WorldWideScience

Sample records for cdna deep sequencing

  1. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  2. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  3. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  4. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  5. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  7. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  8. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  11. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  12. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  13. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  14. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  15. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  16. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  17. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  18. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  19. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  20. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  1. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  2. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  3. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  4. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  5. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  6. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  7. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  8. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  9. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  10. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  11. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  12. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  13. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  14. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  15. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  16. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  17. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  18. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Science.gov (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  19. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  20. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  1. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  2. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  3. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  4. DeepSimulator: a deep simulator for Nanopore sequencing

    KAUST Repository

    Li, Yu; Han, Renmin; Bi, Chongwei; Li, Mo; Wang, Sheng; Gao, Xin

    2017-01-01

    or assembled contigs, we simulate the electrical current signals by a context-dependent deep learning model, followed by a base-calling procedure to yield simulated reads. This workflow mimics the sequencing procedure more naturally. The thorough experiments

  5. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  6. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    Science.gov (United States)

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  7. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  8. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  9. DNA Replication Profiling Using Deep Sequencing.

    Science.gov (United States)

    Saayman, Xanita; Ramos-Pérez, Cristina; Brown, Grant W

    2018-01-01

    Profiling of DNA replication during progression through S phase allows a quantitative snap-shot of replication origin usage and DNA replication fork progression. We present a method for using deep sequencing data to profile DNA replication in S. cerevisiae.

  10. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  11. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  12. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  13. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  14. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  15. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  16. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  17. Quantitative phenotyping via deep barcode sequencing.

    Science.gov (United States)

    Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

    2009-10-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

  18. DeepSimulator: a deep simulator for Nanopore sequencing

    KAUST Repository

    Li, Yu

    2017-12-23

    Motivation: Oxford Nanopore sequencing is a rapidly developed sequencing technology in recent years. To keep pace with the explosion of the downstream data analytical tools, a versatile Nanopore sequencing simulator is needed to complement the experimental data as well as to benchmark those newly developed tools. However, all the currently available simulators are based on simple statistics of the produced reads, which have difficulty in capturing the complex nature of the Nanopore sequencing procedure, the main task of which is the generation of raw electrical current signals. Results: Here we propose a deep learning based simulator, DeepSimulator, to mimic the entire pipeline of Nanopore sequencing. Starting from a given reference genome or assembled contigs, we simulate the electrical current signals by a context-dependent deep learning model, followed by a base-calling procedure to yield simulated reads. This workflow mimics the sequencing procedure more naturally. The thorough experiments performed across four species show that the signals generated by our context-dependent model are more similar to the experimentally obtained signals than the ones generated by the official context-independent pore model. In terms of the simulated reads, we provide a parameter interface to users so that they can obtain the reads with different accuracies ranging from 83% to 97%. The reads generated by the default parameter have almost the same properties as the real data. Two case studies demonstrate the application of DeepSimulator to benefit the development of tools in de novo assembly and in low coverage SNP detection. Availability: The software can be accessed freely at: https://github.com/lykaust15/DeepSimulator.

  19. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  20. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  1. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  2. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  3. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  4. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  5. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  6. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

    International Nuclear Information System (INIS)

    Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

    1988-01-01

    Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

  7. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  8. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves

    2015-11-01

    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  9. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    Science.gov (United States)

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  10. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  11. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  12. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  13. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  14. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  15. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  16. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  17. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  18. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

  19. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    International Nuclear Information System (INIS)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-01-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

  20. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  1. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  2. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  3. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  4. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  5. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  6. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  7. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  8. Analysis of xylem formation in pine by cDNA sequencing

    Science.gov (United States)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  9. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  10. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  11. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  12. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  13. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  14. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  15. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  16. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  17. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  18. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  19. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  20. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  1. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  2. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  3. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  4. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  5. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  6. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  7. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  8. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    Science.gov (United States)

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Geoseq: a tool for dissecting deep-sequencing datasets

    Directory of Open Access Journals (Sweden)

    Homann Robert

    2010-10-01

    Full Text Available Abstract Background Datasets generated on deep-sequencing platforms have been deposited in various public repositories such as the Gene Expression Omnibus (GEO, Sequence Read Archive (SRA hosted by the NCBI, or the DNA Data Bank of Japan (ddbj. Despite being rich data sources, they have not been used much due to the difficulty in locating and analyzing datasets of interest. Results Geoseq http://geoseq.mssm.edu provides a new method of analyzing short reads from deep sequencing experiments. Instead of mapping the reads to reference genomes or sequences, Geoseq maps a reference sequence against the sequencing data. It is web-based, and holds pre-computed data from public libraries. The analysis reduces the input sequence to tiles and measures the coverage of each tile in a sequence library through the use of suffix arrays. The user can upload custom target sequences or use gene/miRNA names for the search and get back results as plots and spreadsheet files. Geoseq organizes the public sequencing data using a controlled vocabulary, allowing identification of relevant libraries by organism, tissue and type of experiment. Conclusions Analysis of small sets of sequences against deep-sequencing datasets, as well as identification of public datasets of interest, is simplified by Geoseq. We applied Geoseq to, a identify differential isoform expression in mRNA-seq datasets, b identify miRNAs (microRNAs in libraries, and identify mature and star sequences in miRNAS and c to identify potentially mis-annotated miRNAs. The ease of using Geoseq for these analyses suggests its utility and uniqueness as an analysis tool.

  10. Deep sequencing as a method of typing bluetongue virus isolates.

    Science.gov (United States)

    Rao, Pavuluri Panduranga; Reddy, Yella Narasimha; Ganesh, Kapila; Nair, Shreeja G; Niranjan, Vidya; Hegde, Nagendra R

    2013-11-01

    Bluetongue (BT) is an economically important endemic disease of livestock in tropics and subtropics. In addition, its recent spread to temperate regions like North America and Northern Europe is of serious concern. Rapid serotyping and characterization of BT virus (BTV) is an essential step in the identification of origin of the virus and for controlling the disease. Serotyping of BTV is typically performed by serum neutralization, and of late by nucleotide sequencing. This report describes the near complete genome sequencing and typing of two isolates of BTV using Illumina next generation sequencing platform. Two of the BTV RNAs were multiplexed with ten other unknown samples. Viral RNA was isolated and fragmented, reverse transcribed, the cDNA ends were repaired and ligated with a multiplex oligo. The genome library was amplified using primers complementary to the ligated oligo and subjected to single and paired end sequencing. The raw reads were assembled using a de novo method and reference-based assembly was performed based on the contig data. Near complete sequences of all segments of BTV were obtained with more than 20× coverage, and single read sequencing method was sufficient to identify the genotype and serotype of the virus. The two viruses used in this study were typed as BTV-1 and BTV-9E. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  12. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  13. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  14. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  15. Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing.

    Science.gov (United States)

    Sahoo, Malaya K; Holubar, Marisa; Huang, ChunHong; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Waggoner, Jesse J; Troy, Stephanie B; Garcia-Garcia, Lourdes; Ferreyra-Reyes, Leticia; Maldonado, Yvonne; Pinsky, Benjamin A

    2017-07-01

    Oral poliovirus vaccine can mutate to regain neurovirulence. To date, evaluation of these mutations has been performed primarily on culture-enriched isolates by using conventional Sanger sequencing. We therefore developed a culture-independent, deep-sequencing method targeting the 5' untranslated region (UTR) and P1 genomic region to characterize vaccine-related poliovirus variants. Error analysis of the deep-sequencing method demonstrated reliable detection of poliovirus mutations at levels of vaccinated, asymptomatic children and their close contacts collected during a prospective cohort study in Veracruz, Mexico, revealed no vaccine-derived polioviruses. This was expected given that the longest duration between sequenced sample collection and the end of the most recent national immunization week was 66 days. However, we identified many low-level variants (Sabin serotypes, as well as vaccine-related viruses with multiple canonical mutations associated with phenotypic reversion present at high levels (>90%). These results suggest that monitoring emerging vaccine-related poliovirus variants by deep sequencing may aid in the poliovirus endgame and efforts to ensure global polio eradication. Copyright © 2017 Sahoo et al.

  16. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  17. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  18. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  19. Unified Deep Learning Architecture for Modeling Biology Sequence.

    Science.gov (United States)

    Wu, Hongjie; Cao, Chengyuan; Xia, Xiaoyan; Lu, Qiang

    2017-10-09

    Prediction of the spatial structure or function of biological macromolecules based on their sequence remains an important challenge in bioinformatics. When modeling biological sequences using traditional sequencing models, characteristics, such as long-range interactions between basic units, the complicated and variable output of labeled structures, and the variable length of biological sequences, usually lead to different solutions on a case-by-case basis. This study proposed the use of bidirectional recurrent neural networks based on long short-term memory or a gated recurrent unit to capture long-range interactions by designing the optional reshape operator to adapt to the diversity of the output labels and implementing a training algorithm to support the training of sequence models capable of processing variable-length sequences. Additionally, the merge and pooling operators enhanced the ability to capture short-range interactions between basic units of biological sequences. The proposed deep-learning model and its training algorithm might be capable of solving currently known biological sequence-modeling problems through the use of a unified framework. We validated our model on one of the most difficult biological sequence-modeling problems currently known, with our results indicating the ability of the model to obtain predictions of protein residue interactions that exceeded the accuracy of current popular approaches by 10% based on multiple benchmarks.

  20. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  1. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  2. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  3. Transcriptome sequences resolve deep relationships of the grape family.

    Science.gov (United States)

    Wen, Jun; Xiong, Zhiqiang; Nie, Ze-Long; Mao, Likai; Zhu, Yabing; Kan, Xian-Zhao; Ickert-Bond, Stefanie M; Gerrath, Jean; Zimmer, Elizabeth A; Fang, Xiao-Dong

    2013-01-01

    Previous phylogenetic studies of the grape family (Vitaceae) yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated.

  4. Transcriptome sequences resolve deep relationships of the grape family.

    Directory of Open Access Journals (Sweden)

    Jun Wen

    Full Text Available Previous phylogenetic studies of the grape family (Vitaceae yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated.

  5. Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh

    Science.gov (United States)

    2011-01-01

    Background Pigeonpea [Cajanus cajan (L.) Millspaugh], one of the most important food legumes of semi-arid tropical and subtropical regions, has limited genomic resources, particularly expressed sequence based (genic) markers. We report a comprehensive set of validated genic simple sequence repeat (SSR) markers using deep transcriptome sequencing, and its application in genetic diversity analysis and mapping. Results In this study, 43,324 transcriptome shotgun assembly unigene contigs were assembled from 1.696 million 454 GS-FLX sequence reads of separate pooled cDNA libraries prepared from leaf, root, stem and immature seed of two pigeonpea varieties, Asha and UPAS 120. A total of 3,771 genic-SSR loci, excluding homopolymeric and compound repeats, were identified; of which 2,877 PCR primer pairs were designed for marker development. Dinucleotide was the most common repeat motif with a frequency of 60.41%, followed by tri- (34.52%), hexa- (2.62%), tetra- (1.67%) and pentanucleotide (0.76%) repeat motifs. Primers were synthesized and tested for 772 of these loci with repeat lengths of ≥18 bp. Of these, 550 markers were validated for consistent amplification in eight diverse pigeonpea varieties; 71 were found to be polymorphic on agarose gel electrophoresis. Genetic diversity analysis was done on 22 pigeonpea varieties and eight wild species using 20 highly polymorphic genic-SSR markers. The number of alleles at these loci ranged from 4-10 and the polymorphism information content values ranged from 0.46 to 0.72. Neighbor-joining dendrogram showed distinct separation of the different groups of pigeonpea cultivars and wild species. Deep transcriptome sequencing of the two parental lines helped in silico identification of polymorphic genic-SSR loci to facilitate the rapid development of an intra-species reference genetic map, a subset of which was validated for expected allelic segregation in the reference mapping population. Conclusion We developed 550 validated genic

  6. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  7. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  8. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  9. Deep sequencing-based transcriptome analysis of Plutella xylostella larvae parasitized by Diadegma semiclausum

    Science.gov (United States)

    2011-01-01

    Background Parasitoid insects manipulate their hosts' physiology by injecting various factors into their host upon parasitization. Transcriptomic approaches provide a powerful approach to study insect host-parasitoid interactions at the molecular level. In order to investigate the effects of parasitization by an ichneumonid wasp (Diadegma semiclausum) on the host (Plutella xylostella), the larval transcriptome profile was analyzed using a short-read deep sequencing method (Illumina). Symbiotic polydnaviruses (PDVs) associated with ichneumonid parasitoids, known as ichnoviruses, play significant roles in host immune suppression and developmental regulation. In the current study, D. semiclausum ichnovirus (DsIV) genes expressed in P. xylostella were identified and their sequences compared with other reported PDVs. Five of these genes encode proteins of unknown identity, that have not previously been reported. Results De novo assembly of cDNA sequence data generated 172,660 contigs between 100 and 10000 bp in length; with 35% of > 200 bp in length. Parasitization had significant impacts on expression levels of 928 identified insect host transcripts. Gene ontology data illustrated that the majority of the differentially expressed genes are involved in binding, catalytic activity, and metabolic and cellular processes. In addition, the results show that transcription levels of antimicrobial peptides, such as gloverin, cecropin E and lysozyme, were up-regulated after parasitism. Expression of ichnovirus genes were detected in parasitized larvae with 19 unique sequences identified from five PDV gene families including vankyrin, viral innexin, repeat elements, a cysteine-rich motif, and polar residue rich protein. Vankyrin 1 and repeat element 1 genes showed the highest transcription levels among the DsIV genes. Conclusion This study provides detailed information on differential expression of P. xylostella larval genes following parasitization, DsIV genes expressed in the

  10. Deep whole-genome sequencing of 90 Han Chinese genomes.

    Science.gov (United States)

    Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

    2017-09-01

    Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000

  11. deepTools2: a next generation web server for deep-sequencing data analysis.

    Science.gov (United States)

    Ramírez, Fidel; Ryan, Devon P; Grüning, Björn; Bhardwaj, Vivek; Kilpert, Fabian; Richter, Andreas S; Heyne, Steffen; Dündar, Friederike; Manke, Thomas

    2016-07-08

    We present an update to our Galaxy-based web server for processing and visualizing deeply sequenced data. Its core tool set, deepTools, allows users to perform complete bioinformatic workflows ranging from quality controls and normalizations of aligned reads to integrative analyses, including clustering and visualization approaches. Since we first described our deepTools Galaxy server in 2014, we have implemented new solutions for many requests from the community and our users. Here, we introduce significant enhancements and new tools to further improve data visualization and interpretation. deepTools continue to be open to all users and freely available as a web service at deeptools.ie-freiburg.mpg.de The new deepTools2 suite can be easily deployed within any Galaxy framework via the toolshed repository, and we also provide source code for command line usage under Linux and Mac OS X. A public and documented API for access to deepTools functionality is also available. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Deep sequencing methods for protein engineering and design.

    Science.gov (United States)

    Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A

    2017-08-01

    The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  14. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  15. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

    Science.gov (United States)

    Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

    2013-04-01

    The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

  16. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  17. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    NARCIS (Netherlands)

    Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

    2002-01-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  18. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

    NARCIS (Netherlands)

    Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  19. Error Analysis of Deep Sequencing of Phage Libraries: Peptides Censored in Sequencing

    Directory of Open Access Journals (Sweden)

    Wadim L. Matochko

    2013-01-01

    Full Text Available Next-generation sequencing techniques empower selection of ligands from phage-display libraries because they can detect low abundant clones and quantify changes in the copy numbers of clones without excessive selection rounds. Identification of errors in deep sequencing data is the most critical step in this process because these techniques have error rates >1%. Mechanisms that yield errors in Illumina and other techniques have been proposed, but no reports to date describe error analysis in phage libraries. Our paper focuses on error analysis of 7-mer peptide libraries sequenced by Illumina method. Low theoretical complexity of this phage library, as compared to complexity of long genetic reads and genomes, allowed us to describe this library using convenient linear vector and operator framework. We describe a phage library as N×1 frequency vector n=ni, where ni is the copy number of the ith sequence and N is the theoretical diversity, that is, the total number of all possible sequences. Any manipulation to the library is an operator acting on n. Selection, amplification, or sequencing could be described as a product of a N×N matrix and a stochastic sampling operator (Sa. The latter is a random diagonal matrix that describes sampling of a library. In this paper, we focus on the properties of Sa and use them to define the sequencing operator (Seq. Sequencing without any bias and errors is Seq=Sa IN, where IN is a N×N unity matrix. Any bias in sequencing changes IN to a nonunity matrix. We identified a diagonal censorship matrix (CEN, which describes elimination or statistically significant downsampling, of specific reads during the sequencing process.

  20. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  1. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Sztrolovics, R.; Grover, J.; Roughley, P.J. [McGill Univ., Montreal (Canada)] [and others

    1994-10-01

    This report describes the cloning of the 3{prime}-untranslated region of the human fibromodulin cDNA and its use to map the gene. For somatic cell hybrids, the generation of the PCR product was concordant with the presence of chromosome 1 and discordant with the presence of all other chromosomes, confirming that the fibromodulin gene is located within region q32 of chromosome 1. The physical mapping of genes is a critical step in the process of identifying which genes may be responsible for various inherited disorders. Specifically, the mapping of the fibromodulin gene now provides the information necessary to evaluate its potential role in genetic disorders of connective tissues. The analysis of previously reported diseases mapped to chromosome 1 reveals two genes located in the proximity of the fibromodulin locus. These are Usher syndrome type II, a recessive disorder characterized by hearing loss and retinitis pigmentosa, and Van der Woude syndrome, a dominant condition associated with abnormalities such as cleft lip and palate and hyperdontia. The genes for both of these disorders have been projected to be localized to 1q32 of a physical map that integrates available genetic linkage and physical data. However, it seems improbable that either of these disorders, exhibiting restricted tissue involvement, could be linked to the fibromodulin gene, given the wide tissue distribution of the encoded proteoglycan, although it remains possible that the relative importance of the quantity and function of the proteoglycan may avry between tissues. 11 refs., 1 fig.

  2. Protein model discrimination using mutational sensitivity derived from deep sequencing.

    Science.gov (United States)

    Adkar, Bharat V; Tripathi, Arti; Sahoo, Anusmita; Bajaj, Kanika; Goswami, Devrishi; Chakrabarti, Purbani; Swarnkar, Mohit K; Gokhale, Rajesh S; Varadarajan, Raghavan

    2012-02-08

    A major bottleneck in protein structure prediction is the selection of correct models from a pool of decoys. Relative activities of ∼1,200 individual single-site mutants in a saturation library of the bacterial toxin CcdB were estimated by determining their relative populations using deep sequencing. This phenotypic information was used to define an empirical score for each residue (RankScore), which correlated with the residue depth, and identify active-site residues. Using these correlations, ∼98% of correct models of CcdB (RMSD ≤ 4Å) were identified from a large set of decoys. The model-discrimination methodology was further validated on eleven different monomeric proteins using simulated RankScore values. The methodology is also a rapid, accurate way to obtain relative activities of each mutant in a large pool and derive sequence-structure-function relationships without protein isolation or characterization. It can be applied to any system in which mutational effects can be monitored by a phenotypic readout. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Sequencing Infrastructure Investments under Deep Uncertainty Using Real Options Analysis

    Directory of Open Access Journals (Sweden)

    Nishtha Manocha

    2018-02-01

    Full Text Available The adaptation tipping point and adaptation pathway approach developed to make decisions under deep uncertainty do not shed light on which among the multiple available pathways should be chosen as the preferred pathway. This creates the need to extend these approaches by means of suitable tools that can help sequence actions and subsequently enable the outlining of relevant policies. This paper presents two sequencing approaches, namely, the “Build to Target” and “Build Up” approach, to aid in sub-selecting a set of preferred pathways. Both approaches differ in the levels of flexibility they offer. They are exemplified by means of two case studies wherein the Net Present Valuation and the Real Options Analysis are employed as selection criterions. The results demonstrate the benefit of these two approaches when used in conjunction with the adaptation pathways and show how the pathways selected by means of a Build to Target approach generally have a value greater than, or at least the same as, the pathways selected by the Build Up approach. Further, this paper also demonstrates the capacity of Real Options to quantify and capture the economic value of flexibility, which cannot be done by traditional valuation approaches such as Net Present Valuation.

  4. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  5. DeepBase: annotation and discovery of microRNAs and other noncoding RNAs from deep-sequencing data.

    Science.gov (United States)

    Yang, Jian-Hua; Qu, Liang-Hu

    2012-01-01

    Recent advances in high-throughput deep-sequencing technology have produced large numbers of short and long RNA sequences and enabled the detection and profiling of known and novel microRNAs (miRNAs) and other noncoding RNAs (ncRNAs) at unprecedented sensitivity and depth. In this chapter, we describe the use of deepBase, a database that we have developed to integrate all public deep-sequencing data and to facilitate the comprehensive annotation and discovery of miRNAs and other ncRNAs from these data. deepBase provides an integrative, interactive, and versatile web graphical interface to evaluate miRBase-annotated miRNA genes and other known ncRNAs, explores the expression patterns of miRNAs and other ncRNAs, and discovers novel miRNAs and other ncRNAs from deep-sequencing data. deepBase also provides a deepView genome browser to comparatively analyze these data at multiple levels. deepBase is available at http://deepbase.sysu.edu.cn/.

  6. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  7. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  8. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  9. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  10. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  11. Key roles for freshwater Actinobacteria revealed by deep metagenomic sequencing.

    Science.gov (United States)

    Ghai, Rohit; Mizuno, Carolina Megumi; Picazo, Antonio; Camacho, Antonio; Rodriguez-Valera, Francisco

    2014-12-01

    Freshwater ecosystems are critical but fragile environments directly affecting society and its welfare. However, our understanding of genuinely freshwater microbial communities, constrained by our capacity to manipulate its prokaryotic participants in axenic cultures, remains very rudimentary. Even the most abundant components, freshwater Actinobacteria, remain largely unknown. Here, applying deep metagenomic sequencing to the microbial community of a freshwater reservoir, we were able to circumvent this traditional bottleneck and reconstruct de novo seven distinct streamlined actinobacterial genomes. These genomes represent three new groups of photoheterotrophic, planktonic Actinobacteria. We describe for the first time genomes of two novel clades, acMicro (Micrococcineae, related to Luna2,) and acAMD (Actinomycetales, related to acTH1). Besides, an aggregate of contigs belonged to a new branch of the Acidimicrobiales. All are estimated to have small genomes (approximately 1.2 Mb), and their GC content varied from 40 to 61%. One of the Micrococcineae genomes encodes a proteorhodopsin, a rhodopsin type reported for the first time in Actinobacteria. The remarkable potential capacity of some of these genomes to transform recalcitrant plant detrital material, particularly lignin-derived compounds, suggests close linkages between the terrestrial and aquatic realms. Moreover, abundances of Actinobacteria correlate inversely to those of Cyanobacteria that are responsible for prolonged and frequently irretrievable damage to freshwater ecosystems. This suggests that they might serve as sentinels of impending ecological catastrophes. © 2014 John Wiley & Sons Ltd.

  12. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  13. DeepProbe: Information Directed Sequence Understanding and Chatbot Design via Recurrent Neural Networks

    OpenAIRE

    Yin, Zi; Chang, Keng-hao; Zhang, Ruofei

    2017-01-01

    Information extraction and user intention identification are central topics in modern query understanding and recommendation systems. In this paper, we propose DeepProbe, a generic information-directed interaction framework which is built around an attention-based sequence to sequence (seq2seq) recurrent neural network. DeepProbe can rephrase, evaluate, and even actively ask questions, leveraging the generative ability and likelihood estimation made possible by seq2seq models. DeepProbe makes...

  14. Transcriptome analysis of the model protozoan, Tetrahymena thermophila, using Deep RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Jie Xiong

    Full Text Available BACKGROUND: The ciliated protozoan Tetrahymena thermophila is a well-studied single-celled eukaryote model organism for cellular and molecular biology. However, the lack of extensive T. thermophila cDNA libraries or a large expressed sequence tag (EST database limited the quality of the original genome annotation. METHODOLOGY/PRINCIPAL FINDINGS: This RNA-seq study describes the first deep sequencing analysis of the T. thermophila transcriptome during the three major stages of the life cycle: growth, starvation and conjugation. Uniquely mapped reads covered more than 96% of the 24,725 predicted gene models in the somatic genome. More than 1,000 new transcribed regions were identified. The great dynamic range of RNA-seq allowed detection of a nearly six order-of-magnitude range of measurable gene expression orchestrated by this cell. RNA-seq also allowed the first prediction of transcript untranslated regions (UTRs and an updated (larger size estimate of the T. thermophila transcriptome: 57 Mb, or about 55% of the somatic genome. Our study identified nearly 1,500 alternative splicing (AS events distributed over 5.2% of T. thermophila genes. This percentage represents a two order-of-magnitude increase over previous EST-based estimates in Tetrahymena. Evidence of stage-specific regulation of alternative splicing was also obtained. Finally, our study allowed us to completely confirm about 26.8% of the genes originally predicted by the gene finder, to correct coding sequence boundaries and intron-exon junctions for about a third, and to reassign microarray probes and correct earlier microarray data. CONCLUSIONS/SIGNIFICANCE: RNA-seq data significantly improve the genome annotation and provide a fully comprehensive view of the global transcriptome of T. thermophila. To our knowledge, 5.2% of T. thermophila genes with AS is the highest percentage of genes showing AS reported in a unicellular eukaryote. Tetrahymena thus becomes an excellent unicellular

  15. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  16. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  17. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  18. Deep-Sea, Deep-Sequencing: Metabarcoding Extracellular DNA from Sediments of Marine Canyons.

    Directory of Open Access Journals (Sweden)

    Magdalena Guardiola

    Full Text Available Marine sediments are home to one of the richest species pools on Earth, but logistics and a dearth of taxonomic work-force hinders the knowledge of their biodiversity. We characterized α- and β-diversity of deep-sea assemblages from submarine canyons in the western Mediterranean using an environmental DNA metabarcoding. We used a new primer set targeting a short eukaryotic 18S sequence (ca. 110 bp. We applied a protocol designed to obtain extractions enriched in extracellular DNA from replicated sediment corers. With this strategy we captured information from DNA (local or deposited from the water column that persists adsorbed to inorganic particles and buffered short-term spatial and temporal heterogeneity. We analysed replicated samples from 20 localities including 2 deep-sea canyons, 1 shallower canal, and two open slopes (depth range 100-2,250 m. We identified 1,629 MOTUs, among which the dominant groups were Metazoa (with representatives of 19 phyla, Alveolata, Stramenopiles, and Rhizaria. There was a marked small-scale heterogeneity as shown by differences in replicates within corers and within localities. The spatial variability between canyons was significant, as was the depth component in one of the canyons where it was tested. Likewise, the composition of the first layer (1 cm of sediment was significantly different from deeper layers. We found that qualitative (presence-absence and quantitative (relative number of reads data showed consistent trends of differentiation between samples and geographic areas. The subset of exclusively benthic MOTUs showed similar patterns of β-diversity and community structure as the whole dataset. Separate analyses of the main metazoan phyla (in number of MOTUs showed some differences in distribution attributable to different lifestyles. Our results highlight the differentiation that can be found even between geographically close assemblages, and sets the ground for future monitoring and conservation

  19. Genome-wide detection and analysis of hippocampus core promoters using DeepCAGE

    DEFF Research Database (Denmark)

    Valen, Eivind; Pascarella, Giovanni; Chalk, Alistair

    2009-01-01

    in a given tissue. Here, we present a new method for high-throughput sequencing of 5' cDNA tags-DeepCAGE: merging the Cap Analysis of Gene Expression method with ultra-high-throughput sequence technology. We apply DeepCAGE to characterize 1.4 million sequenced TSS from mouse hippocampus and reveal a wealth...

  20. Discovery radiomics via evolutionary deep radiomic sequencer discovery for pathologically proven lung cancer detection.

    Science.gov (United States)

    Shafiee, Mohammad Javad; Chung, Audrey G; Khalvati, Farzad; Haider, Masoom A; Wong, Alexander

    2017-10-01

    While lung cancer is the second most diagnosed form of cancer in men and women, a sufficiently early diagnosis can be pivotal in patient survival rates. Imaging-based, or radiomics-driven, detection methods have been developed to aid diagnosticians, but largely rely on hand-crafted features that may not fully encapsulate the differences between cancerous and healthy tissue. Recently, the concept of discovery radiomics was introduced, where custom abstract features are discovered from readily available imaging data. We propose an evolutionary deep radiomic sequencer discovery approach based on evolutionary deep intelligence. Motivated by patient privacy concerns and the idea of operational artificial intelligence, the evolutionary deep radiomic sequencer discovery approach organically evolves increasingly more efficient deep radiomic sequencers that produce significantly more compact yet similarly descriptive radiomic sequences over multiple generations. As a result, this framework improves operational efficiency and enables diagnosis to be run locally at the radiologist's computer while maintaining detection accuracy. We evaluated the evolved deep radiomic sequencer (EDRS) discovered via the proposed evolutionary deep radiomic sequencer discovery framework against state-of-the-art radiomics-driven and discovery radiomics methods using clinical lung CT data with pathologically proven diagnostic data from the LIDC-IDRI dataset. The EDRS shows improved sensitivity (93.42%), specificity (82.39%), and diagnostic accuracy (88.78%) relative to previous radiomics approaches.

  1. Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

    Science.gov (United States)

    Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

    2018-04-16

    RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

  2. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  3. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  4. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    Science.gov (United States)

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  5. Predicting effects of noncoding variants with deep learning-based sequence model.

    Science.gov (United States)

    Zhou, Jian; Troyanskaya, Olga G

    2015-10-01

    Identifying functional effects of noncoding variants is a major challenge in human genetics. To predict the noncoding-variant effects de novo from sequence, we developed a deep learning-based algorithmic framework, DeepSEA (http://deepsea.princeton.edu/), that directly learns a regulatory sequence code from large-scale chromatin-profiling data, enabling prediction of chromatin effects of sequence alterations with single-nucleotide sensitivity. We further used this capability to improve prioritization of functional variants including expression quantitative trait loci (eQTLs) and disease-associated variants.

  6. A simple method for the parallel deep sequencing of full influenza A genomes

    DEFF Research Database (Denmark)

    Kampmann, Marie-Louise; Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen

    2011-01-01

    Given the major threat of influenza A to human and animal health, and its ability to evolve rapidly through mutation and reassortment, tools that enable its timely characterization are necessary to help monitor its evolution and spread. For this purpose, deep sequencing can be a very valuable tool....... This study reports a comprehensive method that enables deep sequencing of the complete genomes of influenza A subtypes using the Illumina Genome Analyzer IIx (GAIIx). By using this method, the complete genomes of nine viruses were sequenced in parallel, representing the 2009 pandemic H1N1 virus, H5N1 virus...

  7. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens.

    Science.gov (United States)

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z

    2017-03-14

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.

  8. LookSeq: A browser-based viewer for deep sequencing data

    OpenAIRE

    Manske, Heinrich Magnus; Kwiatkowski, Dominic P.

    2009-01-01

    Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an ov...

  9. Uniform, optimal signal processing of mapped deep-sequencing data.

    Science.gov (United States)

    Kumar, Vibhor; Muratani, Masafumi; Rayan, Nirmala Arul; Kraus, Petra; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam

    2013-07-01

    Despite their apparent diversity, many problems in the analysis of high-throughput sequencing data are merely special cases of two general problems, signal detection and signal estimation. Here we adapt formally optimal solutions from signal processing theory to analyze signals of DNA sequence reads mapped to a genome. We describe DFilter, a detection algorithm that identifies regulatory features in ChIP-seq, DNase-seq and FAIRE-seq data more accurately than assay-specific algorithms. We also describe EFilter, an estimation algorithm that accurately predicts mRNA levels from as few as 1-2 histone profiles (R ∼0.9). Notably, the presence of regulatory motifs in promoters correlates more with histone modifications than with mRNA levels, suggesting that histone profiles are more predictive of cis-regulatory mechanisms. We show by applying DFilter and EFilter to embryonic forebrain ChIP-seq data that regulatory protein identification and functional annotation are feasible despite tissue heterogeneity. The mathematical formalism underlying our tools facilitates integrative analysis of data from virtually any sequencing-based functional profile.

  10. Protein sequences bound to mineral surfaces persist into deep time

    DEFF Research Database (Denmark)

    Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa

    2016-01-01

    of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell......, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated...

  11. DeepGO: predicting protein functions from sequence and interactions using a deep ontology-aware classifier

    KAUST Repository

    Kulmanov, Maxat

    2017-09-27

    Motivation A large number of protein sequences are becoming available through the application of novel high-throughput sequencing technologies. Experimental functional characterization of these proteins is time-consuming and expensive, and is often only done rigorously for few selected model organisms. Computational function prediction approaches have been suggested to fill this gap. The functions of proteins are classified using the Gene Ontology (GO), which contains over 40 000 classes. Additionally, proteins have multiple functions, making function prediction a large-scale, multi-class, multi-label problem. Results We have developed a novel method to predict protein function from sequence. We use deep learning to learn features from protein sequences as well as a cross-species protein–protein interaction network. Our approach specifically outputs information in the structure of the GO and utilizes the dependencies between GO classes as background information to construct a deep learning model. We evaluate our method using the standards established by the Computational Assessment of Function Annotation (CAFA) and demonstrate a significant improvement over baseline methods such as BLAST, in particular for predicting cellular locations.

  12. DeepGO: predicting protein functions from sequence and interactions using a deep ontology-aware classifier.

    Science.gov (United States)

    Kulmanov, Maxat; Khan, Mohammed Asif; Hoehndorf, Robert; Wren, Jonathan

    2018-02-15

    A large number of protein sequences are becoming available through the application of novel high-throughput sequencing technologies. Experimental functional characterization of these proteins is time-consuming and expensive, and is often only done rigorously for few selected model organisms. Computational function prediction approaches have been suggested to fill this gap. The functions of proteins are classified using the Gene Ontology (GO), which contains over 40 000 classes. Additionally, proteins have multiple functions, making function prediction a large-scale, multi-class, multi-label problem. We have developed a novel method to predict protein function from sequence. We use deep learning to learn features from protein sequences as well as a cross-species protein-protein interaction network. Our approach specifically outputs information in the structure of the GO and utilizes the dependencies between GO classes as background information to construct a deep learning model. We evaluate our method using the standards established by the Computational Assessment of Function Annotation (CAFA) and demonstrate a significant improvement over baseline methods such as BLAST, in particular for predicting cellular locations. Web server: http://deepgo.bio2vec.net, Source code: https://github.com/bio-ontology-research-group/deepgo. robert.hoehndorf@kaust.edu.sa. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  13. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  14. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  15. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  16. Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

    Energy Technology Data Exchange (ETDEWEB)

    Shi, CY; Yang, H; Wei, CL; Yu, O; Zhang, ZZ; Sun, J; Wan, XC

    2011-01-01

    Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq) provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Using high-throughput Illumina RNA-seq, the transcriptome from poly (A){sup +} RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs). Approximate 34.5 million reads were obtained, trimmed, and assembled into 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010). Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG) found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were analyzed by RT-PCR and quantitative real

  17. Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

    Directory of Open Access Journals (Sweden)

    Chen Qi

    2011-02-01

    Full Text Available Abstract Background Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Results Using high-throughput Illumina RNA-seq, the transcriptome from poly (A+ RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs. Approximate 34.5 million reads were obtained, trimmed, and assembled into 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010. Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were

  18. Workup of Human Blood Samples for Deep Sequencing of HIV-1 Genomes

    NARCIS (Netherlands)

    Cornelissen, Marion; Gall, Astrid; van der Kuyl, Antoinette; Wymant, Chris; Blanquart, François; Fraser, Christophe; Berkhout, Ben

    2018-01-01

    We describe a detailed protocol for the manual workup of blood (plasma/serum) samples from individuals infected with the human immunodeficiency virus type 1 (HIV-1) for deep sequence analysis of the viral genome. The study optimizing the assay was performed in the context of the BEEHIVE (Bridging

  19. Efficient forward propagation of time-sequences in convolutional neural networks using Deep Shifting

    NARCIS (Netherlands)

    K.L. Groenland (Koen); S.M. Bohte (Sander)

    2016-01-01

    textabstractWhen a Convolutional Neural Network is used for on-the-fly evaluation of continuously updating time-sequences, many redundant convolution operations are performed. We propose the method of Deep Shifting, which remembers previously calculated results of convolution operations in order

  20. Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

    NARCIS (Netherlands)

    Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.

    2013-01-01

    Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of

  1. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    Institute of Scientific and Technical Information of China (English)

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  2. Characterization of the porcine carboxypeptidase E cDNA

    DEFF Research Database (Denmark)

    Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

    2007-01-01

    the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

  3. AUC-Maximized Deep Convolutional Neural Fields for Protein Sequence Labeling.

    Science.gov (United States)

    Wang, Sheng; Sun, Siqi; Xu, Jinbo

    2016-09-01

    Deep Convolutional Neural Networks (DCNN) has shown excellent performance in a variety of machine learning tasks. This paper presents Deep Convolutional Neural Fields (DeepCNF), an integration of DCNN with Conditional Random Field (CRF), for sequence labeling with an imbalanced label distribution. The widely-used training methods, such as maximum-likelihood and maximum labelwise accuracy, do not work well on imbalanced data. To handle this, we present a new training algorithm called maximum-AUC for DeepCNF. That is, we train DeepCNF by directly maximizing the empirical Area Under the ROC Curve (AUC), which is an unbiased measurement for imbalanced data. To fulfill this, we formulate AUC in a pairwise ranking framework, approximate it by a polynomial function and then apply a gradient-based procedure to optimize it. Our experimental results confirm that maximum-AUC greatly outperforms the other two training methods on 8-state secondary structure prediction and disorder prediction since their label distributions are highly imbalanced and also has similar performance as the other two training methods on solvent accessibility prediction, which has three equally-distributed labels. Furthermore, our experimental results show that our AUC-trained DeepCNF models greatly outperform existing popular predictors of these three tasks. The data and software related to this paper are available at https://github.com/realbigws/DeepCNF_AUC.

  4. Enhanced arbovirus surveillance with deep sequencing: Identification of novel rhabdoviruses and bunyaviruses in Australian mosquitoes.

    Science.gov (United States)

    Coffey, Lark L; Page, Brady L; Greninger, Alexander L; Herring, Belinda L; Russell, Richard C; Doggett, Stephen L; Haniotis, John; Wang, Chunlin; Deng, Xutao; Delwart, Eric L

    2014-01-05

    Viral metagenomics characterizes known and identifies unknown viruses based on sequence similarities to any previously sequenced viral genomes. A metagenomics approach was used to identify virus sequences in Australian mosquitoes causing cytopathic effects in inoculated mammalian cell cultures. Sequence comparisons revealed strains of Liao Ning virus (Reovirus, Seadornavirus), previously detected only in China, livestock-infecting Stretch Lagoon virus (Reovirus, Orbivirus), two novel dimarhabdoviruses, named Beaumont and North Creek viruses, and two novel orthobunyaviruses, named Murrumbidgee and Salt Ash viruses. The novel virus proteomes diverged by ≥ 50% relative to their closest previously genetically characterized viral relatives. Deep sequencing also generated genomes of Warrego and Wallal viruses, orbiviruses linked to kangaroo blindness, whose genomes had not been fully characterized. This study highlights viral metagenomics in concert with traditional arbovirus surveillance to characterize known and new arboviruses in field-collected mosquitoes. Follow-up epidemiological studies are required to determine whether the novel viruses infect humans. © 2013 Elsevier Inc. All rights reserved.

  5. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.

    2001-01-01

    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  6. Exploring fungal diversity in deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing

    Science.gov (United States)

    Zhang, Xiao-Yong; Wang, Guang-Hua; Xu, Xin-Ya; Nong, Xu-Hua; Wang, Jie; Amin, Muhammad; Qi, Shu-Hua

    2016-10-01

    The present study investigated the fungal diversity in four different deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing of the nuclear ribosomal internal transcribed spacer-1 (ITS1). A total of 40,297 fungal ITS1 sequences clustered into 420 operational taxonomic units (OTUs) with 97% sequence similarity and 170 taxa were recovered from these sediments. Most ITS1 sequences (78%) belonged to the phylum Ascomycota, followed by Basidiomycota (17.3%), Zygomycota (1.5%) and Chytridiomycota (0.8%), and a small proportion (2.4%) belonged to unassigned fungal phyla. Compared with previous studies on fungal diversity of sediments from deep-sea environments by culture-dependent approach and clone library analysis, the present result suggested that Illumina sequencing had been dramatically accelerating the discovery of fungal community of deep-sea sediments. Furthermore, our results revealed that Sordariomycetes was the most diverse and abundant fungal class in this study, challenging the traditional view that the diversity of Sordariomycetes phylotypes was low in the deep-sea environments. In addition, more than 12 taxa accounted for 21.5% sequences were found to be rarely reported as deep-sea fungi, suggesting the deep-sea sediments from Okinawa Trough harbored a plethora of different fungal communities compared with other deep-sea environments. To our knowledge, this study is the first exploration of the fungal diversity in deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing.

  7. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  8. Ultra-deep sequencing of intra-host rabies virus populations during cross-species transmission.

    Directory of Open Access Journals (Sweden)

    Monica K Borucki

    2013-11-01

    Full Text Available One of the hurdles to understanding the role of viral quasispecies in RNA virus cross-species transmission (CST events is the need to analyze a densely sampled outbreak using deep sequencing in order to measure the amount of mutation occurring on a small time scale. In 2009, the California Department of Public Health reported a dramatic increase (350 in the number of gray foxes infected with a rabies virus variant for which striped skunks serve as a reservoir host in Humboldt County. To better understand the evolution of rabies, deep-sequencing was applied to 40 unpassaged rabies virus samples from the Humboldt outbreak. For each sample, approximately 11 kb of the 12 kb genome was amplified and sequenced using the Illumina platform. Average coverage was 17,448 and this allowed characterization of the rabies virus population present in each sample at unprecedented depths. Phylogenetic analysis of the consensus sequence data demonstrated that samples clustered according to date (1995 vs. 2009 and geographic location (northern vs. southern. A single amino acid change in the G protein distinguished a subset of northern foxes from a haplotype present in both foxes and skunks, suggesting this mutation may have played a role in the observed increased transmission among foxes in this region. Deep-sequencing data indicated that many genetic changes associated with the CST event occurred prior to 2009 since several nonsynonymous mutations that were present in the consensus sequences of skunk and fox rabies samples obtained from 20032010 were present at the sub-consensus level (as rare variants in the viral population in skunk and fox samples from 1995. These results suggest that analysis of rare variants within a viral population may yield clues to ancestral genomes and identify rare variants that have the potential to be selected for if environment conditions change.

  9. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  10. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  11. LookSeq: a browser-based viewer for deep sequencing data.

    Science.gov (United States)

    Manske, Heinrich Magnus; Kwiatkowski, Dominic P

    2009-11-01

    Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.

  12. Prognostic value of deep sequencing method for minimal residual disease detection in multiple myeloma

    Science.gov (United States)

    Lahuerta, Juan J.; Pepin, François; González, Marcos; Barrio, Santiago; Ayala, Rosa; Puig, Noemí; Montalban, María A.; Paiva, Bruno; Weng, Li; Jiménez, Cristina; Sopena, María; Moorhead, Martin; Cedena, Teresa; Rapado, Immaculada; Mateos, María Victoria; Rosiñol, Laura; Oriol, Albert; Blanchard, María J.; Martínez, Rafael; Bladé, Joan; San Miguel, Jesús; Faham, Malek; García-Sanz, Ramón

    2014-01-01

    We assessed the prognostic value of minimal residual disease (MRD) detection in multiple myeloma (MM) patients using a sequencing-based platform in bone marrow samples from 133 MM patients in at least very good partial response (VGPR) after front-line therapy. Deep sequencing was carried out in patients in whom a high-frequency myeloma clone was identified and MRD was assessed using the IGH-VDJH, IGH-DJH, and IGK assays. The results were contrasted with those of multiparametric flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR). The applicability of deep sequencing was 91%. Concordance between sequencing and MFC and ASO-PCR was 83% and 85%, respectively. Patients who were MRD– by sequencing had a significantly longer time to tumor progression (TTP) (median 80 vs 31 months; P < .0001) and overall survival (median not reached vs 81 months; P = .02), compared with patients who were MRD+. When stratifying patients by different levels of MRD, the respective TTP medians were: MRD ≥10−3 27 months, MRD 10−3 to 10−5 48 months, and MRD <10−5 80 months (P = .003 to .0001). Ninety-two percent of VGPR patients were MRD+. In complete response patients, the TTP remained significantly longer for MRD– compared with MRD+ patients (131 vs 35 months; P = .0009). PMID:24646471

  13. miRBase: integrating microRNA annotation and deep-sequencing data.

    Science.gov (United States)

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  14. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  15. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  16. Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing

    OpenAIRE

    Manske, Magnus; Miotto, Olivo; Campino, Susana; Auburn, Sarah; Almagro-Garcia, Jacob; Maslen, Gareth; O?Brien, Jack; Djimde, Abdoulaye; Doumbo, Ogobara; Zongo, Issaka; Ouedraogo, Jean-Bosco; Michon, Pascal; Mueller, Ivo; Siba, Peter; Nzila, Alexis

    2012-01-01

    : Malaria elimination strategies require surveillance of the parasite population for genetic changes that demand a public health response, such as new forms of drug resistance. Here we describe methods for the large-scale analysis of genetic variation in Plasmodium falciparum by deep sequencing of parasite DNA obtained from the blood of patients with malaria, either directly or after short-term culture. Analysis of 86,158 exonic single nucleotide polymorphisms that passed genotyping quality c...

  17. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  18. A novel wavelet sequence based on deep bidirectional LSTM network model for ECG signal classification.

    Science.gov (United States)

    Yildirim, Özal

    2018-05-01

    Long-short term memory networks (LSTMs), which have recently emerged in sequential data analysis, are the most widely used type of recurrent neural networks (RNNs) architecture. Progress on the topic of deep learning includes successful adaptations of deep versions of these architectures. In this study, a new model for deep bidirectional LSTM network-based wavelet sequences called DBLSTM-WS was proposed for classifying electrocardiogram (ECG) signals. For this purpose, a new wavelet-based layer is implemented to generate ECG signal sequences. The ECG signals were decomposed into frequency sub-bands at different scales in this layer. These sub-bands are used as sequences for the input of LSTM networks. New network models that include unidirectional (ULSTM) and bidirectional (BLSTM) structures are designed for performance comparisons. Experimental studies have been performed for five different types of heartbeats obtained from the MIT-BIH arrhythmia database. These five types are Normal Sinus Rhythm (NSR), Ventricular Premature Contraction (VPC), Paced Beat (PB), Left Bundle Branch Block (LBBB), and Right Bundle Branch Block (RBBB). The results show that the DBLSTM-WS model gives a high recognition performance of 99.39%. It has been observed that the wavelet-based layer proposed in the study significantly improves the recognition performance of conventional networks. This proposed network structure is an important approach that can be applied to similar signal processing problems. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Continuous Distributed Representation of Biological Sequences for Deep Proteomics and Genomics.

    Directory of Open Access Journals (Sweden)

    Ehsaneddin Asgari

    Full Text Available We introduce a new representation and feature extraction method for biological sequences. Named bio-vectors (BioVec to refer to biological sequences in general with protein-vectors (ProtVec for proteins (amino-acid sequences and gene-vectors (GeneVec for gene sequences, this representation can be widely used in applications of deep learning in proteomics and genomics. In the present paper, we focus on protein-vectors that can be utilized in a wide array of bioinformatics investigations such as family classification, protein visualization, structure prediction, disordered protein identification, and protein-protein interaction prediction. In this method, we adopt artificial neural network approaches and represent a protein sequence with a single dense n-dimensional vector. To evaluate this method, we apply it in classification of 324,018 protein sequences obtained from Swiss-Prot belonging to 7,027 protein families, where an average family classification accuracy of 93%±0.06% is obtained, outperforming existing family classification methods. In addition, we use ProtVec representation to predict disordered proteins from structured proteins. Two databases of disordered sequences are used: the DisProt database as well as a database featuring the disordered regions of nucleoporins rich with phenylalanine-glycine repeats (FG-Nups. Using support vector machine classifiers, FG-Nup sequences are distinguished from structured protein sequences found in Protein Data Bank (PDB with a 99.8% accuracy, and unstructured DisProt sequences are differentiated from structured DisProt sequences with 100.0% accuracy. These results indicate that by only providing sequence data for various proteins into this model, accurate information about protein structure can be determined. Importantly, this model needs to be trained only once and can then be applied to extract a comprehensive set of information regarding proteins of interest. Moreover, this representation can be

  20. CPSS: a computational platform for the analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua

    2012-07-15

    Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.

  1. Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

    Science.gov (United States)

    Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

    2011-04-01

    Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

  2. Deep sequencing analysis of HBV genotype shift and correlation with antiviral efficiency during adefovir dipivoxil therapy.

    Directory of Open Access Journals (Sweden)

    Yuwei Wang

    Full Text Available Viral genotype shift in chronic hepatitis B (CHB patients during antiviral therapy has been reported, but the underlying mechanism remains elusive.38 CHB patients treated with ADV for one year were selected for studying genotype shift by both deep sequencing and Sanger sequencing method.Sanger sequencing method found that 7.9% patients showed mixed genotype before ADV therapy. In contrast, all 38 patients showed mixed genotype before ADV treatment by deep sequencing. 95.5% mixed genotype rate was also obtained from additional 200 treatment-naïve CHB patients. Of the 13 patients with genotype shift, the fraction of the minor genotype in 5 patients (38% increased gradually during the course of ADV treatment. Furthermore, responses to ADV and HBeAg seroconversion were associated with the high rate of genotype shift, suggesting drug and immune pressure may be key factors to induce genotype shift. Interestingly, patients with genotype C had a significantly higher rate of genotype shift than genotype B. In genotype shift group, ADV treatment induced a marked enhancement of genotype B ratio accompanied by a reduction of genotype C ratio, suggesting genotype C may be more sensitive to ADV than genotype B. Moreover, patients with dominant genotype C may have a better therapeutic effect. Finally, genotype shifts was correlated with clinical improvement in terms of ALT.Our findings provided a rational explanation for genotype shift among ADV-treated CHB patients. The genotype and genotype shift might be associated with antiviral efficiency.

  3. miRBase: annotating high confidence microRNAs using deep sequencing data.

    Science.gov (United States)

    Kozomara, Ana; Griffiths-Jones, Sam

    2014-01-01

    We describe an update of the miRBase database (http://www.mirbase.org/), the primary microRNA sequence repository. The latest miRBase release (v20, June 2013) contains 24 521 microRNA loci from 206 species, processed to produce 30 424 mature microRNA products. The rate of deposition of novel microRNAs and the number of researchers involved in their discovery continue to increase, driven largely by small RNA deep sequencing experiments. In the face of these increases, and a range of microRNA annotation methods and criteria, maintaining the quality of the microRNA sequence data set is a significant challenge. Here, we describe recent developments of the miRBase database to address this issue. In particular, we describe the collation and use of deep sequencing data sets to assign levels of confidence to miRBase entries. We now provide a high confidence subset of miRBase entries, based on the pattern of mapped reads. The high confidence microRNA data set is available alongside the complete microRNA collection at http://www.mirbase.org/. We also describe embedding microRNA-specific Wikipedia pages on the miRBase website to encourage the microRNA community to contribute and share textual and functional information.

  4. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  5. High-throughput sequencing and analysis of the gill tissue transcriptome from the deep-sea hydrothermal vent mussel Bathymodiolus azoricus

    Directory of Open Access Journals (Sweden)

    Gomes Paula

    2010-10-01

    Full Text Available Abstract Background Bathymodiolus azoricus is a deep-sea hydrothermal vent mussel found in association with large faunal communities living in chemosynthetic environments at the bottom of the sea floor near the Azores Islands. Investigation of the exceptional physiological reactions that vent mussels have adopted in their habitat, including responses to environmental microbes, remains a difficult challenge for deep-sea biologists. In an attempt to reveal genes potentially involved in the deep-sea mussel innate immunity we carried out a high-throughput sequence analysis of freshly collected B. azoricus transcriptome using gills tissues as the primary source of immune transcripts given its strategic role in filtering the surrounding waterborne potentially infectious microorganisms. Additionally, a substantial EST data set was produced and from which a comprehensive collection of genes coding for putative proteins was organized in a dedicated database, "DeepSeaVent" the first deep-sea vent animal transcriptome database based on the 454 pyrosequencing technology. Results A normalized cDNA library from gills tissue was sequenced in a full 454 GS-FLX run, producing 778,996 sequencing reads. Assembly of the high quality reads resulted in 75,407 contigs of which 3,071 were singletons. A total of 39,425 transcripts were conceptually translated into amino-sequences of which 22,023 matched known proteins in the NCBI non-redundant protein database, 15,839 revealed conserved protein domains through InterPro functional classification and 9,584 were assigned with Gene Ontology terms. Queries conducted within the database enabled the identification of genes putatively involved in immune and inflammatory reactions which had not been previously evidenced in the vent mussel. Their physical counterpart was confirmed by semi-quantitative quantitative Reverse-Transcription-Polymerase Chain Reactions (RT-PCR and their RNA transcription level by quantitative PCR (q

  6. Exploring the Mechanisms of Gastrointestinal Cancer Development Using Deep Sequencing Analysis

    International Nuclear Information System (INIS)

    Matsumoto, Tomonori; Shimizu, Takahiro; Takai, Atsushi; Marusawa, Hiroyuki

    2015-01-01

    Next-generation sequencing (NGS) technologies have revolutionized cancer genomics due to their high throughput sequencing capacity. Reports of the gene mutation profiles of various cancers by many researchers, including international cancer genome research consortia, have increased over recent years. In addition to detecting somatic mutations in tumor cells, NGS technologies enable us to approach the subject of carcinogenic mechanisms from new perspectives. Deep sequencing, a method of optimizing the high throughput capacity of NGS technologies, allows for the detection of genetic aberrations in small subsets of premalignant and/or tumor cells in noncancerous chronically inflamed tissues. Genome-wide NGS data also make it possible to clarify the mutational signatures of each cancer tissue by identifying the precise pattern of nucleotide alterations in the cancer genome, providing new information regarding the mechanisms of tumorigenesis. In this review, we highlight these new methods taking advantage of NGS technologies, and discuss our current understanding of carcinogenic mechanisms elucidated from such approaches

  7. Exploring the Mechanisms of Gastrointestinal Cancer Development Using Deep Sequencing Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Tomonori; Shimizu, Takahiro; Takai, Atsushi; Marusawa, Hiroyuki, E-mail: maru@kuhp.kyoto-u.ac.jp [Department of Gastroenterology and Hepatology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawahara-cho, Sakyo-ku, Kyoto 606-8507 (Japan)

    2015-06-15

    Next-generation sequencing (NGS) technologies have revolutionized cancer genomics due to their high throughput sequencing capacity. Reports of the gene mutation profiles of various cancers by many researchers, including international cancer genome research consortia, have increased over recent years. In addition to detecting somatic mutations in tumor cells, NGS technologies enable us to approach the subject of carcinogenic mechanisms from new perspectives. Deep sequencing, a method of optimizing the high throughput capacity of NGS technologies, allows for the detection of genetic aberrations in small subsets of premalignant and/or tumor cells in noncancerous chronically inflamed tissues. Genome-wide NGS data also make it possible to clarify the mutational signatures of each cancer tissue by identifying the precise pattern of nucleotide alterations in the cancer genome, providing new information regarding the mechanisms of tumorigenesis. In this review, we highlight these new methods taking advantage of NGS technologies, and discuss our current understanding of carcinogenic mechanisms elucidated from such approaches.

  8. Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

    Science.gov (United States)

    Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

    2005-05-01

    Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

  9. Sequence-based prediction of protein protein interaction using a deep-learning algorithm.

    Science.gov (United States)

    Sun, Tanlin; Zhou, Bo; Lai, Luhua; Pei, Jianfeng

    2017-05-25

    Protein-protein interactions (PPIs) are critical for many biological processes. It is therefore important to develop accurate high-throughput methods for identifying PPI to better understand protein function, disease occurrence, and therapy design. Though various computational methods for predicting PPI have been developed, their robustness for prediction with external datasets is unknown. Deep-learning algorithms have achieved successful results in diverse areas, but their effectiveness for PPI prediction has not been tested. We used a stacked autoencoder, a type of deep-learning algorithm, to study the sequence-based PPI prediction. The best model achieved an average accuracy of 97.19% with 10-fold cross-validation. The prediction accuracies for various external datasets ranged from 87.99% to 99.21%, which are superior to those achieved with previous methods. To our knowledge, this research is the first to apply a deep-learning algorithm to sequence-based PPI prediction, and the results demonstrate its potential in this field.

  10. Deep sequence characterisation of a divergent HPIV-4a from an adult with prolonged influenza-like illness

    Directory of Open Access Journals (Sweden)

    Katherine E. Arden

    2015-12-01

    Deep sequencing allowed identification and genomic characterisation of a possible pathogen from an ILI as well as being an important tool to aid future understanding of the linkages between viral genetic variation, transmission and disease prognosis.

  11. An introduction to deep learning on biological sequence data: examples and solutions.

    Science.gov (United States)

    Jurtz, Vanessa Isabell; Johansen, Alexander Rosenberg; Nielsen, Morten; Almagro Armenteros, Jose Juan; Nielsen, Henrik; Sønderby, Casper Kaae; Winther, Ole; Sønderby, Søren Kaae

    2017-11-15

    Deep neural network architectures such as convolutional and long short-term memory networks have become increasingly popular as machine learning tools during the recent years. The availability of greater computational resources, more data, new algorithms for training deep models and easy to use libraries for implementation and training of neural networks are the drivers of this development. The use of deep learning has been especially successful in image recognition; and the development of tools, applications and code examples are in most cases centered within this field rather than within biology. Here, we aim to further the development of deep learning methods within biology by providing application examples and ready to apply and adapt code templates. Given such examples, we illustrate how architectures consisting of convolutional and long short-term memory neural networks can relatively easily be designed and trained to state-of-the-art performance on three biological sequence problems: prediction of subcellular localization, protein secondary structure and the binding of peptides to MHC Class II molecules. All implementations and datasets are available online to the scientific community at https://github.com/vanessajurtz/lasagne4bio. skaaesonderby@gmail.com. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  12. Deep sequencing of the Camellia chekiangoleosa transcriptome revealed candidate genes for anthocyanin biosynthesis.

    Science.gov (United States)

    Wang, Zhong-Wei; Jiang, Cong; Wen, Qiang; Wang, Na; Tao, Yuan-Yuan; Xu, Li-An

    2014-03-15

    Camellia chekiangoleosa is an important species of genus Camellia. It provides high-quality edible oil and has great ornamental value. The flowers are big and red which bloom between February and March. Flower pigmentation is closely related to the accumulation of anthocyanin. Although anthocyanin biosynthesis has been studied extensively in herbaceous plants, little molecular information on the anthocyanin biosynthesis pathway of C. chekiangoleosa is yet known. In the present study, a cDNA library was constructed to obtain detailed and general data from the flowers of C. chekiangoleosa. To explore the transcriptome of C. chekiangoleosa and investigate genes involved in anthocyanin biosynthesis, a 454 GS FLX Titanium platform was used to generate an EST dataset. About 46,279 sequences were obtained, and 24,593 (53.1%) were annotated. Using Blast search against the AGRIS, 1740 unigenes were found homologous to 599 Arabidopsis transcription factor genes. Based on the transcriptome dataset, nine anthocyanin biosynthesis pathway genes (PAL, CHS1, CHS2, CHS3, CHI, F3H, DFR, ANS, and UFGT) were identified and cloned. The spatio-temporal expression patterns of these genes were also analyzed using quantitative real-time polymerase chain reaction. The study results not only enrich the gene resource but also provide valuable information for further studies concerning anthocyanin biosynthesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis.

    Science.gov (United States)

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-05-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner.

  14. Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata

    Directory of Open Access Journals (Sweden)

    Yu Huaping

    2010-07-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play a critical role in post-transcriptional gene regulation and have been shown to control many genes involved in various biological and metabolic processes. There have been extensive studies to discover miRNAs and analyze their functions in model plant species, such as Arabidopsis and rice. Deep sequencing technologies have facilitated identification of species-specific or lowly expressed as well as conserved or highly expressed miRNAs in plants. Results In this research, we used Solexa sequencing to discover new microRNAs in trifoliate orange (Citrus trifoliata which is an important rootstock of citrus. A total of 13,106,753 reads representing 4,876,395 distinct sequences were obtained from a short RNA library generated from small RNA extracted from C. trifoliata flower and fruit tissues. Based on sequence similarity and hairpin structure prediction, we found that 156,639 reads representing 63 sequences from 42 highly conserved miRNA families, have perfect matches to known miRNAs. We also identified 10 novel miRNA candidates whose precursors were all potentially generated from citrus ESTs. In addition, five miRNA* sequences were also sequenced. These sequences had not been earlier described in other plant species and accumulation of the 10 novel miRNAs were confirmed by qRT-PCR analysis. Potential target genes were predicted for most conserved and novel miRNAs. Moreover, four target genes including one encoding IRX12 copper ion binding/oxidoreductase and three genes encoding NB-LRR disease resistance protein have been experimentally verified by detection of the miRNA-mediated mRNA cleavage in C. trifoliata. Conclusion Deep sequencing of short RNAs from C. trifoliata flowers and fruits identified 10 new potential miRNAs and 42 highly conserved miRNA families, indicating that specific miRNAs exist in C. trifoliata. These results show that regulatory miRNAs exist in agronomically important trifoliate orange

  15. Virus pathotype and deep sequencing of the HA gene of a low pathogenicity H7N1 avian influenza virus causing mortality in Turkeys.

    Directory of Open Access Journals (Sweden)

    Munir Iqbal

    Full Text Available Low pathogenicity avian influenza (LPAI viruses of the H7 subtype generally cause mild disease in poultry. However the evolution of a LPAI virus into highly pathogenic avian influenza (HPAI virus results in the generation of a virus that can cause severe disease and death. The classification of these two pathotypes is based, in part, on disease signs and death in chickens, as assessed in an intravenous pathogenicity test, but the effect of LPAI viruses in turkeys is less well understood. During an investigation of LPAI virus infection of turkeys, groups of three-week-old birds inoculated with A/chicken/Italy/1279/99 (H7N1 showed severe disease signs and died or were euthanised within seven days of infection. Virus was detected in many internal tissues and organs from culled birds. To examine the possible evolution of the infecting virus to a highly pathogenic form in these turkeys, sequence analysis of the haemagglutinin (HA gene cleavage site was carried out by analysing multiple cDNA amplicons made from swabs and tissue sample extracts employing Sanger and Next Generation Sequencing. In addition, a RT-PCR assay to detect HPAI virus was developed. There was no evidence of the presence of HPAI virus in either the virus used as inoculum or from swabs taken from infected birds. However, a small proportion (<0.5% of virus carried in individual tracheal or liver samples did contain a molecular signature typical of a HPAI virus at the HA cleavage site. All the signature sequences were identical and were similar to HPAI viruses collected during the Italian epizootic in 1999/2000. We assume that the detection of HPAI virus in tissue samples following infection with A/chicken/Italy/1279/99 reflected amplification of a virus present at very low levels within the mixed inoculum but, strikingly, we observed no new HPAI virus signatures in the amplified DNA analysed by deep-sequencing.

  16. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2013-09-21

    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  17. 3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

    Science.gov (United States)

    2013-01-01

    Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

  18. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  19. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    Science.gov (United States)

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the

  20. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  1. Deep sequencing reveals persistence of cell-associated mumps vaccine virus in chronic encephalitis.

    Science.gov (United States)

    Morfopoulou, Sofia; Mee, Edward T; Connaughton, Sarah M; Brown, Julianne R; Gilmour, Kimberly; Chong, W K 'Kling'; Duprex, W Paul; Ferguson, Deborah; Hubank, Mike; Hutchinson, Ciaran; Kaliakatsos, Marios; McQuaid, Stephen; Paine, Simon; Plagnol, Vincent; Ruis, Christopher; Virasami, Alex; Zhan, Hong; Jacques, Thomas S; Schepelmann, Silke; Qasim, Waseem; Breuer, Judith

    2017-01-01

    Routine childhood vaccination against measles, mumps and rubella has virtually abolished virus-related morbidity and mortality. Notwithstanding this, we describe here devastating neurological complications associated with the detection of live-attenuated mumps virus Jeryl Lynn (MuV JL5 ) in the brain of a child who had undergone successful allogeneic transplantation for severe combined immunodeficiency (SCID). This is the first confirmed report of MuV JL5 associated with chronic encephalitis and highlights the need to exclude immunodeficient individuals from immunisation with live-attenuated vaccines. The diagnosis was only possible by deep sequencing of the brain biopsy. Sequence comparison of the vaccine batch to the MuV JL5 isolated from brain identified biased hypermutation, particularly in the matrix gene, similar to those found in measles from cases of SSPE. The findings provide unique insights into the pathogenesis of paramyxovirus brain infections.

  2. Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing

    Directory of Open Access Journals (Sweden)

    Chen Shou-Yi

    2011-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in higher plants. miRNAs and related target genes have been widely studied in model plants such as Arabidopsis and rice; however, the number of identified miRNAs in soybean (Glycine max is limited, and global identification of the related miRNA targets has not been reported in previous research. Results In our study, a small RNA library and a degradome library were constructed from developing soybean seeds for deep sequencing. We identified 26 new miRNAs in soybean by bioinformatic analysis and further confirmed their expression by stem-loop RT-PCR. The miRNA star sequences of 38 known miRNAs and 8 new miRNAs were also discovered, providing additional evidence for the existence of miRNAs. Through degradome sequencing, 145 and 25 genes were identified as targets of annotated miRNAs and new miRNAs, respectively. GO analysis indicated that many of the identified miRNA targets may function in soybean seed development. Additionally, a soybean homolog of Arabidopsis SUPPRESSOR OF GENE SLIENCING 3 (AtSGS3 was detected as a target of the newly identified miRNA Soy_25, suggesting the presence of feedback control of miRNA biogenesis. Conclusions We have identified large numbers of miRNAs and their related target genes through deep sequencing of a small RNA library and a degradome library. Our study provides more information about the regulatory network of miRNAs in soybean and advances our understanding of miRNA functions during seed development.

  3. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data

    DEFF Research Database (Denmark)

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne Vibeke

    2016-01-01

    a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2...

  4. Poly(A)-tag deep sequencing data processing to extract poly(A) sites.

    Science.gov (United States)

    Wu, Xiaohui; Ji, Guoli; Li, Qingshun Quinn

    2015-01-01

    Polyadenylation [poly(A)] is an essential posttranscriptional processing step in the maturation of eukaryotic mRNA. The advent of next-generation sequencing (NGS) technology has offered feasible means to generate large-scale data and new opportunities for intensive study of polyadenylation, particularly deep sequencing of the transcriptome targeting the junction of 3'-UTR and the poly(A) tail of the transcript. To take advantage of this unprecedented amount of data, we present an automated workflow to identify polyadenylation sites by integrating NGS data cleaning, processing, mapping, normalizing, and clustering. In this pipeline, a series of Perl scripts are seamlessly integrated to iteratively map the single- or paired-end sequences to the reference genome. After mapping, the poly(A) tags (PATs) at the same genome coordinate are grouped into one cleavage site, and the internal priming artifacts removed. Then the ambiguous region is introduced to parse the genome annotation for cleavage site clustering. Finally, cleavage sites within a close range of 24 nucleotides and from different samples can be clustered into poly(A) clusters. This procedure could be used to identify thousands of reliable poly(A) clusters from millions of NGS sequences in different tissues or treatments.

  5. Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

    Science.gov (United States)

    Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

    2015-05-01

    Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

  6. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    Science.gov (United States)

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  7. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

  8. Identification and Characterization of Liver MicroRNAs of the Chinese Tree Shrew via Deep Sequencing.

    Science.gov (United States)

    Feng, Yue; Feng, Yue-Mei; Feng, Yang; Lu, Caixia; Liu, Li; Sun, Xiaomei; Dai, Jiejie; Xia, Xueshan

    2015-10-01

    Chinese tree shrew (Tupaia belangeri chinensis) is a small animal that possess many features, which are valuable in biomedical research, as experimental models. Currently, there are numerous attempts to utilize tree shrews as models for hepatitis C virus (HCV) infection. This study aimed to construct a liver microRNA (miRNA) data of the tree shrew. Three second filial generation tree shrews were used in this study. Total RNA was extracted from each liver of the tree shrew and equal quality mixed, then reverse-transcribed to complementary DNA (cDNA). The cDNAs were amplified by polymerase chain reaction and subjected to high-throughput sequencing. A total of 2060 conserved miRNAs were identified through alignment with the mature miRNAs in miRBase 20.0 database. The gene ontology and Kyoto encyclopedia of genes and genomes analyses of the target genes of the miRNAs revealed several candidate miRNAs, genes and pathways that may involve in the process of HCV infection. The abundance of miR-122 and Let-7 families and their other characteristics provided us more evidences for the utilization of this animal, as a potential model for HCV infection and other related biomedical research. Moreover, 80 novel microRNAs were predicted using the software Mireap. The top 3 abundant miRNAs were validated in other tree samples, based on stem-loop quantitative reverse transcription-polymerase chain reaction. According to the liver microRNA data of Chinese tree shrew, characteristics of the miR-122 and Let-7 families further highlight the suitability of tree shrew as the animal model in HCV research.

  9. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  10. [Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

    Science.gov (United States)

    Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

    2011-07-01

    Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

  11. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  12. Advancing Eucalyptus genomics: identification and sequencing of lignin biosynthesis genes from deep-coverage BAC libraries

    Directory of Open Access Journals (Sweden)

    Kudrna David

    2011-03-01

    Full Text Available Abstract Background Eucalyptus species are among the most planted hardwoods in the world because of their rapid growth, adaptability and valuable wood properties. The development and integration of genomic resources into breeding practice will be increasingly important in the decades to come. Bacterial artificial chromosome (BAC libraries are key genomic tools that enable positional cloning of important traits, synteny evaluation, and the development of genome framework physical maps for genetic linkage and genome sequencing. Results We describe the construction and characterization of two deep-coverage BAC libraries EG_Ba and EG_Bb obtained from nuclear DNA fragments of E. grandis (clone BRASUZ1 digested with HindIII and BstYI, respectively. Genome coverages of 17 and 15 haploid genome equivalents were estimated for EG_Ba and EG_Bb, respectively. Both libraries contained large inserts, with average sizes ranging from 135 Kb (Eg_Bb to 157 Kb (Eg_Ba, very low extra-nuclear genome contamination providing a probability of finding a single copy gene ≥ 99.99%. Libraries were screened for the presence of several genes of interest via hybridizations to high-density BAC filters followed by PCR validation. Five selected BAC clones were sequenced and assembled using the Roche GS FLX technology providing the whole sequence of the E. grandis chloroplast genome, and complete genomic sequences of important lignin biosynthesis genes. Conclusions The two E. grandis BAC libraries described in this study represent an important milestone for the advancement of Eucalyptus genomics and forest tree research. These BAC resources have a highly redundant genome coverage (> 15×, contain large average inserts and have a very low percentage of clones with organellar DNA or empty vectors. These publicly available BAC libraries are thus suitable for a broad range of applications in genetic and genomic research in Eucalyptus and possibly in related species of Myrtaceae

  13. Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing

    Science.gov (United States)

    Manske, Magnus; Miotto, Olivo; Campino, Susana; Auburn, Sarah; Almagro-Garcia, Jacob; Maslen, Gareth; O’Brien, Jack; Djimde, Abdoulaye; Doumbo, Ogobara; Zongo, Issaka; Ouedraogo, Jean-Bosco; Michon, Pascal; Mueller, Ivo; Siba, Peter; Nzila, Alexis; Borrmann, Steffen; Kiara, Steven M.; Marsh, Kevin; Jiang, Hongying; Su, Xin-Zhuan; Amaratunga, Chanaki; Fairhurst, Rick; Socheat, Duong; Nosten, Francois; Imwong, Mallika; White, Nicholas J.; Sanders, Mandy; Anastasi, Elisa; Alcock, Dan; Drury, Eleanor; Oyola, Samuel; Quail, Michael A.; Turner, Daniel J.; Rubio, Valentin Ruano; Jyothi, Dushyanth; Amenga-Etego, Lucas; Hubbart, Christina; Jeffreys, Anna; Rowlands, Kate; Sutherland, Colin; Roper, Cally; Mangano, Valentina; Modiano, David; Tan, John C.; Ferdig, Michael T.; Amambua-Ngwa, Alfred; Conway, David J.; Takala-Harrison, Shannon; Plowe, Christopher V.; Rayner, Julian C.; Rockett, Kirk A.; Clark, Taane G.; Newbold, Chris I.; Berriman, Matthew; MacInnis, Bronwyn; Kwiatkowski, Dominic P.

    2013-01-01

    Malaria elimination strategies require surveillance of the parasite population for genetic changes that demand a public health response, such as new forms of drug resistance. 1,2 Here we describe methods for large-scale analysis of genetic variation in Plasmodium falciparum by deep sequencing of parasite DNA obtained from the blood of patients with malaria, either directly or after short term culture. Analysis of 86,158 exonic SNPs that passed genotyping quality control in 227 samples from Africa, Asia and Oceania provides genome-wide estimates of allele frequency distribution, population structure and linkage disequilibrium. By comparing the genetic diversity of individual infections with that of the local parasite population, we derive a metric of within-host diversity that is related to the level of inbreeding in the population. An open-access web application has been established for exploration of regional differences in allele frequency and of highly differentiated loci in the P. falciparum genome. PMID:22722859

  14. Draft Genome Sequence of Deep-Sea Alteromonas sp. Strain V450 Isolated from the Marine Sponge Leiodermatium sp.

    Science.gov (United States)

    Wang, Guojun; Barrett, Nolan H; McCarthy, Peter J

    2017-02-02

    The proteobacterium Alteromonas sp. strain V450 was isolated from the Atlantic deep-sea sponge Leiodermatium sp. Here, we report the draft genome sequence of this strain, with a genome size of approx. 4.39 Mb and a G+C content of 44.01%. The results will aid deep-sea microbial ecology, evolution, and sponge-microbe association studies. Copyright © 2017 Wang et al.

  15. Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.

    Directory of Open Access Journals (Sweden)

    Arjan P Palstra

    Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.

  16. DeepGO: predicting protein functions from sequence and interactions using a deep ontology-aware classifier

    KAUST Repository

    Kulmanov, Maxat; Khan, Mohammed Asif; Hoehndorf, Robert

    2017-01-01

    A large number of protein sequences are becoming available through the application of novel high-throughput sequencing technologies. Experimental functional characterization of these proteins is time-consuming and expensive, and is often

  17. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Anne Bruun Krøigård

    Full Text Available Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

  18. Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

    Science.gov (United States)

    Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A; Larsen, Martin Jakob

    2016-01-01

    Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

  19. Ultra Deep Sequencing of a Baculovirus Population Reveals Widespread Genomic Variations

    Directory of Open Access Journals (Sweden)

    Aurélien Chateigner

    2015-07-01

    Full Text Available Viruses rely on widespread genetic variation and large population size for adaptation. Large DNA virus populations are thought to harbor little variation though natural populations may be polymorphic. To measure the genetic variation present in a dsDNA virus population, we deep sequenced a natural strain of the baculovirus Autographa californica multiple nucleopolyhedrovirus. With 124,221X average genome coverage of our 133,926 bp long consensus, we could detect low frequency mutations (0.025%. K-means clustering was used to classify the mutations in four categories according to their frequency in the population. We found 60 high frequency non-synonymous mutations under balancing selection distributed in all functional classes. These mutants could alter viral adaptation dynamics, either through competitive or synergistic processes. Lastly, we developed a technique for the delimitation of large deletions in next generation sequencing data. We found that large deletions occur along the entire viral genome, with hotspots located in homologous repeat regions (hrs. Present in 25.4% of the genomes, these deletion mutants presumably require functional complementation to complete their infection cycle. They might thus have a large impact on the fitness of the baculovirus population. Altogether, we found a wide breadth of genomic variation in the baculovirus population, suggesting it has high adaptive potential.

  20. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.

    Science.gov (United States)

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong

    2012-01-01

    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  1. Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing

    Science.gov (United States)

    Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising

    2011-01-01

    Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633

  2. Ultra-deep sequencing of mouse mitochondrial DNA: mutational patterns and their origins.

    Directory of Open Access Journals (Sweden)

    Adam Ameur

    2011-03-01

    Full Text Available Somatic mutations of mtDNA are implicated in the aging process, but there is no universally accepted method for their accurate quantification. We have used ultra-deep sequencing to study genome-wide mtDNA mutation load in the liver of normally- and prematurely-aging mice. Mice that are homozygous for an allele expressing a proof-reading-deficient mtDNA polymerase (mtDNA mutator mice have 10-times-higher point mutation loads than their wildtype siblings. In addition, the mtDNA mutator mice have increased levels of a truncated linear mtDNA molecule, resulting in decreased sequence coverage in the deleted region. In contrast, circular mtDNA molecules with large deletions occur at extremely low frequencies in mtDNA mutator mice and can therefore not drive the premature aging phenotype. Sequence analysis shows that the main proportion of the mutation load in heterozygous mtDNA mutator mice and their wildtype siblings is inherited from their heterozygous mothers consistent with germline transmission. We found no increase in levels of point mutations or deletions in wildtype C57Bl/6N mice with increasing age, thus questioning the causative role of these changes in aging. In addition, there was no increased frequency of transversion mutations with time in any of the studied genotypes, arguing against oxidative damage as a major cause of mtDNA mutations. Our results from studies of mice thus indicate that most somatic mtDNA mutations occur as replication errors during development and do not result from damage accumulation in adult life.

  3. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  4. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  5. Identification of ribonucleotide reductase mutation causing temperature-sensitivity of herpes simplex virus isolates from whitlow by deep sequencing.

    Science.gov (United States)

    Daikoku, Tohru; Oyama, Yukari; Yajima, Misako; Sekizuka, Tsuyoshi; Kuroda, Makoto; Shimada, Yuka; Takehara, Kazuhiko; Miwa, Naoko; Okuda, Tomoko; Sata, Tetsutaro; Shiraki, Kimiyasu

    2015-06-01

    Herpes simplex virus 2 caused a genital ulcer, and a secondary herpetic whitlow appeared during acyclovir therapy. The secondary and recurrent whitlow isolates were acyclovir-resistant and temperature-sensitive in contrast to a genital isolate. We identified the ribonucleotide reductase mutation responsible for temperature-sensitivity by deep-sequencing analysis.

  6. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  7. High-throughput verification of transcriptional starting sites by Deep-RACE

    DEFF Research Database (Denmark)

    Olivarius, Signe; Plessy, Charles; Carninci, Piero

    2009-01-01

    We present a high-throughput method for investigating the transcriptional starting sites of genes of interest, which we named Deep-RACE (Deep–rapid amplification of cDNA ends). Taking advantage of the latest sequencing technology, it allows the parallel analysis of multiple genes and is free...

  8. Deep sequencing-based analysis of the anaerobic stimulon in Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Clark Virginia L

    2011-01-01

    Full Text Available Abstract Background Maintenance of an anaerobic denitrification system in the obligate human pathogen, Neisseria gonorrhoeae, suggests that an anaerobic lifestyle may be important during the course of infection. Furthermore, mounting evidence suggests that reduction of host-produced nitric oxide has several immunomodulary effects on the host. However, at this point there have been no studies analyzing the complete gonococcal transcriptome response to anaerobiosis. Here we performed deep sequencing to compare the gonococcal transcriptomes of aerobically and anaerobically grown cells. Using the information derived from this sequencing, we discuss the implications of the robust transcriptional response to anaerobic growth. Results We determined that 198 chromosomal genes were differentially expressed (~10% of the genome in response to anaerobic conditions. We also observed a large induction of genes encoded within the cryptic plasmid, pJD1. Validation of RNA-seq data using translational-lacZ fusions or RT-PCR demonstrated the RNA-seq results to be very reproducible. Surprisingly, many genes of prophage origin were induced anaerobically, as well as several transcriptional regulators previously unknown to be involved in anaerobic growth. We also confirmed expression and regulation of a small RNA, likely a functional equivalent of fnrS in the Enterobacteriaceae family. We also determined that many genes found to be responsive to anaerobiosis have also been shown to be responsive to iron and/or oxidative stress. Conclusions Gonococci will be subject to many forms of environmental stress, including oxygen-limitation, during the course of infection. Here we determined that the anaerobic stimulon in gonococci was larger than previous studies would suggest. Many new targets for future research have been uncovered, and the results derived from this study may have helped to elucidate factors or mechanisms of virulence that may have otherwise been overlooked.

  9. A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology.

    Science.gov (United States)

    Kravatsky, Yuri; Chechetkin, Vladimir; Fedoseeva, Daria; Gorbacheva, Maria; Kravatskaya, Galina; Kretova, Olga; Tchurikov, Nickolai

    2017-11-23

    The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs), requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s). Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s). The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi) targets in human immunodeficiency virus 1 (HIV-1) subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

  10. A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Yuri Kravatsky

    2017-11-01

    Full Text Available The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs, requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s. Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s. The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi targets in human immunodeficiency virus 1 (HIV-1 subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

  11. Deep Ion Torrent sequencing identifies soil fungal community shifts after frequent prescribed fires in a southeastern US forest ecosystem.

    Science.gov (United States)

    Brown, Shawn P; Callaham, Mac A; Oliver, Alena K; Jumpponen, Ari

    2013-12-01

    Prescribed burning is a common management tool to control fuel loads, ground vegetation, and facilitate desirable game species. We evaluated soil fungal community responses to long-term prescribed fire treatments in a loblolly pine forest on the Piedmont of Georgia and utilized deep Internal Transcribed Spacer Region 1 (ITS1) amplicon sequencing afforded by the recent Ion Torrent Personal Genome Machine (PGM). These deep sequence data (19,000 + reads per sample after subsampling) indicate that frequent fires (3-year fire interval) shift soil fungus communities, whereas infrequent fires (6-year fire interval) permit system resetting to a state similar to that without prescribed fire. Furthermore, in nonmetric multidimensional scaling analyses, primarily ectomycorrhizal taxa were correlated with axes associated with long fire intervals, whereas soil saprobes tended to be correlated with the frequent fire recurrence. We conclude that (1) multiplexed Ion Torrent PGM analyses allow deep cost effective sequencing of fungal communities but may suffer from short read lengths and inconsistent sequence quality adjacent to the sequencing adaptor; (2) frequent prescribed fires elicit a shift in soil fungal communities; and (3) such shifts do not occur when fire intervals are longer. Our results emphasize the general responsiveness of these forests to management, and the importance of fire return intervals in meeting management objectives. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  12. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  13. Application of Tandem Two-Dimensional Mass Spectrometry for Top-Down Deep Sequencing of Calmodulin.

    Science.gov (United States)

    Floris, Federico; Chiron, Lionel; Lynch, Alice M; Barrow, Mark P; Delsuc, Marc-André; O'Connor, Peter B

    2018-06-04

    Two-dimensional mass spectrometry (2DMS) involves simultaneous acquisition of the fragmentation patterns of all the analytes in a mixture by correlating their precursor and fragment ions by modulating precursor ions systematically through a fragmentation zone. Tandem two-dimensional mass spectrometry (MS/2DMS) unites the ultra-high accuracy of Fourier transform ion cyclotron resonance (FT-ICR) MS/MS and the simultaneous data-independent fragmentation of 2DMS to achieve extensive inter-residue fragmentation of entire proteins. 2DMS was recently developed for top-down proteomics (TDP), and applied to the analysis of calmodulin (CaM), reporting a cleavage coverage of about ~23% using infrared multiphoton dissociation (IRMPD) as fragmentation technique. The goal of this work is to expand the utility of top-down protein analysis using MS/2DMS in order to extend the cleavage coverage in top-down proteomics further into the interior regions of the protein. In this case, using MS/2DMS, the cleavage coverage of CaM increased from ~23% to ~42%. Graphical Abstract Two-dimensional mass spectrometry, when applied to primary fragment ions from the source, allows deep-sequencing of the protein calmodulin.

  14. Genomic region operation kit for flexible processing of deep sequencing data.

    Science.gov (United States)

    Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

    2013-01-01

    Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

  15. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  16. High-Quality Draft Single-Cell Genome Sequence Belonging to the Archaeal Candidate Division SA1, Isolated from Nereus Deep in the Red Sea

    KAUST Repository

    Ngugi, David

    2018-05-09

    Candidate division SA1 encompasses a phylogenetically coherent archaeal group ubiquitous in deep hypersaline anoxic brines around the globe. Recently, the genome sequences of two cultivated representatives from hypersaline soda lake sediments were published. Here, we present a single-cell genome sequence from Nereus Deep in the Red Sea that represents a putatively novel family within SA1.

  17. High-Quality Draft Single-Cell Genome Sequence Belonging to the Archaeal Candidate Division SA1, Isolated from Nereus Deep in the Red Sea

    KAUST Repository

    Ngugi, David; Stingl, Ulrich

    2018-01-01

    Candidate division SA1 encompasses a phylogenetically coherent archaeal group ubiquitous in deep hypersaline anoxic brines around the globe. Recently, the genome sequences of two cultivated representatives from hypersaline soda lake sediments were published. Here, we present a single-cell genome sequence from Nereus Deep in the Red Sea that represents a putatively novel family within SA1.

  18. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  19. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  20. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  1. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  2. MicroRNA discovery and analysis of pinewood nematode Bursaphelenchus xylophilus by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Qi-Xing Huang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are considered to be very important in regulating the growth, development, behavior and stress response in animals and plants in post-transcriptional gene regulation. Pinewood nematode, Bursaphelenchus xylophilus, is an important invasive plant parasitic nematode in Asia. To have a comprehensive knowledge about miRNAs of the nematode is necessary for further in-depth study on roles of miRNAs in the ecological adaptation of the invasive species. METHODS AND FINDINGS: Five small RNA libraries were constructed and sequenced by Illumina/Solexa deep-sequencing technology. A total of 810 miRNA candidates (49 conserved and 761 novel were predicted by a computational pipeline, of which 57 miRNAs (20 conserved and 37 novel encoded by 53 miRNA precursors were identified by experimental methods. Ten novel miRNAs were considered to be species-specific miRNAs of B. xylophilus. Comparison of expression profiles of miRNAs in the five small RNA libraries showed that many miRNAs exhibited obviously different expression levels in the third-stage dispersal juvenile and at a cold-stressed status. Most of the miRNAs exhibited obviously down-regulated expression in the dispersal stage. But differences among the three geographic libraries were not prominent. A total of 979 genes were predicted to be targets of these authentic miRNAs. Among them, seven heat shock protein genes were targeted by 14 miRNAs, and six FMRFamide-like neuropeptides genes were targeted by 17 miRNAs. A real-time quantitative polymerase chain reaction was used to quantify the mRNA expression levels of target genes. CONCLUSIONS: Basing on the fact that a negative correlation existed between the expression profiles of miRNAs and the mRNA expression profiles of their target genes (hsp, flp by comparing those of the nematodes at a cold stressed status and a normal status, we suggested that miRNAs might participate in ecological adaptation and behavior regulation of the

  3. Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

    Science.gov (United States)

    Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

    2017-04-01

    Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on

  4. The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing.

    Directory of Open Access Journals (Sweden)

    Kari A Dilley

    Full Text Available Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV, and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV. Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR activation.

  5. Deep sequencing-based identification of small regulatory RNAs in Synechocystis sp. PCC 6803.

    Directory of Open Access Journals (Sweden)

    Wen Xu

    Full Text Available Synechocystis sp. PCC 6803 is a genetically tractable model organism for photosynthesis research. The genome of Synechocystis sp. PCC 6803 consists of a circular chromosome and seven plasmids. The importance of small regulatory RNAs (sRNAs as mediators of a number of cellular processes in bacteria has begun to be recognized. However, little is known regarding sRNAs in Synechocystis sp. PCC 6803. To provide a comprehensive overview of sRNAs in this model organism, the sRNAs of Synechocystis sp. PCC 6803 were analyzed using deep sequencing, and 7,951,189 reads were obtained. High quality mapping reads (6,127,890 were mapped onto the genome and assembled into 16,192 transcribed regions (clusters based on read overlap. A total number of 5211 putative sRNAs were revealed from the genome and the 4 megaplasmids, and 27 of these molecules, including four from plasmids, were confirmed by RT-PCR. In addition, possible target genes regulated by all of the putative sRNAs identified in this study were predicted by IntaRNA and analyzed for functional categorization and biological pathways, which provided evidence that sRNAs are indeed involved in many different metabolic pathways, including basic metabolic pathways, such as glycolysis/gluconeogenesis, the citrate cycle, fatty acid metabolism and adaptations to environmentally stress-induced changes. The information from this study provides a valuable reservoir for understanding the sRNA-mediated regulation of the complex physiology and metabolic processes of cyanobacteria.

  6. Deep sequencing reveals a novel closterovirus associated with wild rose leaf rosette disease.

    Science.gov (United States)

    He, Yan; Yang, Zuokun; Hong, Ni; Wang, Guoping; Ning, Guogui; Xu, Wenxing

    2015-06-01

    A bizarre virus-like symptom of a leaf rosette formed by dense small leaves on branches of wild roses (Rosa multiflora Thunb.), designated as 'wild rose leaf rosette disease' (WRLRD), was observed in China. To investigate the presumed causal virus, a wild rose sample affected by WRLRD was subjected to deep sequencing of small interfering RNAs (siRNAs) for a complete survey of the infecting viruses and viroids. The assembly of siRNAs led to the reconstruction of the complete genomes of three known viruses, namely Apple stem grooving virus (ASGV), Blackberry chlorotic ringspot virus (BCRV) and Prunus necrotic ringspot virus (PNRSV), and of a novel virus provisionally named 'rose leaf rosette-associated virus' (RLRaV). Phylogenetic analysis clearly placed RLRaV alongside members of the genus Closterovirus, family Closteroviridae. Genome organization of RLRaV RNA (17,653 nucleotides) showed 13 open reading frames (ORFs), except ORF1 and the quintuple gene block, most of which showed no significant similarities with known viral proteins, but, instead, had detectable identities to fungal or bacterial proteins. Additional novel molecular features indicated that RLRaV seems to be the most complex virus among the known genus members. To our knowledge, this is the first report of WRLRD and its associated closterovirus, as well as two ilarviruses and one capilovirus, infecting wild roses. Our findings present novel information about the closterovirus and the aetiology of this rose disease which should facilitate its control. More importantly, the novel features of RLRaV help to clarify the molecular and evolutionary features of the closterovirus. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  7. The Ebola virus VP35 protein binds viral immunostimulatory and host RNAs identified through deep sequencing.

    Science.gov (United States)

    Dilley, Kari A; Voorhies, Alexander A; Luthra, Priya; Puri, Vinita; Stockwell, Timothy B; Lorenzi, Hernan; Basler, Christopher F; Shabman, Reed S

    2017-01-01

    Ebola virus and Marburg virus are members of the Filovirdae family and causative agents of hemorrhagic fever with high fatality rates in humans. Filovirus virulence is partially attributed to the VP35 protein, a well-characterized inhibitor of the RIG-I-like receptor pathway that triggers the antiviral interferon (IFN) response. Prior work demonstrates the ability of VP35 to block potent RIG-I activators, such as Sendai virus (SeV), and this IFN-antagonist activity is directly correlated with its ability to bind RNA. Several structural studies demonstrate that VP35 binds short synthetic dsRNAs; yet, there are no data that identify viral immunostimulatory RNAs (isRNA) or host RNAs bound to VP35 in cells. Utilizing a SeV infection model, we demonstrate that both viral isRNA and host RNAs are bound to Ebola and Marburg VP35s in cells. By deep sequencing the purified VP35-bound RNA, we identified the SeV copy-back defective interfering (DI) RNA, previously identified as a robust RIG-I activator, as the isRNA bound by multiple filovirus VP35 proteins, including the VP35 protein from the West African outbreak strain (Makona EBOV). Moreover, RNAs isolated from a VP35 RNA-binding mutant were not immunostimulatory and did not include the SeV DI RNA. Strikingly, an analysis of host RNAs bound by wild-type, but not mutant, VP35 revealed that select host RNAs are preferentially bound by VP35 in cell culture. Taken together, these data support a model in which VP35 sequesters isRNA in virus-infected cells to avert RIG-I like receptor (RLR) activation.

  8. Differential genomic arrangements in Caryophyllales through deep transcriptome sequencing of A. hypochondriacus.

    Directory of Open Access Journals (Sweden)

    Meeta Sunil

    Full Text Available Genome duplication event in edible dicots under the orders Rosid and Asterid, common during the oligocene period, is missing for species under the order Caryophyllales. Despite this, grain amaranths not only survived this period but display many desirable traits missing in species under rosids and asterids. For example, grain amaranths display traits like C4 photosynthesis, high-lysine seeds, high-yield, drought resistance, tolerance to infection and resilience to stress. It is, therefore, of interest to look for minor genome rearrangements with potential functional implications that are unique to grain amaranths. Here, by deep sequencing and assembly of 16 transcriptomes (86.8 billion bases we have interrogated differential genome rearrangement unique to Amaranthus hypochondriacus with potential links to these phenotypes. We have predicted 125,581 non-redundant transcripts including 44,529 protein coding transcripts identified based on homology to known proteins and 13,529 predicted as novel/amaranth specific coding transcripts. Of the protein coding de novo assembled transcripts, we have identified 1810 chimeric transcripts. More than 30% and 19% of the gene pairs within the chimeric transcripts are found within the same loci in the genomes of A. hypochondriacus and Beta vulgaris respectively and are considered real positives. Interestingly, one of the chimeric transcripts comprises two important genes, namely DHDPS1, a key enzyme implicated in the biosynthesis of lysine, and alpha-glucosidase, an enzyme involved in sucrose catabolism, in close proximity to each other separated by a distance of 612 bases in the genome of A. hypochondriacus in a convergent configuration. We have experimentally validated that transcripts of these two genes are also overlapping in the 3' UTR with their expression negatively correlated from bud to mature seed, suggesting a potential link between the high seed lysine trait and unique genome organization.

  9. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  10. Deep sequencing of the mitochondrial genome reveals common heteroplasmic sites in NADH dehydrogenase genes.

    Science.gov (United States)

    Liu, Chunyu; Fetterman, Jessica L; Liu, Poching; Luo, Yan; Larson, Martin G; Vasan, Ramachandran S; Zhu, Jun; Levy, Daniel

    2018-03-01

    Increasing evidence implicates mitochondrial dysfunction in aging and age-related conditions. But little is known about the molecular basis for this connection. A possible cause may be mutations in the mitochondrial DNA (mtDNA), which are often heteroplasmic-the joint presence of different alleles at a single locus in the same individual. However, the involvement of mtDNA heteroplasmy in aging and age-related conditions has not been investigated thoroughly. We deep-sequenced the complete mtDNA genomes of 356 Framingham Heart Study participants (52% women, mean age 43, mean coverage 4570-fold), identified 2880 unique mutations and comprehensively annotated them by MITOMAP and PolyPhen-2. We discovered 11 heteroplasmic "hot" spots [NADH dehydrogenase (ND) subunit 1, 4, 5 and 6 genes, n = 7; cytochrome c oxidase I (COI), n = 2; 16S rRNA, n = 1; D-loop, n = 1] for which the alternative-to-reference allele ratios significantly increased with advancing age (Bonferroni correction p < 0.001). Four of these heteroplasmic mutations in ND and COI genes were predicted to be deleterious nonsynonymous mutations which may have direct impact on ATP production. We confirmed previous findings that healthy individuals carry many low-frequency heteroplasmy mutations with potentially deleterious effects. We hypothesize that the effect of a single deleterious heteroplasmy may be minimal due to a low mutant-to-wildtype allele ratio, whereas the aggregate effects of many deleterious mutations may cause changes in mitochondrial function and contribute to age-related diseases. The identification of age-related mtDNA mutations is an important step to understand the genetic architecture of age-related diseases and may uncover novel therapeutic targets for such diseases.

  11. The subclonal structure and genomic evolution of oral squamous cell carcinoma revealed by ultra-deep sequencing

    DEFF Research Database (Denmark)

    Tabatabaeifar, Siavosh; Thomassen, Mads; Larsen, Martin J

    2017-01-01

    Recent studies suggest that head and neck squamous cell carcinomas are very heterogeneous between patients; however the subclonal structure remains unexplored mainly due to studies using only a single biopsy per patient. To deconvolutethe clonal structure and describe the genomic cancer evolution......, we applied whole-exome sequencing combined with ultra-deep targeted sequencing on oral squamous cell carcinomas (OSCC). From each patient, a set of biopsies was sampled from distinct geographical sites in primary tumor and lymph node metastasis.We demonstrate that the included OSCCs show a high...

  12. Rapid and Deep Proteomes by Faster Sequencing on a Benchtop Quadrupole Ultra-High-Field Orbitrap Mass Spectrometer

    DEFF Research Database (Denmark)

    Kelstrup, Christian D; Jersie-Christensen, Rosa R; Batth, Tanveer Singh

    2014-01-01

    per second or up to 600 new peptides sequenced per gradient minute. We identify 4400 proteins from one microgram of HeLa digest using a one hour gradient, which is an approximately 30% improvement compared to previous instrumentation. In addition, we show very deep proteome coverage can be achieved...... in less than 24 hours of analysis time by offline high pH reversed-phase peptide fractionation from which we identify more than 140,000 unique peptide sequences. This is comparable to state-of-the-art multi-day, multi-enzyme efforts. Finally the acquisition methods are evaluated for single...

  13. An introduction to Deep learning on biological sequence data - Examples and solutions

    DEFF Research Database (Denmark)

    Jurtz, Vanessa Isabell; Johansen, Alexander Rosenberg; Nielsen, Morten

    2017-01-01

    Deep neural network architectures such as convolutional and long short-term memory networks have become increasingly popular as machine learning tools during the recent years. The availability of greater computational resources, more data, new algorithms for training deep models and easy to use....... Here, we aim to further the development of deep learning methods within biology by providing application examples and ready to apply and adapt code templates. Given such examples, we illustrate how architectures consisting of convolutional and long short-term memory neural networks can relatively...

  14. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  15. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    Science.gov (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

  16. Identification and Removal of Contaminant Sequences From Ribosomal Gene Databases: Lessons From the Census of Deep Life.

    Science.gov (United States)

    Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S

    2018-01-01

    Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA

  17. Comparison of illumina and 454 deep sequencing in participants failing raltegravir-based antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Jonathan Z Li

    Full Text Available The impact of raltegravir-resistant HIV-1 minority variants (MVs on raltegravir treatment failure is unknown. Illumina sequencing offers greater throughput than 454, but sequence analysis tools for viral sequencing are needed. We evaluated Illumina and 454 for the detection of HIV-1 raltegravir-resistant MVs.A5262 was a single-arm study of raltegravir and darunavir/ritonavir in treatment-naïve patients. Pre-treatment plasma was obtained from 5 participants with raltegravir resistance at the time of virologic failure. A control library was created by pooling integrase clones at predefined proportions. Multiplexed sequencing was performed with Illumina and 454 platforms at comparable costs. Illumina sequence analysis was performed with the novel snp-assess tool and 454 sequencing was analyzed with V-Phaser.Illumina sequencing resulted in significantly higher sequence coverage and a 0.095% limit of detection. Illumina accurately detected all MVs in the control library at ≥0.5% and 7/10 MVs expected at 0.1%. 454 sequencing failed to detect any MVs at 0.1% with 5 false positive calls. For MVs detected in the patient samples by both 454 and Illumina, the correlation in the detected variant frequencies was high (R2 = 0.92, P<0.001. Illumina sequencing detected 2.4-fold greater nucleotide MVs and 2.9-fold greater amino acid MVs compared to 454. The only raltegravir-resistant MV detected was an E138K mutation in one participant by Illumina sequencing, but not by 454.In participants of A5262 with raltegravir resistance at virologic failure, baseline raltegravir-resistant MVs were rarely detected. At comparable costs to 454 sequencing, Illumina demonstrated greater depth of coverage, increased sensitivity for detecting HIV MVs, and fewer false positive variant calls.

  18. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  19. High-resolution deep sequencing reveals biodiversity, population structure, and persistence of HIV-1 quasispecies within host ecosystems

    Directory of Open Access Journals (Sweden)

    Yin Li

    2012-12-01

    Full Text Available Abstract Background Deep sequencing provides the basis for analysis of biodiversity of taxonomically similar organisms in an environment. While extensively applied to microbiome studies, population genetics studies of viruses are limited. To define the scope of HIV-1 population biodiversity within infected individuals, a suite of phylogenetic and population genetic algorithms was applied to HIV-1 envelope hypervariable domain 3 (Env V3 within peripheral blood mononuclear cells from a group of perinatally HIV-1 subtype B infected, therapy-naïve children. Results Biodiversity of HIV-1 Env V3 quasispecies ranged from about 70 to 270 unique sequence clusters across individuals. Viral population structure was organized into a limited number of clusters that included the dominant variants combined with multiple clusters of low frequency variants. Next generation viral quasispecies evolved from low frequency variants at earlier time points through multiple non-synonymous changes in lineages within the evolutionary landscape. Minor V3 variants detected as long as four years after infection co-localized in phylogenetic reconstructions with early transmitting viruses or with subsequent plasma virus circulating two years later. Conclusions Deep sequencing defines HIV-1 population complexity and structure, reveals the ebb and flow of dominant and rare viral variants in the host ecosystem, and identifies an evolutionary record of low-frequency cell-associated viral V3 variants that persist for years. Bioinformatics pipeline developed for HIV-1 can be applied for biodiversity studies of virome populations in human, animal, or plant ecosystems.

  20. Radioactive cDNA microarray in neurospsychiatry

    International Nuclear Information System (INIS)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

    2003-01-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  1. Radioactive cDNA microarray in neurospsychiatry

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

    2003-02-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  2. Simultaneous identification of DNA and RNA viruses present in pig faeces using process-controlled deep sequencing.

    Directory of Open Access Journals (Sweden)

    Jana Sachsenröder

    Full Text Available BACKGROUND: Animal faeces comprise a community of many different microorganisms including bacteria and viruses. Only scarce information is available about the diversity of viruses present in the faeces of pigs. Here we describe a protocol, which was optimized for the purification of the total fraction of viral particles from pig faeces. The genomes of the purified DNA and RNA viruses were simultaneously amplified by PCR and subjected to deep sequencing followed by bioinformatic analyses. The efficiency of the method was monitored using a process control consisting of three bacteriophages (T4, M13 and MS2 with different morphology and genome types. Defined amounts of the bacteriophages were added to the sample and their abundance was assessed by quantitative PCR during the preparation procedure. RESULTS: The procedure was applied to a pooled faecal sample of five pigs. From this sample, 69,613 sequence reads were generated. All of the added bacteriophages were identified by sequence analysis of the reads. In total, 7.7% of the reads showed significant sequence identities with published viral sequences. They mainly originated from bacteriophages (73.9% and mammalian viruses (23.9%; 0.8% of the sequences showed identities to plant viruses. The most abundant detected porcine viruses were kobuvirus, rotavirus C, astrovirus, enterovirus B, sapovirus and picobirnavirus. In addition, sequences with identities to the chimpanzee stool-associated circular ssDNA virus were identified. Whole genome analysis indicates that this virus, tentatively designated as pig stool-associated circular ssDNA virus (PigSCV, represents a novel pig virus. CONCLUSION: The established protocol enables the simultaneous detection of DNA and RNA viruses in pig faeces including the identification of so far unknown viruses. It may be applied in studies investigating aetiology, epidemiology and ecology of diseases. The implemented process control serves as quality control, ensures

  3. Sequence of structures in fine-grained turbidites: Comparison of recent deep-sea and ancient flysch sediments

    Science.gov (United States)

    Stow, Dorrik A. V.; Shanmugam, Ganapathy

    1980-01-01

    A comparative study of the sequence of sedimentary structures in ancient and modern fine-grained turbidites is made in three contrasting areas. They are (1) Holocene and Pleistocene deep-sea muds of the Nova Scotian Slope and Rise, (2) Middle Ordovician Sevier Shale of the Valley and Ridge Province of the Southern Appalachians, and (3) Cambro-Ordovician Halifax Slate of the Meguma Group in Nova Scotia. A standard sequence of structures is proposed for fine-grained turbidites. The complete sequence has nine sub-divisions that are here termed T 0 to T 8. "The lower subdivision (T 0) comprises a silt lamina which has a sharp, scoured and load-cast base, internal parallel-lamination and cross-lamination, and a sharp current-lineated or wavy surface with 'fading-ripples' (= Type C etc. …)." (= Type C ripple-drift cross-lamination, Jopling and Walker, 1968). The overlying sequence shows textural and compositional grading through alternating silt and mud laminae. A convolute-laminated sub-division (T 1) is overlain by low-amplitude climbing ripples (T 2), thin regular laminae (T 3), thin indistinct laminae (T 4), and thin wipsy or convolute laminae (T 5). The topmost three divisions, graded mud (T 6), ungraded mud (T 7) and bioturbated mud (T 8), do not have silt laminae but rare patchy silt lenses and silt pseudonodules and a thin zone of micro-burrowing near the upper surface. The proposed sequence is analogous to the Bouma (1962) structural scheme for sandy turbidites and is approximately equivalent to Bouma's (C)DE divisions. The repetition of partial sequences characterizes different parts of the slope/base-of-slope/basin plain environment, and represents deposition from different stages of evolution of a large, muddy, turbidity flow. Microstructural detail and sequence are well preserved in ancient and even slightly metamorphosed sediments. Their recognition is important for determining depositional processes and for palaeoenvironmental interpretation.

  4. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  5. Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus.

    Science.gov (United States)

    Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

    2017-01-01

    The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus , occurring in 48 of the 61 Ilarvirus -positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus -like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus -like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus -like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the

  6. Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus

    Directory of Open Access Journals (Sweden)

    Wycliff M. Kinoti

    2017-06-01

    Full Text Available The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV was the most frequently detected Ilarvirus, occurring in 48 of the 61 Ilarvirus-positive trees and Prune dwarf virus (PDV and Apple mosaic virus (ApMV were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus-like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus-like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus-like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples

  7. Characterization and Development of EST-SSRs by Deep Transcriptome Sequencing in Chinese Cabbage (Brassica rapa L. ssp. pekinensis

    Directory of Open Access Journals (Sweden)

    Qian Ding

    2015-01-01

    Full Text Available Simple sequence repeats (SSRs are among the most important markers for population analysis and have been widely used in plant genetic mapping and molecular breeding. Expressed sequence tag-SSR (EST-SSR markers, located in the coding regions, are potentially more efficient for QTL mapping, gene targeting, and marker-assisted breeding. In this study, we investigated 51,694 nonredundant unigenes, assembled from clean reads from deep transcriptome sequencing with a Solexa/Illumina platform, for identification and development of EST-SSRs in Chinese cabbage. In total, 10,420 EST-SSRs with over 12 bp were identified and characterized, among which 2744 EST-SSRs are new and 2317 are known ones showing polymorphism with previously reported SSRs. A total of 7877 PCR primer pairs for 1561 EST-SSR loci were designed, and primer pairs for twenty-four EST-SSRs were selected for primer evaluation. In nineteen EST-SSR loci (79.2%, amplicons were successfully generated with high quality. Seventeen (89.5% showed polymorphism in twenty-four cultivars of Chinese cabbage. The polymorphic alleles of each polymorphic locus were sequenced, and the results showed that most polymorphisms were due to variations of SSR repeat motifs. The EST-SSRs identified and characterized in this study have important implications for developing new tools for genetics and molecular breeding in Chinese cabbage.

  8. Geochemical features and effects on deep-seated fluids during the May-June 2012 southern Po Valley seismic sequence

    Directory of Open Access Journals (Sweden)

    Francesco Italiano

    2012-10-01

    Full Text Available A periodic sampling of the groundwaters and dissolved and free gases in selected deep wells located in the area affected by the May-June 2012 southern Po Valley seismic sequence has provided insight into seismogenic-induced changes of the local aquifer systems. The results obtained show progressive changes in the fluid geochemistry, allowing it to be established that deep-seated fluids were mobilized during the seismic sequence and reached surface layers along faults and fractures, which generated significant geochemical anomalies. The May-June 2012 seismic swarm (mainshock on May 29, 2012, M 5.8; 7 shocks M >5, about 200 events 3 > M > 5 induced several modifications in the circulating fluids. This study reports the preliminary results obtained for the geochemical features of the waters and gases collected over the epicentral area from boreholes drilled at different depths, thus intercepting water and gases with different origins and circulation. The aim of the investigations was to improve our knowledge of the fluids circulating over the seismic area (e.g. origin, provenance, interactions, mixing of different components, temporal changes. This was achieved by collecting samples from both shallow and deep-drilled boreholes, and then, after the selection of the relevant sites, we looked for temporal changes with mid-to-long-term monitoring activity following a constant sampling rate. This allowed us to gain better insight into the relationships between the fluid circulation and the faulting activity. The sampling sites are listed in Table 1, along with the analytical results of the gas phase. […

  9. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  10. Mitochondrial genome sequences reveal deep divergences among Anopheles punctulatus sibling species in Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Logue Kyle

    2013-02-01

    Full Text Available Abstract Background Members of the Anopheles punctulatus group (AP group are the primary vectors of human malaria in Papua New Guinea. The AP group includes 13 sibling species, most of them morphologically indistinguishable. Understanding why only certain species are able to transmit malaria requires a better comprehension of their evolutionary history. In particular, understanding relationships and divergence times among Anopheles species may enable assessing how malaria-related traits (e.g. blood feeding behaviours, vector competence have evolved. Methods DNA sequences of 14 mitochondrial (mt genomes from five AP sibling species and two species of the Anopheles dirus complex of Southeast Asia were sequenced. DNA sequences from all concatenated protein coding genes (10,770 bp were then analysed using a Bayesian approach to reconstruct phylogenetic relationships and date the divergence of the AP sibling species. Results Phylogenetic reconstruction using the concatenated DNA sequence of all mitochondrial protein coding genes indicates that the ancestors of the AP group arrived in Papua New Guinea 25 to 54 million years ago and rapidly diverged to form the current sibling species. Conclusion Through evaluation of newly described mt genome sequences, this study has revealed a divergence among members of the AP group in Papua New Guinea that would significantly predate the arrival of humans in this region, 50 thousand years ago. The divergence observed among the mtDNA sequences studied here may have resulted from reproductive isolation during historical changes in sea-level through glacial minima and maxima. This leads to a hypothesis that the AP sibling species have evolved independently for potentially thousands of generations. This suggests that the evolution of many phenotypes, such as insecticide resistance will arise independently in each of the AP sibling species studied here.

  11. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  12. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  13. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  14. Improved detection of CXCR4-using HIV by V3 genotyping: application of population-based and "deep" sequencing to plasma RNA and proviral DNA.

    Science.gov (United States)

    Swenson, Luke C; Moores, Andrew; Low, Andrew J; Thielen, Alexander; Dong, Winnie; Woods, Conan; Jensen, Mark A; Wynhoven, Brian; Chan, Dennison; Glascock, Christopher; Harrigan, P Richard

    2010-08-01

    Tropism testing should rule out CXCR4-using HIV before treatment with CCR5 antagonists. Currently, the recombinant phenotypic Trofile assay (Monogram) is most widely utilized; however, genotypic tests may represent alternative methods. Independent triplicate amplifications of the HIV gp120 V3 region were made from either plasma HIV RNA or proviral DNA. These underwent standard, population-based sequencing with an ABI3730 (RNA n = 63; DNA n = 40), or "deep" sequencing with a Roche/454 Genome Sequencer-FLX (RNA n = 12; DNA n = 12). Position-specific scoring matrices (PSSMX4/R5) (-6.96 cutoff) and geno2pheno[coreceptor] (5% false-positive rate) inferred tropism from V3 sequence. These methods were then independently validated with a separate, blinded dataset (n = 278) of screening samples from the maraviroc MOTIVATE trials. Standard sequencing of HIV RNA with PSSM yielded 69% sensitivity and 91% specificity, relative to Trofile. The validation dataset gave 75% sensitivity and 83% specificity. Proviral DNA plus PSSM gave 77% sensitivity and 71% specificity. "Deep" sequencing of HIV RNA detected >2% inferred-CXCR4-using virus in 8/8 samples called non-R5 by Trofile, and <2% in 4/4 samples called R5. Triplicate analyses of V3 standard sequence data detect greater proportions of CXCR4-using samples than previously achieved. Sequencing proviral DNA and "deep" V3 sequencing may also be useful tools for assessing tropism.

  15. Ultra-deep sequencing reveals the subclonal structure and genomic evolution of oral squamous cell carcinoma

    DEFF Research Database (Denmark)

    Tabatabaeifar, Siavosh; Thomassen, Mads; Larsen, Martin Jakob

    Background: Oral squamous cell carcinoma (OSCC), a subgroup of head and neck squamous cell carcinoma (HNSCC), is primarily caused by alcohol consumption and tobacco use. Recent DNA sequencing studies suggests that HNSCC are very heterogeneous between patients; however the intra-patient subclonal...

  16. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  17. High diversity of picornaviruses in rats from different continents revealed by deep sequencing

    DEFF Research Database (Denmark)

    Arn Hansen, Thomas; Mollerup, Sarah; Nguyen, Nam-Phuong

    2016-01-01

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norv...

  18. High diversity of picornaviruses in rats from different continents revealed by deep sequencing

    DEFF Research Database (Denmark)

    Arn Hansen, Thomas; Mollerup, Sarah; Nguyen, Nam-Phuong

    2016-01-01

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus...

  19. Deep-sequencing revealed Citrus bark cracking viroid (CBCVd) as a highly aggressive pathogen on hop

    Czech Academy of Sciences Publication Activity Database

    Jakše, J.; Radišek, S.; Pokorn, T.; Matoušek, Jaroslav; Javornik, B.

    2015-01-01

    Roč. 64, č. 4 (2015), s. 831-842 ISSN 0032-0862 R&D Projects: GA MŠk(CZ) LH14255 Institutional support: RVO:60077344 Keywords : Bioinformatic * Citrus bark cracking viroid * Hop * Next-generation sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.383, year: 2015

  20. Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

    Science.gov (United States)

    Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

  1. Deep sequencing of uveal melanoma identifies a recurrent mutation in PLCB4

    DEFF Research Database (Denmark)

    Johansson, Peter; Aoude, Lauren G; Wadt, Karin

    2016-01-01

    Next generation sequencing of uveal melanoma (UM) samples has identified a number of recurrent oncogenic or loss-of-function mutations in key driver genes including: GNAQ, GNA11, EIF1AX, SF3B1 and BAP1. To search for additional driver mutations in this tumor type we carried out whole......, instead, a BRCA mutation signature predominated. In addition to mutations in the known UM driver genes, we found a recurrent mutation in PLCB4 (c.G1888T, p.D630Y, NM_000933), which was validated using Sanger sequencing. The identical mutation was also found in published UM sequence data (1 of 56 tumors......-genome or whole-exome sequencing of 28 tumors or primary cell lines. These samples have a low mutation burden, with a mean of 10.6 protein changing mutations per sample (range 0 to 53). As expected for these sun-shielded melanomas the mutation spectrum was not consistent with an ultraviolet radiation signature...

  2. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  3. A Retrospective Examination of Feline Leukemia Subgroup Characterization: Viral Interference Assays to Deep Sequencing

    Directory of Open Access Journals (Sweden)

    Elliott S. Chiu

    2018-01-01

    Full Text Available Feline leukemia virus (FeLV was the first feline retrovirus discovered, and is associated with multiple fatal disease syndromes in cats, including lymphoma. The original research conducted on FeLV employed classical virological techniques. As methods have evolved to allow FeLV genetic characterization, investigators have continued to unravel the molecular pathology associated with this fascinating agent. In this review, we discuss how FeLV classification, transmission, and disease-inducing potential have been defined sequentially by viral interference assays, Sanger sequencing, PCR, and next-generation sequencing. In particular, we highlight the influences of endogenous FeLV and host genetics that represent FeLV research opportunities on the near horizon.

  4. A Retrospective Examination of Feline Leukemia Subgroup Characterization: Viral Interference Assays to Deep Sequencing.

    Science.gov (United States)

    Chiu, Elliott S; Hoover, Edward A; VandeWoude, Sue

    2018-01-10

    Feline leukemia virus (FeLV) was the first feline retrovirus discovered, and is associated with multiple fatal disease syndromes in cats, including lymphoma. The original research conducted on FeLV employed classical virological techniques. As methods have evolved to allow FeLV genetic characterization, investigators have continued to unravel the molecular pathology associated with this fascinating agent. In this review, we discuss how FeLV classification, transmission, and disease-inducing potential have been defined sequentially by viral interference assays, Sanger sequencing, PCR, and next-generation sequencing. In particular, we highlight the influences of endogenous FeLV and host genetics that represent FeLV research opportunities on the near horizon.

  5. Deep sequencing of the oral microbiome reveals signatures of periodontal disease.

    Directory of Open Access Journals (Sweden)

    Bo Liu

    Full Text Available The oral microbiome, the complex ecosystem of microbes inhabiting the human mouth, harbors several thousands of bacterial types. The proliferation of pathogenic bacteria within the mouth gives rise to periodontitis, an inflammatory disease known to also constitute a risk factor for cardiovascular disease. While much is known about individual species associated with pathogenesis, the system-level mechanisms underlying the transition from health to disease are still poorly understood. Through the sequencing of the 16S rRNA gene and of whole community DNA we provide a glimpse at the global genetic, metabolic, and ecological changes associated with periodontitis in 15 subgingival plaque samples, four from each of two periodontitis patients, and the remaining samples from three healthy individuals. We also demonstrate the power of whole-metagenome sequencing approaches in characterizing the genomes of key players in the oral microbiome, including an unculturable TM7 organism. We reveal the disease microbiome to be enriched in virulence factors, and adapted to a parasitic lifestyle that takes advantage of the disrupted host homeostasis. Furthermore, diseased samples share a common structure that was not found in completely healthy samples, suggesting that the disease state may occupy a narrow region within the space of possible configurations of the oral microbiome. Our pilot study demonstrates the power of high-throughput sequencing as a tool for understanding the role of the oral microbiome in periodontal disease. Despite a modest level of sequencing (~2 lanes Illumina 76 bp PE and high human DNA contamination (up to ~90% we were able to partially reconstruct several oral microbes and to preliminarily characterize some systems-level differences between the healthy and diseased oral microbiomes.

  6. High diversity of picornaviruses in rats from different continents revealed by deep sequencing.

    Science.gov (United States)

    Hansen, Thomas Arn; Mollerup, Sarah; Nguyen, Nam-Phuong; White, Nicole E; Coghlan, Megan; Alquezar-Planas, David E; Joshi, Tejal; Jensen, Randi Holm; Fridholm, Helena; Kjartansdóttir, Kristín Rós; Mourier, Tobias; Warnow, Tandy; Belsham, Graham J; Bunce, Michael; Willerslev, Eske; Nielsen, Lars Peter; Vinner, Lasse; Hansen, Anders Johannes

    2016-08-17

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norvegicus (R. norvegicus) is a known reservoir for important zoonotic pathogens. Transmission may be direct via contact with the animal, for example, through exposure to its faecal matter, or indirectly mediated by arthropod vectors. Here we investigated the viral content in rat faecal matter (n=29) collected from two continents by analyzing 2.2 billion next-generation sequencing reads derived from both DNA and RNA. Among other virus families, we found sequences from members of the Picornaviridae to be abundant in the microbiome of all the samples. Here we describe the diversity of the picornavirus-like contigs including near-full-length genomes closely related to the Boone cardiovirus and Theiler's encephalomyelitis virus. From this study, we conclude that picornaviruses within R. norvegicus are more diverse than previously recognized. The virome of R. norvegicus should be investigated further to assess the full potential for zoonotic virus transmission.

  7. Deep transcriptome sequencing provides new insights into the structural and functional organization of the wheat genome.

    Science.gov (United States)

    Pingault, Lise; Choulet, Frédéric; Alberti, Adriana; Glover, Natasha; Wincker, Patrick; Feuillet, Catherine; Paux, Etienne

    2015-02-10

    Because of its size, allohexaploid nature, and high repeat content, the bread wheat genome is a good model to study the impact of the genome structure on gene organization, function, and regulation. However, because of the lack of a reference genome sequence, such studies have long been hampered and our knowledge of the wheat gene space is still limited. The access to the reference sequence of the wheat chromosome 3B provided us with an opportunity to study the wheat transcriptome and its relationships to genome and gene structure at a level that has never been reached before. By combining this sequence with RNA-seq data, we construct a fine transcriptome map of the chromosome 3B. More than 8,800 transcription sites are identified, that are distributed throughout the entire chromosome. Expression level, expression breadth, alternative splicing as well as several structural features of genes, including transcript length, number of exons, and cumulative intron length are investigated. Our analysis reveals a non-monotonic relationship between gene expression and structure and leads to the hypothesis that gene structure is determined by its function, whereas gene expression is subject to energetic cost. Moreover, we observe a recombination-based partitioning at the gene structure and function level. Our analysis provides new insights into the relationships between gene and genome structure and function. It reveals mechanisms conserved with other plant species as well as superimposed evolutionary forces that shaped the wheat gene space, likely participating in wheat adaptation.

  8. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.

    Science.gov (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang

    2014-08-01

    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  9. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  10. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  11. Identification of microRNAs Involved in the Host Response to Enterovirus 71 Infection by a Deep Sequencing Approach

    Directory of Open Access Journals (Sweden)

    Lunbiao Cui

    2010-01-01

    Full Text Available Role of microRNA (miRNA has been highlighted in pathogen-host interactions recently. To identify cellular miRNAs involved in the host response to enterovirus 71 (EV71 infection, we performed a comprehensive miRNA profiling in EV71-infected Hep2 cells through deep sequencing. 64 miRNAs were found whose expression levels changed for more than 2-fold in response to EV71 infection. Gene ontology analysis revealed that many of these mRNAs play roles in neurological process, immune response, and cell death pathways, which are known to be associated with the extreme virulence of EV71. To our knowledge, this is the first study on host miRNAs expression alteration response to EV71 infection. Our findings supported the hypothesis that certain miRNAs might be essential in the host-pathogen interactions.

  12. Laser Capture and Deep Sequencing Reveals the Transcriptomic Programmes Regulating the Onset of Pancreas and Liver Differentiation in Human Embryos

    Directory of Open Access Journals (Sweden)

    Rachel E. Jennings

    2017-11-01

    Full Text Available To interrogate the alternative fates of pancreas and liver in the earliest stages of human organogenesis, we developed laser capture, RNA amplification, and computational analysis of deep sequencing. Pancreas-enriched gene expression was less conserved between human and mouse than for liver. The dorsal pancreatic bud was enriched for components of Notch, Wnt, BMP, and FGF signaling, almost all genes known to cause pancreatic agenesis or hypoplasia, and over 30 unexplored transcription factors. SOX9 and RORA were imputed as key regulators in pancreas compared with EP300, HNF4A, and FOXA family members in liver. Analyses implied that current in vitro human stem cell differentiation follows a dorsal rather than a ventral pancreatic program and pointed to additional factors for hepatic differentiation. In summary, we provide the transcriptional codes regulating the start of human liver and pancreas development to facilitate stem cell research and clinical interpretation without inter-species extrapolation.

  13. Insights into the genetic structure and diversity of 38 South Asian Indians from deep whole-genome sequencing.

    Directory of Open Access Journals (Sweden)

    Lai-Ping Wong

    2014-05-01

    Full Text Available South Asia possesses a significant amount of genetic diversity due to considerable intergroup differences in culture and language. There have been numerous reports on the genetic structure of Asian Indians, although these have mostly relied on genotyping microarrays or targeted sequencing of the mitochondria and Y chromosomes. Asian Indians in Singapore are primarily descendants of immigrants from Dravidian-language-speaking states in south India, and 38 individuals from the general population underwent deep whole-genome sequencing with a target coverage of 30X as part of the Singapore Sequencing Indian Project (SSIP. The genetic structure and diversity of these samples were compared against samples from the Singapore Sequencing Malay Project and populations in Phase 1 of the 1,000 Genomes Project (1 KGP. SSIP samples exhibited greater intra-population genetic diversity and possessed higher heterozygous-to-homozygous genotype ratio than other Asian populations. When compared against a panel of well-defined Asian Indians, the genetic makeup of the SSIP samples was closely related to South Indians. However, even though the SSIP samples clustered distinctly from the Europeans in the global population structure analysis with autosomal SNPs, eight samples were assigned to mitochondrial haplogroups that were predominantly present in Europeans and possessed higher European admixture than the remaining samples. An analysis of the relative relatedness between SSIP with two archaic hominins (Denisovan, Neanderthal identified higher ancient admixture in East Asian populations than in SSIP. The data resource for these samples is publicly available and is expected to serve as a valuable complement to the South Asian samples in Phase 3 of 1 KGP.

  14. Insights into the genetic structure and diversity of 38 South Asian Indians from deep whole-genome sequencing.

    Science.gov (United States)

    Wong, Lai-Ping; Lai, Jason Kuan-Han; Saw, Woei-Yuh; Ong, Rick Twee-Hee; Cheng, Anthony Youzhi; Pillai, Nisha Esakimuthu; Liu, Xuanyao; Xu, Wenting; Chen, Peng; Foo, Jia-Nee; Tan, Linda Wei-Lin; Koo, Seok-Hwee; Soong, Richie; Wenk, Markus Rene; Lim, Wei-Yen; Khor, Chiea-Chuen; Little, Peter; Chia, Kee-Seng; Teo, Yik-Ying

    2014-05-01

    South Asia possesses a significant amount of genetic diversity due to considerable intergroup differences in culture and language. There have been numerous reports on the genetic structure of Asian Indians, although these have mostly relied on genotyping microarrays or targeted sequencing of the mitochondria and Y chromosomes. Asian Indians in Singapore are primarily descendants of immigrants from Dravidian-language-speaking states in south India, and 38 individuals from the general population underwent deep whole-genome sequencing with a target coverage of 30X as part of the Singapore Sequencing Indian Project (SSIP). The genetic structure and diversity of these samples were compared against samples from the Singapore Sequencing Malay Project and populations in Phase 1 of the 1,000 Genomes Project (1 KGP). SSIP samples exhibited greater intra-population genetic diversity and possessed higher heterozygous-to-homozygous genotype ratio than other Asian populations. When compared against a panel of well-defined Asian Indians, the genetic makeup of the SSIP samples was closely related to South Indians. However, even though the SSIP samples clustered distinctly from the Europeans in the global population structure analysis with autosomal SNPs, eight samples were assigned to mitochondrial haplogroups that were predominantly present in Europeans and possessed higher European admixture than the remaining samples. An analysis of the relative relatedness between SSIP with two archaic hominins (Denisovan, Neanderthal) identified higher ancient admixture in East Asian populations than in SSIP. The data resource for these samples is publicly available and is expected to serve as a valuable complement to the South Asian samples in Phase 3 of 1 KGP.

  15. Deep Sequencing of Plant and Animal DNA Contained within Traditional Chinese Medicines Reveals Legality Issues and Health Safety Concerns

    Science.gov (United States)

    Coghlan, Megan L.; Haile, James; Houston, Jayne; Murray, Dáithí C.; White, Nicole E.; Moolhuijzen, Paula; Bellgard, Matthew I.; Bunce, Michael

    2012-01-01

    Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when

  16. Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing.

    Science.gov (United States)

    Cornman, Robert Scott; Boncristiani, Humberto; Dainat, Benjamin; Chen, Yanping; vanEngelsdorp, Dennis; Weaver, Daniel; Evans, Jay D

    2013-03-07

    Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RNA viruses of the Western honey bee (Apis mellifera), deformed wing virus (DWV) and Israel acute paralysis virus (IAPV). All viral RNA was extracted from North American samples of honey bees or, in one case, the ectoparasitic mite Varroa destructor. Coverage depth was generally lower for IAPV than DWV, and marked gaps in coverage occurred in several narrow regions (selection. The Kakugo strain of DWV fell outside of all other DWV sequences at 100% bootstrap support. IAPV consensus sequences supported the existence of multiple clades as had been previously reported, and Fu and Li's D was closer to neutral expectation overall, although a sliding-window analysis identified a significantly positive D within the protease region, suggesting selection maintains diversity in that region. Within-sample mean diversity was comparable between the two viruses on average, although for both viruses there was substantial variation among samples in mean diversity at third codon positions and in the number of high-diversity sites. FST values were bimodal for DWV, likely reflecting neutral divergence in two low-diversity populations, whereas IAPV had several sites that were strong outliers with very low FST. This initial survey of genetic variation within honey bee RNA viruses suggests future directions for studies examining the underlying causes of population-genetic structure in these economically important pathogens.

  17. Deep sequencing-based analysis of the Cymbidium ensifolium floral transcriptome.

    Directory of Open Access Journals (Sweden)

    Xiaobai Li

    Full Text Available Cymbidium ensifolium is a Chinese Cymbidium with an elegant shape, beautiful appearance, and a fragrant aroma. C. ensifolium has a long history of cultivation in China and it has excellent commercial value as a potted plant and cut flower. The development of C. ensifolium genomic resources has been delayed because of its large genome size. Taking advantage of technical and cost improvement of RNA-Seq, we extracted total mRNA from flower buds and mature flowers and obtained a total of 9.52 Gb of filtered nucleotides comprising 98,819,349 filtered reads. The filtered reads were assembled into 101,423 isotigs, representing 51,696 genes. Of the 101,423 isotigs, 41,873 were putative homologs of annotated sequences in the public databases, of which 158 were associated with floral development and 119 were associated with flowering. The isotigs were categorized according to their putative functions. In total, 10,212 of the isotigs were assigned into 25 eukaryotic orthologous groups (KOGs, 41,690 into 58 gene ontology (GO terms, and 9,830 into 126 Arabidopsis Kyoto Encyclopedia of Genes and Genomes (KEGG pathways, and 9,539 isotigs into 123 rice pathways. Comparison of the isotigs with those of the two related orchid species P. equestris and C. sinense showed that 17,906 isotigs are unique to C. ensifolium. In addition, a total of 7,936 SSRs and 16,676 putative SNPs were identified. To our knowledge, this transcriptome database is the first major genomic resource for C. ensifolium and the most comprehensive transcriptomic resource for genus Cymbidium. These sequences provide valuable information for understanding the molecular mechanisms of floral development and flowering. Sequences predicted to be unique to C. ensifolium would provide more insights into C. ensifolium gene diversity. The numerous SNPs and SSRs identified in the present study will contribute to marker development for C. ensifolium.

  18. Congruent Deep Relationships in the Grape Family (Vitaceae) Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Science.gov (United States)

    Zhang, Ning; Wen, Jun; Zimmer, Elizabeth A

    2015-01-01

    Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera). The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera) methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  19. Congruent Deep Relationships in the Grape Family (Vitaceae Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera. The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  20. Predicting backbone Cα angles and dihedrals from protein sequences by stacked sparse auto-encoder deep neural network.

    Science.gov (United States)

    Lyons, James; Dehzangi, Abdollah; Heffernan, Rhys; Sharma, Alok; Paliwal, Kuldip; Sattar, Abdul; Zhou, Yaoqi; Yang, Yuedong

    2014-10-30

    Because a nearly constant distance between two neighbouring Cα atoms, local backbone structure of proteins can be represented accurately by the angle between C(αi-1)-C(αi)-C(αi+1) (θ) and a dihedral angle rotated about the C(αi)-C(αi+1) bond (τ). θ and τ angles, as the representative of structural properties of three to four amino-acid residues, offer a description of backbone conformations that is complementary to φ and ψ angles (single residue) and secondary structures (>3 residues). Here, we report the first machine-learning technique for sequence-based prediction of θ and τ angles. Predicted angles based on an independent test have a mean absolute error of 9° for θ and 34° for τ with a distribution on the θ-τ plane close to that of native values. The average root-mean-square distance of 10-residue fragment structures constructed from predicted θ and τ angles is only 1.9Å from their corresponding native structures. Predicted θ and τ angles are expected to be complementary to predicted ϕ and ψ angles and secondary structures for using in model validation and template-based as well as template-free structure prediction. The deep neural network learning technique is available as an on-line server called Structural Property prediction with Integrated DEep neuRal network (SPIDER) at http://sparks-lab.org. Copyright © 2014 Wiley Periodicals, Inc.

  1. Metagenomes obtained by "deep sequencing" - what do they tell about the EBPR communities?

    DEFF Research Database (Denmark)

    Albertsen, Mads; Saunders, Aaron Marc; Nielsen, Kåre Lehmann

    2013-01-01

    Metagenomics enables studies of the genomic potential of complex microbial communities by sequencing bulk genomic DNA directly from the environment. Knowledge of the genetic potential of a community can be used to formulate and test ecological hypotheses about stability and performance...... demonstrate that metagenomics can be used as a powerful tool for system wide characterization of the EBPR community as well as for a deeper understanding of the function of specific community members. Furthermore, we discuss and illustrate some of the general pitfalls in metagenomics and stress the need...

  2. Evolution of simeprevir-resistant variants over time by ultra-deep sequencing in HCV genotype 1b.

    Science.gov (United States)

    Akuta, Norio; Suzuki, Fumitaka; Sezaki, Hitomi; Suzuki, Yoshiyuki; Hosaka, Tetsuya; Kobayashi, Masahiro; Kobayashi, Mariko; Saitoh, Satoshi; Ikeda, Kenji; Kumada, Hiromitsu

    2014-08-01

    Using ultra-deep sequencing technology, the present study was designed to investigate the evolution of simeprevir-resistant variants (amino acid substitutions of aa80, aa155, aa156, and aa168 positions in HCV NS3 region) over time. In Toranomon Hospital, 18 Japanese patients infected with HCV genotype 1b, received triple therapy of simeprevir/PEG-IFN/ribavirin (DRAGON or CONCERT study). Sustained virological response rate was 67%, and that was significantly higher in patients with IL28B rs8099917 TT than in those with non-TT. Six patients, who did not achieve sustained virological response, were tested for resistant variants by ultra-deep sequencing, at the baseline, at the time of re-elevation of viral loads, and at 96 weeks after the completion of treatment. Twelve of 18 resistant variants, detected at re-elevation of viral load, were de novo resistant variants. Ten of 12 de novo resistant variants become undetectable over time, and that five of seven resistant variants, detected at baseline, persisted over time. In one patient, variants of Q80R at baseline (0.3%) increased at 96-week after the cessation of treatment (10.2%), and de novo resistant variants of D168E (0.3%) also increased at 96-week after the cessation of treatment (9.7%). In conclusion, the present study indicates that the emergence of simeprevir-resistant variants after the start of treatment could not be predicted at baseline, and the majority of de novo resistant variants become undetectable over time. Further large-scale prospective studies should be performed to investigate the clinical utility in detecting simeprevir-resistant variants. © 2014 Wiley Periodicals, Inc.

  3. DEEPre: sequence-based enzyme EC number prediction by deep learning

    KAUST Repository

    Li, Yu

    2017-10-20

    Annotation of enzyme function has a broad range of applications, such as metagenomics, industrial biotechnology, and diagnosis of enzyme deficiency-caused diseases. However, the time and resource required make it prohibitively expensive to experimentally determine the function of every enzyme. Therefore, computational enzyme function prediction has become increasingly important. In this paper, we develop such an approach, determining the enzyme function by predicting the Enzyme Commission number.We propose an end-to-end feature selection and classification model training approach, as well as an automatic and robust feature dimensionality uniformization method, DEEPre, in the field of enzyme function prediction. Instead of extracting manuallycrafted features from enzyme sequences, our model takes the raw sequence encoding as inputs, extracting convolutional and sequential features from the raw encoding based on the classification result to directly improve the prediction performance. The thorough cross-fold validation experiments conducted on two large-scale datasets show that DEEPre improves the prediction performance over the previous state-of-the-art methods. In addition, our server outperforms five other servers in determining the main class of enzymes on a separate low-homology dataset. Two case studies demonstrate DEEPre\\'s ability to capture the functional difference of enzyme isoforms.The server could be accessed freely at http://www.cbrc.kaust.edu.sa/DEEPre.

  4. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

    Science.gov (United States)

    Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

    2011-07-01

    Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

  5. Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts.

    Science.gov (United States)

    Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

    2010-08-01

    Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250,000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described 'sponge-specific' clusters that were detected in this study, 48% were found exclusively in adults and larvae - implying vertical transmission of these groups. The remaining taxa, including 'Poribacteria', were also found at very low abundance among the 135,000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  6. DEEPre: sequence-based enzyme EC number prediction by deep learning

    KAUST Repository

    Li, Yu; Wang, Sheng; Umarov, Ramzan; Xie, Bingqing; Fan, Ming; Li, Lihua; Gao, Xin

    2017-01-01

    Annotation of enzyme function has a broad range of applications, such as metagenomics, industrial biotechnology, and diagnosis of enzyme deficiency-caused diseases. However, the time and resource required make it prohibitively expensive to experimentally determine the function of every enzyme. Therefore, computational enzyme function prediction has become increasingly important. In this paper, we develop such an approach, determining the enzyme function by predicting the Enzyme Commission number.We propose an end-to-end feature selection and classification model training approach, as well as an automatic and robust feature dimensionality uniformization method, DEEPre, in the field of enzyme function prediction. Instead of extracting manuallycrafted features from enzyme sequences, our model takes the raw sequence encoding as inputs, extracting convolutional and sequential features from the raw encoding based on the classification result to directly improve the prediction performance. The thorough cross-fold validation experiments conducted on two large-scale datasets show that DEEPre improves the prediction performance over the previous state-of-the-art methods. In addition, our server outperforms five other servers in determining the main class of enzymes on a separate low-homology dataset. Two case studies demonstrate DEEPre's ability to capture the functional difference of enzyme isoforms.The server could be accessed freely at http://www.cbrc.kaust.edu.sa/DEEPre.

  7. Evolutionary Relations of Hexanchiformes Deep-Sea Sharks Elucidated by Whole Mitochondrial Genome Sequences

    Science.gov (United States)

    Tanaka, Keiko; Tomita, Taketeru; Suzuki, Shingo; Hosomichi, Kazuyoshi; Sano, Kazumi; Doi, Hiroyuki; Kono, Azumi; Inoko, Hidetoshi; Kulski, Jerzy K.; Tanaka, Sho

    2013-01-01

    Hexanchiformes is regarded as a monophyletic taxon, but the morphological and genetic relationships between the five extant species within the order are still uncertain. In this study, we determined the whole mitochondrial DNA (mtDNA) sequences of seven sharks including representatives of the five Hexanchiformes, one squaliform, and one carcharhiniform and inferred the phylogenetic relationships among those species and 12 other Chondrichthyes (cartilaginous fishes) species for which the complete mitogenome is available. The monophyly of Hexanchiformes and its close relation with all other Squaliformes sharks were strongly supported by likelihood and Bayesian phylogenetic analysis of 13,749 aligned nucleotides of 13 protein coding genes and two rRNA genes that were derived from the whole mDNA sequences of the 19 species. The phylogeny suggested that Hexanchiformes is in the superorder Squalomorphi, Chlamydoselachus anguineus (frilled shark) is the sister species to all other Hexanchiformes, and the relations within Hexanchiformes are well resolved as Chlamydoselachus, (Notorynchus, (Heptranchias, (Hexanchus griseus, H. nakamurai))). Based on our phylogeny, we discussed evolutionary scenarios of the jaw suspension mechanism and gill slit numbers that are significant features in the sharks. PMID:24089661

  8. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  9. Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches.

    Science.gov (United States)

    Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-03-12

    microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

  10. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  11. Genome-wide analysis of SRSF10-regulated alternative splicing by deep sequencing of chicken transcriptome

    Directory of Open Access Journals (Sweden)

    Xuexia Zhou

    2014-12-01

    Full Text Available Splicing factor SRSF10 is known to function as a sequence-specific splicing activator that is capable of regulating alternative splicing both in vitro and in vivo. We recently used an RNA-seq approach coupled with bioinformatics analysis to identify the extensive splicing network regulated by SRSF10 in chicken cells. We found that SRSF10 promoted both exon inclusion and exclusion. Functionally, many of the SRSF10-verified alternative exons are linked to pathways of response to external stimulus. Here we describe in detail the experimental design, bioinformatics analysis and GO/pathway enrichment analysis of SRSF10-regulated genes to correspond with our data in the Gene Expression Omnibus with accession number GSE53354. Our data thus provide a resource for studying regulation of alternative splicing in vivo that underlines biological functions of splicing regulatory proteins in cells.

  12. Deep Sequencing Reveals Uncharted Isoform Heterogeneity of the Protein-Coding Transcriptome in Cerebral Ischemia.

    Science.gov (United States)

    Bhattarai, Sunil; Aly, Ahmed; Garcia, Kristy; Ruiz, Diandra; Pontarelli, Fabrizio; Dharap, Ashutosh

    2018-06-03

    Gene expression in cerebral ischemia has been a subject of intense investigations for several years. Studies utilizing probe-based high-throughput methodologies such as microarrays have contributed significantly to our existing knowledge but lacked the capacity to dissect the transcriptome in detail. Genome-wide RNA-sequencing (RNA-seq) enables comprehensive examinations of transcriptomes for attributes such as strandedness, alternative splicing, alternative transcription start/stop sites, and sequence composition, thus providing a very detailed account of gene expression. Leveraging this capability, we conducted an in-depth, genome-wide evaluation of the protein-coding transcriptome of the adult mouse cortex after transient focal ischemia at 6, 12, or 24 h of reperfusion using RNA-seq. We identified a total of 1007 transcripts at 6 h, 1878 transcripts at 12 h, and 1618 transcripts at 24 h of reperfusion that were significantly altered as compared to sham controls. With isoform-level resolution, we identified 23 splice variants arising from 23 genes that were novel mRNA isoforms. For a subset of genes, we detected reperfusion time-point-dependent splice isoform switching, indicating an expression and/or functional switch for these genes. Finally, for 286 genes across all three reperfusion time-points, we discovered multiple, distinct, simultaneously expressed and differentially altered isoforms per gene that were generated via alternative transcription start/stop sites. Of these, 165 isoforms derived from 109 genes were novel mRNAs. Together, our data unravel the protein-coding transcriptome of the cerebral cortex at an unprecedented depth to provide several new insights into the flexibility and complexity of stroke-related gene transcription and transcript organization.

  13. Transcriptional responses of Acropora hyacinthus embryo under the benzo(a)pyrene stress by deep sequencing.

    Science.gov (United States)

    Xiao, Rong; Zhou, Hailong; Chen, Chien-Min; Cheng, Huamin; Li, Hongwu; Xie, Jia; Zhao, Hongwei; Han, Qian; Diao, Xiaoping

    2018-04-24

    Coral embryos are a critical and sensitive period for the early growth and development of coral. Benzo(a)pyrene (BaP) is widely distributed in the ocean and has strong toxicity, but there is little information on the toxic effects to coral embryos exposed to this widespread environmental contaminant. Thus, in this study, we utilized the Illumina Hiseq™ 4000 platform to explore the gene response of Acropora hyacinthus embryos under the BaP stress. A total of 130,042 Unigenes were obtained and analyzed, and approximately 37.67% of those matched with sequences from four different species. In total, 2606 Unigenes were up-regulated, and 3872 Unigenes were down-regulated. After Gene Ontology (GO) annotation, the results show that the "cellular process" and "metabolic process" were leading in the category of biological processes, which the "binding" and "catalytic activity" were the most abundant subcategories in molecular function. Based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, the most differentially expressed genes (DEGs) were enriched, as well as down-regulated in the pathways of oxidative phosphorylation, metabolism of xenobiotics, immune-related genes, apoptosis and human disease genes. At the same time, 388,197 of Single-nucleotide Polymorphisms (SNPs) and 6164 of Simple Sequence Repeats (SSRs) were obtained, which can be served as the richer and more valuable SSRs molecular markers in the future. The results of this study can help to better understand the toxicological mechanism of coral embryo exposed to BaP, and it is also essential for the protection and restoration of coral reef ecosystem in the future. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  15. Identification and characterization of novel serum microRNA candidates from deep sequencing in cervical cancer patients.

    Science.gov (United States)

    Juan, Li; Tong, Hong-li; Zhang, Pengjun; Guo, Guanghong; Wang, Zi; Wen, Xinyu; Dong, Zhennan; Tian, Ya-ping

    2014-09-03

    Small non-coding microRNAs (miRNAs) are involved in cancer development and progression, and serum profiles of cervical cancer patients may be useful for identifying novel miRNAs. We performed deep sequencing on serum pools of cervical cancer patients and healthy controls with 3 replicates and constructed a small RNA library. We used MIREAP to predict novel miRNAs and identified 2 putative novel miRNAs between serum pools of cervical cancer patients and healthy controls after filtering out pseudo-pre-miRNAs using Triplet-SVM analysis. The 2 putative novel miRNAs were validated by real time PCR and were significantly decreased in cervical cancer patients compared with healthy controls. One novel miRNA had an area under curve (AUC) of 0.921 (95% CI: 0.883, 0.959) with a sensitivity of 85.7% and a specificity of 88.2% when discriminating between cervical cancer patients and healthy controls. Our results suggest that characterizing serum profiles of cervical cancers by Solexa sequencing may be a good method for identifying novel miRNAs and that the validated novel miRNAs described here may be cervical cancer-associated biomarkers.

  16. Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

    Science.gov (United States)

    Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

    2016-10-04

    To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

  17. Identifying genomic changes associated with insecticide resistance in the dengue mosquito Aedes aegypti by deep targeted sequencing

    Science.gov (United States)

    Faucon, Frederic; Dusfour, Isabelle; Gaude, Thierry; Navratil, Vincent; Boyer, Frederic; Chandre, Fabrice; Sirisopa, Patcharawan; Thanispong, Kanutcharee; Juntarajumnong, Waraporn; Poupardin, Rodolphe; Chareonviriyaphap, Theeraphap; Girod, Romain; Corbel, Vincent; Reynaud, Stephane; David, Jean-Philippe

    2015-01-01

    The capacity of mosquitoes to resist insecticides threatens the control of diseases such as dengue and malaria. Until alternative control tools are implemented, characterizing resistance mechanisms is crucial for managing resistance in natural populations. Insecticide biodegradation by detoxification enzymes is a common resistance mechanism; however, the genomic changes underlying this mechanism have rarely been identified, precluding individual resistance genotyping. In particular, the role of copy number variations (CNVs) and polymorphisms of detoxification enzymes have never been investigated at the genome level, although they can represent robust markers of metabolic resistance. In this context, we combined target enrichment with high-throughput sequencing for conducting the first comprehensive screening of gene amplifications and polymorphisms associated with insecticide resistance in mosquitoes. More than 760 candidate genes were captured and deep sequenced in several populations of the dengue mosquito Ae. aegypti displaying distinct genetic backgrounds and contrasted resistance levels to the insecticide deltamethrin. CNV analysis identified 41 gene amplifications associated with resistance, most affecting cytochrome P450s overtranscribed in resistant populations. Polymorphism analysis detected more than 30,000 variants and strong selection footprints in specific genomic regions. Combining Bayesian and allele frequency filtering approaches identified 55 nonsynonymous variants strongly associated with resistance. Both CNVs and polymorphisms were conserved within regions but differed across continents, confirming that genomic changes underlying metabolic resistance to insecticides are not universal. By identifying novel DNA markers of insecticide resistance, this study opens the way for tracking down metabolic changes developed by mosquitoes to resist insecticides within and among populations. PMID:26206155

  18. Real-Time Human Detection for Aerial Captured Video Sequences via Deep Models

    Directory of Open Access Journals (Sweden)

    Nouar AlDahoul

    2018-01-01

    Full Text Available Human detection in videos plays an important role in various real life applications. Most of traditional approaches depend on utilizing handcrafted features which are problem-dependent and optimal for specific tasks. Moreover, they are highly susceptible to dynamical events such as illumination changes, camera jitter, and variations in object sizes. On the other hand, the proposed feature learning approaches are cheaper and easier because highly abstract and discriminative features can be produced automatically without the need of expert knowledge. In this paper, we utilize automatic feature learning methods which combine optical flow and three different deep models (i.e., supervised convolutional neural network (S-CNN, pretrained CNN feature extractor, and hierarchical extreme learning machine for human detection in videos captured using a nonstatic camera on an aerial platform with varying altitudes. The models are trained and tested on the publicly available and highly challenging UCF-ARG aerial dataset. The comparison between these models in terms of training, testing accuracy, and learning speed is analyzed. The performance evaluation considers five human actions (digging, waving, throwing, walking, and running. Experimental results demonstrated that the proposed methods are successful for human detection task. Pretrained CNN produces an average accuracy of 98.09%. S-CNN produces an average accuracy of 95.6% with soft-max and 91.7% with Support Vector Machines (SVM. H-ELM has an average accuracy of 95.9%. Using a normal Central Processing Unit (CPU, H-ELM’s training time takes 445 seconds. Learning in S-CNN takes 770 seconds with a high performance Graphical Processing Unit (GPU.

  19. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  20. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars

    Directory of Open Access Journals (Sweden)

    Kim Jungeun

    2012-11-01

    Full Text Available Abstract Background Roses (Rosa sp., which belong to the family Rosaceae, are the most economically important ornamental plants—making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. Results We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: ‘Vital’, ‘Maroussia’, and ‘Sympathy’ and Rosa rugosa Thunb. , respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO terms, Plant Ontology (PO terms, and MIPS Functional Catalogue (FunCat terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. Conclusions In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a

  1. Analysis of hepatitis C NS5A resistance associated polymorphisms using ultra deep single molecule real time (SMRT) sequencing.

    Science.gov (United States)

    Bergfors, Assar; Leenheer, Daniël; Bergqvist, Anders; Ameur, Adam; Lennerstrand, Johan

    2016-02-01

    Development of Hepatitis C virus (HCV) resistance against direct-acting antivirals (DAAs), including NS5A inhibitors, is an obstacle to successful treatment of HCV when DAAs are used in sub-optimal combinations. Furthermore, it has been shown that baseline (pre-existing) resistance against DAAs is present in treatment naïve-patients and this will potentially complicate future treatment strategies in different HCV genotypes (GTs). Thus the aim was to detect low levels of NS5A resistant associated variants (RAVs) in a limited sample set of treatment-naïve patients of HCV GT1a and 3a, since such polymorphisms can display in vitro resistance as high as 60000 fold. Ultra-deep single molecule real time (SMRT) sequencing with the Pacific Biosciences (PacBio) RSII instrument was used to detect these RAVs. The SMRT sequencing was conducted on ten samples; three of them positive with Sanger sequencing (GT1a Q30H and Y93N, and GT3a Y93H), five GT1a samples, and two GT3a non-positive samples. The same methods were applied to the HCV GT1a H77-plasmid in a dilution series, in order to determine the error rates of replication, which in turn was used to determine the limit of detection (LOD), as defined by mean + 3SD, of minority variants down to 0.24%. We found important baseline NS5A RAVs at levels between 0.24 and 0.5%, which could potentially have clinical relevance. This new method with low level detection of baseline RAVs could be useful in predicting the most cost-efficient combination of DAA treatment, and reduce the treatment duration for an HCV infected individual. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. The 2007 Nazko, British Columbia, earthquake sequence: Injection of magma deep in the crust beneath the Anahim volcanic belt

    Science.gov (United States)

    Cassidy, J.F.; Balfour, N.; Hickson, C.; Kao, H.; White, Rickie; Caplan-Auerbach, J.; Mazzotti, S.; Rogers, Gary C.; Al-Khoubbi, I.; Bird, A.L.; Esteban, L.; Kelman, M.; Hutchinson, J.; McCormack, D.

    2011-01-01

    On 9 October 2007, an unusual sequence of earthquakes began in central British Columbia about 20 km west of the Nazko cone, the most recent (circa 7200 yr) volcanic center in the Anahim volcanic belt. Within 25 hr, eight earthquakes of magnitude 2.3-2.9 occurred in a region where no earthquakes had previously been recorded. During the next three weeks, more than 800 microearthquakes were located (and many more detected), most at a depth of 25-31 km and within a radius of about 5 km. After about two months, almost all activity ceased. The clear P- and S-wave arrivals indicated that these were high-frequency (volcanic-tectonic) earthquakes and the b value of 1.9 that we calculated is anomalous for crustal earthquakes but consistent with volcanic-related events. Analysis of receiver functions at a station immediately above the seismicity indicated a Moho near 30 km depth. Precise relocation of the seismicity using a double-difference method suggested a horizontal migration at the rate of about 0:5 km=d, with almost all events within the lowermost crust. Neither harmonic tremor nor long-period events were observed; however, some spasmodic bursts were recorded and determined to be colocated with the earthquake hypocenters. These observations are all very similar to a deep earthquake sequence recorded beneath Lake Tahoe, California, in 2003-2004. Based on these remarkable similarities, we interpret the Nazko sequence as an indication of an injection of magma into the lower crust beneath the Anahim volcanic belt. This magma injection fractures rock, producing high-frequency, volcanic-tectonic earthquakes and spasmodic bursts.

  3. Genomic DNA sequences from mastodon and woolly mammoth reveal deep speciation of forest and savanna elephants.

    Directory of Open Access Journals (Sweden)

    Nadin Rohland

    2010-12-01

    Full Text Available To elucidate the history of living and extinct elephantids, we generated 39,763 bp of aligned nuclear DNA sequence across 375 loci for African savanna elephant, African forest elephant, Asian elephant, the extinct American mastodon, and the woolly mammoth. Our data establish that the Asian elephant is the closest living relative of the extinct mammoth in the nuclear genome, extending previous findings from mitochondrial DNA analyses. We also find that savanna and forest elephants, which some have argued are the same species, are as or more divergent in the nuclear genome as mammoths and Asian elephants, which are considered to be distinct genera, thus resolving a long-standing debate about the appropriate taxonomic classification of the African elephants. Finally, we document a much larger effective population size in forest elephants compared with the other elephantid taxa, likely reflecting species differences in ancient geographic structure and range and differences in life history traits such as variance in male reproductive success.

  4. Deep Sequencing of Porphyromonas gingivalis and comparative transcriptome analysis of a LuxS mutant

    Directory of Open Access Journals (Sweden)

    Takanoi eHirano

    2012-06-01

    Full Text Available Porphyromonas gingivalis is a major etiological agent and chronic and aggressive forms of periodontal disease. The organism is an assacharolytic anaerobe and is a constituent of mixed species biofilms in a variety of microenvironments in the oral cavity. P. gingivalis expresses a range of virulence factors over which it exerts tight control. High-throughput sequencing technologies provide the opportunity to relate functional genomics to basic biology. In this study we report qualitative and quantitative RNA-Seq analysis of the transcriptome of P. gingivalis. We have also applied RNA-Seq to the transcriptome of a ΔluxS mutant of P. gingivalis deficient in AI-2-mediated bacterial communication. The transcriptome analysis confirmed the expression of all predicted ORFs for strain ATCC 33277, including 854 hypothetical proteins, and allowed the identification of hitherto unknown transcriptional units. Twelve noncoding RNAs were identified, including 11 small RNAs and one cobalamine riboswitch. Fifty seven genes were differentially regulated in the LuxS mutant. Addition of exogenous synthetic 4,5-dihydroxy-2,3-pentanedione (DPD, AI-2 precursor to the ΔluxS mutant culture complemented expression of a subset of genes, indicating that LuxS is involved in both AI-2 signaling and non-signaling dependent systems in P. gingivalis. This work provides an important dataset for future study of P. gingivalis pathophysiology and further defines the LuxS regulon in this oral pathogen.

  5. Deep sequencing and ecological characterization of gut microbial communities of diverse bumble bee species.

    Directory of Open Access Journals (Sweden)

    Haw Chuan Lim

    Full Text Available Gut bacterial communities of bumble bees are correlated with defense against pathogens. Further understanding this host-microbe association is vitally important as bumble bees are currently experiencing global population declines, potentially due in part to emergent diseases. In this study, we used pyrosequencing and community fingerprinting (ARISA to characterize the gut microbial communities of nine bumble species from across the Bombus phylogeny. Overall, we delimited 74 bacterial taxa (operational taxonomic units or OTUs belonging to Betaproteobacteria, Gammaproteobacteria, Bacilli, Actinobacteria, Flavobacteria and Alphaproteobacteria. Each bacterial community was taxonomically simple, containing an average of 1.9 common (relative abundance per sample > 5% bacterial OTUs. The most abundant and prevalent (occurring in 92% of the samples bacterial OTU, based on 16S rRNA sequences, closely matched that of the previously described Betaproteobacteria species Snodgrassella alvi. Bacteria that were first described in bee-related external environments dominated a number of gut bacterial communities, suggesting that they are not strictly dependent on the internal gut environment. The ARISA data showed a correlation between bacterial community structures and the geographic locations where the bees were sampled, suggesting that at least a subset of the bacterial species may be transmitted environmentally. Using light and fluorescent microscopy, we demonstrated that the gut bacteria form a biofilm on the internal epithelial surface of the ileum, corroborating results obtained from Apis mellifera.

  6. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  7. Deep sequencing whole transcriptome exploration of the σE regulon in Neisseria meningitidis.

    Directory of Open Access Journals (Sweden)

    Robert Antonius Gerhardus Huis in 't Veld

    Full Text Available Bacteria live in an ever-changing environment and must alter protein expression promptly to adapt to these changes and survive. Specific response genes that are regulated by a subset of alternative σ(70-like transcription factors have evolved in order to respond to this changing environment. Recently, we have described the existence of a σ(E regulon including the anti-σ-factor MseR in the obligate human bacterial pathogen Neisseria meningitidis. To unravel the complete σ(E regulon in N. meningitidis, we sequenced total RNA transcriptional content of wild type meningococci and compared it with that of mseR mutant cells (ΔmseR in which σ(E is highly expressed. Eleven coding genes and one non-coding gene were found to be differentially expressed between H44/76 wildtype and H44/76ΔmseR cells. Five of the 6 genes of the σ(E operon, msrA/msrB, and the gene encoding a pepSY-associated TM helix family protein showed enhanced transcription, whilst aniA encoding a nitrite reductase and nspA encoding the vaccine candidate Neisserial surface protein A showed decreased transcription. Analysis of differential expression in IGRs showed enhanced transcription of a non-coding RNA molecule, identifying a σ(E dependent small non-coding RNA. Together this constitutes the first complete exploration of an alternative σ-factor regulon in N. meningitidis. The results direct to a relatively small regulon indicative for a strictly defined response consistent with a relatively stable niche, the human throat, where N. meningitidis resides.

  8. Draft Genome Sequence of Pseudoalteromonas sp. Strain XI10 Isolated from the Brine-Seawater Interface of Erba Deep in the Red Sea

    KAUST Repository

    Zhang, Guishan; Haroon, Mohamed; Zhang, Ruifu; Hikmawan, Tyas I.; Stingl, Ulrich

    2016-01-01

    Pseudoalteromonas sp. strain XI10 was isolated from the brine-seawater interface of Erba Deep in the Red Sea, Saudi Arabia. Here, we present the draft genome sequence of strain XI10, a gammaproteobacterium that synthesizes polysaccharides for biofilm formation when grown in liquid culture.

  9. Draft Genome Sequences of TwoThiomicrospiraStrains Isolated from the Brine-Seawater Interface of Kebrit Deep in the Red Sea

    KAUST Repository

    Zhang, Guishan

    2016-03-11

    Two Thiomicrospira strains, WB1 and XS5, were isolated from the Kebrit Deep brine-seawater interface in the Red Sea, Saudi Arabia. Here, we present the draft genome sequences of these gammaproteobacteria, which both produce sulfuric acid from thiosulfate in culture.

  10. Draft Genome Sequences of TwoThiomicrospiraStrains Isolated from the Brine-Seawater Interface of Kebrit Deep in the Red Sea

    KAUST Repository

    Zhang, Guishan; Haroon, Mohamed; Zhang, Ruifu; Hikmawan, Tyas I.; Stingl, Ulrich

    2016-01-01

    Two Thiomicrospira strains, WB1 and XS5, were isolated from the Kebrit Deep brine-seawater interface in the Red Sea, Saudi Arabia. Here, we present the draft genome sequences of these gammaproteobacteria, which both produce sulfuric acid from thiosulfate in culture.

  11. Draft Genome Sequence of Pseudoalteromonas sp. Strain XI10 Isolated from the Brine-Seawater Interface of Erba Deep in the Red Sea

    KAUST Repository

    Zhang, Guishan

    2016-03-10

    Pseudoalteromonas sp. strain XI10 was isolated from the brine-seawater interface of Erba Deep in the Red Sea, Saudi Arabia. Here, we present the draft genome sequence of strain XI10, a gammaproteobacterium that synthesizes polysaccharides for biofilm formation when grown in liquid culture.

  12. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  13. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  14. Analyses of Tissue Culture Adaptation of Human Herpesvirus-6A by Whole Genome Deep Sequencing Redefines the Reference Sequence and Identifies Virus Entry Complex Changes.

    Science.gov (United States)

    Tweedy, Joshua G; Escriva, Eric; Topf, Maya; Gompels, Ursula A

    2017-12-31

    Tissue-culture adaptation of viruses can modulate infection. Laboratory passage and bacterial artificial chromosome (BAC)mid cloning of human cytomegalovirus, HCMV, resulted in genomic deletions and rearrangements altering genes encoding the virus entry complex, which affected cellular tropism, virulence, and vaccine development. Here, we analyse these effects on the reference genome for related betaherpesviruses, Roseolovirus, human herpesvirus 6A (HHV-6A) strain U1102. This virus is also naturally "cloned" by germline subtelomeric chromosomal-integration in approximately 1% of human populations, and accurate references are key to understanding pathological relationships between exogenous and endogenous virus. Using whole genome next-generation deep-sequencing Illumina-based methods, we compared the original isolate to tissue-culture passaged and the BACmid-cloned virus. This re-defined the reference genome showing 32 corrections and 5 polymorphisms. Furthermore, minor variant analyses of passaged and BACmid virus identified emerging populations of a further 32 single nucleotide polymorphisms (SNPs) in 10 loci, half non-synonymous indicating cell-culture selection. Analyses of the BAC-virus genome showed deletion of the BAC cassette via loxP recombination removing green fluorescent protein (GFP)-based selection. As shown for HCMV culture effects, select HHV-6A SNPs mapped to genes encoding mediators of virus cellular entry, including virus envelope glycoprotein genes gB and the gH/gL complex. Comparative models suggest stabilisation of the post-fusion conformation. These SNPs are essential to consider in vaccine-design, antimicrobial-resistance, and pathogenesis.

  15. InFusion: Advancing Discovery of Fusion Genes and Chimeric Transcripts from Deep RNA-Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Konstantin Okonechnikov

    Full Text Available Analysis of fusion transcripts has become increasingly important due to their link with cancer development. Since high-throughput sequencing approaches survey fusion events exhaustively, several computational methods for the detection of gene fusions from RNA-seq data have been developed. This kind of analysis, however, is complicated by native trans-splicing events, the splicing-induced complexity of the transcriptome and biases and artefacts introduced in experiments and data analysis. There are a number of tools available for the detection of fusions from RNA-seq data; however, certain differences in specificity and sensitivity between commonly used approaches have been found. The ability to detect gene fusions of different types, including isoform fusions and fusions involving non-coding regions, has not been thoroughly studied yet. Here, we propose a novel computational toolkit called InFusion for fusion gene detection from RNA-seq data. InFusion introduces several unique features, such as discovery of fusions involving intergenic regions, and detection of anti-sense transcription in chimeric RNAs based on strand-specificity. Our approach demonstrates superior detection accuracy on simulated data and several public RNA-seq datasets. This improved performance was also evident when evaluating data from RNA deep-sequencing of two well-established prostate cancer cell lines. InFusion identified 26 novel fusion events that were validated in vitro, including alternatively spliced gene fusion isoforms and chimeric transcripts that include intergenic regions. The toolkit is freely available to download from http:/bitbucket.org/kokonech/infusion.

  16. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Science.gov (United States)

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  17. Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.

    Science.gov (United States)

    Yang, Kai-Chien; Yamada, Kathryn A; Patel, Akshar Y; Topkara, Veli K; George, Isaac; Cheema, Faisal H; Ewald, Gregory A; Mann, Douglas L; Nerbonne, Jeanne M

    2014-03-04

    Microarrays have been used extensively to profile transcriptome remodeling in failing human heart, although the genomic coverage provided is limited and fails to provide a detailed picture of the myocardial transcriptome landscape. Here, we describe sequencing-based transcriptome profiling, providing comprehensive analysis of myocardial mRNA, microRNA (miRNA), and long noncoding RNA (lncRNA) expression in failing human heart before and after mechanical support with a left ventricular (LV) assist device (LVAD). Deep sequencing of RNA isolated from paired nonischemic (NICM; n=8) and ischemic (ICM; n=8) human failing LV samples collected before and after LVAD and from nonfailing human LV (n=8) was conducted. These analyses revealed high abundance of mRNA (37%) and lncRNA (71%) of mitochondrial origin. miRNASeq revealed 160 and 147 differentially expressed miRNAs in ICM and NICM, respectively, compared with nonfailing LV. Among these, only 2 (ICM) and 5 (NICM) miRNAs are normalized with LVAD. RNASeq detected 18 480, including 113 novel, lncRNAs in human LV. Among the 679 (ICM) and 570 (NICM) lncRNAs differentially expressed with heart failure, ≈10% are improved or normalized with LVAD. In addition, the expression signature of lncRNAs, but not miRNAs or mRNAs, distinguishes ICM from NICM. Further analysis suggests that cis-gene regulation represents a major mechanism of action of human cardiac lncRNAs. The myocardial transcriptome is dynamically regulated in advanced heart failure and after LVAD support. The expression profiles of lncRNAs, but not mRNAs or miRNAs, can discriminate failing hearts of different pathologies and are markedly altered in response to LVAD support. These results suggest an important role for lncRNAs in the pathogenesis of heart failure and in reverse remodeling observed with mechanical support.

  18. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  19. Construction and characterization of cDNA library for IRM-2 mice

    International Nuclear Information System (INIS)

    Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

    2010-01-01

    Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

  20. Deep Sea Coral voucher sequence dataset - Identification of deep-sea corals collected during the 2009 - 2014 West Coast Groundfish Bottom Trawl Survey

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data for this project resides in the West Coast Groundfish Bottom Trawl Survey Database. Deep-sea corals are often components of trawling bycatch, though their...

  1. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    Science.gov (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  2. Deconstructing the genetic basis of spent sulphite liquor tolerance using deep sequencing of genome-shuffled yeast.

    Science.gov (United States)

    Pinel, Dominic; Colatriano, David; Jiang, Heng; Lee, Hung; Martin, Vincent Jj

    2015-01-01

    Identifying the genetic basis of complex microbial phenotypes is currently a major barrier to our understanding of multigenic traits and our ability to rationally design biocatalysts with highly specific attributes for the biotechnology industry. Here, we demonstrate that strain evolution by meiotic recombination-based genome shuffling coupled with deep sequencing can be used to deconstruct complex phenotypes and explore the nature of multigenic traits, while providing concrete targets for strain development. We determined genomic variations found within Saccharomyces cerevisiae previously evolved in our laboratory by genome shuffling for tolerance to spent sulphite liquor. The representation of these variations was backtracked through parental mutant pools and cross-referenced with RNA-seq gene expression analysis to elucidate the importance of single mutations and key biological processes that play a role in our trait of interest. Our findings pinpoint novel genes and biological determinants of lignocellulosic hydrolysate inhibitor tolerance in yeast. These include the following: protein homeostasis constituents, including Ubp7p and Art5p, related to ubiquitin-mediated proteolysis; stress response transcriptional repressor, Nrg1p; and NADPH-dependent glutamate dehydrogenase, Gdh1p. Reverse engineering a prominent mutation in ubiquitin-specific protease gene UBP7 in a laboratory S. cerevisiae strain effectively increased spent sulphite liquor tolerance. This study advances understanding of yeast tolerance mechanisms to inhibitory substrates and biocatalyst design for a biomass-to-biofuel/biochemical industry, while providing insights into the process of mutation accumulation that occurs during genome shuffling.

  3. Transmission Bottleneck Size Estimation from Pathogen Deep-Sequencing Data, with an Application to Human Influenza A Virus.

    Science.gov (United States)

    Sobel Leonard, Ashley; Weissman, Daniel B; Greenbaum, Benjamin; Ghedin, Elodie; Koelle, Katia

    2017-07-15

    The bottleneck governing infectious disease transmission describes the size of the pathogen population transferred from the donor to the recipient host. Accurate quantification of the bottleneck size is particularly important for rapidly evolving pathogens such as influenza virus, as narrow bottlenecks reduce the amount of transferred viral genetic diversity and, thus, may decrease the rate of viral adaptation. Previous studies have estimated bottleneck sizes governing viral transmission by using statistical analyses of variants identified in pathogen sequencing data. These analyses, however, did not account for variant calling thresholds and stochastic viral replication dynamics within recipient hosts. Because these factors can skew bottleneck size estimates, we introduce a new method for inferring bottleneck sizes that accounts for these factors. Through the use of a simulated data set, we first show that our method, based on beta-binomial sampling, accurately recovers transmission bottleneck sizes, whereas other methods fail to do so. We then apply our method to a data set of influenza A virus (IAV) infections for which viral deep-sequencing data from transmission pairs are available. We find that the IAV transmission bottleneck size estimates in this study are highly variable across transmission pairs, while the mean bottleneck size of 196 virions is consistent with a previous estimate for this data set. Furthermore, regression analysis shows a positive association between estimated bottleneck size and donor infection severity, as measured by temperature. These results support findings from experimental transmission studies showing that bottleneck sizes across transmission events can be variable and influenced in part by epidemiological factors. IMPORTANCE The transmission bottleneck size describes the size of the pathogen population transferred from the donor to the recipient host and may affect the rate of pathogen adaptation within host populations. Recent

  4. Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

    International Nuclear Information System (INIS)

    Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

    1990-01-01

    A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

  5. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  6. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  7. Deep sequencing shows that oocytes are not prone to accumulate mtDNA heteroplasmic mutations during ovarian ageing.

    Science.gov (United States)

    Boucret, L; Bris, C; Seegers, V; Goudenège, D; Desquiret-Dumas, V; Domin-Bernhard, M; Ferré-L'Hotellier, V; Bouet, P E; Descamps, P; Reynier, P; Procaccio, V; May-Panloup, P

    2017-10-01

    Does ovarian ageing increase the number of heteroplasmic mitochondrial DNA (mtDNA) point mutations in oocytes? Our results suggest that oocytes are not subject to the accumulation of mtDNA point mutations during ovarian ageing. Ageing is associated with the alteration of mtDNA integrity in various tissues. Primary oocytes, present in the ovary since embryonic life, may accumulate mtDNA mutations during the process of ovarian ageing. This was an observational study of 53 immature oocyte-cumulus complexes retrieved from 35 women undergoing IVF at the University Hospital of Angers, France, from March 2013 to March 2014. The women were classified in two groups, one including 19 women showing signs of ovarian ageing objectified by a diminished ovarian reserve (DOR), and the other, including 16 women with a normal ovarian reserve (NOR), which served as a control group. mtDNA was extracted from isolated oocytes, and from their corresponding cumulus cells (CCs) considered as a somatic cell compartment. The average mtDNA content of each sample was assessed by using a quantitative real-time PCR technique. Deep sequencing was performed using the Ion Torrent Proton for Next-Generation Sequencing. Signal processing and base calling were done by the embedded pre-processing pipeline and the variants were analyzed using an in-house workflow. The distribution of the different variants between DOR and NOR patients, on one hand, and oocyte and CCs, on the other, was analyzed with the generalized mixed linear model to take into account the cluster of cells belonging to a given mother. There were no significant differences between the numbers of mtDNA variants between the DOR and the NOR patients, either in the oocytes (P = 0.867) or in the surrounding CCs (P = 0.154). There were also no differences in terms of variants with potential functional consequences. De-novo mtDNA variants were found in 28% of the oocytes and in 66% of the CCs with the mean number of variants being

  8. High-throughput deep sequencing reveals that microRNAs play important roles in salt tolerance of euhalophyte Salicornia europaea.

    Science.gov (United States)

    Feng, Juanjuan; Wang, Jinhui; Fan, Pengxiang; Jia, Weitao; Nie, Lingling; Jiang, Ping; Chen, Xianyang; Lv, Sulian; Wan, Lichuan; Chang, Sandra; Li, Shizhong; Li, Yinxin

    2015-02-26

    microRNAs (miRNAs) are implicated in plant development processes and play pivotal roles in plant adaptation to environmental stresses. Salicornia europaea, a salt mash euhalophyte, is a suitable model plant to study salt adaptation mechanisms. S. europaea is also a vegetable, forage, and oilseed that can be used for saline land reclamation and biofuel precursor production on marginal lands. Despite its importance, no miRNA has been identified from S. europaea thus far. Deep sequencing was performed to investigate small RNA transcriptome of S. europaea. Two hundred and ten conserved miRNAs comprising 51 families and 31 novel miRNAs (including seven miRNA star sequences) belonging to 30 families were identified. About half (13 out of 31) of the novel miRNAs were only detected in salt-treated samples. The expression of 43 conserved and 13 novel miRNAs significantly changed in response to salinity. In addition, 53 conserved and 13 novel miRNAs were differentially expressed between the shoots and roots. Furthermore, 306 and 195 S. europaea unigenes were predicted to be targets of 41 conserved and 29 novel miRNA families, respectively. These targets encoded a wide range of proteins, and genes involved in transcription regulation constituted the largest category. Four of these genes encoding laccase, F-box family protein, SAC3/GANP family protein, and NADPH cytochrome P-450 reductase were validated using 5'-RACE. Our results indicate that specific miRNAs are tightly regulated by salinity in the shoots and/or roots of S. europaea, which may play important roles in salt tolerance of this euhalophyte. The S. europaea salt-responsive miRNAs and miRNAs that target transcription factors, nucleotide binding site-leucine-rich repeat proteins and enzymes involved in lignin biosynthesis as well as carbon and nitrogen metabolism may be applied in genetic engineering of crops with high stress tolerance, and genetic modification of biofuel crops with high biomass and regulatable

  9. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  10. RNA deep sequencing reveals novel candidate genes and polymorphisms in boar testis and liver tissues with divergent androstenone levels.

    Directory of Open Access Journals (Sweden)

    Asep Gunawan

    Full Text Available Boar taint is an unpleasant smell and taste of pork meat derived from some entire male pigs. The main causes of boar taint are the two compounds androstenone (5α-androst-16-en-3-one and skatole (3-methylindole. It is crucial to understand the genetic mechanism of boar taint to select pigs for lower androstenone levels and thus reduce boar taint. The aim of the present study was to investigate transcriptome differences in boar testis and liver tissues with divergent androstenone levels using RNA deep sequencing (RNA-Seq. The total number of reads produced for each testis and liver sample ranged from 13,221,550 to 33,206,723 and 12,755,487 to 46,050,468, respectively. In testis samples 46 genes were differentially regulated whereas 25 genes showed differential expression in the liver. The fold change values ranged from -4.68 to 2.90 in testis samples and -2.86 to 3.89 in liver samples. Differentially regulated genes in high androstenone testis and liver samples were enriched in metabolic processes such as lipid metabolism, small molecule biochemistry and molecular transport. This study provides evidence for transcriptome profile and gene polymorphisms of boars with divergent androstenone level using RNA-Seq technology. Digital gene expression analysis identified candidate genes in flavin monooxygenease family, cytochrome P450 family and hydroxysteroid dehydrogenase family. Moreover, polymorphism and association analysis revealed mutation in IRG6, MX1, IFIT2, CYP7A1, FMO5 and KRT18 genes could be potential candidate markers for androstenone levels in boars. Further studies are required for proving the role of candidate genes to be used in genomic selection against boar taint in pig breeding programs.

  11. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  12. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  13. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  14. Deep Sequencing of Three Loci Implicated in Large-Scale Genome-Wide Association Study Smoking Meta-Analyses.

    Science.gov (United States)

    Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Aberg, Karolina A; Kumar, Gaurav; Nerella, Sri; Xie, Linying; Collins, Ann L; Crowley, James J; Quakenbush, Corey R; Hillard, Christopher E; Gao, Guimin; Shabalin, Andrey A; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; Maes, Hermine; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

    2016-05-01

    Genome-wide association study meta-analyses have robustly implicated three loci that affect susceptibility for smoking: CHRNA5\\CHRNA3\\CHRNB4, CHRNB3\\CHRNA6 and EGLN2\\CYP2A6. Functional follow-up studies of these loci are needed to provide insight into biological mechanisms. However, these efforts have been hampered by a lack of knowledge about the specific causal variant(s) involved. In this study, we prioritized variants in terms of the likelihood they account for the reported associations. We employed targeted capture of the CHRNA5\\CHRNA3\\CHRNB4, CHRNB3\\CHRNA6, and EGLN2\\CYP2A6 loci and flanking regions followed by next-generation deep sequencing (mean coverage 78×) to capture genomic variation in 363 individuals. We performed single locus tests to determine if any single variant accounts for the association, and examined if sets of (rare) variants that overlapped with biologically meaningful annotations account for the associations. In total, we investigated 963 variants, of which 71.1% were rare (minor allele frequency < 0.01), 6.02% were insertion/deletions, and 51.7% were catalogued in dbSNP141. The single variant results showed that no variant fully accounts for the association in any region. In the variant set results, CHRNB4 accounts for most of the signal with significant sets consisting of directly damaging variants. CHRNA6 explains most of the signal in the CHRNB3\\CHRNA6 locus with significant sets indicating a regulatory role for CHRNA6. Significant sets in CYP2A6 involved directly damaging variants while the significant variant sets suggested a regulatory role for EGLN2. We found that multiple variants implicating multiple processes explain the signal. Some variants can be prioritized for functional follow-up. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Deep Sequencing Analysis of miRNA Expression in Breast Muscle of Fast-Growing and Slow-Growing Broilers

    Directory of Open Access Journals (Sweden)

    Hongjia Ouyang

    2015-07-01

    Full Text Available Growth performance is an important economic trait in chicken. MicroRNAs (miRNAs have been shown to play important roles in various biological processes, but their functions in chicken growth are not yet clear. To investigate the function of miRNAs in chicken growth, breast muscle tissues of the two-tail samples (highest and lowest body weight from Recessive White Rock (WRR and Xinghua Chickens (XH were performed on high throughput small RNA deep sequencing. In this study, a total of 921 miRNAs were identified, including 733 known mature miRNAs and 188 novel miRNAs. There were 200, 279, 257 and 297 differentially expressed miRNAs in the comparisons of WRRh vs. WRRl, WRRh vs. XHh, WRRl vs. XHl, and XHh vs. XHl group, respectively. A total of 22 highly differentially expressed miRNAs (fold change > 2 or < 0.5; p-value < 0.05; q-value < 0.01, which also have abundant expression (read counts > 1000 were found in our comparisons. As far as two analyses (WRRh vs. WRRl, and XHh vs. XHl are concerned, we found 80 common differentially expressed miRNAs, while 110 miRNAs were found in WRRh vs. XHh and WRRl vs. XHl. Furthermore, 26 common miRNAs were identified among all four comparisons. Four differentially expressed miRNAs (miR-223, miR-16, miR-205a and miR-222b-5p were validated by quantitative real-time RT-PCR (qRT-PCR. Regulatory networks of interactions among miRNAs and their targets were constructed using integrative miRNA target-prediction and network-analysis. Growth hormone receptor (GHR was confirmed as a target of miR-146b-3p by dual-luciferase assay and qPCR, indicating that miR-34c, miR-223, miR-146b-3p, miR-21 and miR-205a are key growth-related target genes in the network. These miRNAs are proposed as candidate miRNAs for future studies concerning miRNA-target function on regulation of chicken growth.

  16. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  17. Phylogenetic and genome-wide deep-sequencing analyses of canine parvovirus reveal co-infection with field variants and emergence of a recent recombinant strain.

    Directory of Open Access Journals (Sweden)

    Ruben Pérez

    Full Text Available Canine parvovirus (CPV, a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population and a major recombinant strain (86.7%. The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity.

  18. Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

    Science.gov (United States)

    Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

    2014-01-01

    Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

  19. Deep-sequencing to resolve complex diversity of apicomplexan parasites in platypuses and echidnas: Proof of principle for wildlife disease investigation.

    Science.gov (United States)

    Šlapeta, Jan; Saverimuttu, Stefan; Vogelnest, Larry; Sangster, Cheryl; Hulst, Frances; Rose, Karrie; Thompson, Paul; Whittington, Richard

    2017-11-01

    The short-beaked echidna (Tachyglossus aculeatus) and the platypus (Ornithorhynchus anatinus) are iconic egg-laying monotremes (Mammalia: Monotremata) from Australasia. The aim of this study was to demonstrate the utility of diversity profiles in disease investigations of monotremes. Using small subunit (18S) rDNA amplicon deep-sequencing we demonstrated the presence of apicomplexan parasites and confirmed by direct and cloned amplicon gene sequencing Theileria ornithorhynchi, Theileria tachyglossi, Eimeria echidnae and Cryptosporidium fayeri. Using a combination of samples from healthy and diseased animals, we show a close evolutionary relationship between species of coccidia (Eimeria) and piroplasms (Theileria) from the echidna and platypus. The presence of E. echidnae was demonstrated in faeces and tissues affected by disseminated coccidiosis. Moreover, the presence of E. echidnae DNA in the blood of echidnas was associated with atoxoplasma-like stages in white blood cells, suggesting Hepatozoon tachyglossi blood stages are disseminated E. echidnae stages. These next-generation DNA sequencing technologies are suited to material and organisms that have not been previously characterised and for which the material is scarce. The deep sequencing approach supports traditional diagnostic methods, including microscopy, clinical pathology and histopathology, to better define the status quo. This approach is particularly suitable for wildlife disease investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Genomic variation in macrophage-cultured European porcine reproductive and respiratory syndrome virus Olot/91 revealed using ultra-deep next generation sequencing.

    Science.gov (United States)

    Lu, Zen H; Brown, Alexander; Wilson, Alison D; Calvert, Jay G; Balasch, Monica; Fuentes-Utrilla, Pablo; Loecherbach, Julia; Turner, Frances; Talbot, Richard; Archibald, Alan L; Ait-Ali, Tahar

    2014-03-04

    Porcine Reproductive and Respiratory Syndrome (PRRS) is a disease of major economic impact worldwide. The etiologic agent of this disease is the PRRS virus (PRRSV). Increasing evidence suggest that microevolution within a coexisting quasispecies population can give rise to high sequence heterogeneity in PRRSV. We developed a pipeline based on the ultra-deep next generation sequencing approach to first construct the complete genome of a European PRRSV, strain Olot/9, cultured on macrophages and then capture the rare variants representative of the mixed quasispecies population. Olot/91 differs from the reference Lelystad strain by about 5% and a total of 88 variants, with frequencies as low as 1%, were detected in the mixed population. These variants included 16 non-synonymous variants concentrated in the genes encoding structural and nonstructural proteins; including Glycoprotein 2a and 5. Using an ultra-deep sequencing methodology, the complete genome of Olot/91 was constructed without any prior knowledge of the sequence. Rare variants that constitute minor fractions of the heterogeneous PRRSV population could successfully be detected to allow further exploration of microevolutionary events.

  1. deepBase v2.0: identification, expression, evolution and function of small RNAs, LncRNAs and circular RNAs from deep-sequencing data.

    Science.gov (United States)

    Zheng, Ling-Ling; Li, Jun-Hao; Wu, Jie; Sun, Wen-Ju; Liu, Shun; Wang, Ze-Lin; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

    2016-01-04

    Small non-coding RNAs (e.g. miRNAs) and long non-coding RNAs (e.g. lincRNAs and circRNAs) are emerging as key regulators of various cellular processes. However, only a very small fraction of these enigmatic RNAs have been well functionally characterized. In this study, we describe deepBase v2.0 (http://biocenter.sysu.edu.cn/deepBase/), an updated platform, to decode evolution, expression patterns and functions of diverse ncRNAs across 19 species. deepBase v2.0 has been updated to provide the most comprehensive collection of ncRNA-derived small RNAs generated from 588 sRNA-Seq datasets. Moreover, we developed a pipeline named lncSeeker to identify 176 680 high-confidence lncRNAs from 14 species. Temporal and spatial expression patterns of various ncRNAs were profiled. We identified approximately 24 280 primate-specific, 5193 rodent-specific lncRNAs, and 55 highly conserved lncRNA orthologs between human and zebrafish. We annotated 14 867 human circRNAs, 1260 of which are orthologous to mouse circRNAs. By combining expression profiles and functional genomic annotations, we developed lncFunction web-server to predict the function of lncRNAs based on protein-lncRNA co-expression networks. This study is expected to provide considerable resources to facilitate future experimental studies and to uncover ncRNA functions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Complete genome sequence of the aerobic, heterotroph Marinithermus hydrothermalis type strain (T1T) from a deep-sea hydrothermal vent chimney

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, A [U.S. Department of Energy, Joint Genome Institute; Gu, Wei [U.S. Department of Energy, Joint Genome Institute; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Pan, Chongle [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute

    2012-01-01

    Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1 T was the first isolate within the phylum ThermusDeinococcus to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1 T is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Complete genome sequence of the aerobic, heterotroph Marinithermus hydrothermalis type strain (T1(T)) from a deep-sea hydrothermal vent chimney.

    Science.gov (United States)

    Copeland, Alex; Gu, Wei; Yasawong, Montri; Lapidus, Alla; Lucas, Susan; Deshpande, Shweta; Pagani, Ioanna; Tapia, Roxanne; Cheng, Jan-Fang; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Pan, Chongle; Brambilla, Evelyne-Marie; Rohde, Manfred; Tindall, Brian J; Sikorski, Johannes; Göker, Markus; Detter, John C; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Woyke, Tanja

    2012-03-19

    Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1(T) was the first isolate within the phylum "Thermus-Deinococcus" to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1(T) is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  4. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    Science.gov (United States)

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  5. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  6. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  7. Transcriptional Slippage and RNA Editing Increase the Diversity of Transcripts in Chloroplasts: Insight from Deep Sequencing of Vigna radiata Genome and Transcriptome.

    Directory of Open Access Journals (Sweden)

    Ching-Ping Lin

    Full Text Available We performed deep sequencing of the nuclear and organellar genomes of three mungbean genotypes: Vigna radiata ssp. sublobata TC1966, V. radiata var. radiata NM92 and the recombinant inbred line RIL59 derived from a cross between TC1966 and NM92. Moreover, we performed deep sequencing of the RIL59 transcriptome to investigate transcript variability. The mungbean chloroplast genome has a quadripartite structure including a pair of inverted repeats separated by two single copy regions. A total of 213 simple sequence repeats were identified in the chloroplast genomes of NM92 and RIL59; 78 single nucleotide variants and nine indels were discovered in comparing the chloroplast genomes of TC1966 and NM92. Analysis of the mungbean chloroplast transcriptome revealed mRNAs that were affected by transcriptional slippage and RNA editing. Transcriptional slippage frequency was positively correlated with the length of simple sequence repeats of the mungbean chloroplast genome (R2=0.9911. In total, 41 C-to-U editing sites were found in 23 chloroplast genes and in one intergenic spacer. No editing site that swapped U to C was found. A combination of bioinformatics and experimental methods revealed that the plastid-encoded RNA polymerase-transcribed genes psbF and ndhA are affected by transcriptional slippage in mungbean and in main lineages of land plants, including three dicots (Glycine max, Brassica rapa, and Nicotiana tabacum, two monocots (Oryza sativa and Zea mays, two gymnosperms (Pinus taeda and Ginkgo biloba and one moss (Physcomitrella patens. Transcript analysis of the rps2 gene showed that transcriptional slippage could affect transcripts at single sequence repeat regions with poly-A runs. It showed that transcriptional slippage together with incomplete RNA editing may cause sequence diversity of transcripts in chloroplasts of land plants.

  8. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  9. Automation of cDNA Synthesis and Labelling Improves Reproducibility

    Directory of Open Access Journals (Sweden)

    Daniel Klevebring

    2009-01-01

    Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

  10. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  11. Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region

    Science.gov (United States)

    Wu, Shuang; Kanda, Tatsuo; Nakamoto, Shingo; Jiang, Xia; Miyamura, Tatsuo; Nakatani, Sueli M.; Ono, Suzane Kioko; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2013-01-01

    Background Hepatitis C virus (HCV) subgenotypes 1a and 1b have different impacts on the treatment response to peginterferon plus ribavirin with direct-acting antivirals (DAAs) against patients infected with HCV genotype 1, as the emergence rates of resistance mutations are different between these two subgenotypes. In Japan, almost all of HCV genotype 1 belongs to subgenotype 1b. Methods and Findings To determine HCV subgenotype 1a or 1b in Japanese patients infected with HCV genotype 1, real-time PCR-based method and Sanger method were used for the HCV NS5B region. HCV subgenotypes were determined in 90% by real-time PCR-based method. We also analyzed the specific probe regions for HCV subgenotypes 1a and 1b using ultra-deep sequencing, and uncovered mutations that could not be revealed using direct-sequencing by Sanger method. We estimated the prevalence of HCV subgenotype 1a as 1.2-2.5% of HCV genotype 1 patients in Japan. Conclusions Although real-time PCR-based HCV subgenotyping method seems fair for differentiating HCV subgenotypes 1a and 1b, it may not be sufficient for clinical practice. Ultra-deep sequencing is useful for revealing the resistant strain(s) of HCV before DAA treatment as well as mixed infection with different genotypes or subgenotypes of HCV. PMID:24069214

  12. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  13. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  14. Deep sequencing of ESTs from nacreous and prismatic layer producing tissues and a screen for novel shell formation-related genes in the pearl oyster.

    Directory of Open Access Journals (Sweden)

    Shigeharu Kinoshita

    Full Text Available BACKGROUND: Despite its economic importance, we have a limited understanding of the molecular mechanisms underlying shell formation in pearl oysters, wherein the calcium carbonate crystals, nacre and prism, are formed in a highly controlled manner. We constructed comprehensive expressed gene profiles in the shell-forming tissues of the pearl oyster Pinctada fucata and identified novel shell formation-related genes candidates. PRINCIPAL FINDINGS: We employed the GS FLX 454 system and constructed transcriptome data sets from pallial mantle and pearl sac, which form the nacreous layer, and from the mantle edge, which forms the prismatic layer in P. fucata. We sequenced 260477 reads and obtained 29682 unique sequences. We also screened novel nacreous and prismatic gene candidates by a combined analysis of sequence and expression data sets, and identified various genes encoding lectin, protease, protease inhibitors, lysine-rich matrix protein, and secreting calcium-binding proteins. We also examined the expression of known nacreous and prismatic genes in our EST library and identified novel isoforms with tissue-specific expressions. CONCLUSIONS: We constructed EST data sets from the nacre- and prism-producing tissues in P. fucata and found 29682 unique sequences containing novel gene candidates for nacreous and prismatic layer formation. This is the first report of deep sequencing of ESTs in the shell-forming tissues of P. fucata and our data provide a powerful tool for a comprehensive understanding of the molecular mechanisms of molluscan biomineralization.

  15. Profile of microbial communities on carbonate stones of the medieval church of San Leonardo di Siponto (Italy) by Illumina-based deep sequencing.

    Science.gov (United States)

    Chimienti, Guglielmina; Piredda, Roberta; Pepe, Gabriella; van der Werf, Inez Dorothé; Sabbatini, Luigia; Crecchio, Carmine; Ricciuti, Patrizia; D'Erchia, Anna Maria; Manzari, Caterina; Pesole, Graziano

    2016-10-01

    Comprehensive studies of the biodiversity of the microbial epilithic community on monuments may provide critical insights for clarifying factors involved in the colonization processes. We carried out a high-throughput investigation of the communities colonizing the medieval church of San Leonardo di Siponto (Italy) by Illumina-based deep sequencing. The metagenomic analysis of sequences revealed the presence of Archaea, Bacteria, and Eukarya. Bacteria were Actinobacteria, Proteobacteria, Bacteroidetes, Cyanobacteria, Chloroflexi, Firmicutes and Candidatus Saccharibacteria. The predominant phylum was Actinobacteria, with the orders Actynomycetales and Rubrobacteriales, represented by the genera Pseudokineococcus, Sporichthya, Blastococcus, Arthrobacter, Geodermatophilus, Friedmanniella, Modestobacter, and Rubrobacter, respectively. Cyanobacteria sequences showing strong similarity with an uncultured bacterium sequence were identified. The presence of the green algae Oocystaceae and Trebuxiaceae was revealed. The microbial diversity was explored at qualitative and quantitative levels, evaluating the richness (the number of operational taxonomic units (OTUs)) and the abundance of reads associated with each OTU. The rarefaction curves approached saturation, suggesting that the majority of OTUs were recovered. The results highlighted a structured community, showing low diversity, made up of extremophile organisms adapted to desiccation and UV radiation. Notably, the microbiome appeared to be composed not only of microorganisms possibly involved in biodeterioration but also of carbonatogenic bacteria, such as those belonging to the genus Arthrobacter, which could be useful in bioconservation. Our investigation demonstrated that molecular tools, and in particular the easy-to-run next-generation sequencing, are powerful to perform a microbiological diagnosis in order to plan restoration and protection strategies.

  16. Deep sequencing reveals different compositions of mRNA transcribed from the F8 gene in a panel of FVIII-producing CHO cell lines

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder; Bolt, Gert; Hansen, Jens J

    2015-01-01

    orders of magnitude lower than for antibodies. In the present study we investigated CHO DXB11 cells transfected with a plasmid encoding human coagulation factor VIII. Single cell clones were isolated from the pool of transfectants and a panel of 14 clones representing a dynamic range of FVIII...... FVIII productivity. It was found that three MTX resistant, nonproducing clones had different truncations of the F8 transcripts. We find that by using deep sequencing, in contrast to microarray technology, for determining the transcriptome from CHO transfectants, we are able to accurately deduce...

  17. Genome sequence of Halorhabdus tiamatea, the first archaeon isolated from a deep-sea anoxic brine lake.

    KAUST Repository

    Antunes, Andre

    2011-09-01

    We present the draft genome of Halorhabdus tiamatea, the first member of the Archaea ever isolated from a deep-sea anoxic brine. Genome comparison with Halorhabdus utahensis revealed some striking differences, including a marked increase in genes associated with transmembrane transport and putative genes for a trehalose synthase and a lactate dehydrogenase.

  18. Genome sequence of Haloplasma contractile, an unusual contractile bacterium from a deep-sea anoxic brine lake.

    KAUST Repository

    Antunes, Andre; Alam, Intikhab; El Dorry, Hamza; Siam, Rania; Robertson, Anthony J.; Bajic, Vladimir B.; Stingl, Ulrich

    2011-01-01

    We present the draft genome of Haloplasma contractile, isolated from a deep-sea brine and representing a new order between Firmicutes and Mollicutes. Its complex morphology with contractile protrusions might be strongly influenced by the presence of seven MreB/Mbl homologs, which appears to be the highest copy number ever reported.

  19. Genome Sequence of Aeribacillus pallidus Strain GS3372, an Endospore-Forming Bacterium Isolated in a Deep Geothermal Reservoir

    OpenAIRE

    Sevasti Filippidou; Marion Jaussi; Thomas Junier; Tina Wunderlin; Nicole Jeanneret; Simona Regenspurg; Po-E Li; Chien-Chi Lo; Shannon Johnson; Kim McMurry; Cheryl D. Gleasner; Momchilo Vuyisich; Patrick S. Chain; Pilar Junier

    2015-01-01

    The genome of strain GS3372 is the first publicly available strain of Aeribacillus pallidus. This endospore-forming thermophilic strain was isolated from a deep geothermal reservoir. The availability of this genome can contribute to the clarification of the taxonomy of the closely related Anoxybacillus, Geobacillus, and Aeribacillus genera.

  20. Genome Sequence of Aeribacillus pallidus Strain GS3372, an Endospore-Forming Bacterium Isolated in a Deep Geothermal Reservoir.

    Science.gov (United States)

    Filippidou, Sevasti; Jaussi, Marion; Junier, Thomas; Wunderlin, Tina; Jeanneret, Nicole; Regenspurg, Simona; Li, Po-E; Lo, Chien-Chi; Johnson, Shannon; McMurry, Kim; Gleasner, Cheryl D; Vuyisich, Momchilo; Chain, Patrick S; Junier, Pilar

    2015-08-27

    The genome of strain GS3372 is the first publicly available strain of Aeribacillus pallidus. This endospore-forming thermophilic strain was isolated from a deep geothermal reservoir. The availability of this genome can contribute to the clarification of the taxonomy of the closely related Anoxybacillus, Geobacillus, and Aeribacillus genera. Copyright © 2015 Filippidou et al.

  1. Genome sequence of Haloplasma contractile, an unusual contractile bacterium from a deep-sea anoxic brine lake.

    KAUST Repository

    Antunes, Andre

    2011-09-01

    We present the draft genome of Haloplasma contractile, isolated from a deep-sea brine and representing a new order between Firmicutes and Mollicutes. Its complex morphology with contractile protrusions might be strongly influenced by the presence of seven MreB/Mbl homologs, which appears to be the highest copy number ever reported.

  2. Genome sequence of Halorhabdus tiamatea, the first archaeon isolated from a deep-sea anoxic brine lake.

    KAUST Repository

    Antunes, Andre; Alam, Intikhab; Bajic, Vladimir B.; Stingl, Ulrich

    2011-01-01

    We present the draft genome of Halorhabdus tiamatea, the first member of the Archaea ever isolated from a deep-sea anoxic brine. Genome comparison with Halorhabdus utahensis revealed some striking differences, including a marked increase in genes associated with transmembrane transport and putative genes for a trehalose synthase and a lactate dehydrogenase.

  3. Deep sequencing of the Trypanosoma cruzi GP63 surface proteases reveals diversity and diversifying selection among chronic and congenital Chagas disease patients.

    Science.gov (United States)

    Llewellyn, Martin S; Messenger, Louisa A; Luquetti, Alejandro O; Garcia, Lineth; Torrico, Faustino; Tavares, Suelene B N; Cheaib, Bachar; Derome, Nicolas; Delepine, Marc; Baulard, Céline; Deleuze, Jean-Francois; Sauer, Sascha; Miles, Michael A

    2015-04-01

    Chagas disease results from infection with the diploid protozoan parasite Trypanosoma cruzi. T. cruzi is highly genetically diverse, and multiclonal infections in individual hosts are common, but little studied. In this study, we explore T. cruzi infection multiclonality in the context of age, sex and clinical profile among a cohort of chronic patients, as well as paired congenital cases from Cochabamba, Bolivia and Goias, Brazil using amplicon deep sequencing technology. A 450bp fragment of the trypomastigote TcGP63I surface protease gene was amplified and sequenced across 70 chronic and 22 congenital cases on the Illumina MiSeq platform. In addition, a second, mitochondrial target--ND5--was sequenced across the same cohort of cases. Several million reads were generated, and sequencing read depths were normalized within patient cohorts (Goias chronic, n = 43, Goias congenital n = 2, Bolivia chronic, n = 27; Bolivia congenital, n = 20), Among chronic cases, analyses of variance indicated no clear correlation between intra-host sequence diversity and age, sex or symptoms, while principal coordinate analyses showed no clustering by symptoms between patients. Between congenital pairs, we found evidence for the transmission of multiple sequence types from mother to infant, as well as widespread instances of novel genotypes in infants. Finally, non-synonymous to synonymous (dn:ds) nucleotide substitution ratios among sequences of TcGP63Ia and TcGP63Ib subfamilies within each cohort provided powerful evidence of strong diversifying selection at this locus. Our results shed light on the diversity of parasite DTUs within each patient, as well as the extent to which parasite strains pass between mother and foetus in congenital cases. Although we were unable to find any evidence that parasite diversity accumulates with age in our study cohorts, putative diversifying selection within members of the TcGP63I gene family suggests a link between genetic diversity within this gene

  4. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  5. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  6. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  7. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  8. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  9. Discovery of Bovine Digital Dermatitis-Associated Treponema spp. in the Dairy Herd Environment by a Targeted Deep-Sequencing Approach

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Weiss Nielsen, Martin; Ingerslev, Hans-Christian

    2014-01-01

    The bacteria associated with the infectious claw disease bovine digital dermatitis (DD) are spirochetes of the genus Treponema; however, their environmental reservoir remains unknown. To our knowledge, the current study is the first report of the discovery and phylogenetic characterization of r...... of this disease among cows within a herd as well as between herds. To address the issue of DD infection reservoirs, we searched for evidence of DD-associated treponemes in fresh feces, in slurry, and in hoof lesions by deep sequencing of the V3 and V4 hypervariable regions of the 16S rRNA gene coupled...... with identification at the operational-taxonomic-unit level. Using treponeme-specific primers in this high-throughput approach, we identified small amounts of DNA (on average 0.6% of the total amount of sequence reads) from DD-associated treponemes in 43 of 64 samples from slurry and cow feces collected from six...

  10. Deep learning

    CERN Document Server

    Goodfellow, Ian; Courville, Aaron

    2016-01-01

    Deep learning is a form of machine learning that enables computers to learn from experience and understand the world in terms of a hierarchy of concepts. Because the computer gathers knowledge from experience, there is no need for a human computer operator to formally specify all the knowledge that the computer needs. The hierarchy of concepts allows the computer to learn complicated concepts by building them out of simpler ones; a graph of these hierarchies would be many layers deep. This book introduces a broad range of topics in deep learning. The text offers mathematical and conceptual background, covering relevant concepts in linear algebra, probability theory and information theory, numerical computation, and machine learning. It describes deep learning techniques used by practitioners in industry, including deep feedforward networks, regularization, optimization algorithms, convolutional networks, sequence modeling, and practical methodology; and it surveys such applications as natural language proces...

  11. Identification of microRNAs from Amur grape (Vitis amurensis Rupr.) by deep sequencing and analysis of microRNA variations with bioinformatics.

    Science.gov (United States)

    Wang, Chen; Han, Jian; Liu, Chonghuai; Kibet, Korir Nicholas; Kayesh, Emrul; Shangguan, Lingfei; Li, Xiaoying; Fang, Jinggui

    2012-03-29

    MicroRNA (miRNA) is a class of functional non-coding small RNA with 19-25 nucleotides in length while Amur grape (Vitis amurensis Rupr.) is an important wild fruit crop with the strongest cold resistance among the Vitis species, is used as an excellent breeding parent for grapevine, and has elicited growing interest in wine production. To date, there is a relatively large number of grapevine miRNAs (vv-miRNAs) from cultivated grapevine varieties such as Vitis vinifera L. and hybrids of V. vinifera and V. labrusca, but there is no report on miRNAs from Vitis amurensis Rupr, a wild grapevine species. A small RNA library from Amur grape was constructed and Solexa technology used to perform deep sequencing of the library followed by subsequent bioinformatics analysis to identify new miRNAs. In total, 126 conserved miRNAs belonging to 27 miRNA families were identified, and 34 known but non-conserved miRNAs were also found. Significantly, 72 new potential Amur grape-specific miRNAs were discovered. The sequences of these new potential va-miRNAs were further validated through miR-RACE, and accumulation of 18 new va-miRNAs in seven tissues of grapevines confirmed by real time RT-PCR (qRT-PCR) analysis. The expression levels of va-miRNAs in flowers and berries were found to be basically consistent in identity to those from deep sequenced sRNAs libraries of combined corresponding tissues. We also describe the conservation and variation of va-miRNAs using miR-SNPs and miR-LDs during plant evolution based on comparison of orthologous sequences, and further reveal that the number and sites of miR-SNP in diverse miRNA families exhibit distinct divergence. Finally, 346 target genes for the new miRNAs were predicted and they include a number of Amur grape stress tolerance genes and many genes regulating anthocyanin synthesis and sugar metabolism. Deep sequencing of short RNAs from Amur grape flowers and berries identified 72 new potential miRNAs and 34 known but non-conserved mi

  12. Identification of microRNAs from Amur grape (vitis amurensis Rupr. by deep sequencing and analysis of microRNA variations with bioinformatics

    Directory of Open Access Journals (Sweden)

    Wang Chen

    2012-03-01

    Full Text Available Abstract Background MicroRNA (miRNA is a class of functional non-coding small RNA with 19-25 nucleotides in length while Amur grape (Vitis amurensis Rupr. is an important wild fruit crop with the strongest cold resistance among the Vitis species, is used as an excellent breeding parent for grapevine, and has elicited growing interest in wine production. To date, there is a relatively large number of grapevine miRNAs (vv-miRNAs from cultivated grapevine varieties such as Vitis vinifera L. and hybrids of V. vinifera and V. labrusca, but there is no report on miRNAs from Vitis amurensis Rupr, a wild grapevine species. Results A small RNA library from Amur grape was constructed and Solexa technology used to perform deep sequencing of the library followed by subsequent bioinformatics analysis to identify new miRNAs. In total, 126 conserved miRNAs belonging to 27 miRNA families were identified, and 34 known but non-conserved miRNAs were also found. Significantly, 72 new potential Amur grape-specific miRNAs were discovered. The sequences of these new potential va-miRNAs were further validated through miR-RACE, and accumulation of 18 new va-miRNAs in seven tissues of grapevines confirmed by real time RT-PCR (qRT-PCR analysis. The expression levels of va-miRNAs in flowers and berries were found to be basically consistent in identity to those from deep sequenced sRNAs libraries of combined corresponding tissues. We also describe the conservation and variation of va-miRNAs using miR-SNPs and miR-LDs during plant evolution based on comparison of orthologous sequences, and further reveal that the number and sites of miR-SNP in diverse miRNA families exhibit distinct divergence. Finally, 346 target genes for the new miRNAs were predicted and they include a number of Amur grape stress tolerance genes and many genes regulating anthocyanin synthesis and sugar metabolism. Conclusions Deep sequencing of short RNAs from Amur grape flowers and berries identified 72

  13. Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population.

    Science.gov (United States)

    Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E

    2017-01-01

    The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.

  14. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  15. Multiple viral infections in Agaricus bisporus - Characterisation of 18 unique RNA viruses and 8 ORFans identified by deep sequencing

    OpenAIRE

    Deakin, Gregory; Dobbs, Edward; Bennett, Julie M.; Jones, Ian M.; Grogan, Helen M.; Burton, Kerry S.

    2017-01-01

    Thirty unique non-host RNAs were sequenced in the cultivated fungus, Agaricus bisporus, comprising 18 viruses each encoding an RdRp domain with an additional 8 ORFans (non-host RNAs with no similarity to known sequences). Two viruses were multipartite with component RNAs showing correlative abundances and common 3′ motifs. The viruses, all positive sense single-stranded, were classified into diverse orders/families. Multiple infections of Agaricus may represent a diverse, dynamic and interact...

  16. Trace Fossils as Indicators of Depositional Sequence Boundaries in Lower Carboniferous Deep-Sea Fan Environment Moravice Formation, Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Lehotský, T.; Bábek, O.; Mikuláš, Radek; Zapletal, J.

    2002-01-01

    Roč. 14, - (2002), s. 59-60 ISSN 1210-9606. [Áelazno 2002. Meeting of the Czech Tectonic Studies Group /7./. Áelazno, 09.05.2002-12.05.2002] R&D Projects: GA ČR GA205/00/0118 Keywords : trace fossils * Carboniferous * Deep- Sea Environment Subject RIV: DB - Geology ; Mineralogy http://geolines.gli.cas.cz/fileadmin/volumes/volume14/G14-059.pdf

  17. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  18. Inspecting Targeted Deep Sequencing of Whole Genome Amplified DNA Versus Fresh DNA for Somatic Mutation Detection: A Genetic Study in Myelodysplastic Syndrome Patients.

    Science.gov (United States)

    Palomo, Laura; Fuster-Tormo, Francisco; Alvira, Daniel; Ademà, Vera; Armengol, María Pilar; Gómez-Marzo, Paula; de Haro, Nuri; Mallo, Mar; Xicoy, Blanca; Zamora, Lurdes; Solé, Francesc

    2017-08-01

    Whole genome amplification (WGA) has become an invaluable method for preserving limited samples of precious stock material and has been used during the past years as an alternative tool to increase the amount of DNA before library preparation for next-generation sequencing. Myelodysplastic syndromes (MDS) are a group of clonal hematopoietic stem cell disorders characterized by presenting somatic mutations in several myeloid-related genes. In this work, targeted deep sequencing has been performed on four paired fresh DNA and WGA DNA samples from bone marrow of MDS patients, to assess the feasibility of using WGA DNA for detecting somatic mutations. The results of this study highlighted that, in general, the sequencing and alignment statistics of fresh DNA and WGA DNA samples were similar. However, after variant calling and when considering variants detected at all frequencies, there was a high level of discordance between fresh DNA and WGA DNA (overall, a higher number of variants was detected in WGA DNA). After proper filtering, a total of three somatic mutations were detected in the cohort. All somatic mutations detected in fresh DNA were also identified in WGA DNA and validated by whole exome sequencing.

  19. High throughput deep degradome sequencing reveals microRNAs and their targets in response to drought stress in mulberry (Morus alba).

    Science.gov (United States)

    Li, Ruixue; Chen, Dandan; Wang, Taichu; Wan, Yizhen; Li, Rongfang; Fang, Rongjun; Wang, Yuting; Hu, Fei; Zhou, Hong; Li, Long; Zhao, Weiguo

    2017-01-01

    MicroRNAs (miRNAs) play important regulatory roles by targeting mRNAs for cleavage or translational repression. Identification of miRNA targets is essential to better understanding the roles of miRNAs. miRNA targets have not been well characterized in mulberry (Morus alba). To anatomize miRNA guided gene regulation under drought stress, transcriptome-wide high throughput degradome sequencing was used in this study to directly detect drought stress responsive miRNA targets in mulberry. A drought library (DL) and a contrast library (CL) were constructed to capture the cleaved mRNAs for sequencing. In CL, 409 target genes of 30 conserved miRNA families and 990 target genes of 199 novel miRNAs were identified. In DL, 373 target genes of 30 conserved miRNA families and 950 target genes of 195 novel miRNAs were identified. Of the conserved miRNA families in DL, mno-miR156, mno-miR172, and mno-miR396 had the highest number of targets with 54, 52 and 41 transcripts, respectively, indicating that these three miRNA families and their target genes might play important functions in response to drought stress in mulberry. Additionally, we found that many of the target genes were transcription factors. By analyzing the miRNA-target molecular network, we found that the DL independent networks consisted of 838 miRNA-mRNA pairs (63.34%). The expression patterns of 11 target genes and 12 correspondent miRNAs were detected using qRT-PCR. Six miRNA targets were further verified by RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-5' RACE). Gene Ontology (GO) annotations and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that these target transcripts were implicated in a broad range of biological processes and various metabolic pathways. This is the first study to comprehensively characterize target genes and their associated miRNAs in response to drought stress by degradome sequencing in mulberry. This study provides a framework for understanding

  20. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

    Science.gov (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

    2009-01-01

    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  1. Deep Sequencing of T-cell Receptor DNA as a Biomarker of Clonally Expanded TILs in Breast Cancer after Immunotherapy.

    Science.gov (United States)

    Page, David B; Yuan, Jianda; Redmond, David; Wen, Y Hanna; Durack, Jeremy C; Emerson, Ryan; Solomon, Stephen; Dong, Zhiwan; Wong, Phillip; Comstock, Christopher; Diab, Adi; Sung, Janice; Maybody, Majid; Morris, Elizabeth; Brogi, Edi; Morrow, Monica; Sacchini, Virgilio; Elemento, Olivier; Robins, Harlan; Patil, Sujata; Allison, James P; Wolchok, Jedd D; Hudis, Clifford; Norton, Larry; McArthur, Heather L

    2016-10-01

    In early-stage breast cancer, the degree of tumor-infiltrating lymphocytes (TIL) predicts response to chemotherapy and overall survival. Combination immunotherapy with immune checkpoint antibody plus tumor cryoablation can induce lymphocytic infiltrates and improve survival in mice. We used T-cell receptor (TCR) DNA sequencing to evaluate both the effect of cryoimmunotherapy in humans and the feasibility of TCR sequencing in early-stage breast cancer. In a pilot clinical trial, 18 women with early-stage breast cancer were treated preoperatively with cryoablation, single-dose anti-CTLA-4 (ipilimumab), or cryoablation + ipilimumab. TCRs within serially collected peripheral blood and tumor tissue were sequenced. In baseline tumor tissues, T-cell density as measured by TCR sequencing correlated with TIL scores obtained by hematoxylin and eosin (H&E) staining. However, tumors with little or no lymphocytes by H&E contained up to 3.6 × 10 6 TCR DNA sequences, highlighting the sensitivity of the ImmunoSEQ platform. In this dataset, ipilimumab increased intratumoral T-cell density over time, whereas cryoablation ± ipilimumab diversified and remodeled the intratumoral T-cell clonal repertoire. Compared with monotherapy, cryoablation plus ipilimumab was associated with numerically greater numbers of peripheral blood and intratumoral T-cell clones expanding robustly following therapy. In conclusion, TCR sequencing correlates with H&E lymphocyte scoring and provides additional information on clonal diversity. These findings support further study of the use of TCR sequencing as a biomarker for T-cell responses to therapy and for the study of cryoimmunotherapy in early-stage breast cancer. Cancer Immunol Res; 4(10); 835-44. ©2016 AACR. ©2016 American Association for Cancer Research.

  2. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  3. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  4. Discovery and profiling of novel and conserved microRNAs during flower development in Carya cathayensis via deep sequencing.

    Science.gov (United States)

    Wang, Zheng Jia; Huang, Jian Qin; Huang, You Jun; Li, Zheng; Zheng, Bing Song

    2012-08-01

    Hickory (Carya cathayensis Sarg.) is an economically important woody plant in China, but its long juvenile phase delays yield. MicroRNAs (miRNAs) are critical regulators of genes and important for normal plant development and physiology, including flower development. We used Solexa technology to sequence two small RNA libraries from two floral differentiation stages in hickory to identify miRNAs related to flower development. We identified 39 conserved miRNA sequences from 114 loci belonging to 23 families as well as two novel and ten potential novel miRNAs belonging to nine families. Moreover, 35 conserved miRNA*s and two novel miRNA*s were detected. Twenty miRNA sequences from 49 loci belonging to 11 families were differentially expressed; all were up-regulated at the later stage of flower development in hickory. Quantitative real-time PCR of 12 conserved miRNA sequences, five novel miRNA families, and two novel miRNA*s validated that all were expressed during hickory flower development, and the expression patterns were similar to those detected with Solexa sequencing. Finally, a total of 146 targets of the novel and conserved miRNAs were predicted. This study identified a diverse set of miRNAs that were closely related to hickory flower development and that could help in plant floral induction.

  5. Display of a Maize cDNA library on baculovirus infected insect cells

    Directory of Open Access Journals (Sweden)

    Jones Ian M

    2008-08-01

    Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  6. Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

    Science.gov (United States)

    Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

    2000-08-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

  7. The Subclonal Structure and Genomic Evolution of Oral Squamous Cell Carcinoma Revealed by Ultra-deep Sequencing

    DEFF Research Database (Denmark)

    Tabatabaeifar, Siavosh; Thomassen, Mads; Larsen, Martin Jakob

    Background: Oral squamous cell carcinoma (OSCC), a subgroup of head and neck squamous cell carcinoma (HNSCC), is primarily caused by alcohol consumption and tobacco use. Recent DNA sequencing studies suggests that HNSCC are very heterogeneous between patients; however the intra-patient subclonal...

  8. Deep Illumina-based shotgun sequencing reveals dietary effects on the structure and function of the fecal microbiome of growing kittens.

    Directory of Open Access Journals (Sweden)

    Oliver Deusch

    Full Text Available Previously, we demonstrated that dietary protein:carbohydrate ratio dramatically affects the fecal microbial taxonomic structure of kittens using targeted 16S gene sequencing. The present study, using the same fecal samples, applied deep Illumina shotgun sequencing to identify the diet-associated functional potential and analyze taxonomic changes of the feline fecal microbiome.Fecal samples from kittens fed one of two diets differing in protein and carbohydrate content (high-protein, low-carbohydrate, HPLC; and moderate-protein, moderate-carbohydrate, MPMC were collected at 8, 12 and 16 weeks of age (n = 6 per group. A total of 345.3 gigabases of sequence were generated from 36 samples, with 99.75% of annotated sequences identified as bacterial. At the genus level, 26% and 39% of reads were annotated for HPLC- and MPMC-fed kittens, with HPLC-fed cats showing greater species richness and microbial diversity. Two phyla, ten families and fifteen genera were responsible for more than 80% of the sequences at each taxonomic level for both diet groups, consistent with the previous taxonomic study. Significantly different abundances between diet groups were observed for 324 genera (56% of all genera identified demonstrating widespread diet-induced changes in microbial taxonomic structure. Diversity was not affected over time. Functional analysis identified 2,013 putative enzyme function groups were different (p<0.000007 between the two dietary groups and were associated to 194 pathways, which formed five discrete clusters based on average relative abundance. Of those, ten contained more (p<0.022 enzyme functions with significant diet effects than expected by chance. Six pathways were related to amino acid biosynthesis and metabolism linking changes in dietary protein with functional differences of the gut microbiome.These data indicate that feline feces-derived microbiomes have large structural and functional differences relating to the dietary

  9. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  10. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  11. MicroRNAs in Amoebozoa: deep sequencing of the small RNA population in the social amoeba Dictyostelium discoideum reveals developmentally regulated microRNAs.

    Science.gov (United States)

    Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik

    2012-10-01

    The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.

  12. Genome-wide analyses of long noncoding RNA expression profiles correlated with radioresistance in nasopharyngeal carcinoma via next-generation deep sequencing.

    Science.gov (United States)

    Li, Guo; Liu, Yong; Liu, Chao; Su, Zhongwu; Ren, Shuling; Wang, Yunyun; Deng, Tengbo; Huang, Donghai; Tian, Yongquan; Qiu, Yuanzheng

    2016-09-06

    Radioresistance is one of the major factors limiting the therapeutic efficacy and prognosis of patients with nasopharyngeal carcinoma (NPC). Accumulating evidence has suggested that aberrant expression of long noncoding RNAs (lncRNAs) contributes to cancer progression. Therefore, here we identified lncRNAs associated with radioresistance in NPC. The differential expression profiles of lncRNAs associated with NPC radioresistance were constructed by next-generation deep sequencing by comparing radioresistant NPC cells with their parental cells. LncRNA-related mRNAs were predicted and analyzed using bioinformatics algorithms compared with the mRNA profiles related to radioresistance obtained in our previous study. Several lncRNAs and associated mRNAs were validated in established NPC radioresistant cell models and NPC tissues. By comparison between radioresistant CNE-2-Rs and parental CNE-2 cells by next-generation deep sequencing, a total of 781 known lncRNAs and 2054 novel lncRNAs were annotated. The top five upregulated and downregulated known/novel lncRNAs were detected using quantitative real-time reverse transcription-polymerase chain reaction, and 7/10 known lncRNAs and 3/10 novel lncRNAs were demonstrated to have significant differential expression trends that were the same as those predicted by deep sequencing. From the prediction process, 13 pairs of lncRNAs and their associated genes were acquired, and the prediction trends of three pairs were validated in both radioresistant CNE-2-Rs and 6-10B-Rs cell lines, including lncRNA n373932 and SLITRK5, n409627 and PRSS12, and n386034 and RIMKLB. LncRNA n373932 and its related SLITRK5 showed dramatic expression changes in post-irradiation radioresistant cells and a negative expression correlation in NPC tissues (R = -0.595, p < 0.05). Our study provides an overview of the expression profiles of radioresistant lncRNAs and potentially related mRNAs, which will facilitate future investigations into the

  13. Genome-wide discovery and differential regulation of conserved and novel microRNAs in chickpea via deep sequencing.

    Science.gov (United States)

    Jain, Mukesh; Chevala, V V S Narayana; Garg, Rohini

    2014-11-01

    MicroRNAs (miRNAs) are essential components of complex gene regulatory networks that orchestrate plant development. Although several genomic resources have been developed for the legume crop chickpea, miRNAs have not been discovered until now. For genome-wide discovery of miRNAs in chickpea (Cicer arietinum), we sequenced the small RNA content from seven major tissues/organs employing Illumina technology. About 154 million reads were generated, which represented more than 20 million distinct small RNA sequences. We identified a total of 440 conserved miRNAs in chickpea based on sequence similarity with known miRNAs in other plants. In addition, 178 novel miRNAs were identified using a miRDeep pipeline with plant-specific scoring. Some of the conserved and novel miRNAs with significant sequence similarity were grouped into families. The chickpea miRNAs targeted a wide range of mRNAs involved in diverse cellular processes, including transcriptional regulation (transcription factors), protein modification and turnover, signal transduction, and metabolism. Our analysis revealed several miRNAs with differential spatial expression. Many of the chickpea miRNAs were expressed in a tissue-specific manner. The conserved and differential expression of members of the same miRNA family in different tissues was also observed. Some of the same family members were predicted to target different chickpea mRNAs, which suggested the specificity and complexity of miRNA-mediated developmental regulation. This study, for the first time, reveals a comprehensive set of conserved and novel miRNAs along with their expression patterns and putative targets in chickpea, and provides a framework for understanding regulation of developmental processes in legumes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  14. Genome re-sequencing of semi-wild soybean reveals a complex Soja population structure and deep introgression.

    Directory of Open Access Journals (Sweden)

    Jie Qiu

    Full Text Available Semi-wild soybean is a unique type of soybean that retains both wild and domesticated characteristics, which provides an important intermediate type for understanding the evolution of the subgenus Soja population in the Glycine genus. In this study, a semi-wild soybean line (Maliaodou and a wild line (Lanxi 1 collected from the lower Yangtze regions were deeply sequenced while nine other semi-wild lines were sequenced to a 3-fold genome coverage. Sequence analysis revealed that (1 no independent phylogenetic branch covering all 10 semi-wild lines was observed in the Soja phylogenetic tree; (2 besides two distinct subpopulations of wild and cultivated soybean in the Soja population structure, all semi-wild lines were mixed with some wild lines into a subpopulation rather than an independent one or an intermediate transition type of soybean domestication; (3 high heterozygous rates (0.19-0.49 were observed in several semi-wild lines; and (4 over 100 putative selective regions were identified by selective sweep analysis, including those related to the development of seed size. Our results suggested a hybridization origin for the semi-wild soybean, which makes a complex Soja population structure.

  15. Detection of low frequency FGFR3 mutations in the urine of bladder cancer patients using next-generation deep sequencing

    Directory of Open Access Journals (Sweden)

    Millholl

    2012-06-01

    Full Text Available John M Millholland, Shuqiang Li, Cecilia A Fernandez, Anthony P ShuberPredictive Biosciences Inc, Lexington, MA, USAAbstract: Biological fluid-based noninvasive biomarker assays for monitoring and diagnosing disease are clinically powerful. A major technical hurdle for developing these assays is the requirement of high analytical sensitivity so that biomarkers present at very low levels can be consistently detected. In the case of biological fluid-based cancer diagnostic assays, sensitivities similar to those of tissue-based assays are difficult to achieve with DNA markers due to the high abundance of normal DNA background present in the sample. Here we describe a new urine-based assay that uses ultradeep sequencing technology to detect single mutant molecules of fibroblast growth factor receptor 3 (FGFR3 DNA that are indicative of bladder cancer. Detection of FGFR3 mutations in urine would provide clinicians with a noninvasive means of diagnosing early-stage bladder cancer. The single-molecule assay detects FGFR3 mutant DNA when present at as low as 0.02% of total urine DNA and results in 91% concordance with the frequency that FGFR3 mutations are detected in bladder cancer tumors, significantly improving diagnostic performance. To our knowledge, this is the first practical application of next-generation sequencing technology for noninvasive cancer diagnostics.Keywords: FGFR3, mutation, urine, single molecule, sequencing, bladder cancer

  16. Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

    International Nuclear Information System (INIS)

    Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

    1988-01-01

    Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

  17. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  18. Gene expression in the deep biosphere.

    Science.gov (United States)

    Orsi, William D; Edgcomb, Virginia P; Christman, Glenn D; Biddle, Jennifer F

    2013-07-11

    Scientific ocean drilling has revealed a deep biosphere of widespread microbial life in sub-seafloor sediment. Microbial metabolism in the marine subsurface probably has an important role in global biogeochemical cycles, but deep biosphere activities are not well understood. Here we describe and analyse the first sub-seafloor metatranscriptomes from anaerobic Peru Margin sediment up to 159 metres below the sea floor, represented by over 1 billion complementary DNA (cDNA) sequence reads. Anaerobic metabolism of amino acids, carbohydrates and lipids seem to be the dominant metabolic processes, and profiles of dissimilatory sulfite reductase (dsr) transcripts are consistent with pore-water sulphate concentration profiles. Moreover, transcripts involved in cell division increase as a function of microbial cell concentration, indicating that increases in sub-seafloor microbial abundance are a function of cell division across all three domains of life. These data support calculations and models of sub-seafloor microbial metabolism and represent the first holistic picture of deep biosphere activities.

  19. The induced earthquake sequence related to the St. Gallen deep geothermal project (Switzerland): Fault reactivation and fluid interactions imaged by microseismicity

    Science.gov (United States)

    Diehl, T.; Kraft, T.; Kissling, E.; Wiemer, S.

    2017-09-01

    In July 2013, a sequence of more than 340 earthquakes was induced by reservoir stimulations and well-control procedures following a gas kick at a deep geothermal drilling project close to the city of St. Gallen, Switzerland. The sequence culminated in an ML 3.5 earthquake, which was felt within 10-15 km from the epicenter. High-quality earthquake locations and 3-D reflection seismic data acquired in the St. Gallen project provide a unique data set, which allows high-resolution studies of earthquake triggering related to the injection of fluids into macroscopic fault zones. In this study, we present a high-precision earthquake catalog of the induced sequence. Absolute locations are constrained by a coupled hypocenter-velocity inversion, and subsequent double-difference relocations image the geometry of the ML 3.5 rupture and resolve the spatiotemporal evolution of seismicity. A joint interpretation of earthquake and seismic data shows that the majority of the seismicity occurred in the pre-Mesozoic basement, hundreds of meters below the borehole and the targeted Mesozoic sequence. We propose a hydraulic connectivity between the reactivated fault and the borehole, likely through faults mapped by seismic data. Despite the excellent quality of the seismic data, the association of seismicity with mapped faults remains ambiguous. In summary, our results document that the actual hydraulic properties of a fault system and hydraulic connections between its fault segments are complex and may not be predictable upfront. Incomplete knowledge of fault structures and stress heterogeneities within highly complex fault systems additionally challenge the degree of predictability of induced seismicity related to underground fluid injections.

  20. Appearances can be deceptive: revealing a hidden viral infection with deep sequencing in a plant quarantine context.

    Science.gov (United States)

    Candresse, Thierry; Filloux, Denis; Muhire, Brejnev; Julian, Charlotte; Galzi, Serge; Fort, Guillaume; Bernardo, Pauline; Daugrois, Jean-Heindrich; Fernandez, Emmanuel; Martin, Darren P; Varsani, Arvind; Roumagnac, Philippe

    2014-01-01

    Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS) of both virus-derived small interfering RNAs (siRNAs) and virion-associated nucleic acids (VANA) for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae), but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV). This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non

  1. Appearances can be deceptive: revealing a hidden viral infection with deep sequencing in a plant quarantine context.

    Directory of Open Access Journals (Sweden)

    Thierry Candresse

    Full Text Available Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS of both virus-derived small interfering RNAs (siRNAs and virion-associated nucleic acids (VANA for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae, but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV. This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non

  2. Detection of Inter-lineage Natural Recombination in Avian Paramyxovirus Serotype 1 using Simplified Deep Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Dilan Amila Satharasinghe

    2016-11-01

    Full Text Available Newcastle disease virus (NDV is a prototype member of avian paramyxovirus serotype 1 (APMV-1, which causes severe and contagious disease in the commercial poultry and wild birds. Despite extensive vaccination programs and other control measures, the disease remains endemic around the globe especially in Asia, Africa, and the Middle East. Being a single serotype, genotype II based vaccines remained most acceptable means of immunization. However, the evidence is emerging on failures of vaccines mainly due to evolving nature of the virus and higher genetic gaps between vaccine and field strains of APMV-1. Most of the epidemiological and genetic characterizations of APMVs are based on conventional methods, which are prone to mask the diverse population of viruses in complex samples. In this study, we report the application of a simple, robust, and less resource-demanding methodology for the whole genome sequencing of NDV, using next-generation sequencing on the Illumina MiSeq platform. Using this platform, we sequenced full genomes of five virulent Malaysian NDV strains collected during 2004-2013. All isolates clustered within highly prevalent lineage 5 (specifically in lineage 5a; however, a significantly greater genetic divergence was observed in isolates collected from 2004 to 2011. Interestingly, genetic characterization of one isolate collected in 2013 (IBS025/13 shown natural recombination between lineage 2 and lineage 5. In the event of recombination, the isolate (IBS025/13 carried nucleocapsid protein consist of 55-1801 nucleotides (nts and near-complete phosphoprotein (1804-3254 nts genes of lineage 2 whereas surface glycoproteins (fusion, hemagglutinin-neuraminidase and large polymerase of lineage 5. Additionally, the recombinant virus has a genome size of 15,186 nts which is characteristics for the old genotypes I to IV isolated from 1930 to 1960. Taken together, we report the occurrence of a natural recombination in circulating strains

  3. Integrative analysis of deep sequencing data identifies estrogen receptor early response genes and links ATAD3B to poor survival in breast cancer.

    Directory of Open Access Journals (Sweden)

    Kristian Ovaska

    Full Text Available Identification of responsive genes to an extra-cellular cue enables characterization of pathophysiologically crucial biological processes. Deep sequencing technologies provide a powerful means to identify responsive genes, which creates a need for computational methods able to analyze dynamic and multi-level deep sequencing data. To answer this need we introduce here a data-driven algorithm, SPINLONG, which is designed to search for genes that match the user-defined hypotheses or models. SPINLONG is applicable to various experimental setups measuring several molecular markers in parallel. To demonstrate the SPINLONG approach, we analyzed ChIP-seq data reporting PolII, estrogen receptor α (ERα, H3K4me3 and H2A.Z occupancy at five time points in the MCF-7 breast cancer cell line after estradiol stimulus. We obtained 777 ERa early responsive genes and compared the biological functions of the genes having ERα binding within 20 kb of the transcription start site (TSS to genes without such binding site. Our results show that the non-genomic action of ERα via the MAPK pathway, instead of direct ERa binding, may be responsible for early cell responses to ERα activation. Our results also indicate that the ERα responsive genes triggered by the genomic pathway are transcribed faster than those without ERα binding sites. The survival analysis of the 777 ERα responsive genes with 150 primary breast cancer tumors and in two independent validation cohorts indicated the ATAD3B gene, which does not have ERα binding site within 20 kb of its TSS, to be significantly associated with poor patient survival.

  4. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    Science.gov (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  5. DanQ: a hybrid convolutional and recurrent deep neural network for quantifying the function of DNA sequences.

    Science.gov (United States)

    Quang, Daniel; Xie, Xiaohui

    2016-06-20

    Modeling the properties and functions of DNA sequences is an important, but challenging task in the broad field of genomics. This task is particularly difficult for non-coding DNA, the vast majority of which is still poorly understood in terms of function. A powerful predictive model for the function of non-coding DNA can have enormous benefit for both basic science and translational research because over 98% of the human genome is non-coding and 93% of disease-associated variants lie in these regions. To address this need, we propose DanQ, a novel hybrid convolutional and bi-directional long short-term memory recurrent neural network framework for predicting non-coding function de novo from sequence. In the DanQ model, the convolution layer captures regulatory motifs, while the recurrent layer captures long-term dependencies between the motifs in order to learn a regulatory 'grammar' to improve predictions. DanQ improves considerably upon other models across several metrics. For some regulatory markers, DanQ can achieve over a 50% relative improvement in the area under the precision-recall curve metric compared to related models. We have made the source code available at the github repository http://github.com/uci-cbcl/DanQ. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. HIV-1 transmission patterns in antiretroviral therapy-naive, HIV-infected North Americans based on phylogenetic analysis by population level and ultra-deep DNA sequencing.

    Directory of Open Access Journals (Sweden)

    Lisa L Ross

    Full Text Available Factors that contribute to the transmission of human immunodeficiency virus type 1 (HIV-1, especially drug-resistant HIV-1 variants remain a significant public health concern. In-depth phylogenetic analyses of viral sequences obtained in the screening phase from antiretroviral-naïve HIV-infected patients seeking enrollment in EPZ108859, a large open-label study in the USA, Canada and Puerto Rico (ClinicalTrials.gov NCT00440947 were examined for insights into the roles of drug resistance and epidemiological factors that could impact disease dissemination. Viral transmission clusters (VTCs were initially predicted from a phylogenetic analysis of population level HIV-1 pol sequences obtained from 690 antiretroviral-naïve subjects in 2007. Subsequently, the predicted VTCs were tested for robustness by ultra deep sequencing (UDS using pyrosequencing technology and further phylogenetic analyses. The demographic characteristics of clustered and non-clustered subjects were then compared. From 690 subjects, 69 were assigned to 1 of 30 VTCs, each containing 2 to 5 subjects. Race composition of VTCs were significantly more likely to be white (72% vs. 60%; p = 0.04. VTCs had fewer reverse transcriptase and major PI resistance mutations (9% vs. 24%; p = 0.002 than non-clustered sequences. Both men-who-have-sex-with-men (MSM (68% vs. 48%; p = 0.001 and Canadians (29% vs. 14%; p = 0.03 were significantly more frequent in VTCs than non-clustered sequences. Of the 515 subjects who initiated antiretroviral therapy, 33 experienced confirmed virologic failure through 144 weeks while only 3/33 were from VTCs. Fewer VTCs subjects (as compared to those with non-clustering virus had HIV-1 with resistance-associated mutations or experienced virologic failure during the course of the study. Our analysis shows specific geographical and drug resistance trends that correlate well with transmission clusters defined by HIV sequences of similarity

  7. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  8. Detection of Inter-Lineage Natural Recombination in Avian Paramyxovirus Serotype 1 Using Simplified Deep Sequencing Platform.

    Science.gov (United States)

    Satharasinghe, Dilan A; Murulitharan, Kavitha; Tan, Sheau W; Yeap, Swee K; Munir, Muhammad; Ideris, Aini; Omar, Abdul R

    2016-01-01

    Newcastle disease virus (NDV) is a prototype member of avian paramyxovirus serotype 1 (APMV-1), which causes severe and contagious disease in the commercial poultry and wild birds. Despite extensive vaccination programs and other control measures, the disease remains endemic around the globe especially in Asia, Africa, and the Middle East. Being a single serotype, genotype II based vaccines remained most acceptable means of immunization. However, the evidence is emerging on failures of vaccines mainly due to evolving nature of the virus and higher genetic gaps between vaccine and field strains of APMV-1. Most of the epidemiological and genetic characterizations of APMVs are based on conventional methods, which are prone to mask the diverse population of viruses in complex samples. In this study, we report the application of a simple, robust, and less resource-demanding methodology for the whole genome sequencing of NDV, using next-generation sequencing (NGS) on the Illumina MiSeq platform. Using this platform, we sequenced full genomes of five virulent Malaysian NDV strains collected during 2004-2013. All isolates clustered within highly prevalent lineage 5 (specifically in lineage 5a); however, a significantly greater genetic divergence was observed in isolates collected from 2004 to 2011. Interestingly, genetic characterization of one isolate collected in 2013 (IBS025/13) shown natural recombination between lineage 2 and lineage 5. In the event of recombination, the isolate (IBS025/13) carried nucleocapsid protein consist of 55-1801 nucleotides (nts) and near-complete phosphoprotein (1804-3254 nts) genes of lineage 2 whereas surface glycoproteins (fusion, hemagglutinin-neuraminidase) and large polymerase of lineage 5. Additionally, the recombinant virus has a genome size of 15,186 nts which is characteristics for the old genotypes I-IV isolated from 1930 to 1960. Taken together, we report the occurrence of a natural recombination in circulating strains of NDV in

  9. Targeted deep sequencing of mucinous ovarian tumors reveals multiple overlapping RAS-pathway activating mutations in borderline and cancerous neoplasms

    International Nuclear Information System (INIS)

    Mackenzie, Robertson; Kommoss, Stefan; Winterhoff, Boris J.; Kipp, Benjamin R.; Garcia, Joaquin J.; Voss, Jesse; Halling, Kevin; Karnezis, Anthony; Senz, Janine; Yang, Winnie; Prigge, Elena-Sophie; Reuschenbach, Miriam; Doeberitz, Magnus Von Knebel; Gilks, Blake C.; Huntsman, David G.; Bakkum-Gamez, Jamie; McAlpine, Jessica N.; Anglesio, Michael S.

    2015-01-01

    Mucinous ovarian tumors represent a distinct histotype of epithelial ovarian cancer. The rarest (2-4 % of ovarian carcinomas) of the five major histotypes, their genomic landscape remains poorly described. We undertook hotspot sequencing of 50 genes commonly mutated in human cancer across 69 mucinous ovarian tumors. Our goals were to establish the overall frequency of cancer-hotspot mutations across a large cohort, especially those tumors previously thought to be “RAS-pathway alteration negative”, using highly-sensitive next-generation sequencing as well as further explore a small number of cases with apparent heterogeneity in RAS-pathway activating alterations. Using the Ion Torrent PGM platform, we performed next generation sequencing analysis using the v2 Cancer Hotspot Panel. Regions of disparate ERBB2-amplification status were sequenced independently for two mucinous carcinoma (MC) cases, previously established as showing ERBB2 amplification/overexpression heterogeneity, to assess the hypothesis of subclonal populations containing either KRAS mutation or ERBB2 amplification independently or simultaneously. We detected mutations in KRAS, TP53, CDKN2A, PIK3CA, PTEN, BRAF, FGFR2, STK11, CTNNB1, SRC, SMAD4, GNA11 and ERBB2. KRAS mutations remain the most frequently observed alteration among MC (64.9 %) and mucinous borderline tumors (MBOT) (92.3 %). TP53 mutation occurred more frequently in carcinomas than borderline tumors (56.8 % and 11.5 %, respectively), and combined IHC and mutation data suggest alterations occur in approximately 68 % of MC and as many as 20 % of MBOT. Proven and potential RAS-pathway activating changes were observed in all but one MC. Concurrent ERBB2 amplification and KRAS mutation were observed in a substantial number of cases (7/63 total), as was co-occurrence of KRAS and BRAF mutations (one case). Microdissection of ERBB2-amplified regions of tumors harboring KRAS mutation suggests these alterations are occurring in the same cell

  10. Revisiting bovine pyometra-New insights into the disease using a culture-independent deep sequencing approach

    DEFF Research Database (Denmark)

    Knudsen, Lif Rødtness Vesterby; Karstrup, Cecilia Christensen; Pedersen, Hanne Gervi

    2015-01-01

    -independent studies have demonstrated that the bacterial diversity in most environments is underestimated in culture-based studies. Consequently, fastidious pyometra-associated pathogens may have been overlooked. Therefore, the primary purpose of this study was to investigate the diversity of bacteria in the uterus......The bacteria present in the uterus during pyometra have previously been studied using bacteriological culturing. These studies identified Fusobacterium necrophorum and Trueperella pyogenes as the major contributors to the pathogenesis of pyometra. However, an increasing number of culture...... of cows with pyometra by using culture-independent 16S rRNA PCR combined with next generation sequencing. We investigated the microbial composition in the uterus of 21 cows with pyometra, which were obtained from a Danish slaughterhouse. Similar to the observations from the culture studies...

  11. Deep sequencing reveals transcriptome re-programming of Taxus × media cells to the elicitation with methyl jasmonate.

    Science.gov (United States)

    Sun, Guiling; Yang, Yanfang; Xie, Fuliang; Wen, Jian-Fan; Wu, Jianqiang; Wilson, Iain W; Tang, Qi; Liu, Hongwei; Qiu, Deyou

    2013-01-01

    Plant cell culture represents an alternative source for producing high-value secondary metabolites including paclitaxel (Taxol®), which is mainly produced in Taxus and has been widely used in cancer chemotherapy. The phytohormone methyl jasmonate (MeJA) can significantly increase the production of paclitaxel, which is induced in plants as a secondary metabolite possibly in defense against herbivores and pathogens. In cell culture, MeJA also elicits the accumulation of paclitaxel; however, the mechanism is still largely unknown. To obtain insight into the global regulation mechanism of MeJA in the steady state of paclitaxel production (7 days after MeJA addition), especially on paclitaxel biosynthesis, we sequenced the transcriptomes of MeJA-treated and untreated Taxus × media cells and obtained ∼ 32.5 M high quality reads, from which 40,348 unique sequences were obtained by de novo assembly. Expression level analysis indicated that a large number of genes were associated with transcriptional regulation, DNA and histone modification, and MeJA signaling network. All the 29 known genes involved in the biosynthesis of terpenoid backbone and paclitaxel were found with 18 genes showing increased transcript abundance following elicitation of MeJA. The significantly up-regulated changes of 9 genes in paclitaxel biosynthesis were validated by qRT-PCR assays. According to the expression changes and the previously proposed enzyme functions, multiple candidates for the unknown steps in paclitaxel biosynthesis were identified. We also found some genes putatively involved in the transport and degradation of paclitaxel. Potential target prediction of miRNAs indicated that miRNAs may play an important role in the gene expression regulation following the elicitation of MeJA. Our results shed new light on the global regulation mechanism by which MeJA regulates the physiology of Taxus cells and is helpful to understand how MeJA elicits other plant species besides Taxus.

  12. Purification of MUC1 from Bovine Milk-Fat Globules and Characterization of a Corresponding Full-Length cDNA Clone

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Andersen, Mikkel Holmen; Nielsen, Rune

    2001-01-01

    acid sequences obtained by peptide mapping. The complete amino acid sequence of MUC1 was determined by cloning and sequencing the corresponding bovine mammary gland cDNA, which was shown to encode a protein of 580 amino acid residues comprising a cleavable signal peptide of 22 residues. The deduced...

  13. Compositional Bias in Naïve and Chemically-modified Phage-Displayed Libraries uncovered by Paired-end Deep Sequencing.

    Science.gov (United States)

    He, Bifang; Tjhung, Katrina F; Bennett, Nicholas J; Chou, Ying; Rau, Andrea; Huang, Jian; Derda, Ratmir

    2018-01-19

    Understanding the composition of a genetically-encoded (GE) library is instrumental to the success of ligand discovery. In this manuscript, we investigate the bias in GE-libraries of linear, macrocyclic and chemically post-translationally modified (cPTM) tetrapeptides displayed on the M13KE platform, which are produced via trinucleotide cassette synthesis (19 codons) and NNK-randomized codon. Differential enrichment of synthetic DNA {S}, ligated vector {L} (extension and ligation of synthetic DNA into the vector), naïve libraries {N} (transformation of the ligated vector into the bacteria followed by expression of the library for 4.5 hours to yield a "naïve" library), and libraries chemically modified by aldehyde ligation and cysteine macrocyclization {M} characterized by paired-end deep sequencing, detected a significant drop in diversity in {L} → {N}, but only a minor compositional difference in {S} → {L} and {N} → {M}. Libraries expressed at the N-terminus of phage protein pIII censored positively charged amino acids Arg and Lys; libraries expressed between pIII domains N1 and N2 overcame Arg/Lys-censorship but introduced new bias towards Gly and Ser. Interrogation of biases arising from cPTM by aldehyde ligation and cysteine macrocyclization unveiled censorship of sequences with Ser/Phe. Analogous analysis can be used to explore library diversity in new display platforms and optimize cPTM of these libraries.

  14. Use of whole genome deep sequencing to define emerging minority variants in virus envelope genes in herpesvirus treated with novel antimicrobial K21.

    Science.gov (United States)

    Tweedy, Joshua G; Prusty, Bhupesh K; Gompels, Ursula A

    2017-10-01

    New antivirals are required to prevent rising antimicrobial resistance from replication inhibitors. The aim of this study was to analyse the range of emerging mutations in herpesvirus by whole genome deep sequencing. We tested human herpesvirus 6 treatment with novel antiviral K21, where evidence indicated distinct effects on virus envelope proteins. We treated BACmid cloned virus in order to analyse mechanisms and candidate targets for resistance. Illumina based next generation sequencing technology enabled analyses of mutations in 85 genes to depths of 10,000 per base detecting low prevalent minority variants (<1%). After four passages in tissue culture the untreated virus accumulated mutations in infected cells giving an emerging mixed population (45-73%) of non-synonymous SNPs in six genes including two envelope glycoproteins. Strikingly, treatment with K21 did not accumulate the passage mutations; instead a high frequency mutation was selected in envelope protein gQ2, part of the gH/gL complex essential for herpesvirus infection. This introduced a stop codon encoding a truncation mutation previously observed in increased virion production. There was reduced detection of the glycoprotein complex in infected cells. This supports a novel pathway for K21 targeting virion envelopes distinct from replication inhibition. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Consistent errors in first strand cDNA due to random hexamer mispriming.

    Directory of Open Access Journals (Sweden)

    Thomas P van Gurp

    Full Text Available Priming of random hexamers in cDNA synthesis is known to show sequence bias, but in addition it has been suggested recently that mismatches in random hexamer priming could be a cause of mismatches between the original RNA fragment and observed sequence reads. To explore random hexamer mispriming as a potential source of these errors, we analyzed two independently generated RNA-seq datasets of synthetic ERCC spikes for which the reference is known. First strand cDNA synthesized by random hexamer priming on RNA showed consistent position and nucleotide-specific mismatch errors in the first seven nucleotides. The mismatch errors found in both datasets are consistent in distribution and thermodynamically stable mismatches are more common. This strongly indicates that RNA-DNA mispriming of specific random hexamers causes these errors. Due to their consistency and specificity, mispriming errors can have profound implications for downstream applications if not dealt with properly.

  16. Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Soumen Naskar

    2012-01-01

    Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

  17. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  18. Discovery of MicroRNAs associated with myogenesis by deep sequencing of serial developmental skeletal muscles in pigs.

    Directory of Open Access Journals (Sweden)

    Xinhua Hou

    Full Text Available MicroRNAs (miRNAs are short, single-stranded non-coding RNAs that repress their target genes by binding their 3' UTRs. These RNAs play critical roles in myogenesis. To gain knowledge about miRNAs involved in the regulation of myogenesis, porcine longissimus muscles were collected from 18 developmental stages (33-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80-, 85-, 90-, 95-, 100- and 105-day post-gestation fetuses, 0 and 10-day postnatal piglets and adult pigs to identify miRNAs using Solexa sequencing technology. We detected 197 known miRNAs and 78 novel miRNAs according to comparison with known miRNAs in the miRBase (release 17.0 database. Moreover, variations in sequence length and single nucleotide polymorphisms were also observed in 110 known miRNAs. Expression analysis of the 11 most abundant miRNAs were conducted using quantitative PCR (qPCR in eleven tissues (longissimus muscles, leg muscles, heart, liver, spleen, lung, kidney, stomach, small intestine and colon, and the results revealed that ssc-miR-378, ssc-miR-1 and ssc-miR-206 were abundantly expressed in skeletal muscles. During skeletal muscle development, the expression level of ssc-miR-378 was low at 33 days post-coitus (dpc, increased at 65 and 90 dpc, peaked at postnatal day 0, and finally declined and maintained a comparatively stable level. This expression profile suggested that ssc-miR-378 was a new candidate miRNA for myogenesis and participated in skeletal muscle development in pigs. Target prediction and KEGG pathway analysis suggested that bone morphogenetic protein 2 (BMP2 and mitogen-activated protein kinase 1 (MAPK1, both of which were relevant to proliferation and differentiation, might be the potential targets of miR-378. Luciferase activities of report vectors containing the 3'UTR of porcine BMP2 or MAPK1 were downregulated by miR-378, which suggested that miR-378 probably regulated myogenesis though the regulation of these two genes.

  19. Three-dimensional fluid-attenuated inversion recovery sequence for visualisation of subthalamic nucleus for deep brain stimulation in Parkinson's disease

    Energy Technology Data Exchange (ETDEWEB)

    Heo, Young Jin [University of Ulsan College of Medicine, Asan Medical Center, Department of Radiology, Research Institute of Radiology, Seoul (Korea, Republic of); Inje University, Department of Radiology, Busan Paik Hospital, Busan (Korea, Republic of); Kim, Sang Joon; Kim, Ho Sung; Choi, Choong Gon; Jung, Seung Chai [University of Ulsan College of Medicine, Asan Medical Center, Department of Radiology, Research Institute of Radiology, Seoul (Korea, Republic of); Lee, Jung Kyo [University of Ulsan College of Medicine, Asan Medical Center, Department of Neurosurgery, Seoul (Korea, Republic of); Lee, Chong Sik; Chung, Sun J. [University of Ulsan College of Medicine, Asan Medical Center, Department of Neurology, Seoul (Korea, Republic of); Cho, So Hyun [Department of Radiology, Busan (Korea, Republic of); Lee, Gyoung Ro [Philips HealthCare Korea, Seoul (Korea, Republic of)

    2015-09-15

    Deep brain stimulation (DBS) of the subthalamic nucleus (STN) is an accepted treatment for advanced Parkinson's disease (PD). However, targeting the STN is difficult due to its relatively small size and variable location. The purpose of this study was to assess which of the following sequences obtained with the 3.0 T MR system can accurately delineate the STN: coronal 3D fluid-attenuated inversion recovery (FLAIR), 2D T2*-weighted fast-field echo (T2*-FFE) and 2D T2-weighted turbo spin-echo (TSE) sequences. We included 20 consecutive patients with PD who underwent 3.0 T MR for DBS targeting. 3D FLAIR, 2D T2*-FFE and T2-TSE images were obtained for all study patients. Image quality and demarcation of the STN were analysed using 4-point scales, and contrast ratio (CR) of the STN and normal white matter was calculated. The Friedman test was used to compare the three sequences. In qualitative analysis, the 2D T2*-FFE image showed more artefacts than 3D FLAIR or 2D T2-TSE, but the difference did not reach statistical significance. 3D FLAIR images showed significantly superior demarcation of the STN compared with 2D T2*-FFE and T2-TSE images (P < 0.001, respectively). The CR of 3D FLAIR was significantly higher than that of 2D T2*-FFE or T2-TSE images in multiple comparison correction (P < 0.001), but there was no significant difference in the CR between 2D T2*-FFE and T2-TSE images. Coronal 3D FLAIR images showed the most accurate demarcation of the STN for DBS targeting among coronal 3D FLAIR, 2D T2*-FFE and T2-TSE images. (orig.)

  20. Integrated analysis of gene expression, CpG island methylation, and gene copy number in breast cancer cells by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Zhifu Sun

    Full Text Available We used deep sequencing technology to profile the transcriptome, gene copy number, and CpG island methylation status simultaneously in eight commonly used breast cell lines to develop a model for how these genomic features are integrated in estrogen receptor positive (ER+ and negative breast cancer. Total mRNA sequence, gene copy number, and genomic CpG island methylation were carried out using the Illumina Genome Analyzer. Sequences were mapped to the human genome to obtain digitized gene expression data, DNA copy number in reference to the non-tumor cell line (MCF10A, and methylation status of 21,570 CpG islands to identify differentially expressed genes that were correlated with methylation or copy number changes. These were evaluated in a dataset from 129 primary breast tumors. Gene expression in cell lines was dominated by ER-associated genes. ER+ and ER- cell lines formed two distinct, stable clusters, and 1,873 genes were differentially expressed in the two groups. Part of chromosome 8 was deleted in all ER- cells and part of chromosome 17 amplified in all ER+ cells. These loci encoded 30 genes that were overexpressed in ER+ cells; 9 of these genes were overexpressed in ER+ tumors. We identified 149 differentially expressed genes that exhibited differential methylation of one or more CpG islands within 5 kb of the 5' end of the gene and for which mRNA abundance was inversely correlated with CpG island methylation status. In primary tumors we identified 84 genes that appear to be robust components of the methylation signature that we identified in ER+ cell lines. Our analyses reveal a global pattern of differential CpG island methylation that contributes to the transcriptome landscape of ER+ and ER- breast cancer cells and tumors. The role of gene amplification/deletion appears to more modest, although several potentially significant genes appear to be regulated by copy number aberrations.

  1. Three-dimensional fluid-attenuated inversion recovery sequence for visualisation of subthalamic nucleus for deep brain stimulation in Parkinson's disease

    International Nuclear Information System (INIS)

    Heo, Young Jin; Kim, Sang Joon; Kim, Ho Sung; Choi, Choong Gon; Jung, Seung Chai; Lee, Jung Kyo; Lee, Chong Sik; Chung, Sun J.; Cho, So Hyun; Lee, Gyoung Ro

    2015-01-01

    Deep brain stimulation (DBS) of the subthalamic nucleus (STN) is an accepted treatment for advanced Parkinson's disease (PD). However, targeting the STN is difficult due to its relatively small size and variable location. The purpose of this study was to assess which of the following sequences obtained with the 3.0 T MR system can accurately delineate the STN: coronal 3D fluid-attenuated inversion recovery (FLAIR), 2D T2*-weighted fast-field echo (T2*-FFE) and 2D T2-weighted turbo spin-echo (TSE) sequences. We included 20 consecutive patients with PD who underwent 3.0 T MR for DBS targeting. 3D FLAIR, 2D T2*-FFE and T2-TSE images were obtained for all study patients. Image quality and demarcation of the STN were analysed using 4-point scales, and contrast ratio (CR) of the STN and normal white matter was calculated. The Friedman test was used to compare the three sequences. In qualitative analysis, the 2D T2*-FFE image showed more artefacts than 3D FLAIR or 2D T2-TSE, but the difference did not reach statistical significance. 3D FLAIR images showed significantly superior demarcation of the STN compared with 2D T2*-FFE and T2-TSE images (P < 0.001, respectively). The CR of 3D FLAIR was significantly higher than that of 2D T2*-FFE or T2-TSE images in multiple comparison correction (P < 0.001), but there was no significant difference in the CR between 2D T2*-FFE and T2-TSE images. Coronal 3D FLAIR images showed the most accurate demarcation of the STN for DBS targeting among coronal 3D FLAIR, 2D T2*-FFE and T2-TSE images. (orig.)

  2. Deep sequencing-based transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus reveals insight into the immune-relevant genes in marine fish

    Directory of Open Access Journals (Sweden)

    Xiang Li-xin

    2010-08-01

    Full Text Available Abstract Background Systematic research on fish immunogenetics is indispensable in understanding the origin and evolution of immune systems. This has long been a challenging task because of the limited number of deep sequencing technologies and genome backgrounds of non-model fish available. The newly developed Solexa/Illumina RNA-seq and Digital gene expression (DGE are high-throughput sequencing approaches and are powerful tools for genomic studies at the transcriptome level. This study reports the transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus using RNA-seq and DGE in an attempt to gain insights into the immunogenetics of marine fish. Results RNA-seq analysis generated 169,950 non-redundant consensus sequences, among which 48,987 functional transcripts with complete or various length encoding regions were identified. More than 52% of these transcripts are possibly involved in approximately 219 known metabolic or signalling pathways, while 2,673 transcripts were associated with immune-relevant genes. In addition, approximately 8% of the transcripts appeared to be fish-specific genes that have never been described before. DGE analysis revealed that the host transcriptome profile of Vibrio harveyi-challenged L. japonicus is considerably altered, as indicated by the significant up- or down-regulation of 1,224 strong infection-responsive transcripts. Results indicated an overall conservation of the components and transcriptome alterations underlying innate and adaptive immunity in fish and other vertebrate models. Analysis suggested the acquisition of numerous fish-specific immune system components during early vertebrate evolution. Conclusion This study provided a global survey of host defence gene activities against bacterial challenge in a non-model marine fish. Results can contribute to the in-depth study of candidate genes in marine fish immunity, and help improve current understanding of host

  3. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  4. Minimal Residual Disease Detection and Evolved IGH Clones Analysis in Acute B Lymphoblastic Leukemia Using IGH Deep Sequencing.

    Science.gov (United States)

    Wu, Jinghua; Jia, Shan; Wang, Changxi; Zhang, Wei; Liu, Sixi; Zeng, Xiaojing; Mai, Huirong; Yuan, Xiuli; Du, Yuanping; Wang, Xiaodong; Hong, Xueyu; Li, Xuemei; Wen, Feiqiu; Xu, Xun; Pan, Jianhua; Li, Changgang; Liu, Xiao

    2016-01-01

    Acute B lymphoblastic leukemia (B-ALL) is one of the most common types of childhood cancer worldwide and chemotherapy is the main treatment approach. Despite good response rates to chemotherapy regiments, many patients eventually relapse and minimal residual disease (MRD) is the leading risk factor for relapse. The evolution of leukemic clones during disease development and treatment may have clinical significance. In this study, we performed immunoglobulin heavy chain ( IGH ) repertoire high throughput sequencing (HTS) on the diagnostic and post-treatment samples of 51 pediatric B-ALL patients. We identified leukemic IGH clones in 92.2% of the diagnostic samples and nearly half of the patients were polyclonal. About one-third of the leukemic clones have correct open reading frame in the complementarity determining region 3 (CDR3) of IGH , which demonstrates that the leukemic B cells were in the early developmental stage. We also demonstrated the higher sensitivity of HTS in MRD detection and investigated the clinical value of using peripheral blood in MRD detection and monitoring the clonal IGH evolution. In addition, we found leukemic clones were extensively undergoing continuous clonal IGH evolution by variable gene replacement. Dynamic frequency change and newly emerged evolved IGH clones were identified upon the pressure of chemotherapy. In summary, we confirmed the high sensitivity and universal applicability of HTS in MRD detection. We also reported the ubiquitous evolved IGH clones in B-ALL samples and their response to chemotherapy during treatment.

  5. Deep RNA sequencing reveals hidden features and dynamics of early gene transcription in Paramecium bursaria chlorella virus 1.

    Directory of Open Access Journals (Sweden)

    Guillaume Blanc

    Full Text Available Paramecium bursaria chlorella virus 1 (PBCV-1 is the prototype of the genus Chlorovirus (family Phycodnaviridae that infects the unicellular, eukaryotic green alga Chlorella variabilis NC64A. The 331-kb PBCV-1 genome contains 416 major open reading frames. A mRNA-seq approach was used to analyze PBCV-1 transcriptomes at 6 progressive times during the first hour of infection. The alignment of 17 million reads to the PBCV-1 genome allowed the construction of single-base transcriptome maps. Significant transcription was detected for a subset of 50 viral genes as soon as 7 min after infection. By 20 min post infection (p.i., transcripts were detected for most PBCV-1 genes and transcript levels continued to increase globally up to 60 min p.i., at which time 41% or the poly (A+-containing RNAs in the infected cells mapped to the PBCV-1 genome. For some viral genes, the number of transcripts in the latter time points (20 to 60 min p.i. was much higher than that of the most highly expressed host genes. RNA-seq data revealed putative polyadenylation signal sequences in PBCV-1 genes that were identical to the polyadenylation signal AAUAAA of green algae. Several transcripts have an RNA fragment excised. However, the frequency of excision and the resulting putative shortened protein products suggest that most of these excision events have no functional role but are probably the result of the activity of misled splicesomes.

  6. Deep sequencing-based transcriptome analysis of chicken spleen in response to avian pathogenic Escherichia coli (APEC infection.

    Directory of Open Access Journals (Sweden)

    Qinghua Nie

    Full Text Available Avian pathogenic Escherichia coli (APEC leads to economic losses in poultry production and is also a threat to human health. The goal of this study was to characterize the chicken spleen transcriptome and to identify candidate genes for response and resistance to APEC infection using Solexa sequencing. We obtained 14422935, 14104324, and 14954692 Solexa read pairs for non-challenged (NC, challenged-mild pathology (MD, and challenged-severe pathology (SV, respectively. A total of 148197 contigs and 98461 unigenes were assembled, of which 134949 contigs and 91890 unigenes match the chicken genome. In total, 12272 annotated unigenes take part in biological processes (11664, cellular components (11927, and molecular functions (11963. Summing three specific contrasts, 13650 significantly differentially expressed unigenes were found in NC Vs. MD (6844, NC Vs. SV (7764, and MD Vs. SV (2320. Some unigenes (e.g. CD148, CD45 and LCK were involved in crucial pathways, such as the T cell receptor (TCR signaling pathway and microbial metabolism in diverse environments. This study facilitates understanding of the genetic architecture of the chicken spleen transcriptome, and has identified candidate genes for host response to APEC infection.

  7. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids.

    Science.gov (United States)

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-08-13

    Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.

  8. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2016-08-01

    Full Text Available An arthropod-borne virus, Zika virus (ZIKV, has recently emerged as a major human pathogen. Associated with complications during perinatal development and Guillain-Barré syndrome in adults, ZIKV raises new challenges for understanding the molecular determinants of flavivirus pathogenesis. This underscores the necessity for the development of a reverse genetic system based on an epidemic ZIKV strain. Here, we describe the generation and characterization in cell cultures of an infectious cDNA clone of ZIKV isolated from the 2015 epidemic in Brazil. The cDNA-derived ZIKV replicated efficiently in a variety of cell lines, including those of both neuronal and placental origin. We observed that the growth of cDNA-derived virus was attenuated compared to the growth of the parental isolate in most cell lines, which correlates with substantial differences in sequence heterogeneity between these viruses that were determined by deep-sequencing analysis. Our findings support the role of genetic diversity in maintaining the replicative fitness of viral populations under changing conditions. Moreover, these results indicate that caution should be exercised when interpreting the results of reverse-genetics experiments in attempts to accurately predict the biology of natural viruses. Finally, a Vero cell-adapted cDNA clone of ZIKV was generated that can be used as a convenient platform for studies aimed at the development of ZIKV vaccines and therapeutics.

  9. CDNA library from the Latex of Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Wilaiwan Chotigeat

    2010-12-01

    Full Text Available Latex from Hevea brasiliensis contains 30-50% (w/w of natural rubber (cis-1,4-polyisoprene, the important rawmaterial for many rubber industries. We have constructed a cDNA library from the latex of H. brasiliensis to investigate theexpressed genes and molecular events in the latex. We analyzed 412 expressed sequence tags (ESTs. More than 90% of theEST clones showed homology to previously described sequences in public databases. Functional classification of the ESTsshowed that the largest category were proteins of unknown function (30.1%, 11.4% of ESTs encoded for rubber synthesisrelatedproteins (RS and 8.5% for defense or stress related proteins (DS. Those with no significant homology to knownsequences (NSH accounted for 8.7%, primary metabolism (PM and gene expression and RNA metabolism were 7.8% and6.6%, respectively. Other categories included, protein synthesis-related proteins (6.6%, chromatin and DNA metabolism(CDM 3.9%, energy metabolism (EM 3.4%, cellular transport (CT 3.2%, cell structure (CS 3.2%, signal transduction (ST2.2%, secondary metabolism (SM 1.7%, protein fate (PF 2.2%, and reproductive proteins (RP 0.7%.

  10. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

  11. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    Science.gov (United States)

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  12. Deep sequencing of natural and experimental populations of Drosophila melanogaster reveals biases in the spectrum of new mutations.

    Science.gov (United States)

    Assaf, Zoe June; Tilk, Susanne; Park, Jane; Siegal, Mark L; Petrov, Dmitri A

    2017-12-01

    Mutations provide the raw material of evolution, and thus our ability to study evolution depends fundamentally on having precise measurements of mutational rates and patterns. We generate a data set for this purpose using (1) de novo mutations from mutation accumulation experiments and (2) extremely rare polymorphisms from natural populations. The first, mutation accumulation (MA) lines are the product of maintaining flies in tiny populations for many generations, therefore rendering natural selection ineffective and allowing new mutations to accrue in the genome. The second, rare genetic variation from natural populations allows the study of mutation because extremely rare polymorphisms are relatively unaffected by the filter of natural selection. We use both methods in Drosophila melanogaster , first generating our own novel data set of sequenced MA lines and performing a meta-analysis of all published MA mutations (∼2000 events) and then identifying a high quality set of ∼70,000 extremely rare (≤0.1%) polymorphisms that are fully validated with resequencing. We use these data sets to precisely measure mutational rates and patterns. Highlights of our results include: a high rate of multinucleotide mutation events at both short (∼5 bp) and long (∼1 kb) genomic distances, showing that mutation drives GC content lower in already GC-poor regions, and using our precise context-dependent mutation rates to predict long-term evolutionary patterns at synonymous sites. We also show that de novo mutations from independent MA experiments display similar patterns of single nucleotide mutation and well match the patterns of mutation found in natural populations. © 2017 Assaf et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Identification of novel and conserved microRNAs related to drought stress in potato by deep sequencing.

    Science.gov (United States)

    Zhang, Ning; Yang, Jiangwei; Wang, Zemin; Wen, Yikai; Wang, Jie; He, Wenhui; Liu, Bailin; Si, Huaijun; Wang, Di

    2014-01-01

    MicroRNAs (miRNAs) are a group of small, non-coding RNAs that play important roles in plant growth, development and stress response. There have been an increasing number of investigations aimed at discovering miRNAs and analyzing their functions in model plants (such as Arabidopsis thaliana and rice). In this research, we constructed small RNA libraries from both polyethylene glycol (PEG 6,000) treated and control potato samples, and a large number of known and novel miRNAs were identified. Differential expression analysis showed that 100 of the known miRNAs were down-regulated and 99 were up-regulated as a result of PEG stress, while 119 of the novel miRNAs were up-regulated and 151 were down-regulated. Based on target prediction, annotation and expression analysis of the miRNAs and their putative target genes, 4 miRNAs were identified as regulating drought-related genes (miR811, miR814, miR835, miR4398). Their target genes were MYB transcription factor (CV431094), hydroxyproline-rich glycoprotein (TC225721), quaporin (TC223412) and WRKY transcription factor (TC199112), respectively. Relative expression trends of those miRNAs were the same as that predicted by Solexa sequencing and they showed a negative correlation with the expression of the target genes. The results provide molecular evidence for the possible involvement of miRNAs in the process of drought response and/or tolerance in the potato plant.

  14. Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing.

    Science.gov (United States)

    Tian, Bin; Wang, Shichen; Todd, Timothy C; Johnson, Charles D; Tang, Guiliang; Trick, Harold N

    2017-08-02

    The soybean cyst nematode (SCN), Heterodera glycines, is one of the most devastating diseases limiting soybean production worldwide. It is known that small RNAs, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), play important roles in regulating plant growth and development, defense against pathogens, and responses to environmental changes. In order to understand the role of soybean miRNAs during SCN infection, we analyzed 24 small RNA libraries including three biological replicates from two soybean cultivars (SCN susceptible KS4607, and SCN HG Type 7 resistant KS4313N) that were grown under SCN-infested and -noninfested soil at two different time points (SCN feeding establishment and egg production). In total, 537 known and 70 putative novel miRNAs in soybean were identified from a total of 0.3 billion reads (average about 13.5 million reads for each sample) with the programs of Bowtie and miRDeep2 mapper. Differential expression analyses were carried out using edgeR to identify miRNAs involved in the soybean-SCN interaction. Comparative analysis of miRNA profiling indicated a total of 60 miRNAs belonging to 25 families that might be specifically related to cultivar responses to SCN. Quantitative RT-PCR validated similar miRNA interaction patterns as sequencing results. These findings suggest that miRNAs are likely to play key roles in soybean response to SCN. The present work could provide a framework for miRNA functional identification and the development of novel approaches for improving soybean SCN resistance in future studies.

  15. Transcriptome profiling and digital gene expression by deep sequencing in early somatic embryogenesis of endangered medicinal Eleutherococcus senticosus Maxim.

    Science.gov (United States)

    Tao, Lei; Zhao, Yue; Wu, Ying; Wang, Qiuyu; Yuan, Hongmei; Zhao, Lijuan; Guo, Wendong; You, Xiangling

    2016-03-01

    Somatic embryogenesis (SE) has been studied as a model system to understand molecular events in physiology, biochemistry, and cytology during plant embryo development. In particular, it is exceedingly difficult to access the morphological and early regulatory events in zygotic embryos. To understand the molecular mechanisms regulating early SE in Eleutherococcus senticosus Maxim., we used high-throughput RNA-Seq technology to investigate its transcriptome. We obtained 58,327,688 reads, which were assembled into 75,803 unique unigenes. To better understand their functions, the unigenes were annotated using the Clusters of Orthologous Groups, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes databases. Digital gene expression libraries revealed differences in gene expression profiles at different developmental stages (embryogenic callus, yellow embryogenic callus, global embryo). We obtained a sequencing depth of >5.6 million tags per sample and identified many differentially expressed genes at various stages of SE. The initiation of SE affected gene expression in many KEGG pathways, but predominantly that in metabolic pathways, biosynthesis of secondary metabolites, and plant hormone signal transduction. This information on the changes in the multiple pathways related to SE induction in E. senticosus Maxim. embryogenic tissue will contribute to a more comprehensive understanding of the mechanisms involved in early SE. Additionally, the differentially expressed genes may act as molecular markers and could play very important roles in the early stage of SE. The results are a comprehensive molecular biology resource for investigating SE of E. senticosus Maxim. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response

    Directory of Open Access Journals (Sweden)

    Chong Kang

    2009-09-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are endogenous small RNAs having large-scale regulatory effects on plant development and stress responses. Extensive studies of miRNAs have only been performed in a few model plants. Although miRNAs are proved to be involved in plant cold stress responses, little is known for winter-habit monocots. Brachypodium distachyon, with close evolutionary relationship to cool-season cereals, has recently emerged as a novel model plant. There are few reports of Brachypodium miRNAs. Results High-throughput sequencing and whole-genome-wide data mining led