiprotein complex that achieves a large number of processive and degradative functions in eukaryotic cells. Recently, mutations have been mapped to the gene encoding one of the subunits of the exosome, EXOSC3 (yeast Rrp40p), which results in pontocerebellar hypoplasia with motor neuron degeneration in human patients. However, the molecular impact of these mutations in the pathology of these diseases is not well understood. To investigate the molecular consequences of mutations in EXOSC3 that lead to neurological diseases, we analyzed the effect of three of the mutations that affect conserved residues of EXOSC3/Rrp40p (G31A, G191C, and W238R; G8A, G148C, and W195R, respectively, in human and yeast) in S. cerevisiae. We show that the severity of the phenotypes of these mutations in yeast correlate with that of the disease in human patients, with the W195R mutant showing the strongest growth and RNA processing phenotypes. Furthermore, we show that these mutations affect more severely pre-ribosomal RNA processing functions of the exosome rather than other nuclear processing or surveillance functions. These results suggest that delayed or defective pre-rRNA processing might be the primary defect responsible for the pathologies detected in patients with mutations affecting EXOSC3 function in residues conserved throughout eukaryotes. PMID:28053271

  8. Identification of the cis-elements mediating the autogenous control of ribosomal protein L2 mRNA stability in yeast.

    Science.gov (United States)

    Presutti, C; Villa, T; Hall, D; Pertica, C; Bozzoni, I

    1995-08-15

    The ribosomal protein L2 (rpL2) of Saccharomyces cerevisiae regulates the accumulation of its own mRNA by a feedback mechanism. An RNA sequence is responsible for this control, initially characterized as a 360 nucleotide-long region, localized at the 5' end of the transcript. This region, fused to an unrelated coding sequence, is able to down-regulate the accumulation of the chimeric transcript when increased levels of rpL2 are induced in the cell. The target regulatory region also responds to regulation when inserted inside an intron, demonstrating that the control process can take place inside the nucleus. Deletion analysis from the 5' and 3' borders have restricted the responsive region to approximately 200 nt. The insertion of a poly-G cassette downstream of the regulatory region allowed the identification of truncated 3' cut-off poly(A)+ RNA molecules. The parallel identification of cut-off molecules containing the 5' portion of the transcript allowed us to deduce that the truncated products originate by endonucleolytic cleavage. Altogether, these results are consistent with a mechanism by which the presence of excess amounts of rpL2 in the cell triggers its own mRNA to a degradative pathway; this involves an initial endonucleolytic cleavage that is followed by exonucleolytic trimming. Such a regulatory mechanism shows interesting analogies with the translational regulation of r-proteins in Escherichia coli.

  9. The structure of a single unit of ribosomal RNA gene (rDNA) including intergenic subrepeats in the Australian bulldog ant Myrmecia croslandi (Hymenoptera: Formicidae).

    Science.gov (United States)

    Ohnishi, Hitoshi; Yamamoto, Masa-Toshi

    2004-02-01

    A complete single unit of a ribosomal RNA gene (rDNA) of M. croslandi was sequenced. The ends of the 18S, 5.8S and 28S rRNA genes were determined by using the sequences of D. melanogaster rDNAs as references. Each of the tandemly repeated rDNA units consists of coding and non-coding regions whose arrangement is the same as that of D. melanogaster rDNA. The intergenic spacer (IGS) contains, as in other species, a region with subrepeats, of which the sequences are different from those previously reported in other insect species. The length of IGSs was estimated to be 7-12 kb by genomic Southern hybridization, showing that an rDNA repeating unit of M. croslandi is 14-19 kb-long. The sequences of the coding regions are highly conserved, whereas IGS and ITS (internal transcribed spacer) sequences are not. We obtained clones with insertions of various sizes of R2 elements, the target sequence of which was found in the 28S rRNA coding region. A short segment in the IGS that follows the 3' end of the 28S rRNA gene was predicted to form a secondary structure with long stems.

  10. mRNA decay factor AUF1 binds the internal ribosomal entry site of enterovirus 71 and inhibits virus replication.

    Directory of Open Access Journals (Sweden)

    Jing-Yi Lin

    Full Text Available AU-rich element binding factor 1 (AUF1 has a role in the replication cycles of different viruses. Here we demonstrate that AUF1 binds the internal ribosome entry site (IRES of enterovirus 71 (EV71 and negatively regulates IRES-dependent translation. During EV71 infection, AUF1 accumulates in the cytoplasm where viral replication occurs, whereas AUF1 localizes predominantly in the nucleus in mock-infected cells. AUF1 knockdown in infected cells increases IRES activity and synthesis of viral proteins. Taken together, the results suggest that AUF1 interacts with the EV71 IRES to negatively regulate viral translation and replication.

  11. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    Science.gov (United States)

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  12. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  13. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Science.gov (United States)

    Fernández-Miragall, Olga; Hernández, Carmen

    2011-01-01

    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  14. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    Science.gov (United States)

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  15. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  16. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  17. MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation

    DEFF Research Database (Denmark)

    Ørom, Ulf Andersson; Nielsen, Finn Cilius; Lund, Anders Henrik

    2008-01-01

    MicroRNAs (miRNAs) are small RNAs that function as posttranscriptional regulators of gene expression. miRNAs affect a variety of signaling pathways, and impaired miRNA regulation may contribute to the development of cancer and other diseases. Here we show that miRNA miR-10a interacts with the 5' ...

  18. Chromosome Mapping of 18S Ribosomal RNA Genes in Eleven Hypostomus Species (Siluriformes, Loricariidae): Diversity Analysis of the Sites.

    Science.gov (United States)

    Rubert, Marceléia; da Rosa, Renata; Zawadzki, Claudio H; Mariotto, Sandra; Moreira-Filho, Orlando; Giuliano-Caetano, Lucia

    2016-08-01

    We investigated the chromosomal distribution of 18S ribosomal DNA (rDNA) in different populations of 11 species of Hypostomus collected in important Brazilian basins, namely South Atlantic, Upper Paraná, and Paraguay applying the fluorescence in situ hybridization (FISH). Hypostomus cochliodon, Hypostomus commersoni, Hypostomus hermanni, Hypostomus regani, Hypostomus albopunctatus, Hypostomus paulinus, Hypostomus aff. paulinus, Hypostomus iheringii, and Hypostomus mutucae presented multiple 18S rDNA sites while Hypostomus strigaticeps and Hypostomus nigromaculatus exhibited a single pair of chromosomes with 18S rDNA sites. The studied species presented variations in the number and position of these sites. The results accomplished were similar to those obtained by the analysis of AgNORs, revealing the same interspecific variability. Each species exhibited distinctive patterns of AgNOR and 18S rDNA distribution, which can be considered cytogenetic markers in each species of the genus and help improve the discussions on the phylogeny of the group.

  19. Real-time quantitative reverse transcription-polymerase chain reaction to detect propionibacterial ribosomal RNA in the lymph nodes of Chinese patients with sarcoidosis.

    Science.gov (United States)

    Zhou, Y; Wei, Y-R; Zhang, Y; Du, S-S; Baughman, R P; Li, H-P

    2015-09-01

    The aim of this study was to investigate the diagnostic value of using the copy number of propionibacterial rRNA as a biomarker for sarcoidosis. Ribosomal RNA of Propionibacterium acnes and P. granulosum was measured by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) using formalin-fixed and paraffin-embedded tissue of lymph node biopsy from 65 Chinese patients with sarcoidosis, 45 with tuberculosis and 50 controls with other diseases (23 with non-specific lymphadenitis and 27 with mediastinal lymph node metastasis from lung cancer). The receiver operating characteristic (ROC) curve was analysed to determine an optimal cut-off value for diagnosis, and the diagnostic accuracy of the cut-off value was evaluated in additional tissue samples [24 patients with sarcoidosis and 22 with tuberculosis (TB)]. P. acnes or P. granulosum rRNA was detected in 48 of the 65 sarcoidosis samples but only in four of the 45 TB samples and three of the 50 control samples. Analysis of the ROC curve revealed that an optimal cut-off value of the copy number of propionibacterial rRNA for diagnosis of sarcoidosis was 50·5 copies/ml with a sensitivity and specificity of 73·8 and 92·6%, respectively. Based on the cut-off value, 19 of the 24 additional sarcoidosis samples exhibited positive P. acnes or P. granulosum, whereas only one of the 22 additional TB samples was positive, resulting in a sensitivity and specificity of 79·2 and 95·5%, respectively. These findings suggest that propionibacteria might be associated with sarcoidosis granulomatous inflammation. Detection of propionibacterial rRNA by RT-PCR might possibly distinguish sarcoidosis from TB.

  20. DEAD-box helicase DDX27 regulates 3′ end formation of ribosomal 47S RNA and stably associates with the PeBoW-complex

    Energy Technology Data Exchange (ETDEWEB)

    Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)

    2015-05-15

    PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.

  1. The nucleolus and transcription of ribosomal genes.

    Science.gov (United States)

    Raska, Ivan; Koberna, Karel; Malínský, Jan; Fidlerová, Helena; Masata, Martin

    2004-10-01

    Ribosome biogenesis is a highly dynamic, steady-state nucleolar process that involves synthesis and maturation of rRNA, its transient interactions with non-ribosomal proteins and RNPs and assembly with ribosomal proteins. In the few years of the 21st century, an exciting progress in the molecular understanding of rRNA and ribosome biogenesis has taken place. In this review, we discuss the recent results on the regulation of rRNA synthesis in relation to the functional organization of the nucleolus, and put an emphasis on the situation encountered in mammalian somatic cells.

  2. Mapping the ribosomal protein S7 regulatory binding site on mRNA of the E. coli streptomycin operon.

    Science.gov (United States)

    Surdina, A V; Rassokhin, T I; Golovin, A V; Spiridonova, V A; Kopylov, A M

    2010-07-01

    In this work it is shown by deletion analysis that an intercistronic region (ICR) approximately 80 nucleotides in length is necessary for interaction with recombinant E. coli S7 protein (r6hEcoS7). A model is proposed for the interaction of S7 with two ICR sites-region of hairpin bifurcations and Shine-Dalgarno sequence of cistron S7. A de novo RNA binding site for heterologous S7 protein of Thermus thermophilus (r6hTthS7) was constructed by selection of a combinatorial RNA library based on E. coli ICR: it has only a single supposed protein recognition site in the region of bifurcation. The SERW technique was used for selection of two intercistronic RNA libraries in which five nucleotides of a double-stranded region, adjacent to the bifurcation, had the randomized sequence. One library contained an authentic AG (-82/-20) pair, while in the other this pair was replaced by AU. A serwamer capable of specific binding to r6hTthS7 was selected; it appeared to be the RNA68 mutant with eight nucleotide mutations. The serwamer binds to r6hTthS7 with the same affinity as homologous authentic ICR of str mRNA binds to r6hEcoS7; apparent dissociation constants are 89 +/- 43 and 50 +/- 24 nM, respectively.

  3. Interferons specifically suppress the translation from the internal ribosome entry site of hepatitis C virus through a double-stranded RNA-activated protein kinase-independent pathway.

    Science.gov (United States)

    Kato, Jun; Kato, Naoya; Moriyama, Masaru; Goto, Tadashi; Taniguchi, Hiroyoshi; Shiratori, Yasushi; Omata, Masao

    2002-07-15

    Interferon (IFN) therapy is used worldwide as the best available treatment for hepatitis C virus (HCV) infection; however, little is known about how IFN or other drugs work against liver diseases. The effect of 6 drugs (glycyrrhizin, ursodeoxycholic acid, ribavirin, methylprednisolone, IFN-alpha, and IFN-beta) on HCV RNA translation from the HCV internal ribosome entry site (IRES) was investigated, using a bicistronic reporter containing the HCV IRES. IFNs suppressed both cap-dependent and HCV IRES-dependent translation, with HCV IRES-dependent translation being more significantly suppressed. In contrast to HCV IRES, IFN did not suppress either foot-and-mouth disease virus IRES-dependent or encephalomyocarditis virus IRES-dependent translation more than it suppressed cap-dependent translation. Moreover, dominant inhibition of HCV IRES-dependent over cap-dependent translation depended neither on the double-stranded RNA-activated protein kinase activation nor on La protein function. These results indicate a novel antiviral effect of IFNs against HCV.

  4. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    Science.gov (United States)

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru.

  5. Hepatitis C virus internal ribosome entry site RNA contains a tertiary structural element in a functional domain of stem–loop II

    Science.gov (United States)

    Lyons, Alita J.; Lytle, J. Robin; Gomez, Jordi; Robertson, Hugh D.

    2001-01-01

    The internal ribosome entry site (IRES) of hepatitis C virus (HCV) RNA contains >300 bases of highly conserved 5′-terminal sequence, most of it in the uncapped 5′-untranslated region (5′-UTR) upstream from the single AUG initiator triplet at which translation of the HCV polyprotein begins. Although progress has been made in defining singularities like the RNA pseudoknot near this AUG, the sequence and structural features of the HCV IRES which stimulate accurate and efficient initiation of protein synthesis are only partially defined. Here we report that a region further upstream from the AUG, stem–loop II of the HCV IRES, also contains an element of local tertiary structure which we have detected using RNase H cleavage and have mapped using the singular ability of two bases therein to undergo covalent intra-chain crosslinking stimulated by UV light. This pre-existing element maps to two non-contiguous stretches of the HCV IRES sequence, residues 53–68 and 103–117. Several earlier studies have shown that the correct sequence between bases 45 and 70 of the HCV IRES stem–loop II domain is required for initiation of protein synthesis. Because features of local tertiary structure like the one we report here are often associated with protein binding, we propose that the HCV stem–loop II element is directly involved in IRES action. PMID:11410661

  6. Ribosomal RNA-based analysis of the bacterial flora from the conjunctivae of cattle with bovine keratoconjunctivitis (BKC).

    Science.gov (United States)

    Hare, William R; Hoyt, Phillip G; Hohn, Christina; Higgins, James A

    2008-10-15

    Bovine keratoconjunctivitis (BKC), colloquially referred to as 'pinkeye', is a disease affecting cattle worldwide; it costs cattle producers millions of dollars in economic loss annually. While Moraxella spp. are the primary etiologic agent of pinkeye, surveys of flora from the conjunctivae of livestock from around the world have indicated that a variety of bacterial commensals occupy this niche. We used molecular biology-based methods to determine the composition of bacterial flora in the conjunctivae of normal dairy and beef cattle from Maryland (n=113), and beef cattle with clinical BKC from Louisiana (n=42). Three regimens were used: 16S rRNA PCR and DGGE analysis of amplicons; 16S rRNA PCR and cloning of amplicons into Escherichia coli followed by screening and sequencing of clones harboring inserts; and culture of bacteria on chromogenic agar followed by 16S rRNA PCR and sequencing. Most taxa were comprised of saprophytes found in the environment, such as Bacillus, Pantoea, E. coli, and Exiguobacterium. Moraxella spp. were infrequently observed. Some species, such as Propionibacterium acnes, represent taxa not previously associated with the conjunctivae. Bacillus pumilus and Bacillus licheniformis isolates from the conjunctivae of Maryland cattle were genetically distinct from isolates previously implicated in septic infections in cattle at the same location. We conclude that employing 16S rRNA-based methods for bacterial identification can be useful in defining the flora present in the conjunctivae of normal cattle, and those with BKC.

  7. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins

    NARCIS (Netherlands)

    van Gijtenbeek, Lieke A; Robinson, Andrew; van Oijen, Antoine; Poolman, Bert; Kok, Jan

    2016-01-01

    By using fluorescence imaging, we provide a time-resolved single-cell view on coupled defects in transcription, translation, and growth during expression of heterologous membrane proteins in Lactococcus lactis. Transcripts encoding poorly produced membrane proteins accumulate in mRNA-dense bodies at

  8. GTPases involved in bacterial ribosome maturation.

    Science.gov (United States)

    Goto, Simon; Muto, Akira; Himeno, Hyouta

    2013-05-01

    The ribosome is an RNA- and protein-based macromolecule having multiple functional domains to facilitate protein synthesis, and it is synthesized through multiple steps including transcription, stepwise cleavages of the primary transcript, modifications of ribosomal proteins and RNAs and assemblies of ribosomal proteins with rRNAs. This process requires dozens of trans-acting factors including GTP- and ATP-binding proteins to overcome several energy-consuming steps. Despite accumulation of genetic, biochemical and structural data, the entire process of bacterial ribosome synthesis remains elusive. Here, we review GTPases involved in bacterial ribosome maturation.

  9. Flow Cytometry-assisted Cloning of Specific Sequence Motifs fromComplex 16S ribosomal RNA Gene Libraries.

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, J.L.; Schramm, A.; Bernhard, A.E.; van den Engh, G.J.; Stahl, D.A.

    2004-07-21

    A flow cytometry method was developed for rapid screeningand recovery of cloned DNA containing common sequence motifs. Thisapproach, termed fluorescence-activated cell sorting-assisted cloning,was used to recover sequences affiliated with a unique lineage within theBacteroidetes not abundant in a clone library of environmental 16S rRNAgenes. Retrieval and sequence analysis of phylogenetically informativegenes has become a standard cultivation-independent technique toinvestigate microbial diversity in nature (7, 18). Genes encoding the 16SrRNA, because of the relative ease of their selective amplification, havebeen most frequently employed for general diversity surveys (16).Environmental studies have also focused on specific subpopulationsaffiliated with a phylogenetic group or identified by genes encodingspecific metabolic functions (e.g., ammonia oxidation, sulfaterespiration, and nitrate reduction) (8,15,20). However, specificpopulations may be of low abundance (1,23), or the genes encodingspecific metabolic functions may be insufficiently conserved to providepriming sites for general PCR amplification. Three general approacheshave been used to obtain 16S rRNA sequence information from low-abundancepopulations: screening hundreds to thousands of clones in a general 16SrRNA gene library (21), flow cytometric sorting of a subpopulation ofenvironmentally derived cells labeled by fluorescent in situhybridization (FISH) (27), or selective PCR amplification using primersspecific for the subpopulation (2,23). While the first approach is simplytime-consuming and tedious, the second has been restricted to fairlylarge and strongly fluorescent cells from aquatic samples (5, 27). Thethird approach often generates fragments of only a few hundred bases dueto the limited number of specific priming sites. Partial sequenceinformation often degrades analysis, obscuring or distorting thephylogenetic placement of the new sequences (11, 20). A more robustcharacterization of environ

  10. Phylogenetic position of Dysteria derouxi (Ciliophora:Phyllopharyngea: Dysteriida) inferred from the small subunit ribosomal RNA gene sequence

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The complete small subunit rRNA (SSrRNA) gene sequence of a marine ciliate, Dysteria derouxi Gong and Song, 2004, was determined to be of 1 708 nucleotides. The phylogenetic position of this species within the class Phyllopharyngea was deduced using distance matrix, maximum parsimony and maximum likelihood methods. Dysteria derouxi, together with other available ciliates of the class Phyllopharyngea, forms a monophyletic clade with strong bootstrap support in the distance matrix, maximum parsimony and likelihood tree construction methods, while the dysterids are, as a monophyletic group, phylogenetically close to the clade of chlamydodontids [values of 100% LS(least-squares), 100% NJ(neighbor-joining)]. In addition, the trees indicate that dysteriids may be a higher or specialized group within the class, which corresponds well to the morphology and infraciliature.

  11. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Directory of Open Access Journals (Sweden)

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  12. Ribosomal RNA gene detection and targeted culture of novel nitrogen-responsive fungal taxa from temperate pine forest soil.

    Science.gov (United States)

    Hesse, Cedar Nelson; Torres-Cruz, Terry; Billingsley Tobias, Terri L; Al-Matruk, Maryam; Porras-Alfaro, Andrea; Kuske, Cheryl R

    2016-09-12

    Soil fungal communities are responsible for carbon and nitrogen (N) cycling. The high complexity of the soil fungal community and the high proportion of taxonomically unidentifiable sequences confound ecological interpretations in field studies because physiological information is lacking for many organisms known only by their rRNA sequences. This situation forces experimental comparisons to be made at broader taxonomic racks where functions become difficult to infer. The objective of this study was to determine OTU (operational taxonomic units) level responses of the soil fungal community to N enrichment in a temperate pine forest experiment and to use the sequencing data to guide culture efforts of novel N-responsive fungal taxa. Replicate samples from four soil horizons (up to 10 cm depth) were obtained from ambient, enriched CO2 and N-fertilization plots. Through a fungal large subunit rRNA gene (LSU) sequencing survey, we identified two novel fungal clades that were abundant in our soil sampling (representing up to 27% of the sequences in some samples) and responsive to changes in soil N. The two N-responsive taxa with no predicted taxonomic association were targeted for isolation and culturing from specific soil samples where their sequences were abundant. Representatives of both OTUs were successfully cultured using a filtration approach. One taxon (OTU6) was most closely related to Saccharomycotina; the second taxon (OTU69) was most closely related to Mucoromycotina. Both taxa likely represent novel species. This study shows how observation of specific OTUs level responses to altered N status in a large rRNA gene field survey provided the impetus to design targeted culture approaches for isolation of novel N-responsive fungal taxa.

  13. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W;

    1993-01-01

    between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally...

  14. Use of the polymerase chain reaction assay for the detection of Babesia odocoilei 18S ribosomal RNA in formalin-fixed tissues.

    Science.gov (United States)

    Lockerbie, Betty P; Bollinger, Trent K; Burgess, Hilary J

    2014-06-10

    The effect of fixation and storage conditions on the performance of polymerase chain reaction (PCR) assays for Babesia odocoilei were examined using 3 different primer sets targeting the eukaryotic 18S ribosomal RNA gene, with variably sized products of 1,723 base pairs (bp), 483 bp, and 306 bp. All primer sets performed well on fresh-frozen tissue, and storage for 1 year at -20°C did not affect PCR performance. Formalin fixation markedly affected the amplicon length that could be amplified. However, DNA was successfully amplified after storage in formalin for 2 months using the primer set with a 483-bp product, and up to 6 months using the primer set with a 306-bp product. The latter primer set successfully differentiated B. odocoilei and Babesia microti DNA; however, further evaluation is required to confirm its specificity. Treatment of tissues with formic acid, at concentrations typically used to denature prions, degraded the DNA and made it unsuitable for PCR testing.

  15. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata.

  16. Molecular epidemiology of trichophyton tonsurans isolated in Japan using RFLP analysis of non-transcribed spacer regions of ribosomal RNA genes.

    Science.gov (United States)

    Mochizuki, Takashi; Kawasaki, Masako; Tanabe, Hiroshi; Anzawa, Kazushi; Ishizaki, Hiroshi; Choi, Jong Soo

    2007-07-01

    Trichophyton tonsurans has been reported to be the causative agent of an epidemic of tinea corporis and tinea capitis among Japanese judoists and wrestlers. A molecular method using restriction enzyme analysis of PCR-amplified fragments targeting the non-transcribed spacer (NTS) region of ribosomal RNA genes in fungal nuclei was applied to a total of 232 strains of T. tonsurans isolated in Japan. Six molecular types, i.e., NTS types I, II, III, IV, V, and VI, were clearly detected in restriction analysis of fragments digested with MvaI and AvaI together. Of the 232 strains, 199 were classified as NTS I, 21 as NTS II, 7 as NTS III, 3 as NTS IV, 1 as type V, and 1 as type VI. Whereas the NTS I strains were found nationwide, most of the NTS II and NTS III strains were limited to central Japan. Of 164 strains isolated from judoists, 160 were classified as NTS I, which suggests that the majority of the cases were caused by a clonal lineage. On the other hand, the 48 strains isolated from wrestlers showed more variety, with 27 strains classified as NTS I, 17 as NTS II, and 4 as NTS III. We concluded that the epidemic was caused by at least three lineages of T. tonsurans. NTS VI strains, the major molecular type among sporadically isolated strains, were not observed among the epidemic strains, and strains of this type did not contribute to the present epidemic.

  17. Ptc6 is required for proper rapamycin-induced down-regulation of the genes coding for ribosomal and rRNA processing proteins in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Asier González

    Full Text Available Ptc6 is one of the seven components (Ptc1-Ptc7 of the protein phosphatase 2C family in the yeast Saccharomyces cerevisiae. In contrast to other type 2C phosphatases, the cellular role of this isoform is poorly understood. We present here a comprehensive characterization of this gene product. Cells lacking Ptc6 are sensitive to zinc ions, and somewhat tolerant to cell-wall damaging agents and to Li(+. Ptc6 mutants are sensitive to rapamycin, albeit to lesser extent than ptc1 cells. This phenotype is not rescued by overexpression of PTC1 and mutation of ptc6 does not reproduce the characteristic genetic interactions of the ptc1 mutation with components of the TOR pathway, thus suggesting different cellular roles for both isoforms. We show here that the rapamycin-sensitive phenotype of ptc6 cells is unrelated to the reported role of Pt6 in controlling pyruvate dehydrogenase activity. Lack of Ptc6 results in substantial attenuation of the transcriptional response to rapamycin, particularly in the subset of repressed genes encoding ribosomal proteins or involved in rRNA processing. In contrast, repressed genes involved in translation are Ptc6-independent. These effects cannot be attributed to the regulation of the Sch9 kinase, but they could involve modulation of the binding of the Ifh1 co-activator to specific gene promoters.

  18. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    Studies on the value of culture-independent molecular identification of bacteria in cardiac valves are mostly restricted to comparing agreement of identification to what is obtained by culture to the number of identified bacteria in culture-negative cases. However, evaluation of the usefulness...... of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...

  19. History of the ribosome and the origin of translation

    Science.gov (United States)

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  20. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar

    2010-09-01

    was significantly slower than mock vector transformed E. coli. The S30 extract of E. coli expressing the Rv1694 had poor translational activity in presence of capreomycin, further confirming its methylation activity. Finally, incorporation of methyl group of [3H]-S-adenosylmethionine in isolated ribosomes also confirmed its methylation activity. Conclusions The Rv1694 has an unusual dual activity. It appears to contain two diverse functions such as haemolytic activity and ribosomal RNA methylation activity. It is possible that the haemolytic activity might be relevant to intra-cellular compartments such as phagosomes rather than cell lysis of erythrocytes and the self-assembly trait may have a potential role after successful entry into macrophages by Mycobacterium tuberculosis.

  1. Additional data for a new Theileria sp. from China based on the sequences of ribosomal RNA internal transcribed spacers.

    Science.gov (United States)

    Liu, Junlong; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Ma, Miling; Bai, Qi; Yin, Hong; Luo, Jianxun

    2013-02-01

    Theileria sinensis was recently isolated and named as an independent Theileria species that infects cattle in China. To date, this parasite has been described based on its morphology, transmission and molecular studies, indicating that it should be classified as a distinct species. To test the validity of this taxon, the two internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene were cloned and sequenced from three T. sinensis isolates. The complete ITS sequences were compared with those of other Theileria sp. available in GenBank. Phylogenetic analyses based on sequence data for the complete ITS sequences indicate that T. sinensis lies in a distinct clade that is separate from that of T. buffeli/orientalis and T. annulata. Sequence comparisons indicate that different T. sinensis isolates possess unique sizes of ITS1 and ITS2 as well as species-specific nucleotide sequences. This analysis provides new molecular data to support the classification of T. sinensis as a distinct species from other known Theileria spp. based on ITS sequences.

  2. AtRH57, a DEAD-box RNA helicase, is involved in feedback inhibition of glucose-mediated abscisic acid accumulation during seedling development and additively affects pre-ribosomal RNA processing with high glucose.

    Science.gov (United States)

    Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine

    2014-01-01

    The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth.

  3. Crystal structure of eukaryotic ribosome and its complexes with inhibitors.

    Science.gov (United States)

    Yusupova, Gulnara; Yusupov, Marat

    2017-03-19

    A high-resolution structure of the eukaryotic ribosome has been determined and has led to increased interest in studying protein biosynthesis and regulation of biosynthesis in cells. The functional complexes of the ribosome crystals obtained from bacteria and yeast have permitted researchers to identify the precise residue positions in different states of ribosome function. This knowledge, together with electron microscopy studies, enhances our understanding of how basic ribosome processes, including mRNA decoding, peptide bond formation, mRNA, and tRNA translocation and cotranslational transport of the nascent peptide, are regulated. In this review, we discuss the crystal structure of the entire 80S ribosome from yeast, which reveals its eukaryotic-specific features, and application of X-ray crystallography of the 80S ribosome for investigation of the binding mode for distinct compounds known to inhibit or modulate the protein-translation function of the ribosome. We also refer to a challenging aspect of the structural study of ribosomes, from higher eukaryotes, where the structures of major distinctive features of higher eukaryote ribosome-the high-eukaryote-specific long ribosomal RNA segments (about 1MDa)-remain unresolved. Presently, the structures of the major part of these high-eukaryotic expansion ribosomal RNA segments still remain unresolved.This article is part of the themed issue 'Perspectives on the ribosome'.

  4. 16S ribosomal RNA pseudouridine synthase RsuA of Escherichia coli: deletion, mutation of the conserved Asp102 residue, and sequence comparison among all other pseudouridine synthases.

    Science.gov (United States)

    Conrad, J; Niu, L; Rudd, K; Lane, B G; Ofengand, J

    1999-06-01

    The gene for RsuA, the pseudouridine synthase that converts U516 to pseudouridine in 16S ribosomal RNA of Escherichia coli, has been deleted in strains MG1655 and BL21/DE3. Deletion of this gene resulted in the specific loss of pseudouridine516 in both cell lines, and replacement of the gene in trans on a plasmid restored the pseudouridine. Therefore, rsuA is the only gene in E. coli with the ability to produce a protein capable of forming pseudouridine516. There was no effect on the growth rate of rsuA- MG1655 either in rich or minimal medium at either 24, 37, or 42 degrees C. Plasmid rescue of the BL21/DE3 rsuA- strain using pET15b containing an rsuA gene with aspartate102 replaced by asparagine or threonine demonstrated that neither mutant was active in vivo. This result supports a role for this aspartate, located in a unique GRLD sequence in this gene, at the catalytic center of the synthase. Induction of wild-type and the two mutant synthases in strain BL21/DE3 from genes in pET15b yielded a strong overexpression of all three proteins in approximately equal amounts showing that the mutations did not affect production of the protein in vivo and thus that the lack of activity was not due to a failure to produce a gene product. Aspartate102 is found in a conserved motif present in many pseudouridine synthases. The conservation and distribution of this motif in nature was assessed.

  5. Potential extra-ribosomal functions of ribosomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lu, Hui; Zhu, Yi-Fei; Xiong, Juan; Wang, Rong; Jia, Zhengping

    2015-08-01

    Ribosomal proteins (RPs), are essential components of the ribosomes, the molecular machines that turn mRNA blueprints into proteins, as they serve to stabilize the structure of the rRNA, thus improving protein biosynthesis. In addition, growing evidence suggests that RPs can function in other cellular roles. In the present review, we summarize several potential extra-ribosomal functions of RPs in ribosomal biogenesis, transcription activity, translation process, DNA repair, replicative life span, adhesive growth, and morphological transformation in Saccharomyces cerevisiae. However, the future in-depth studies are needed to identify these novel secondary functions of RPs in S. cerevisiae.

  6. The localization of multiple sites on 16S RNA which are cross-linked to proteins S7 and S8 in Escherichia coli 30S ribosomal subunits by treatment with 2-iminothiolane.

    Science.gov (United States)

    Wower, I; Brimacombe, R

    1983-03-11

    RNA-protein cross-links were introduced into E. coli 30S ribosomal subunits by reaction with 2-iminothiolane followed by a mild ultraviolet irradiation treatment. After removal of non-reacted protein and partial nuclease digestion of the cross-linked 16S RNA-protein moiety, a number of individual cross-linked complexes could be isolated and the sites of attachment of the proteins to the RNA determined. Protein S8 was cross-linked to the RNA at three different positions, within oligo-nucleotides encompassing positions 629-633, 651-654, and (tentatively) 593-597 in the 16S sequence. Protein S7 was cross-linked within two oligonucleotides encompassing positions 1238-1240, and 1377-1378. In addition, a site at position 723-724 was observed, cross-linked to protein S19, S20 or S21.

  7. The phosphorylation of protein S6 modulates the interaction of the 40 S ribosomal subunit with the 5'-untranslated region of a dictyostelium pre-spore-specific mRNA and controls its stability.

    Science.gov (United States)

    Chiaberge, S; Cassarino, E; Mangiarotti, G

    1998-10-16

    AC914 mRNA, a pre-spore-specific mRNA that accumulates only in the post-aggregation stage of development, is transcribed constitutively as shown by nuclear run-off experiments and by fusing its promoter to the luciferase reporter gene. The same mRNA disappears quickly from disaggregated cells. If the 5'-untranslated region (5'UTR) of the constitutively expressed Actin 15 mRNA is substituted for the 5'UTR of AC914 mRNA, this can no longer be destabilized and accumulates both in growing and disaggregated cells. If the 5'UTR of AC914 mRNA is substituted for the 5'UTR of Actin 15 mRNA, the latter accumulates only in aggregated cells. Pactamycin, but not other inhibitors of protein synthesis, prevents AC914 mRNA from being destabilized in disaggregated cells, suggesting a role of 40 S subunits in the destabilization. This has been confirmed by using an in vitro system in which the in vivo stability of different mRNAs is reproduced. A protein kinase A-dependent phosphorylation of ribosomal protein S6 determines whether 40 S subunits are capable or not of destabilizing AC914 mRNA in the in vitro system.

  8. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  9. RNA helicases

    OpenAIRE

    Owttrim, George W.

    2013-01-01

    Similar to proteins, RNA molecules must fold into the correct conformation and associate with protein complexes in order to be functional within a cell. RNA helicases rearrange RNA secondary structure and RNA-protein interactions in an ATP-dependent reaction, performing crucial functions in all aspects of RNA metabolism. In prokaryotes, RNA helicase activity is associated with roles in housekeeping functions including RNA turnover, ribosome biogenesis, translation and small RNA metabolism. In...

  10. The influence of the ratio of protein energy to total energy in the feed on the activity of protein synthesis in vitro, the level of ribosomal RNA and the RNA-DNA ratio in white trunk muscle of Atlantic cod (Gadus morhua).

    Science.gov (United States)

    Lied, E; Rosenlund, G

    1984-01-01

    Cod (Gadus morhua) were fed diets containing protein energy to total energy levels (PE/TE) of 10.0, 20.6, 29.6, 38.4, 56.2 and 74.1% for 21 days. Ribosomes were isolated from the white trunk muscle tissue, the capacity for protein synthesis in vitro determined and related to muscle tissue wet weight rRNA and DNA. Protein concentrations of less than 47.4% PE/TE in the diets reduce the ribosomal capacity for protein synthesis per g wet weight and per mg DNA, and the tissue contents of rRNA and ratio of rRNA/DNA. The capacity for muscle protein synthesis in vitro is a significant and sensitive parameter of protein inadequacy in fish diets.

  11. Mescaline-induced changes of brain-cortex ribosomes. Effect of mescaline on the stability of brain-cortex ribosomes.

    Science.gov (United States)

    Datta, R K; Ghosh, J J

    1970-05-01

    1. During the action of mescaline sulphate on goat brain-cortex slices the ribosomal particles become susceptible to breakdown, releasing protein, RNA, acidsoluble nucleotides and ninhydrin-positive materials, resulting in loss of ribosomal enzyme activities. 2. Ribosomes of the mescaline-treated cortex slices undergo rapid degradation in the presence of trypsin and ribonuclease. 3. Mescaline does not alter the chemical and nucleotide compositions or the u.v.-absorption characteristics of ribosomal particles, however.

  12. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding.

    Science.gov (United States)

    Sharma, Ajeet K; Chowdhury, Debashish

    2011-04-01

    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid residues, the monomers of the protein, is dictated by the sequence of codons (triplets of nucleotides) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechanochemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is the time of dwell of the ribosome at the corresponding codon. We derive the analytical expression for the distribution of the dwell times of a ribosome in our model. Wherever experimental data are available, our theoretical predictions are consistent with those results. We suggest appropriate experiments to test the new predictions of our model, particularly the effects of the quality control mechanism of the ribosome and that of their crowding on the mRNA track.

  13. Structural diversity in bacterial ribosomes: mycobacterial 70S ribosome structure reveals novel features.

    Directory of Open Access Journals (Sweden)

    Manidip Shasmal

    Full Text Available Here we present analysis of a 3D cryo-EM map of the 70S ribosome from Mycobacterium smegmatis, a saprophytic cousin of the etiological agent of tuberculosis in humans, Mycobacterium tuberculosis. In comparison with the 3D structures of other prokaryotic ribosomes, the density map of the M. smegmatis 70S ribosome reveals unique structural features and their relative orientations in the ribosome. Dramatic changes in the periphery due to additional rRNA segments and extra domains of some of the peripheral ribosomal proteins like S3, S5, S16, L17, L25, are evident. One of the most notable features appears in the large subunit near L1 stalk as a long helical structure next to helix 54 of the 23S rRNA. The sharp upper end of this structure is located in the vicinity of the mRNA exit channel. Although the M. smegmatis 70S ribosome possesses conserved core structure of bacterial ribosome, the new structural features, unveiled in this study, demonstrates diversity in the 3D architecture of bacterial ribosomes. We postulate that the prominent helical structure related to the 23S rRNA actively participates in the mechanisms of translation in mycobacteria.

  14. Structural features of the tmRNA–ribosome interaction

    Science.gov (United States)

    Bugaeva, Elizaveta Y.; Surkov, Serhiy; Golovin, Andrey V.; Öfverstedt, Lars-Göran; Skoglund, Ulf; Isaksson, Leif A.; Bogdanov, Alexey A.; Shpanchenko, Olga V.; Dontsova, Olga A.

    2009-01-01

    Trans-translation is a process which switches the synthesis of a polypeptide chain encoded by a nonstop messenger RNA to the mRNA-like domain of a transfer-messenger RNA (tmRNA). It is used in bacterial cells for rescuing the ribosomes arrested during translation of damaged mRNA and directing this mRNA and the product polypeptide for degradation. The molecular basis of this process is not well understood. Earlier, we developed an approach that allowed isolation of tmRNA–ribosomal complexes arrested at a desired step of tmRNA passage through the ribosome. We have here exploited it to examine the tmRNA structure using chemical probing and cryo-electron microscopy tomography. Computer modeling has been used to develop a model for spatial organization of the tmRNA inside the ribosome at different stages of trans-translation. PMID:19861420

  15. Efficient Translation Initiation Directed by the 900-Nucleotide-Long and GC-Rich 5′ Untranslated Region of the Human Retrotransposon LINE-1 mRNA Is Strictly Cap Dependent Rather than Internal Ribosome Entry Site Mediated▿

    Science.gov (United States)

    Dmitriev, Sergey E.; Andreev, Dmitri E.; Terenin, Ilya M.; Olovnikov, Ivan A.; Prassolov, Vladimir S.; Merrick, William C.; Shatsky, Ivan N.

    2007-01-01

    Retrotransposon L1 is a mobile genetic element of the LINE family that is extremely widespread in the mammalian genome. It encodes a dicistronic mRNA, which is exceptionally rare among eukaryotic cellular mRNAs. The extremely long and GC-rich L1 5′ untranslated region (5′UTR) directs synthesis of numerous copies of RNA-binding protein ORF1p per mRNA. One could suggest that the 5′UTR of L1 mRNA contained a powerful internal ribosome entry site (IRES) element. Using transfection of cultured cells with the polyadenylated monocistronic (L1 5′UTR-Fluc) or bicistronic (Rluc-L1 5′UTR-Fluc) RNA constructs, capped or uncapped, it has been firmly established that the 5′UTR of L1 does not contain an IRES. Uncapping reduces the initiation activity of the L1 5′UTR to that of background. Moreover, the translation is inhibited by upstream AUG codons in the 5′UTR. Nevertheless, this cap-dependent initiation activity of the L1 5′UTR was unexpectedly high and resembles that of the beta-actin 5′UTR (84 nucleotides long). Strikingly, the deletion of up to 80% of the nucleotide sequence of the L1 5′UTR, with most of its stem loops, does not significantly change its translation initiation efficiency. These data can modify current ideas on mechanisms used by 40S ribosomal subunits to cope with complex 5′UTRs and call into question the conception that every long GC-rich 5′UTR working with a high efficiency has to contain an IRES. Our data also demonstrate that the ORF2 translation initiation is not directed by internal initiation, either. It is very inefficient and presumably based on a reinitiation event. PMID:17470553

  16. Efficient translation initiation directed by the 900-nucleotide-long and GC-rich 5' untranslated region of the human retrotransposon LINE-1 mRNA is strictly cap dependent rather than internal ribosome entry site mediated.

    Science.gov (United States)

    Dmitriev, Sergey E; Andreev, Dmitri E; Terenin, Ilya M; Olovnikov, Ivan A; Prassolov, Vladimir S; Merrick, William C; Shatsky, Ivan N

    2007-07-01

    Retrotransposon L1 is a mobile genetic element of the LINE family that is extremely widespread in the mammalian genome. It encodes a dicistronic mRNA, which is exceptionally rare among eukaryotic cellular mRNAs. The extremely long and GC-rich L1 5' untranslated region (5'UTR) directs synthesis of numerous copies of RNA-binding protein ORF1p per mRNA. One could suggest that the 5'UTR of L1 mRNA contained a powerful internal ribosome entry site (IRES) element. Using transfection of cultured cells with the polyadenylated monocistronic (L1 5'UTR-Fluc) or bicistronic (Rluc-L1 5'UTR-Fluc) RNA constructs, capped or uncapped, it has been firmly established that the 5'UTR of L1 does not contain an IRES. Uncapping reduces the initiation activity of the L1 5'UTR to that of background. Moreover, the translation is inhibited by upstream AUG codons in the 5'UTR. Nevertheless, this cap-dependent initiation activity of the L1 5'UTR was unexpectedly high and resembles that of the beta-actin 5'UTR (84 nucleotides long). Strikingly, the deletion of up to 80% of the nucleotide sequence of the L1 5'UTR, with most of its stem loops, does not significantly change its translation initiation efficiency. These data can modify current ideas on mechanisms used by 40S ribosomal subunits to cope with complex 5'UTRs and call into question the conception that every long GC-rich 5'UTR working with a high efficiency has to contain an IRES. Our data also demonstrate that the ORF2 translation initiation is not directed by internal initiation, either. It is very inefficient and presumably based on a reinitiation event.

  17. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  18. A recent intermezzo at the Ribosome Club.

    Science.gov (United States)

    Pavlov, Michael Y; Liljas, Anders; Ehrenberg, Måns

    2017-03-19

    Two sets of ribosome structures have recently led to two different interpretations of what limits the accuracy of codon translation by transfer RNAs. In this review, inspired by this intermezzo at the Ribosome Club, we briefly discuss accuracy amplification by energy driven proofreading and its implementation in genetic code translation. We further discuss general ways by which the monitoring bases of 16S rRNA may enhance the ultimate accuracy (d-values) and how the codon translation accuracy is reduced by the actions of Mg(2+) ions and the presence of error inducing aminoglycoside antibiotics. We demonstrate that complete freezing-in of cognate-like tautomeric states of ribosome-bound nucleotide bases in transfer RNA or messenger RNA is not compatible with recent experiments on initial codon selection by transfer RNA in ternary complex with elongation factor Tu and GTP. From these considerations, we suggest that the sets of 30S subunit structures from the Ramakrishnan group and 70S structures from the Yusupov/Yusupova group may, after all, reflect two sides of the same coin and how the structurally based intermezzo at the Ribosome Club may be resolved simply by taking the dynamic aspects of ribosome function into account.This article is part of the themed issue 'Perspectives on the ribosome'.

  19. Structural insights into the assembly of the 30S ribosomal subunit in vivo: functional role of S5 and location of the 17S rRNA precursor sequence.

    Science.gov (United States)

    Yang, Zhixiu; Guo, Qiang; Goto, Simon; Chen, Yuling; Li, Ningning; Yan, Kaige; Zhang, Yixiao; Muto, Akira; Deng, Haiteng; Himeno, Hyouta; Lei, Jianlin; Gao, Ning

    2014-05-01

    The in vivo assembly of ribosomal subunits is a highly complex process, with a tight coordination between protein assembly and rRNA maturation events, such as folding and processing of rRNA precursors, as well as modifications of selected bases. In the cell, a large number of factors are required to ensure the efficiency and fidelity of subunit production. Here we characterize the immature 30S subunits accumulated in a factor-null Escherichia coli strain (∆rsgA∆rbfA). The immature 30S subunits isolated with varying salt concentrations in the buffer system show interesting differences on both protein composition and structure. Specifically, intermediates derived under the two contrasting salt conditions (high and low) likely reflect two distinctive assembly stages, the relatively early and late stages of the 3' domain assembly, respectively. Detailed structural analysis demonstrates a mechanistic coupling between the maturation of the 5' end of the 17S rRNA and the assembly of the 30S head domain, and attributes a unique role of S5 in coordinating these two events. Furthermore, our structural results likely reveal the location of the unprocessed terminal sequences of the 17S rRNA, and suggest that the maturation events of the 17S rRNA could be employed as quality control mechanisms on subunit production and protein translation.

  20. The ribosomal genes of Mycoplasma capricolum.

    Science.gov (United States)

    Muto, A; Hori, H; Sawada, M; Kawauchi, Y; Iwami, M; Yamao, F; Osawa, S

    1983-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the gene arrangement is in the order of 16S, 23S, and 5S rDNA. The ribosomes of M. capricolum contain about 30 species of proteins in 50S and 20 in 30S subunits. The number and size of the ribosomal proteins are not significantly different from those of other eubacterial ribosomes.

  1. Ribosome recycling: An essential process of protein synthesis.

    Science.gov (United States)

    Kiel, Michael C; Kaji, Hideko; Kaji, Akira

    2007-01-01

    A preponderance of textbooks outlines cellular protein synthesis (translation) in three basic steps: initiation, elongation, and termination. However, researchers in the field of translation accept that a vital fourth step exists; this fourth step is called ribosome recycling. Ribosome recycling occurs after the nascent polypeptide has been released during the termination step. Despite the release of the polypeptide, ribosomes remain bound to the mRNA and tRNA. It is only during the fourth step of translation that ribosomes are ultimately released from the mRNA, split into subunits, and are free to bind new mRNA, thus the term "ribosome recycling." This step is essential to the viability of cells. In bacteria, it is catalyzed by two proteins, elongation factor G and ribosome recycling factor, a near perfect structural mimic of tRNA. Eukaryotic organelles such as mitochondria and chloroplasts possess ribosome recycling factor and elongation factor G homologues, but the nature of ribosome recycling in eukaryotic cytoplasm is still under investigation. In this review, the discovery of ribosome recycling and the basic mechanisms involved are discussed so that textbook writers and teachers can include this vital step, which is just as important as the three conventional steps, in sections dealing with protein synthesis.

  2. Germ cell specification and regeneration in planarians.

    Science.gov (United States)

    Newmark, P A; Wang, Y; Chong, T

    2008-01-01

    In metazoans, two apparently distinct mechanisms specify germ cell fate: Determinate specification (observed in animals including Drosophila, Caenorhabditis elegans, zebra fish, and Xenopus) uses cytoplasmic factors localized to specific regions of the egg, whereas epigenetic specification (observed in many basal metazoans, urodeles, and mammals) involves inductive interactions between cells. Much of our understanding of germ cell specification has emerged from studies of model organisms displaying determinate specification. In contrast, our understanding of epigenetic/inductive specification is less advanced and would benefit from studies of additional organisms. Freshwater planarians--widely known for their remarkable powers of regeneration--are well suited for studying the mechanisms by which germ cells can be induced. Classic experiments showed that planarians can regenerate germ cells from body fragments entirely lacking reproductive structures, suggesting that planarian germ cells could be specified by inductive signals. Furthermore, the availability of the genome sequence of the planarian Schmidtea mediterranea, coupled with the animal's susceptibility to systemic RNA interference (RNAi), facilitates functional genomic analyses of germ cell development and regeneration. Here, we describe recent progress in studies of planarian germ cells and frame some of the critical unresolved questions for future work.

  3. Structural and functional topography of the human ribosome

    Institute of Scientific and Technical Information of China (English)

    Dmitri Graifer; Galina Karpova

    2012-01-01

    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  4. Modulation of Decoding Fidelity by Ribosomal Proteins S4 and S5

    OpenAIRE

    2014-01-01

    Ribosomal proteins S4 and S5 participate in the decoding and assembly processes on the ribosome and the interaction with specific antibiotic inhibitors of translation. Many of the characterized mutations affecting these proteins decrease the accuracy of translation, leading to a ribosomal-ambiguity phenotype. Structural analyses of ribosomal complexes indicate that the tRNA selection pathway involves a transition between the closed and open conformations of the 30S ribosomal subunit and requi...

  5. Silencing of hepatitis C virus replication by a non-viral vector based on solid lipid nanoparticles containing a shRNA targeted to the internal ribosome entry site (IRES).

    Science.gov (United States)

    Torrecilla, Josune; Del Pozo-Rodríguez, Ana; Solinís, María Ángeles; Apaolaza, Paola S; Berzal-Herranz, Beatriz; Romero-López, Cristina; Berzal-Herranz, Alfredo; Rodríguez-Gascón, Alicia

    2016-10-01

    Gene silencing mediated by RNAi has gained increasing interest as an alternative for the treatment of infectious diseases such as refractory hepatitis C virus (HCV) infection. In this work we have designed and evaluated a non-viral vector based on solid lipid nanoparticles (SLN) bearing hyaluronic acid, protamine and a short hairpin RNA (shRNA74) targeted to the Internal Ribosome Entry Site (IRES) of the HCV. The vector was able to inhibit the expression of the HCV IRES in Huh-7 cells, with the inhibition level dependent on the shRNA74 to SLN ratio and on the shRNA74 dose added to the culture cells. The nanocarrier was also able to inhibit the replication in human hepatoma cells supporting a subgenomic HCV replicon (Huh-7 NS3-3'). The vector was quickly and efficiently internalized by the cells, and endocytosis was the most productive uptake mechanism for silencing. Clathrin-mediated endocytosis and to a lesser extent caveolae/lipid raft-mediated endocytosis were identified as endocytic mechanisms involved in the cell uptake. Internalization via the CD44 receptor was also involved, although this entry route seems to be less productive for silencing than endocytosis. The vector did not induce either hemolysis or agglutination of red cells in vitro, which was indicative of good biocompatibility. In summary, we have shown for the first time the ability of a non-viral SLN-based vector to silence a HCV replicon.

  6. The inhibition of mouse L-cell 45 S ribosomal RNA processing is a highly uv-resistant property of vesicular stomatitis virus

    Energy Technology Data Exchange (ETDEWEB)

    Zan, M.; Evans, P.; Lucas-Lenard, J. (Univ. of Connecticut, Storrs (USA))

    1990-07-01

    In mouse L cells infected with vesicular stomatitis virus (VSV), the synthesis of 45 S rRNA and its conversion to 28 S and 18 S rRNA are inhibited during the course of infection. Evidence is presented that the lack of accumulation of stable rRNA species results not only from the decreased transcription and processing of 45 S rRNA, but also from an increased breakdown of pre-rRNA or stable rRNA during processing. In cells prelabeled with (3H)uridine and then infected, the 28 S and 18 S rRNA species remain unaffected. Studies using uv-irradiated VSV indicate that the viral function involved in rRNA synthesis inhibition is slightly more sensitive to uv irradiation than the function involved in processing inhibition. These results suggest that the VSV functions involved in 45 S rRNA synthesis and processing inhibition may be related, or overlapping, but not identical. In cells infected by VSV mutant T1026R1, total RNA synthesis is inhibited, but the distribution of precursor and stable rRNA species remains nearly normal for up to 5 hr after infection. The function of the mutant virus involved in the inhibition of rRNA processing appears to be defective. In mengovirus-infected L cells, 45 S rRNA synthesis, but not processing, is severely inhibited soon after infection, indicating that a decrease in rRNA transcription is not necessarily accompanied by a decrease in processing.

  7. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding

    CERN Document Server

    Sharma, Ajeet K

    2010-01-01

    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid subunits of the protein is dictated by the sequence of codons (triplets of nucleotide subunits) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechano-chemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is defined as the time of dwell of the ribosome at the corresponding codon. We present an analytical calculation of the distribution of the dwell times of a ribosome in our model. Our theoretical prediction is consistent with the experimental results reported in the literature.

  8. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    Koji Tamura

    2011-12-01

    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  9. Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

    Directory of Open Access Journals (Sweden)

    Ulrich Andergassen

    2013-01-01

    Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

  10. QUANTITATIVE FLUORESCENCE IN-SITU HYBRIDIZATION OF BIFIDOBACTERIUM SPP WITH GENUS-SPECIFIC 16S RIBOSOMAL-RNA-TARGETED PROBES AND ITS APPLICATION IN FECAL SAMPLES

    NARCIS (Netherlands)

    LANGENDIJK, PS; SCHUT, F; JANSEN, GJ; RAANGS, GC; KAMPHUIS, GR; WILKINSON, MHF; WELLING, GW

    1995-01-01

    Three 16S rRNA hybridization probes were developed and tested for genus-specific detection of Bifidobacterium species in the human fecal flora. Variable regions V2, V4, and VS of the 16S rRNA contained sequences unique to this genus and proved applicable as target sites for oligodeoxynucleotide prob

  11. Chaos and Hyperchaos in a Model of Ribosome Autocatalytic Synthesis

    OpenAIRE

    Likhoshvai, Vitaly A.; Vladislav V. Kogai; Fadeev, Stanislav I.; Khlebodarova, Tamara M.

    2016-01-01

    Any vital activities of the cell are based on the ribosomes, which not only provide the basic machinery for the synthesis of all proteins necessary for cell functioning during growth and division, but for biogenesis itself. From this point of view, ribosomes are self-replicating and autocatalytic structures. In current work we present an elementary model in which the autocatalytic synthesis of ribosomal RNA and proteins, as well as enzymes ensuring their degradation are described with two mon...

  12. 'Candidatus Phytoplasma pruni', a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal protein genes.

    Science.gov (United States)

    Davis, Robert E; Zhao, Yan; Dally, Ellen L; Lee, Ing-Ming; Jomantiene, Rasa; Douglas, Sharon M

    2013-02-01

    X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rRNA gene RFLP group 16SrIII, subgroup A. Phylogenetic analyses of 16S rRNA gene sequences revealed that the X-disease phytoplasma strains formed a distinct subclade within the phytoplasma clade, supporting the hypothesis that they represented a lineage distinct from those of previously described 'Candidatus Phytoplasma' species. Nucleotide sequence alignments revealed that all studied X-disease phytoplasma strains shared less than 97.5 % 16S rRNA gene sequence similarity with previously described 'Candidatus Phytoplasma' species. Based on unique properties of the DNA, we propose recognition of X-disease phytoplasma strain PX11CT1(R) as representative of a novel taxon, 'Candidatus Phytoplasma pruni'. Results from nucleotide and phylogenetic analyses of secY and ribosomal protein (rp) gene sequences provided additional molecular markers of the 'Ca. Phytoplasma pruni' lineage. We propose that the term 'Ca. Phytoplasma pruni' be applied to phytoplasma strains whose 16S rRNA gene sequences contain the oligonucleotide sequences of unique regions that are designated in the formally published description of the taxon. Such strains include X-disease phytoplasma and--within the tolerance of a single base difference in one unique sequence--peach rosette, peach red suture, and little peach phytoplasmas. Although not employed for taxon delineation in this work, we further propose that secY, rp, and other genetic loci from the reference strain of a taxon, and where possible oligonucleotide sequences of unique regions of those genes that distinguish taxa within a given 16Sr group, be incorporated in emended descriptions and as part of future descriptions of 'Candidatus Phytoplasma' taxa.

  13. The circadian clock coordinates ribosome biogenesis.

    Directory of Open Access Journals (Sweden)

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  14. Mescaline-induced changes of brain-cortex ribosomes. Effect of mescaline on the hydrogen-bonded structure of ribonucleic acid of brain-cortex ribosomes.

    Science.gov (United States)

    Datta, R K; Ghosh, J J

    1970-05-01

    1. The action of mescaline sulphate on the hydrogen-bonded structure of the RNA constituent of ribosomes of goat brain-cortex slices was studied by using the hyperchromic effect of heating and formaldehyde reaction. 2. The ribosomal total RNA species of the mescaline-treated brain-cortex slices have a smaller proportion of hydrogen-bonded structure than the ribosomal RNA species of the untreated brain-cortex slices. 3. Mescaline also appears to have affected this lowering of hydrogen-bonded structure of the ribosomal 28S RNA of brain-cortex tissue.

  15. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    Science.gov (United States)

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  16. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA

    Indian Academy of Sciences (India)

    Ankita Srivastava; Alok Bhattacharya; Sudha Bhattacharya; Gagan Deep Jhingan

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  17. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    Science.gov (United States)

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

  18. RNA granules

    OpenAIRE

    Anderson, Paul; Kedersha, Nancy

    2006-01-01

    Cytoplasmic RNA granules in germ cells (polar and germinal granules), somatic cells (stress granules and processing bodies), and neurons (neuronal granules) have emerged as important players in the posttranscriptional regulation of gene expression. RNA granules contain various ribosomal subunits, translation factors, decay enzymes, helicases, scaffold proteins, and RNA-binding proteins, and they control the localization, stability, and translation of their RNA cargo. We review the relationshi...

  19. Perspectives and Insights into the Competition for Aminoacyl-tRNAs between the Translational Machinery and for tRNA Dependent Non-Ribosomal Peptide Bond Formation

    Directory of Open Access Journals (Sweden)

    Angela W. S. Fung

    2015-12-01

    Full Text Available Aminoacyl-tRNA protein transferases catalyze the transfer of amino acids from aminoacyl-tRNAs to polypeptide substrates. Different forms of these enzymes are found in the different kingdoms of life and have been identified to be central to a wide variety of cellular processes. L/F-transferase is the sole member of this class of enzyme found in Escherichia coli and catalyzes the transfer of leucine to the N-termini of proteins which result in the targeted degradation of the modified protein. Recent investigations on the tRNA specificity of L/F-transferase have revealed the unique recognition nucleotides for a preferred Leu-tRNALeu isoacceptor substrate. In addition to discussing this tRNA selectivity by L/F-transferase, we present and discuss a hypothesis and its implications regarding the apparent competition for this aminoacyl-tRNA between L/F-transferase and the translational machinery. Our discussion reveals a hypothetical involvement of the bacterial stringent response that occurs upon amino acid limitation as a potential cellular event that may reduce this competition and provide the opportunity for L/F-transferase to readily increase its access to the pool of aminoacylated tRNA substrates.

  20. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  1. pH-sensitivity of the ribosomal peptidyl transfer reaction dependent on the identity of the A-site aminoacyl-tRNA

    Science.gov (United States)

    Johansson, Magnus; Ieong, Ka-Weng; Trobro, Stefan; Strazewski, Peter; Åqvist, Johan; Pavlov, Michael Y.; Ehrenberg, Måns

    2011-01-01

    We studied the pH-dependence of ribosome catalyzed peptidyl transfer from fMet-tRNAfMet to the aa-tRNAs Phe-tRNAPhe, Ala-tRNAAla, Gly-tRNAGly, Pro-tRNAPro, Asn-tRNAAsn, and Ile-tRNAIle, selected to cover a large range of intrinsic pKa-values for the α-amino group of their amino acids. The peptidyl transfer rates were different at pH 7.5 and displayed different pH-dependence, quantified as the pH-value, , at which the rate was half maximal. The -values were downshifted relative to the intrinsic pKa-value of aa-tRNAs in bulk solution. Gly-tRNAGly had the smallest downshift, while Ile-tRNAIle and Ala-tRNAAla had the largest downshifts. These downshifts correlate strongly with molecular dynamics (MD) estimates of the downshifts in pKa-values of these aa-tRNAs upon A-site binding. Our data show the chemistry of peptide bond formation to be rate limiting for peptidyl transfer at pH 7.5 in the Gly and Pro cases and indicate rate limiting chemistry for all six aa-tRNAs. PMID:21169502

  2. Chemotherapeutic drugs inhibit ribosome biogenesis at various levels.

    Science.gov (United States)

    Burger, Kaspar; Mühl, Bastian; Harasim, Thomas; Rohrmoser, Michaela; Malamoussi, Anastassia; Orban, Mathias; Kellner, Markus; Gruber-Eber, Anita; Kremmer, Elisabeth; Hölzel, Michael; Eick, Dirk

    2010-04-16

    Drugs for cancer therapy belong to different categories of chemical substances. The cellular targets for the therapeutic efficacy are often not unambiguously identified. Here, we describe the process of ribosome biogenesis as a target of a large variety of chemotherapeutic drugs. We determined the inhibitory concentration of 36 chemotherapeutic drugs for transcription and processing of ribosomal RNA by in vivo labeling experiments. Inhibitory drug concentrations were correlated to the loss of nucleolar integrity. The synergism of drugs inhibiting ribosomal RNA synthesis at different levels was studied. Drugs inhibited ribosomal RNA synthesis either at the level of (i) rRNA transcription (e.g. oxaliplatin, doxorubicin, mitoxantrone, methotrexate), (ii) early rRNA processing (e.g. camptothecin, flavopiridol, roscovitine), or (iii) late rRNA processing (e.g. 5-fluorouracil, MG-132, homoharringtonine). Blockage of rRNA transcription or early rRNA processing steps caused nucleolar disintegration, whereas blockage of late rRNA processing steps left the nucleolus intact. Flavopiridol and 5-fluorouracil showed a strong synergism for inhibition of rRNA processing. We conclude that inhibition of ribosome biogenesis by chemotherapeutic drugs potentially may contribute to the efficacy of therapeutic regimens.

  3. Partial base-methylation and other structural differences in the 17 S ribosomal RNA of sycamore cells during growth in cell culture.

    Science.gov (United States)

    Miassod, R; Cecchini, J P

    1979-04-26

    Sycamore (Acer pseudoplatanus L.) cytoplasmic rRNA was investigated in rapidly dividing cells, cells starting mitosis after the lag phase of growth (4 days) induced by deconditioning of the culture medium and also in growth-arrested cells from 10 day-old cultures deprived of exogenous auxin (i.e. exponential, early exponential and 2,4-dichlorophenoxyacetic acid (2,4-D)-deprived cultures). rRNA was extracted and purified from mixed 14C-labelled exponential cultures and 3H-labelled early exponential cultures. A 14C-labelled exponential culture and a 3H-labelled 2,4-D-deprived culture were analyzed in the same way. The 17 S rRNA molecules from both early exponential and 2,4-D-deprived cultures displayed a lower electrophoretic mobility on polyacrylamide gels than those from exponential cultures. Alkaline and acid hydrolysates of purified 17 S rRNA labelled on the phosphate groups or the methyl groups were analyzed on ion-exchange resins. There was no change in the extent of ribose methylation of the molecule from the three different cultures. However, the base methylation of the 17 S rRNA was decreased in early exponential cultures and in 2,4-D-deprived cultures. Part of the molecules synthesized in early exponential cultures specifically lacked 7-methylguanine, N6-methyladenine and N6,N6-dimethyladenine. The possible significance of these changes in the 17 S rRNA were discussed.

  4. Structure of a protein L23-RNA complex located at the A-site domain of the ribosomal peptidyl transferase centre

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1984-01-01

    -strand-specific ribonucleases; a secondary structural model and a tertiary structural interaction are proposed on the basis of these data that are compatible with phylogenetic sequence comparisons. Several nucleotides exhibited altered chemical reactivity, both lower and higher, in the presence of protein L23, thereby...... and sequencing the RNA binding site of protein L23; it consists of two main fragments of 25 and 105 nucleotides that strongly interact and are separated by 172 nucleotides in the primary sequence. The higher-order structure of the RNA moiety was probed by chemical reagents, and by single-strand and double...

  5. Hypoxia-inducible Factor-1α mRNA Contains an Internal Ribosome Entry Site That Allows Efficient Translation during Normoxia and Hypoxia

    OpenAIRE

    Lang, Kenneth J. D.; Kappel, Andreas; Gregory J. Goodall

    2002-01-01

    HIF-1α is the regulated subunit of the HIF-1 transcription factor, which induces transcription of a number of genes involved in the cellular response to hypoxia. The HIF-1α protein is rapidly degraded in cells supplied with adequate oxygen but is stabilized in hypoxic cells. Using polysome profile analysis, we found that translation of HIF-1α mRNA in NIH3T3 cells is spared the general reduction in translation rate that occurs during hypoxia. To assess whether the 5′UTR of the HIF-1α mRNA cont...

  6. Antimicrobial susceptibility and Ribosomal-RNA gene restriction patterns among Staphylococcus-intermedius from healthy dogs and from dogs sufferning from pyoderma or otitis-externa

    DEFF Research Database (Denmark)

    Pedersen, Karl; Wegener, Henrik Caspar

    1995-01-01

    A total of 60 Staphlococcus intermedius strains from dogs were investigated by their sensitivity to various antibiotics (50 strains) and by their rRNA gene restriction patterns (ribotyping) (60 strains). Fifteen isolates were from healthy dogs, 9 with otitis externa, and 36 with pyoderma, includi...

  7. Ribosomal RNA and nucleolar proteins from the oocyte are to some degree used for embryonic nucleolar formation in cattle and pig

    DEFF Research Database (Denmark)

    Maddox-Hyttel, Poul; Svarcova, Olga; Laurincik, Josef

    2007-01-01

    I and upstream binding factor) and early (fibrillarin) or late rRNA processing (nucleolin and nucleophosmin) localize to it. At the end of the oocyte growth phase, the nucleolus is inactivated again and transforms into a solid remnant. The nucleolar remnant is dissolved when meiosis is resumed. Upon...

  8. Phosphorylation of ribosomal proteins influences subunit association and translation of poly (U) in Streptomyces coelicolor.

    Science.gov (United States)

    Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvie

    2011-03-01

    The occurrence of phosphorylated proteins in ribosomes of Streptomyces coelicolor was investigated. Little is known about which biological functions these posttranslational modifications might fulfil. A protein kinase associated with ribosomes phosphorylated six ribosomal proteins of the small subunit (S3, S4, S12, S13, S14 and S18) and seven ribosomal proteins of the large subunit (L2, L3, L7/L12, L16, L17, L23 and L27). The ribosomal proteins were phosphorylated mainly on the Ser/Thr residues. Phosphorylation of the ribosomal proteins influences ribosomal subunits association. Ribosomes with phosphorylated proteins were used to examine poly (U) translation activity. Phosphorylation induced about 50% decrease in polyphenylalanine synthesis. After preincubation of ribosomes with alkaline phosphatase the activity of ribosomes was greatly restored. Small differences were observed between phosphorylated and unphosphorylated ribosomes in the kinetic parameters of the binding of Phe-tRNA to the A-site of poly (U) programmed ribosomes, suggesting that the initial binding of Phe-tRNA is not significantly affected by phosphorylation. On contrary, the rate of peptidyl transferase was about two-fold lower than that in unphosphorylated ribosomes. The data presented demonstrate that phosphorylation of ribosomal proteins affects critical steps of protein synthesis.

  9. A molecular orbital study of a model of the Mg2+ coordination complex of the self splicing reaction of ribosomal RNA

    Science.gov (United States)

    McCourt, M.; Shibata, M.; McIver, J. W.; Rein, R.

    1988-01-01

    Recent discoveries have established the fact that RNA is capable of acting as an enzyme. In this study two different types of molecular orbital calculations, INDO and ab initio, were used in an attempt to assess the structural/functional role of the Mg2+ hydrated complex in ribozyme reactions. Preliminary studies indicate that the reaction is multistep and that the Mg2+ complex exerts a stabilizing effect on the intermediate or midpoint of the reaction.

  10. 细菌16 S核糖体RNA基因检测杰氏棒状杆菌一株%Identification of corynebacterium jeikeium by detection of bacterial 16s ribosomal RNA gene

    Institute of Scientific and Technical Information of China (English)

    崔颖鹏; 黄朱亮

    2015-01-01

    Objective To detect clinical strain by amplifying 16S ribosomal RNA( 16S rRNA) gene with polymerase chain reaction ( PCR) method. Methods 16S rRNA gene was amplifyied by universal primers P1,P2 with polymerase chain reaction,and the polymerase chain reaction products were sequenced to achieve the DNA sequences. Results PCR products were about 1 465bp, and the PCR sequences were blasted in NCBI web to achieve the proper strain name,with the use of this method,the unkown gram⁃positive bacilli strain was identified as corynebacterium jeikeium strain, ATCC25923 was identified as a strain of staphylococcus aureus and negative control was also specific.Conclusion 16S rRNA gene detection can be used as strain identification,and especially for some less common clinical strains.%目的:探讨通过16S核糖体RNA(16S rRNA )基因测序的方法用于临床菌株鉴定。方法以细菌16S rRNA基因为靶序列,采用细菌的通用引物P1、P2进行PCR扩增,同时送到测序公司测序从而达到鉴定。结果待测菌株及ATCC25923阳性对照通过PCR得到的扩增片段为1465bp左右,待测菌株经测序比对鉴定为一株杰氏棒状杆菌,阳性质控ATCC25923鉴定为一株金黄的葡萄球菌,阴性对照未出现任何结果。结论通过PCR检测细菌16srRNA基因可以应用于临床菌株的鉴定,并且适用一些难以鉴定的细菌。

  11. 16s rRNA的保守字和进化树重建%Conserved Words in 16s Ribosomal RNA Deduced from Evolutionary Tree Reconstruction

    Institute of Scientific and Technical Information of China (English)

    罗辽复; 贾孟文

    2002-01-01

    Evolutionary distance is defined by oligonucleotide (n-bases) frequency difference of two sequences.Phylogenetic tree is reconstructed using a set of 16S (18S) rRNA sequences and the definition of distance.The quality of trees generally improves with increasing n and reaches a plateau of best fit at n=7 or 8.So,the 7-mer or 8-mer frequencies provides a basis to describe rRNA evolution.Then,a group of 7-mers are deduced which are correlate well with evolution.Evolution-related conservative words longer than 7 bases for Bacteria and Archaea in 16S rRNA sequences have been found.They are highly conserved in nearly all species of a kingdom (or a sub-kingdom) and are located on nearly same sites of sequences. The structural meaning of these conservative words is discussed briefly.%据寡核苷(n核苷)频数差定义进化距离,由此构成16s rRNA进化树,当n=7,8时和实验资料符合很好,在寻找出全部进化相关的7-核苷的基础上,本文进一步求得了长度大于7的保守字,它们在一个界别中的诸物种中高度保守,并出现于核糖体序列的基本相同的位置上,这些保守字对于核糖体的早期进化至关重要.

  12. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes.

  13. Molecular mimicry between Mycobacterium leprae proteins (50S ribosomal protein L2 and Lysyl-tRNA synthetase) and myelin basic protein: a possible mechanism of nerve damage in leprosy.

    Science.gov (United States)

    Singh, Itu; Yadav, Asha Ram; Mohanty, Keshar Kunja; Katoch, Kiran; Sharma, Prashant; Mishra, Bishal; Bisht, Deepa; Gupta, U D; Sengupta, Utpal

    2015-04-01

    Autoantibodies against various components of host are known to occur in leprosy. Nerve damage is the primary cause of disability associated with leprosy. The aim of this study was to detect the level of autoantibodies and lympho-proliferative response against myelin basic protein (MBP) in leprosy patients (LPs) and their correlation with clinical phenotypes of LPs. Further, probable role of molecular mimicry in nerve damage of LPs was investigated. We observed significantly high level of anti-MBP antibodies in LPs across the spectrum and a positive significant correlation between the level of anti-MBP antibodies and the number of nerves involved in LPs. We report here that 4 B cell epitopes of myelin A1 and Mycobacterium leprae proteins, 50S ribosomal L2 and lysyl tRNA synthetase are cross-reactive. Further, M. leprae sonicated antigen hyperimmunization was responsible for induction of autoantibody response in mice which could be adoptively transferred to naive mice. For the first time our findings suggest the role of molecular mimicry in nerve damage in leprosy.

  14. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera employing ribosomal (28S rRNA and mitochondrial (cox1, nad1 gene sequence data.

    Directory of Open Access Journals (Sweden)

    Niamh E Redmond

    Full Text Available The systematics of the poriferan Order Haplosclerida (Class Demospongiae has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae, Amphimedon queenslandica (Family Niphatidae and Tabulocalyx (Family Phloeodictyidae, Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here.

  15. Phylogenetic relationships of the marine Haplosclerida (Phylum Porifera) employing ribosomal (28S rRNA) and mitochondrial (cox1, nad1) gene sequence data.

    Science.gov (United States)

    Redmond, Niamh E; Raleigh, Jean; van Soest, Rob W M; Kelly, Michelle; Travers, Simon A A; Bradshaw, Brian; Vartia, Salla; Stephens, Kelly M; McCormack, Grace P

    2011-01-01

    The systematics of the poriferan Order Haplosclerida (Class Demospongiae) has been under scrutiny for a number of years without resolution. Molecular data suggests that the order needs revision at all taxonomic levels. Here, we provide a comprehensive view of the phylogenetic relationships of the marine Haplosclerida using many species from across the order, and three gene regions. Gene trees generated using 28S rRNA, nad1 and cox1 gene data, under maximum likelihood and Bayesian approaches, are highly congruent and suggest the presence of four clades. Clade A is comprised primarily of species of Haliclona and Callyspongia, and clade B is comprised of H. simulans and H. vansoesti (Family Chalinidae), Amphimedon queenslandica (Family Niphatidae) and Tabulocalyx (Family Phloeodictyidae), Clade C is comprised primarily of members of the Families Petrosiidae and Niphatidae, while Clade D is comprised of Aka species. The polyphletic nature of the suborders, families and genera described in other studies is also found here.

  16. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    Science.gov (United States)

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome.

  17. Cdc42-mediated tubulogenesis controls cell specification

    DEFF Research Database (Denmark)

    Kesavan, Gokul; Sand, Fredrik Wolfhagen; Greiner, Thomas Uwe

    2009-01-01

    Understanding how cells polarize and coordinate tubulogenesis during organ formation is a central question in biology. Tubulogenesis often coincides with cell-lineage specification during organ development. Hence, an elementary question is whether these two processes are independently controlled......, or whether proper cell specification depends on formation of tubes. To address these fundamental questions, we have studied the functional role of Cdc42 in pancreatic tubulogenesis. We present evidence that Cdc42 is essential for tube formation, specifically for initiating microlumen formation and later...... for maintaining apical cell polarity. Finally, we show that Cdc42 controls cell specification non-cell-autonomously by providing the correct microenvironment for proper control of cell-fate choices of multipotent progenitors. For a video summary of this article, see the PaperFlick file with the Supplemental Data...

  18. Comparative analysis of codon usage bias in Crenarchaea and Euryarchaea genome reveals differential preference of synonymous codons to encode highly expressed ribosomal and RNA polymerase proteins

    Indian Academy of Sciences (India)

    VISHWA JYOTI BARUAH; SIDDHARTHA SANKAR SATAPATHY; BHESH RAJ POWDEL; ROCKTOTPAL KONWARH; ALAK KUMAR BURAGOHAIN; SUVENDRA KUMAR RAY

    2016-09-01

    The present study was undertaken to investigate the pattern of optimal codon usage in Archaea. Comparative analysis was executed to understand the pattern of codon usage bias between the high expression genes (HEG) and the whole genomes in two Archaeal phyla, Crenarchaea and Euryarchaea. The G+C% of the HEG was found to be less in comparison to the genome G+ C% in Crenarchaea, whereas reverse was the case in Euryarchaea. The preponderance of U/A ending codons that code for HEG in Crenarchaea was in sharp contrast to the C/G ended ones in Euryarchaea. The analysis revealed prevalence of U-ending codons even within the WWY (nucleotide ambiguity code) families in Crenarchaea vis-à-vis Euryarchaea, bacteria and Eukarya. No plausible interpretation of the observed disparity could be made either in the context of tRNA gene composition or genome G +C%. The results in this study attested that the preferential biasness for codons in HEG of Crenarchaea might be different from Euryarchaea. The main highlights are (i) varied CUB in the HEG and in the whole genomes in Euryarchaea and Crenarchaea. (ii) Crenarchaea was found to have some unusual optimal codons (OCs) compared to other organisms. (iii) G+ C% (and GC 3) of the HEG were different from the genome G + C% in the two phyla. (iv) Genome G + C% and tRNAgene number failed to explain CUB in Crenarchaea. (v) Translational selection is possibly responsible for A + T rich OCs in Crenarchaea.

  19. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Institute of Scientific and Technical Information of China (English)

    Inderdeep Kaur; R C Gupta; Munish Puri

    2011-01-01

    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  20. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    Science.gov (United States)

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  1. A comparison of two real-time polymerase chain reaction assays using hybridization probes targeting either 16S ribosomal RNA or a subsurface lipoprotein gene for detecting leptospires in canine urine.

    Science.gov (United States)

    Gentilini, Fabio; Zanoni, Renato Giulio; Zambon, Elisa; Turba, Maria Elena

    2015-11-01

    Leptospires are excreted in the urine of infected animals, and the prompt detection of leptospiral DNA using polymerase chain reaction (PCR) is increasingly being used. However, contradictory data has emerged concerning the diagnostic accuracy of the most popular PCR assays that target either the 16S ribosomal RNA (rrs) or the subsurface lipoprotein (LipL32) genes. In order to clarify the effect of the gene target, a novel hydrolysis probe-based, quantitative real-time PCR (qPCR) assay targeting the LipL32 gene was developed, validated, and then compared directly to the previously described rrs hydrolysis probe-based qPCR using a convenience collection of canine urine samples. The novel LipL32 qPCR assay was linear from 5.9 × 10(6) to 59 genome equivalents per reaction. Both the LipL32 and the rrs qPCR assays showed a limit of detection of 10 target copies per reaction indicating an approximately equivalent analytical sensitivity. Both assays amplified all 20 pathogenic leptospiral strains tested but did not amplify a representative collection of bacteria commonly found in voided canine urine. When the field samples were assayed, 1 and 5 out of 184 samples yielded an amplification signal in the LipL32 and rrs assays, respectively. Nevertheless, when the limit of detection was considered as the cutoff for interpreting findings, the 4 discordant cases were judged as negative. In conclusion, our study confirmed that both LipL32 and rrs are suitable targets for qPCR for the detection of leptospiral DNA in canine urine. However, the rrs target requires the mandatory use of a cutoff value in order to correctly interpret spurious amplifications.

  2. Epidemiology of sporadic (non-epidemic) cases of Trichophyton tonsurans infection in Japan based on PCR-RFLP analysis of non-transcribed spacer region of ribosomal RNA gene.

    Science.gov (United States)

    Mochizuki, Takashi; Kawasaki, Masako; Anzawa, Kazushi; Fujita, Jun; Ushigami, Tsuyoshi; Takeda, Kiminobu; Sano, Ayako; Takahashi, Yoko; Kamei, Katsuhiko

    2008-05-01

    A number of cases of Trichophyton tonsurans infection have been reported among sportsmen and women participating in wrestling, judo, and sumo wrestling in Japan, but there have also been sporadic reports of cases with no history of contact with these sports. A molecular method using restriction enzyme analysis of PCR-amplified fragments targeting the non-transcribed spacer region (NTS) of ribosomal RNA gene in fungal nuclei was applied to T. tonsurans strains isolated from sporadic cases in Japan. Five of 6 molecular types recorded in Japan, i.e., NTS types I, II, IV, V, and VI, and two new types, designated NTS VII and NTS VIII, were observed among 10 strains isolated from sporadic cases. The NTS IV strains, considered not to be related to the present epidemic, were found to be the most prevalent molecular type accounting for 4 of the 10 strains isolated. NTS I was the most prevalent type in the current epidemic in Japan, but it was cultured from only one patient who was later noted to be the daughter of a retired judo practitioner. Four subjects had histories of living abroad and were considered to have been infected outside Japan. The strains in these cases were NTS II, V, VI, and VII. The results of this study suggested that the NTS IV strains were originally present in Japan at a low incidence, but that there has been a recent influx of NTS I, II, V, VI, and VII from abroad, which has been accompanied by the secondary spread of strains from wrestlers and practitioners of martial arts to the general community.

  3. A functional interaction between ribosomal proteins S7 and S11 within the bacterial ribosome.

    Science.gov (United States)

    Robert, Francis; Brakier-Gingras, Léa

    2003-11-01

    In this study, we used site-directed mutagenesis to disrupt an interaction that had been detected between ribosomal proteins S7 and S11 in the crystal structure of the bacterial 30 S subunit. This interaction, which is located in the E site, connects the head of the 30 S subunit to the platform and is involved in the formation of the exit channel through which passes the 30 S-bound messenger RNA. Neither mutations in S7 nor mutations in S11 prevented the incorporation of the proteins into the 30 S subunits but they perturbed the function of the ribosome. In vivo assays showed that ribosomes with either mutated S7 or S11 were altered in the control of translational fidelity, having an increased capacity for frameshifting, readthrough of a nonsense codon and codon misreading. Toeprinting and filter-binding assays showed that 30 S subunits with either mutated S7 or S11 have an enhanced capacity to bind mRNA. The effects of the S7 and S11 mutations can be related to an increased flexibility of the head of the 30 S, to an opening of the mRNA exit channel and to a perturbation of the proposed allosteric coupling between the A and E sites. Altogether, our results demonstrate that S7 and S11 interact in a functional manner and support the notion that protein-protein interactions contribute to the dynamics of the ribosome.

  4. Effects of magnesium ions on ribosomes: a fluorescence study.

    Science.gov (United States)

    Bonincontro, A; Briganti, G; Giansanti, A; Pedone, F; Risuleo, G

    1993-07-18

    Fluorescence intensity measurements of ethidium bromide (EB) bound to ribosomal RNA (rRNA) in suspensions of 30S and 50S subunits, of 70S ribosomal particles and of protein-free extracted rRNA are presented. Changes in the intercalation of EB reflect changes in conformation and degree of exposure of rRNA. The effect of removal of magnesium ions on the binding of EB is compared in protein-free rRNA and in ribosomal particles by a Scatchard plot analysis. In free ribosomal RNA the number of bound EBs do not depend on magnesium content, only the association constant is affected. In intact 70S particles and both in the separated 50S and 30S subunits the presence of magnesium greatly reduces binding of EB and no saturation of the fluorescence intensity with rRNA concentration is observed, preventing a Scatchard plot analysis. Removal of magnesium restores a strong EB intercalation. Then magnesium ions induce a conformational change in the 70S particles as well as in the separated subunits. The different behavior of the free-rRNA and of the ribosomal particles indicates that ribosomal proteins are relevant to the structural changes induced by magnesium ions. The comparison of the number of excluded sites and of the association constant in the 30S, 50S subunits and in the 70S particles indicates that even without Mg2+ ions the two subunits still interact, at variance with the commonly shared opinion that subunits dissociation takes place at low magnesium concentration.

  5. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC

    2013-11-12

    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  6. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  7. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  8. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  9. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    CERN Document Server

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  10. Mitochondrial ribosome assembly in health and disease.

    Science.gov (United States)

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health.

  11. The fail-safe system to rescue the stalled ribosomes in Escherichia coli.

    Science.gov (United States)

    Abo, Tatsuhiko; Chadani, Yuhei

    2014-01-01

    Translation terminates at stop codon. Without stop codon, ribosome cannot terminate translation properly and reaches and stalls at the 3'-end of the mRNA lacking stop codon. Bacterial tmRNA-mediated trans-translation releases such stalled ribosome and targets the protein product to degradation by adding specific "degradation tag." Recently two alternative ribosome rescue factors, ArfA (YhdL) and ArfB (YaeJ), have been found in Escherichia coli. These three ribosome rescue systems are different each other in terms of molecular mechanism of ribosome rescue and their activity, but they are mutually related and co-operate to maintain the translation system in shape. This suggests the biological significance of ribosome rescue.

  12. The sequential addition of ribosomal proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.

    Science.gov (United States)

    Todorov, I T; Noll, F; Hadjiolov, A A

    1983-03-15

    Nucleolar '80-S' and '40-S' preribosomes (containing 45-S and 21-S pre-rRNA, respectively), as well as cytoplasmic ribosomes, were isolated from Friend erythroleukemia cells. The presence of structural ribosomal proteins in the isolated particles was studied by using antisera against individual rat liver small ribosomal subunit proteins. The analysis is based on the established crossreactivity between rat and mouse ribosomes [F. Noll and H. Bielka (1970) Mol. Gen. Genet. 106, 106-113]. The identification of the proteins was achieved by two independent immunological techniques: the passive haemagglutination test and the enzyme immunoassay of electrophoretically fractionated proteins, blotted on nitrocellulose. All 17 proteins tested are present in cytoplasmic ribosomes. A large number of proteins (S3a, S6, S7, S8, S11, S14, S18, S20, S23/24 and S25) are present in the '80-S' preribosome. Only two proteins (S3 and S21) are added during the formation of the '40-S' preribosome in the nucleolus. Four proteins (S2, S19, S26 and S29) are added at later, possibly extranucleolar, stages of ribosome formation. The results obtained provide evidence for the sequential addition of proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.

  13. Cell-specific modulation of surfactant proteins by ambroxol treatment.

    Science.gov (United States)

    Seifart, Carola; Clostermann, Ursula; Seifart, Ulf; Müller, Bernd; Vogelmeier, Claus; von Wichert, Peter; Fehrenbach, Heinz

    2005-02-15

    Ambroxol [trans-4-(2-amino-3,5-dibromobenzylamino)-cyclohexanole hydrochloride], a mucolytic agent, was postulated to provide surfactant stimulatory properties and was previously used to prevent surfactant deficiency. Currently, the underlying mechanisms are not exactly clear. Because surfactant homeostasis is regulated by surfactant-specific proteins (SP), we analyzed protein amount and mRNA expression in whole lung tissue, isolated type II pneumocytes and bronchoalveolar lavage of Sprague-Dawley rats treated with ambroxol i.p. (75 mg/kg body weight, twice a day [every 12 h]). The methods used included competitive polymerase chain reaction (RT-PCR), Northern blotting, Western immunoblotting, and immunohistochemistry. In isolated type II pneumocytes of ambroxol-treated animals, SP-C protein and mRNA content were increased, whereas SP-A, -B and -D protein, mRNA, and immunoreactivity remained unaffected. However, ambroxol treatment resulted in a significant increase of SP-B and in a decrease of SP-D in whole lung tissue with enhanced immunostaining for SP-B in Clara Cells. SP-A and SP-D were significantly decreased in BAL fluid of ambroxol-treated animals. The data suggest that surfactant protein expression is modulated in a cell-specific manner by ambroxol, as type II pneumocytes exhibited an increase in SP-C, whereas Clara cells exhibited an increase in the immunoreactivity for SP-B accounting for the increased SP-B content of whole lung tissue. The results indicate that ambroxol may exert its positive effects, observed in the treatment of diseases related to surfactant deficiency, via modulation of surfactant protein expression.

  14. Human Cells Require Non-stop Ribosome Rescue Activity in Mitochondria.

    Directory of Open Access Journals (Sweden)

    Heather A Feaga

    2016-03-01

    Full Text Available Bacteria use trans-translation and the alternative rescue factors ArfA (P36675 and ArfB (Q9A8Y3 to hydrolyze peptidyl-tRNA on ribosomes that stall near the 3' end of an mRNA during protein synthesis. The eukaryotic protein ICT1 (Q14197 is homologous to ArfB. In vitro ribosome rescue assays of human ICT1 and Caulobacter crescentus ArfB showed that these proteins have the same activity and substrate specificity. Both ArfB and ICT1 hydrolyze peptidyl-tRNA on nonstop ribosomes or ribosomes stalled with ≤6 nucleotides extending past the A site, but are unable to hydrolyze peptidyl-tRNA when the mRNA extends ≥14 nucleotides past the A site. ICT1 provided sufficient ribosome rescue activity to support viability in C. crescentus cells that lacked both trans-translation and ArfB. Likewise, expression of ArfB protected human cells from death when ICT1 was silenced with siRNA. These data indicate that ArfB and ICT1 are functionally interchangeable, and demonstrate that ICT1 is a ribosome rescue factor. Because ICT1 is essential in human cells, these results suggest that ribosome rescue activity in mitochondria is required in humans.

  15. Assembling the archaeal ribosome: roles for translation-factor-related GTPases

    NARCIS (Netherlands)

    Blombach, F.; Brouns, S.J.J.; Oost, van der J.

    2011-01-01

    The assembly of ribosomal subunits from their individual components (rRNA and ribosomal proteins) requires the assistance of a multitude of factors in order to control and increase the efficiency of the assembly process. GTPases of the TRAFAC (translation-factor-related) class constitute a major typ

  16. A Conserved Proline Switch on the Ribosome Facilitates the Recruitment and Binding of trGTPases

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    The process of protein synthesis in vivo is a highly complex and orderly system, which is dependent on the ribosome as factory, mRNA as a template, the amino acid as raw materials, the GTP for energy. Ri- bosomal protein synthesis is a continuous dynamics process, which involves not only the ribosome itself, but also involves the synergy of translation factors.

  17. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

    2009-01-01

    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a...

  18. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  19. Ligation-free ribosome profiling of cell type-specific translation in the brain.

    Science.gov (United States)

    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A

    2016-01-01

    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome profiling to mouse brain tissue to identify new patterns of cell type-specific translation and test its ability to identify translational targets of mTOR signaling in the brain.

  20. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  1. Fluorescently labeled ribosomes as a tool for analyzing antibiotic binding.

    Science.gov (United States)

    Llano-Sotelo, Beatriz; Hickerson, Robyn P; Lancaster, Laura; Noller, Harry F; Mankin, Alexander S

    2009-08-01

    Measuring the binding of antibiotics and other small-molecular-weight ligands to the 2.5 MDa ribosome often presents formidable challenges. Here, we describe a general method for studying binding of ligands to ribosomes that carry a site-specific fluorescent label covalently attached to one of the ribosomal proteins. As a proof of principle, an environment-sensitive fluorescent group was placed at several specific sites within the ribosomal protein S12. Small ribosomal subunits were reconstituted from native 16S rRNA, individually purified small subunit proteins, and fluorescently labeled S12. The fluorescence characteristics of the reconstituted subunits were affected by several antibiotics, including streptomycin and neomycin, which bind in the vicinity of protein S12. The equilibrium dissociation constants of the drugs obtained using a conventional fluorometer were in good agreement with those observed using previously published methods and with measurements based on the use of radiolabeled streptomycin. The newly developed method is rapid and sensitive, and can be used for determining thermodynamic and kinetic binding characteristics of antibiotics and other small ribosomal ligands. The method can readily be adapted for use in high-throughput screening assays.

  2. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  3. A model for the interaction of the G3-subdomain of Geobacillus stearothermophilus IF2 with the 30S ribosomal subunit

    NARCIS (Netherlands)

    Dongre, Ramachandra; Folkers, Gert E; Gualerzi, Claudio O; Boelens, Rolf; Wienk, Hans

    2016-01-01

    Bacterial translation initiation factor IF2 complexed with GTP binds to the 30S ribosomal subunit, promotes ribosomal binding of fMet-tRNA, and favors the joining of the small and large ribosomal subunits yielding a 70S initiation complex ready to enter the translation elongation phase. Within the I

  4. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  5. Utilización del patrón de restricción del DNA codificante para el RNA Ribosomal de la subunidad pequeña para la caracterización de Apicomplexa

    Directory of Open Access Journals (Sweden)

    López Adelaida

    1996-12-01

    Full Text Available Los Apicomplexos constituyen un phylum de protozoarios que se caracterizan por ser parásitos obligados de una gran variedad de huéspedes vertebrados e invertebrados. Hoy en día hay fuertes polémicas en tomo a su clasificación taxonómica, sus relaciones filogenéticas, y los patrones de coevolución con sus hospederos. El gen que codifica para el ARN ribosomal de la subunidad pequeña (ARN-SURp se utiliza como marcador molecular para resolver estas inquietudes. A partir del ADN de las especies de la familia Sarcocystidae (Sarcocystis cruzi, Sarcocystis sp. de Didelphis marsupialis y Sarcocystis sp. de Columbina talpacoti y Toxoplasma gondii, y de especies de la familia Plasmodiidae (Plasmodium de Anolis chloris, P. simium, y P. falciparumi, se amplificó por PCR el gen que codifica para el ARN de la subunidad ribosomal pequeña (ARN- SURp usando los iniciadores P5-P3, 0009-2134 Y566R-567R. Se compararon
    los patrones de restricción Hind III, Eco RI, Sau 3AI y Alw 261 del DNA ribosomal. La prueba de riboprini mostró que además de discriminar entre familias permite caracterizar diferencias a nivel de género y especie.Apicomplexa is a Protozoa phylum in which all members are obliged parasites of a wide range of vertebrate and invertebrate hosts. There is an ongoing controversy on
    systematics, phylogenetic relationships and parasite - host coevolution patterns. The SSU ribosomal gen has been used as a molecular marker in order to solve these issues.
    From DNA of the species of the Sarcocystidae family (Sarcocystis cruzi, Sarcocystis sp. from Didelphis marsupialis, Sarcocystis sp. from Columbina talpacoti and Toxoplasma
    gondii, and from the species of the Plasmodiidae family (Plasmodium from Anolis ehloris, P. simium, and P. falciparum, the SSU ribosomal DNA fragemnt was
    amplified by PCR, using the pair of primers P5-P3, 0009-2134 and 566R-567R. Hind III, Eco RI, Sau 3AI and Alw 261 restriction pattems were compared

  6. The structure of the eukaryotic ribosome at 3.0 Å resolution.

    Science.gov (United States)

    Ben-Shem, Adam; Garreau de Loubresse, Nicolas; Melnikov, Sergey; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2011-12-16

    Ribosomes translate genetic information encoded by messenger RNA into proteins. Many aspects of translation and its regulation are specific to eukaryotes, whose ribosomes are much larger and intricate than their bacterial counterparts. We report the crystal structure of the 80S ribosome from the yeast Saccharomyces cerevisiae--including nearly all ribosomal RNA bases and protein side chains as well as an additional protein, Stm1--at a resolution of 3.0 angstroms. This atomic model reveals the architecture of eukaryote-specific elements and their interaction with the universally conserved core, and describes all eukaryote-specific bridges between the two ribosomal subunits. It forms the structural framework for the design and analysis of experiments that explore the eukaryotic translation apparatus and the evolutionary forces that shaped it.

  7. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  8. Cell-specific differences in the requirements for translation quality control

    DEFF Research Database (Denmark)

    Reynolds, Noah M; Ling, Jiqiang; Roy, Hervé;

    2010-01-01

    Protein synthesis has an overall error rate of approximately 10(-4) for each mRNA codon translated. The fidelity of translation is mainly determined by two events: synthesis of cognate amino acid:tRNA pairs by aminoacyl-tRNA synthetases (aaRSs) and accurate selection of aminoacyl-tRNAs (aa-tRNAs......) by the ribosome. To ensure faithful aa-tRNA synthesis, many aaRSs employ a proofreading ("editing") activity, such as phenylalanyl-tRNA synthetases (PheRS) that hydrolyze mischarged Tyr-tRNA(Phe). Eukaryotes maintain two distinct PheRS enzymes, a cytoplasmic (ctPheRS) and an organellar form. CtPheRS is similar...... to bacterial enzymes in that it consists of a heterotetramer in which the alpha-subunits contain the active site and the beta-subunits harbor the editing site. In contrast, mitochondrial PheRS (mtPheRS) is an alpha-subunit monomer that does not edit Tyr-tRNA(Phe), and a comparable transacting activity does...

  9. Cinnamomin-A Versatile Type Ⅱ Ribosome-inactivating Protein

    Institute of Scientific and Technical Information of China (English)

    Hong XU; Wang-Yi LIU

    2004-01-01

    Ribosome-inactivating proteins(RIPs)are a group of toxic proteins that can specifically act on the universally conserved sarcin/ricin domain(S/R domain)of the largest RNA in ribosome and thus irreversibly inactivate ribosome for protein synthesis.Cinnamomin is a multifunctional type Ⅱ RIP isolated in our laboratory from the mature seeds of the camphor tree.This protein has been extensively studied with regard to its purification,characteristics,structure and function,genetic expression,enzymatic mechanism,physiological role in seed cell and toxicity to cancer cells and insect larvae.The research results of cinnamomin obtained in our laboratory are summarized in this review.Understanding of cinnamomin and the relative new proteins will help expand our knowledge of RIPs and may accelerate theoretical study and the development of their potential applications.

  10. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing sever......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  11. Ribosomal small subunit domains radiate from a central core

    Science.gov (United States)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  12. Ribosomal small subunit domains radiate from a central core

    Science.gov (United States)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  13. Mescaline-induced changes of brain-cortex ribosomes. Role of sperimidine in counteracting the destabilizing effect of mescaline of brain-cortex ribosomes.

    Science.gov (United States)

    Datta, R K; Antopol, W; Ghosh, J J

    1971-11-01

    1. The effect of spermidine on the mescaline-induced changes of brain-cortex ribosomes was studied by adding spermidine during the treatment of goat brain-cortex slices with mescaline. 2. Mescaline treatment of brain-cortex slices removed a portion of the endogenous spermidine from ribosomes and this removal was significantly prevented when spermidine was present during mescaline treatment. 3. Spermidine present during mescaline treatment of brain-cortex slices counteracted, to some extent, the destabilizing effect of mescaline on ribosomes with respect to heat denaturation. 4. Mescaline treatment of brain-cortex slices made ribosomes more susceptible to breakdown, releasing protein and RNA, and resulting in loss of ribosomal enzymic activities. However, spermidine present during mescaline treatment counteracted moderately the mescaline-induced ribosomal susceptibility to breakdown and ribosomal loss of enzymic activities. 5. Ribosomes of mescaline-treated cortex slices were rapidly degraded by ribonuclease and trypsin. However, if spermidine was present during mescaline treatment of brain-cortex slices the rates of degradation diminished.

  14. Translational regulation via L11: Molecular switches on the ribosome turned on and off by thiostrepton and micrococcin

    OpenAIRE

    M Harms, J.; Wilson, D. N.; Schluenzen, F.; Connell, S. R.; Stachelhaus, T.; Zaborowska, Z.; Spahn, C. M. T.; Fucini, P.

    2008-01-01

    The thiopeptide class of antibiotics targets the GTPase-associated center (GAC) of the ribosome to inhibit translation factor function. Using X-ray crystallography, we have determined the binding sites of thiostrepton (Thio), nosiheptide (Nosi), and micrococcin (Micro), on the Deinococcus radiodurans large ribosomal subunit. The thiopeptides, by binding within a cleft located between the ribosomal protein L11 and helices 43 and 44 of the 23S rRNA, overlap with the position of domain V of EF-G...

  15. Methylation of yeast ribosomal protein S2 is elevated during stationary phase growth conditions.

    Science.gov (United States)

    Ladror, Daniel T; Frey, Brian L; Scalf, Mark; Levenstein, Mark E; Artymiuk, Jacklyn M; Smith, Lloyd M

    2014-03-14

    Ribosomes, as the center of protein translation in the cell, require careful regulation via multiple pathways. While regulation of ribosomal synthesis and function has been widely studied on the transcriptional and translational "levels," the biological roles of ribosomal post-translational modifications (PTMs) are largely not understood. Here, we explore this matter by using quantitative mass spectrometry to compare the prevalence of ribosomal methylation and acetylation for yeast in the log phase and the stationary phase of growth. We find that of the 27 modified peptides identified, two peptides experience statistically significant changes in abundance: a 1.9-fold decrease in methylation for k(Me)VSGFKDEVLETV of ribosomal protein S1B (RPS1B), and a 10-fold increase in dimethylation for r(DiMe)GGFGGR of ribosomal protein S2 (RPS2). While the biological role of RPS1B methylation has largely been unexplored, RPS2 methylation is a modification known to have a role in processing and export of ribosomal RNA. This suggests that yeast in the stationary phase increase methylation of RPS2 in order to regulate ribosomal synthesis. These results demonstrate the utility of mass spectrometry for quantifying dynamic changes in ribosomal PTMs.

  16. An extra-ribosomal function of ribosomal protein L13a in macrophage resolves inflammation

    Science.gov (United States)

    Poddar, Darshana; Basu, Abhijit; Baldwin, William; Kondratov, Roman V; Barik, Sailen; Mazumder, Barsanjit

    2013-01-01

    Inflammation is an obligatory attempt of the immune system to protect the host from infections. However, unregulated synthesis of pro-inflammatory products can have detrimental effects. Although mechanisms that lead to inflammation are well appreciated, those that restrain it are not adequately understood. Creating macrophage-specific L13a-knockout (KO) mice here we report that depletion of ribosomal protein L13a abrogates the endogenous translation control of several chemokines in macrophages. Upon LPS-induced endotoxemia these animals displayed symptoms of severe inflammation caused by widespread infiltration of macrophages in major organs causing tissue injury and reduced survival rates. Macrophages from these KO animals show unregulated expression of several chemokines e.g. CXCL13, CCL22, CCL8 and CCR3. These macrophages failed to show L13a-dependent RNA binding complex formation on target mRNAs. In addition, increased polyribosomal abundance of these mRNAs shows a defect in translation control in the macrophages. Thus, our studies provide the first evidence of an essential extra-ribosomal function of ribosomal protein L13a in resolving physiological inflammation in a mammalian host. PMID:23460747

  17. Cell-specific information processing in segregating populations of Eph receptor ephrin-expressing cells

    DEFF Research Database (Denmark)

    Jørgensen, Claus; Sherman, Andrew; Chen, Ginny I;

    2009-01-01

    Cells have self-organizing properties that control their behavior in complex tissues. Contact between cells expressing either B-type Eph receptors or their transmembrane ephrin ligands initiates bidirectional signals that regulate cell positioning. However, simultaneously investigating how...... information is processed in two interacting cell types remains a challenge. We implemented a proteomic strategy to systematically determine cell-specific signaling networks underlying EphB2- and ephrin-B1-controlled cell sorting. Quantitative mass spectrometric analysis of mixed populations of EphB2......- and ephrin-B1-expressing cells that were labeled with different isotopes revealed cell-specific tyrosine phosphorylation events. Functional associations between these phosphotyrosine signaling networks and cell sorting were established with small interfering RNA screening. Data-driven network modeling...

  18. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-26

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  19. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  20. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck;

    2009-01-01

    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate...... of rRNA processing genes points towards a coordinated process enabling the overproduction of matured ribosomal structures....

  1. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  2. Key Intermediates in Ribosome Recycling Visualized by Time-Resolved Cryoelectron Microscopy.

    Science.gov (United States)

    Fu, Ziao; Kaledhonkar, Sandip; Borg, Anneli; Sun, Ming; Chen, Bo; Grassucci, Robert A; Ehrenberg, Måns; Frank, Joachim

    2016-12-06

    Upon encountering a stop codon on mRNA, polypeptide synthesis on the ribosome is terminated by release factors, and the ribosome complex, still bound with mRNA and P-site-bound tRNA (post-termination complex, PostTC), is split into ribosomal subunits, ready for a new round of translational initiation. Separation of post-termination ribosomes into subunits, or "ribosome recycling," is promoted by the joint action of ribosome-recycling factor (RRF) and elongation factor G (EF-G) in a guanosine triphosphate (GTP) hydrolysis-dependent manner. Here we used a mixing-spraying-based method of time-resolved cryo-electron microscopy (cryo-EM) to visualize the short-lived intermediates of the recycling process. The two complexes that contain (1) both RRF and EF-G bound to the PostTC or (2) deacylated tRNA bound to the 30S subunit are of particular interest. Our observations of the native form of these complexes demonstrate the strong potential of time-resolved cryo-EM for visualizing previously unobservable transient structures.

  3. The Role of Disordered Ribosomal Protein Extensions in the Early Steps of Eubacterial 50 S Ribosomal Subunit Assembly

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    2009-03-01

    Full Text Available Although during the past decade research has shown the functional importance of disorder in proteins, many of the structural and dynamics properties of intrinsically unstructured proteins (IUPs remain to be elucidated. This review is focused on the role of the extensions of the ribosomal proteins in the early steps of the assembly of the eubacterial 50 S subunit. The recent crystallographic structures of the ribosomal particles have revealed the picture of a complex assembly pathway that condenses the rRNA and the ribosomal proteins into active ribosomes. However, little is know about the molecular mechanisms of this process. It is thought that the long basic r-protein extensions that penetrate deeply into the subunit cores play a key role through disorder-order transitions and/or co-folding mechanisms. A current view is that such structural transitions may facilitate the proper rRNA folding. In this paper, the structures of the proteins L3, L4, L13, L20, L22 and L24 that have been experimentally found to be essential for the first steps of ribosome assembly have been compared. On the basis of their structural and dynamics properties, three categories of extensions have been identified. Each of them seems to play a distinct function. Among them, only the coil-helix transition that occurs in a phylogenetically conserved cluster of basic residues of the L20 extension appears to be strictly required for the large subunit assembly in eubacteria. The role of a helix-coil transitions in 23 S RNA folding is discussed in the light of the calcium binding protein calmodulin that shares many structural and dynamics properties with L20.

  4. Efficient reconstitution of functional Escherichia coli 30S ribosomal subunits from a complete set of recombinant small subunit ribosomal proteins.

    Science.gov (United States)

    Culver, G M; Noller, H F

    1999-06-01

    Previous studies have shown that the 30S ribosomal subunit of Escherichia coli can be reconstituted in vitro from individually purified ribosomal proteins and 16S ribosomal RNA, which were isolated from natural 30S subunits. We have developed a 30S subunit reconstitution system that uses only recombinant ribosomal protein components. The genes encoding E. coli ribosomal proteins S2-S21 were cloned, and all twenty of the individual proteins were overexpressed and purified. Reconstitution, following standard procedures, using the complete set of recombinant proteins and purified 16S ribosomal RNA is highly inefficient. Efficient reconstitution of 30S subunits using these components requires sequential addition of proteins, following either the 30S subunit assembly map (Mizushima & Nomura, 1970, Nature 226:1214-1218; Held et al., 1974, J Biol Chem 249:3103-3111) or following the order of protein assembly predicted from in vitro assembly kinetics (Powers et al., 1993, J MoI Biol 232:362-374). In the first procedure, the proteins were divided into three groups, Group I (S4, S7, S8, S15, S17, and S20), Group II (S5, S6, S9, Sll, S12, S13, S16, S18, and S19), and Group III (S2, S3, S10, S14, and S21), which were sequentially added to 16S rRNA with a 20 min incubation at 42 degrees C following the addition of each group. In the second procedure, the proteins were divided into Group I (S4, S6, S11, S15, S16, S17, S18, and S20), Group II (S7, S8, S9, S13, and S19), Group II' (S5 and S12) and Group III (S2, S3, S10, S14, and S21). Similarly efficient reconstitution is observed whether the proteins are grouped according to the assembly map or according to the results of in vitro 30S subunit assembly kinetics. Although reconstitution of 30S subunits using the recombinant proteins is slightly less efficient than reconstitution using a mixture of total proteins isolated from 30S subunits, it is much more efficient than reconstitution using proteins that were individually isolated

  5. Pseudouridines and pseudouridine synthases of the ribosome.

    Science.gov (United States)

    Ofengand, J; Malhotra, A; Remme, J; Gutgsell, N S; Del Campo, M; Jean-Charles, S; Peil, L; Kaya, Y

    2001-01-01

    psi are ubiquitous in ribosomal RNA. Eubacteria, Archaea, and eukaryotes all contain psi, although their number varies widely, with eukaryotes having the most. The small ribosomal subunit can apparently do without psi in some organisms, even though others have as many as 40 or more. Large subunits appear to need at least one psi but can have up to 50-60. psi is made by a set of site-specific enzymes in eubacteria, and in eukaryotes by a single enzyme complexed with auxiliary proteins and specificity-conferring guide RNAs. The mechanism is not known in Archaea, but based on an analysis of the kinds of psi synthases found in sequenced archaeal genomes, it is likely to involve use of guide RNAs. All psi synthases can be classified into one of four related groups, virtually all of which have a conserved aspartate residue in a conserved sequence motif. The aspartate is essential for psi formation in all twelve synthases examined so far. When the need for psi in E. coli was examined, the only synthase whose absence caused a major decrease in growth rate under normal conditions was RluD, the synthase that makes psi 1911, psi 1915, and psi 1917 in the helix 69 end-loop. This growth defect was the result of a major failure in assembly of the large ribosomal subunit. The defect could be prevented by supplying the rluD structural gene in trans, and also by providing a point mutant gene that made a synthase unable to make psi. Therefore, the RluD synthase protein appears to be directly involved in 50S subunit assembly, possibly as an RNA chaperone, and this activity is independent of its ability to form psi. This result is not without precedent. Depletion of PET56, a 2'-O-methyltransferase specific for G2251 (E. coli numbering) in yeast mitochondria virtually blocks 50S subunit assembly and mitochondrial function (Sirum-Connolly et al. 1995), but the methylation activity of the enzyme is not required (T. Mason, pers. comm.). The absence of FtsJ, a heat shock protein that makes

  6. Biochemistry and Function of the RNA Exosomes

    DEFF Research Database (Denmark)

    Lubas, Michal Szymon; Chlebowski, Aleksander; Dziembowski, Andrzej

    2012-01-01

    Discovery of the evolutionary conserved RNA exosome was a milestone in RNA biology. First identified as an activity essential for the processing of ribosomal RNA, the exosome has since proved to be central for RNA processing and degradation in both the nucleus and the cytoplasm of eukaryotic cell...

  7. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    Science.gov (United States)

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016.

  8. Riboproteomics of the hepatitis C virus internal ribosomal entry site.

    Science.gov (United States)

    Lu, Henry; Li, Weiqun; Noble, William Stafford; Payan, Donald; Anderson, D C

    2004-01-01

    Hepatitis C virus (HCV) protein translation is mediated by a cis-acting RNA, an internal ribosomal entry site (IRES), located in the 5' nontranslated region of the viral RNA. To examine proteins bound to the IRES, which could include proteins important for its function as well as potential drug targets, we used shotgun peptide sequencing to identify proteins in quadruplicate protein affinity extracts of lysed Huh7 cells, obtained using a biotinylated IRES. Twenty-six proteins bound the HCV IRES but not a reversed complementary sequence RNA or vector RNA controls. These included five ribosomal subunits, nine eukaryotic initiation factor 3 subunits, and novel interacting proteins such as the cytoskeletal-related proteins actin, FHOS (formin homologue overexpressed in spleen) and MIP-T3 (microtubule interacting protein that associates with TRAF3). Other novel HCV IRES-binding proteins included UNR (upstream of N-ras), UNR-interacting protein, and the RNA-binding proteins PAI-1 (plasminogen activator inhibitor-1) mRNA binding protein and Ewing sarcoma breakpoint 1 region protein EWS. A large set of additional proteins bound both the HCV IRES and a reversed complementary IRES sequence control, including the known HCV interactors PTB (polypyrimidine tract binding protein), the La autoantigen, and nucleolin. The discovery of these novel HCV IRES-binding proteins suggests links between IRES biology and the cytoskeleton, signal transduction, and other cellular functions.

  9. Isolation of Moraxella bovis ribosomes and their subsequent use in a vaccine against infectious bovine keratoconjunctivitis.

    Science.gov (United States)

    Pugh, G W; Phillips, M; McDonald, T J; Kopecky, K E

    1981-03-01

    A study was conducted to determine whether a Moraxella bovis ribosomal vaccine would protect calves from infectious bovine keratoconjunctivitis (IBK). Each of 16 calves were given 2 inoculations 21 days apart. Twenty-one days after the 2nd inoculation, 8 of the calves were challenge exposed with a homologous strain culture and 8 calves were challenge exposed to a heterologous strain culture of M bovis. Sedimentation velocity analysis of the ribosomes used in this study indicated that they were mostly 30S and 50S subunits. Chemical assays indicated that the ribosomes were composed of 64% to 65% RNA and 35% to 36% protein. The cesium chloride buoyant density of the ribosomes was 1.62 g/ml. Ribosomes used as antigen gave 1 line of precipitation in a gel-diffusion precipitin test with hyperimmune serum against the whole-cell antigen of the homologous strain of M bovis. The eyes of all the experimentally exposed calves became infected and all calves developed clinical signs of either unilateral or bilateral IBK. None of the sera of the vaccinated calves had detectable precipitins against the ribosomal antigen at the time they were challenge exposed, but most of the sera had precipitins against whole-cell and pilus antigens. The results indicate that M bovis ribosomes, although similar to other bacterial ribosomes, did not protect cattle against IBK.

  10. Preparation of ribosome-free membranes from rat liver microsomes by means of lithium chloride

    Science.gov (United States)

    Scott-Burden, T.; Hawtrey, A. O.

    1969-01-01

    1. Treatment of washed rat liver microsomes in a medium containing 0·12m-sucrose, 12·5mm-potassium chloride, 2·5mm-magnesium chloride and 25mm-tris–hydrochloric acid buffer, pH7·6, with 2m-lithium chloride at 5° for 16hr. leads to the formation of membranes free of ribosomes and ribosomal subunits. 2. Confirmation of the absence of ribosomes from lithium chloride-prepared membranes was obtained by treatment of the membranes with sodium deoxycholate, followed by sucrose-density-gradient centrifugation, which showed the complete absence of ribosomes. 3. Treatment of membranes with phenol, followed by sucrose-density-gradient analysis of the isolated RNA, showed the presence of a small amount of 4s material. Repetition of the phenol extraction procedure in the presence of liver cell sap as a ribonuclease inhibitor again showed the presence of only 4s material. The 4s RNA was shown to be transfer RNA by the fact that it had the same capacity for accepting 14C-labelled amino acids as isolated transfer RNA from rat liver pH5 enzyme. 4. Analysis showed that microsomes and membranes possessed similar glucose 6-phosphatase, NADH–2,6-dichlorophenol-indophenol reductase, NADH–neo-tetrazolium reductase, NADH–cytochrome c reductase and ribonuclease activities. 5. 3H-labelled ribosomal RNA binds to membranes. However, isolation of the bound RNA by the phenol extraction procedure, followed by sucrose-density-gradient analysis, shows the RNA to be degraded to 7s material. Very little breakdown of 3H-labelled ribosomal RNA bound to membranes occurs if the binding and isolation are carried out in the presence of liver cell sap. ImagesPLATE 1 PMID:4311814

  11. In vitro synthesis of ribosomal proteins directed by Escherichia coli DNA.

    Science.gov (United States)

    Kaltschmidt, E; Kahan, L; Nomura, M

    1974-02-01

    In vitro synthesis of a number of E. coli 30S ribosomal proteins has been demonstrated in a cell-free system consisting of ribosomes, initiation factors, RNA polymerase, a fraction containing soluble enzymes and factors, and E. coli DNA. DNA-dependent synthesis of the following 30S proteins has been demonstrated: S4, S5, S7, S8, S9, S10, S13, S14, S16, S19, and S20.

  12. Modulation of decoding fidelity by ribosomal proteins S4 and S5.

    Science.gov (United States)

    Agarwal, Deepali; Kamath, Divya; Gregory, Steven T; O'Connor, Michael

    2015-03-01

    Ribosomal proteins S4 and S5 participate in the decoding and assembly processes on the ribosome and the interaction with specific antibiotic inhibitors of translation. Many of the characterized mutations affecting these proteins decrease the accuracy of translation, leading to a ribosomal-ambiguity phenotype. Structural analyses of ribosomal complexes indicate that the tRNA selection pathway involves a transition between the closed and open conformations of the 30S ribosomal subunit and requires disruption of the interface between the S4 and S5 proteins. In agreement with this observation, several of the mutations that promote miscoding alter residues located at the S4-S5 interface. Here, the Escherichia coli rpsD and rpsE genes encoding the S4 and S5 proteins were targeted for mutagenesis and screened for accuracy-altering mutations. While a majority of the 38 mutant proteins recovered decrease the accuracy of translation, error-restrictive mutations were also recovered; only a minority of the mutant proteins affected rRNA processing, ribosome assembly, or interactions with antibiotics. Several of the mutations affect residues at the S4-S5 interface. These include five nonsense mutations that generate C-terminal truncations of S4. These truncations are predicted to destabilize the S4-S5 interface and, consistent with the domain closure model, all have ribosomal-ambiguity phenotypes. A substantial number of the mutations alter distant locations and conceivably affect tRNA selection through indirect effects on the S4-S5 interface or by altering interactions with adjacent ribosomal proteins and 16S rRNA.

  13. 'Candidatus Phytoplasmas pruni', a novel taxon associated with X-disease of stone fruits, Prunus spp.: multilocus characterization based on 16S rRNA, secY, and ribosomal protein genes

    Science.gov (United States)

    X-disease is one of the most serious diseases known in peach (Prunus persica). Based on RFLP analysis of 16S rRNA gene sequences, peach X-disease phytoplasma strains from eastern and western United States and eastern Canada were classified in 16S rDNA RFLP group 16SrIII, subgroup A. Phylogenetic a...

  14. The Cj0588 protein is a Campylobacter jejuni RNA methyltransferase.

    Science.gov (United States)

    Sałamaszyńska-Guz, Agnieszka; Taciak, Bartłomiej; Kwiatek, Agnieszka; Klimuszko, Danuta

    2014-06-06

    TlyA proteins belong to 2'-O-methyltransferases. Methylation is a common posttranscriptional RNA modification. The Campylobacter jejuni Cj0588 protein belongs to the TlyA(I) protein family and is a rRNA methyltransferase. Methylation of ribosomal RNA catalyzed by Cj0588 appears to have an impact on the biology of the cell. Presence of the cj0588 gene in bacteria appears to be important for ribosome stability and virulence properties. Absence of the Cj0588 protein causes accumulation of the 50S ribosomal subunits, reduction in the amount of functional 70S ribosomes and confers increase resistance to capreomycin.

  15. Ribosomal accretion, apriorism and the phylogenetic method: a response to Petrov and Williams.

    Science.gov (United States)

    Caetano-Anollés, Derek; Caetano-Anollés, Gustavo

    2015-01-01

    Historical (ideographic) and non-historical (nomothetic) studies of ribosomal accretion appear to arrive at diametrically opposite conclusions. Phylogenetic analysis of thousands of RNA molecules and protein structures in hundreds of genomes supports the structural origin of the ribosome in RNA decoding and ribosomal mechanics. Predictions from extant features in a handful of rRNA structural models of the large ribosomal subunit support its origin in protein biosynthesis. In recent correspondence, one of us reported that correcting dismissals of conflicting data and avoiding unwarranted assumptions of the nomothetic method reconciled conclusions. In response, Petrov and Williams dismissed our arguments claiming we did not understand their algorithmic model of ribosomal apical growth. Instead, they controverted the historical approach. Here we show that their objections to the phylogenetic method are unjustified, that their algorithm subjectively guarantees back-in-time molecular deconstructions toward the protein biosynthetic core, and that processes of ribosomal growth are much more complex. We prompt abandoning apriorism, decreasing ad hoc hypotheses and integrating historical and non-historical scientific methods.

  16. Ribosomal accretion, apriorism and the phylogenetic method: A response to Petrov and Williams

    Directory of Open Access Journals (Sweden)

    Derek eCaetano-Anollés

    2015-06-01

    Full Text Available Historical (ideographic and non-historical (nomothetic studies of ribosomal accretion appear to arrive at diametrically opposite conclusions. Phylogenetic analysis of thousands of RNA molecules and protein structures in hundreds of genomes supports the structural origin of the ribosome in RNA decoding and ribosomal mechanics. Predictions from extant features in a handful of rRNA structural models of the large ribosomal subunit support its origin in protein biosynthesis. In recent correspondence, one of us reported that correcting dismissals of conflicting data and avoiding unwarranted assumptions of the nomethetic method reconciled conclusions. In response, Petrov and Williams dismissed our arguments claiming we did not understand their ‘BS’ algorithmic model of ribosomal apical growth. Instead, they controverted the historical approach. Here we show that their objections to the phylogenetic method are unjustified, that the BS algorithm subjectively guarantees back-in-time molecular deconstructions towards the protein biosynthetic core, and that processes of ribosomal growth are much more complex. We prompt abandoning apriorism, decreasing ad hoc hypotheses and integrating historical and non-historical scientific methods.

  17. Assembly of the 30S ribosomal subunit: positioning ribosomal protein S13 in the S7 assembly branch.

    Science.gov (United States)

    Grondek, Joel F; Culver, Gloria M

    2004-12-01

    Studies of Escherichia coli 30S ribosomal subunit assembly have revealed a hierarchical and cooperative association of ribosomal proteins with 16S ribosomal RNA; these results have been used to compile an in vitro 30S subunit assembly map. In single protein addition and omission studies, ribosomal protein S13 was shown to be dependent on the prior association of ribosomal protein S20 for binding to the ribonucleoprotein particle. While the overwhelming majority of interactions revealed in the assembly map are consistent with additional data, the dependency of S13 on S20 is not. Structural studies position S13 in the head of the 30S subunit > 100 A away from S20, which resides near the bottom of the body of the 30S subunit. All of the proteins that reside in the head of the 30S subunit, except S13, have been shown to be part of the S7 assembly branch, that is, they all depend on S7 for association with the assembling 30S subunit. Given these observations, the assembly requirements for S13 were investigated using base-specific chemical footprinting and primer extension analysis. These studies reveal that S13 can bind to 16S rRNA in the presence of S7, but not S20. Additionally, interaction between S13 and other members of the S7 assembly branch have been observed. These results link S13 to the 3' major domain family of proteins, and the S7 assembly branch, placing S13 in a new location in the 30S subunit assembly map where its position is in accordance with much biochemical and structural data.

  18. Chloramphenicol induction of cat-86 requires ribosome stalling at a specific site in the leader.

    Science.gov (United States)

    Alexieva, Z; Duvall, E J; Ambulos, N P; Kim, U J; Lovett, P S

    1988-05-01

    The plasmid gene cat-86 specifies chloramphenicol-inducible chloramphenicol acetyltransferase in Bacillus subtilis. Induction by the antibiotic is primarily due to activation of the translation of cat-86-encoded mRNA. It has been suggested that the inducer stalls ribosomes at a discrete location in the leader region of cat-86 mRNA, which causes the destabilization of a downstream RNA secondary structure that normally sequesters the cat-86 ribosome binding site. It is the destabilization of this RNA secondary structure that permits translation of the cat-86 coding sequence. In the present report, we show that ribosomes that were stalled in the cat-86 leader by starvation of host cells for the amino acid specified by leader codon 6 induced gene expression to a level above that detected when cells were starved for the amino acids specified by leader codons 7 and 8. Starvation for amino acids specified by leader codons 3, 4, or 5 failed to activate cat-86 expression. These results indicate that the stalled ribosome that is most active in cat-86 induction has its aminoacyl site occupied by leader codon 6. To determine if chloramphenicol also stalled ribosomes in the cat-86 regulatory leader such that the aminoacyl site was occupied by codon 6, we separately changed leader codons 3, 4, 5, and 6 to the translation termination (ochre) codon TAA. Each of the mutated genes was tested for its ability to be induced by chloramphenicol. The results show that replacement of leader codons 3, 4, or 5 by the ochre codon blocked induction, whereas replacement of leader codon 6 by the ochre codon permitted induction. Collectively, these observations lead to the conclusion that cat-86 induction requires ribosome stalling in leader mRNA, and they identify leader codon 6 as the codon most likely to be occupied by the aminoacyl site of a stalled ribosome that is active in the induction.

  19. Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3

    Indian Academy of Sciences (India)

    Anuradha Seshadri; Umesh Varshney

    2006-06-01

    Ribosome recycling is a process which dissociates the post-termination complexes (post-TC) consisting of mRNA-bound ribosomes harbouring deacylated tRNA(s). Ribosome recycling factor (RRF), and elongation factor G (EFG) participate in this crucial process to free the ribosomal subunits for a new round of translation. We discuss the overall pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor 3 (IF3) in this process. Depending on the step(s) at which IF3 function is implicated, three models have been proposed. In model 1, RRF and EFG dissociate the post-TCs into the 50S and 30S subunits, mRNA and tRNA(s). In this model, IF3, which binds to the 30S subunit, merely keeps the dissociated subunits apart by its anti-association activity. In model 2, RRF and EFG separate the 50S subunit from the post-TC. IF3 then dissociates the remaining complex of mRNA, tRNA and the 30S subunit, and keeps the ribosomal subunits apart from each other. However, in model 3, both the genetic and biochemical evidence support a more active role for IF3 even at the step of dissociation of the post-TC by RRF and EFG into the 50S and 30S subunits.

  20. Laser capture microdissection in Ectocarpus siliculosus: the pathway to cell-specific transcriptomics in brown algae

    Directory of Open Access Journals (Sweden)

    Denis eSaint-Marcoux

    2015-02-01

    Full Text Available Laser capture microdissection (LCM facilitates the isolation of individual cells from tissue sections, and when combined with RNA amplification techniques, it is an extremely powerful tool for examining genome-wide expression profiles in specific cell-types. LCM has been widely used to address various biological questions in both animal and plant systems, however, no attempt has been made so far to transfer LCM technology to macroalgae. Macroalgae are a collection of widespread eukaryotes living in fresh and marine water. In line with the collective effort to promote molecular investigations of macroalgal biology, here we demonstrate the feasibility of using LCM and cell-specific transcriptomics to study development of the brown alga, Ectocarpus siliculosus. We describe a workflow comprising cultivation and fixation of algae on glass slides, laser microdissection, and RNA amplification. To illustrate the effectiveness of the procedure, we show qPCR data and metrics obtained from cell-specific transcriptomes generated from both upright and prostrate filaments of Ectocarpus.

  1. A stochastic model of translation with -1 programmed ribosomal frameshifting

    Science.gov (United States)

    Bailey, Brenae L.; Visscher, Koen; Watkins, Joseph

    2014-02-01

    Many viruses produce multiple proteins from a single mRNA sequence by encoding overlapping genes. One mechanism to decode both genes, which reside in alternate reading frames, is -1 programmed ribosomal frameshifting. Although recognized for over 25 years, the molecular and physical mechanism of -1 frameshifting remains poorly understood. We have developed a mathematical model that treats mRNA translation and associated -1 frameshifting as a stochastic process in which the transition probabilities are based on the energetics of local molecular interactions. The model predicts both the location and efficiency of -1 frameshift events in HIV-1. Moreover, we compute -1 frameshift efficiencies upon mutations in the viral mRNA sequence and variations in relative tRNA abundances, predictions that are directly testable in experiment.

  2. Evolution of the holozoan ribosome biogenesis regulon

    Science.gov (United States)

    Brown, Seth J; Cole, Michael D; Erives, Albert J

    2008-01-01

    Background The ribosome biogenesis (RiBi) genes encode a highly-conserved eukaryotic set of nucleolar proteins involved in rRNA transcription, assembly, processing, and export from the nucleus. While the mode of regulation of this suite of genes has been studied in the yeast, Saccharomyces cerevisiae, how this gene set is coordinately regulated in the larger and more complex metazoan genomes is not understood. Results Here we present genome-wide analyses indicating that a distinct mode of RiBi regulation co-evolved with the E(CG)-binding, Myc:Max bHLH heterodimer complex in a stem-holozoan, the ancestor of both Metazoa and Choanoflagellata, the protozoan group most closely related to animals. These results show that this mode of regulation, characterized by an E(CG)-bearing core-promoter, is specific to almost all of the known genes involved in ribosome biogenesis in these genomes. Interestingly, this holozoan RiBi promoter signature is absent in nematode genomes, which have not only secondarily lost Myc but are marked by invariant cell lineages typically producing small body plans of 1000 somatic cells. Furthermore, a detailed analysis of 10 fungal genomes shows that this holozoan signature in RiBi genes is not found in hemiascomycete fungi, which evolved their own unique regulatory signature for the RiBi regulon. Conclusion These results indicate that a Myc regulon, which is activated in proliferating cells during normal development as well as during tumor progression, has primordial roots in the evolution of an inducible growth regime in a protozoan ancestor of animals. Furthermore, by comparing divergent bHLH repertoires, we conclude that regulation by Myc but not by other bHLH genes is responsible for the evolutionary maintenance of E(CG) sites across the RiBi suite of genes. PMID:18816399

  3. Evolution of the holozoan ribosome biogenesis regulon

    Directory of Open Access Journals (Sweden)

    Cole Michael D

    2008-09-01

    Full Text Available Abstract Background The ribosome biogenesis (RiBi genes encode a highly-conserved eukaryotic set of nucleolar proteins involved in rRNA transcription, assembly, processing, and export from the nucleus. While the mode of regulation of this suite of genes has been studied in the yeast, Saccharomyces cerevisiae, how this gene set is coordinately regulated in the larger and more complex metazoan genomes is not understood. Results Here we present genome-wide analyses indicating that a distinct mode of RiBi regulation co-evolved with the E(CG-binding, Myc:Max bHLH heterodimer complex in a stem-holozoan, the ancestor of both Metazoa and Choanoflagellata, the protozoan group most closely related to animals. These results show that this mode of regulation, characterized by an E(CG-bearing core-promoter, is specific to almost all of the known genes involved in ribosome biogenesis in these genomes. Interestingly, this holozoan RiBi promoter signature is absent in nematode genomes, which have not only secondarily lost Myc but are marked by invariant cell lineages typically producing small body plans of 1000 somatic cells. Furthermore, a detailed analysis of 10 fungal genomes shows that this holozoan signature in RiBi genes is not found in hemiascomycete fungi, which evolved their own unique regulatory signature for the RiBi regulon. Conclusion These results indicate that a Myc regulon, which is activated in proliferating cells during normal development as well as during tumor progression, has primordial roots in the evolution of an inducible growth regime in a protozoan ancestor of animals. Furthermore, by comparing divergent bHLH repertoires, we conclude that regulation by Myc but not by other bHLH genes is responsible for the evolutionary maintenance of E(CG sites across the RiBi suite of genes.

  4. A second function for pseudouridine synthases: A point mutant of RluD unable to form pseudouridines 1911, 1915, and 1917 in Escherichia coli 23S ribosomal RNA restores normal growth to an RluD-minus strain.

    Science.gov (United States)

    Gutgsell, N S; Del Campo, M; Raychaudhuri, S; Ofengand, J

    2001-07-01

    This laboratory previously showed that truncation of the gene for RluD, the Escherichia coli pseudouridine synthase responsible for synthesis of 23S rRNA pseudouridines 1911, 1915, and 1917, blocks pseudouridine formation and inhibits growth. We now show that RluD mutants at the essential aspartate 139 allow these two functions of RluD to be separated. In vitro, RluD with aspartate 139 replaced by threonine or asparagine is completely inactive. In vivo, the growth defect could be completely restored by transformation of an RluD-inactive strain with plasmids carrying genes for RluD with aspartate 139 replaced by threonine or asparagine. Pseudouridine sequencing of the 23S rRNA from these transformed strains demonstrated the lack of these pseudouridines. Pseudoreversion, which has previously been shown to restore growth without pseudouridine formation by mutation at a distant position on the chromosome, was not responsible because transformation with empty vector under identical conditions did not alter the growth rate.

  5. Vorticella Linnaeus, 1767 (Ciliophora, Oligohymenophora, Peritrichia) is a grade not a clade: redefinition of Vorticella and the families Vorticellidae and Astylozoidae using molecular characters derived from the gene coding for small subunit ribosomal RNA.

    Science.gov (United States)

    Sun, Ping; Clamp, John; Xu, Dapeng; Kusuoka, Yasushi; Miao, Wei

    2012-01-01

    Recent phylogenetic analyses of the peritrich genus Vorticella have suggested that it might be paraphyletic, with one Vorticella species - Vorticella microstoma grouping with the swimming peritrichs Astylozoon and Opisthonecta in a distant clade. These results were based on very limited taxon sampling and thus could not be accepted as conclusive evidence for revising the generic classification. We tested paraphyly of the genus Vorticella by making a new analysis with a broad range of samples from three continents that yielded 52 new sequences of the gene coding for small subunit rRNA. Our results, together with the available sequences in Genbank, form a comprehensive set of data for the genus Vorticella. Analyses of these data showed that Vorticella microstoma morphotypes, Astylozoon, and Opisthonecta form a well-supported, monophyletic clade, that is distinct from and basal to the family Vorticellidae containing other species of Vorticella. Paraphyly of the genus Vorticella and family Vorticellidae was strongly confirmed by these results. Furthermore, the two clades of Vorticella identified by the SSU rRNA gene are so genetically diverse whereas the genetic distances within the one containing Vorticella microstoma morphotypes, Astylozoon, and Opisthonecta were so slight, which marked it as a separate family that must be defined by molecular characters in the absence of unifying morphological and morphogenetic characters. An emended characterization and status of the genus Vorticella, the families Vorticellidae and Astylozoidae are presented and discussed.

  6. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    Science.gov (United States)

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  7. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome.

    Science.gov (United States)

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-04-20

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance.

  8. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  9. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    Directory of Open Access Journals (Sweden)

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  10. Structure of the hypusinylated eukaryotic translation factor eIF-5A bound to the ribosome.

    Science.gov (United States)

    Schmidt, Christian; Becker, Thomas; Heuer, André; Braunger, Katharina; Shanmuganathan, Vivekanandan; Pech, Markus; Berninghausen, Otto; Wilson, Daniel N; Beckmann, Roland

    2016-02-29

    During protein synthesis, ribosomes become stalled on polyproline-containing sequences, unless they are rescued in archaea and eukaryotes by the initiation factor 5A (a/eIF-5A) and in bacteria by the homologous protein EF-P. While a structure of EF-P bound to the 70S ribosome exists, structural insight into eIF-5A on the 80S ribosome has been lacking. Here we present a cryo-electron microscopy reconstruction of eIF-5A bound to the yeast 80S ribosome at 3.9 Å resolution. The structure reveals that the unique and functionally essential post-translational hypusine modification reaches toward the peptidyltransferase center of the ribosome, where the hypusine moiety contacts A76 of the CCA-end of the P-site tRNA. These findings would support a model whereby eIF-5A stimulates peptide bond formation on polyproline-stalled ribosomes by stabilizing and orienting the CCA-end of the P-tRNA, rather than by directly contributing to the catalysis.

  11. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-27

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics.

  12. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns...... that encode reverse transcriptase-like genes, and group I introns and archaeal introns that encode homing endonuclease genes (HEGs). Although rDNA-embedded protein genes are widespread in nuclei, organelles and bacteria, there is surprisingly little information available on how these genes are expressed....... Exceptions include a handful of HEGs from group I introns. Recent studies have revealed unusual and essential roles of group I and group I-like ribozymes in the endogenous expression of HEGs. Here we discuss general aspects of rDNA-embedded protein genes and focus on HEG expression from group I introns...

  13. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  14. Structure of the 70S ribosome from human pathogen Staphylococcus aureus.

    Science.gov (United States)

    Khusainov, Iskander; Vicens, Quentin; Bochler, Anthony; Grosse, François; Myasnikov, Alexander; Ménétret, Jean-François; Chicher, Johana; Marzi, Stefano; Romby, Pascale; Yusupova, Gulnara; Yusupov, Marat; Hashem, Yaser

    2016-12-01

    Comparative structural studies of ribosomes from various organisms keep offering exciting insights on how species-specific or environment-related structural features of ribosomes may impact translation specificity and its regulation. Although the importance of such features may be less obvious within more closely related organisms, their existence could account for vital yet species-specific mechanisms of translation regulation that would involve stalling, cell survival and antibiotic resistance. Here, we present the first full 70S ribosome structure from Staphylococcus aureus, a Gram-positive pathogenic bacterium, solved by cryo-electron microscopy. Comparative analysis with other known bacterial ribosomes pinpoints several unique features specific to S. aureus around a conserved core, at both the protein and the RNA levels. Our work provides the structural basis for the many studies aiming at understanding translation regulation in S. aureus and for designing drugs against this often multi-resistant pathogen.

  15. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Science.gov (United States)

    McCall, Ingrid C.; Perrot, Véronique; Weiss, Howard; Ovesepian, Armen; Baquero, Fernando

    2017-01-01

    ABSTRACT We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn) operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE), is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures. PMID:28174311

  16. RNA nanoparticles come of age

    Institute of Scientific and Technical Information of China (English)

    John J.Rossi

    2011-01-01

    @@ RNA has multiple functions in nature, including informa- tional transfer (mRNA) Ill, adaptor function (tRNAs) [2], guide functions (snRNAs, snoRNAs) [3,4]catalytic func- tion (ribozymes and the large ribosomal RNA) [5-7], and environmental sensing (riboswitehes) [8].In contrast, DNA only serves as an information storage molecule, and proteins serve as structural and enzymatic molecules.

  17. Etudes structurales du ribosome de Staphylococcus aureus

    OpenAIRE

    Khusainov, Iskander

    2015-01-01

    The ribosome is a large cellular machinery that performs the protein synthesis in every living cell. Therefore, the ribosome is one of the major targets of naturally produced antibiotics, which can kill bacterial cells by blocking protein synthesis. However, some bacteria are resistant to these antibiotics due to small modifications of their ribosomes. Among them, Staphylococcus aureus (S. aureus) is a severe pathogen that causes numerous infections in humans. The crystal structures of comple...

  18. Prostate Cell Specific Regulation of Androgen Receptor Phosphorylation in Vivo

    Science.gov (United States)

    2009-11-01

    immunoprecipitation; CRE, cAMP-responsive element; CREB, CRE-binding pro- tein; DMSO, dimethylsulfoxide ; EGF, epidermal growth fac- tor; EGFR, EGF...inhibitor, or dimethylsulfoxide (DMSO) ve- hicle control for 4 h and examined ART-27 mRNA levels. TSA increases ART-27 mRNA levels in 293 cells but does not

  19. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  20. The DEAD-box helicase DDX3 supports the assembly of functional 80S ribosomes.

    Science.gov (United States)

    Geissler, Rene; Golbik, Ralph P; Behrens, Sven-Erik

    2012-06-01

    The DEAD-box helicase DDX3 has suggested functions in innate immunity, mRNA translocation and translation, and it participates in the propagation of assorted viruses. Exploring initially the role of DDX3 in the life cycle of hepatitis C virus, we observed the protein to be involved in translation directed by different viral internal ribosomal entry sites. Extension of these studies revealed a general supportive role of DDX3 in translation initiation. DDX3 was found to interact in an RNA-independent manner with defined components of the translational pre-initiation complex and to specifically associate with newly assembling 80S ribosomes. DDX3 knock down and in vitro reconstitution experiments revealed a significant function of the protein in the formation of 80S translation initiation complexes. Our study implies that DDX3 assists the 60S subunit joining process to assemble functional 80S ribosomes.

  1. Assembly of the central domain of the 30S ribosomal subunit: roles for the primary binding ribosomal proteins S15 and S8.

    Science.gov (United States)

    Jagannathan, Indu; Culver, Gloria M

    2003-07-01

    Assembly of the 30S ribosomal subunit occurs in a highly ordered and sequential manner. The ordered addition of ribosomal proteins to the growing ribonucleoprotein particle is initiated by the association of primary binding proteins. These proteins bind specifically and independently to 16S ribosomal RNA (rRNA). Two primary binding proteins, S8 and S15, interact exclusively with the central domain of 16S rRNA. Binding of S15 to the central domain results in a conformational change in the RNA and is followed by the ordered assembly of the S6/S18 dimer, S11 and finally S21 to form the platform of the 30S subunit. In contrast, S8 is not part of this major platform assembly branch. Of the remaining central domain binding proteins, only S21 association is slightly dependent on S8. Thus, although S8 is a primary binding protein that extensively contacts the central domain, its role in assembly of this domain remains unclear. Here, we used directed hydroxyl radical probing from four unique positions on S15 to assess organization of the central domain of 16S rRNA as a consequence of S8 association. Hydroxyl radical probing of Fe(II)-S15/16S rRNA and Fe(II)-S15/S8/16S rRNA ribonucleoprotein particles reveal changes in the 16S rRNA environment of S15 upon addition of S8. These changes occur predominantly in helices 24 and 26 near previously identified S8 binding sites. These S8-dependent conformational changes are consistent with 16S rRNA folding in complete 30S subunits. Thus, while S8 binding is not absolutely required for assembly of the platform, it appears to affect significantly the 16S rRNA environment of S15 by influencing central domain organization.

  2. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina

    2008-10-01

    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  3. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation.

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30S and large 50S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  4. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  5. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.

    Science.gov (United States)

    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha

    2015-06-01

    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  6. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-07-02

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of (/sup 125/I)iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis.

  7. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered.

  8. EF-Tu dynamics during pre-translocation complex formation: EF-Tu·GDP exits the ribosome via two different pathways.

    Science.gov (United States)

    Liu, Wei; Chen, Chunlai; Kavaliauskas, Darius; Knudsen, Charlotte R; Goldman, Yale E; Cooperman, Barry S

    2015-10-30

    The G-protein EF-Tu, which undergoes a major conformational change when EF-Tu·GTP is converted to EF-Tu·GDP, forms part of an aminoacyl(aa)-tRNA·EF-Tu·GTP ternary complex (TC) that accelerates the binding of aa-tRNA to the ribosome during peptide elongation. Such binding, placing a portion of EF-Tu in contact with the GTPase Associated Center (GAC), is followed by GTP hydrolysis and Pi release, and results in formation of a pretranslocation (PRE) complex. Although tRNA movement through the ribosome during PRE complex formation has been extensively studied, comparatively little is known about the dynamics of EF-Tu interaction with either the ribosome or aa-tRNA. Here we examine these dynamics, utilizing ensemble and single molecule assays employing fluorescent labeled derivatives of EF-Tu, tRNA, and the ribosome to measure changes in either FRET efficiency or fluorescence intensity during PRE complex formation. Our results indicate that ribosome-bound EF-Tu separates from the GAC prior to its full separation from aa-tRNA, and suggest that EF-Tu·GDP dissociates from the ribosome by two different pathways. These pathways correspond to either reversible EF-Tu·GDP dissociation from the ribosome prior to the major conformational change in EF-Tu that follows GTP hydrolysis, or irreversible dissociation after or concomitant with this conformational change.

  9. Ribosomal oxygenases are structurally conserved from prokaryotes to humans.

    Science.gov (United States)

    Chowdhury, Rasheduzzaman; Sekirnik, Rok; Brissett, Nigel C; Krojer, Tobias; Ho, Chia-Hua; Ng, Stanley S; Clifton, Ian J; Ge, Wei; Kershaw, Nadia J; Fox, Gavin C; Muniz, Joao R C; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S; Kavanagh, Kathryn L; von Delft, Frank; Oppermann, Udo; McDonough, Michael A; Doherty, Aidan J; Schofield, Christopher J

    2014-06-19

    2-Oxoglutarate (2OG)-dependent oxygenases have important roles in the regulation of gene expression via demethylation of N-methylated chromatin components and in the hydroxylation of transcription factors and splicing factor proteins. Recently, 2OG-dependent oxygenases that catalyse hydroxylation of transfer RNA and ribosomal proteins have been shown to be important in translation relating to cellular growth, TH17-cell differentiation and translational accuracy. The finding that ribosomal oxygenases (ROXs) occur in organisms ranging from prokaryotes to humans raises questions as to their structural and evolutionary relationships. In Escherichia coli, YcfD catalyses arginine hydroxylation in the ribosomal protein L16; in humans, MYC-induced nuclear antigen (MINA53; also known as MINA) and nucleolar protein 66 (NO66) catalyse histidine hydroxylation in the ribosomal proteins RPL27A and RPL8, respectively. The functional assignments of ROXs open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in the residue and protein selectivities of prokaryotic and eukaryotic ROXs, comparison of the crystal structures of E. coli YcfD and Rhodothermus marinus YcfD with those of human MINA53 and NO66 reveals highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-dependent oxygenases. ROX structures with and without their substrates support their functional assignments as hydroxylases but not demethylases, and reveal how the subfamily has evolved to catalyse the hydroxylation of different residue side chains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-domain-containing hydroxylases, including the hypoxia-inducible factor asparaginyl hydroxylase FIH and histone N(ε)-methyl lysine demethylases, identifies branch points in 2OG-dependent oxygenase evolution and distinguishes between JmjC-containing hydroxylases and demethylases

  10. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  11. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  12. Ribosomal protein genes are overexpressed in colorectal cancer: isolation of a cDNA clone encoding the human S3 ribosomal protein.

    Science.gov (United States)

    Pogue-Geile, K; Geiser, J R; Shu, M; Miller, C; Wool, I G; Meisler, A I; Pipas, J M

    1991-08-01

    We have isolated a cDNA clone encoding the human S3 ribosomal protein from a normal human colon cDNA library. The clone was identified as one of many that detected genes whose level of expression was increased in adenocarcinoma of the colon relative to normal colonic mucosa. Increased levels of the S3 transcript were present in the tumors of all eight patients examined. Moreover, the S3 mRNA was also more abundant in 7 of 10 adenomatous polyps, the presumed precursor of carcinoma. Additional studies demonstrated that increased levels of mRNAs encoding several other ribosomal proteins, including S6, S8, S12, L5, and P0, were present in colorectal tumors and polyps. These results suggest that there is increased synthesis of ribosomes in colorectal tumors and that this increase is an early event in colon neoplasia.

  13. A protein inventory of human ribosome biogenesis reveals an essential function of exportin 5 in 60S subunit export.

    Science.gov (United States)

    Wild, Thomas; Horvath, Peter; Wyler, Emanuel; Widmann, Barbara; Badertscher, Lukas; Zemp, Ivo; Kozak, Karol; Csucs, Gabor; Lund, Elsebet; Kutay, Ulrike

    2010-10-26

    The assembly of ribosomal subunits in eukaryotes is a complex, multistep process so far mostly studied in yeast. In S. cerevisiae, more than 200 factors including ribosomal proteins and trans-acting factors are required for the ordered assembly of 40S and 60S ribosomal subunits. To date, only few human homologs of these yeast ribosome synthesis factors have been characterized. Here, we used a systematic RNA interference (RNAi) approach to analyze the contribution of 464 candidate factors to ribosomal subunit biogenesis in human cells. The screen was based on visual readouts, using inducible, fluorescent ribosomal proteins as reporters. By performing computer-based image analysis utilizing supervised machine-learning techniques, we obtained evidence for a functional link of 153 human proteins to ribosome synthesis. Our data show that core features of ribosome assembly are conserved from yeast to human, but differences exist for instance with respect to 60S subunit export. Unexpectedly, our RNAi screen uncovered a requirement for the export receptor Exportin 5 (Exp5) in nuclear export of 60S subunits in human cells. We show that Exp5, like the known 60S exportin Crm1, binds to pre-60S particles in a RanGTP-dependent manner. Interference with either Exp5 or Crm1 function blocks 60S export in both human cells and frog oocytes, whereas 40S export is compromised only upon inhibition of Crm1. Thus, 60S subunit export is dependent on at least two RanGTP-binding exportins in vertebrate cells.

  14. Genome-wide analysis of thylakoid-bound ribosomes in maize reveals principles of cotranslational targeting to the thylakoid membrane.

    Science.gov (United States)

    Zoschke, Reimo; Barkan, Alice

    2015-03-31

    Chloroplast genomes encode ∼ 37 proteins that integrate into the thylakoid membrane. The mechanisms that target these proteins to the membrane are largely unexplored. We used ribosome profiling to provide a comprehensive, high-resolution map of ribosome positions on chloroplast mRNAs in separated membrane and soluble fractions in maize seedlings. The results show that translation invariably initiates off the thylakoid membrane and that ribosomes synthesizing a subset of membrane proteins subsequently become attached to the membrane in a nuclease-resistant fashion. The transition from soluble to membrane-attached ribosomes occurs shortly after the first transmembrane segment in the nascent peptide has emerged from the ribosome. Membrane proteins whose translation terminates before emergence of a transmembrane segment are translated in the stroma and targeted to the membrane posttranslationally. These results indicate that the first transmembrane segment generally comprises the signal that links ribosomes to thylakoid membranes for cotranslational integration. The sole exception is cytochrome f, whose cleavable N-terminal cpSecA-dependent signal sequence engages the thylakoid membrane cotranslationally. The distinct behavior of ribosomes synthesizing the inner envelope protein CemA indicates that sorting signals for the thylakoid and envelope membranes are distinguished cotranslationally. In addition, the fractionation behavior of ribosomes in polycistronic transcription units encoding both membrane and soluble proteins adds to the evidence that the removal of upstream ORFs by RNA processing is not typically required for the translation of internal genes in polycistronic chloroplast mRNAs.

  15. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    Directory of Open Access Journals (Sweden)

    Ehrenberg Måns

    2005-06-01

    Full Text Available Abstract Background During the translation of mRNA into polypeptide, elongation factor G (EF-G catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF. Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3.

  16. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    Science.gov (United States)

    Zavialov, Andrey V; Hauryliuk, Vasili V; Ehrenberg, Måns

    2005-01-01

    Background During the translation of mRNA into polypeptide, elongation factor G (EF-G) catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF). Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3. PMID:15985150

  17. Assembling the archaeal ribosome: roles for translation-factor-related GTPases.

    Science.gov (United States)

    Blombach, Fabian; Brouns, Stan J J; van der Oost, John

    2011-01-01

    The assembly of ribosomal subunits from their individual components (rRNA and ribosomal proteins) requires the assistance of a multitude of factors in order to control and increase the efficiency of the assembly process. GTPases of the TRAFAC (translation-factor-related) class constitute a major type of ribosome-assembly factor in Eukaryota and Bacteria. They are thought to aid the stepwise assembly of ribosomal subunits through a 'molecular switch' mechanism that involves conformational changes in response to GTP hydrolysis. Most conserved TRAFAC GTPases are involved in ribosome assembly or other translation-associated processes. They typically interact with ribosomal subunits, but in many cases, the exact role that these GTPases play remains unclear. Previous studies almost exclusively focused on the systems of Bacteria and Eukaryota. Archaea possess several conserved TRAFAC GTPases as well, with some GTPase families being present only in the archaeo-eukaryotic lineage. In the present paper, we review the occurrence of TRAFAC GTPases with translation-associated functions in Archaea.

  18. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Directory of Open Access Journals (Sweden)

    Katherine E. Sloan

    2013-10-01

    Full Text Available Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2 homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP. We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  19. The other lives of ribosomal proteins

    Directory of Open Access Journals (Sweden)

    Bhavsar Rital B

    2010-06-01

    Full Text Available Abstract Despite the fact that ribosomal proteins are the constituents of an organelle that is present in every cell, they show a surprising level of regulation, and several of them have also been shown to have other extra-ribosomal functions, such in replication, transcription, splicing or even ageing. This review provides a comprehensive summary of these important aspects.

  20. 云南保山和普洱地区带绦虫线粒体DNA基因编码核糖体RNA小亚基基因序列分析%Analysis of the mitochondrial DNA-gene encoding ribosomal RNA small subunit gene sequence of Taenia cestode from Baoshan and Puer areas in Yunnan Province

    Institute of Scientific and Technical Information of China (English)

    刘爱波; 杨毅梅

    2011-01-01

    Objective To identify Taenia cestodes specimens collected from Baoshan and Puer regions of Yunnan Province by analyzing mitochondrial DNA gene encoding ribosomal RNA small subunit (mtDNA-12S rRNA) gene sequence. Methods The adult Taenia cestode samples were collected from Baoshan and Puer regions of Yunnan Province. The genomic DNA was extracted and mtDNA-12S rRAN gene was amplified by polymerase chain reaction (PCR), then sequenced.Combined with the known mtDNA-12S rRNA gene sequence of Taenia solium, Taenia saginata,Taenia asiatica in GenBank, homology tree and phylogenetic tree were constructed by DNA MAN software. Results Taenia cestode homology tree and phylogenetic tree showed that gene sequences of BS1, BS2, BS4 and BS5 were most close to YZ with identity of 99% and those of BS3, BS6, BST,PE1 and PE2 were most close to ND with identity of 99%. Conclusions Taenia saginata and Taenia asiatica can be found in Baoshan area, while Taenia saginata can be found in Puer area. The gene sequence of mtDNA-12S rRNA can be used for clarifying the three types of Taenia cestode.%目的 利用线粒体DNA基因编码核糖体RNA小亚基(mtDNA-12S rRNA)基因序列分析对采自云南保山、普洱地区的带绦虫标本进行鉴定.方法 选取保山(7条,BS1-BS7)、普洱(2条,PE1~PE2)带绦虫成虫节片,抽提基因组DNA,PCR扩增mtDNA-12S rRNA基因序列,并测序;结合GenBank中已知的猪带绦虫(ZD)、牛带绦虫(ND)、亚洲带绦虫(YZ)mtDNA-12S rRNA基因序列,经DNA MAN软件处理后构建同源树状图与系统发育树状图.结果 带绦虫同源树与系统发育树状图显示,BS1、BS2、BS4、BS5与YZ的同源性最近(99%).BS3、BS6、BS7、PE1、PE2与ND的同源性最近(99%).结论 云南保山存在牛带绦虫与亚洲带绦虫,普洱存在牛带绦虫,mtDNA-12S rRNA基因序列可用于三种带绦虫的分类研究.

  1. How Amino Acids and Peptides Shaped the RNA World

    NARCIS (Netherlands)

    Gulik, P.T.S. van der; Speijer, D.

    2015-01-01

    The “RNA world” hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this

  2. Mutations of ribosomal protein S5 suppress a defect in late-30S ribosomal subunit biogenesis caused by lack of the RbfA biogenesis factor.

    Science.gov (United States)

    Nord, Stefan; Bhatt, Monika J; Tükenmez, Hasan; Farabaugh, Philip J; Wikström, P Mikael

    2015-08-01

    The in vivo assembly of ribosomal subunits requires assistance by maturation proteins that are not part of mature ribosomes. One such protein, RbfA, associates with the 30S ribosomal subunits. Loss of RbfA causes cold sensitivity and defects of the 30S subunit biogenesis and its overexpression partially suppresses the dominant cold sensitivity caused by a C23U mutation in the central pseudoknot of 16S rRNA, a structure essential for ribosome function. We have isolated suppressor mutations that restore partially the growth of an RbfA-lacking strain. Most of the strongest suppressor mutations alter one out of three distinct positions in the carboxy-terminal domain of ribosomal protein S5 (S5) in direct contact with helix 1 and helix 2 of the central pseudoknot. Their effect is to increase the translational capacity of the RbfA-lacking strain as evidenced by an increase in polysomes in the suppressed strains. Overexpression of RimP, a protein factor that along with RbfA regulates formation of the ribosome's central pseudoknot, was lethal to the RbfA-lacking strain but not to a wild-type strain and this lethality was suppressed by the alterations in S5. The S5 mutants alter translational fidelity but these changes do not explain consistently their effect on the RbfA-lacking strain. Our genetic results support a role for the region of S5 modified in the suppressors in the formation of the central pseudoknot in 16S rRNA.

  3. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells.

    Science.gov (United States)

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A; Johnson, Rory

    2016-06-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent of expressed lncRNAs are detected in the cytoplasm. The majority of these (70%) have >50% of their cytoplasmic copies associated with polysomal fractions. These interactions are lost upon disruption of ribosomes by puromycin. Polysomal lncRNAs are distinguished by a number of 5' mRNA-like features, including capping and 5'UTR length. On the other hand, nonpolysomal "free cytoplasmic" lncRNAs have more conserved promoters and a wider range of expression across cell types. Exons of polysomal lncRNAs are depleted of endogenous retroviral insertions, suggesting a role for repetitive elements in lncRNA localization. Finally, we show that blocking of ribosomal elongation results in stabilization of many associated lncRNAs. Together these findings suggest that the ribosome is the default destination for the majority of cytoplasmic long noncoding RNAs and may play a role in their degradation.

  4. Covalent modifications of ribosomal proteins in growing and aggregation-competent dictyostelium discoideum: phosphorylation and methylation.

    Science.gov (United States)

    Ramagopal, S

    1991-04-01

    Phosphorylated and methylated ribosomal proteins were identified in vegetatively growing amoebae and in the starvation-induced, aggregation-competent cells of Dictyostelium discoideum. Of the 15 developmentally regulated cell-specific ribosomal proteins reported earlier, protein A and the acidic proteins A1, A2, and A3 were identified as phosphoproteins, and S5, S6, S10, and D were identified as methylated proteins. Three other ribosomal proteins were phosphorylated and 19 others methylated. S19, L13, A1, A2, and A3 were the predominant phosphoproteins in growing amoebae, whereas S20 and A were the predominant ones in the aggregation-competent cells. Among the methylated proteins, eight (S6, S10, S13, S30, D, L1, L2, and L31) were modified only during growth phase, six (S5, S7, S8, S24, S31, and L36) were altered only during aggregation-competent phase, and nine (S9, S27, S28, S29, S34, L7, L35, L41, and L42) were modified under both phases. Five proteins (S6, S24, L7, L41, and L42) were heavily methylated and of these, the large subunit proteins were present in both growing amoebae and aggregation-competent cells. These findings demonstrate that covalent modification of specific ribosomal proteins is regulated during cell differentiation in D. discoideum.

  5. The RIN: an RNA integrity number for assigning integrity values to RNA measurements

    OpenAIRE

    Gassmann Marcus; Leiber Michael; Salowsky Ruediger; Stocker Susanne; Mueller Odilo; Schroeder Andreas; Lightfoot Samar; Menzel Wolfram; Granzow Martin; Ragg Thomas

    2006-01-01

    Abstract Background The integrity of RNA molecules is of paramount importance for experiments that try to reflect the snapshot of gene expression at the moment of RNA extraction. Until recently, there has been no reliable standard for estimating the integrity of RNA samples and the ratio of 28S:18S ribosomal RNA, the common measure for this purpose, has been shown to be inconsistent. The advent of microcapillary electrophoretic RNA separation provides the basis for an automated high-throughpu...

  6. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

    Science.gov (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  7. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation.

    Directory of Open Access Journals (Sweden)

    Svetlana Minakhina

    Full Text Available Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein complexes and also controls RNA of select Transposable Elements (TEs. Here we show that in Zfrp8/PDCD2 knock down (KD ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S small ribosomal subunit through direct interaction with RpS2 (uS5. By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation.

  8. Structure-Activity Relationships of Diverse Oxazolidinones for Linezolid-Resistant Staphylococcus aureus Strains Possessing the cfr Methyltransferase Gene or Ribosomal Mutations▿

    OpenAIRE

    Locke, Jeffrey B.; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; Kedar, G. C.; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L.

    2010-01-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZDr) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-ring...

  9. A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling

    Science.gov (United States)

    Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

    2017-01-01

    Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529

  10. Induction of ribosomal subunits misassembly by antisense RNAs to control cell growth.

    Science.gov (United States)

    Mangiarotti, G

    2000-08-25

    The assembly of ribosomal subunits starting from free ribosomal RNA and protein of Dictyostelium discoideum was induced in vitro in the presence of several oligoribonucleotides complementary to defined sequences of ribosomal RNA. The reconstituted particles had a full complement of ribosomal proteins, but did not function in an in vitro protein synthesis system and were disassembled following interaction with mRNA. The same result was obtained in vivo by fusing the oligodeossiribonucleotides coding for the selected oligoribonucleotides to the promoter of the gene coding for contact site A protein. This gene is expressed only in the first part of development. Transfected growing cells, transferred in developing buffer in the presence of pulses of cAMP, accumulated significant amounts of the oligoribonucleotides. When retransferred to the growth medium, they grew progressively more slowly, until their doubling time doubled, apparently due to the availability of a limiting amount of functional ribosomes. To avoid disassembly of misassembled subunits (G. Mangiarotti et al., 1997, J. Biol. Chem. 272, 27818-27822), two oligoribonucleotides complementary to sequences present at the 5' ends of pre-17S and pre-26S RNAs were also induced to accumulate during early development with the same technique. When transfected cells were retransferred to the growth medium, their rate of growth declined rapidly to zero and cells died, apparently because they were unable to disassemble misassembled ribosomal subunits and avoid their entry into polyribosomes. This technique to perturb protein synthesis, arrest cell growth, and cause cell suicide will be tested in abnormally growing animal cells.

  11. Molecular interactions of ribosomal components. IV: Cooperative interactions during assembly in vitro.

    Science.gov (United States)

    Green, M; Kurland, C G

    1973-08-01

    Cooperative interactions between different 30S ribosomal proteins during assembly in vitro are described. The site specific binding of S7 to 16S RNA is enhanced by S20; that of S16 requires S4 and S20; and S7 is required for the maximum binding of S9, S13 and S19. Some of these interactions are reflected in the protein neighborhoods of the functional ribosome, but this may not be a general rule. Finally, we suggest that the assembly cooperativety observed may not be a consequence of direct-protein interactions.

  12. Translational Maintenance of Frame: Mutants of Saccharomyces Cerevisiae with Altered -1 Ribosomal Frameshifting Efficiences

    OpenAIRE

    Dinman, J D; Wickner, R B

    1994-01-01

    A special site on the (+) strand of the L-A dsRNA virus induces about 2% of ribosomes translating the gag open reading frame to execute a -1 frameshift and thus produce the viral gag-pol fusion protein. Using constructs in which a -1 ribosomal frameshift at this site was necessary for expression of lacZ we isolated chromosomal mutants in which the efficiency of frameshifting was increased. These mutants comprise eight genes, named mof (maintenance of frame). The mof1-1, mof2-1, mof4-1, mof5-1...

  13. Inhibition of protein synthesis on the ribosome by tildipirosin compared with other veterinary macrolides.

    Science.gov (United States)

    Andersen, Niels Møller; Poehlsgaard, Jacob; Warrass, Ralf; Douthwaite, Stephen

    2012-11-01

    Tildipirosin is a 16-membered-ring macrolide developed to treat bacterial pathogens, including Mannheimia haemolytica and Pasteurella multocida, that cause respiratory tract infections in cattle and swine. Here we evaluated the efficacy of tildipirosin at inhibiting protein synthesis on the ribosome (50% inhibitory concentration [IC(50)], 0.23 ± 0.01 μM) and compared it with the established veterinary macrolides tylosin, tilmicosin, and tulathromycin. Mutation and methylation at key rRNA nucleotides revealed differences in the interactions of these macrolides within their common ribosomal binding site.

  14. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...... of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms....

  15. Variation in the ribosome interacting loop of the Sec61α from Giardia lamblia.

    Science.gov (United States)

    Sinha, Abhishek; Ray, Atrayee; Ganguly, Sandipan; Ghosh Dastidar, Shubhra; Sarkar, Srimonti

    2015-09-30

    The interaction between the ribosome and the endoplasmic reticulum-located Sec61 protein translocon is mediated through an arginine residue of Sec61α, which is conserved in all prokaryotic and eukaryotic orthologues characterized to date. Using in silico approaches we report that instead of arginine, this ribosome-interaction function is most likely discharged by a lysine residue in the protist Giardia lamblia. This functional substitution of the R with a K in GlSec61α may have taken place to accommodate a G-rich rRNA.

  16. Nanometer scale pores similar in size to the entrance of the ribosomal exit cavity are a common feature of large RNAs

    Science.gov (United States)

    Rivas, Mario; Tran, Quyen; Fox, George E.

    2013-01-01

    The highly conserved peptidyl transferase center (PTC) of the ribosome contains an RNA pore that serves as the entrance to the exit tunnel. Analysis of available ribosome crystal structures has revealed the presence of multiple additional well-defined pores of comparable size in the ribosomal (rRNA) RNAs. These typically have dimensions of 1–2 nm, with a total area of ∼100 Å2 or more, and most are associated with one or more ribosomal proteins. The PTC example and the other rRNA pores result from the packing of helices. However, in the non-PTC cases the nitrogenous bases do not protrude into the pore, thereby limiting the potential for hydrogen bonding within the pore. Instead, it is the RNA backbone that largely defines the pore likely resulting in a negatively charged environment. In many but not all cases, ribosomal proteins are associated with the pores to a greater or lesser extent. With the exception of the PTC case, the large subunit pores are not found in what are thought to be the evolutionarily oldest regions of the 23S rRNA. The unusual nature of the PTC pore may reflect a history of being created by hybridization between two or more RNAs early in evolution rather than simple folding of a single RNA. An initial survey of nonribosomal RNA crystal structures revealed additional pores, thereby showing that they are likely a general feature of RNA tertiary structure. PMID:23940386

  17. The parable of the caveman and the Ferrari: protein synthesis and the RNA world.

    Science.gov (United States)

    Noller, Harry F

    2017-03-19

    The basic steps of protein synthesis are carried out by the ribosome, a very large and complex ribonucleoprotein particle. In keeping with its proposed emergence from an RNA world, all three of its core mechanisms-aminoacyl-tRNA selection, catalysis of peptide bond formation and coupled translocation of mRNA and tRNA-are embodied in the properties of ribosomal RNA, while its proteins play a supportive role.This article is part of the themed issue 'Perspectives on the ribosome'.

  18. Antibiotic inhibition of the movement of tRNA substrates through a peptidyl transferase cavity

    DEFF Research Database (Denmark)

    Porse, B T; Rodriguez-Fonseca, C; Leviev, I;

    1996-01-01

    The present review attempts to deal with movement of tRNA substrates through the peptidyl transferase centre on the large ribosomal subunit and to explain how this movement is interrupted by antibiotics. It builds on the concept of hybrid tRNA states forming on ribosomes and on the observed movem...

  19. Identification of cell-specific targets of sumoylation during mouse spermatogenesis.

    Science.gov (United States)

    Xiao, Yuxuan; Pollack, Daniel; Andrusier, Miriam; Levy, Avi; Callaway, Myrasol; Nieves, Edward; Reddi, Prabhakara; Vigodner, Margarita

    2016-02-01

    Recent findings suggest diverse and potentially multiple roles of small ubiquitin-like modifier (SUMO) in testicular function and spermatogenesis. However, SUMO targets remain uncharacterized in the testis due to the complex multicellular nature of testicular tissue, the inability to maintain and manipulate spermatogenesis in vitro, and the technical challenges involved in identifying low-abundance endogenous SUMO targets. In this study, we performed cell-specific identification of sumoylated proteins using concentrated cell lysates prepared with de-sumoylation inhibitors from freshly purified spermatocytes and spermatids. One-hundred and twenty proteins were uniquely identified in the spermatocyte and/or spermatid fractions. The identified proteins are involved in the regulation of transcription, stress response, microRNA biogenesis, regulation of major enzymatic pathways, nuclear-cytoplasmic transport, cell-cycle control, acrosome biogenesis, and other processes. Several proteins with important roles during spermatogenesis were chosen for further characterization by co-immunoprecipitation, co-localization, and in vitro sumoylation studies. GPS-SUMO Software was used to identify consensus and non-consensus sumoylation sites within the amino acid sequences of the proteins. The analyses confirmed the cell-specific sumoylation and/or SUMO interaction of several novel, previously uncharacterized SUMO targets such as CDK1, RNAP II, CDC5, MILI, DDX4, TDP-43, and STK31. Furthermore, several proteins that were previously identified as SUMO targets in somatic cells (KAP1 and MDC1) were identified as SUMO targets in germ cells. Many of these proteins have a unique role in spermatogenesis and during meiotic progression. This research opens a novel avenue for further studies of SUMO at the level of individual targets.

  20. Identification of cell-specific targets of sumoylation during mouse spermatogenesis

    Science.gov (United States)

    Xiao, Yuxuan; Pollack, Daniel; Andrusier, Miriam; Levy, Avi; Callaway, Myrasol; Nieves, Edward; Reddi, Prabhakara; Vigodner, Margarita

    2015-01-01

    Recent findings suggest diverse and potentially multiple roles of SUMO in testicular function and spermatogenesis. However, SUMO targets remain uncharacterized in the testis due to the complex multicellular nature of testicular tissue, the inability to maintain and manipulate spermatogenesis in vitro, and the technical challenges involved in identifying low-abundance endogenous SUMO targets. In this study, we performed cell-specific identification of sumoylated proteins using concentrated cell lysates prepared with de-sumoylation inhibitors from freshly purified spermatocytes and spermatids. One-hundred and twenty proteins were uniquely identified in the spermatocyte and/or spermatid fractions. The identified proteins are involved in the regulation of transcription, stress response, microRNA biogenesis, regulation of major enzymatic pathways, nuclear-cytoplasmic transport, cell cycle control, acrosome biogenesis, and other processes. Several proteins with important roles during spermatogenesis were chosen for further characterization by co-immunoprecipitation, co-localization and in-vitro sumoylation studies. GPS-SUMO software was used to identify consensus and non-consensus sumoylation sites within the amino acid sequences of the proteins. The analyses confirmed the cell-specific sumoylation and/or SUMO interaction of several novel, previously uncharacterized SUMO targets such as CDK1, RNAP II, CDC5, MILI, DDX4, TDP-43 and STK31. Furthermore, several proteins that were previously identified as SUMO targets in somatic cells (e.g., KAP1, MDC1) were identified as SUMO targets in germ cells. Many of these proteins have a unique role in spermatogenesis and during meiotic progression. This research opens a novel avenue for further studies of SUMO at the level of individual targets. PMID:26701181

  1. Transient ribosomal attenuation coordinates protein synthesis and co-translational folding.

    Science.gov (United States)

    Zhang, Gong; Hubalewska, Magdalena; Ignatova, Zoya

    2009-03-01

    Clustered codons that pair to low-abundance tRNA isoacceptors can form slow-translating regions in the mRNA and cause transient ribosomal arrest. We report that folding efficiency of the Escherichia coli multidomain protein SufI can be severely perturbed by alterations in ribosome-mediated translational attenuation. Such alterations were achieved by global acceleration of the translation rate with tRNA excess in vitro or by synonymous substitutions to codons with highly abundant tRNAs both in vitro and in vivo. Conversely, the global slow-down of the translation rate modulated by low temperature suppresses the deleterious effect of the altered translational attenuation pattern. We propose that local discontinuous translation temporally separates the translation of segments of the peptide chain and actively coordinates their co-translational folding.

  2. Association of a multi-synthetase complex with translating ribosomes in the archaeon Thermococcus kodakarensis

    DEFF Research Database (Denmark)

    Raina, Medha; Elgamal, Sara; Santangelo, Thomas J;

    2012-01-01

    that components of the archaeal protein synthesis machinery associate into macromolecular assemblies in vivo and provide the potential to increase translation efficiency by limiting substrate diffusion away from the ribosome, thus facilitating rapid recycling of tRNAs. STRUCTURED SUMMARY OF PROTEIN INTERACTIONS...... with several other factors involved in protein synthesis, suggesting that MSCs may interact directly with translating ribosomes. In support of this hypothesis, the aminoacyl-tRNA synthetase (aaRS) activities of the MSC were enriched in isolated T. kodakarensis polysome fractions. These data indicate......)-triphosphatase 205, thiamine monophosphate kinase 179, pyruvate formate lyase family activating protein 298, 3-hydroxy-3-methylglutaryl-CoA reductase (mevanolate), N(2), N(2)-dimethylguanosine tRNA methyltransferase 145, N2, N2-dimethylguanosine tRNA methyltransferase 170, putative 5-methylcytosine restriction...

  3. Hold on to your friends: Dedicated chaperones of ribosomal proteins: Dedicated chaperones mediate the safe transfer of ribosomal proteins to their site of pre-ribosome incorporation.

    Science.gov (United States)

    Pillet, Benjamin; Mitterer, Valentin; Kressler, Dieter; Pertschy, Brigitte

    2017-01-01

    Eukaryotic ribosomes are assembled from their components, the ribosomal RNAs and ribosomal proteins, in a tremendously complex, multi-step process, which primarily takes place in the nuclear compartment. Therefore, most ribosomal proteins have to travel from the cytoplasm to their incorporation site on pre-ribosomes within the nucleus. However, due to their particular characteristics, such as a highly basic amino acid composition and the presence of unstructured extensions, ribosomal proteins are especially prone to aggregation and degradation in their unassembled state, hence specific mechanisms must operate to ensure their safe delivery. Recent studies have uncovered a group of proteins, termed dedicated chaperones, specialized in accompanying and guarding individual ribosomal proteins. In this essay, we review how these dedicated chaperones utilize different folds to interact with their ribosomal protein clients and how they ensure their soluble expression and interconnect their intracellular transport with their efficient assembly into pre-ribosomes.

  4. The DEAD box protein Mrh4 functions in the assembly of the mitochondrial large ribosomal subunit.

    Science.gov (United States)

    De Silva, Dasmanthie; Fontanesi, Flavia; Barrientos, Antoni

    2013-11-01

    Proteins in a cell are universally synthesized by ribosomes. Mitochondria contain their own ribosomes, which specialize in the synthesis of a handful of proteins required for oxidative phosphorylation. The pathway of mitoribosomal biogenesis and factors involved are poorly characterized. An example is the DEAD box proteins, widely known to participate in the biogenesis of bacterial and cytoplasmic eukaryotic ribosomes as either RNA helicases or RNA chaperones, whose mitochondrial counterparts remain completely unknown. Here, we have identified the Saccharomyces cerevisiae mitochondrial DEAD box protein Mrh4 as essential for large mitoribosome subunit biogenesis. Mrh4 interacts with the 21S rRNA, mitoribosome subassemblies, and fully assembled mitoribosomes. In the absence of Mrh4, the 21S rRNA is matured and forms part of a large on-pathway assembly intermediate missing proteins Mrpl16 and Mrpl39. We conclude that Mrh4 plays an essential role during the late stages of mitoribosome assembly by promoting remodeling of the 21S rRNA-protein interactions.

  5. 黄精核糖体灭活蛋白双元表达载体的构建与鉴定%Construction of Binary Vector pGV4945 of Ribosome-Inactivating Protein Gene from Polygonatum multiflorum

    Institute of Scientific and Technical Information of China (English)

    常维山; Henry De Greve; 翟静; Nele Buys; Jan Pierre Hernal Steens

    2004-01-01

    Ribosome-inactivating proteins (RIPs)have been known to have cytotoxic activity by cleaving a specific adenine residue of 28S rRNA. RIPs can be divided into, type 1 and type 2. Type 2 is a toxic protein that was consisted of two Gal/GalNAc-binding chains, A and B Chains that connected through a disulfide linkage. The A chain of RIP has RNA N-glycosidase activity to cleave a specific adenine base from ribosomal RNA,

  6. The aminoglycoside resistance methyltransferases from the ArmA/Rmt family operate late in the 30S ribosomal biogenesis pathway.

    Science.gov (United States)

    Zarubica, Tamara; Baker, Matthew R; Wright, H Tonie; Rife, Jason P

    2011-02-01

    Bacterial resistance to 4,6-type aminoglycoside antibiotics, which target the ribosome, has been traced to the ArmA/RmtA family of rRNA methyltransferases. These plasmid-encoded enzymes transfer a methyl group from S-adenosyl-L-methionine to N7 of the buried G1405 in the aminoglycoside binding site of 16S rRNA of the 30S ribosomal subunit. ArmA methylates mature 30S subunits but not 16S rRNA, 50S, or 70S ribosomal subunits or isolated Helix 44 of the 30S subunit. To more fully characterize this family of enzymes, we have investigated the substrate requirements of ArmA and to a lesser extent its ortholog RmtA. We determined the Mg+² dependence of ArmA activity toward the 30S ribosomal subunits and found that the enzyme recognizes both low Mg+² (translationally inactive) and high Mg+² (translationally active) forms of this substrate. We tested the effects of LiCl pretreatment of the 30S subunits, initiation factor 3 (IF3), and gentamicin/kasugamycin resistance methyltransferase (KsgA) on ArmA activity and determined whether in vivo derived pre-30S ribosomal subunits are ArmA methylation substrates. ArmA failed to methylate the 30S subunits generated from LiCl washes above 0.75 M, despite the apparent retention of ribosomal proteins and a fully mature 16S rRNA. From our experiments, we conclude that ArmA is most active toward the 30S ribosomal subunits that are at or very near full maturity, but that it can also recognize more than one form of the 30S subunit.

  7. 采用rDNA测序的方法鉴定1株祖菲无绿藻碳水化合物变种%Identification of a strain Prototheca zopfii var. hydrocarbonea by analyzing the sequence of ribosome RNA gene

    Institute of Scientific and Technical Information of China (English)

    刘素玲; 冉玉平; 何晓丹; 张东兴; 代亚玲

    2007-01-01

    A strain of Prototheca species isolated from a case of meningitis was identified by routine morphologic and biochemical methods as well as amplification of the related genes, in which the 28S large-subunit (LSU) region of ribosomal RNA (rRNA) gene and intergenic space (ITS) were amplified with universal fungal primers. The small-subunit (SSU) rRNA gene was amplified with eukaryote-specific primers and Prototheca genus-specific primers. Then, compared the sequences with the ones posted on BLAST (www. ncbi. nlm. nih. gov/BLAST). The organism choice giving the closest match, up to 99%, was considered the most likely correct identification. It was found that this strain of fungus grew well at 25 ℃ or 37 ℃. Smooth,moist colonies with white color were observed on Sabouraud Dextrose Agar (SDA) and Potato Dextrose Agar (PDA). Microscopically, globular or ovoid cells, a number of round, ovoid shaped endospores could be observed. No hypha, ascus or blastic conidia was found upon cultivation on SDA. Based on the morphological characteristics, this isolate could be identified as Prototheca species. The identity with Prototheca wickerhamii was 2.9 % as demonstrated by the API 20C AUX system. Sequence analysis showed that the ITS gene was proved to be a complex structural region which was not suitable for the identification of Prototheca species, but the LSU and SSU rDNA regions showed 94% and 99.9% sequence identities with Prototheca zopfii var. hydrocarbonea (P. zopfii var. hydrocarbonea) respectively, indicating that the SSU rRNA gene sequence might be more reliable on than the LSU rRNA gene sequence for identification of Prototheca species.%目的 鉴定1株由脑膜炎患者分离的无绿藻菌株.方法 常规的形态学、生化方法及扩增相关基因序列进行菌种鉴定.选用真菌通用引物扩增核糖RNA(rRNA)28S大亚基(LSU)、核糖体内转录间区(ITS)DNA;真核细胞特异性引物及无绿藻种属特异性引物扩增核糖体18S小亚基(SSU

  8. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    degree of evolutionary conservation of the cellular MMSM tend to support this view. However, under certain selective conditions the machinery itself may be targeted by adaptive mutations, which result in fitness-increasing phenotypic changes. Here we investigate and characterize the role of ribosomal...... mutations in adaptive evolution. Methods: Several mutations in ribosomal genes have been identified in the genome analysis of nearly 700 Pseudomonas aeruginosa isolates from infected cystic fibrosis patients. Among these mutations we have repeatedly identified insertions, deletions and substitutions...... in specific ribosomal genes. The bacterial phenotypes of the mutated strains will be investigated. Results: Preliminary assays show that mutant strains have reduced growth rate and an altered antibiotic resistance pattern. The selection for mutations in ribosomal protein genes is partly explainable...

  9. Ribosome Inactivating Proteins from Rosaceae

    Directory of Open Access Journals (Sweden)

    Chenjing Shang

    2016-08-01

    Full Text Available Ribosome-inactivating proteins (RIPs are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins.

  10. Ribosome Inactivating Proteins from Rosaceae.

    Science.gov (United States)

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-08-22

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins.

  11. Distinct response of yeast ribosomes to a miscoding event during translation.

    Science.gov (United States)

    Eyler, Daniel E; Green, Rachel

    2011-05-01

    Numerous mechanisms have evolved to control the accuracy of translation, including a recently discovered retrospective quality control mechanism in bacteria. This quality control mechanism is sensitive to perturbations in the codon:anticodon interaction in the P site of the ribosome that trigger a dramatic loss of fidelity in subsequent tRNA and release factor selection events in the A site. These events ultimately lead to premature termination of translation in response to an initial miscoding error. In this work, we extend our investigations of this mechanism to an in vitro reconstituted Saccharomyces cerevisiae translation system. We report that yeast ribosomes do not respond to mismatches in the P site by loss of fidelity in subsequent substrate recognition events. We conclude that retrospective editing, as initially characterized in Escherichia coli, does not occur in S. cerevisiae. These results highlight potential mechanistic differences in the functional core of highly conserved ribosomes.

  12. High resolution structure of the large ribosomal subunit from a Mesophilic Eubacterium

    Energy Technology Data Exchange (ETDEWEB)

    Harms, Joerg; Schluenzen, Frank; Zarivach, Raz; Bashan, Anat; Gat, Sharon; Agmon, Ilana; Bartels, Heike; Franceschi, Francois; Yonath, Ada (Weizmann Inst Israel); (Mac Planck Germany); (Max Planck Germany)

    2009-10-07

    We describe the high resolution structure of the large ribosomal subunit from Deinococcus radiodurans (D50S), a gram-positive mesophile suitable for binding of antibiotics and functionally relevant ligands. The over-all structure of D50S is similar to that from the archae bacterium Haloarcula marismortui (H50S); however, a detailed comparison revealed significant differences, for example, in the orientation of nucleotides in peptidyl transferase center and in the structures of many ribosomal proteins. Analysis of ribosomal features involved in dynamic aspects of protein biosynthesis that are partially or fully disordered in H50S revealed the conformations of intersubunit bridges in unbound subunits, suggesting how they may change upon subunit association and how movements of the L1-stalk may facilitate the exit of tRNA.

  13. The control of accuracy during protein synthesis in Escherichia coli and perturbations of this control by streptomycin, neomycin, or ribosomal mutations.

    Science.gov (United States)

    Brakier-Gingras, L; Phoenix, P

    1984-05-01

    This review surveys the different experimental approaches which describe the binding of tRNA to mRNA-programmed ribosomes and the control of tRNA selection. This selection is best described by the two-step model proposed by Hopfield and demonstrated by Thompson and his collaborators. The model involves a first control at the initial reversible binding of tRNA to the ribosome and a second control, the proofreading control, which promotes rejection of the incorrect tRNA from a high-energy intermediate during the transition from the initial to the final binding state. Streptomycin, neomycin, and ribosomal fidelity mutations appear to affect both control steps. Their effect can be related to the location of the mutated ribosomal proteins and to the conformational changes induced in the ribosome by the misreading agents. An alteration of the first control probably results from a distortion of the codon-anticodon interaction, while an alteration of the second control may be caused by a change in the association between ribosomal subunits.

  14. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    Science.gov (United States)

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-08

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated tr