WorldWideScience

Sample records for cdh1 promoter region

  1. Single nucleotide polymorphisms (SNPs at CDH1 promoter region in familial gastric cancer Polimorfismos de nucleótido único (SNPs en la región promotora CDH1 en cáncer gástrico familiar

    Directory of Open Access Journals (Sweden)

    A. Ramos-de la Medina

    2006-01-01

    Full Text Available Introduction: gastric cancer is the most frequent gastrointestinal malignancy in Mexico and the proportion of patients younger than 40 years is one of the highest reported in the world literature. Recently several families with familial diffuse gastric cancer have been identified at the National Institute of Medical Sciences and Nutrition. Germline mutations in the E-cadherin gene (CHD1 have been described that result in the development of diffuse hereditary gastric cancer in young patients. Methods: the complete coding sequence at exons 1 to 16 and the promoter region of CDH1 was amplified by polymerase chain reaction in peripheral blood samples of two patients with early onset familial diffuse gastric cancer. Results: no germline inactivating mutations of CHD1 were found on either patient. Single nucleotide polymorphisms -160 C→A were detected in the promoter region of CDH1 in both patients. Conclusions: the polymorphism -160 C→A theoretically confers an increased risk of developing diffuse gastric cancer. The relatives of these patients may an increased risk of gastric cancer among other tumors. There is presently not enough evidence to consider the -160 C→A polymorphism an etiologic factor of diffuse gastric cancer in these patients since the frequency and type of genetic alterations of CDH1 are largely unknown in the Mexican population. It will be necessary to conduct epidemiologic studies in the Mexican population to determine the influence that genetic alterations have on the genesis of diffuse gastric carcinoma.Introducción: el cáncer gástrico es la neoplasia más frecuente del tracto gastrointestinal en México y la proporción de pacientes menores de 40 años es una de las más altas reportadas en la literatura mundial. Recientemente se han identificado en el Instituto Nacional de Ciencias Médicas y Nutrición varias familias con cáncer gástrico difuso familiar. Múltiples mutaciones germinales del gene de E-cadherina (CHD1

  2. Positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis in budding yeast.

    Science.gov (United States)

    Hatano, Yuhki; Naoki, Koike; Suzuki, Asuka; Ushimaru, Takashi

    2016-10-01

    The mitotic inhibitor securin is degraded via the ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C)-Cdc20 after anaphase onset. This triggers activation of the mitotic protease separase and thereby sister chromatid separation. However, only a proportion of securin molecules are degraded at metaphase-anaphase transition and the remaining molecules are still present in anaphase. The roles of securin and separase in late mitosis remain elusive. Here, we show that securin still inhibits separase to repress mitotic exit in anaphase in budding yeast. APC/C-Cdh1-mediated securin degradation at telophase further liberated separase, which promotes Cdc14 release and mitotic exit. Separase executed these events via its proteolytic action and that in the Cdc14 early release (FEAR) network. Cdc14 release further activated APC/C-Cdh1 in the manner of a positive feedback loop. Thus, the positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis. This study shows the importance of the two-step degradation mode of securin and the role of separase in mitotic exit. PMID:27418100

  3. Expression and promoter methylation status of hMLH1, MGMT, APC, and CDH1 genes in patients with colon adenocarcinoma.

    Science.gov (United States)

    Michailidi, Christina; Theocharis, Stamatios; Tsourouflis, Gerasimos; Pletsa, Vasiliki; Kouraklis, Gregorios; Patsouris, Efstratios; Papavassiliou, Athanasios G; Troungos, Constantinos

    2015-12-01

    Colorectal cancer (CRC) is the third most common cancer in men and the second in women worldwide. CRC development is the result of genetic and epigenetic alterations accumulation in the epithelial cells of colon mucosa. In the present study, DNA methylation, an epigenetic event, was evaluated in tumoral and matching normal epithelium in a cohort of 61 CRC patients. The results confirmed and expanded knowledge for the tumor suppressor genes hMLH1, MGMT, APC, and CDH1. Promoter methylation was observed for all the examined genes in different percentage. A total of 71% and 10% of the examined cases were found to be methylated in two or more and in all genes, respectively. mRNA and protein levels were also evaluated. Promoter methylation of hMLH1, MGMT, APC, and CDH1 genes was present at the early stages of tumor's formation and it could also be detected in the normal mucosa. Correlations of the methylated genes with patient's age and tumor's clinicopathological characteristics were also observed. Our findings suggest that DNA methylation is a useful marker for tumor progression monitoring and that promoter methylation in certain genes is associated with more advanced tumor stage, poor differentiation, and metastasis. PMID:25908636

  4. A conserved cyclin-binding domain determines functional interplay between anaphase-promoting complex-Cdh1 and cyclin A-Cdk2 during cell cycle progression

    DEFF Research Database (Denmark)

    Lukas, C; Kramer, E R; Peters, J M;

    2001-01-01

    how cyclin-CDKs interact with APC subunits remains unresolved. Here we substantiate the evidence that mammalian cyclin A-Cdk2 prevents unscheduled APC reactivation during S phase by demonstrating its periodic interaction with Cdh1 at the level of endogenous proteins. Moreover, we identified a...... conserved cyclin-binding motif within the Cdh1 WD-40 domain and show that its disruption abolished the Cdh1-cyclin A-Cdk2 interaction, eliminated Cdh1-associated histone H1 kinase activity, and impaired Cdh1 phosphorylation by cyclin A-Cdk2 in vitro and in vivo. Overexpression of cyclin binding......, these data provide a mechanistic explanation for the mutual functional interplay between cyclin A-Cdk2 and APC-Cdh1 and the first evidence that Cdh1 may activate the APC by binding specific substrates....

  5. Cdh1 regulates craniofacial development via APC-dependent ubiquitination and activation of Goosecoid.

    Science.gov (United States)

    Shao, Rui; Liu, Jia; Yan, Guang; Zhang, Jinfang; Han, Yujiao; Guo, Jianfeng; Xu, Zhan; Yuan, Zhu; Liu, Jiankang; Malumbres, Marcos; Wan, Lixin; Wei, Wenyi; Zou, Weiguo

    2016-06-01

    Craniofacial anomalies (CFAs) characterized by birth defects of skull and facial bones are the most frequent congenital disease. Genomic analysis has identified multiple genes responsible for CFAs; however, the underlying genetic mechanisms for the majority of CFAs remain largely unclear. Our previous study revealed that the Wwp2 E3 ubiquitin ligase facilitates craniofacial development in part through inducing monoubiquitination and activation of the paired-like homeobox transcription factor, Goosecoid (Gsc). Here we report that Gsc is also ubiquitinated and activated by the APC(Cdh1) E3 ubiquitin ligase, leading to transcriptional activation of various Gsc target genes crucial for craniofacial development. Consistenly, neural crest-specific Cdh1-knockout mice display similar bone malformation as Wwp2-deficient mice in the craniofacial region, characterized by a domed skull, a short snout and a twisted nasal bone. Mechanistically, like Wwp2-deficient mice, mice with Cdh1 deficiency in neural crest cells exhibit reduced Gsc/Sox6 transcriptional activities. Simultaneous deletion of Cdh1 and Wwp2 results in a more severe craniofacial defect compared with single gene deletion, suggesting a synergistic augmentation of Gsc activity by these two E3 ubiquitin ligases. Hence, our study reveals a novel role for Cdh1 in craniofacial development through promoting APC-dependent non-proteolytic ubiquitination and activation of Gsc. PMID:27126000

  6. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis

    DEFF Research Database (Denmark)

    Lukas, C; Kramer, E R; Peters, J M;

    2000-01-01

    Saccharomyces cerevisiae and Drosophila spp., triggers exit from mitosis and during G(1) prevents unscheduled DNA replication. In this study we investigated the importance of periodic oscillation of the APC-Cdh1 activity for the cell cycle progression in human cells. We show that conditional interference with...

  7. APC/C-Cdh1 coordinates neurogenesis and cortical size during development

    Science.gov (United States)

    Delgado-Esteban, Maria; García-Higuera, Irene; Maestre, Carolina; Moreno, Sergio; Almeida, Angeles

    2013-12-01

    The morphology of the adult brain is the result of a delicate balance between neural progenitor proliferation and the initiation of neurogenesis in the embryonic period. Here we assessed whether the anaphase-promoting complex/cyclosome (APC/C) cofactor, Cdh1—which regulates mitosis exit and G1-phase length in dividing cells—regulates neurogenesis in vivo. We use an embryo-restricted Cdh1 knockout mouse model and show that functional APC/C-Cdh1 ubiquitin ligase activity is required for both terminal differentiation of cortical neurons in vitro and neurogenesis in vivo. Further, genetic ablation of Cdh1 impairs the ability of APC/C to promote neurogenesis by delaying the exit of the progenitor cells from the cell cycle. This causes replicative stress and p53-mediated apoptotic death resulting in decreased number of cortical neurons and cortex size. These results demonstrate that APC/C-Cdh1 coordinates cortical neurogenesis and size, thus posing Cdh1 in the molecular pathogenesis of congenital neurodevelopmental disorders, such as microcephaly.

  8. APC/C-Cdh1-dependent anaphase and telophase progression during mitotic slippage

    Directory of Open Access Journals (Sweden)

    Toda Kazuhiro

    2012-02-01

    Full Text Available Abstract Background The spindle assembly checkpoint (SAC inhibits anaphase progression in the presence of insufficient kinetochore-microtubule attachments, but cells can eventually override mitotic arrest by a process known as mitotic slippage or adaptation. This is a problem for cancer chemotherapy using microtubule poisons. Results Here we describe mitotic slippage in yeast bub2Δ mutant cells that are defective in the repression of precocious telophase onset (mitotic exit. Precocious activation of anaphase promoting complex/cyclosome (APC/C-Cdh1 caused mitotic slippage in the presence of nocodazole, while the SAC was still active. APC/C-Cdh1, but not APC/C-Cdc20, triggered anaphase progression (securin degradation, separase-mediated cohesin cleavage, sister-chromatid separation and chromosome missegregation, in addition to telophase onset (mitotic exit, during mitotic slippage. This demonstrates that an inhibitory system not only of APC/C-Cdc20 but also of APC/C-Cdh1 is critical for accurate chromosome segregation in the presence of insufficient kinetochore-microtubule attachments. Conclusions The sequential activation of APC/C-Cdc20 to APC/C-Cdh1 during mitosis is central to accurate mitosis. Precocious activation of APC/C-Cdh1 in metaphase (pre-anaphase causes mitotic slippage in SAC-activated cells. For the prevention of mitotic slippage, concomitant inhibition of APC/C-Cdh1 may be effective for tumor therapy with mitotic spindle poisons in humans.

  9. The E3 Ligase APC/C-Cdh1 Is Required for Associative Fear Memory and Long-Term Potentiation in the Amygdala of Adult Mice

    Science.gov (United States)

    Pick, Joseph E.; Malumbres, Marcos; Klann, Eric

    2013-01-01

    The anaphase promoting complex/cyclosome (APC/C) is an E3 ligase regulated by Cdh1. Beyond its role in controlling cell cycle progression, APC/C-Cdh1 has been detected in neurons and plays a role in long-lasting synaptic plasticity and long-term memory. Herein, we further examined the role of Cdh1 in synaptic plasticity and memory by generating…

  10. CDH1 mutations in gastric cancer patients from northern Brazil identified by Next- Generation Sequencing (NGS).

    Science.gov (United States)

    El-Husny, Antonette; Raiol-Moraes, Milene; Amador, Marcos; Ribeiro-Dos-Santos, André M; Montagnini, André; Barbosa, Silvanira; Silva, Artur; Assumpção, Paulo; Ishak, Geraldo; Santos, Sidney; Pinto, Pablo; Cruz, Aline; Ribeiro-Dos-Santos, Ândrea

    2016-05-13

    Gastric cancer is considered to be the fifth highest incident tumor worldwide and the third leading cause of cancer deaths. Developing regions report a higher number of sporadic cases, but there are only a few local studies related to hereditary cases of gastric cancer in Brazil to confirm this fact. CDH1 germline mutations have been described both in familial and sporadic cases, but there is only one recent molecular description of individuals from Brazil. In this study we performed Next Generation Sequencing (NGS) to assess CDH1 germline mutations in individuals who match the clinical criteria for Hereditary Diffuse Gastric Cancer (HDGC), or who exhibit very early diagnosis of gastric cancer. Among five probands we detected CDH1 germline mutations in two cases (40%). The mutation c.1023T > G was found in a HDGC family and the mutation c.1849G > A, which is nearly exclusive to African populations, was found in an early-onset case of gastric adenocarcinoma. The mutations described highlight the existence of gastric cancer cases caused by CDH1 germline mutations in northern Brazil, although such information is frequently ignored due to the existence of a large number of environmental factors locally. Our report represent the first CDH1 mutations in HDGC described from Brazil by an NGS platform. PMID:27192129

  11. Parkin Regulates Mitosis and Genomic Stability through Cdc20/Cdh1

    NARCIS (Netherlands)

    Lee, S.B.; Kim, J.J.; Nam, H.J.; Gao, B.; Yin, P.; Qin, B.; Yi, S.Y.; Ham, H.; Evans, D.; Kim, S.H.; Zhang, Jun; Deng, M.; Liu, T.; Zhang, H.; Billadeau, D.D.; Wang, L.; Giaime, E.; Shen, J.; Pang, Y.P.; Jen, J.; Deursen, J.M.A. van; Lou, Z.

    2015-01-01

    Mutations in the E3 ubiquitin ligase Parkin have been linked to familial Parkinson's disease. Parkin has also been implicated in mitosis through mechanisms that are unclear. Here we show that Parkin interacts with anaphase promoting complex/cyclosome (APC/C) coactivators Cdc20 and Cdh1 to mediate th

  12. Loss of Cdh1 and Trp53 in the uterus induces chronic inflammation with modification of tumor microenvironment.

    Science.gov (United States)

    Stodden, G R; Lindberg, M E; King, M L; Paquet, M; MacLean, J A; Mann, J L; DeMayo, F J; Lydon, J P; Hayashi, K

    2015-05-01

    Type II endometrial carcinomas (ECs) are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. As TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1(d/d)Trp53(d/d)) clearly demonstrate architectural features characteristic of type II ECs, including focal areas of papillary differentiation, protruding cytoplasm into the lumen (hobnailing) and severe nuclear atypia at 6 months of age. Further, Cdh1(d/d)Trp53(d/d) tumors in 12-month-old mice were highly aggressive, and metastasized to nearby and distant organs within the peritoneal cavity, such as abdominal lymph nodes, mesentery and peri-intestinal adipose tissues, demonstrating that tumorigenesis in this model proceeds through the universally recognized morphological intermediates associated with type II endometrial neoplasia. We also observed abundant cell proliferation and complex angiogenesis in the uteri of Cdh1(d/d)Trp53(d/d) mice. Our microarray analysis found that most of the genes differentially regulated in the uteri of Cdh1(d/d)Trp53(d/d) mice were involved in inflammatory responses. CD163 and Arg1, markers for tumor-associated macrophages, were also detected and increased in the uteri of Cdh1(d/d)Trp53(d/d) mice, suggesting that an inflammatory tumor microenvironment with immune cell recruitment is augmenting tumor development in Cdh1(d/d)Trp53(d/d) uteri. Further, inflammatory mediators secreted from CDH1-negative, TP53 mutant endometrial cancer cells induced normal macrophages to express inflammatory-related genes through activation of nuclear factor-κB signaling. These results indicate that absence of CDH1 and TP53 in endometrial cells initiates chronic inflammation, promotes tumor microenvironment development following the recruitment of macrophages

  13. CDH1 germline mutation in hereditary gastric carcinoma

    Institute of Scientific and Technical Information of China (English)

    Hai-Dan Wang; Jun Ren; Lian Zhang

    2004-01-01

    This paper provides a bird's-eye view both in preclinical and clinical aspects of E-cadherin germline gene (CDH1)in gastric cancer patients and their families. E-cadherin,a product of CDH1 gene, belonging to the functionally related trans-membrane glycoprotein family, is responsible for the Ca2+-dependent cell-cell adhesion mechanism and contributes to dissociation followed by acquisition of cell motility, which usually occurs in the first step of cancer invasion and metastasis. CDH1 gene germline mutation is common in many types of carcinoma,and occurs very frequent in hereditary gastric carcinoma (HGC) patients and their families. Recently, more and more researches support that E-cadherin plays an important role in the differentiation, growth and invasion of HGC. So it is of great value to clarify its mechanisms both for understanding HGC pathogenesis and for clinical therapy, especially in China, where there are a high risk population of gastric cancer and a high HGC incidence rate. In this paper, recent researches on CDH1 gene mutation, especially its role in tumor genesis and progress of HGC, are reviewed, and advances in evaluation of its mutation status for HGC diagnosis, therapy and prognosis,are also discussed briefly.

  14. Cdh1-APC/C, cyclin B-Cdc2, and Alzheimer's disease pathology

    International Nuclear Information System (INIS)

    The anaphase-promoting complex/cyclosome (APC/C) is a key E3 ubiquitin ligase complex that functions in regulating cell cycle transitions in proliferating cells and has, as revealed recently, novel roles in postmitotic neurons. Regulated by its activator Cdh1 (or Hct1), whose level is high in postmitotic neurons, APC/C seems to have multiple functions at different cellular locations, modulating diverse processes such as synaptic development and axonal growth. These processes do not, however, appear to be directly connected to cell cycle regulation. It is now shown that Cdh1-APC/C activity may also have a basic role in suppressing cyclin B levels, thus preventing terminally differentiated neurons from aberrantly re-entering the cell cycle. The result of an aberrant cyclin B-induced S-phase entry, at least for some of these neurons, would be death via apoptosis. Cdh1 thus play an active role in maintaining the terminally differentiated, non-cycling state of postmitotic neurons-a function that could become impaired in Alzheimer's and other neurodegenerative diseases

  15. CDH1 germline mutations and hereditary lobular breast cancer.

    Science.gov (United States)

    Corso, Giovanni; Intra, Mattia; Trentin, Chiara; Veronesi, Paolo; Galimberti, Viviana

    2016-04-01

    Hereditary diffuse gastric cancer is an autosomal dominant inherited disease associated of CDH1 germline mutations (that encodes for the E-cadherin protein), and lobular breast cancer is the second most frequent type of neoplasia. Recently, novel E-cadherin constitutional alterations have been identified in pedigree clustering only for lobular breast carcinoma without evidence of diffuse gastric tumors and in absence of BRCA1/2 mutations. This first evidence opens novel questions about the inherited correlation between diffuse gastric and lobular breast cancers. In this brief review we revise the literature data about the CDH1 mutation frequency affecting exclusively lobular breast cancer, providing clinical recommendation for asymptomatic mutation carriers. PMID:26759166

  16. A Putative Homologue of CDC20/CDH1 in the Malaria Parasite Is Essential for Male Gamete Development

    OpenAIRE

    Guttery, David S; Ferguson, David J. P.; Benoit Poulin; Zhengyao Xu; Ursula Straschil; Onny Klop; Lev Solyakov; Sandrini, Sara M.; Declan Brady; Nieduszynski, Conrad A.; Chris J. Janse; Holder, Anthony A.; Tobin, Andrew B.; Rita Tewari

    2012-01-01

    Cell-cycle progression is governed by a series of essential regulatory proteins. Two major regulators are cell-division cycle protein 20 (CDC20) and its homologue, CDC20 homologue 1 (CDH1), which activate the anaphase-promoting complex/cyclosome (APC/C) in mitosis, and facilitate degradation of mitotic APC/C substrates. The malaria parasite, Plasmodium, is a haploid organism which, during its life-cycle undergoes two stages of mitosis; one associated with asexual multiplication and the other ...

  17. Control of genomic stability by APC/C-Cdh1 and therapeutic implications

    OpenAIRE

    Eguren Fernández, Manuel

    2013-01-01

    Tesis doctoral inédita, leída en Universidad Autónoma de Madrid, facultad de Ciencias, Departamento de Biología Molecular. Fecha de lectura: 11-11-2013 The E3-­‐ubiquitin ligase APC/C-­‐Cdh1 is essential for embryonic endoreduplication but its relevance in the mammalian mitotic cell cycle is still unclear. We show here that genetic ablation of Cdh1 in the developing nervous system results ...

  18. Identification and characterization of CDH1 germline variants in sporadic gastric cancer patients and in individuals at risk of gastric cancer.

    Directory of Open Access Journals (Sweden)

    Marica Garziera

    Full Text Available OBJECTIVE: To screen and characterize germline variants for E-cadherin (CDH1 in non-hereditary gastric cancer (GC patients and in subjects at risk of GC. METHODS: 59 GCs, 59 first degree relatives (FDRs of GC, 20 autoimmune metaplastic atrophic gastritis (AMAGs and 52 blood donors (BDs were analyzed for CDH1 by direct sequencing, structural modelling and bioinformatics. Functional impact on splicing was assessed for intronic mutations. E-cadherin/β-catenin immunohistochemical staining and E-cadherin mRNA quantification using RT-PCR were performed. RESULTS: In GCs, 4 missense variants (p.G274S; p.A298T; p.T470I; p.A592T, 1 mutation in the 5'UTR (-71C>G and 1 mutation in the intronic IVS12 (c.1937-13T>C region were found. First pathogenic effect of p.A298T mutation was predicted by protein 3D modelling. The novel p.G274S mutation showed a no clear functional significance. Moreover, first, intronic IVS12 (c.1937-13T>C mutation was demonstrated to lead to an aberrant CDH1 transcript with exon 11 deletion. This mutation was found in 2 GCs and in 1 BD. In FDRs, we identified 4 variants: the polymorphic (p.A592T and 3 mutations in untranslated regions with unidentified functional role except for the 5'UTR (-54G>C that had been found to decrease CDH1 transcription. In AMAGs, we detected 2 alterations: 1 missense (p.A592T and 1 novel variant (IVS1 (c.48+7C>T without effect on CDH1 splicing. Several silent and polymorphic substitutions were found in all the groups studied. CONCLUSIONS: Overall our study improves upon the current characterization of CDH1 mutations and their functional role in GC and in individuals at risk of GC. Mutations found in untranslated regions and data on splicing effects deserve a particular attention like associated with a reduced E-cadherin amount. The utility of CDH1 screening, in addition to the identification of other risk factors, could be useful for the early detection of GC in subjects at risk (i.e. FDRs and AMAGs, and

  19. ABCG2 Localizes to the Nucleus and Modulates CDH1 Expression in Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Shu-Ching Liang

    2015-03-01

    Full Text Available Breast cancer resistance protein [BCRP/ATP-binding cassette subfamily G member 2 (ABCG2] is a member of the ATP-binding cassette transporter family. The presence of ABCG2 on the plasma membrane in many kinds of human cancer cells contributes to multidrug resistance during chemotherapy, and it has been used as the side population marker for identifying cancer stem cells in lung cancers. We report here that, in addition to the membranous form, ABCG2 proteins are also found inside the nucleus, where they bind to the E-box of CDH1 (E-cadherin promoter and regulate transcription of this gene. Increased expression of ABCG2 causes an increase of E-cadherin and attenuates cell migration, whereas knockdown of ABCG2 downregulates E-cadherin and enhances cell motility. In mice, xenografted A549 cells that have less ABCG2 are more likely to metastasize from the subcutaneous inoculation site to the internal organs. However, for the cancer cells that have already entered the blood circulation, an increased level of ABCG2, and correspondingly increased E-cadherin, may facilitate circulating cancer cells to colonize at a distant site and form a metastatic tumor. We propose a novel role for nuclear ABCG2 that functions as a transcription regulator and participates in modulation of cancer metastasis.

  20. Down-regulation of CDH1 is associated with expression of SNAI1 in colorectal adenomas.

    Directory of Open Access Journals (Sweden)

    Feride Kroepil

    Full Text Available INTRODUCTION: Down-regulation of E-cadherin (CDH1 and epithelial-mesenchymal transition (EMT are considered critical events for invasion and metastasis of colorectal carcinoma. Here we tested whether the important regulators of E-cadherin expression SNAI1 and TWIST1 are already detectable in human colorectal adenomas. METHODS: RNA was extracted from a set of randomly selected formalin-fixed and paraffin-embedded (FFPE colorectal adenomas (n = 41 and normal colon mucosa (n = 10. Subsequently mRNA expression of CDH1, CDH2, SNAI1 and TWIST1 was analysed by quantitative RT-PCR analysis. CDH1 as well as SNAI1 protein expression were assessed by immunohistochemistry (IHC. RESULTS: SNAI1 mRNA was expressed in 78% (n = 32/41, TWIST1 mRNA in 41% (n = 17/41 and CDH2 mRNA in 41% (n = 17/41 of the colorectal adenoma tissue, while normal colon mucosa was negative for these transcription factors. We found a significant correlation between reduced CDH1 and the presence of SNAI1 mRNA expression and for combined SNAI1 and TWIST1 mRNA expression, respectively. A correlation between CDH2 mRNA expression and reduced CDH1 expression was not observed. We confirmed the relationship between SNAI1 expression and reduced E-cadherin expression on the protein level via IHC. CONCLUSION: Our data show that SNAI1 and Twist1 are already expressed in benign precursor lesions of colorectal cancer and that SNAI1 expression was significantly correlated with lower expression of CDH1. Whether these findings reflect true EMT and/or are a sign of a more aggressive biology need to be investigated in further studies.

  1. Hereditary diffuse gastric cancer: updated clinical guidelines with an emphasis on germline CDH1 mutation carriers

    NARCIS (Netherlands)

    Post, R.S. van der; Vogelaar, I.P.; Carneiro, F.; Guilford, P.; Huntsman, D.; Hoogerbrugge, N.; Caldas, C.; Schreiber, K.E.; Hardwick, R.H.; Ausems, M.G.; Bardram, L.; Benusiglio, P.R.; Bisseling, T.M.; Blair, V.; Bleiker, E.; Boussioutas, A.; Cats, A.; Coit, D.; DeGregorio, L.; Figueiredo, J.; Ford, J.M.; Heijkoop, E.; Hermens, R.; Humar, B.; Kaurah, P.; Keller, G.; Lai, J.; Ligtenberg, M.J.; O'Donovan, M.; Oliveira, C.; Pinheiro, H.; Ragunath, K.; Rasenberg, E.; Richardson, S.; Roviello, F.; Schackert, H.; Seruca, R.; Taylor, A.; Huurne, A. Ter; Tischkowitz, M.; Joe, S.T.; Dijck, B. van; Grieken, N.C. van; Hillegersberg, R. van; Sandick, J.W. van; Vehof, R.; Krieken, J.H.J.M. van; Fitzgerald, R.C.

    2015-01-01

    Germline CDH1 mutations confer a high lifetime risk of developing diffuse gastric (DGC) and lobular breast cancer (LBC). A multidisciplinary workshop was organised to discuss genetic testing, surgery, surveillance strategies, pathology reporting and the patient's perspective on multiple aspects, inc

  2. Hereditary diffuse gastric cancer : updated clinical guidelines with an emphasis on germline CDH1 mutation carriers

    NARCIS (Netherlands)

    van der Post, Rachel S.; Vogelaar, Ingrid P.; Carneiro, Fatima; Guilford, Parry; Huntsman, David; Hoogerbrugge, Nicoline; Caldas, Carlos; Schreiber, Karen E. Chelcun; Hardwick, Richard H.; Ausems, Margreet G. E. M.; Bardram, Linda; Benusiglio, Patrick R.; Bisseling, Tanya M.; Blair, Vanessa; Bleiker, Eveline; Boussioutas, Alex; Cats, Annemieke; Coit, Daniel; DeGregorio, Lynn; Figueiredo, Joana; Ford, James M.; Heijkoop, Esther; Hermens, Rosella; Humar, Bostjan; Kaurah, Pardeep; Keller, Gisella; Lai, Jennifer; Ligtenberg, Marjolijn J. L.; O'Donovan, Maria; Oliveira, Carla; Pinheiro, Hugo; Ragunath, Krish; Rasenberg, Esther; Richardson, Susan; Roviello, Franco; Schackert, Hans; Seruca, Raquel; Taylor, Amy; ter Huurne, Anouk; Tischkowitz, Marc; Joe, Sheena Tjon A.; van Dijck, Benjamin; van Grieken, Nicole C. T.; van Hillegersberg, Richard; van Sandick, Johanna W.; Vehof, Rianne; van Krieken, J. Han; Fitzgerald, Rebecca C.

    2015-01-01

    Germline CDH1 mutations confer a high lifetime risk of developing diffuse gastric (DGC) and lobular breast cancer (LBC). A multidisciplinary workshop was organised to discuss genetic testing, surgery, surveillance strategies, pathology reporting and the patient's perspective on multiple aspects, inc

  3. Clinicopathological significance and potential drug target of CDH1 in breast cancer: a meta-analysis and literature review

    Directory of Open Access Journals (Sweden)

    Huang R

    2015-09-01

    Full Text Available Ruixue Huang,* Ping Ding,* Fei Yang*Department of Occupational and Environmental Health, School of Public Health, Central South University, Changsha, Hunan, People’s Republic of China*All authors contributed equally to this workAbstract: CDH1, as a tumor suppressor gene, contributes sporadic breast cancer (BC progression. However, the association between CDH1 hypermethylation and BC, and its clinicopathological significance remains unclear. We conducted a meta-analysis to investigate the relationship between the CDH1 methylation profile and the major clinicopathological features. A detailed literature was searched through the electronic databases PubMed, Web of Science™, and EMBASE™ for related research publications. The data were extracted and assessed by two reviewers independently. Odds ratios (ORs with corresponding confidence intervals (CIs were calculated and summarized respectively. The frequency of CDH1 methylation was significantly higher in invasive ductal carcinoma than in normal breast tissues (OR =5.83, 95% CI 3.76–9.03, P<0.00001. CDH1 hypermethylation was significantly higher in estrogen receptor (ER-negative BC than in ER-positive BC (OR =0.62, 95% CI 0.43–0.87, P=0.007. In addition, we found that the CDH1 was significantly methylated in HER2-negative BC than in HER2-positive BC (OR =0.26, 95% CI 0.15–0.44, P<0.00001. However, CDH1 methylation frequency was not associated with progesterone receptor (PR status, or with grades, stages, or lymph node metastasis of BC patients. Our results indicate that CDH1 hypermethylation is a potential novel drug target for developing personalized therapy. CDH1 hypermethylation is strongly associated with ER-negative and HER2-negative BC, respectively, suggesting CDH1 methylation status could contribute to the development of novel therapeutic approaches for the treatment of ER-negative or HER2-negative BC with aggressive tumor biology.Keywords: methylation, estrogen receptor, HER2

  4. A novel mutation in the CDH1 gene in a Spanish family with hereditary diffuse gastric cancer.

    Science.gov (United States)

    López, María; Cervera-Acedo, Cristina; Santibáñez, Paula; Salazar, Raquel; Sola, Jesús-Javier; Domínguez-Garrido, Elena

    2016-01-01

    Hereditary diffuse gastric cancer (HDGC) is an inherited form of diffuse type gastric cancer. Germline CDH1 mutations have been identified in approximately 15-50 % of affected kindred that meet the clinical criteria for HDGC. If any of the criteria is met the individual is referred to genetic counseling and CDH1 testing is offered. In this report we present the case of a Spanish family with HDGC harboring a novel CDH1 mutation. A 47 year-old female with a diagnostic of gastric adenocarcinoma and some of her relatives were tested. Study of the entire CDH1 gene, including intron-exon boundaries, by PCR and sequencing and immunohistochemical determination of the expression of E-cadherin were performed. A novel heterozygous deletion in exon 9 of CDH1 gene (c.1220_1220delC, p.P407Qfs10), was found in the proband, one sister and a nephew. It generates a premature stop codon giving rise to a truncated protein that leads to a pathogenic variant. Expression of E-cadherin was absent or frankly reduced in the proband's tumor but normal in tumor cells of great-uncle. After these results, the sister underwent prophylactic total gastrectomy, and the nephew is under annual endoscopic surveillance. Personal or familial history of diffuse gastric cancer, above all at young age, should encourage CDH1 genetic testing. In this sense, the review of the criteria and the addition in the last guideline of the recommendation: "other families in which genetic testing may also be considered" broadens the number of individuals at risk detected. Since there are not reliable methods for early detection, DGC is usually diagnosed at an advanced stage and consequently associated with a poorer outcome. Thus, CDH1 mutations detection contributes to an improvement in diagnosis and therapeutic intervention. PMID:27512640

  5. Regional Product Promotion via ICT

    OpenAIRE

    Dvořák, Jan

    2012-01-01

    Bachelor thesis Regional Product Promotion via ICT deals with the ways of internet marketing and promotion of regional foods on the Internet. The aim of this study is to evaluate and select appropriate information channel and compare the websites of products from the experimental sites dealing with the same product. In the theoretical part of the thesis deals with the definition of terms, such as regional food, the labeling methodology for regional food, internet marketing, advertising on th...

  6. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    . Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to...... include ideas of mobility as a narrative in community transport policy which further that through Community pricing policies, the conditions for mobility is enhanced in a Community perspective. However, when this is connected to infrastructure pricing, the effect is largest at a regional scale. Further...

  7. Sport Tourism: Regional Promotion Strategies

    OpenAIRE

    Pereira, Nuno; Ribeiro, J. Cadima; Viseu, José

    2004-01-01

    The main purposes of this paper are (i) to analyze the regional promotion strategies of the UEFA Euro 2004 and (ii) to contribute for the improvement of planning and implementation strategies of tourism marketing at regional level. Data regarding these strategies were collected and synthesized. We verified if these strategies match some of the theoretical issues of promotion and tourism marketing. Despite the fact that already many studies have been made, internationally, on the impact of ...

  8. Rab7 Regulates CDH1 Endocytosis, Circular Dorsal Ruffles Genesis, and Thyroglobulin Internalization in a Thyroid Cell Line.

    Science.gov (United States)

    Mascia, Anna; Gentile, Flaviana; Izzo, Antonella; Mollo, Nunzia; De Luca, Maria; Bucci, Cecilia; Nitsch, Lucio; Calì, Gaetano

    2016-08-01

    Rab7 regulates the biogenesis of late endosomes, lysosomes, and autophagosomes. It has been proposed that a functional and physical interaction exists between Rab7 and Rac1 GTPases in CDH1 endocytosis and ruffled border formation. In FRT cells over-expressing Rab7, increased expression and activity of Rac1 was observed, whereas a reduction of Rab7 expression by RNAi resulted in reduced Rac1 activity, as measured by PAK1 phosphorylation. We found that CDH1 endocytosis was extremely reduced only in Rab7 over-expressing cells but was unchanged in Rab7 silenced cells. In Rab7 under or over-expressing cells, Rab7 and LC3B-II co-localized and co-localization in large circular structures occurred only in Rab7 over-expressing cells. These large circular structures occurred in about 10% of the cell population; some of them (61%) showed co-localization of Rab7 with cortactin and f-actin and were identified as circular dorsal ruffles (CDRs), the others as mature autophagosomes. We propose that the over-expression of Rab7 is sufficient to induce CDRs. Furthermore, in FRT cells, we found that the expression of the insoluble/active form of Rab7, rather than Rab5, or Rab8, was inducible by cAMP and that cAMP-stimulated FRT cells showed increased PAK1 phosphorylation and were no longer able to endocytose CDH1. Finally, we demonstrated that Rab7 over-expressing cells are able to endocytose exogenous thyroglobulin via pinocytosis/CDRs more efficiently than control cells. We propose that the major thyroglobulin endocytosis described in thyroid autonomous adenomas due to Rab7 increased expression, occurs via CDRs. J. Cell. Physiol. 231: 1695-1708, 2016. © 2015 Wiley Periodicals, Inc. PMID:26599499

  9. Frequency of CDH1 germline mutations in gastric carcinoma coming from high- and low-risk areas: metanalysis and systematic review of the literature

    International Nuclear Information System (INIS)

    The frequency of E-cadherin germline mutations in countries with different incidence rates for gastric carcinoma has not been well established. The goal of this study was to assess the worldwide frequency of CDH1 germline mutations in gastric cancers coming from low- and high-risk areas. English articles using MEDLINE access (from 1998 to 2011). Search terms included CDH1, E-cadherin, germline mutation, gastric cancer, hereditary, familial and diffuse histotype. The study included all E-cadherin germline mutations identified in gastric cancer patients; somatic mutations and germline mutations reported in other tumors were excluded. The method of this study was scheduled in accordance with the 'PRISMA statement for reporting systematic reviews and meta-analyses'. Countries were classified as low- or middle/high risk-areas for gastric carcinoma incidence. Statistical analysis was performed to correlate the CDH1 mutation frequency with gastric cancer incidence areas. A total of 122 E-cadherin germline mutations have been identified; the majority (87.5%) occurred in gastric cancers coming from low-risk areas. In high-risk areas, we identified 16 mutations in which missense mutations were predominant. (68.8%). We verified a significant association between the mutation frequency and the gastric cancer risk area (p < 0.001: overall identified mutations in low- vs. middle/high-risk areas). E-cadherin genetic screenings performed in low-risk areas for gastric cancer identified a higher frequency of CDH1 germline mutations. This data could open new approaches in the gastric cancer prevention test; before proposing a proband candidate for the CDH1 genetic screening, geographic variability, alongside the family history should be considered

  10. TGF-β activates APC through Cdh1 binding for Cks1 and Skp2 proteasomal destruction stabilizing p27kip1 for normal endometrial growth.

    Science.gov (United States)

    Pavlides, Savvas C; Lecanda, Jon; Daubriac, Julien; Pandya, Unnati M; Gama, Patricia; Blank, Stephanie; Mittal, Khushbakhat; Shukla, Pratibha; Gold, Leslie I

    2016-04-01

    We previously reported that aberrant TGF-β/Smad2/3 signaling in endometrial cancer (ECA) leads to continuous ubiquitylation of p27(kip1)(p27) by the E3 ligase SCF-Skp2/Cks1 causing its degradation, as a putative mechanism involved in the pathogenesis of this cancer. In contrast, normal intact TGF-β signaling prevents degradation of nuclear p27 by SCF-Skp2/Cks1 thereby accumulating p27 to block Cdk2 for growth arrest. Here we show that in ECA cell lines and normal primary endometrial epithelial cells, TGF-β increases Cdh1 and its binding to APC/C to form the E3 ligase complex that ubiquitylates Cks1 and Skp2 prompting their proteasomal degradation and thus, leaving p27 intact. Knocking-down Cdh1 in ECA cell lines increased Skp2/Cks1 E3 ligase activity, completely diminished nuclear and cytoplasmic p27, and obviated TGF-β-mediated inhibition of proliferation. Protein synthesis was not required for TGF-β-induced increase in nuclear p27 and decrease in Cks1 and Skp2. Moreover, half-lives of Cks1 and Skp2 were extended in the Cdh1-depleted cells. These results suggest that the levels of p27, Skp2 and Cks1 are strongly or solely regulated by proteasomal degradation. Finally, an inverse relationship of low p27 and high Cks1 in the nucleus was shown in patients in normal proliferative endometrium and grade I-III ECAs whereas differentiated secretory endometrium showed the reverse. These studies implicate Cdh1 as the master regulator of TGF-β-induced preservation of p27 tumor suppressor activity. Thus, Cdh1 is a potential therapeutic target for ECA and other human cancers showing an inverse relationship between Cks1/Skp2 and p27 and/or dysregulated TGF-β signaling. PMID:26963853

  11. E2F-dependent accumulation of hEmi1 regulates S phase entry by inhibiting APC(Cdh1)

    DEFF Research Database (Denmark)

    Hsu, Jerry Y; Reimann, Julie D R; Sørensen, Claus S;

    2002-01-01

    G1-S transition, hEmi1 is transcriptionally induced by the E2F transcription factor, much like cyclin A. hEmi1 overexpression accelerates S phase entry and can override a G1 block caused by overexpression of Cdh1 or the E2F-inhibitor p105 retinoblastoma protein (pRb). Depleting cells of hEmi1...

  12. Engineering of core promoter regions enables the construction of constitutive and inducible promoters in Halomonas sp.

    Science.gov (United States)

    Li, Tingting; Li, Teng; Ji, Weiyue; Wang, Qiuyue; Zhang, Haoqian; Chen, Guo-Qiang; Lou, Chunbo; Ouyang, Qi

    2016-02-01

    Halomonas strain TD01, a newly identified halophilic bacterium, has proven to be a promising low-cost host for the production of chemicals. However, genetic manipulation in Halomonas sp. is still difficult due to the lack of well-characterized and tunable expression systems. In this study, a systematic, efficient method was exploited to construct both a constitutive promoter library and inducible promoters. Porin, a highly expressed protein in Halomonas TD01, was first identified from the Halomonas TD01 proteome. Subsequent study of the intergenic region upstream of porin led to the identification of a core promoter region, including -10 and -35 elements. By randomizing the sequence between the -35 and -10 elements, a constitutive promoter library was obtained with 310-fold variation in transcriptional activity; an inducible promoter with a >200-fold induction was built by integrating a lac operator into the core promoter region. As two complementary expression systems, the constitutive and inducible promoters were then employed to regulate the biosynthetic pathway of poly-3-hydroxybutyrate (PHB) in Halomonas TD01, demonstrating the usefulness of the expression systems, furthermore, they could be applied in future metabolic engineering of Halomonas TD strains, and the systematic method used in this study can be generalized to other less-characterized bacterial strains. PMID:26332342

  13. SNP@Promoter: a database of human SNPs (Single Nucleotide Polymorphisms) within the putative promoter regions

    OpenAIRE

    Chung Won-Hyong; Park Daeui; Kim Woo-Yeon; Kim Byoung-Chul; Shin Kwang-sik; Bhak Jong

    2008-01-01

    Abstract Background Analysis of single nucleotide polymorphism (SNP) is becoming a key research in genomics fields. Many functional analyses of SNPs have been carried out for coding regions and splicing sites that can alter proteins and mRNA splicing. However, SNPs in non-coding regulatory regions can also influence important biological regulation. Presently, there are few databases for SNPs in non-coding regulatory regions. Description We identified 488,452 human SNPs in the putative promote...

  14. Promoting regional countryside tourism in the Sound region (Denmark/Sweden)

    OpenAIRE

    Haaland, Christine; Peterson, Anna

    2013-01-01

    Öreferie is an Interreg project on sustainable tourism in the Sound region, which comprises parts of Zealand (Denmark) and the most Southern part of Sweden, Scania. While parts of the region are densely populated including both Copenhagen and Malmö, other parts are very rural. Here large areas of unspoiled landscapes exist including seaside, woodland and agricultural areas, which are often very little exploited for tourism. The objective of the project is to promote and initiate tourism regar...

  15. Detección del estado de metilación de los genes dapk, cdh13, cdh1 y rassf1 en ADN de plasma de pacientes con cáncer de cuello uterino

    Directory of Open Access Journals (Sweden)

    Aristizábal Fabio

    2005-07-01

    Full Text Available El estudio de las características epigenéticas en ADN proveniente de plasma de pacientes con cáncer de cuello uterino (CCU tiene un futuro promisorio;  se han encontrado previamente genes supresores de tumor (GST metilados, correlacionados con estadios avanzados del CCU, siendo
    posibles indicadores de peor pronóstico y marcadores moleculares de respuesta a tratamiento. Sin embargo, no existe ningún estudio para Colombia, en el que se haya buscado detectar estados de metilación para ADN de plasma en ningún tipo de cáncer. En este trabajo se reporta el estudio
    de 23 pacientes colombianas con estadios avanzados (III y IV de CCU (Banco de Muestras del Instituto Nacional de Cancerología, a los cuales les fue detectado el estado de mutilación (conversión por bisulfito de sodio posterior MSP de los GST dapk, cdh13, cdh1 y rassf1, en ADN de plasma,
    y se comparó contra el estado de metilación en ADN de plasma, arrojando los siguientes porcentajes de pacientes que presentaron el mismo estado de metilación (presente/ausente rassf1, 44%; cdh13, 33%; cdh1, 44%; dapk, 78%; para un total de los cuatro genes en conjunto de 47%. Adicionalmente, se detectó la presencia en el 100% de las muestras de tumor de HPV tipo 16. Se demostró igualdad entre las poblaciones de tumor y plasma para el panel de los cuatro genes (p=0,635, Test de McNemar a=0,05, en particular para el estadio III (p=0,85. El gen dapk presentó un estado de metilación positivo para plasma del 68,4% y para tumor del 94% en estadios avanzados. De esta manera, se consiguió la detección de los estados de metilación en ADN de plasma y se encontró correlación estadística con los encontrados en ADN tumoral, en particular para el estadio III. Este trabajo constituye un aporte importante para el uso de características epigenéticas de ADN de plasma, como marcadores moleculares de progresión, respuesta a tratamiento, y suprevivencia, en pacientes colombianas con CCU.

  16. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González

    2010-12-01

    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  17. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    OpenAIRE

    Enrique Yamil Alul González

    2010-01-01

    The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters) in prioritized...

  18. Mutations in the P1 promoter region of Micromonospora echinospora.

    OpenAIRE

    Lin, L S; Rothstein, D. M.

    1992-01-01

    We demonstrated previously that the promoters P1a, P1b, and P1c are very closely spaced and are coordinately turned on during stationary phase in Micromonospora echinospora. To determine the nucleotides important for promoter recognition, we characterized mutations that were defective in transcription from the P1b start site, using Streptomyces lividans as the host. Two mutations upstream of the start site resulted in a drastic loss of promoter activity, while two mutations downstream of the ...

  19. Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability

    Indian Academy of Sciences (India)

    Vetriselvi Rangannan; Manju Bansal

    2007-08-01

    Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the difference in stability between neighboring upstream and downstream regions in the vicinity of experimentally determined transcription start sites, a promoter prediction algorithm has been developed to identify prokaryotic promoter sequences in whole genomes. The average free energy (E) over known promoter sequences and the difference (D) between E and the average free energy over the entire genome (G) are used to search for promoters in the genomic sequences. Using these cutoff values to predict promoter regions across entire Escherichia coli genome, we achieved a reliability of 70% when the predicted promoters were cross verified against the 960 transcription start sites (TSSs) listed in the Ecocyc database. Annotation of the whole E. coli genome for promoter region could be carried out with 49% accuracy. The method is quite general and it can be used to annotate the promoter regions of other prokaryotic genomes.

  20. Governmental promotion of the Information Society in the Spanish Region of Valencia

    OpenAIRE

    Emilio Feliu-García, Ph.D.; Natalia Papí-Gálvez, Ph.D.

    2011-01-01

    Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society. The methodology employed in t...

  1. Ningxia Hui Autonomous Region Utilizes Standardization to Promote Economic Development

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ In China, 10 ethnic minorities with a combined population of over 20 million people are followers of Islam. In Ningxia Hui Autonomous Region, the population is nearly 6 million, among which the Islamic population is about 2 million.

  2. Regional initiatives to promote economic development in north East Asia

    OpenAIRE

    Nijkamp, P.; Wiegmans, B.W.

    1996-01-01

    This paper addresses the economic development potential of the Asian Pacific Rim, with a particular view on north East Asia. It is argued that growth triangles are likely to be a proper way of organizing regional development forces. Next, the attention is focused on the Tumen River Area Development Programme as a potentially interesting region for joint transnational development initiatives. The opportunities and threats of this area are explored by means of scenario analysis. It is conc1uded...

  3. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  4. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter

    2007-01-01

    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland. The...... profile of the programme changed from focusing on localised change targeting the producers of ICT in the region, to be initiated as a radical change project focusing on the users. In addition to the more historical accounts for DDN the actual implementation will also be analysed. The analyses of...

  5. Promoter regions of Plasmodium vivax are poorly or not recognized by Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    del Portillo Hernando A

    2007-02-01

    Full Text Available Abstract Background Heterologous promoter analysis in Plasmodium has revealed the existence of conserved cis regulatory elements as promoters from different species can drive expression of reporter genes in heterologous transfection assays. Here, the functional characterization of different Plasmodium vivax promoters in Plasmodium falciparum using luciferase as the reporter gene is presented. Methods Luciferase reporter plasmids harboring the upstream regions of the msp1, dhfr, and vir3 genes as well as the full-length intergenic regions of the vir23/24 and ef-1α genes of P. vivax were constructed and transiently transfected in P. falciparum. Results Only the constructs with the full-length intergenic regions of the vir23/24 and ef-1α genes were recognized by the P. falciparum transcription machinery albeit to values approximately two orders of magnitude lower than those reported by luc plasmids harbouring promoter regions from P. falciparum and Plasmodium berghei. A bioinformatics approach allowed the identification of a motif (GCATAT in the ef-1α intergenic region that is conserved in five Plasmodium species but is degenerate (GCANAN in P. vivax. Mutations of this motif in the P. berghei ef-1α promoter region decreased reporter expression indicating it is active in gene expression in Plasmodium. Conclusion Together, this data indicates that promoter regions of P. vivax are poorly or not recognized by the P. falciparum transcription machinery suggesting the existence of P. vivax-specific transcription regulatory elements.

  6. Scale Development of Individual and Organisation Infrastructure for Heart Health Promotion in Regional Health Authorities

    Science.gov (United States)

    Plotnikoff, Ronald C.; Anderson, Donna; Raine, Kim; Cook, Kay; Barrett, Linda; Prodaniuk, Tricia R.

    2005-01-01

    Objective: The purpose of this study was to validate measures of individual and organisational infrastructure for health promotion within Alberta's (Canada) 17 Regional Health Authorities (RHAs). Design: A series of phases were conducted to develop individual and organisational scales to measure health promotion infrastructure. Instruments were…

  7. Open Source Introducing Policy and Promotion of Regional Industries in Japan

    OpenAIRE

    Noda, Tetsuo; Tansho, Terutaka

    2010-01-01

    The development style of open source has a possibility to create new business markets for Regional IT industries. Some local governments are trying to promote their regional IT industries by adopting an open source in their electronic government systems. In this paper, we analyze the data of open source application policy of the Japanese government and case studies of promotion policy of local industries by local governments; for example, Nagasaki Prefecture and Matsue City. And it aims to ex...

  8. A mitogen-responsive promoter region that is synergistically activated through multiple signalling pathways.

    OpenAIRE

    Ouyang, Q.; Bommakanti, M; Miskimins, W K

    1993-01-01

    A regulatory region of the human transferrin receptor gene promoter was found to be required for increased expression in response to serum or growth factors. This region contains two elements that appear to cooperate for full responsiveness. We found that sodium orthovanadate treatment of cells significantly activated expression of promoter constructs containing these elements. 12-O-Tetradecanoylphorbol-13-acetate alone induced a twofold increase in expression but acted synergistically with v...

  9. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva

    2016-01-01

    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  10. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    Directory of Open Access Journals (Sweden)

    Oliveira Jorge

    2007-07-01

    Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.

  11. Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors

    International Nuclear Information System (INIS)

    Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses

  12. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh

    2010-05-28

    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  13. Definition of the human N-myc promoter region during development in a transgenic mouse model.

    Science.gov (United States)

    Tai, K F; Rogers, S W; Pont-Kingdon, G; Carroll, W L

    1999-09-01

    The N-myc oncogene directs organogenesis, and gene amplification is associated with aggressive forms of neuroblastoma, a common malignant tumor in children. N-myc is expressed in fetal epithelium, and expression decreases markedly postnatally. To localize sequences responsible for directing expression, we have analyzed the human N-myc promoter. We noted previously that N-myc promoter regions 5' to exon 1 directed reporter gene expression in all cell lines, including those without detectable N-myc transcripts. However, when promoter constructs included 3' exon 1 and the 5' portion of intron 1, reporter activity was detected only when there was expression of the endogenous gene. To determine the role of this "tissue-specific region" in directing expression during development, we generated transgenic mice carrying N-myc promoter lacZ minigenes that contained 5' N-myc promoter elements alone or the promoter linked to the 3' exon 1/5' intron 1 tissue-specific region. Animals lacking the tissue-specific exon 1/intron 1 region showed beta-galactosidase expression in the CNS, but expression was not observed in other organs in which endogenously derived N-myc transcripts were seen. Within the CNS, transgene expression was seen mainly in the olfactory system and was not observed in other areas in which expression of the murine gene has been noted. In contrast, no transgene expression was observed in any of the animals carrying the tissue-specific exon 1/intron 1 region. Thus, sequences that direct expression within the olfactory system were contained within our 5' promoter transgene, whereas sequences that guide the ubiquitous expression of N-myc during organogenesis lie outside the regions studied here. Finally, the exon 1/intron 1 region seems to act in a dominant fashion to repress expression in the CNS from the immediate 5' N-myc promoter. PMID:10473038

  14. Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.

    Science.gov (United States)

    Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui

    2014-05-01

    Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene. PMID:24464129

  15. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)

    2000-12-01

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  16. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  17. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    International Nuclear Information System (INIS)

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter

  18. Cloning and characterizing of the murine IRF-3 gene promoter region.

    Science.gov (United States)

    Xu, Hua-Guo; Liu, Lifei; Gao, Shan; Jin, Rui; Ren, Wei; Zhou, Guo-Ping

    2016-08-01

    The interferon regulatory factor 3 (IRF-3) plays essential roles in inflammation and immune response. Here, we cloned the nucleotide sequence of the 5'-flanking region of the murine IRF-3 gene (mIRF-3) and characterized the molecular mechanisms controlling the mIRF-3 transcriptional activity in NIH3T3 cells. Analyses of a series of 5' deletion constructs demonstrated that a 301 bp region (-255/+46) of the mIRF-3 gene is sufficient for full promoter activity. This region contains IK1, Egr2, Cmyb, E2F1 and YY1 putative transcription factor binding sites. Mutation of Egr2 or YY1 site led to 52-68 % decrease of the mIRF-3 promoter activity, and double Egr2 and YY1 mutation reduced the promoter activity to 20 % of the wild-type promoter activity. Furthermore, knockingdown of endogenous Egr2 or YY1 by a siRNA strategy markedly inhibited the mIRF-3 promoter activity. Chromatin immunoprecipitation assays showed that Egr2 and YY1 interact with the mIRF-3 promoter in vivo. These results suggested that the basal promoter activity of the mIRF-3 gene is regulated by transcription factors Egr2 and YY1 in NIH3T3 cells. PMID:26740329

  19. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    OpenAIRE

    Bekier-Jaworska Ewa; Bochenek Marcin

    2015-01-01

    Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and meth...

  20. Global hypomethylation and promoter methylation in small intestinal neuroendocrine tumors

    OpenAIRE

    Fotouhi, Omid; Adel Fahmideh, Maral; Kjellman, Magnus; Sulaiman, Luqman; Höög, Anders; Zedenius, Jan; Hashemi, Jamileh; Larsson, Catharina

    2014-01-01

    Aberrant DNA methylation is a feature of human cancer affecting gene expression and tumor phenotype. Here, we quantified promoter methylation of candidate genes and global methylation in 44 small intestinal-neuroendocrine tumors (SI-NETs) from 33 patients by pyrosequencing. Findings were compared with gene expression, patient outcome and known tumor copy number alterations. Promoter methylation was observed for WIF1, RASSF1A, CTNNB1, CXCL14, NKX2–3, P16, LAMA1, and CDH1. By contrast APC, CDH3...

  1. Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.

    Science.gov (United States)

    Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon

    2009-01-01

    Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene. PMID:19853675

  2. Promotion

    OpenAIRE

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed.

  3. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)

    Vassilis MONASTIRIOTIS

    2010-12-01

    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  4. Analysis of promoter regions of co-expressed genes identified by microarray analysis

    Directory of Open Access Journals (Sweden)

    Höglund Mattias

    2006-08-01

    Full Text Available Abstract Background The use of global gene expression profiling to identify sets of genes with similar expression patterns is rapidly becoming a widespread approach for understanding biological processes. A logical and systematic approach to study co-expressed genes is to analyze their promoter sequences to identify transcription factors that may be involved in establishing specific profiles and that may be experimentally investigated. Results We introduce promoter clustering i.e. grouping of promoters with respect to their high scoring motif content, and show that this approach greatly enhances the identification of common and significant transcription factor binding sites (TFBS in co-expressed genes. We apply this method to two different dataset, one consisting of micro array data from 108 leukemias (AMLs and a second from a time series experiment, and show that biologically relevant promoter patterns may be obtained using phylogenetic foot-printing methodology. In addition, we also found that 15% of the analyzed promoter regions contained transcription factors start sites for additional genes transcribed in the opposite direction. Conclusion Promoter clustering based on global promoter features greatly improve the identification of shared TFBS in co-expressed genes. We believe that the outlined approach may be a useful first step to identify transcription factors that contribute to specific features of gene expression profiles.

  5. Impact of Different Promoters on Episomal Vectors Harbouring Characteristic Motifs of Matrix Attachment Regions.

    Science.gov (United States)

    Wang, Xiao-Yin; Zhang, Jun-He; Zhang, Xi; Sun, Qiu-Li; Zhao, Chun-Peng; Wang, Tian-Yun

    2016-01-01

    We previously demonstrated that the characteristic sequence of matrix attachment regions (MARs) allows transgenes to be maintained episomally in CHO cells. In the present study, six commonly used promoters from human cytomegalovirus major immediate-early (CMV), simian vacuolating virus 40 (SV40), Rous sarcoma virus, Homo sapiens ubiquitin C, phosphoglycerate kinase, and β-globin, respectively, were evaluated to determine their effects on transgene expression and stability in CHO cells stably transfected via the episomal vector harbouring characteristic MAR motifs. The CHO cells were transfected with vectors and then screened using G418, after which the stably transfected cells were split into two and further cultured either in the presence or absence of G418. Of the six promoters, the CMV promoter yielded the highest transgene expression levels and the highest transfection efficiency, whereas the SV40 promoter maintained transgene expression more stably during long-term culture than the other promoters did. The CMV and SV40 promoter-containing vectors were furthermore episomally maintained and conferred sustained eGFP expression in the cells even under nonselective conditions. On the basis of these findings, we conclude that the CMV promoter performs best in terms of yielding both high expression levels and high levels of stability using this episomal vector system. PMID:27226236

  6. Australia's role in promoting and supporting tuberculosis control in the Western Pacific Region.

    Science.gov (United States)

    Shaw, Kerrie A

    2013-07-01

    Twenty-one percent of the world's tuberculosis cases are found in the Western Pacific Region. The region has demonstrated a lower rate of decline in incidence than the regions of Africa, the Americas and Europe. Issues around drug resistance, human immunodeficiency virus and diabetes impact on the burden of tuberculosis disease in the Western Pacific Region. Australia has exhibited a low and relatively stable tuberculosis incidence rate but has not progressed toward the desired international goal for tuberculosis elimination (disease control are amplified by globalisation and Australia's increasing economic and strategic engagement within the Western Pacific Region and South-East Asia. Promoting and supporting tuberculosis control within the Western Pacific Region provides an opportunity for Australia to maintain its low tuberculosis incidence rate and progress toward elimination. PMID:23849030

  7. Promoters and processing sites within the transforming region of bovine papillomavirus type 1.

    Science.gov (United States)

    Ahola, H; Stenlund, A; Moreno-López, J; Pettersson, U

    1987-07-01

    The mRNAs present in bovine papillomavirus type 1 (BPV-1)-transformed C127 cells were studied by primer extension. The results show that two internal promoters are present in the E region of BPV-1 in addition to the previously identified promoter at coordinate 1 (H. Ahola, A. Stenlund, J. Moreno-López, and U. Pettersson, Nucleic Acids Res. 11:2639-2650, 1983). One, located at coordinate 31, generated a set of mRNAs with heterogeneous 5' ends, which may encode the major transforming protein of BPV-1, the E5 protein. The second promoter, which is located at coordinate 39, generates colinear mRNAs which encode either the E4 protein or a truncated form of the E2 protein. Unlike the cottontail rabbit papillomavirus (O. Danos, E. Georges, G. Orth, and M. Yaniv, J. Virol. 53:735-741, 1985), BPV-1 appears to lack a separate promoter for expression of the E7 protein. The major splice sites in the transforming region (E region) of the BPV-1 genome were also identified by nucleotide sequence analysis. PMID:2884331

  8. Mapping Collaborative Methods and Tools for Promoting Urban Transitions in the Öresund Region

    OpenAIRE

    Hellström-Reimer, M.; Nilsson, E.; McCormick, Kes; Larsen, M.

    2012-01-01

    This report is produced within the Urban Transition Øresund (UT) project (2011–2014), and it is part of the subtask Collaborative Methods and Tools for Urban Transitions (UT CoMeT). The goal of the UT project is to promote sustainable growth and advance sustainable urban transformation in the Øresund region by gathering municipalities, universities and businesses in cross-border cooperation. The subtask UT CoMeT has a special focus on tools and methods for working that allow and promote great...

  9. Genome-wide function of H2B ubiquitylation in promoter and genic regions

    OpenAIRE

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B.; Pugh, B. Franklin

    2011-01-01

    The contribution of transcription-linked histone modifications on genome-wide nucleosomal organization is not clear. Batta et al. investigate the function of H2BK123 ubiquitylation in the yeast genome by analyzing high-resolution MNase ChIP-seq mapping of nucleosome positions in histone point mutants. The study suggests that H2BK123ub promotes nucleosome assembly across the genome, which at promoter regions causes inhibition of pol II assembly and activates elongation of pol II in the body of...

  10. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.

    2013-02-19

    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  11. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa

    2015-03-01

    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  12. Quantitative global and gene-specific promoter methylation in relation to biological properties of neuroblastomas

    Directory of Open Access Journals (Sweden)

    Kiss Nimrod B

    2012-09-01

    Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.

  13. Genome-wide function of H2B ubiquitylation in promoter and genic regions.

    Science.gov (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin

    2011-11-01

    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating). PMID:22056671

  14. E-cadherin gene C-160A promoter polymorphism and risk of non-cardia gastric cancer in a Chinese population

    Institute of Scientific and Technical Information of China (English)

    Yan Lu; Yao-Chu Xu; Jing Shen; Rong-Bin Yu; Ju-Yin Niu; Jian-Tao Guo; Xu Hu; Hong-Bing Shen

    2005-01-01

    AIM: To test the hypothesis that E-cadherin gene (CDH1)C-160A promoter variant genotype is associated with an increased risk for developing gastric cancer.METHODS: In this population-based case-control study of gastric cancer in Jiangsu Province, China, we performed polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to genotype the C-160A polymorphism of CDH1 promoter in 206 non-cardia gastriccancer patients and 261 age- and sex-matched but unrelated cancer-free controls.RESULTS: The frequencies of genotypes CC, CA and AA were 57.8%, 36.4% and 5.8% in gasfric cancer cases,respectively, and 58.2%, 34.9% and 6.9% in controls respectively. The distributions of CDH1 genotypes were not significantly different between gastric cancer cases and controls (P = 0.87 for genotype frequency and P = 0.92for allele frequency). Compared with the CC genotype, the CA and AA genotypes were not associated with an increased risk for non-cardia gastric cancer (adjusted odds ratios (OR)= 1.15, and 95% confidence interval (95% CI) = 0.78-1.72for CA genotype, and OR = 0.90 and 95% CI = 0.42-2.01for AA genotype).CONCLUSION: E-cadherin gene C-160A promoter polymorphism may not play a major role in the etiology of non-cardia gastric cancer in Chinese population.

  15. Polymorphisms of the ELANE Gene Promoter Region in End-Stage Chronic Kidney Disease Patients

    Science.gov (United States)

    Fernandes, Rafael; Freitas, Bruno; Miranda, Vasco; Costa, Elísio; Santos-Silva, Alice; Bronze-da-Rocha, Elsa

    2016-01-01

    End-stage renal disease (ESRD) patients have a high mortality rate that exceeds that of non-ESRD population. The hemodialysis procedure induces neutrophil activation and elastase release, which might have a role in the inflammatory process and in the development of oxidative stress. The ELANE gene encodes the neutrophil elastase. We analyzed the effect of ELANE promoter region polymorphisms and its relation with the circulating levels of elastase, as well as several clinical, biochemical and inflammatory markers in 123 ESRD patients. We found two duplications in heterozygosity in the promoter region and a new polymorphism, the c.-801G>A. ESRD patients heterozygous for the c.-903T>G polymorphism had no changes in the circulating levels of elastase or other evaluated variables, and those homozygous for the c.-741G>A polymorphism showed significant effects on neutrophils count, as well as in neutrophils/lymphocytes ratio, which might be associated with an increased inflammatory process. PMID:27136588

  16. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Predicts Resting Respiratory Sinus Arrhythmia

    OpenAIRE

    Ellis, Alissa; Beevers, Christopher; Hixon, J. Gregory; McGeary, John E.

    2010-01-01

    Respiratory sinus arrhythmia (RSA) is often conceptualized as an index of physiological flexibility that has been related to emotion regulatory capacity. Although behavioral genetics research indicates that RSA is partly heritable, relatively few molecular genetics studies have been conducted. We examined whether the serotonin transporter promoter region (5-HTTLPR) polymorphism was associated with resting RSA among healthy young adults (N = 71). Short 5-HTTLPR allele carriers had significantl...

  17. Association of polymorphisms in the promoter region of turkey prolactin with egg performance

    Directory of Open Access Journals (Sweden)

    Fathi Mehrangiz

    2014-01-01

    Full Text Available The induction and regulation of broodiness is of the most important role of prolactin in avian species. In this study, the association between prolactin promoter region alleles and reproductive traits in Fars native turkey was investigated. These traits consisted of mean egg weight (MEW, number of egg (EN and egg mass, during the first laying period. In total, 115 laying turkeys, randomly selected from the flock of the Breeding Center for Fars Native turkey, and DNA was purificated from blood samples, 231 bp of prolactin promoter region was amplified and Genotype of Samples was determinate by PCR-SSCP technique were genotyped. Two alleles D and I were identified. Based on the results obtained, the frequency of D and I alleles were 0.67 and 0.33, respectively. Frequencies of DD, II and ID genotypes were 0.385, 0.044 and 0.571, respectively. The association analysis between the polymorphism PRL gene promoter region and egg performance was carried out. Significant relationship was found between genotypes with egg production (P<0.01. Individuals with II genotype produced higher egg production than DD and ID genotype. The results of current study showed that using information of genes related to egg production could be used to improve the performance of native turkey of East Azerbaijan province.

  18. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.

    2011-01-01

    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  19. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Loots, G; Ovcharenko, I

    2006-08-08

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at http://ECRbase.dcode.org.

  20. CAREST--Multilingual Regional Integration for Health Promotion and Research on Sickle Cell Disease and Thalassemia.

    Science.gov (United States)

    Knight-Madden, Jennifer; Romana, Marc; Villaescusa, Rinaldo; Reid, Marvin; Etienne-Julan, Maryse; Boutin, Laurence; Elana, Gisèle; Elenga, Narcisse; Wheeler, Gillian; Lee, Ketty; Nieves, Rosa; Jones Lecointe, Althea; Lalanne-Mistrih, Marie-Laure; Loko, Gylna; Keclard-Christophe, Lisiane; Hardy-Dessources, Marie-Dominique

    2016-05-01

    Sickle cell disease (SCD) is a significant problem in the Caribbean, where many individuals have African and Asian forebears. However, reliable prevalence data and specific health care programs for SCD are often missing in this region. Closer collaboration between Caribbean territories initiated in 2006 to set up strategies to promote better equity in the health care system for SCD patients led to the formation of CAREST: the Caribbean Network of Researchers on Sickle Cell Disease and Thalassemia. We present the effectiveness of collaborations established by CAREST to promote SCD newborn screening programs and early childhood care, to facilitate health worker training and approaches for prevention and treatment of SCD complications, and to carry out inter-Caribbean research studies. PMID:26999505

  1. Study on the Polymorphisms of Porcine Myostatin Gene in Promoter Region by PCR-RFLPS

    Institute of Scientific and Technical Information of China (English)

    YANG Xiu-qin; LIU Di

    2005-01-01

    In order to further study functions of the porcine myostatin gene, we analyzed the polymorphisms of porcine myostatin gene in promoter region among different breeds including Yorkshire, Landrace, Duroc, Junmu, Min pig and Sanjiang white pig by PCR-RFLPs. The allele T dominated in the imported lean-type pig breeds such as Yorkshire, Landrace and Duroc. No allele A was detected in Junmu and Sanjiang white pig, and the frequencies of three genotypes were about equal in Min pig. The result using X2 analysis showed that the distribution of three genotypes was related to pig breeds.

  2. Mapping the chromosome 16 cadherin gene cluster to a minimal deleted region in ductal breast cancer.

    Science.gov (United States)

    Chalmers, I J; Aubele, M; Hartmann, E; Braungart, E; Werner, M; Höfler, H; Atkinson, M J

    2001-04-01

    The cadherin family of cell adhesion molecules has been implicated in tumor metastasis and progression. Eight family members have been mapped to the long arm of chromosome 16. Using radiation hybrid mapping, we have located six of these genes within a cluster at 16q21-q22.1. In invasive lobular carcinoma of the breast frequent LOH and accompanying mutation affect the CDH1 gene, which is a member of this chromosome 16 gene cluster. CDH1 LOH also occurs in invasive ductal carcinoma, but in the absence of gene mutation. The proximity of other cadherin genes to 16q22.1 suggests that they may be affected by LOH in invasive ductal carcinomas. Using the mapping data, microsatellite markers were selected which span regions of chromosome 16 containing the cadherin genes. In breast cancer tissues, a high rate of allelic loss was found over the gene cluster region, with CDH1 being the most frequently lost marker. In invasive ductal carcinoma a minimal deleted region was identified within part of the chromosome 16 cadherin gene cluster. This provides strong evidence for the existence of a second 16q22 suppressor gene locus within the cadherin cluster. PMID:11343777

  3. Statistically Significant Strings are Related to Regulatory Elements in the Promoter Regions of Saccharomyces cerevisiae

    CERN Document Server

    Hu, R; Hu, Rui; Wang, Bin

    2000-01-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae(yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene family of yeast. The method successfully extracts the binding sites varified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are a ctive in both directions, while others show directional preference.

  4. Defining NELF-E RNA binding in HIV-1 and promoter-proximal pause regions.

    Directory of Open Access Journals (Sweden)

    John M Pagano

    2014-01-01

    Full Text Available The four-subunit Negative Elongation Factor (NELF is a major regulator of RNA Polymerase II (Pol II pausing. The subunit NELF-E contains a conserved RNA Recognition Motif (RRM and is proposed to facilitate Poll II pausing through its association with nascent transcribed RNA. However, conflicting ideas have emerged for the function of its RNA binding activity. Here, we use in vitro selection strategies and quantitative biochemistry to identify and characterize the consensus NELF-E binding element (NBE that is required for sequence specific RNA recognition (NBE: CUGAGGA(U for Drosophila. An NBE-like element is present within the loop region of the transactivation-response element (TAR of HIV-1 RNA, a known regulatory target of human NELF-E. The NBE is required for high affinity binding, as opposed to the lower stem of TAR, as previously claimed. We also identify a non-conserved region within the RRM that contributes to the RNA recognition of Drosophila NELF-E. To understand the broader functional relevance of NBEs, we analyzed promoter-proximal regions genome-wide in Drosophila and show that the NBE is enriched +20 to +30 nucleotides downstream of the transcription start site. Consistent with the role of NELF in pausing, we observe a significant increase in NBEs among paused genes compared to non-paused genes. In addition to these observations, SELEX with nuclear run-on RNA enrich for NBE-like sequences. Together, these results describe the RNA binding behavior of NELF-E and supports a biological role for NELF-E in promoter-proximal pausing of both HIV-1 and cellular genes.

  5. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    OpenAIRE

    James Dollman; Melissa Hull; Nicole Lewis; Suzanne Carroll; Dorota Zarnowiecki

    2016-01-01

    Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant pr...

  6. Induction of apolipoprotein E expression by TR4 orphan nuclear receptor via 5' proximal promoter region

    International Nuclear Information System (INIS)

    While other plasma lipoproteins are exclusively expressed in liver and intestine, apoliprotein E (apoE) is ubiquitously synthesized in many tissues. To understand the molecular mechanism of non-tissue-specific apoE expression, we tested the testicular orphan receptor 4 (TR4) effect on apoE expression in different cell lines, such as HepG2, COS-1, and H1299 cells. Gel shift assay and 5' promoter activity analyses identified one distinct hormone response element (TR4RE-DR0-apoE at -303 to -292 bp) that binds to TR4 and results in full induction of apoE gene transcription. TR4 also forms a complex with Sp1 to synergistically induce apoE expression via a region containing the TR4RE-DR0-apoE and the Sp1 binding site (-169 to -140 bp). Induction of apoE expression by TR4 was also confirmed at the mRNA and protein levels in H1299 cells. Together, our data demonstrate that TR4 can enhance apoE gene expression via binding to TR4RE-DR0 in apoE 5' promoter and this TR4 binding is essential for synergistic interaction with another transcription factor, Sp1

  7. Genotype and allele frequencies of heme oxygenase-1 promoter region in a Greek cohort

    Institute of Scientific and Technical Information of China (English)

    Eleni P. Katana; Lemonia G. Skoura; Zacharias G Scouras; Michail A. Daniilidis

    2011-01-01

    Background Heme oxygenase-1 (HO-1) is an enzyme,which catabolizes heme into carbon monoxide,biliverdin and free iron.The induction of this enzyme is an important cytoprotective mechanism,which occurs as an adaptive and beneficial response to a wide variety of oxidant stimuli.HO-1 inducibility is mainly modulated by a (GT)n polymorphism in the promoter region,and has been shown that short (S) repeats are associated with greater up-regulation of HO-1,compared with long (L) repeats.Methods In the present study,250 healthy Greek individuals have been screened in order to estimate the frequencies of (GT)n alleles in the HO-1 gene.Results Nineteen different alleles,ranging from 17 to 39 repeats,with (GT)23 and (GT)30 being the most common ones,were identified.Conclusion The possible role of this polymorphism in disease states is discussed.

  8. Hypomethylation within gene promoter regions and type 1 diabetes in discordant monozygotic twins.

    Science.gov (United States)

    Elboudwarej, Emon; Cole, Michael; Briggs, Farren B S; Fouts, Alexandra; Fain, Pamela R; Quach, Hong; Quach, Diana; Sinclair, Elizabeth; Criswell, Lindsey A; Lane, Julie A; Steck, Andrea K; Barcellos, Lisa F; Noble, Janelle A

    2016-04-01

    Genetic susceptibility to type 1 diabetes (T1D) is well supported by epidemiologic evidence; however, disease risk cannot be entirely explained by established genetic variants identified so far. This study addresses the question of whether epigenetic modification of the inherited DNA sequence may contribute to T1D susceptibility. Using the Infinium HumanMethylation450 BeadChip array (450k), a total of seven long-term disease-discordant monozygotic (MZ) twin pairs and five pairs of HLA-identical, disease-discordant non-twin siblings (NTS) were examined for associations between DNA methylation (DNAm) and T1D. Strong evidence for global hypomethylation of CpG sites within promoter regions in MZ twins with TID compared to twins without T1D was observed. DNA methylation data were then grouped into three categories of CpG sites for further analysis, including those within: 1) the major histocompatibility complex (MHC) region, 2) non-MHC genes with reported T1D association through genome wide association studies (GWAS), and 3) the epigenome, or remainder of sites that did not include MHC and T1D associated genes. Initial results showed modest methylation differences between discordant MZ twins for the MHC region and T1D-associated CpG sites, BACH2, INS-IGF2, and CLEC16A (DNAm difference range: 2.2%-5.0%). In the epigenome CpG set, the greatest methylation differences were observed in MAGI2, FANCC, and PCDHB16, (DNAm difference range: 6.9%-16.1%). These findings were not observed in the HLA-identical NTS pairs. Targeted pyrosequencing of five candidate CpG loci identified using the 450k array in the original discordant MZ twins produced similar results using control DNA samples, indicating strong agreement between the two DNA methylation profiling platforms. However, findings for the top five candidate CpG loci were not replicated in six additional T1D-discordant MZ twin pairs. Our results indicate global DNA hypomethylation within gene promoter regions may contribute to T

  9. Promoter region sequence differences in the A and G gamma globin genes of Brazilian sickle cell anemia patients

    Directory of Open Access Journals (Sweden)

    C.G. Barbosa

    2010-08-01

    Full Text Available Fetal hemoglobin (HbF, encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their βS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104 and an Afro-descendant one (N = 98, to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C→T in the HBG1 promoter region were associated with the Central African Republic βS-globin haplotype. In contrast, the -369 C→G and 309 A→G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

  10. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio

    2006-03-01

    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  11. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis

    2014-04-01

    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  12. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  13. Prognostic prediction of glioblastoma by quantitative assessment of the methylation status of the entire MGMT promoter region

    OpenAIRE

    Kanemoto, Manabu; Shirahata, Mitsuaki; Nakauma, Akiyo; Nakanishi, Katsumi; TANIGUCHI, Kazuya; Kukita, Yoji; Arakawa, Yoshiki; Miyamoto, Susumu; Kato, Kikuya

    2014-01-01

    Background O6-methylguanine-DNA methyltransferase (MGMT) promoter methylation is reported to be a prognostic and predictive factor of alkylating chemotherapy for glioblastoma patients. Methylation specific PCR (MSP) has been most commonly used when the methylation status of MGMT is assessed. However, technical obstacles have hampered the implementation of MSP-based diagnostic tests. We quantitatively analyzed the methylation status of the entire MGMT promoter region and applied this informati...

  14. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    OpenAIRE

    Cocco, Eleonora; Meloni, Alessandra; Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, ...

  15. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product

    Science.gov (United States)

    Fanguin, Pauline

    2014-05-01

    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) (www.interreg-francesuisse.org). Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  16. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M

    2004-10-01

    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  17. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan

    2011-12-01

    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  18. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman

    2016-01-01

    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  19. Construction of a promoter probe vector autonomously maintained in Aspergillus and characterization of promoter regions derived from A. niger and A. oryzae genomes.

    Science.gov (United States)

    Ozeki, K; Kanda, A; Hamachi, M; Nunokawa, Y

    1996-03-01

    We used a plasmid carrying a sequence for autonomous maintenance in Aspergillus (AMA1) and the E. coli uidA gene as a reporter gene to search the A. oryzae and A. niger genomes for DNA fragments having strong promoter activity. Beta-glucuronidase (GUS)-producing A. oryzae transformants containing the No. 8AN derived from A. niger, or the No. 9AO derived from A. oryzae, were constitutive for the expression of the uidA gene when cultivated in the presence of a variety of carbon and nitrogen sources. When the GUS-producing transformants were grown in liquid culture, the No. 8AN showed an increase of approximately 3-fold in GUS activity compared to the amyB (alpha-amylase encoding gene) promoter. There was also a corresponding increase in the amount of GUS gene-specific mRNA. When these transformants were grown as rice-koji, the No. 8AN showed an increase of approximately 6-fold compared to the amyB promoter, and the amount of GUS protein produced also increased. These strong promoter regions might be applicable to the production of other heterologous proteins in Aspergillus species. PMID:8901095

  20. AFRIMETS working together with AFRA and the IAEA promoting quality dosimetry and sustainability in the region

    International Nuclear Information System (INIS)

    the New Partnership for Africa's Development (NEPAD) in July 2007 where the Memorandum of Understanding was finalised and subsequently signed by representatives from bodies representing their official metrology institutes from 38 African countries. The second and third General assemblies were held in 2008 and 2009. The third GA was preceded by the working group meetings including the working group for ionising radiation. The main goal of AFRIMETS is to harmonise accurate measurements in Africa, establish new measurement facilities and gain international acceptance for all measurements. It is also envisaged that AFRIMETS will promote Africa's metrology interests and its effective participation in international standard-setting bodies. AFRIMETS replaced SADCMET as a Regional Metrology Organisations (RMO) representing Africa at the JCRB. One of the tasks of the JCRB is to coordinate the activities among the RMO's in establishing confidence for the recognition of calibration and measurement capabilities (CMC), according to the terms of the CIPM MRA. National Metrology Institutes outside Africa, designated institutes in Africa, and other institutes in Africa responsible for accurate measurement can become associate members. Other organisations can have observer member status. Most ionising radiation laboratories in the region were set up with the help of the IAEA and are not within national metrology institutes. Some are members of the IAEA/WHO Secondary Standard Dosimetry Laboratory (SSDL) network and some countries are members of the African Regional Cooperative Agreement (AFRA). AFRA is an intergovernmental agreement established in 1990 by the IAEA and African Member States to further strengthen and enlarge the contribution of nuclear science and technology to socioeconomic development on the African continent. The IAEA is not party to AFRA, but provides technical and scientific backstopping as well as financial and administrative support, in accordance with the rules

  1. Expression pattern and core region analysis of AtMPK3 promoter in response to environmental stresses

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The protein kinase AtMPK3,a component of the MAP kinase cascade,plays an important role in stress signal transduction in plant cells. To clarify how AtMPK3 is regulated at the transcriptional level in response to various environmental factors, the 1016-bp promoter sequence upstream of the transcription start site of the AtMPK3 gene was isolated. Analyses of the promoter sequence using plant promoter databases revealed that the AtMPK3 promoter contains many potential cis-acting elements involved in environmental stress responses. We constructed four deletion mutants of the AtMPK3 promoter, and introduced the intact and truncated promoter sequences fused to the β-glucuronidase (GUS) gene into Arabidopsis. GUS histochemical staining and quantitative fluorometric GUS assays were performed to visualize and compare the expression patterns in response to different environmental stimuli. The region between-188 and-62 upstream of the transcription start site was identified as the essential DNA sequence of the AtMPK3 promoter for responses to drought, high salinity, low temperature, and wounding. These results advance our understanding of the molecular mechanisms controlling AtMPK3 expression in response to different environmental stimuli.

  2. TdaA Regulates Tropodithietic Acid Synthesis by Binding to the tdaC Promoter Region ▿ †

    OpenAIRE

    Geng, Haifeng; Belas, Robert

    2011-01-01

    Silicibacter sp. TM1040, a member of the marine Roseobacter clade, produces the antibiotic and quorum signaling molecule tropodithietic acid (TDA), encoded by tdaABCDEF. Here, we showed that an LysR-type transcriptional regulator, TdaA, is a positive regulator of tdaCDE gene expression and binds to the tdaC promoter region.

  3. 7 CFR 1150.153 - Qualified State or regional dairy product promotion, research or nutrition education programs.

    Science.gov (United States)

    2010-01-01

    ..., research or nutrition education programs. 1150.153 Section 1150.153 Agriculture Regulations of the... § 1150.153 Qualified State or regional dairy product promotion, research or nutrition education programs... nutrition education program may apply to the Secretary for certification of qualification so that...

  4. Relationship between Expression of the Human Alpha-Fetoprotein Gene and DNA Methylation Status of the Promoter Region

    Institute of Scientific and Technical Information of China (English)

    Lijun Chen; Wei Wang; Qiuyue Jin; Ruimin Wang; Wenliang Hu

    2006-01-01

    OBJECTIVE DNA methylation has been regarded as an important epigenetic signature reflecting the transcription state of DNA in cells. This study was to conducted to assess the relationship between human alpha-fetoprotein (AFP) gene expression and the DNA methylation status of the promoter region in three different cells, namely two human hepatocellular carcinoma (HCC) cell lines and normal human fibroblasts.METHODS Transcription of the AFP gene was verified by RT-PCR. After bisulphate treatment of DNA, the methods of MSP and BSP were used to analyze the methylation density and status within single DNA strands of two closely spaced CpG dinucleotides of the promoter region in the different cells.RESULTS RT-PCR analysis indicated that the expression of the AFP gene in HepG2 cells was significantly higher than in SMMC-7721 cells,and that the AFP gene was not expressed in normal human fibroblasts.By MSP and BSP we observed that the promoter region was demethylated in the AFP-high-expressing cell lines, and that the sites of -2,494 bp and -2,431 bp in the AFP genomic sequence can be used as detection sites for early tumorous diagnosis.CONCLUSION These results indicate that the DNA methylation state of the promoter region has a negative correlation with AFP gene expression.

  5. Identification and genetic effect of a variable duplication in the promoter region of the cattle ADIPOQ gene

    Science.gov (United States)

    The ADIPOQ gene of cattle, is located in the vicinity of the quantitative trait locus (QTL) wich effects marbling, the rib eye muscle area and fat thickness on BTA1. In our study, a novel variable duplication (NW_003103812.1:g.9232067_9232133 dup) in the bovine ADIPOQ promoter region was identified ...

  6. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    Science.gov (United States)

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  7. Interleukin 10.G microsatellite in the promoter region of the interleukin-10 gene in severe sepsis

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background The highly polymorphic interleukin 10.G (IL10.G) microsatellite located in the promoter region of the interleukin-10 (IL-10) gene exerts a positive transcriptional regulatory effect on IL-10 gene expression and correlates with the in vitro IL-10 secretion. This study was conducted to investigate whether IL10.G microsatellite is associated with the incidence and /or the outcome of severe sepsis.Methods One hundred and fifteen patients with severe sepsis who had been treated at the intensive care unit of the university hospital were studied. One hundred and forty-one healthy individuals served as controls. IL10.G microsatellite genotyping was performed with the following two methods: fluorescent based polymerase chain reaction (PCR) techniques and silver staining of the amplified DNA fragment in polyacrylamide gel. Alleles were defined according to the size of the amplified DNA product.Results Ten alleles and 36 genotypes were detected both in the patients with severe sepsis and in the healthy controls. Allele IL10.G9 and allele IL10.G13 were the commonest alleles with the frequencies of 32.6% and 21.3% respectively in the patients with severe sepsis, and 34% and 27% respectively in the healthy controls. The allele frequencies of IL10.G microsatellite were neither different between the patients with severe sepsis and the healthy controls (P > 0.05), nor between survivors and non-survivors (P > 0.05). However, the frequency of one common allele IL10.G13 was slightly lower in the patients with severe sepsis than in the healthy controls (21.3% vs 27%, P > 0.05), and the frequency of allele IL10.G9 was slightly higher in the non-survivors than in the survivors (37.1% vs 28.1%, P > 0.05).Conclusion IL10.G microsatellite may neither contribute to the susceptibility to severe sepsis nor to the fatal outcome of severe sepsis.

  8. Promoting Climate Literacy through Collaborative Temperature Investigations at Local, Regional, and Global Scales

    Science.gov (United States)

    Geary, E. E.; Charlevoix, D.; Hoffman, M.

    2009-12-01

    One of the fundamental challenges in promoting student and citizen climate literacy is developing awareness and understanding of the time and spatial scales on which climate changes occur. Students and citizens living in polar regions are now able to observe changes in sea ice extent, permafrost depth, and local ecosystems that have occurred in their lifetimes. In other parts of the world, environmental changes related to climate tend to be more subtle making it more challenging for students and citizens to recognize how changes in climate are affecting their communities. The GLOBE program, an international science and education program operating in 110 countries, implements field-based research and education programs that directly involve students and citizens in observations of their local environment as well as online collaboration using Web 2.0 communication tools to share and discuss how their research findings compare to other environments around the world. In fall 2009, secondary students from several GLOBE schools from around the world will use the GLOBE Minimum-Maximum Temperature protocol to determine daily and monthly average mean air temperatures. Students will collect data in a manner identical to that used by scientists who contributed to the International Panel on Climate Change reports. Students will then use historic weather and climate data from nearby global weather stations to create baseline weather and climate profiles for their communities. Students will use FieldScope, an online GIS tool created by the National Geographic Society to compare their data to temperature trends in their regions for the past 30 to 50 years. Students will share the results of their local temperature investigations with other participating schools via a live Webinar and through asynchronous Web-based conversations held in conjunction with the annual meeting of the Group on Earth Observations. Students participating in this “Great Global Investigation of

  9. The brand of regional products as a tool to promote rural development (on the basis of opolskie voivodeship

    Directory of Open Access Journals (Sweden)

    Sabina Kauf

    2010-01-01

    Full Text Available In recent years a growing interest in regional products could be observed. Products which names point to the place of their origin are bought willingly. Regional products are frequently rediscovered, often found by accident to be finally found with a great efforts in the shops. The specific qualities of the regional products, and especially those of traditional food products, decide about their originality and authenticity. It also proves the fact that they are bought more willingly than mass products. The research on the behaviour of the consumers on the regional products market in Opole area shows that these products are bought willingly. They also create a chance to show and promote the region they are from.

  10. Analysis of nascent RNA identifies a unified architecture of initiation regions at mammalian promoters and enhancers.

    Science.gov (United States)

    Core, Leighton J; Martins, André L; Danko, Charles G; Waters, Colin T; Siepel, Adam; Lis, John T

    2014-12-01

    Despite the conventional distinction between them, promoters and enhancers share many features in mammals, including divergent transcription and similar modes of transcription factor binding. Here we examine the architecture of transcription initiation through comprehensive mapping of transcription start sites (TSSs) in human lymphoblastoid B cell (GM12878) and chronic myelogenous leukemic (K562) ENCODE Tier 1 cell lines. Using a nuclear run-on protocol called GRO-cap, which captures TSSs for both stable and unstable transcripts, we conduct detailed comparisons of thousands of promoters and enhancers in human cells. These analyses identify a common architecture of initiation, including tightly spaced (110 bp apart) divergent initiation, similar frequencies of core promoter sequence elements, highly positioned flanking nucleosomes and two modes of transcription factor binding. Post-initiation transcript stability provides a more fundamental distinction between promoters and enhancers than patterns of histone modification and association of transcription factors or co-activators. These results support a unified model of transcription initiation at promoters and enhancers. PMID:25383968

  11. Analysis of the CCR3 promoter reveals a regulatory region in exon 1 that binds GATA-1

    Directory of Open Access Journals (Sweden)

    Koch Laura E

    2005-04-01

    Full Text Available Abstract Background CC Chemokine Receptor 3 (CCR3, the major chemokine receptor expressed on eosinophils, binds promiscuously to several ligands including eotaxins 1, 2, and 3. Even though the only cells that consistently accumulate following eotaxin administration in vivo are myeloid cells (primarily eosinophils, other cell types have recently been shown to express CCR3. It is therefore important to elucidate the molecular mechanisms regulating receptor expression. Results In order to define regions responsible for CCR3 transcription, a DNAse hypersensitive site was identified in the vicinity of exon 1. Coupled with our previous data implicating exon 1 in CCR3 transcription, we hypothesized that transcription factors bind to exon-1. Electrophoretic mobility shift analysis revealed that nuclear proteins in eosinophilic cells bound to exon 1. Furthermore, antibody interference and mutation studies demonstrated GATA-1 binding to exon 1. In order to test the 1.6-kb CCR3 promoter element (that includes exon 1 for in vivo function, this region was used to generate transgenic mice that expressed a reporter protein. Strong transgene expression was achieved, with the pattern of expression suggesting a broad acting promoter. Conclusion The transcription factor GATA-1 binds to CCR3 exon 1. The 1.6-kb CCR3 promoter element, that includes exon 1, is a strong promoter in vivo.

  12. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  13. Molecular Analysis of Promoter and Intergenic Region Attenuator of the Vibrio vulnificus prx1ahpF Operon.

    Science.gov (United States)

    Lee, Hyun Sung; Lim, Jong Gyu; Han, Kook; Lee, Younghoon; Choi, Sang Ho

    2015-08-01

    Prx1, an AhpF-dependent 2-Cys peroxiredoxin (Prx), was previously identified in Vibrio vulnificus, a facultative aerobic pathogen. In the present study, transcription of the V. vulnificus prx1ahpF genes, which are adjacently located on the chromosome, was evaluated by analyzing the promoter and intergenic region of the two genes. Northern blot analyses revealed that transcription of prx1ahpF results in two transcripts, the prx1 and prx1ahpF transcripts. Primer extension analysis and a point mutational analysis of the promoter region showed that the two transcripts are generated from a single promoter. In addition, the 3' end of the prx1 transcript at the prx1ahpF intergenic region was determined by a 3'RACE assay. These results suggested that the prx1ahpF genes are transcribed as an operon, and the prx1 transcript was produced by transcriptional termination in the intergenic region. RNA secondary structure prediction of the prx1ahpF intergenic region singled out a stem-loop structure without poly(U) tract, and a deletion analysis of the intergenic region showed that the atypical stem-loop structure acts as the transcriptional attenuator to result in the prx1 and prx1ahpF transcripts. The combined results demonstrate that the differential expression of prx1 and ahpF is accomplished by the cis-acting transcriptional attenuator located between the two genes and thereby leads to the production of a high level of Prx1 and a low level of AhpF. PMID:25824432

  14. Expressing activity of promoter elements of large intergenic region from cotton leaf curl virus in host plant*

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Cotton leaf curl virus (CLCuV) is a type of single-stranded DNAvirus, belonging to geminivirus of subgroup III. In order to determine the function of CLCuV large intergenic region (LIR), total DNA of CLCuV-infected cotton leaves was used as template, and fragment of LIR was obtained by PCR and inserted into clone vector. The fragment of LIR was fused with gus reporter gene and nos terminator in the orientation of transcription of virion sense and complementary sense respectively, and the plant expression vectors were constructed. GUS activity of Agrobacterium-mediated transgenic tobacco was measured. The result indicated that LIR showed strong promoter activity in complementary sense gene orientation. Average GUS activity of the complementary sense promoter was 5-6 times that of CaMV 35S promoter, and the highest GUS activity of individual plant was ten times of that of CaMV 35S promoter. Histochemical localization confirmed its activity in both mesophyll and vascular tissues. Activity of virion sense of LIR was rather low. Thus LIR isolated from CLCuV could be used as a novel strong promoter in plant genetic manipulation.

  15. A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter

    OpenAIRE

    Orfanoudakis Georges; Boulade-Ladame Charlotte; Mailly Laurent; Deryckere François

    2008-01-01

    Abstract The construction of expression vectors derived from the human adenovirus type 5 (Ad5), usually based on homologous recombination, is time consuming as a shuttle plasmid has to be selected before recombination with the viral genome. Here, we describe a method allowing direct cloning of a transgene in the E3 region of the Ad5 genome already containing the immediate early CMV promoter upstream of three unique restriction sites. This allowed the construction of recombinant adenoviral gen...

  16. Cultural Chameleons and Teamwork Terminators − Promoting Intercultural Management in the Baltic Sea Region PIM 2009 as Intercultural Teamwork

    OpenAIRE

    Kirjavainen, Sanna

    2009-01-01

    This bachelor’s thesis discusses intercultural teamwork in the intensive programme Promoting Intercultural Management in the Baltic Sea Region (PIM) 2009. The aim is to answer the research problem “How did cultural differences appear and affect teamwork in PIM 2009”. The need for this research and discussion of this topic can be found in the growing importance of both in-terculturalism and teamwork in working life. The research was implemented as a qualitative research using the observati...

  17. The need to identify and promote Galaţi touristic area in order to eliminate regional economic disparities

    OpenAIRE

    Nicoleta Cristache; Irina Susanu

    2007-01-01

    Touristic activities in Romania during the last years have two main activity directions, one beeing the pursue of touristic programs and projects that have been launched in the prevoius years and that have proven their success and viability both on national and on south-east europeean regional level, the other activity direction beeing the launch of new touristic programs. We do consider the latter as having a major importance. Each one of the programs and initiatives to touristically promote...

  18. Human in vitro induced T regulatory cells and memory T cells share common demethylation of specific FOXP3 promoter region

    OpenAIRE

    Bégin, Philippe; Schulze, Janika; Baron, Udo; Olek, Sven; Rebecca N Bauer; Passerini, Laura; Baccheta, Rosa; Nadeau, Kari C.

    2015-01-01

    Background The FOXP3 gene is the master regulator for T regulatory cells and is under tight DNA methylation control at the Treg specific demethylated region (TSDR) in its first intron. This said, methylation of its promoter region, the significance of which is unknown, has also been associated with various immune-related disease states such as asthma, food allergy, auto-immunity and cancer. Here, we used induced T regulatory cells (iTreg) as a target cell population to identify candidate hypo...

  19. Bridging Integration Gaps: Scenarios and Policy Recommendations to Promote Physical Infrastructure and Reduce Intra-Regional Trade Costs

    OpenAIRE

    Inter-American Development Bank (IDB); World Bank (WB); Economic Commission for Latin America and the Caribbean (ECLAC); Banco Interamericano de Desarrollo (BID); Banco Mundial (BM); Comisión Económica para América Latina y el Caribe (CEPAL)

    2010-01-01

    This policy brief is intended to serve as the basis for the discussion of the Ministers of Finance on action needed to promote physical infrastructure and reduce intra-regional trade costs, in the context of the Third Meeting of the Finance Ministers of the Americas and the Caribbean held in Lima (Perú), on May 28, 2010. It is argued that the Latin American and Caribbean region must bridge three interrelated policy gaps in order to advance its integration agenda. First, despite advances in tr...

  20. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  1. Isolation and sequencing of a putative promoter region of the murine G protein beta 1 subunit (GNB1) gene.

    Science.gov (United States)

    Kitanaka, Junichi; Kitanaka, Nobue; Takemura, Motohiko; Wang, Xiao-Bing; Hembree, Cambria M; Goodman, Nancy L; Uhl, George R

    2002-02-01

    The expression of the heterotrimeric GTP-binding protein beta 1 subunit gene (GNB1) is regulated by psychostimulants such as cocaine and amphetamines. Since the up-regulation appears to be one of the candidate processes of sensitization, it is necessary to elucidate the cellular and molecular mechanism of the GNB1 gene regulation for a better understanding the establishment of sensitization. In the present study, we describe the isolation and nucleotide sequence analysis of the GNB1 gene promoter region. We have isolated approximately 10 kb of the 5'-flanking region of the mouse of GNB1 gene and found potential elements involved in putative transcriptional control of the GNB1, such as AP1, AP2, Sp1, cyclic AMP response element, and nuclear factor kappa B recognition sites, within the sequences 0.3 kb upstream from the putative transcription start site. This region was highly rich in G + C content, but lacked TATA or CATT boxes. Comparing the nucleotide sequence of the cDNA clone with the human genome databases using the BLAST program a region containing putative exon 1 and promoter of the human GNB1 gene in chromosome 1 was found. The cloning and sequence analysis of an extensive portion of the 5'-flanking regulatory region of the GNB1 gene provides new insights into the factors involved in the regulation by psychostimulants of GNB1 expression. PMID:12180136

  2. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  3. Vitamin D responsive elements within the HLA-DRB1 promoter region in Sardinian multiple sclerosis associated alleles.

    Directory of Open Access Journals (Sweden)

    Eleonora Cocco

    Full Text Available Vitamin D response elements (VDREs have been found in the promoter region of the MS-associated allele HLA-DRB1*15:01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15:01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04:05, *03:01, *13:01 and *15:01 and non-MS-associated *16:01, *01, *11, *07:01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects. Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15:01, *16:01, *11 and in 45/73 *03:01 and in heterozygous state in 28/73 *03:01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13:03, *04:05 and *07:01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04:05 and *03:01 alleles carrying the new mutated VDRE, while the *16:01 and *03:01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16:01 and in the *15:01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients.

  4. Identification of a binding protein to the X gene promoter region of hepatitis B virus.

    Science.gov (United States)

    Nakamura, I; Koike, K

    1992-12-01

    The X protein of hepatitis B virus (HBV) is a transactivator to homologous and heterologous viral and cellular transcriptional regulatory elements. One sequence-specific binding protein, whose binding site located from nt 1102 to nt 1117 of HBV DNA, was identified by mobility shift assay and DNase I foot-printing analysis. A CAT assay experiment demonstrated this 16-bp binding site to have a promoter activity in the X gene transcription. The 58-bp DNA fragment (nt 1085 to nt 1142), which contains the above binding site, could be enhanced by the HBV enhancer. Mobility shift assay using the mutated 58-bp DNA fragments as probes, showed that the mutation, which damaged the palindrome structure between nt 1105 and nt 1112, resulted in loss of the binding activity. This mutation also remarkably reduced the promoter activity. The binding site differed from the target sequences of known transcriptional factors. This factor was thus concluded to be a binding protein to the X gene promoter (X-PBP) of HBV. A homology search demonstrated the binding site to be highly homologous to the promoter elements of human laminin receptor (2H5epitope) and lipoprotein receptor-related protein (LRP) genes. PMID:1448911

  5. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  6. Advantages and disadvantages in usage of bioinformatic programs in promoter region analysis

    Science.gov (United States)

    Pawełkowicz, Magdalena E.; Skarzyńska, Agnieszka; Posyniak, Kacper; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2015-09-01

    An important computational challenge is finding the regulatory elements across the promotor region. In this work we present the advantages and disadvantages from the application of different bioinformatics programs for localization of transcription factor binding sites in the upstream region of genes connected with sex determination in cucumber. We use PlantCARE, PlantPAN and SignalScan to find motifs in the promotor regions. The results have been compared and possible function of chosen motifs has been described.

  7. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents

    Science.gov (United States)

    Abdel-Rahman, Sherif Z.

    2014-01-01

    The O 6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O 6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18–119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29–97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents. PMID:24163400

  8. Reduced syncytin-1 expression levels in placental syndromes correlates with epigenetic hypermethylation of the ERVW-1 promoter region.

    Directory of Open Access Journals (Sweden)

    Matthias Ruebner

    Full Text Available Terminal differentiation of villous cytotrophoblasts (CT ends in formation of the multinucleated syncytiotrophoblast representing the fetal-maternal interface. Aberrations during this cell-fusion process are associated with Intrauterine Growth Restriction (IUGR, Preeclampsia (PE and High Elevated Liver and Low Platelets (HELLP Syndrome. Syncytin-1, the envelope gene of the human Endogenous Retrovirus ERVW-1, is one of the most important genes involved in cell-fusion and showed decreased gene expression during these pathological pregnancies. The aim of this study was to determine the methylation pattern of the entire promoter of ERVW-1 and to correlate these findings with the expression profile of Syncytin-1 in the placental syndromes. 14 isolated villous cytotrophoblasts from control (n = 3, IUGR (n = 3, PE (n = 3, PE/IUGR (n = 3 and HELLP/IUGR (n = 2 placentae were used to determine the mean methylation level (ML for the ERVW-1 promoter region. ML rose significantly from 29% in control CTs to 49% in IUGR, 53% in PE, 47% in PE/IUGR and 64% in HELLP/IUGR indicating an epigenetic down-regulation of Syncytin-1 by promoter hypermethylation. DNA demethylation of the trophoblast like cell lines BeWo, JEG-3 and JAR with 5-AZA-2'desoxycytidine (AZA showed an increased Syncytin-1 expression and fusion ability in all cell lines. Promoter activity of the 5'LTR could be inhibited by hypermethylation 42-fold using a luciferase based reporter-gene assay. Finally overexpression of the methyltransferases DNMT3a and LSH could be responsible for a decreased Syncytin-1 expression by promoter hypermethylation of ERVW-1. Our study linked decreased Syncytin-1 expression to an epigenetic hypermethylation of the entire promoter of ERVW-1. Based on our findings we are predicting a broad aberrant epigenetic DNA-methylation pattern in pathological placentae affecting placentogenesis, but also the development of the fetus and the mother during pregnancy.

  9. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  10. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Science.gov (United States)

    Peng, Xian-E; Wu, Yun-Li; Zhu, Yi-Bing; Huang, Rong-Dong; Lu, Qing-Qing; Lin, Xu

    2015-01-01

    Liver fatty acid-binding protein (L-FABP), also known as fatty acid-binding protein 1 (FABP1), is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD) and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs) of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182) from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032).Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05). The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01). In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003), while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014). Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans. PMID:26439934

  11. Tourism Promotion and Regional Development in Low-income Developing Countries

    OpenAIRE

    Kazuhiro Testu

    2006-01-01

    There are not so many papers that the economic effects of tourism are examined in a general equilibrium framework. The features of those papers are that they assume that tourism is regarded as non-tradable goods and services and that tourism is consumed by not only foreign tourists but also domestic residents. However, since our purpose of this paper is to examine the economic effects of tourism promotion on low-income developing countries, we assume that most domestic residents cannot afford...

  12. A Common Variation in the Promoter Region of Interleukin-6 Gene Shows Association with Exercise Performance

    OpenAIRE

    Antti Huuskonen; Minna Tanskanen; Jani Lappalainen; Niku Oksala; Heikki Kyröläinen; Mustafa Atalay

    2009-01-01

    Skeletal muscle-derived interleukin-6 (IL-6) is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP) -174G/C of the IL6 gene (rs1800795) promoter was examined on maximal oxygen uptake (VO2max), body mass index (BMI) and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks ...

  13. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.

    2012-12-01

    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  14. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu

    2012-01-01

    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  15. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  16. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni

    2013-02-01

    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  17. Promoting eWork in Remote Regions: Lessons from FlexWork

    OpenAIRE

    Wilson, Frank; Grene, Margaret; Hill, Stewart; Rogian, Davorin

    2003-01-01

    The FlexWork project provided a set of knowledge objects (handbook, templates, cases, decision support tools) to business advisors in ten European regions and assisted them in learning about flexible working. These advisors were also provided with standardised presentation materials and supported in deploying knowledge about flexible working to their constituencies of SME clients at regional level (multiplier). The demand for knowledge about flexible working among business advisors and their ...

  18. Analysis of aberrant methylation on promoter sequences of tumor suppressor genes and total DNA in sputum samples: a promising tool for early detection of COPD and lung cancer in smokers

    Directory of Open Access Journals (Sweden)

    Guzmán Leda

    2012-07-01

    Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is a disorder associated to cigarette smoke and lung cancer (LC. Since epigenetic changes in oncogenes and tumor suppressor genes (TSGs are clearly important in the development of LC. In this study, we hypothesize that tobacco smokers are susceptible for methylation in the promoter region of TSGs in airway epithelial cells when compared with non-smoker subjects. The purpose of this study was to investigate the usefulness of detection of genes promoter methylation in sputum specimens, as a complementary tool to identify LC biomarkers among smokers with early COPD. Methods We determined the amount of DNA in induced sputum from patients with COPD (n = 23, LC (n = 26, as well as in healthy subjects (CTR (n = 33, using a commercial kit for DNA purification, followed by absorbance measurement at 260 nm. The frequency of CDKN2A, CDH1 and MGMT promoter methylation in the same groups was determined by methylation-specific polymerase chain reaction (MSP. The Fisher’s exact test was employed to compare frequency of results between different groups. Results DNA concentration was 7.4 and 5.8 times higher in LC and COPD compared to the (CTR (p  Conclusions We provide evidence that aberrant methylation of TSGs in samples of induced sputum is a useful tool for early diagnostic of lung diseases (LC and COPD in smoker subjects. Virtual slides The abstract MUST finish with the following text: Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1127865005664160

  19. Induced Pib Expression and Resistance to Magnaporthe grisea are Compromised by Cytosine Demethylation at Critical Promoter Regions in Rice

    Institute of Scientific and Technical Information of China (English)

    Yuan Li; Qiong Xia; Hongping Kou; Dan Wang; Xiuyun Lin; Ying Wu; Chunming Xu; Shaochen Xing

    2011-01-01

    Pib is a well-characterized rice blast-resistance gene belonging to the nucleotide binding site (NBS) and leucine-rich repeat (LRR) superfamily.Expression of Pib was low under non-challenged conditions,but strongly induced by the blast-causing fungal pathogen Magnaporthe grisea,thereby conferring resistance to the pathogen.It is generally established that cytosine methylation of the promoter-region often plays a repressive role in modulating expression of the gene in question.We report here that two critical regions of the Pib promoter were heavily CG cytosine-methylated in both cultivars studied.Surprisingly,induced expression of Pib by M.grisea infection did not entail its promoter demethylation,and partial demethylation by 5-azacytidine-treatment actually reduced Pib expression relative to wildtype plants.Accordingly,the blast disease-resistance was compromised in the 5’-azaC-treated plants relative to wild-type.In contrast,the disease susceptibility was not affected by the 5’-azaC treatment in another two rice cultivars that did not contain the Pib gene,ruling out effects of other R genes and non-specific genotoxic effects by the drug-treatment as a cause for the compromised Pib-conditioned blast-resistance.Taken together,our results suggest that promoter DNA methylation plays a novel enhancing role in conditioning high-level of induced expression of the Pib gene in times of M.grisea infection,and its conferred resistance to the pathogen.

  20. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca;

    2009-01-01

    search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being....... Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been...

  1. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus

    2009-11-01

    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  2. Screening for mutations in the muscle promoter region and for exonic deletions in a series of 115 DMD and BMD patients.

    OpenAIRE

    Vitiello, L.; Mostacciuolo, M. L.; Oliviero, S; Schiavon, F; Nicoletti, L.; Angelini, C.; Danieli, G A

    1992-01-01

    Mutations in the muscle promoter region and exonic deletions were screened in a series of 115 unrelated DMD and BMD patients from north-east Italy. No gross mutations of the promoter region were found. In three cases in which dystrophin of normal size was expressed at low levels, the analysis of DNA sequences of the promoter region failed to detect abnormalities. The majority of deletions in coding sequences, detected by cDNA probes, occur in the deletion hot spot identified by the probe P20....

  3. A 350 bp region of the proximal promoter of Rds drives cell-type specific gene expression

    OpenAIRE

    Cai, Xue; Conley, Shannon M.; Cheng, Tong; Al-Ubaidi, Muayyad R.; Naash, Muna I.

    2010-01-01

    RDS (retinal degeneration slow) is a photoreceptor-specific tetraspanin protein required for the biogenesis and maintenance of rod and cone outer segments. Mutations in the Rds gene are associated with multiple forms of rod- and cone-dominant retinal degeneration. To gain more insight into the mechanisms underlying the regulation of this gene the identification of regulatory sequences within the promoter of Rds was undertaken. A 3.5kb fragment of the 5′ flanking region of the mouse Rds gene w...

  4. Sequence change in the HS2-LCR and Gg-globin gene promoter region of sickle cell anemia patients

    Directory of Open Access Journals (Sweden)

    E.V. Adorno

    2008-02-01

    Full Text Available The fetal hemoglobin (HbF levels and ßS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Gg- and Ag-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR of patients with HbF level disparities as compared to their ßS haplotypes. Sixty-four (51.2% patients had CAR/Ben genotype; 36 (28.8% Ben/Ben; 18 (14.4% CAR/CAR; 2 (1.6% CAR/Atypical; 2 (1.6% Ben/Cam; 1 (0.8% CAR/Cam; 1 (0.8% CAR/Arab-Indian, and 1 (0.8% Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

  5. Meeting in the MIDDLE:BUILDING off Regional Policies to Promote Climate Education Partnerships on and off Campus

    Science.gov (United States)

    Griswold, M.; Stylinski, C.; Shea, N.; Veron, D. E.; Merrill, J.

    2013-12-01

    Both the impacts of climate change and the choices available to adapt and mitigate climate change largely function at the regional scale. Understanding and addressing climate change will require a concerted campaign involving a diverse array of educations from small to large organizations. By focusing on a specific region's climate impacts, adaptation and mitigation options, and existing policies, climate education networks will likely have a higher likelihood of sustainability. Building on this concept, we have developed a climate education partnership, Maryland Delaware Climate Change Education, Assessment and Research (MADE CLEAR), to better understand effective ways to support formal-, informal- and higher-education practitioners in climate change education in this Mid-Atlantic region. We do so largely through face-to-face and web based professional development for each education practitioner group to improve their capacity to incorporate rigorous regionally-based climate science and solutions into their education strategies. We are promoting communities-of-practice within and across these groups as they share their successes and challenges and consider common messages and approaches. Our training and resources focus on impacts and solutions most relevant to our region including sea level rise, extreme events, and urban heat impacts. Our professional development approach aligns directly with existing education and natural resource, including the region's environmental literacy initiatives, the Next Generation Science Standards, and state climate adaptation and mitigation plans. We anticipate that by building off of existing policy, we will build the success of the network into the future. Our project includes design-based research of all three education groups, and thus we will identify effective climate change education strategies, in and out of schools, that are applicable in other regions.

  6. Haplotypes in the promoter region of the CIDEC gene associated with growth traits in Nanyang cattle

    OpenAIRE

    Jing Wang; Liu-shuai Hua; Hong Pan; Liang-zhi Zhang; Ming-xun Li; Yong-zhen Huang; Zhuan-jian Li; Xian-yong Lan; Chu-zhao Lei; Cong-jun Li; Hong Chen

    2015-01-01

    Cell death-inducing DFFA-like effector c (CIDEC, also known as Fsp27) has emerged as an important regulator of metabolism associated with lipodystrophy, diabetes, and hepatic steatosis. It is required for unilocular lipid droplet formation and optimal energy storage. The mechanism between this gene and livestock growth traits, however, has yet to be reported. In this study, we found ten novel single nucleotide polymorphisms (SNPs) in the 5’ transcriptional region of CIDEC in Nanyang (NY) catt...

  7. Climate harzard management to promote sustainable land management in dry region of Gokwe, Zimbabwe

    OpenAIRE

    Ephraim Chifamba

    2012-01-01

    The major aim of the study was to assess the risk affecting sustainable land management and its implications on sustainable development in Gokwe. The dry region of Gokwe suffers from unsustainable land uses that have been experienced over the last decade. The spiral of environmental degradation facing the study area is both anthropogenic and natural in nature and origin. These factors include demographic failure, climatic variability, information failure, market failure, institutional crisis ...

  8. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    OpenAIRE

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sit...

  9. Cloning of the promoter region of plasma membrane aquaporin BnPIP1 from Brassica napus and its functional analysis

    Institute of Scientific and Technical Information of China (English)

    于秋菊; 杜丽; 胡鸢雷; 林忠平

    2003-01-01

    A 1.6 kb upstream regulatory sequence (GenBank accession no. AF472487) of plasma membrane aquaporin BnPIP1 gene from Brassica napus was obtained by genomic walking based on ligation-mediated PCR method. Sequence analysis indicated that this fragment contained seed germination specific and vascular specific sequences. The 1.6 kb upstream sequence and various 5'end deleted sequences were fused with uidA gene and constructed into plant expression vectors which were used for tobacco transformation. GUS histochemical assay showed that the 1.6 kb fragment had high levels of promoter activity and the GUS staining was mainly distributed in vascular systems and tissues with rapid expanding and proliferating cells. Promoter deletion analysis showed that the deletion of -1610 - -1030 bp resulted in a dramatic reduction in GUS activity. It was assumed that there might be cis-acting element(s) existing in this region. Whereas, the region located at-1030- -902 bp strongly inhibited the expression of gus and probably contained negative regulatory element(s). The fragment of -902 - -19 bp could also direct gus expression at high level.

  10. Study on polymorphism in promoter region of mannose binding lectin gene in patients with systemic lupus erythematosus

    International Nuclear Information System (INIS)

    The relationship between polymorphisms in the promoter region of mannose binding lectin (MBL) gene and the serum levels of MBL in patients with systemic lupus erythematosus (SLE) was investigated. The polymorphism of alleles-550(H/L) and-221(X/Y) in the promoter region of MBL gene was analyzed by polymerase chain reaction with sequence-specific primers (SSP-PCR) in 62 patients with SLE and 54 healthy controls. The serum level of MBL was also determined by ELISA. The results showed that three haplotypes, HY, LY and LX, were presented in both groups. The frequency of haplotype LX in SLE patients were significantly higher than that in healthy control(OR, 2.23; 95% CI,1.09-4.55; P=0.02). The serum level of MBL in SLE patients with genotype HY/HY was significantly higher than that in the patients with other genotypes (LY/LY, LX/LX, HY/LY, HY/LX and LY/LX, P<0.05). There was a significant difference for the percentage of subjects with MBL level in serum lower than 1000 μg/L between SLE patients (40.32%) and controls (14.81%) (OR, 3.89; 95% CI, 1.57-9.62; P=0.002). Therefore, low serum level of MBL in SLE patients may be associated with increased frequency of haplotype LX. (authors)

  11. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias

    2014-12-01

    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  12. TMAO promotes fibrillization and microtubule assembly activity in the C-terminal repeat region of tau.

    Science.gov (United States)

    Scaramozzino, Francesca; Peterson, Dylan W; Farmer, Patrick; Gerig, J T; Graves, Donald J; Lew, John

    2006-03-21

    Alzheimer's disease most closely correlates with the appearance of the neurofibrillary tangles (NFTs), intracellular fibrous aggregates of the microtubule-associated protein, tau. Under native conditions, tau is an unstructured protein, and its physical characterization has revealed no clues about the three-dimensional structural determinants essential for aggregation or microtubule binding. We have found that the natural osmolyte trimethylamine N-oxide (TMAO) induces secondary structure in a C-terminal fragment of tau (tau(187)) and greatly promotes both self-aggregation and microtubule (MT) assembly activity. These processes could be distinguished, however, by a single-amino acid substitution (Tyr(310) --> Ala), which severely inhibited aggregation but had no effect on MT assembly activity. The inability of this mutant to aggregate could be completely reversed by TMAO. We propose a model in which TMAO induces partial order in tau(187), resulting in conformers that may correspond to on-pathway intermediates of either aggregation or tau-dependent MT assembly or both. These studies set the stage for future high-resolution structural characterization of these intermediates and the basis by which Tyr(310) may direct pathologic versus normal tau function. PMID:16533051

  13. A COMMON VARIATION IN THE PROMOTER REGION OF INTERLEUKIN-6 GENE SHOWS ASSOCIATION WITH EXERCISE PERFORMANCE

    Directory of Open Access Journals (Sweden)

    Antti Huuskonen

    2009-06-01

    Full Text Available Skeletal muscle-derived interleukin-6 (IL-6 is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP -174G/C of the IL6 gene (rs1800795 promoter was examined on maximal oxygen uptake (VO2max, body mass index (BMI and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks 1, 5 and 8, VO2max and anthropometrics were measured, and blood samples collected before and after acute aerobic exercise. Acute exercise increased plasma IL-6 in subjects with genotype CG. Moreover, during the 8-week training period, a tendency for increased plasma IL-6 was observed in subjects with this genotype. VO2max values increased in all genotype groups, but subjects with genotype CG made the greatest gains in VO2max. Training significantly decreased BMI only in subjects with genotype CG. Our findings suggest that the allele C may have an effect on plasma IL-6 response to acute exercise in healthy male subjects. Exercise training has a favourable effect on VO2max and BMI, with the most prominent effects in subjects with genotype CG. Thus we conclude that this SNP may account for individual response to exercise training.

  14. The Marche Film Commission: a Tool for Promoting Territorial Development and Regional Tourism

    Directory of Open Access Journals (Sweden)

    Enrico Nicosia

    2015-03-01

    Full Text Available The level of attractiveness of a tourist destination due to several tangible and intangible elements, which usually have a high degree of interdependence and reciprocity. The film is thus both a communication channel guide is a reference market of the destination. Many areas offer a wide variety of potential movie sets, thanks to the scenic splendor that characterizes different environmental and artistic and monumental heritage, also varied for the different origins of the architectural structures. This paper aims to highlight the role played by the Film Commission, which allow you to have a vision of cinema that goes beyond the original one, as they can think of it not only as a cultural activity, but also as a possible tool for development economic territory, able to promote and enhance the same resources and places of historical, artistic and natural and economic benefits are linked precisely to the revival of tourism and the possible revenues appropriated by the producers of the film/television industry.

  15. [Active health promotion among the aged in a rural region. Participants, acceptance, and implementation].

    Science.gov (United States)

    Hofreuter-Gätgens, K; Mnich, E; Thomas, D; Salomon, T; von dem Knesebeck, O

    2011-08-01

    The program "active health promotion in old age" focuses on persons aged 60 years and older who are not in need of care and are living independently without cognitive impairment. The objective of the intervention is to improve physical activity, healthy nutrition, and the integration of older people into network structures. The intervention was successfully conducted in an urban setting and has now been transferred to a rural area in southwestern Germany (Baden-Wuerttemberg). It was offered to statutory health insured people of Baden-Wuerttemberg within an integrated care program and was free of charge. This article reports the results of the process evaluation. For data collection, participants were interviewed using a standardized questionnaire. Semistructured interviews were conducted with the intervention team and involved general practitioners. In addition, secondary data were used to analyze selection bias between participants and nonparticipants. Although the rural area has a major impact on recruitment, access, and factors of implementation, results demonstrate that the intervention is highly accepted by participants. Moreover, structural conditions (e.g., fitness clubs, exercise classes) are essential for a successful transfer. PMID:21800241

  16. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin;

    2014-01-01

    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other with...... each gene and the common transcription factors likely to regulate the three genes. Our data imply Polycomb Repressive Complex 2 (PRC2) mediated silencing of Foxg1 in cerebellum CONCLUSIONS: Our analyses provide a comprehensive picture of the regulatory regions of the three genes involved in Rett...... Syndrome....

  17. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  18. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation

    Science.gov (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.

    2014-09-01

    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  19. THE ANALYSIS OF THE ASYMMETRICAL RISK IN TOURISM FOR THE DEVELOPMENT AND PROMOTION OF A LASTING REGIONAL TOURISM IDENTITY

    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA

    2009-06-01

    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  20. A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter

    Directory of Open Access Journals (Sweden)

    Orfanoudakis Georges

    2008-06-01

    Full Text Available Abstract The construction of expression vectors derived from the human adenovirus type 5 (Ad5, usually based on homologous recombination, is time consuming as a shuttle plasmid has to be selected before recombination with the viral genome. Here, we describe a method allowing direct cloning of a transgene in the E3 region of the Ad5 genome already containing the immediate early CMV promoter upstream of three unique restriction sites. This allowed the construction of recombinant adenoviral genomes in just one step, reducing considerably the time of selection and, of course, production of the corresponding vectors. Using this vector, we produced recombinant adenoviruses, each giving high-level expression of the transgene in the transduced cells.

  1. Methylation profiling of twenty promoter-CpG islands of genes which may contribute to hepatocellular carcinogenesis

    International Nuclear Information System (INIS)

    Hepatocellular carcinoma (HCC) presents one of the major health threats in China today. A better understanding of the molecular genetics underlying malignant transformation of hepatocytes is critical to success in the battle against this disease. The methylation state of C5 of the cytosine in the CpG di-nucleotide that is enriched within or near the promoter region of over 50 % of the polymerase II genes has a drastic effect on transcription of these genes. Changes in the methylation profile of the promoters represent an alternative to genetic lesions as causative factors for the tumor-specific aberrant expression of the genes. We have used the methylation specific PCR method in conjunction with DNA sequencing to assess the methylation state of the promoter CpG islands of twenty genes. Aberrant expression of these genes have been attributed to the abnormal methylation profile of the corresponding promoter CpG islands in human tumors. While the following sixteen genes remained the unmethylated in all tumor and normal tissues: CDH1, APAF1, hMLH1, BRCA1, hTERC, VHL, RARβ, TIMP3, DAPK1, SURVIVIN, p14ARF, RB1, p15INK4b, APC, RASSF1c and PTEN, varying degrees of tumor specific hypermethylation were associated with the p16INK4a, RASSF1a, CASP8 and CDH13 genes. For instance, the p16INK4a was highly methylated in HCC (17/29, 58.6%) and less significantly methylated in non-cancerous tissue (4/29. 13.79%). The RASSF1a was fully methylated in all tumor tissues (29/29, 100%), and less frequently methylated in corresponding non-cancerous tissue (24/29, 82.75%). Furthermore, co-existence of methylated with unmethylated DNA in some cases suggested that both genetic and epigenetic (CpG methylation) mechanisms may act in concert to inactivate the p16INK4a and RASSF1a in HCC. Finally, we found a significant association of cirrhosis with hypermethylation of the p16INK4a and hypomethylation of the CDH13 genes. For the first time, the survey was carried out on such an extent that it

  2. Climate harzard management to promote sustainable land management in dry region of Gokwe, Zimbabwe

    Directory of Open Access Journals (Sweden)

    Ephraim Chifamba

    2012-08-01

    Full Text Available The major aim of the study was to assess the risk affecting sustainable land management and its implications on sustainable development in Gokwe. The dry region of Gokwe suffers from unsustainable land uses that have been experienced over the last decade. The spiral of environmental degradation facing the study area is both anthropogenic and natural in nature and origin. These factors include demographic failure, climatic variability, information failure, market failure, institutional crisis and educational failure. Land degradation owing to both human and natural factors is usually not in tandem with the regenerative capacities of the land. Land use activities are degrading the local environment in a way that ultimately undermines local ecosystem services, human welfare, and the long term sustainability of human societies. The study utilized both qualitative and quantitative research methodologies. The research noted that changes in climatic patterns have the potential to change current land management practices. With additional increasing commercialisation and expansion of agriculture and its integration into international markets and supply chains, the new risk management approaches are required that are adapted to the agricultural and rural sectors, and to the pervasive risk affecting those sectors (Murhpree, 2004; Snapp et al., 2003. The research further noted that farming and land management activities in the study area are exposed to seasonal climatic risks arising from inter-annual climatic variability and anthropogenic perturbations of the climatic system, which have resulted in more frequent extreme weather events. The major element of agricultural and risk management in Gokwe should include efficient use of inherently variable natural resources (for example, run off, and measures to increase the resilience of land and crop management systems against seasonal climate threats (for example, droughts and floods. There is need to develop

  3. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra

    2004-01-01

    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  4. Microsatellite polymorphism in the P1 promoter region of the IGF‑1 gene is associated with endometrial cancer.

    Science.gov (United States)

    Kwasniewski, Wojciech; Gozdzicka-Jozefiak, Anna; Wolun-Cholewa, Maria; Polak, Grzegorz; Sierocinska-Sawa, Jadwiga; Kwasniewska, Anna; Kotarski, Jan

    2016-06-01

    Endometrial carcinoma (EC) is the most common type of gynecological malignancy. Studies have demonstrated that the insulin growth factor (IGF) pathway is implicated in the development of endometrial tumors and that the serum levels of IGF‑1 are affected by estrogen. Most EC cells with high microsatellite instability (MSI‑H) accumulate mutations at a microsatellite sequence in the IGF‑1 gene. The present study investigated the CA repeat polymorphism in the P1 promoter region of the IGF‑1 gene among Caucasian females with endometrial hyperplasia, EC and healthy control subjects, whose blood serum and surgical tissue specimens were analyzed. Differences or correlations between the analyzed parameters [serum levels of IGF-1 and IGF binding protein (IGFBP)‑1 and IGFBP‑3 as well as estrogens among the polymorphisms] were verified using the χ2, Mann-Whitney U, Kruskal-Wallis or Spearman's rank correlation tests. A PCR amplification and DNA sequencing analysis was used for identification of (CA)n repeats in the P1 region of IGF‑1. ELISA was used to determine the blood serum levels of IGF‑1, IGFBP‑1, IGFBP‑3 and estrogens. Furthermore, IGF-1 was assessed in endometrial tissues by immunohistochemical analysis. The present study indicated no statistically significant differences between serum levels of IGF‑1, IGFBP‑1, IGFBP‑3 and estrone, estriol and estradiol in the control and study groups. A significant correlation was identified between the IGF-1 levels and estrone levels in the MSI-H polymorphism (r=-0.41, P=0.012) as well as a highly negative correlation between IGF-1 levels and the estradiol levels in the MSI-H polymorphism (r=-0.6, P=0.002). Genotypes without the 19 CA allele were predominantly found in EC. Furthermore, statistical analysis indicated that the number of IGF-1-expressing cells was significantly elevated in MSI-H type 18-20 (P=0.0072), MSI-L type 19-20 (P=0.025) and microsatellite-stable MSS type 19-19 (P=0.024) compared with

  5. Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region.

    Science.gov (United States)

    Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

    2011-05-01

    Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼ 70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5'- and 3'-boundaries of the PIC assembly zone. PMID:21288884

  6. Correlation between ECT2 gene expression and methylation change of ECT2 promoter region in pancreatic cancer

    Institute of Scientific and Technical Information of China (English)

    Mang-Li Zhang; Sen Lu; Lin Zhou; Shu-Sen Zheng

    2008-01-01

    BACKGROUND: Pancreatic cancer is closely related to epigenetic abnormality. The epithelial cell transforming sequence 2 gene (ECT2) plays a critical role in Rho activation during cytokinesis, and thus may play a role in the pathogenesis of pancreatic cancer. In this study, we investigated the relationships between aberrant expression and epigenetic changes of the ECT2 gene in pancreatic cancer. METHODS: Four cell lines (PANC-1, Colo357, T3M-4 and PancTuⅠ) and pancreatic ductal adenocarcinoma (PDAC) tissues were used for mRNA detection. After restriction isoschizomer endonucleases (MspⅠ/HpaⅡ) were used to digest the DNA sequence (5'-CCGG-3'), PCR was made to amplify the product. And RT-PCR was applied to determine the expression of the gene. RESULTS: The mRNA expression of the ECT2 gene was higher in pancreatic tumor tissue than in normal tissue. The gene was also expressed in the 4 PDAC cell lines. The methylation states of the upstream regions of the ECT2 gene were almost identical in normal, tumor pancreatic tissues, and the 4 PDAC cell lines. Some of the 5'-CCGG-3' areas in the upstream region of ECT2 were methylated, while others were unmethylated. CONCLUSIONS: The oncogene ECT2 is overexpressed in pancreatic tumor tissues as veriifed by RT-PCR detection. The methylation status of DNA in promoter areas is involved in the gene expression, along with other factors, in pancreatic cancer.

  7. Dysfunction of endothelial NO system originated from homocysteine-induced aberrant methylation pattern in promoter region of DDAH2 gene

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jing-ge; LIU Jun-xu; LI Zhu-hua; WANG Li-zhen; JIANG Yi-deng; WANG Shu-ren

    2007-01-01

    Background Hyperhomocysteinemia (HHcy)-mediated dysfunction of endothelial NO system is an important mechanism for atherosclerotic pathogenesis.Dimethylarginine dimethylaminohydrolase (DDAH) is the key enzyme for degrading asymmetric dimethylarginine (ADMA),which is an endogenous inhibitor of endothelial nitric oxide (NO) synthase (eNOS).This study was designed to investigate whether the dysfunction of endothelial NO system originates from HHcy-mediated aberrant methylation modification in promotor region of DDAH2 gene.Methods Human umbilical vein endothelial cells (HUVECs) were cultured to the third generation and treated with homocysteine (Hcy) at different concentrations (0,10,30,100,and 300 μmol/L) for 72 hours.The methylation pattern in promoter region CpG island of DDAH2 gene was analyzed by nested methylation-specific PCR (nMSP).The mRNA expression of eNOS gene and DDAH2 gene was detected by semi-quantitative RT-PCR.The activity of DDAH2 and eNOS in cells,and the concentrations of ADMA and NO in culture medium were assayed respectively.Results Mild increased concentration of Hcy (10 and 30 μmol/L) induced hypomethylation,while high concentration of Hcy (100 and 300 μmol/L) induced hypermethylation in the promoter CpG island of DDAH2 gene.The mRNA expression of DDAH2 increased in mild enhanced concentration of Hcy,and decreased in high concentration of Hcy correspondingly.The inhibition of DDAH2 activity,the increase of ADMA concentration,the reduction of eNOS activity and the decrease of NO production were all consistently relevant to the alteration of Hcy concentration Conclusion The increased concentration of Hcy induced aberrant methylation pattern in promotor region of DDAH2 gene and the successive alterations in DDAH/ADMA/NOS/NO pathway,which showed highly relevant and dose-effect relationship.The results suggested that the dysfunction of endothelial NO system induced by HHcy could be partially originated from Hcy-mediated aberrant methylation in

  8. The promotion of geotourism in protected areas: a proposal of itinerary through the Matese Massif (Campania and Molise regions, Italy).

    Science.gov (United States)

    Rosskopf, Carmen Maria; Filocamo, Francesca; Amato, Vincenzo; Cesarano, Massimo

    2016-04-01

    The Matese Massif is a ca. 1000 km2 wide and NW-SE elongated carbonate relief, located in the inner sector of the Southern Apennine chain. It has a tabular setting with steep structural slopes bordering the central high mountain sector including its major peaks and is crossed from approximately west to east by the border between Campania and Molise regions. The Matese Mountains represent a key area for the comprehension of the geological and tectonic evolution of the Southern Apennines since Mesozoic times. Its long-term geomorphological evolution has been controlled by Quaternary tectonics and climate variations that have allowed the temporary or permanent establishment of various environments and morphodynamics. Deposits and landforms originated by glacial, periglacial, karst and fluvial processes, along with a rich assemblage of tectonic-structural features and landforms of complex origin have given origin to a geological heritage of exceptional value. The geosites actually censured within the Campanian sector of Matese are reported in the Geosites Map of Campania, available at the website of Campania Region and partly included in the Italian Geosites Inventory of ISPRA. The geosites of the Molise sector have been recently assessed within the geosite inventory carried out by Molise University. They are reported in the Geosites Map of Molise, available at the website of Molise Region, and partly included in the ISPRA's National Inventory of Geosites. The Matese area is largely included in protected areas: the Campania portion falls within the Matese Regional Park, established in 2002, while most of the Molise sector falls in the extensive ZPS/SIC IT72222287. To better protect and exploit the unique natural and geological heritage of the Matese Massif, numerous initiatives aimed at the establishment of the National Park of Matese have continued for several years and very recent attempts to promote the Matese Geopark have been made, but unfortunately without any

  9. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others

    1995-10-09

    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  10. Prevention of liver fibrosis by triple helix-forming oligodeoxyribonucleotides targeted to the promoter region of type I collagen gene.

    Science.gov (United States)

    Koilan, Subramaniyan; Hamilton, David; Baburyan, Narina; Padala, Mythili K; Weber, Karl T; Guntaka, Ramareddy V

    2010-10-01

    Hepatic fibrosis leading to cirrhosis remains a global health problem. The most common etiologies are alcoholism and viral infections. Liver fibrosis is associated with major changes in both quantity and composition of extracellular matix and leads to disorganization of the liver architecture and irreversible damage to the liver function. As of now there is no effective therapy to control fibrosis. The end product of fibrosis is abnormal synthesis and accumulation of type I collagen in the extracellular matrix, which is produced by activated stellate or Ito cells in the damaged liver. Therefore, inhibition of transcription of type I collagen should in principle inhibit its production and accumulation in liver. Normally, DNA exists in a duplex form. However, under some circumstances, DNA can assume triple helical (triplex) structures. Intermolecular triplexes, formed by the addition of a sequence-specific third strand to the major groove of the duplex DNA, have the potential to serve as selective gene regulators. Earlier, we demonstrated efficient triplex formation between the exogenously added triplex-forming oligodeoxyribonucleotides (TFOs) and a specific sequence in the promoter region of the COL1A1 gene. In this study we used a rat model of liver fibrosis, induced by dimethylnitrosamine, to test whether these TFOs prevent liver fibrosis. Our results indicate that both the 25-mer and 18-mer TFOs, specific for the upstream nucleotide sequence from -141 to -165 (relative to the transcription start site) in the 5' end of collagen gene promoter, effectively prevented accumulation of liver collagen and fibrosis. We also observed improvement in liver function tests. However, mutations in the TFO that eliminated formation of triplexes are ineffective in preventing fibrosis. We believe that these TFOs can be used as potential antifibrotic therapeutic molecules. PMID:20818932

  11. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    OpenAIRE

    Yang, J; THOMAS, K.

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC...

  12. Protein-DNA interactions in the cAMP responsive promoter region of the murine ornithine decarboxylase gene.

    OpenAIRE

    Palvimo, J J; Eisenberg, L M; Jänne, O A

    1991-01-01

    To evaluate the function of the murine ornithine decarboxylase (ODC) gene promoter, expression of chimeric ODC-chloramphenicol acetyltransferase (CAT) plasmids (pODCcat) containing 1,658 nt of the ODC promoter sequence and its various 5'-deletions was analyzed. In transient expression assays with NIH/3T3 mouse cells, pODCcat constructs exhibited fairly strong promoter activity yielding CAT values up to 40% of those obtained with the viral promoter RSV. Interestingly, 5'-deletions of the pODCc...

  13. Employment effects of regional climate policy. The case of renewable energy promotion by feed-in tariffs

    Energy Technology Data Exchange (ETDEWEB)

    Heindl, Peter; Voigt, Sebastian

    2012-07-01

    This paper examines the local impacts of renewable energy carrier promotion by the German feed-in tariffs scheme ''Erneuerbare-Energien-Gesetz'' for the German State of Baden-Wuerttemberg by using an input-output approach. The local impacts are of particular interest as in Baden-Wuerttemberg the manufacturing industries are highly important compared to the rest of Germany. We analyze the effects of the policy actions on the production as well as the employment of several sectors. We construct a regional input-output table of Baden- Wuerttemberg and introduce the construction and the operation of installations for seven renewable energy types in order to examine different paths to achieve the state government's targets. We consider two scenarios with different sources funding the investments in the construction and operation of renewable energy installations. In the first scenario, all the necessary investments are funded completely by internal sources. Hence, the scenario is driven by the assumption that these investments either crowd out investments in other industries of the regional economy or the investments are paid by the government, i.e. by taxes which are borne by all other industries and by the households. Therefore, the final demand of all other sectors decreases. In this scenario, we have a slightly positive total turnover effect, although in many sectors the turnover effect is negative. In addition, the total employment effect is negative since the more labour-intensive industries are affected more heavily from the policy than the less labour-intensive industries. The second scenario considers the case of a partly external funding by taking into account that the installations may be demanded from ''abroad'', i.e. the rest of Germany and the rest of the world. Therefore, investments in other industries are not completely crowded out in this scenario. We find positive production and employment effects also for

  14. A stage—specific protein factor binding to a CACCC motif in both human β—globin gene promoter and 5‘—HS2 region

    Institute of Scientific and Technical Information of China (English)

    SUNTONG; YADICHEN; 等

    1994-01-01

    The DNaseI hypersensitive site 2 (HS2) of human β-globin locus control region(LCR) is required for the high level expression of human β-globin genes.In the present study,a stage-specific protein factor (LPF-β) was identified in the nuclear extract prepared from mouse fetal liver at d 18 of gestation,which could bind to the HS2 region of human β-globin LCR.We also found that the shift band of LPF-β factor could be competed by human β-globin promoter.However,it couldn't be competed by human ε-globin promoter or by human Aγ-globin promoter.Furthermore,our data demonstrated that the binding-sequence of LPF-β factor is 5'CACACCCTA 3',which is located at the HS2 region of β-LCR(from-10845 to-10853 bp)and human β-globin promoter(from-92 to -84 bp).We speculated that these regions containing the CACCC box in both the human β-globin promoter and HS2 might function as stage selector elements in the regulation of human β-globin switching and the LPF-β factor might be a stage-specific protein factor involved in the regulation of human β-globin gene expression.

  15. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni

    2006-09-01

    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  16. A cis-regulatory sequence from a short intergenic region gives rise to a strong microbe-associated molecular pattern-responsive synthetic promoter.

    Science.gov (United States)

    Lehmeyer, Mona; Hanko, Erik K R; Roling, Lena; Gonzalez, Lilian; Wehrs, Maren; Hehl, Reinhard

    2016-06-01

    The high gene density in Arabidopsis thaliana leaves only relatively short intergenic regions for potential cis-regulatory sequences. To learn more about the regulation of genes harbouring only very short upstream intergenic regions, this study investigates a recently identified novel microbe-associated molecular pattern (MAMP)-responsive cis-sequence located within the 101 bp long intergenic region upstream of the At1g13990 gene. It is shown that the cis-regulatory sequence is sufficient for MAMP-responsive reporter gene activity in the context of its native promoter. The 3' UTR of the upstream gene has a quantitative effect on gene expression. In context of a synthetic promoter, the cis-sequence is shown to achieve a strong increase in reporter gene activity as a monomer, dimer and tetramer. Mutation analysis of the cis-sequence determined the specific nucleotides required for gene expression activation. In transgenic A. thaliana the synthetic promoter harbouring a tetramer of the cis-sequence not only drives strong pathogen-responsive reporter gene expression but also shows a high background activity. The results of this study contribute to our understanding how genes with very short upstream intergenic regions are regulated and how these regions can serve as a source for MAMP-responsive cis-sequences for synthetic promoter design. PMID:26833485

  17. The intrinsic topological information of the wild-type and of up-promoter mutations of the Saccharomyces cerevisiae alcohol dehydrogenase II regulatory region.

    Science.gov (United States)

    Della Seta, F; Camilloni, G; Venditti, S; Di Mauro, E

    1988-11-01

    A 569-base pair fragment encompassing the upstream regulatory region, the RNA initiation sites, and the initial part of the coding region of the Saccharomyces cerevisiae alcohol dehydrogenase II gene has been analyzed for the presence of sites which undergo conformational modification under torsional stress. Fine mapping of P1 and S1 endonuclease-sensitive sites was obtained on single topoisomers produced by in vitro ligation. It was shown that the upstream activator sequence, the TATA sequence, a region directly upstream to the RNA initiation sites, and several positions in the first segment of the transcribed region change conformation as a function of the applied torsional stress in a precisely coordinate fashion. The superhelical density optima for this coordinate modifications have been determined. Analysis of the conformational changes of the promoter sequence in several naturally occurring (Young, E. T., Williamson, V. M., Taguchi, A., Smith, M., Sledziewski, L., Russel, D., Osterman, J., Denis, C., Cox, D., and Beier, D., (1982) in Genetic Engineering of Microorganisms for Chemicals (Hollander, A., De Moss, R. D., Kaplan, S., Konisky, J., Savage, D., and Wolle, R. S., eds) pp. 335-361, Plenum Publishing Corp., New York) up-promoter constitutive mutants was performed. This analysis has shown that the conformation of functionally relevant sites changes as a function of sequence mutations that have taken place elsewhere; this shows that the conformational behavior of the whole promoter region is linked and suggests transmission in cis of topological effects in RNA polymerase II promoters. PMID:3053683

  18. Effect of microsomal triglyceride transfer protein gene polymorphism in the promoter region on dyslipidemia in type 2 diabetic subjects

    Institute of Scientific and Technical Information of China (English)

    陈莉明; 芳野原; 前田英一; 曾淑范

    2003-01-01

    Objective To explore the relationship between microsomal triglyceride transfer protein (MTP) gene variation and diabetic dyslipidemia among Chinese. Methods Using PCR restriction fragment length polymorphism (PCR-RFLP) analysis and gene sequencing, we studied the influence of a common MTP gene polymorphism in the p romoter region on the apoB-containing lipoproteins in 44 Chinese type 2 diabeti c subjects and 32 non-diabetic volunteers. Results A common functional G/T polymorphism in 493 bp upstream from the transcriptional start point was detected among native Chinese. There were 41 carriers (53.9%) of the MTP-493 G/G genotype, 28 (36.8%) of the MTP-493 G/T genotype and 7 (9.3%) of the MTP-493 T/T genotype. The allele frequency of M TP-493 T in the diabetic group was 0.30. The MTP-493 T/T diabetic group had significantly higher TG (P<0.05), VLDL-CH (P<0.05) and smaller LDL pa rticle size (P<0.001) than the MTP-493 common genotype group. Conclusion Genetic variation in the MTP promoter is likely to be highly involved in the production of dyslipidemia in type 2 diabetic subjects.

  19. Re-expression of RASSF1A by 5-Aza-CdR Induced Demethylation of the Promoter Region in Human Biliary Tract Carcinoma Cells

    Institute of Scientific and Technical Information of China (English)

    ZUO Shi; CHEN Yongjun; XU Lining; TANG Qibin; ZOU Shengquan

    2007-01-01

    Hypermethylation of the promoter region is an important mean for the transcriptional repression of a number of cancer-associated genes, and over-expression and/or increased activity of DNA methyltransferase are considered to be the main cause of promoter hypermethylation. In order to further explore the epigenetic mechanism of tumor suppressor gene RASSF1A inactivation,5-aza-2'-deoxycytidine (5-Aza-CdR), a DNA methyltransferase inhibitor, was used to treat the human biliary tract carcinoma cell line QBC-939 at the concentration of 5 μmol/L for 24 h in this study. After the chemical intervention with 5-Aza-CdR, the methylation status in the promoter region of RASSF1A gene was detected by methylation specific PCR (MS-PCR), and the expression alteration of RASSF1A mRNA and protein were observed by RT-PCR and Western Blot respectively. Following the treatment with 5-Aza-CdR, methylaiton status in the promoter region of RASSF1A gene was reversed from methylation to unmethylation. A 280 bp DNA band which represented RASS1FA expression at transcriptional level and a 40 kDa (1kDa=0.9921 ku) protein band which represented RASSF1A expression at protein level were detected by RT-PCR and Western Blot respectively in the experimental group cells and there were no corresponding bands in the control group cells. The experimental results suggest that 5-Aza-CdR can induce demethylation in the promoter region of RASSF1A. It can also reverse epigenetic transcriptional silencing caused by DNA methylation and induce the re-expression of RASSF1A in QBC-939. This study also suggest that the mechanism of RASSF1A inactivation is very closely related to the methylation of the promoter region, which may provide a new epigenetic understanding for tumor related gene inactivation and the pathogenesis of biliary tract carcinoma.

  20. Growth Promotion and Enhanced Nutrient Uptake of Maize (Zea maysL.) by Application of Plant Growth Promoting Rhizobacteria in Arid Region of Iran

    OpenAIRE

    A. Biari; A. Gholami; H.A. Rahmani

    2008-01-01

    The effect of plant growth-promoting rhizobacteria (PGPR) belonging to the genera Azospirillum and Azotobacter on the growth and nutrient uptake of maize (Zea mays) was investigated in the field as factorial experiment. Azospirillum strains were: Z0 = no inoculation, Z1 = Azospirillum sp. Strain 21, Z2 = Azospirillum lipoferum DSM 1691, Z3 = Azospirillum brasilense DSM 1690 and Azotobacter strains were: A0 = no inoculation, A1 = Azotobacter sp. Strain 5, A2 = Azotobacter chroococcum ...

  1. Decoding a signature-based model of transcription cofactor recruitment dictated by cardinal cis-regulatory elements in proximal promoter regions.

    Directory of Open Access Journals (Sweden)

    Christopher Benner

    2013-11-01

    Full Text Available Genome-wide maps of DNase I hypersensitive sites (DHSs reveal that most human promoters contain perpetually active cis-regulatory elements between -150 bp and +50 bp (-150/+50 bp relative to the transcription start site (TSS. Transcription factors (TFs recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the -150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed 'cardinal' motifs prefer acting individually, rather than in fixed combinations, within the -150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1 motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A. This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription.

  2. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  3. Detection of a 640-bp deletion in the Aggregatibacter actinomycetemcomitans leukotoxin promoter region in isolates from an adolescent of Ethiopian origin

    Directory of Open Access Journals (Sweden)

    Rolf Claesson

    2015-04-01

    Full Text Available The expression of the leukotoxin of Aggregatibacter actinomycetemcomitans is regulated by the leukotoxin promoter. A 530-bp deletion or an 886-bp insertion sequence (IS element in this region has earlier been described in highly leukotoxic isolates. Here, we report on highly leukotoxic isolate with a 640-bp deletion, which was detected in an adolescent of Ethiopian origin.

  4. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    2014-01-01

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine trea

  5. Promoter region of interleukin-2 gene undergoes chromatin structure changes and confers inducibility on chloramphenicol acetyltransferase gene during activation of T cells.

    OpenAIRE

    Siebenlist, U; Durand, D B; Bressler, P; Holbrook, N J; Norris, C A; Kamoun, M.; Kant, J A; Crabtree, G R

    1986-01-01

    The chromatin structure of the interleukin-2 (IL-2) gene was probed by DNase I treatment of isolated nuclei. The 5' region of the IL-2 gene contains three regions of hypersensitivity to DNase I. When peripheral blood T cells or Jurkat T cells are stimulated with mitogens, IL-2 message is induced, and the promoter region of the IL-2 gene develops an additional hypersensitive site. This suggests that a DNA sequence close to the transcriptional start site is involved in the transduction of the e...

  6. Characterization of the regulatory region of the zebrafish Prep1.1 gene: analogies to the promoter of the human PREP1.

    Directory of Open Access Journals (Sweden)

    Elisa Bernardi

    Full Text Available Prep1 is a developmentally essential TALE class homeodomain transcription factor. In zebrafish and mouse, Prep1 is already ubiquitously expressed at the earliest stages of development, with important tissue-specific peculiarities. The Prep1 gene in mouse is developmentally essential and has haploinsufficient tumor suppressor activity [1]. We have determined the human Prep1 transcription start site (TSS by primer extension analysis and identified, within 20 bp, the transcription start region (TSR of the zebrafish Prep1.1 promoter. The functions of the zebrafish 5' upstream sequences were analyzed both by transient transfections in Hela Cells and by injection in zebrafish embryos. This analysis revealed a complex promoter with regulatory sequences extending up to -1.8, possibly -5.0 Kb, responsible for tissue specific expression. Moreover, the first intron contains a conserved tissue-specific enhancer both in zebrafish and in human cells. Finally, a two nucleotides mutation of an EGR-1 site, conserved in all species including human and zebrafish and located at a short distance from the TSS, destroyed the promoter activity of the -5.0 Kb promoter. A transgenic fish expressing GFP under the -1.8 Kb zebrafish promoter/enhancer co-expressed GFP and endogenous Prep1.1 during embryonic development. In the adult fish, GFP was expressed in hematopoietic regions like the kidney, in agreement with the essential function of Prep1 in mouse hematopoiesis. Sequence comparison showed conservation from man to fish of the sequences around the TSS, within the first intron enhancer. Moreover, about 40% of the sequences spread throughout the 5 Kbof the zebrafish promoter are concentrated in the -3 to -5 Kb of the human upstream region.

  7. Rhodobacter capsulatus nifA1 Promoter: High-GC −10 Regions in High-GC Bacteria and the Basis for Their Transcription

    Science.gov (United States)

    Richard, Cynthia L.; Tandon, Animesh; Kranz, Robert G.

    2004-01-01

    It was previously shown that the Rhodobacter capsulatus NtrC enhancer-binding protein activates the R. capsulatus housekeeping RNA polymerase but not the Escherichia coli RNA polymerase at the nifA1 promoter. We have tested the hypothesis that this activity is due to the high G+C content of the −10 sequence. A comparative analysis of R. capsulatus and other α-proteobacterial promoters with known transcription start sites suggests that the G+C content of the −10 region is higher than that for E. coli. Both in vivo and in vitro results obtained with nifA1 promoters with −10 and/or −35 variations are reported here. A major conclusion of this study is that α-proteobacteria have evolved a promiscuous sigma factor and core RNA polymerase that can transcribe promoters with high-GC −10 regions in addition to the classic E. coli Pribnow box. To facilitate studies of R. capsulatus transcription, we cloned and overexpressed all of the RNA polymerase subunits in E. coli, and these were reconstituted in vitro to form an active, recombinant R. capsulatus RNA polymerase with properties mimicking those of the natural polymerase. Thus, no additional factors from R. capsulatus are necessary for the recognition of high-GC promoters or for activation by R. capsulatus NtrC. The addition of R. capsulatus σ70 to the E. coli core RNA polymerase or the use of −10 promoter mutants did not facilitate R. capsulatus NtrC activation of the nifA1 promoter by the E. coli RNA polymerase. Thus, an additional barrier to activation by R. capsulatus NtrC exists, probably a lack of the proper R. capsulatus NtrC-E. coli RNA polymerase (protein-protein) interaction(s). PMID:14729700

  8. Environmental Stress Affects DNA Methylation of a CpG Rich Promoter Region of Serotonin Transporter Gene in a Nurse Cohort

    OpenAIRE

    Alasaari, J. S.; Lagus, M.; Ollila, H M; Toivola, A.; Kivimäki, M; Vahtera, J.; Kronholm, E; Härmä, M; Puttonen, S.; Paunio, T

    2012-01-01

    Background Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4) promoter methylation among nurses from high and low work stress environments. Methodology Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses fro...

  9. Rhodobacter capsulatus nifA1 Promoter: High-GC −10 Regions in High-GC Bacteria and the Basis for Their Transcription

    OpenAIRE

    Richard, Cynthia L.; Tandon, Animesh; Kranz, Robert G.

    2004-01-01

    It was previously shown that the Rhodobacter capsulatus NtrC enhancer-binding protein activates the R. capsulatus housekeeping RNA polymerase but not the Escherichia coli RNA polymerase at the nifA1 promoter. We have tested the hypothesis that this activity is due to the high G+C content of the −10 sequence. A comparative analysis of R. capsulatus and other α-proteobacterial promoters with known transcription start sites suggests that the G+C content of the −10 region is higher than that for ...

  10. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY

    2010-02-01

    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  11. Conserved POU/OCT- and GATA-binding sites in 5'-flanking promoter region of mammalian WNT8B orthologs.

    Science.gov (United States)

    Katoh, Masuko; Katoh, Masaru

    2007-05-01

    WNT family members are secreted-type glycoproteins regulating cell fate, planar cell polarity, cell adhesion, and cell movement. WNT signals are context-dependently transduced to the canonical pathway for the transcriptional up-regulation of MYC, CCND1, FGF20, JAG1, WISP1 and DKK1 genes, and also to the non-canonical pathway for the activation of RHOA, JNK, PKC, NFAT and NLK signaling cascades. We cloned and characterized the wild-type human WNT8B, while another group the aberrant human WNT8B with Gly230Ala and Arg284Leu amino-acid substitutions. Although WNT8B is undetectable in normal adult tissues by using Northern blot analyses, WNT8B is expressed in gastric cancer, pancreatic cancer, colorectal cancer, breast cancer, and embryonal tumors. Here, comparative integromics on WNT8B orthologs were investigated by using bioinformatics (Techint) and human intelligence (Humint). Cow Wnt8b gene was identified within NW_001494361.1 genome sequence. Predicted sequence XM_582222.3 was an artificial cow Wnt8b with aberrant prediction for the first exon. Cow Wnt8b complete coding sequence was found to encode a 350-amino-acid protein, which showed 96.9% total-amino-acid identity with human WNT8B. Comparative proteomics revealed that N-terminal signal peptide, 22 Cys residues, two Asn-linked glycosylation sites, Gly230, and Arg284 of human WNT8B were conserved among mammalian WNT8B orthologs. Comparative genomics revealed that POU/OCT- and GATA-binding sites in the 5'-flanking promoter region were conserved among human, chimpanzee, cow, mouse, and rat WNT8B orthologs. In silico expression analyses revealed that human WNT8B was expressed in embryoid body derived from embryonic stem (ES) cells, hepatocyte progenitors derived from ES cells, fetal brain, diffuse-type gastric cancer, colorectal cancer, prostate cancer, and ovarian fibrotheoma. Based on the expression profiles of POU and GATA family transcription factors, it was revealed that WNT8B expression in hepatocyte

  12. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc+ foci as well as nuclear and cytoplasmic p21Cip1+ foci in Yy1− or GST-P+ foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5− foci was increased in Yy1− foci in proportion to the TAA dose. Yy1−/GST-P+ foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1+/GST-P+ foci, while cleaved caspase-3+ cells were unchanged between Yy1–/GST-P+ and Yy1+/GST-P+ foci. In the case of Wdr45b, most GST-P+ foci were Wdr45b– and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1–/GST-P+ foci showing high proliferation. • TAA promoted activation of c

  13. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Hajime [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Pathogenetic Veterinary Science, United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Ogawa, Takashi; Wang, Liyun [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Pathogenetic Veterinary Science, United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193 (Japan); Yoshida, Toshinori [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan); Shibutani, Makoto, E-mail: mshibuta@cc.tuat.ac.jp [Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509 (Japan)

    2014-11-01

    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc{sup +} foci as well as nuclear and cytoplasmic p21{sup Cip1+} foci in Yy1{sup −} or GST-P{sup +} foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5{sup −} foci was increased in Yy1{sup −} foci in proportion to the TAA dose. Yy1{sup −}/GST-P{sup +} foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1{sup +}/GST-P{sup +} foci, while cleaved caspase-3{sup +} cells were unchanged between Yy1{sup –}/GST-P{sup +} and Yy1{sup +}/GST-P{sup +} foci. In the case of Wdr45b, most GST-P{sup +} foci were Wdr45b{sup –} and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted

  14. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  15. Effect of single-nucleotide polymorphisms -705T/C and -603T/A in P1 promoter region of human insulin-like growth factor-I gene on promoter activity

    Directory of Open Access Journals (Sweden)

    Wei HUANG

    2012-01-01

    Full Text Available Objective  To investigate the effect of single-nucleotide polymorphisms (SNP -705T>C and -603T>A in the P1 promoter region of human insulin-like growth factor I (IGF-I gene on promoter activity. Methods  A total of 152 healthy volunteers were recruited for the present study. The peripheral blood samples were obtained through venipuncture. The total genomic DNA of each blood sample was extracted using the genomic DNA extraction kit. Genotyping of SNP -705T>C and -603T>A in each volunteer was performed based on restriction fragment length polymorphism (RFLP analysis, and the frequencies of each genotype were statistically analyzed. P1 promoter haplotypes and their frequencies were analyzed by PHASE v2.1 software. Luciferase reporter gene assays were adopted to determine the difference in activity between different promoter haplotypes. Results  The total genomic DNA of each volunteer was successfully extracted. Genotyping of SNP -705T>C and -603T>A was also carried out. The genotype frequencies of -705T/T, -705T/C, and -705C/C were the same as those of -603T/T, -603T/ A, and -603A/A, which were 43.4%, 45.4%, and 11.2%, respectively. The frequencies of allelic gene -705T and -705C were the same as those of -603T and -603A, which were 66.1% and 33.9%, respectively. A complete linkage disequilibrium between SNP -705T>C and -603T>A was observed. Moreover, these two SNPs only comprised two types of promoter haplotypes, including -705T/-603T (66.1% and -705C/-603A (33.9%. The results of reporter gene assays showed that the activity of -705C/-603A P1 promoter haplotype was significantly higher than that of -705T/-603T haplotype. Conclusion  SNP -705T>C and -603T>A in the P1 promoter field of human IGF-I gene can affect the activity of the P1 promoter.

  16. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    OpenAIRE

    Paddy K C Janssen; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D.

    2014-01-01

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphi...

  17. A Common Polymorphism in the Promoter Region of the TNFSF4 Gene Is Associated with Lower Allele-Specific Expression and Risk of Myocardial Infarction

    OpenAIRE

    Massimiliano Ria; Jacob Lagercrantz; Ann Samnegård; Susanna Boquist; Anders Hamsten; Per Eriksson

    2011-01-01

    BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI) in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism...

  18. Isolation and Identification of Indigenous Plant Growth Promoting Rhizobacteria from Himalayan Region of Kashmir and their Effect on Improving Growth and Nutrient Contents of Maize (Zea Mays L.)

    OpenAIRE

    Mahwish eZahid

    2015-01-01

    IIntroduction and exploitation of plant growth promoting rhizobacteria (PGPR) in agro-ecosystems enhance plant-microbes interactions that may affect ecosystems sustainability, agricultural productivity and environmental quality. The present study was conducted to isolate and identify PGPRs associated with maize (Zea mays L.) from twenty sites of Himalayan region of Hajira-Rawalakot, Azad Jammu and Kashmir (AJK), Pakistan. A total of one hundred isolates were isolated from these sites, out of ...

  19. Isolation and identification of indigenous plant growth promoting rhizobacteria from Himalayan region of Kashmir and their effect on improving growth and nutrient contents of maize (Zea mays L.)

    OpenAIRE

    Zahid, Mahwish; Abbasi, M. Kaleem; Hameed, Sohail; Rahim, Nasir

    2015-01-01

    Introduction and exploitation of plant growth promoting rhizobacteria (PGPR) in agro-ecosystems enhance plant–microbes interactions that may affect ecosystems sustainability, agricultural productivity, and environmental quality. The present study was conducted to isolate and identify PGPRs associated with maize (Zea mays L.) from twenty sites of Himalayan region of Hajira-Rawalakot, Azad Jammu and Kashmir (AJK), Pakistan. A total of 100 isolates were isolated from these sites, out of which ei...

  20. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    ElenaV.Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  1. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。%With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.

  2. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.%当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。

  3. Fusion of the promoter region of rRNA operon rrnB to lac Z gene.

    OpenAIRE

    Glaser, G; Kobi, S.; Oppenheim, A B

    1980-01-01

    A Lambda phage was constructed in which the structural gene for beta galactosidase is fused to a DNA segment carrying the ribosomal promoter rrnB of E. coli. In this hybrid operon beta galactosidase synthesis in vitro is repressed by ppGpp. Repression of beta galactosidase synthesis by cAMP is reported.

  4. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  5. Polycomb complex 2 is required for E-cadherin repression by the Snail1 transcription factor

    DEFF Research Database (Denmark)

    Herranz, Nicolás; Pasini, Diego; Díaz, Víctor M; Francí, Clara; Gutierrez, Arantxa; Dave, Natàlia; Escrivà, Maria; Hernandez-Muñoz, Inma; Di Croce, Luciano; Helin, Kristian; García de Herreros, Antonio; Peiró, Sandra

    2008-01-01

    -regulate CDH1 and partially de-represses CDH1. Chromatin immunoprecipitation assays demonstrated that Snail1 increases the binding of Suz12 to CDH1 promoter and the tri-methylation of lysine 27 in the histone 3. Moreover, Snail1 interacts with Suz12 and Ezh2 as shown by coimmunoprecipitation experiments. In...

  6. Polymorphism in the regulatory region located more than 1.1 kilobases 5' to the start site of transcription, the promoter region, and exon 1 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Sørensen, Steen; Morling, N

    1999-01-01

    The non-classic Human Leucocyte Antigen class Ib molecule, HLA-G, is expressed on the invasive, extra-villous cytotrophoblast in human placenta. HLA-G protects against natural killer (NK)-cell-mediated lysis and may modulate the secretion of cytokines. Aberrant expression of HLA-G has been reported...... in certain disorders of pregnancy. We have studied the DNA sequences of the putative regulatory region located more than 1.1 kilobases 5' from the start site of transcription (a 244 bp HindIII/EcoRI fragment) of the HLA-G gene and of the promoter region to detect any possible polymorphism. We...

  7. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.

    2012-11-01

    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  8. An examination of the association between the 5-HTT promoter region polymorphism and depressogenic attributional styles in childhood

    OpenAIRE

    Sheikh, Haroon I.; Hayden, Elizabeth P.; Shiva M. Singh; Dougherty, Lea R.; Olino, Thomas M.; Durbin, C. Emily; Klein, Daniel N.

    2008-01-01

    Although a vast literature examining the role of attributional styles in depression has accumulated, the origins of such cognitions remain poorly understood. Investigators are increasingly interested in whether cognitive vulnerability to depression is linked to genetic variation. As a preliminary test of this hypothesis, we examined whether the serotonin transporter promoter polymorphism (5-HTTLPR) was associated with attributional styles in children. Thirty-eight children completed a self-re...

  9. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey

    OpenAIRE

    Yan YANG; LI, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin

    2010-01-01

    Objective To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Methods Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logi...

  10. Isolation and Screening of Rhizosphere Bacteria from Grasses in East Kavango Region of Namibia for Plant Growth Promoting Characteristics.

    Science.gov (United States)

    Haiyambo, D H; Chimwamurombe, P M; Reinhold-Hurek, B

    2015-11-01

    A diverse group of soil bacteria known as plant growth promoting rhizobacteria (PGPR) is able to inhabit the area close to plant roots and exert beneficial effects on plant growth. Beneficial interactions between rhizospheric bacteria and plants provide prospects for isolating culturable PGPR that can be used as bio-fertilizers for sustainable crop production in communities that cannot easily afford chemical fertilizers. This study was conducted with the aim of isolating rhizospheric bacteria from grasses along the Kavango River and screening the bacterial isolates for plant growth promoting characteristics. The bacteria were isolated from rhizospheres of Phragmites australis, Sporobolus sp., Vetiveria nigritana, Pennisetum glaucum and Sorghum bicolor. The isolates were screened for inorganic phosphate solubilization, siderophore production and indole-3-acetic acid (IAA) production. The nitrogen-fixing capability of the bacteria was determined by screening for the presence of the nifH gene. Up to 21 isolates were obtained from P. australis, Sporobolus sp., S. bicolor, P. glaucum and V. nigritana. The genera Bacillus, Enterobacter, Kocuria, Pseudomonas and Stenotrophomonas, identified via 16S rDNA were represented in the 13 PGPR strains isolated. The isolates exhibited more than one plant growth promoting trait and they were profiled as follows: three phosphate solubilizers, four siderophore producers, eight IAA producing isolates and five nitrogen-fixers. These bacteria can be used to develop bio-fertilizer inoculants for improved soil fertility management and sustainable production of local cereals. PMID:26254764

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P; Vestergaard, H; Hansen, Torben; Zierath, J; Pedersen, O

    1994-01-01

    '-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582......, -16, -43, -143, and -250. The three most common variants could be excluded for having major impact on allele-specific GS mRNA expression in muscle. Scanning of GS cDNA revealed one frequent silent polymorphism at codon 342. Moreover, SSCP analysis of approximately 900 bp of the promoter, the 5...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  13. Conserving and developing folktales for promoting virtue and ethics of children and youths in the Isan region

    Directory of Open Access Journals (Sweden)

    Somkit Saenboonsiri

    2015-11-01

    Full Text Available The findings indicate that the background of folktales of each research area comes from the application of Buddhist philosophy. One folktale told in many versions depends on who the narrator is. The centers of folktales are monasteries and they are always told by monks and the elderly. The main difficulties are a lack of folktale narrators, the majority of children and youths do not know folktales in depth, and many folktales are lost because they are not perpetuated by the present generation. As for the conservation and the development of folktales, all sectors in society should cooperate in these affairs, such as establishing folktale museums in the Isan region, integrating them in school curriculums of all levels and holding folktale telling competitions throughout the region. These folktales benefit the development of virtue and ethics of children and youths in the Isan region and other regions of Thailand.

  14. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  15. A mitigator sequence in the downstream region of the major late promoter of adenovirus type 12 DNA.

    OpenAIRE

    Zock, C; Doerfler, W

    1990-01-01

    Human adenovirus type 12 (Ad12) replicates in permissive human host cells, but undergoes an abortive infection cycle in non-permissive hamster cells. Ad12 DNA cannot replicate and late viral genes are not expressed in hamster cells, whereas most of the early viral mRNAs are synthesized. We have shown previously that the major late promoter of Ad12 DNA (Ad12 MLP; nucleotides -228 to +435 relative to nucleotide +1 as the site of transcriptional initiation) does not function in uninfected or in ...

  16. Mutational characterization of promoter regions recognized by the Salmonella dublin virulence plasmid regulatory protein SpvR.

    OpenAIRE

    Grob, P; Kahn, D.; Guiney, D G

    1997-01-01

    The virulence plasmid-encoded spv regulon is essential for virulence of Salmonella dublin in mice. The spvR gene product belongs to the LysR family of transcriptional regulator proteins. SpvR induces the expression of the spvABCD operon and positively regulates its own expression. DNase I protection analysis with purified SpvR fusion proteins identified SpvR binding sites within the spvA and spvR promoters (P. Grob and D. G. Guiney, J. Bacteriol. 178:1813-1820, 1996). We have used PCR mutagen...

  17. DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy in Alzheimer's disease and amnesic mild cognitive impairment patients.

    Science.gov (United States)

    Shinagawa, Shunichiro; Kobayashi, Nobuyuki; Nagata, Tomoyuki; Kusaka, Akira; Yamada, Hisashi; Kondo, Kazuhiro; Nakayama, Kazuhiko

    2016-08-26

    Several studies have noted an effect of DNA methylation on the pathogenesis of Alzheimer's disease (AD). We have already reported that DNA methylation levels in the NCAPH2/LMF2 promoter region can be a useful biomarker for the diagnosis of AD and amnesic mild cognitive impairment (aMCI). However, there is still uncertainty about the mechanism by which NCAPH2/LMF2 methylation affects the pathogenesis of AD and aMCI. In this study, we investigated relationships between NCAPH2/LMF2 methylation and other factors. AD (n=30) and aMCI (n=28) subjects were included in this study. NCAPH2/LMF2 methylation levels were measured by pyrosequencing. Correlations between methylation levels and other factors including age at onset, sex, duration of disease, education, mini-mental state examination (MMSE) and frontal assessment battery (FAB) scores, APOE genotype, degree of hippocampal atrophy, and total brain atrophy were measured. Degrees of hippocampal atrophy and total brain atrophy were measured by VSRAD (Voxel-Based Specific Regional Analysis System for Alzheimer's Disease). Regression analysis revealed that only hippocampal atrophy according to VSRAD is a significant dependent variable correlated with NCAPH2/LMF2 methylation levels. Our results suggest that DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy through apoptosis. PMID:27356276

  18. Isolation and identification of indigenous plant growth promoting rhizobacteria from Himalayan region of Kashmir and their effect on improving growth and nutrient contents of maize (Zea mays L.).

    Science.gov (United States)

    Zahid, Mahwish; Abbasi, M Kaleem; Hameed, Sohail; Rahim, Nasir

    2015-01-01

    Introduction and exploitation of plant growth promoting rhizobacteria (PGPR) in agro-ecosystems enhance plant-microbes interactions that may affect ecosystems sustainability, agricultural productivity, and environmental quality. The present study was conducted to isolate and identify PGPRs associated with maize (Zea mays L.) from twenty sites of Himalayan region of Hajira-Rawalakot, Azad Jammu and Kashmir (AJK), Pakistan. A total of 100 isolates were isolated from these sites, out of which eight (HJR1, HJR2, HJR3, HJR4, HJR5, MR6, HJR7, HJR8) were selected in vitro for their plant growth promoting ability (PGPA) including phosphorus solubilization, indole-3-acetic acid (IAA) production and N2 fixation. The 16S rRNA gene sequencing technique was used for molecular identity and authentication. Isolates were then further tested for their effects on growth and nutrient contents of maize (Z. mays L.) under pouch and pot conditions. The 16S rRNA gene sequencing and phylogenetic analysis identified these isolates belong to Pseudomonas and Bacillus genera. The isolates promoted plant growth by solubilizing soil P which ranged between 19.2 and 35.6 μg mL(-1). The isolates HJR1, HJR2, HJR3, and HJR5 showed positive activity in acetylene reduction assay showing their N2-fixation potential. All eight isolates showed the potential to produce IAA in the range of 0.9-5.39 μg mL(-1) and promote plant growth. Results from a subsequent pot experiment indicated PGPRs distinctly increased maize shoot and root length, shoot and root dry weight, root surface area, leaf surface area, shoot and root N and P contents. Among the eight isolates, HR3 showed a marked P-solubilizing activity, plant growth-promoting attributes, and the potential to be developed as a biofertilizers for integrated nutrient management strategies. PMID:25852667

  19. Isolation and Identification of Indigenous Plant Growth Promoting Rhizobacteria from Himalayan Region of Kashmir and their Effect on Improving Growth and Nutrient Contents of Maize (Zea Mays L.

    Directory of Open Access Journals (Sweden)

    Mahwish eZahid

    2015-03-01

    Full Text Available IIntroduction and exploitation of plant growth promoting rhizobacteria (PGPR in agro-ecosystems enhance plant-microbes interactions that may affect ecosystems sustainability, agricultural productivity and environmental quality. The present study was conducted to isolate and identify PGPRs associated with maize (Zea mays L. from twenty sites of Himalayan region of Hajira-Rawalakot, Azad Jammu and Kashmir (AJK, Pakistan. A total of one hundred isolates were isolated from these sites, out of which eight (HJR1, HJR2, HJR3, HJR4, HJR5, MR6, HJR7, HJR8 were selected in vitro for their plant growth promoting ability (PGPA including phosphorus solubilization, indole acetic acid (IAA production and N2 fixation. The 16S rRNA gene sequencing technique was used for molecular identity and authentication. Isolates were then further tested for their effects on growth and nutrient contents of maize (Zea mays L. under pouch and pot conditions. The 16S rRNA gene sequencing and phylogenetic analysis identified these isolates belong to Pseudomonas and Bacillus genera. The isolates promoted plant growth by solubilizing soil P which ranged between 19.2 and 35.6 µgmL−1. The isolates HJR1, HJR2, HJR3 and HJR5 showed positive activity in acetylene reduction assay showing their N2-fixation potential. All eight isolates showed the potential to produce IAA in the range of 0.9−5.39 µgmL−1 and promote plant growth. Results from a subsequent pot experiment indicated PGPRs distinctly increased maize shoot and root length, shoot and root dry weight, root surface area, leaf surface area, shoot and root N and P contents. Among the eight isolates, HR3 showed a marked P-solubilizing activity, plant growth-promoting attributes, and the potential to be developed as a biofertilizers for integrated nutrient management strategies

  20. Polymorphisms in the CCR5 promoter region influence disease progression in perinatally human immunodeficiency virus type 1-infected children.

    Science.gov (United States)

    Ometto, L; Bertorelle, R; Mainardi, M; Zanchetta, M; Tognazzo, S; Rampon, O; Ruga, E; Chieco-Bianchi, L; De Rossi, A

    2001-03-01

    The effect of CC-chemokine receptor 5 (CCR5) promoter polymorphisms on the natural history of human immunodeficiency virus (HIV) disease was studied in 73 HIV-1-infected children. The CCR5(59338-59537) promoter haplotype, CCR5-59029A/G polymorphism, and CCR5Delta32 and CCR2-64I alterations were investigated. After exclusion of carriers of CCR5Delta32 or CCR2-64I, Kaplan-Meier analysis disclosed that children with the P1/P1(59353C,59356C,59402A) genotype progressed faster to disease than did children with other haplotypes (P=.016). When CCR2-64I carriers were included, this effect had borderline significance (P=.065) and was lost when CCR5Delta32 carriers were also considered (P=.387). The P1/P1 effect was strongest early after infection, when progression to disease was mainly associated with CCR5 coreceptor-using viruses. These results indicate that the P1/P1 genotype is predictive of rapid progression in HIV-1-infected children lacking CCR5Delta32 or CCR5-64I alleles. The observation of a linkage disequilibrium between P1 and 59029A might explain the previously reported association between 59029A homozygosity and rapid disease progression. PMID:11181160

  1. Low frequency of mutations in the core promoter and precore regions of hepatitis B virus in anti-HBe positive Brazilian carriers

    Directory of Open Access Journals (Sweden)

    Niel Christian

    2001-07-01

    Full Text Available Abstract Background Mutations in the core promoter and precore regions of the hepatitis B virus (HBV genome, notably the double substitution (AGG to TGA at nt positions 1762-1764 in the core promoter, and the precore stop codon mutation G to A at nt 1896, can often explain the anti-HBe phenotype in chronic carriers. However, the A1896 mutation is restricted to HBV isolates that have T at nt 1858. The double substitution at positions 1762-1764 has been described to occur preferentially in patients infected with strains showing C instead of T at nt 1858. Results HBV DNAs from 29 anti-HBe Brazilian samples were characterized by nucleotide sequencing of PCR products from precore region. Among them, 18 isolates presented C at nt 1858 (mostly genotype A strains. The 11 remaining isolates (genotypes D and F had T1858. The stop codon mutation at nt 1896 was found in seven isolates (24% of the total and 63% of the isolates that had T1858. The frequency of the double substitution at positions 1762-1764 was surprisingly low (20% among C1858 isolates. An association between A1896 and TGA 1762-1764 mutations was observed among genotype D isolates: these showed either none of the two mutations or both. Furthermore, strains mutated at positions 1896 and/or 1762-1764 also presented an elevated number of other, less common substitutions in the core promoter and precore regions. Conclusions The data reported here are not in accordance with some reports from other parts of the world. In half of the isolates, none of the mutations previously described could explain the anti-HBe phenotype.

  2. Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (−359 to −260) Methylation in the Neonate

    Science.gov (United States)

    Casamadrid, VRE; Amaya, CA; Mendieta, ZH

    2016-01-01

    Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator-activated receptor γ (PPAR) promoter region (-359 to - 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000-10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation-Direct™ Kit; Zymo Research). Real-time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARγ coactivator (PPARG) M3 were 5’- aagacggtttggtcgatc-3’ (forward), and5’- cgaaaaaaaatccgaaatttaa-3’ (reverse) and those for PPARG unmethylated were: 5’-gggaagatggtttggttgatt-3’ (forward) and 5’- ttccaaaaaaaaatccaaaatttaa-3’ (reverse). Intergroup differences were calculated using the Mann-Whitney U-test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (-359 to - 260). Conclusion: The PPARγ promoter region (-359 to - 260) in peripheral leukocytes is unlikely to get an obesity-induced methylation in pregnancy. PMID:27144075

  3. Analysis of the downstream region of nodD3 P1 promoter by deletion and complementation tests in Sinorhizobium meliloti

    Institute of Scientific and Technical Information of China (English)

    陈迪; 刘彦杰; 朱家璧; 沈善炯; 俞冠翘

    2003-01-01

    In Sinorhizobium meliloti, the nodD3 gene is transcriptionally controlled by two promoters, P1 and P2. Under P1, there is a 660 bp sequence including a small open reading frame, ORF2, followed by the nodD3 coding region. Genetic analysis using the different deletions on the 3′ends of P1 downstream sequence showed that the downstream sequence +1-+125nt is essential for P1 expression. Complementation, mutations and nodulation tests demonstrated that the ORF2 auto-represses P1 expression, while the P1 downstream sequence +1-+125nt counteracts it.

  4. Helical phase dependent action of CRP: effect of the distance between the CRP site and the -35 region on promoter activity.

    OpenAIRE

    Ushida, C; Aiba, H.

    1990-01-01

    A plasmid carrying a CRP-dependent promoter fused to the lac structural genes was manipulated to construct a set of spacing mutants that have varying lengths between the CRP binding site and the -35 region. The lengths of the spacer were changed over 45 bp by inserting or deleting nucleotides. DNase I footprinting analysis revealed that the spacer length did not affect the binding of cAMP-CRP to the CRP site. The effect of the spacer length on transcription activation by cAMP-CRP was tested i...

  5. Cloning and computer analysis of the promoter region of the legumin-like storage protein gene from buckwheat, Fagopyrum esculentum Moench

    Directory of Open Access Journals (Sweden)

    Milisavljević Mira

    2004-01-01

    Full Text Available Using the modified 5’-RACE approach, a fragment containing the 955 bp long 5’- regulatory region of the buckwheat storage globulin gene (FeLEG1 has been amplified from the genomic DNA of buckwheat. The entire fragment was sequenced and the sequence analyzed by computer prediction of cis-regulatory elements possibly involved in tissue specific and developmentally controlled seed storage protein gene expression. The promoter obtained might be interesting not only for fundamental research, but also as a useful tool for biotechnological application.

  6. Effects of 174 G/C polymorphism in the promoter region of the interleukin-6 gene on plasma IL-6 levels and muscle strength in elderly women

    OpenAIRE

    Pereira, D. S.; Garcia, D.M.; F.M.S. Narciso; M.L.A.S. Santos; J.M.D. Dias; B.Z. Queiroz; E.R. Souza; O.T. Nóbrega; L.S.M. Pereira

    2011-01-01

    We investigated the effect of -174 G/C single-nucleotide polymorphism in the promoter region of the IL6 gene on plasma IL-6 levels and muscle strength, and the relationship between IL-6 levels and muscle strength in elderly women. The sample consisted of 199 elderly residents (73.0 ± 7.8 years old) from rest homes and the community in Belo Horizonte, MG, Brazil. -174 G/C polymorphism was determined by direct sequencing of the product by PCR, and plasma IL-6 concentrations were measured by ELI...

  7. Polymorphisms in poly (ADP-ribose) polymerase-1 (PARP1) promoter and 3’ untranslated region and their association with PARP1 expression in breast cancer patients

    OpenAIRE

    Zhai, Lili; LI, SHUAI; Li, Huilan; Zheng, Yi; Lang, Ronggang; Fan, Yu; Gu, Feng; Guo, Xiaojing; Zhang, Xinmin; Fu, Li

    2015-01-01

    Within the past several years, inhibition of the PARP1 activity has been emerged as one of the most exciting and promising strategies for triple-negative breast cancer (TNBC) therapy. The purpose of this study is to assess PARP1 expression in TNBCs and to evaluate the association between polymorphisms in PARP1 promoter or 3’ untranslated region (3’UTR) and PARP1 expression. It was found that PARP1 was overexpressed in nuclear (nPARP1), cytoplasm (cPARP1) and nuclear-cytoplasmic coexisting (co...

  8. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    which two resided in putative NF-kB and Sp1 sites In accordance with. previous studies we detected no variations in the coding regions except for a rare polymorphism that was found in one donor in the last codon of exon 5, which lead to a heterozygous genotype, but no amino acid change. This suggests...

  9. Promoting Nuclear Safety and Security through Self-Assessment and Networking: The Case of the African Region

    International Nuclear Information System (INIS)

    The use of ionizing radiation and radioactive sources is on the increase in the African region. All the African countries are involved in one or more medical applications of ionizing radiation, either for diagnosis or therapy. Industrial applications are equally well spread, either in the form nuclear gauging, industrial radiography or nuclear well logging, especially in the oil producing states. Furthermore, the ravaging energy poverty in the region against the continuing rise in population, and the rising global demand for low carbon emitting energy supplies to fuel sustainable development have resulted in demand for nuclear electricity in the region and the global demand for uranium, with which Africa is well endowed. This widening scope and intensity of applications call for greater concerns for safety and security. Maximum benefits of these applications can only be delivered if they are supported by a well developed regulatory infrastructure, which will enable Member States to control and minimize the associated risks through a functional, effective and efficient regulatory regime. There is therefore the need for adequate attention to the development of regulatory infrastructures commensurate with the magnitude and nature of the associated risks to be controlled and enhancement of the performance of regulatory bodies. It is against this background that the IAEA in 1994 launched an Interregional Model Project, Strengthening Radiation Protection Infrastructure, whose main objective was to eliminate the shortcomings in the safety infrastructure and control of radiation sources of Member States, including African countries. With the completion of the Model Project in 2004, the IAEA had continued over the past five years to strengthen regulatory infrastructure through the ongoing five thematic regional projects. In an effort to consolidate the achievements of the Model Project and to optimize the assistance of the IAEA and from other partners, regulatory bodies in

  10. Association of copy number polymorphisms at the promoter and translated region of COMT with Japanese patients with schizophrenia.

    Science.gov (United States)

    Higashiyama, Ryoko; Ohnuma, Tohru; Takebayashi, Yuto; Hanzawa, Ryo; Shibata, Nobuto; Yamamori, Hidenaga; Yasuda, Yuka; Kushima, Itaru; Aleksic, Branko; Kondo, Kenji; Ikeda, Masashi; Hashimoto, Ryota; Iwata, Nakao; Ozaki, Norio; Arai, Heii

    2016-04-01

    Chromosome 22q11.2 deletion syndrome and genetic variations including single-nucleotide polymorphism (SNP) and copy number variation (CNV) in catechol-O-methyltransferase (COMT) situated at 22q11.2 remains controversial. Here, the genetic relationship between COMT and Japanese patients with schizophrenia was investigated by examining whether the SNPs correlated with schizophrenia based on a common disease-common variant hypothesis. Additionally, 22q11.2DS were screened based on a common disease-rare variant hypothesis; low-frequency CNVs situated at two COMT promoters and exons were investigated based on the low-frequency variants with an intermediate effect; and positive findings from the first stage were reconfirmed using a second-stage replication study including a larger sample size. Eight SNPs and 10 CNVs were investigated using Taqman SNP and CNV quantitative real-time polymerase chain reaction method. For the first-stage analysis, 513 unrelated Japanese patients with schizophrenia and 705 healthy controls were examined. For the second-stage replication study, positive findings from the first stage were further investigated using a larger sample size, namely 1,854 patients with schizophrenia and 2,137 controls. The first-stage analysis showed significant associations among schizophrenia, intronic SNP rs165774, CNV6 situated at promoter 1, CNV8 at exon 6, and CNV9 at exon 7. The second-stage study showed that intronic SNP rs165774 (χ(2)  = 8.327, P = 0.0039), CNV6 (χ(2)  = 19.66, P = 0.00005), and CNV8 (χ(2)  = 16.57, P = 0.00025) were significantly associated with schizophrenia. Large and rare CNVs as well as low-frequency CNVs and relatively small CNVs, namely COMT, may be genetic risk factors for schizophrenia. © 2016 Wiley Periodicals, Inc. PMID:26852906

  11. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    Energy Technology Data Exchange (ETDEWEB)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  12. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  13. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  14. Renewable energy sources, promotion and integration for the sustainable development of insular regions of Europe: the respire project

    Energy Technology Data Exchange (ETDEWEB)

    Vigotti, R. [EnelGreenPower, Rome (Italy); Cariello, F.; Tondi, G. [ETA-Renewable Energies, Florence (Italy); Veyan, P. [Transenergie, Ecully (France); Granel, N.M. [Cegelec Sud Ouest, Toulose (France); Peirano, E. [ADEME, Paris (France)

    2003-07-01

    RESPIRE project, co-financed by European Commission in the framework of the fifth framework programme, started on 1 March 2003, is a global strategic initiative taken at the level of seven European countries in order to promote the achievement of 100% of RES in the electricity consumption of the insular territories of the Union. 5 islands have been selected to start with strong local commitment the path toward ''sustainable communities'': Islay island (Scotland, UK), Sein island (France), Hoedic island (France), Giglio island (Italy), Panarea island (Italy). These islands are of different sizes, ranging from 150 to over 3000 peoples, both in the northern part and the southern part of Europe. One of these islands have already started the implementation of RES, while the other did not. Among other demonstration projects 2 important example of hybrid systems are foreseen to be implemented during the project. The first innovative hybrid solution will be realized in Ile de sein in the north-western atlantic coast of france: here a 400 kW wind plant will be coupled with an uniblock uninterrupted dynamic alimentation together with a set of batteries and 3 existing diesel. Another RESPIRE hybrid system will be implemented in Panarea island, located in Southern Italy. Here a 50 kWp PV generator will be coupled with 6 small wind turbines (15kW), together with a battery storage unit. Also in this case the hybrid system will feed in power to the local grid. (orig.)

  15. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    genes, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  16. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-12-15

    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  17. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kWel plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  18. Transient expression of the cloned mouse c-Ha-ras 5' upstream region in transfected primary SENCAR mouse keratinocytes demonstrates its power as a promoter element.

    Science.gov (United States)

    Neades, R; Betz, N A; Sheng, X Y; Pelling, J C

    1991-01-01

    The mouse Ha-ras oncogene is activated by point mutation and overexpressed in developing papillomas during two-stage skin carcinogenesis in SENCAR mice. One of our research aims is to characterize the factors regulating Ha-ras gene expression at the transcriptional level in SENCAR mouse epidermis. Towards this goal, we sequenced 1400 bp of the 5' upstream region of the mouse Ha-ras gene so as to characterize various cis-regulatory elements present in the gene. We identified seven sites with the proper consensus sequence for binding the SP1 transcription factor and three potential binding sites for the CTF-1 factor. In addition, we located a 13-base sequence with 92% homology to the consensus sequence for an estrogen response element and two hexamers with consensus sequences identical to the core sequence of the glucocorticoid response element. A series of transient gene expression vectors was constructed in which various regions of the mouse Ha-ras 5' upstream region were fused to the chloramphenicol acetyltransferase (CAT) gene. These expression plasmids were transfected into newborn and adult primary SENCAR epidermal cells, the epidermal cell population that presumably contains the stem cells involved in two-stage skin tumorigenesis. Transient gene expression assays carried out after 48-72 h indicated that a 2.3-kb Ha-ras 5' fragment produced CAT activity comparable to that produced by pSV2CAT and pdolCMVCAT, both of which are plasmids with strong viral promoters and enhancers driving CAT gene expression. Maintenance of transfected keratinocytes under both nondifferentiating (0.05 mM calcium) and differentiating (1.2 mM calcium) culture conditions demonstrated that the mouse Ha-ras upstream region was relatively unresponsive to changes in calcium concentration in transient expression assays carried out in either newborn or adult keratinocytes. Our results demonstrated the power of the cloned mouse Ha-ras promoter and upstream region in driving transient gene

  19. Structural features of the human C3 gene: Intron/exon organization, transcriptional start site, and promoter region sequence

    International Nuclear Information System (INIS)

    The third component of human complement (C3) is a key molecule in the activation of the complement cascade. C3 cDNA fragments were used to identify seven cosmid clones that covered all but 1 kilobase pair (kb) of the C3 gene. The remainder of the gene was cloned by using the polymerase chain reaction. These clones were used to identify the interon/exon boundaries and to map the gene. The C3 gene is 42 kb in length and comprises 41 exons ranging in size from 52 to 213 base pairs (bp). The transcription start site was identified by primer extension, and approximately 1 kb of DNA upstream of this site was sequenced. Putative TATA and CAAT boxes were identified along with a number of regions that shared homology with known regulatory sequences. These include responsive elements for interferon-γ, interleukin-6, nuclear factor kB, estrogen, glucocorticoids and thyroid hormone. Several of these agents have been shown to affect C3 synthesis and mRNA levels. The sizes of the exons in C3 were compared to those of C4 and α2-macroglobulin (α2M). Thirty-nine of 41 exons in C4 were found to be of similar size to the analogous ones in C3, and two-thirds of those in α2M were also similarly sized, supporting the hypothesis that these genes arose from a common ancestor

  20. Disjunction of conjoined twins: Cdk1, Cdh1 and separation of centrosomes

    Directory of Open Access Journals (Sweden)

    Surana Uttam

    2006-06-01

    Full Text Available Abstract Accurate transmission of chromosomes from parent to progeny cell requires assembly of a bipolar spindle. Centrosomes (spindle pole body in yeast are critical for the biogenesis of this complex mitotic apparatus since they confer bipolarity on the spindle and serve as the site of microtubule polymerization. In each division cycle, the centrosome is duplicated and the sister-centrosomes move away from each other, forming the two poles of the spindle. While the structure and the duplication of centrosomes have been investigated extensively, the understanding of the control of their segregation remains scant. Recent findings are beginning to yield insights into the regulation of centrosome segregation in yeast and its link to the mitotic kinase.

  1. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland).

    Science.gov (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna

    2013-04-01

    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  2. Dissection of Arabidopsis NCED9 promoter regulatory regions reveals a role for ABA synthesized in embryos in the regulation of GA-dependent seed germination.

    Science.gov (United States)

    Seo, Mitsunori; Kanno, Yuri; Frey, Anne; North, Helen M; Marion-Poll, Annie

    2016-05-01

    Nine-cis-epoxycarotenoid dioxygenase (NCED) catalyzes the key step of abscisic acid (ABA) biosynthesis. There are five genes encoding NCED in Arabidopsis, which differentially regulate ABA biosynthesis in a spatiotemporal manner in response to endogenous and environmental stimuli. Previous studies have shown that NCED9 is expressed in testa and embryos during seed development. In the present study, we have identified promoter regions required for the expression of NCED9 in testa and embryos, respectively. Electrophoretic mobility shift assays (EMSA) and yeast one-hybrid (Y1H) assays showed that several homeodomain-leucine zipper (HD-Zip) proteins, namely ATHBs, bound to the sequence required for expression of NCED9 in testa, suggesting that they redundantly regulate NCED9 expression. By expressing the NCED9 gene under the control of a deleted NCED9 promoter in an nced9 mutant expression was limited to embryos. Transformants were complemented for the paclobutrazol resistant germination phenotype of the mutant, suggesting that the ABA synthesis mediated by NCED9 in embryos plays an important role in the regulation of gibberellin (GA)-dependent seed germination. PMID:26993239

  3. A g.-1256 A>C in the promoter region of CAPN1 is associated with semen quality traits in Chinese Holstein bulls.

    Science.gov (United States)

    Cui, Xiaohui; Sun, Yan; Wang, Xiuge; Yang, Chunhong; Ju, Zhihua; Jiang, Qiang; Zhang, Yan; Huang, Jinming; Zhong, Jifeng; Yin, Miao; Wang, Changfa

    2016-07-01

    The micromolar calcium-activated neutral protease gene (CAPN1) is a physiological candidate gene for sperm motility. However, the molecular mechanisms involved in regulating the expression of the CAPN1 gene in bulls remain unknown. In this study, we investigated the expression pattern of CAPN1 in testis, epididymis, and sperm at the RNA and protein levels by qRT-PCR, western blot, immunohistochemistry, and immunofluorescence assay. Results revealed that the expression of CAPN1 levels was higher in the sperm head compared with that in other tissues. Moreover, we identified a novel single-nucleotide polymorphism (g.-1256 A>C, ss 1917715340) in the noncanonical core promoter of the CAPN1 gene between base g.-1306 and g.-1012. Additionally, we observed greater sperm motility in bulls with the genotype CC than in those with the genotype AA (PC was revealed by transient transfection in MLTC-1 cells and luciferase report assay. Finally, CAPN1 was highly expressed in the spermatozoa with the CC genotype compared with that with the AA genotype by qRT-PCR. This study is the first report on genetic variant g.-1256 A>C in the promoter region of CAPN1 gene association with the semen quality of Chinese Holstein bulls by influencing its expression. g.-1256 A>C can be a functional molecular marker in cattle breeding. PMID:27107033

  4. Polymorphisms in the promoter regions of the CXCL1 and CXCL2 genes contribute to increased risk of alopecia areata in the Korean population.

    Science.gov (United States)

    Kim, S K; Chung, J-H; Park, H J; Kang, S W; Lim, D-J; Byun, S H; Baek, D G; Ko, H Y; Lew, B-L; Baik, H H; Sim, W-Y

    2015-01-01

    Alopecia areata (AA) is a common disease, which causes hair loss in humans. AA has a genetically complex inheritance. This study investigated the possible correlations between single nucleotide polymorphisms (SNPs) in the promoter regions of the chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) (CXCL1) and chemokine (C-X-C motif) ligand 2 (CXCL2) genes and the development of AA in the Korean population. Two hundred and thirty-five AA patients and 240 control subjects were recruited. The specific SNPs occurring in the promoter regions of the CXCL1 and CXCL2 genes (rs3117604, -429C/T and rs3806792, -264T/C, respectively) were genotyped. All data obtained was evaluated using the SNPStats, SPSS 18.0, and the Haploview v.4.2 software platforms. The Odd's ratios (OR), 95% confidence intervals (CI), and P values were calculated using multiple logistic regression models. Analyses of the genetic sequences obtained revealed a significant correlation between the two SNPs and the development of AA (rs3117604, P = 0.0009 in co-dominant model 1, P = 0.01 in co-dominant model 2, P = 0.004 in the dominant model, P = 0.005 in the log-additive model, P = 0.012 in allele distribution; rs3806792, P = 0.036 in co-dominant model 2, P = 0.0046 in the log-additive model). The TT and CC haplotypes were also observed to show a significant association with increased risk of AA (TT haplotype, P = 0.0018; CC haplotype, P = 0.0349). Our data suggests that the CXCL1 and CXCL2 genes may be associated with AA susceptibility. PMID:26345899

  5. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  6. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available BACKGROUND: Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments. METHODOLOGY: Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes. PRINCIPAL FINDINGS: We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels. CONCLUSIONS: Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that

  7. A polymorphism in the promoter region of the survivin gene is related to hemorrhagic transformation in patients with acute ischemic stroke.

    Science.gov (United States)

    Mallolas, Judith; Rodríguez, Rocío; Gubern, Carme; Camós, Susanna; Serena, Joaquín; Castellanos, Mar

    2014-12-01

    Hemorrhagic transformation (HT) of cerebral infarction is a common and serious occurrence following acute ischemic stroke. The expression of survivin, a member of the inhibitor of apoptosis protein family, has been shown to increase after cerebral ischemia. This protein has been mainly located at the microvasculature within the infarcted and peri-infarcted area, so we aimed to investigate whether survivin gene polymorphisms, also known as BIRC5 gene, were associated with HT of cerebral infarction. Polymorphism screening of the BIRC5 gene was performed in 107 patients with a hemispheric ischemic stroke and 93 controls by polymerase chain reaction, single-strand conformation polymorphism and sequencing analysis. Genotype-phenotype correlation was performed in patients. MRI was carried out within 12 h of symptoms onset and at 72 ± 12 h. The presence of HT was determined on the second DWI sequence and classified according to ECASS II criteria. MMP-9 levels were analyzed at admission. Forty-nine patients (45.8%) had HT. The -241 C/T (rs17878467) polymorphism was identified in the promoter region of the survivin gene. The prevalence of the mutant allele (T) was similar in patients and controls (14 vs. 16%, respectively; P = 0.37). However, 9 (29%) patients with allele T had HT compared to 40 (52.6%) of wild-type (P = 0.021). Logistic regression analysis showed that the polymorphism was associated with a lower risk of HT (OR 0.16; 95% CI 0.04-0.65; P = 0.01). The -241 C/T polymorphism in the promoter region of the survivin gene is associated with a lower risk of HT in patients with ischemic stroke. It has recently been reported that the -241 C/T polymorphism increases survivin promoter activity, reinforcing the hypothesis that patients with the mutant allele may have increased survivin expression in the brain. Different mechanisms, including BBB protection by the inhibition or activation of different angiogenic growth factors and the inhibition of apoptosis during

  8. Methylation at the CpG island shore region upregulates Nr3c1 promoter activity after early-life stress.

    Science.gov (United States)

    Bockmühl, Yvonne; Patchev, Alexandre V; Madejska, Arleta; Hoffmann, Anke; Sousa, Joao C; Sousa, Nuno; Holsboer, Florian; Almeida, Osborne F X; Spengler, Dietmar

    2015-01-01

    Early-life stress (ELS) induces long-lasting changes in gene expression conferring an increased risk for the development of stress-related mental disorders. Glucocorticoid receptors (GR) mediate the negative feedback actions of glucocorticoids (GC) in the paraventricular nucleus (PVN) of the hypothalamus and anterior pituitary and therefore play a key role in the regulation of the hypothalamic-pituitary-adrenal (HPA) axis and the endocrine response to stress. We here show that ELS programs the expression of the GR gene (Nr3c1) by site-specific hypermethylation at the CpG island (CGI) shore in hypothalamic neurons that produce corticotropin-releasing hormone (Crh), thus preventing Crh upregulation under conditions of chronic stress. CpGs mapping to the Nr3c1 CGI shore region are dynamically regulated by ELS and underpin methylation-sensitive control of this region's insulation-like function via Ying Yang 1 (YY1) binding. Our results provide new insight into how a genomic element integrates experience-dependent epigenetic programming of the composite proximal Nr3c1 promoter, and assigns an insulating role to the CGI shore. PMID:25793778

  9. Sequencing and G-quadruplex folding of the canine proto-oncogene KIT promoter region: might dog be used as a model for human disease?

    Directory of Open Access Journals (Sweden)

    Silvia Da Ros

    Full Text Available Downregulation of gene expression by induction of non-canonical DNA structures at promotorial level is a novel attractive anticancer strategy. In human, two guanine-rich sequences (h_kit1 and h_kit2 were identified in the promotorial region of oncogene KIT. Their stabilization into G-quadruplex structures can find applications in the treatment of leukemias, mastocytosis, gastrointestinal stromal tumor, and lung carcinomas which are often associated to c-kit mis-regulation. Also the most common skin cancer in domestic dog, mast cell tumor, is linked to a mutation and/or to an over-expression of c-kit, thus supporting dog as an excellent animal model. In order to assess if the G-quadruplex mediated mechanism of regulation of c-kit expression is conserved among the two species, herein we cloned and sequenced the canine KIT promoter region and we compared it with the human one in terms of sequence and conformational equilibria in physiologically relevant conditions. Our results evidenced a general conserved promotorial sequence between the two species. As experimentally confirmed, this grants that the conformational features of the canine kit1 sequence are substantially shared with the human one. Conversely, two isoforms of the kit2 sequences were identified in the analyzed dog population. In comparison with the human counterpart, both of them showed an altered distribution among several folded conformations.

  10. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  11. The optional long 5'-untranslated region of human ACAT1 mRNAs impairs the production of ACAT1 protein by promoting its mRNA decay

    Institute of Scientific and Technical Information of China (English)

    Xiaonan Zhao; Baoliang Song; Tayuan Chang; Boliang Li; Jia Chen; Lei Lei; Guangjing Hu; Ying Xiong; Jiajia Xu; Qin Li; Xinying Yang; Catherine C.Y.Chang

    2009-01-01

    We have previously reported that human ACAT1 mRNAs produce the 50 kDa protein using the AUG1397-1399 initiation codon,and also a minor 56 kDa isoform using the upstream in-frame GGC1274-1276initiation codon.The GGC1274-1276 codon is located at the optional long 5'-untranslated region(5'-UTR,nt 1-1396)of the mRNAs.The DNA sequences corresponding to this 5'-UTR are located in two different chromosomes,7 and 1.In the current work,we report that the optional long 5'-UTR significantly impairs the production of human ACAT1 protein initiated from the AUG1397-1399 codon,mainly by promoting its mRNA decay.The western blot analyses indicated that the optional long 5'-UTR potently impaired the production of different proteins initiated from the AUG1397-1399codon,meaning that this impairing effect was not influenced by the 3'-UTR or the coding sequence of ACAT1 mRNA.The results of reverse transcription-quantitative polymerase chain reaction demonstrated that this 5'-UTR dramatically reduced the contents of its linked mRNAs.Analyses of the protein to mRNA ratios showed that this 5'-UTR mainly decreased its mRNA stability rather than altering its translational efficiency.We next performed the plasmid transfection experiments and used actinomycin D to inhibit transcription.The results showed that this 5'-UTR promoted its mRNA decay.Additional transfection and nucleofection experiments using RNAs prepared in vitro illustrated that,in both the cytoplasm and the nucleus of cells,the optional long 5'-UTR-linked mRNAs decayed faster than those without the link.Overall,our study brings new insight to the regulation of the human ACAT1 gene expression at the post-transcription level.

  12. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)

    2015-06-15

    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  13. Analysis of ultra-deep pyrosequencing and cloning based sequencing of the basic core promoter/precore/core region of hepatitis B virus using newly developed bioinformatics tools.

    Directory of Open Access Journals (Sweden)

    Mukhlid Yousif

    Full Text Available AIMS: The aims of this study were to develop bioinformatics tools to explore ultra-deep pyrosequencing (UDPS data, to test these tools, and to use them to determine the optimum error threshold, and to compare results from UDPS and cloning based sequencing (CBS. METHODS: Four serum samples, infected with either genotype D or E, from HBeAg-positive and HBeAg-negative patients were randomly selected. UDPS and CBS were used to sequence the basic core promoter/precore region of HBV. Two online bioinformatics tools, the "Deep Threshold Tool" and the "Rosetta Tool" (http://hvdr.bioinf.wits.ac.za/tools/, were built to test and analyze the generated data. RESULTS: A total of 10952 reads were generated by UDPS on the 454 GS Junior platform. In the four samples, substitutions, detected at 0.5% threshold or above, were identified at 39 unique positions, 25 of which were non-synonymous mutations. Sample #2 (HBeAg-negative, genotype D had substitutions in 26 positions, followed by sample #1 (HBeAg-negative, genotype E in 12 positions, sample #3 (HBeAg-positive, genotype D in 7 positions and sample #4 (HBeAg-positive, genotype E in only four positions. The ratio of nucleotide substitutions between isolates from HBeAg-negative and HBeAg-positive patients was 3.5 ∶ 1. Compared to genotype E isolates, genotype D isolates showed greater variation in the X, basic core promoter/precore and core regions. Only 18 of the 39 positions identified by UDPS were detected by CBS, which detected 14 of the 25 non-synonymous mutations detected by UDPS. CONCLUSION: UDPS data should be approached with caution. Appropriate curation of read data is required prior to analysis, in order to clean the data and eliminate artefacts. CBS detected fewer than 50% of the substitutions detected by UDPS. Furthermore it is important that the appropriate consensus (reference sequence is used in order to identify variants correctly.

  14. Analysis of Ultra-Deep Pyrosequencing and Cloning Based Sequencing of the Basic Core Promoter/Precore/Core Region of Hepatitis B Virus Using Newly Developed Bioinformatics Tools

    Science.gov (United States)

    Yousif, Mukhlid; Bell, Trevor G.; Mudawi, Hatim; Glebe, Dieter; Kramvis, Anna

    2014-01-01

    Aims The aims of this study were to develop bioinformatics tools to explore ultra-deep pyrosequencing (UDPS) data, to test these tools, and to use them to determine the optimum error threshold, and to compare results from UDPS and cloning based sequencing (CBS). Methods Four serum samples, infected with either genotype D or E, from HBeAg-positive and HBeAg-negative patients were randomly selected. UDPS and CBS were used to sequence the basic core promoter/precore region of HBV. Two online bioinformatics tools, the “Deep Threshold Tool” and the “Rosetta Tool” (http://hvdr.bioinf.wits.ac.za/tools/), were built to test and analyze the generated data. Results A total of 10952 reads were generated by UDPS on the 454 GS Junior platform. In the four samples, substitutions, detected at 0.5% threshold or above, were identified at 39 unique positions, 25 of which were non-synonymous mutations. Sample #2 (HBeAg-negative, genotype D) had substitutions in 26 positions, followed by sample #1 (HBeAg-negative, genotype E) in 12 positions, sample #3 (HBeAg-positive, genotype D) in 7 positions and sample #4 (HBeAg-positive, genotype E) in only four positions. The ratio of nucleotide substitutions between isolates from HBeAg-negative and HBeAg-positive patients was 3.5∶1. Compared to genotype E isolates, genotype D isolates showed greater variation in the X, basic core promoter/precore and core regions. Only 18 of the 39 positions identified by UDPS were detected by CBS, which detected 14 of the 25 non-synonymous mutations detected by UDPS. Conclusion UDPS data should be approached with caution. Appropriate curation of read data is required prior to analysis, in order to clean the data and eliminate artefacts. CBS detected fewer than 50% of the substitutions detected by UDPS. Furthermore it is important that the appropriate consensus (reference) sequence is used in order to identify variants correctly. PMID:24740330

  15. Development of Biomarkers Based on DNA Methylation in the NCAPH2/LMF2 Promoter Region for Diagnosis of Alzheimer's Disease and Amnesic Mild Cognitive Impairment.

    Directory of Open Access Journals (Sweden)

    Nobuyuki Kobayashi

    Full Text Available From the standpoint of early interventions for dementia, a convenient method of diagnosis using biomarkers is required for Alzheimer's disease (AD in the early stage as well as amnesic mild cognitive impairment (aMCI. Focusing on differences in DNA methylation due to AD and aMCI, in the present study, we first conducted genome-wide screening, measuring blood DNA methylation levels by the Illumina Infinium HD Methylation Assay in 3 small age-and gender-matched groups consisting of 4 subjects each: normal controls (NC, aMCI and AD. The genome-wide analysis produced 11 DNA methylation loci that distinguished the 3 groups. For confirmation, we increased group sizes and examined samples by pyrosequencing which revealed that DNA methylation in the NCAPH2/LMF2 promoter region was significantly decreased in the AD (n = 30 and aMCI (n = 28 groups as compared to the NC group (n = 30 (P < 0.0001, ANCOVA. No association was found between methylation levels and APOE genotype. NCAPH2/LMF2 methylation levels were considered to potentially be a convenient and useful biomarker for diagnosis of AD and aMCI.

  16. Leucine residues in conserved region of 33K protein of bovine adenovirus - 3 are important for binding to major late promoter and activation of late gene expression.

    Science.gov (United States)

    Kulshreshtha, Vikas; Islam, Azharul; Ayalew, Lisanework E; Tikoo, Suresh K

    2015-09-01

    The L6 region of bovine adenovirus 3 (BAdV-3) encode 33K (spliced) and 22K (unspliced) proteins. Earlier, anti-33K serum detected five major and three minor proteins in BAdV-3 infected cells. Here, we demonstrate that anti-sera raised against L6-22K protein detected two proteins of 42 and 37 kDa in BAdV-3 infected cells and one protein of 42 kDa in transfected cells expressing splice-site variant 22K protein (pC.22K containing substituted splice acceptor/donor sequence). Unlike 22K, 33K stimulated the transcription from the major late promoter (MLP) by binding to the downstream sequence elements (DE). Analysis of the variant proteins demonstrated that amino acids 201-240 of the conserved C-terminus of 33K containing the potential leucine zipper and RS repeat are required for the activation of MLP. Furthermore, amino acid substitution analysis demonstrated that unlike arginine residues of RS repeat, the leucine residues (217, 224, 232 and 240) of the conserved leucine zipper appear required for the binding of 33K to the MLP. PMID:25974868

  17. Molecular cloning, expression and identification of the promoter regulatory region for the neuropeptide trissin in the nervous system of the silkmoth Bombyx mori.

    Science.gov (United States)

    Roller, Ladislav; Čižmár, Daniel; Gáliková, Zuzana; Bednár, Branislav; Daubnerová, Ivana; Žitňan, Dušan

    2016-06-01

    Trissin has recently been identified as a conserved insect neuropeptide, but its cellular expression and function is unknown. We detected the presence of this neuropeptide in the silkworm Bombyx mori using in silico search and molecular cloning. In situ hybridisation was used to examine trissin expression in the entire central nervous system (CNS) and gut of larvae, pupae and adults. Surprisingly, its expression is restricted to only two pairs of small protocerebral interneurons and four to five large neurons in the frontal ganglion (FG). These neurons were further characterised by subsequent multiple staining with selected antibodies against insect neuropeptides. The brain interneurons innervate edges of the mushroom bodies and co-express trissin with myoinhibitory peptides (MIP) and CRF-like diuretic hormones (CRF-DH). In the FG, one pair of neurons co-express trissin with calcitonin-like diuretic hormone (CT-DH), short neuropeptide F (sNPF) and MIP. These neurons innervate the brain tritocerebrum and musculature of the anterior midgut. The other pair of trissin neurons in the FG co-express sNPF and project axons to the tritocerebrum and midgut. We also used the baculovirus expression system to identify the promoter regulatory region of the trissin gene for targeted expression of various molecular markers in these neurons. Dominant expression of trissin in the FG indicates its possible role in the regulation of foregut-midgut contractions and food intake. PMID:26809512

  18. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  19. Understanding, promoting and protecting geodiversity and geoheritage of the Piemonte region (Italy) through innovative techniques and public engagement in Earth Science studies

    Science.gov (United States)

    Giardino, Marco; Lozar, Francesca; Perotti, Luigi; Palomba, Mauro; Groppo, Chiara; Natalicchio, Marcello; Ghiraldi, Luca; Beltramo, Riccardo; Lombardo, Vincenzo

    2016-04-01

    The onset of Antropocene demonstrates the importance of considering both 1) geodiversity and 2) geoheritage as parts of the landscape "interfaces" where relationships between natural and socio-economic systems can be studied and interpreted. By definition: 1) is the variety, recognizable in nature ("diversity"), of geological features (rocks, minerals, fossils…), of geomorphological environments (and related forms and processes) and of soil characteristics; 2) is an integral part of the global natural heritage focusing on unique, special and representative sites of geological interests (geosites l.s.). In the Antropocene, both 1) and 2) hold a dynamic character, as the result of actions and interactions of natural and/or human factors. Therefore, geodiversity and geoheritage studies are essential for breaking down geological environments and human territories into their main parts and to understand the variables and mechanisms that control their changes. In this perspective, results of the multidisciplinary project PROGEO-Piemonte ("PROactive management of GEOlogical heritage in the Piemonte Region") are presented here: an innovative approach for assessing geodiversity in order to select areas of high potential value of geoheritage to be enhanced by targeted management actions. Since the geodiversity of Piemonte is materialized by elements of high scientific, educational, tourism, etc. value, the geosites where this geoheritage is preserved have been comprehensively analysed and characterized for encompassing both public and private interests. 9 strategic geothematic areas have been selected in the Piemonte Region to test this approach, and to improve social engagement aimed at protecting and promoting geodiversity ad geoheritage. The investigated areas represent the multifaceted geodiversity of Piemonte; each area is characterized by high potential for scientific studies, enhancement of public understanding of science, recreation activities and for economic

  20. HYPERMETHYLATION STATUS OF E-CADHERIN AND p16INK4a IN GASTROINTESTINAL STROMAL TUMOR

    Institute of Scientific and Technical Information of China (English)

    LIANG Jian-fang

    2006-01-01

    Objective: To investigate the methylation status of CpG island in E-cadherin(CDH1), P16INK4a(P16)promoter region ,and to analyze their role in gastrointestinal stromal tumor (GISTs). Methods: A total of 56 surgically resected GISTs were obtained from January 2003 to December 2005. The routine H&E-stained sections and CD117, CD34-immunoreactions were reviewed to verify the morphologic diagnosis. Methylation status of the CDH1, P16INK4a promoter region was analyzed by methylation specific polymerase chain reaction (MSP) from chemically modified DNA after Na-bisulfite treatment. Results: The frequency of CDH1gene methylation was 32% (18 of 56) in GISTs. The rate was 9% (1 of 11), 21% (4 of 19), 41.6% (5 of 12), and 57% (8 of 14) for very low risk, low risk, intermediate risk, and high risk GISTs; P16INK4a methylation was found in 19 of 56(34%) cases. The rate was 0% (0 of 11), 16% (3 of 19), 50% (6 of 12), and 71% (10 of 14) for very low risk, low risk, intermediate risk, and high risk GISTs. Statistical analysis indicated that of the 56 cases, there was significant association of CDH1 and/or P16INK4a methylation status with tumor malignant behavior (methylation rate 23/56, 41%, P<0.01) and site (P<0.05). Conclusion: E-cadherin (CDH1) and/or P16INK4a promoter hypermethylation is strongly associated with risk grade, may be a useful biomarker for GISTs risk assessment, and may shed light on new therapeutic options to treat GISTs

  1. 高尔基体驻膜糖蛋白GP73启动子克隆%Cloning of the Promoter Regions of Golgi Membrane Glycoprotein GP73

    Institute of Scientific and Technical Information of China (English)

    谢红彬; 宫钰; 彭涛

    2008-01-01

    [Objective] The aim of this study is to clone the active promoter of golgi membrane glycoprotein GP73. [Method] The sequence within the range of upstream 1 000 bp and downstream 400 bp of transcription initiation site was analyzed, the genomic DNA of hepatoma cell line Huh-7 was regarded as template for PCR amplification. The amplified fragment was cloned into recombinant construct with enhanced green fluorescent protein (EGFP) report gene. The expression of EGFP in recombinants were observed under fluorescence microscope after transfection, with the assistant of flow cytometry. [Result] The 1 310 bp ranging between upstream 980 bp and downstream 330 bp of transcription initiation site assumed promoter function. The region contains two core promoters and several conserved sequences including TATA box and many DNA binding sites such as NF-κB, AP1, GC-SP1. [Conclusion] The cloning of the promoter provides a reference for the study of the transcription mechanism of GP73.

  2. Mutational analysis of Escherichia coli sigma28 and its target promoters reveals recognition of a composite -10 region, comprised of an 'extended -10' motif and a core -10 element.

    Science.gov (United States)

    Koo, Byoung-Mo; Rhodius, Virgil A; Campbell, Elizabeth A; Gross, Carol A

    2009-05-01

    Sigma28 controls the expression of flagella-related genes and is the most widely distributed alternative sigma factor, present in motile Gram-positive and Gram-negative bacteria. The distinguishing feature of sigma28 promoters is a long -10 region (GCCGATAA). Despite the fact that the upstream GC is highly conserved, previous studies have not indicated a functional role for this motif. Here we examine the functional relevance of the GCCG motif and determine which residues in sigma28 participate in its recognition. We find that the GCCG motif is a functionally important composite element. The upstream GC constitutes an extended -10 motif and is recognized by R91, a residue in Domain 3 of sigma28. The downstream CG is the upstream edge of -10 region of the promoter; two residues in Region 2.4, D81 and R84, participate in its recognition. Consistent with their role in base-specific recognition of the promoter, R91, D81 and D84 are universally conserved in sigma28 orthologues. Sigma28 is the second Group 3 sigma shown to use an extended -10 region in promoter recognition, raising the possibility that other Group 3 sigmas will do so as well. PMID:19400790

  3. A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield.

    Science.gov (United States)

    Pauciullo, Alfredo; Cosenza, Gianfranco; Steri, Roberto; Coletta, Angelo; La Battaglia, Antonio; Di Berardino, Dino; Macciotta, Nicolò P P; Ramunno, Luigi

    2012-11-01

    An association study between the milk yield trait and the stearoyl-CoA desaturase (SCD) polymorphism (g.133A > C) in Italian Mediterranean river buffalo was carried out. A full characterization of the river buffalo SCD promoter region was presented. Genotyping information was provided and a quick method for allelic discrimination was developed. The frequency of the C allele was 0·16. Test-day (TD) records (43 510) of milk production belonging to 226 lactations of 169 buffalo cows were analysed with a mixed linear model in order to estimate the effect of g.133A > C genotype, as well as the effect of parity and calving season. The SCD genotype was significantly associated with milk yield (P = 0·02). The genotype AC showed an over-dominance effect with an average daily milk yield approximately 2 kg/d higher than CC buffaloes. Such a difference represents about 28% more milk/d. The effect of the genotype was constant across lactation stages. The contribution of SCD genotype (r(2)SCD) to the total phenotypic variance in milk yield was equal to 0·12. This report is among the first indications of genetic association between a trait of economic importance in river buffalo. Although such results need to be confirmed with large-scale studies in the same and other buffalo populations, they might offer useful indications for the application of MAS programmes in river buffalo and in the future they might be of great economic interest for the river buffalo dairy industry. PMID:22994977

  4. Association and Prognostic Significance of the Functional -1562C/T Polymorphism in the Promoter Region of MMP-9 in Turkish Patients with Gastric Cancer.

    Science.gov (United States)

    Avcı, Nilufer; Ture, Mehmet; Deligonul, Adem; Cubukcu, Erdem; Olmez, Omer Fatih; Sahinturk, Serdar; Topak, Ali; Kurt, Ender; Evrensel, Turkkan; Şahin, Ahmet Bilgehan; Yakut, Tahsin

    2015-09-01

    Matrix metalloproteinases (MMPs) are a group of zinc-dependent peptidases that participate in matrix turnover in solid malignancies. The aim of this study was twofold. First, we sought to investigate under a case-control design the association between the functional -1562C/T polymorphism in the promoter region of MMP-9 and gastric cancer (GC) in a Turkish sample. Second, we examined its prognostic significance in GC patients. A total of 144 subjects were enrolled in the case-control study (79 GC cases and 65 controls). Overall survival (OS) and progression-free survival (PFS) served as the main outcome measures in the longitudinal study. The MMP-9 -1562C/T polymorphism was genotyped using a polymerase chain reaction-restriction fragment length polymorphism method. The odds ratio (OR) of GC for the CC genotype relative to the CT+TT genotypes was not significant (OR = 0.89, 95 % confidence interval [CI] = 0.44-1.82, P = 0.75). These results did not change after allowance for age and sex in multivariable regression analysis (OR = 0.81, 95 % CI = 0.40-1.94, P = 0.84). When the MMP-9 -1562C/T polymorphism was analyzed among GC patients in relation to OS and PFS, we found no significant differences between subjects with the CC and CT+TT genotypes. In conclusion, the results of our study did not point toward a major role of the MMP-9 -1562C/T polymorphism in the pathogenesis and clinical course of GC in Turkish subjects. PMID:26156886

  5. Effects of 174 G/C polymorphism in the promoter region of the interleukin-6 gene on plasma IL-6 levels and muscle strength in elderly women

    Directory of Open Access Journals (Sweden)

    D.S. Pereira

    2011-02-01

    Full Text Available We investigated the effect of -174 G/C single-nucleotide polymorphism in the promoter region of the IL6 gene on plasma IL-6 levels and muscle strength, and the relationship between IL-6 levels and muscle strength in elderly women. The sample consisted of 199 elderly residents (73.0 ± 7.8 years old from rest homes and the community in Belo Horizonte, MG, Brazil. -174 G/C polymorphism was determined by direct sequencing of the product by PCR, and plasma IL-6 concentrations were measured by ELISA. Muscle strength in the knee joint was evaluated using a Biodex System 3 Pro® isokinetic dynamometer. ANCOVA was used to determine the effect of polymorphism on IL-6 levels and muscle strength, and the Pearson correlation coefficient to assess the relationship between IL-6 levels and muscle strength. -174 G/C polymorphism was associated with the plasma IL-6 levels of elderly women (P 0.05. No association was found between IL-6 levels and knee extensor muscle (r = 0.087, P = 0.306 or flexor (r = -0.011, P = 0.894 strength. An interaction between -174 G/C polymorphism and housing conditions of the sample of elderly women was identified, with the effect of genotype on IL-6 levels being higher in the institutionalized elderly. These results support the evidence that -174 G/C polymorphism of the IL6 gene associates with individual variability of plasma IL-6 levels in elderly women.

  6. Specific contacts of the -35 region of the galP1 promoter by RNA polymerase inhibit GalR-mediated DNA looping repression.

    Science.gov (United States)

    Csiszovszki, Zsolt; Lewis, Dale E A; Le, Phuoc; Sneppen, Kim; Semsey, Szabolcs

    2012-11-01

    The P1 promoter of the galactose operon in Escherichia coli is one of the best studied examples of 'extended -10' promoters. Recognition of the P1 promoter does not require specific contacts between RNA polymerase and its poor -35 element. To investigate whether specific recognition of the -35 element would affect the regulation of P1 by GalR, we mutagenized the -35 element of P1, isolated variants of the -35 element and studied the regulation of the mutant promoters by in vitro transcription assays and by mathematical modeling. The results show that the GalR-mediated DNA loop is less efficient in repressing P1 transcription when RNA polymerase binds to the -10 and -35 elements concomitantly. Our results suggest that promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation. PMID:22941635

  7. Specific contacts of the −35 region of the galP1 promoter by RNA polymerase inhibit GalR-mediated DNA looping repression

    Science.gov (United States)

    Csiszovszki, Zsolt; Lewis, Dale E. A.; Le, Phuoc; Sneppen, Kim; Semsey, Szabolcs

    2012-01-01

    The P1 promoter of the galactose operon in Escherichia coli is one of the best studied examples of ‘extended −10’ promoters. Recognition of the P1 promoter does not require specific contacts between RNA polymerase and its poor −35 element. To investigate whether specific recognition of the −35 element would affect the regulation of P1 by GalR, we mutagenized the −35 element of P1, isolated variants of the −35 element and studied the regulation of the mutant promoters by in vitro transcription assays and by mathematical modeling. The results show that the GalR-mediated DNA loop is less efficient in repressing P1 transcription when RNA polymerase binds to the −10 and −35 elements concomitantly. Our results suggest that promoters that lack specific −35 element recognition allow decoupling of local chromosome structure from transcription initiation. PMID:22941635

  8. Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC)

    International Nuclear Information System (INIS)

    Lung cancer is the leading cause of cancer-related death worldwide. Genetic and epigenetic alterations have been identified frequently in lung cancer, such as promoter methylation, gene mutations and genomic amplification. However, the interaction between genetic and epigenetic events and their significance in lung tumorigenesis remains poorly understood. We determined the promoter methylation of 6 genes and PIK3CA amplification using quantitative methylation-specific PCR (Q-MSP) and real-time quantitative PCR, respectively, and explore the association of promoter methylation with PIK3CA amplification in a large cohort of clinically well-characterized non-small cell lung cancer (NSCLC). Highly frequent promoter methylation was observed in NSCLC. With 100% diagnostic specificity, excellent sensitivity, ranging from 45.8 to 84.1%, was found for each of the 6 genes. The promoter methylation was associated with histologic type. Methylation of CALCA, CDH1, DAPK1, and EVX2 was more common in squamous cell carcinomas (SCC) compared to adenocarcinomas (ADC). Conversely, there was a trend toward a higher frequency of RASSF1A methylation in ADC than SCC. In addition, PIK3CA amplification was frequently found in NSCLC, and was associated with certain clinicopathologic features, such as smoking history, histologic type and pleural indentation. Importantly, aberrant promoter methylation of certain genes was significantly associated with PIK3CA amplification. Our data showed highly frequent promoter methylation and PIK3CA amplification in Chinese NSCLC population, and first demonstrated the associations of gene methylation with PIK3CA amplification, suggesting that these epigenetic events may be a consequence of overactivation of PI3K/Akt pathway

  9. Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC

    Directory of Open Access Journals (Sweden)

    Shi Bingyin

    2011-04-01

    Full Text Available Abstract Background Lung cancer is the leading cause of cancer-related death worldwide. Genetic and epigenetic alterations have been identified frequently in lung cancer, such as promoter methylation, gene mutations and genomic amplification. However, the interaction between genetic and epigenetic events and their significance in lung tumorigenesis remains poorly understood. Methods We determined the promoter methylation of 6 genes and PIK3CA amplification using quantitative methylation-specific PCR (Q-MSP and real-time quantitative PCR, respectively, and explore the association of promoter methylation with PIK3CA amplification in a large cohort of clinically well-characterized non-small cell lung cancer (NSCLC. Results Highly frequent promoter methylation was observed in NSCLC. With 100% diagnostic specificity, excellent sensitivity, ranging from 45.8 to 84.1%, was found for each of the 6 genes. The promoter methylation was associated with histologic type. Methylation of CALCA, CDH1, DAPK1, and EVX2 was more common in squamous cell carcinomas (SCC compared to adenocarcinomas (ADC. Conversely, there was a trend toward a higher frequency of RASSF1A methylation in ADC than SCC. In addition, PIK3CA amplification was frequently found in NSCLC, and was associated with certain clinicopathologic features, such as smoking history, histologic type and pleural indentation. Importantly, aberrant promoter methylation of certain genes was significantly associated with PIK3CA amplification. Conclusions Our data showed highly frequent promoter methylation and PIK3CA amplification in Chinese NSCLC population, and first demonstrated the associations of gene methylation with PIK3CA amplification, suggesting that these epigenetic events may be a consequence of overactivation of PI3K/Akt pathway.

  10. The LTR promoter of the rat oncomodulin gene is regulated by cell-line specific accessibility in the LTR U3 region

    DEFF Research Database (Denmark)

    Rentsch, J. M.; Hergersberg, M.; Banville, D.;

    2006-01-01

    By germline insertion, a long terminal repeat (LTR) of an intracisternal A-particle type IAP retrovirus has overtaken the transcriptional control of the rat oncomodulin (OM) gene, which codes for a high affinity Ca2+-binding protein with modulatory capacity. In order to get insights into regulatory...... mechanisms of LTR directed OM gene expression we tested promoter activity of this LTR by transient transfection of transformed rat fibroblasts with this sequence placed 5' of the human growth hormone hGH reporter gene. The OM LTR is a strong promoter but does not follow an expression pattern similar to the...... accessibility to the LTR promoter....

  11. Single nucleotide polymorphisms in the promoter region of the IL1B gene influence outcome in multiple myeloma patients treated with high-dose chemotherapy independently of relapse treatment with thalidomide and bortezomib

    DEFF Research Database (Denmark)

    Vangsted, Annette J.; Klausen, Tobias W.; Abildgaard, Niels;

    2011-01-01

    impact on outcome of HDT, INF-α maintenance treatment, and treatment with thalidomide and bortezomib at relapse, in relation to the major identified functional polymorphisms in the promoter region of IL1B. The wild-type C-allele of IL1B C-3737T and non-carriage of the IL1B promoter haplotype TGT (−3737T...... −31T) benefit from a better outcome of HDT and INF-α treatment, an effect that may be related to the NF-κB pathway....

  12. A meta-analysis of the effects of the 5-hydroxytryptamine transporter gene-linked promoter region polymorphism on susceptibility to lifelong premature ejaculation.

    Directory of Open Access Journals (Sweden)

    Lijie Zhu

    Full Text Available OBJECTIVE: Premature ejaculation (PE has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT, the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. METHODS: A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR polymorphism and the risk of lifelong PE (LPE in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012 using 'premature ejaculation', 'polymorphism or variant', 'genotype', 'ejaculatory function', and 'rapid ejaculation' as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR and 95% confidence intervals (CIs were used to evaluate this relationship. RESULTS: In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79-0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68-0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76-0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81-0.95, P = 0.002. Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger's test did not reveal presence of a publication bias. CONCLUSIONS: Our investigations demonstrate that 5-HTTLPR (L>S polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene-environment interactions should

  13. HYPERMETHYLATION OF p14ARF PROMOTER REGION AND EXPRESION OF p14ARF GENE PRODUCT IN NON-SMALL CELL LUNG CANCER

    Institute of Scientific and Technical Information of China (English)

    TIAN Kai-hua; SHEN Yi; LUO Yi-rne; WANG Ming-zhao; LIU Hong-xu; ZHAO Hui-ru; ZHANG Lin

    2006-01-01

    Objective: This study was designed to investigate promoter methylation status and protein expression of p14ARF gene in non-small cell lung cancer, and value the role of p14ARF promoter methylation in carcinogenesis of non-small cell lung cancer. Methods: Promoter methylation status and protein expression of p14ARF gene in 40 cases of non-small cell lung cancer were analyzed by methylation specific polymerase china reaction (MSP), restriction enzyme-related polymerase chain reaction (RE-PCR) and immunohistochemistry (IHC). Results: The positive rates of p14ARF promoter methylation in tumor tissues and normal tissues adjacent to cancer were 17.5% (7/40) and 2.5% (1/40) respectively. There were statistically significant differences between them, P<0.05. The results of RE-PCR were consistent with that of MSP. The expression rate of p14ARF protein in tumor tissues was significantly lower than that in normal tissues adjacent to cancer, p<0.01. Promoter methylation status and protein expression of p14ARF gene in non-small cell lung cancer showed significantly an inverse correlation (r=-0.56, P<0.01), and both of them did not relate statistically with the clinicopathologic characteristics of patients such as histological classification, clinical stage, differentiation grade and lymph node involvement. Conclusion: Promoter methylation is a crucial mechanism of inactivation of p14ARF gene. Promoter methylation of p14ARF gene might be involved in carcinogenesis of non-small cell lung cancer, and is an early event in development process of non-small cell lung cancer. It might be used as a new target in gene treatments in the future.

  14. Distinct repressing modules on the distal region of the SBP2 promoter contribute to its vascular tissue-specific expression in different vegetative organs.

    Science.gov (United States)

    Freitas, Rejane L; Carvalho, Claudine M; Fietto, Luciano G; Loureiro, Marcelo E; Almeida, Andrea M; Fontes, Elizabeth P B

    2007-11-01

    The Glycine max sucrose binding protein (GmSBP2) promoter directs vascular tissue-specific expression of reporter genes in transgenic tobacco. Here we showed that an SBP2-GFP fusion protein under the control of the GmSBP2 promoter accumulates in the vascular tissues of vegetative organs, which is consistent with the proposed involvement of SBP in sucrose transport-dependent physiological processes. Through gain-of-function experiments we confirmed that the tissue-specific determinants of the SBP2 promoter reside in the distal cis-regulatory domain A, CRD-A (position -2000 to -700) that is organized into a modular configuration to suppress promoter activity in tissues other than vascular tissues. The four analyzed CRD-A sub-modules, designates Frag II (-1785/-1508), Frag III (-1507/-1237), Frag IV (-1236/-971) and Frag V (-970/-700), act independently to alter the constitutive pattern of -92pSBP2-mediated GUS expression in different organs. Frag V fused to -92pSBP2-GUS restored the tissue-specific pattern of the full-length promoter in the shoot apex, but not in other organs. Likewise, Frag IV confined GUS expression to the vascular bundle of leaves, whereas Frag II mediated vascular specific expression in roots. Strong stem expression-repressing elements were located at positions -1485 to -1212, as Frag III limited GUS expression to the inner phloem. We have also mapped a procambium silencer to the consensus sequence CAGTTnCaAccACATTcCT which is located in both distal and proximal upstream modules. Fusion of either repressing element-containing module to the constitutive -92pSBP2 promoter suppresses GUS expression in the elongation zone of roots. Together our results demonstrate the unusual aspect of distal sequences negatively controlling tissue-specificity of a plant promoter. PMID:17710554

  15. Draft Genome Sequence of Acinetobacter sp. Strain BMW17, a Cellulolytic and Plant Growth-Promoting Bacterium Isolated from the Rhizospheric Region of Phragmites karka of Chilika Lake, India.

    Science.gov (United States)

    Mishra, Samir R; Ray, Lopamudra; Panda, Ananta Narayan; Sahu, Neha; Xess, Sonal S; Jadhao, Sudhir; Suar, Mrutyunjay; Adhya, Tapan Kumar; Rastogi, Gurdeep; Pattnaik, Ajit Kumar; Raina, Vishakha

    2016-01-01

    We report the 3.16 Mb draft genome of Acinetobacter sp. strain BMW17, a Gram-negative bacterium in the class of Gammaproteobacteria, isolated from the rhizospheric region of Phragmites karka, an invasive weed in Chilika Lake, Odisha, India. The strain BMW17(T) is capable of degrading cellulose and is also an efficient plant growth promoter that can be useful for various phytoremedial and commercial applications. PMID:27365343

  16. Association of Mutations in the Basal Core Promoter and Pre-core Regions of the Hepatitis B Viral Genome and Longitudinal Changes in HBV Level in HBeAg Negative Individuals: Results From a Cohort Study in Northern Iran

    OpenAIRE

    Besharat, Sima; Poustchi, Hossein; Mohamadkhani, Ashraf; Katoonizadeh, Aezam; Moradi, Abdolvahab; Roshandel, Gholamreza; Freedman, Neal David; Malekzadeh, Reza

    2015-01-01

    Background: Although certain HBV mutations are known to affect the expression of Hepatitis e antigen, their association with HBV viral level or clinical outcomes is less clear. Objectives: We evaluated associations between different mutations in the Basal Core promoter (BCP) and Pre-core (PC) regions of HBV genome and subsequent changes in HBV viral DNA level over seven years in a population of untreated HBeAg negative chronic hepatitis B (CHB) participants in Northeast of Iran. Materials and...

  17. Draft Genome Sequence of Acinetobacter sp. Strain BMW17, a Cellulolytic and Plant Growth-Promoting Bacterium Isolated from the Rhizospheric Region of Phragmites karka of Chilika Lake, India

    Science.gov (United States)

    Mishra, Samir R.; Ray, Lopamudra; Panda, Ananta Narayan; Sahu, Neha; Xess, Sonal S.; Jadhao, Sudhir; Suar, Mrutyunjay; Adhya, Tapan Kumar; Rastogi, Gurdeep; Pattnaik, Ajit Kumar

    2016-01-01

    We report the 3.16 Mb draft genome of Acinetobacter sp. strain BMW17, a Gram-negative bacterium in the class of Gammaproteobacteria, isolated from the rhizospheric region of Phragmites karka, an invasive weed in Chilika Lake, Odisha, India. The strain BMW17T is capable of degrading cellulose and is also an efficient plant growth promoter that can be useful for various phytoremedial and commercial applications. PMID:27365343

  18. Investigating the influence of maternal cortisol and emotional state during pregnancy on the DNA methylation status of the glucocorticoid receptor gene (NR3C1) promoter region in cord blood

    OpenAIRE

    Verhaeghe, J.; Pexsters, A.; Freson, K.; Van den Bergh, B. R. H.; Fieuws, S.; Glover, V; de Bree, R.; Spitz, B; Claes, S.; Dom, M.; Demyttenaere, K.; Allegaert, K; Hompes, T.; Morreels, M.; Gellens, E

    2013-01-01

    Background: The methylation status of the human glucocorticoid receptor gene NR3C1 in newborns has been reported to be sensitive to prenatal maternal mood. This study investigates both the association between maternal cortisol and emotional state during pregnancy and the methylation state of the promoter region of NR3C1 gene. Methods: We examined 83 pregnant women. Psychological data and diurnal cortisol data were assessed to evaluate maternal stress once each trimester. DNA methylation at di...

  19. Promoting the health of Europeans in a rapidly changing world: a historical study of the implementation of World Health Organisation policies by the Nursing and Midwifery Unit, European Regional Office, 1970-2003

    DEFF Research Database (Denmark)

    Hallett, Christine; Wagner, Lis

    2011-01-01

    Organisation (WHO) was inaugurated in 1948. Formed in a period of post-war devastation, WHO aimed to develop and meet goals that would rebuild the health of shattered populations. The historical study reported here examined the work of the Nursing and Midwifery Unit (NMU) of WHO's European Regional Office......HALLETT C and WAGNER L. Nursing Inquiry 2011; 18: 359-368 Promoting the health of Europeans in a rapidly changing world: a historical study of the implementation of World Health Organisation policies by the Nursing and Midwifery Unit, European Regional Office, 1970-2003 The World Health...

  20. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

    Science.gov (United States)

    Jones, Sandra C.; Smith, Kylie M.

    2011-01-01

    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  1. ColE1 cloning of a ribosomal RNA promoter region from lambdarifsup(d)18 by selection for lambda integration and excision functions

    International Nuclear Information System (INIS)

    The expression of the ribosomal RNA gene carried by the lambda transducing phage lambdarifsup(d)18 is shown to be subject to stringent amino acid control. lambdarifsup(d)18 DNA was digested with endonuclease EcoRI and ligated to similarly restricted ColE1 plasmid DNA. Selection for expression of lambda integration and excision gene activity carried by the same DNA fragment results in cloning of the promoter proximal portion of the 16S ribosomal RNA gene. The resulting chimera expresses lambda integration and excision functions as well as encoding the promoter proximal half of a 16S ribosomal RNA gene. The effect of ultraviolet dose on stringent control of phage lambdarifsup(d)18 dependent ribosomal RNA synthesis is included in the investigation. (Auth.)

  2. Performance of health product risk management and surveillance conducted by health personnel at sub-district health promotion hospitals in the northeast region of Thailand

    OpenAIRE

    Kanjanarach T; Jaisa-ard R; Poonaovarat N

    2014-01-01

    Tipaporn Kanjanarach,1,2 Raksaworn Jaisa-ard,1,2 Nantawan Poonaovarat3 1Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand; 2Center for Research and Development of Herbal Health Products, Khon Kaen University, Khon Kaen, Thailand; 3Health Consumer Protection, Chaiyapum Health Provincial Office, Chaiyapum, Thailand Background: Health personnel at sub-district health promotion hospitals (SD-HPHs) are assigned to take responsibility for 15 activities related to health...

  3. Altered DNA methylation patterns of the H19 differentially methylated region and the DAZL gene promoter are associated with defective human sperm.

    Directory of Open Access Journals (Sweden)

    Bo Li

    Full Text Available DNA methylation disturbance is associated with defective human sperm. However, oligozoospermia (OZ and asthenozoospermia (AZ usually present together, and the relationship between the single-phenotype defects in human sperm and DNA methylation is poorly understood. In this study, 20 infertile OZ patients and 20 infertile AZ patients were compared with 20 fertile normozoospermic men. Bisulfate-specific PCR was used to analyze DNA methylation of the H19-DMR and the DAZL promoter in these subjects. A similar DNA methylation pattern of the H19-DMR was detected in AZ and NZ(control, with only complete methylation and mild hypomethylation(0.05. However, the methylation pattern of severe hypomethylation (>50% unmethylated CpGs and complete unmethylation was only detected in 5 OZ patients, and the occurrence of these two methylation patterns was 8.54±10.86% and 9±6.06%, respectively. Loss of DNA methylation of the H19-DMR in the OZ patients was found to mainly occur in CTCF-binding site 6, with occurrence of 18.15±14.71%, which was much higher than that in patients with NZ (0.84±2.05% and AZ (0.58±1.77% (P20% methylated clones in the DAZL promoter only in infertile patients, there was no significant difference between the AZ and OZ patients in the proportion of moderately-to-severely hypermethylated clones (p>0.05. In all cases, global sperm genome methylation analyses, using LINE1 transposon as the indicator, showed that dysregulation of DNA methylation is specifically associated with the H19-DMR and DAZL promoter. Therefore, abnormal DNA methylation status of H19-DMR, especially at the CTCF-binding site 6, is closely associated with OZ. Abnormal DNA methylation of the DAZL promoter might represent an epigenetic marker of male infertility.

  4. Association of-238G/A and -857C/T Polymorphisms of Tumor Necrosis Factor-Alpha Gene Promoter Region With Outcomes of Hepatitis B Virus Infection

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    To determine whether -238G/A and -857C/T polymorphisms of tumor necrosis factor-alpha (TNF-α) gene promoter were associated with outcomes of hepatitis B virus infection. Methods A total of 246 HBV self-limited infected subjects and 443 chronic hepatitis B (HB) patients were recruited in this case-control study. TNF-α-238G/A and -857C/T gene promoter polymorphisms were examined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).Results The frequency of TNF-α-238 GG (90.7%) in chronic HB group was significantly lower than that (95.1%) in self-limited group (P=0.041). The frequency of TNF-α-857 CC (79.7%) in chronic HB patients was significantly higher than that (70.9%) in self-limited infected subjects (P=0.021). Multiple logistic regression analysis revealed that both TNF-α-238GA and -857CC were independently associated with chronic HB. Conclusions TNF-α promoter variants are likely to play a substantial role in influencing the outcomes of HBV infection.

  5. Mucin1 promotes the migration and invasion of hepatocellular carcinoma cells via JNK-mediated phosphorylation of Smad2 at the C-terminal and linker regions

    OpenAIRE

    Wang, Juan; Liu, Guomu; Li, Qiongshu; Wang, Fang; Xie, Fei; Zhai, Ruiping; Guo, YingYing; Chen, Tanxiu; Zhang, Nannan; Ni, Weihua; Yuan, Hongyan; TAI, GUIXIANG

    2015-01-01

    Mucin1 (MUC1), as an oncogene, plays a key role in the progression and tumorigenesis of many human adenocarcinomas. In this study, wound-healing, transwell migration and matrigel invasion assays showed that MUC1 promotes human hepatocellular carcinoma (HCC) cell migration and invasion by MUC1 gene silencing and overexpressing. Treatment with exogenous transforming growth factor beta (TGF-β)1, TGF-β type I receptor (TβRI) inhibitor, TGF-β1 siRNAs, or activator protein 1 (AP-1) inhibitor to MUC...

  6. Regional distribution of body fat in relation to DNA methylation within the LPL, ADIPOQ and PPAR{gamma} promoters in subcutaneous adipose tissue

    OpenAIRE

    Drogan, D.; Boeing, H.; Janke, J.; Schmitt, B; Zhou, Y.; Walter, J; Pischon, T; Tierling, S

    2015-01-01

    Obesity may be related to differential DNA methylation and thus to differential expression of key genes in adipose tissue metabolism, such as LPL, ADIPOQ and PPAR{gamma}. Using subcutaneous adipose tissue (SAT) from 59 individuals of the European Prospective Investigation into Cancer and Nutrition-Potsdam study, we performed quantitative DNA methylation analysis within the promoters of LPL (LPL-CG1 and -CG2), ADIPOQ (ADIPOQ-CG1 and-CG2) and PPAR{gamma} (PPAR{gamma}-CG1). We then studied DNA m...

  7. The genomic landscapes of histone H3-Lys9 modifications of gene promoter regions and expression profiles in human bone marrow mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Mesenchymal stem cells (MSCs) of nonembryortic origins possess the proliferation and multi-lineage differentiation potentials. It has been established that epigenetic mechanisms could be critical for determining the fate of stem ceils, and MSCs derived from different origins exhibited different expression profiles individually to a certain extent. In this study, ChiP-on-chip was used to generate genome-wide historic H3-Lys9 acetylation and dimethylation profiles at gene promoters in human bone marrow MSCs. We showed that modifications of histone H3-Lys9 at gene promoters correlated well with mRNA expression in human bone marrow MSCs. Functional analysis revealed that many key cellular pathways in human bone marrow MSC self-renewal, such as the canonical signaling pathways,cell cycle pathways and cytokine related pathways may be regulated by H3-Lys9 modifications. These data suggest that gene activation and silencing affected by H3-Lys9 acetylation and dimethylation, respectively, may be essential to the maintenance of human bone marrow MSC self-renewal and multi-potency.

  8. A leader intron and 115-bp promoter region necessary for expression of the carnation S-adenosylmethionine decarboxylase gene in the pollen of transgenic tobacco.

    Science.gov (United States)

    Kim, Young Jin; Lee, Sun Hi; Park, Ky Young

    2004-12-17

    The expression of CSDC9 encoding S-adenosylmethionine decarboxylase (SAMDC) is developmentally and spatially regulated in carnation. To examine the regulation of the SAMDC gene, we analyzed the spatial expression of CSDC9 with a 5'-flanking beta-glucuronidase fusion in transgenic tobacco plants. GUS was strongly expressed in flower, pollen, stem and vein of cotyledons. Expression in both anther and stigma was under developmental control; analysis of a series of mutants with deletions of the 5'-flanking region demonstrated differential activation in petal, anther, stigma and pollen grains. All the major cis-regulatory elements required for pollen-specific transcription were located in the upstream region between -273 and -158. This region contains four putative elements related to gibberellin induction (pyrimidine boxes, TTTTTTCC and CCTTTT) and pollen-specific expression (GTGA and AGAAA). In addition, the first 5'-leader intron was necessary for tissue-specific expression. PMID:15589825

  9. Metazoan promoters

    DEFF Research Database (Denmark)

    Lenhard, Boris; Sandelin, Albin Gustav; Carninci, Piero

    2012-01-01

    Promoters are crucial for gene regulation. They vary greatly in terms of associated regulatory elements, sequence motifs, the choice of transcription start sites and other features. Several technologies that harness next-generation sequencing have enabled recent advances in identifying promoters ...

  10. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...... - an associate professorship was established with a focus on health promotion. Nevertheless, the concept of health promotion had been integrated with or mentioned in courses run prior to the new post. Subsequently, a wide spectrum of courses in health promotion was introduced, such as Empowerment for Child...

  11. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard;

    2013-01-01

    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive...... M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  12. Promoter region of the bovine growth hormone receptor gene: single nucleotide polymorphism discovery in cattle and association with performance in Brangus bulls.

    Science.gov (United States)

    Garrett, A J; Rincon, G; Medrano, J F; Elzo, M A; Silver, G A; Thomas, M G

    2008-12-01

    Expression of the GH receptor (GHR) gene and its binding with GH is essential for growth and fat metabolism. A GT microsatellite exists in the promoter of bovine GHR segregating short (11 bp) and long (16 to 20 bp) allele sequences. To detect SNP and complete an association study of genotype to phenotype, we resequenced a 1,195-bp fragment of DNA including the GT microsatellite and exon 1A. Resequencing was completed in 48 familialy unrelated Holstein, Jersey, Brown Swiss, Simmental, Angus, Brahman, and Brangus cattle. Nine SNP were identified. Phylogeny analyses revealed minor distance (i.e., Brangus was intermediate. An association study of genotype to phenotype was completed with data from growing Brangus bulls (n = 553 from 96 sires) and data from 4 of the SNP flanking the GT microsatellite. These SNP were found to be in Hardy-Weinberg equilibrium and in phase based on linkage disequilibrium analyses (r(2) = 0.84 and D'= 0.92). An A/G tag SNP was identified (ss86273136) and was located in exon 1A, which began 88 bp downstream from the GT microsatellite. Minor allele frequency of the tag SNP was greater than 10%, and Mendelian segregation was verified in 3 generation pedigrees. The A allele was derived from Brahman, and the G allele was derived from Angus. This tag SNP genotype was a significant effect in analyses of rib fat data collected with ultrasound when bulls were ~365 d of age. Specifically, bulls of the GG genotype had 6.1% more (P = 0.0204) rib fat than bulls of the AA and AG genotypes, respectively. Tag SNP (ss86273136), located in the promoter of GHR, appears to be associated with a measure of corporal fat in Bos taurus x Bos indicus composite cattle. PMID:18676722

  13. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide. PMID:6462088

  14. INNOVATION FOR POVERTY REDUCTION WITH INCLUSION IN THE ANDEAN REGION.Panorama Andino - Learning from case studies on locally promoted innovation experiences

    OpenAIRE

    Fernandez-Baca, Edith; Paz Montoya, María; Yañez, Natalia

    2010-01-01

    Agricultural systems in the Andes are going through significant amounts of transformation and are being affected by new dynamics (i.e. globalization, climate change, migration, urbanization). In this context, local communities are developing creative responses and adjustments to these changes through the innovation of agricultural systems. What is the true innovation system that exists in the region? This question recognizes that there is a new reality evolving within innovation systems in th...

  15. Structure of the bovine pancreatic ribonuclease gene: the unique intervening sequence in the 5' untranslated region contains a promoter-like element.

    OpenAIRE

    Carsana, A; Confalone, E; Palmieri, M; Libonati, M; Furia, A

    1988-01-01

    Although pancreatic ribonucleases are extensively studied proteins, little information is available on nucleic acids coding for these enzymes. Here, for the first time, the structure of a gene coding for such an enzyme, the well known bovine pancreatic ribonuclease, is reported. The coding region of this gene is devoid of introns, whereas the 5' untranslated sequence of the pancreatic transcript contains an intron of 735 nucleotides. This intervening sequence is endowed with signals (CAAT and...

  16. Report of the researcher exchange promotion project on the environmental issues in the Asia-Pacific region; Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Proposals have been made for the establishment of a network (ETERNET-APR) linking those involved in the research and development of environmental technology in the Asia-Pacific region in order to limit the environmental impact of industrial activity. By pursuing active exchanges of information and personnel, researchers in environmental technology in the Asia-Pacific region have been making serious efforts to establish such a network. This fiscal year, the Internet Web site of the ETERNET-APR has been created using the data collected to date. This database includes information on some 350 researchers and 200 research projects from seven countries. The first international symposium was successfully held at Environmental Research Institute of Chulalongkorn University in Thailand (ERIC), hosting 200 environmental researchers from 10 countries in the Asia-Pacific region. Tripartite sister laboratories ties among the National Institute for Resources and Environment (NIRE) and three Korean laboratories were forged. The sister laboratory project between ICETT and ERIC is also proving effective. These successes prove that intraregional joint research, the objective of ETERNET-APR, has begun to take shape in this year

  17. Identification of Single Nucleotide Polymorphisms in the Promoter Region of PRPS2 Gene%PRPS2基因启动子区的单核苷酸多态性

    Institute of Scientific and Technical Information of China (English)

    尹艳慧; 朱迅

    2003-01-01

    Sequence variation in human genes is largely confined to single-nucleotide polymophisms (SNPs) and is valuable in test of association with common disease and pharmacogenetic traits. To detect SNPs in the promoter region of phosphoribosyl pyrophosphate synthetase subunit Ⅱ(PRPS2) gene, multiple fluorescence-based PCR-single strand conformation polymorphism (MF-PCR-SSCP) analysis was used. To assess the nature and pattern of SNPs, sequencing was performed. Two SNPs (-1079 t/c, -1110 a/g) were identified in the analyzed 1.5 kb promoter region of PRPS2 gene. The results provided new data for SNPs in PRPS2 gene.%人类基因组变异主要以单核苷酸多态性(SNPs)为主.采用多荧光标记的PCR单链构象多态性分析法(MF-PCR-SSCP)对磷酰核糖焦磷酸合成酶亚基Ⅱ(PRPS2)基因启动子区的序列进行了SNP的筛选,对筛选到的阳性片段进行序列分析以确定SNP的类型及位置.在1.5 kb的启动子区发现了2个SNP (-1079 t/c, -1110 a/g). 研究结果为PRPS2基因SNPs的数据库提供了新的信息.

  18. Possible consequences of the overlap between the CaMV 35S promoter regions in plant transformation vectors used and the viral gene VI in transgenic plants.

    Science.gov (United States)

    Podevin, Nancy; du Jardin, Patrick

    2012-01-01

    Multiple variants of the Cauliflower mosaic virus 35S promoter (P35S) are used to drive the expression of transgenes in genetically modified plants, for both research purposes and commercial applications. The genetic organization of the densely packed genome of this virus results in sequence overlap between P35S and viral gene VI, encoding the multifunctional P6 protein. The present paper investigates whether introduction of P35S variants by genetic transformation is likely to result in the expression of functional domains of the P6 protein and in potential impacts in transgenic plants. A bioinformatic analysis was performed to assess the safety for human and animal health of putative translation products of gene VI overlapping P35S. No relevant similarity was identified between the putative peptides and known allergens and toxins, using different databases. From a literature study it became clear that long variants of the P35S do contain an open reading frame, when expressed, might result in unintended phenotypic changes. A flowchart is proposed to evaluate possible unintended effects in plant transformants, based on the DNA sequence actually introduced and on the plant phenotype, taking into account the known effects of ectopically expressed P6 domains in model plants. PMID:22892689

  19. Plant growth-promoting Pseudomonas sp. Strains reduce natural occurrence of anthracnose in soybean (Glycine max L.) in central Himalayan region.

    Science.gov (United States)

    Tripathi, Manisha; Johri, Bhavdish N; Sharma, Alok

    2006-05-01

    Biological control is an accepted important component of current plant disease management strategies. Introduction of bacterized seeds carrying bacterial isolates with proven growth-promotion capabilities and antagonistic characteristics offer a valid alternative to chemical protectants. Root colonization of disease-susceptible (PS 1024) and moderately resistant (PS1042) varieties of soyabean (Glycine Max L) by fluorescent pseudomonad (FLPs) strains GRP3, PEn-4, PRS1, and WRS-24 was studied in relation to natural occurrence of anthracnose caused by Colletotrichum dematium (Pers Ex Fr.) Grove. Rhizoplane population of FLPs was maintained at a critical level (5.3 cfu) up to 30 days of plant growth, followed by a steep decline. Indigenous FLPs population, however, remained nearly unchanged (3.0 to 2.4 log g(-1) root) between 30 days and 75 days of plant growth. The relative FLPs population in rhizosphere was lower than that in rhizoplane. Although intervarietal difference was observed, the root/shoot length remained unaffected. Compared to nonbacterized control, dry root weight was improved by FLPs treatment. Severity of foliar anthracnose was reduced significantly after FLPs treatment in the variety PS 1042. Because the point of FLPs treatment (seed bacterization) was away from the site of disease appearance (leaf), operation of induced systemic resistance in strains PEn-4 and GRP3 appears imminent. PMID:16604418

  20. In vivo binding of hot pepper bZIP transcription factor CabZIP1 to the G-box region of pathogenesis-related protein 1 promoter

    International Nuclear Information System (INIS)

    We find that salicylic acid and ethephon treatment in hot pepper increases the expression of a putative basic/leucine zipper (bZIP) transcription factor gene, CabZIP1. CabZIP1 mRNA is expressed ubiquitously in various organs. The green fluorescent protein-fused transcription factor, CabZIP1::GFP, can be specifically localized to the nucleus, an action that is consistent with the presence of a nuclear localization signal in its protein sequence. Transient overexpression of the CabZIP1 transcription factor results in an increase in PR-1 transcripts level in Nicotiana benthamiana leaves. Using chromatin immunoprecipitation, we demonstrate that CabZIP1 binds to the G-box elements in native promoter of the hot pepper pathogenesis-related protein 1 (CaPR-1) gene in vivo. Taken together, our results suggest that CabZIP1 plays a role as a transcriptional regulator of the CaPR-1 gene

  1. Serum osteoprotegerin (OPG) and the A163G polymorphism in the OPG promoter region are related to peripheral measures of bone mass and fracture odds ratios

    DEFF Research Database (Denmark)

    Jørgensen, Henrik L; Kusk, Philip; Madsen, Bente Elmfelt; Fenger, Mogens; Lauritzen, Jes B

    2004-01-01

    The purpose of this study is to investigate the association of serum osteoprotegerin (OPG) and the A163G polymorphism in the OPG promoter with peripheral measures of bone mass and with odds ratios for wrist and hip fracture in a case-control study of postmenopausal Danish women. The study included...... 66 women with lower forearm fracture, 41 women with hip fracture, and 206 age-matched controls. All had broadband ultrasound attenuation (BUA) and speed of sound (SOS) measured at the heel as well as bone mineral density (BMD) measured by DXA at the distal forearm. S-OPG was measured by ELISA. The A...... the controls. Patients with a combination of the highest quartile of S-OPG and presence of the G allele ( n = 23) had a significantly elevated fracture odds ratio, 4.0 (95% CI, 1.7-9.9). A significant negative association between S-OPG with peripheral measures of bone mass and with increased fracture...

  2. Survey report for fiscal 1997. Survey on publicity measures for promotion of new energy introduction in Tohoku region; 1997 nendo chosa hokokusho. Tohoku chiiki ni okeru shin energy donyu sokushin koho taisaku chosa

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    In order to discuss mainly on publicity measures for how to promote new energy introduction in the Tohoku region, items of information were collected and put into order for the state of utilization of new energies in this region, and fundamental materials were prepared. Facilities having introduced new energies by public bodies in the Tohoku area include the prefectural office buildings, town and village office buildings, schools, community centers, welfare facilities such as aged people's centers and hospitals, sports facilities, parks, sewage treatment plants, and refuse incineration plants. The actual record of the introduction in the Tohoku region shows greater number of cases utilizing natural energies. Utilization of recycled energy and high-efficiency energy such as regional heat supply is less because of fewer number of areas built up densely with buildings and factories, with exception of some cases of utilization by the consumer sector. Introduction of clean energy fueled automobiles is little excepting electric vehicles used by the electric power company. Number of natural gas fueled automobiles that have been introduced is few because the infrastructural build-up has not been advanced in the natural gas supply network. (NEDO)

  3. The N-terminal region of the 37-kDa translocated fragment of Pseudomonas exotoxin A aborts translocation by promoting its own export after microsomal membrane insertion.

    OpenAIRE

    Theuer, C P; Buchner, J; Fitzgerald, D; Pastan, I

    1993-01-01

    The 37-kDa C-terminal fragment of Pseudomonas exotoxin A (PE; termed PE37 and composed of aa 280-613 of PE) translocates to the cell cytosol to cause cell death. PE37 requires a C-terminal endoplasmic reticulum retention sequence to be cytotoxic, indicating that the toxin may translocate to the cytosol from the endoplasmic reticulum. We show here that the N-terminal region of nascent PE37 can be inserted into the membrane of canine pancreatic microsomes by the preprocecropin signal sequence b...

  4. 论区域推进课堂教学改革的策略%The Promotion Strategy of Regional Class Reform

    Institute of Scientific and Technical Information of China (English)

    张金华

    2015-01-01

    区域推进课堂教学改革,是促进基础教育均衡发展、全面提升教育教学质量的关键。区域推进课堂教学改革是一个系统工程,需要强化区域的角色意识、明确课堂改革的目标、建立课堂改革的样本,更需要从创新机制、重构学校文化、分层推动、强化督导效能等多方面来寻求策略。%Regional class reform is a key to balance the development of primary education and the quality. It is a systematic procedure, which requires a strong awareness of regional role, a definite goal, and a sample. The strategy based on creative mechanism, cultural reconstruction, hierarchical propulsion, and intensified supervision, is even more important.

  5. Performance of health product risk management and surveillance conducted by health personnel at sub-district health promotion hospitals in the northeast region of Thailand

    Directory of Open Access Journals (Sweden)

    Kanjanarach T

    2014-10-01

    Full Text Available Tipaporn Kanjanarach,1,2 Raksaworn Jaisa-ard,1,2 Nantawan Poonaovarat3 1Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand; 2Center for Research and Development of Herbal Health Products, Khon Kaen University, Khon Kaen, Thailand; 3Health Consumer Protection, Chaiyapum Health Provincial Office, Chaiyapum, Thailand Background: Health personnel at sub-district health promotion hospitals (SD-HPHs are assigned to take responsibility for 15 activities related to health product risk management and surveillance (HP-RM&S. This cross-sectional survey aimed to identify factors that determined their job performance and to record their expressed needs to support HP-RM&S operation. In this study, job performance was defined as completion of all 15 activities. Methods: Self-administered postal questionnaires were used to collect data from 380 randomly selected health personnel who were in charge of HP-RM&S at SD-HPHs in the northeast of Thailand. Results: Thirty-six point one percent (n=137 of the respondents were able to perform all 15 of the HP-RM&S activities assigned to SD-HPHs. A logistic regression model identified three factors that statistically significantly determined the completion of all 15 HP-RM&S activities. These were: receiving a high or very high level of support from the community (adjusted odds ratio [OR]: 2.5; 95% confidence interval [CI]: 1.5, 4.1, the responsible persons for HP-RM&S did not hold an administrative position (adjusted OR: 1.7; 95% CI: 1.1, 2.7, and having at least one training session related to HP-RM&S per year (adjusted OR: 1.7; 95% CI 1.1, 2.6. There were 1,536 expressed needs which can be classified into four major categories, ie, training needs (41.6%, n=639, resource support (28.3%, n=435, mechanisms that facilitate HP-RM&S operation (24.1%, n=370 and adjusting of the scope of HP-RM&S (6.0%, n=92. The topics most frequently referred to in training needs were drug law, food law, and cosmetics

  6. Lack of association between rs1800795 (-174 G/C) polymorphism in the promoter region of interleukin-6 gene and susceptibility to type 2 diabetes in Isfahan population

    Science.gov (United States)

    Ghavimi, Reza; Sharifi, Mohammadreza; Mohaghegh, Mohammad Ali; Mohammadian, Hossein; Khadempar, Saedeh; Rezaei, Hamzeh

    2016-01-01

    Background: Type 2 diabetes mellitus (T2DM) is an inflammatory autoimmune disease that mostly affects older adults. The etiology of T2DM includes both genetic and environmental factors. rs1800795 (−174 G/C) single nucleotide polymorphism (SNP) linked with autoimmune disorders predispositions, identified by Genome-Wide Association Study among genes, which immunologically related is considerably over signified. The goal of this study was to evaluate the association between rs1800795 (−174 G/C) polymorphisms in the promoter of interleukin-6 (IL-6) gene with susceptibility to T2DM in a subset of the Iranian population. Materials and Methods: In this case–control study, 120 healthy subjects and 120 patients with T2DM were included. Genomic DNA obtained from whole blood samples and the polymerase chain reaction was used to amplify the fragment of interest contain rs1800795 SNP, restriction fragment length polymorphism method was applied for genotyping of the DNA samples with NlaIII as a restriction enzyme. SPSS for Windows software (version 18.0, SPSS, Chicago, IL, USA) was performed for statistical analysis. Results: No significant differences were found between healthy controls and T2DM patients with respect to the frequency distribution of the cytokine gene polymorphism investigated. Odds ratio, adjusted for sex, age, and smoking status has displayed similar outcomes. Conclusion: These results indicated that the rs1800795 SNP is not a susceptibility gene variant for the development of T2DM in the Isfahan population. Further studies using new data on complex transcriptional interactions between IL-6 polymorphic sites are necessary to determine IL-6 haplotype influence on susceptibility to T2DM. PMID:26962520

  7. Sensitivity of MLL-rearranged AML cells to all-trans retinoic acid is associated with the level of H3K4me2 in the RARα promoter region

    International Nuclear Information System (INIS)

    All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML

  8. A Salmonella typhimurium-translocated Glycerophospholipid:Cholesterol Acyltransferase Promotes Virulence by Binding to the RhoA Protein Switch Regions

    Energy Technology Data Exchange (ETDEWEB)

    LaRock, Doris L.; Brzovic, Peter S.; Levin, Itay; Blanc, Marie-Pierre; Miller, Samuel I.

    2012-08-24

    Salmonella enterica serovar typhimurium translocates a glycerophospholipid: cholesterol acyltransferase (SseJ) into the host cytosol after its entry into mammalian cells. SseJ is recruited to the cytoplasmic face of the host cell phagosome membrane where it is activated upon binding the small GTPase, RhoA. SseJ is regulated similarly to cognate eukaryotic effectors, as only the GTP-bound form of RhoA family members stimulates enzymatic activity. Using NMR and biochemistry, this work demonstrates that SseJ competes effectively with Rhotekin, ROCK, and PKN1 in binding to a similar RhoA surface. The RhoA surface that binds SseJ includes the regulatory switch regions that control activation of mammalian effectors. These data were used to create RhoA mutants with altered SseJ binding and activation. This structure-function analysis supports a model in which SseJ activation occurs predominantly through binding to residues within switch region II. We further defined the nature of the interaction between SseJ and RhoA by constructing SseJ mutants in the RhoA binding surface. These data indicate that SseJ binding to RhoA is required for recruitment of SseJ to the endosomal network and for full Salmonella virulence for inbred susceptible mice, indicating that regulation of SseJ by small GTPases is an important virulence strategy of this bacterial pathogen. The dependence of a bacterial effector on regulation by a mammalian GTPase defines further how intimately host pathogen interactions have coevolved through similar and divergent evolutionary strategies.

  9. On Optimization of Promotion Strategies for Cross-regional Diffusion of New Product%新产品跨区域扩散的促销策略优化

    Institute of Scientific and Technical Information of China (English)

    胡知能; 张鹏

    2012-01-01

    针对新产品跨区域的扩散问题,将市场分为本地市场和外地市场,并考虑本地市场对外地市场产生的影响.通过改进的Bass扩散模型,进行以价格策略组合和免费商品赠送为促销策略的优化分析,探讨区域扩散过程中两地市场的扩散情形.数值分析结果表明:在产品促销策略中,赠样会促进产品扩散,渗透价格策略最优;本地市场对外地市场产品的扩散存在促进作用;考虑重复购买行为时,促销策略产生的效果不变.灵敏度分析表明外部影响率对各自市场的赠样水平存在较大的负影响,但对非自身市场负影响较小;本地市场对外地市场的影响率和/或批量购买量越大,本地市场就越值得采用赠样,但外地市场则越不值得.%For regional diffusion of a new product, this paper divides product market into a local market and a foreign market and presents a model group of regional diffusion of new product,considering the impact of the local market on the foreign market. Then, based on the improved Bass diffusion model, the paper explores the effect of pricing mix, the optimum promotion mix, and the diffusion process of the local and the foreign market. The analysis of model group indicates below:for promotion strategies,sampling can promote the diffusion of the new product; penetration price strategy is the best one. In addition, the diffusion of the local market has a positive influence on the diffusion of the foreign market; promotion strategies have the same effect when considering repeat purchase. The sensitivity analysis indicates that the external innovation coefficients have more negative impact for self-market, but less for non-self market;as the effect of the local market on the foreign market, and/or the multiple units of purchase increase, the local market is more using sampling; however, the foreign market is worthess.

  10. Polymorphism in the regulatory region located more than 1.1 kilobases 5' to the start site of transcription, the promoter region, and exon 1 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Sørensen, Steen; Morling, Niels

    1999-01-01

    The non-classic Human Leucocyte Antigen class Ib molecule, HLA-G, is expressed on the invasive, extra-villous cytotrophoblast in human placenta. HLA-G protects against natural killer (NK)-cell-mediated lysis and may modulate the secretion of cytokines. Aberrant expression of HLA-G has been reported...... can be divided into two groups based on the detected polymorphism. The nucleotide substitutions may have implications for the binding of nuclear factors to the regulatory regions. To our knowledge this is the first study of any polymorphism in the 5'-flanking sequences to the HLA-G gene. Further...

  11. Report on fiscal 1995 project to promote an exchange of researchers on environmental problems in the Asia-Pacific region; 1995 nendo itakujigyo (Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    For the purpose of solving environmental problems caused in association with the increasing industrial activities in the Asia-Pacific region, the construction of a research network is being advanced aiming at promoting exchanges with researchers of other countries and activating information exchanges. Investigators were sent overseas to grasp the present situation, and researchers participated in a symposium on the APEC environmental technology cooperation for mutual understanding and personal interchange. In the overseas survey, visits were paid mainly to national research institutes and universities in India and Thailand. Positive approval was obtained on the construction of the ETERNET APR (Environmental Technology Research Network in the Asia-Pacific Region). In the symposium on the APEC environmental technology cooperation held in Nagoya, researchers participated mostly in the second session and made earnest discussions with researchers from other countries. The necessity and importance of the network was emphasized. Countries which participated the symposium have problems common to each, and it was greatly significant to meet together and discuss together. The environmental problem is on a global scale, and it is necessary to make close exchange/interchange of information/opinion on a long term basis and to tackle it in the whole Asia-Pacific region. 3 tabs.

  12. Promoting Models

    Science.gov (United States)

    Li, Qin; Zhao, Yongxin; Wu, Xiaofeng; Liu, Si

    There can be multitudinous models specifying aspects of the same system. Each model has a bias towards one aspect. These models often override in specific aspects though they have different expressions. A specification written in one model can be refined by introducing additional information from other models. The paper proposes a concept of promoting models which is a methodology to obtain refinements with support from cooperating models. It refines a primary model by integrating the information from a secondary model. The promotion principle is not merely an academic point, but also a reliable and robust engineering technique which can be used to develop software and hardware systems. It can also check the consistency between two specifications from different models. A case of modeling a simple online shopping system with the cooperation of the guarded design model and CSP model illustrates the practicability of the promotion principle.

  13. A regional epidemiology of India′s "NCD′s risk factors" focusing particularly on Maharashtra: A call for "Health promotion" once again

    Directory of Open Access Journals (Sweden)

    Balu Natha Mote

    2016-01-01

    Full Text Available Introduction: Noncommunicable diseases (NCDs are the leading causes of death globally; almost two-thirds of all deaths are due to NCDs. The International Diabetes Federation noted that India′s prevalence of diabetes among 20-79-year-old is 9.09%. India has 65 million of diabetes cases which will rise to 109 million by 2035, only second to China which has 98 million diabetics that will increase to about 142.7 million by 2035. Today′s investment in rupees on NCDs will save our millions lives and rupees in future attributed to NCDs. Ministry of health and family welfare survey of 2012-2013 districts levels survey-4 involved the variables of NCD′s risk factors. Materials and Methods: The present study analyzed the available data of NCD′s risk factors (17 states available data and district wise data of Maharashtra, particularly blood sugar and hypertension for these states, which were available on the websites of ministry. Results: Prevalence of "risk factors" of NCDs, particularly "raised blood sugar (hyperglycemia" and "raised blood pressure (hypertension" found more in North Indian people followed by South Indian and North-East people. In case of focused state of Maharashtra, percentages of people affected with hyperglycemia found in rest of Maharashtra (ROM followed by Marathwada whereas raised hypertension were found more in ROM followed by Vidarbha region indicating future mortality and morbidity associated with NCDs. Conclusion: "Strong and separate health education program" is needed at central level for the intervention and prevention of "risk of future NCD′s risk factors" to tackle the upcoming burden and cost associated with NCDs.

  14. Report on the project for spread/promotion of technology for the industrial waste optimized treatment in the Asian region (International Symposium `98); Asia chiiki sangyo haikibutsu tekiseika shori gijutsu nado fukyu sokushin jigyo (symposium kaisai) hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    In Japan and Asian countries, the optimized treatment of industrial waste is the problem with the economic growth. Border-crossing movement of the waste for promotion of the renewable use is also a problem. Therefore, the International Symposium `98 on the industrial waste problem in the Asian region was held. China, Thailand, the Philippines and Korea were invited to Japan to give lectures. MITI of Japan reported on the present situation of Japan and the cooperation with Asian countries. The industrial circle reported on efforts for environmental protection measures to be taken, the industrial waste problem at companies which advanced into Asian countries, effects of the Basel Convention on recycling activities, Japan`s role in Asia, etc. In the panel discussion, promotion of cooperation for recycling technology and Japan`s support for formulating strategy on the industrial waste were requested to Japan, and the construction of an Asian area network was proposed. Concerning the cooperative system between governments and private companies, it was concluded that it was necessary to discuss it considering the actual state of each country. Importance of recycle and information exchange was realized again. 10 refs., 15 figs., 27 tabs.

  15. Research and Demonstration of the Informatization Promotion Strategy in the Regional Rural Area of Hubei Province%湖北区域农村信息化推进策略研究与示范

    Institute of Scientific and Technical Information of China (English)

    张鹏飞

    2011-01-01

    In order to meet the new requirements in the development of the rural informatization in the new period, the perfection of the informatization service organization and the innovation in the informatization service mechanism is mainly based on the acceleration of the industrialized operation of agriculture, the people' s live hood services, and the advance of the new countryside construction as well as the improvement of the coordinative urban-rural development which based on the informatization. The application and demonstration of rural informatization is deepened with the promotion of the development of informatization technology. This article aims at researching the informatization promotion strategy in the regional rural area of Huibei Province and the application and demonstration by areas.%为适应新时期农村信息化发展的新要求,以信息化建设加快农业产业化步伐,服务民生发展,推进新农村建设,促进城乡统筹发展为主线,完善信息化服务组织,创新信息化服务机制,在推动信息化技术发展的基础上,深化农村信息化应用示范.着重研究湖北省区域农村信息化推进策略,并按区域进行示范应用.

  16. A suppressive effect of Sp1 recruitment to the first leader 5' splice site region on L4-22K-mediated activation of the adenovirus major late promoter.

    Science.gov (United States)

    Lan, Susan; Östberg, Sara; Punga, Tanel; Akusjärvi, Göran

    2015-12-01

    Transcription from the adenovirus major late promoter (MLP) requires binding of late phase-specific factors to the so-called DE element located approximately 100 base pairs downstream of the MLP transcriptional start site. The adenovirus L4-22K protein binds to the DE element and stimulates transcription from the MLP via a DE sequence-dependent mechanism. Here we use a transient expression approach to show that L4-22K binds to an additional site downstream of the MLP start site, the so-called R1 region, which includes the major late first leader 5' splice site. Binding of L4-22K to R1 has a suppressive effect on MLP transcription. L4-22K binds to the distal part of R1 and stimulates the recruitment of Sp1 and other cellular factors to a site overlapping the first leader 5' splice site. Binding of Sp1 to the 5' splice site region had an inhibitory effect on L4-22K-activated MLP transcription. PMID:26247419

  17. Single amino acid changes in the 6K1-CI region can promote the alternative adaptation of Prunus- and Nicotiana-propagated Plum pox virus C isolates to either host.

    Science.gov (United States)

    Calvo, María; Malinowski, Tadeusz; García, Juan Antonio

    2014-02-01

    Plum pox virus (PPV) C is one of the less common PPV strains and specifically infects cherry trees in nature. Making use of two PPV-C isolates that display different pathogenicity features, i.e., SwCMp, which had been adapted to Nicotiana species, and BY101, which had been isolated from cherry rootstock L2 (Prunus lannesiana) and propagated only in cherry species, we have generated two infective full-length cDNA clones in order to determine which viral factors are involved in the adaptation to each host. According to our results, the C-P3(PIPO)/6K1/N-CI (cylindrical inclusion) region contains overlapping but not coincident viral determinants involved in symptoms development, local viral amplification, and systemic movement capacity. Amino acid changes in this region promoting the adaptation to N. benthamiana or P. avium have trade-off effects in the alternative host. In both cases, adaptation can be achieved through single amino acid changes in the NIapro protease recognition motif between 6K1 and CI or in nearby sequences. Thus, we hypothesize that the potyvirus polyprotein processing could depend on specific host factors and the adaptation of PPV-C isolates to particular hosts relies on a fine regulation of the proteolytic cleavage of the 6K1-CI junction. PMID:24200075

  18. Promoting industrialisation

    International Nuclear Information System (INIS)

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  19. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  20. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  1. Individual differences in allocation of funds in the dictator game associated with length of the arginine vasopressin 1a receptor RS3 promoter region and correlation between RS3 length and hippocampal mRNA.

    Science.gov (United States)

    Knafo, A; Israel, S; Darvasi, A; Bachner-Melman, R; Uzefovsky, F; Cohen, L; Feldman, E; Lerer, E; Laiba, E; Raz, Y; Nemanov, L; Gritsenko, I; Dina, C; Agam, G; Dean, B; Bornstein, G; Ebstein, R P

    2008-04-01

    Human altruism is a widespread phenomenon that puzzled evolutionary biologists since Darwin. Economic games illustrate human altruism by showing that behavior deviates from economic predictions of profit maximization. A game that most plainly shows this altruistic tendency is the Dictator Game. We hypothesized that human altruistic behavior is to some extent hardwired and that a likely candidate that may contribute to individual differences in altruistic behavior is the arginine vasopressin 1a (AVPR1a) receptor that in some mammals such as the vole has a profound impact on affiliative behaviors. In the current investigation, 203 male and female university students played an online version of the Dictator Game, for real money payoffs. All subjects and their parents were genotyped for AVPR1a RS1 and RS3 promoter-region repeat polymorphisms. Parents did not participate in online game playing. As variation in the length of a repetitive element in the vole AVPR1a promoter region is associated with differences in social behavior, we examined the relationship between RS1 and RS3 repeat length (base pairs) and allocation sums. Participants with short versions (308-325 bp) of the AVPR1a RS3 repeat allocated significantly (likelihood ratio = 14.75, P = 0.001, df = 2) fewer shekels to the 'other' than participants with long versions (327-343 bp). We also implemented a family-based association test, UNPHASED, to confirm and validate the correlation between the AVPR1a RS3 repeat and monetary allocations in the dictator game. Dictator game allocations were significantly associated with the RS3 repeat (global P value: likelihood ratio chi(2) = 11.73, df = 4, P = 0.019). The association between the AVPR1a RS3 repeat and altruism was also confirmed using two self-report scales (the Bardi-Schwartz Universalism and Benevolence Value-expressive Behavior scales). RS3 long alleles were associated with higher scores on both measures. Finally, long AVPR1a RS3 repeats were associated with

  2. Study of Ancillary Service Market Mechanism for the Promotion of Wind Power Consumption in Northwest Region%西北地区促进风电消纳的辅助服务市场机制研究

    Institute of Scientific and Technical Information of China (English)

    张钦; 辛颂旭; 白建华; 林祺蔚

    2013-01-01

    There are abundant resources including wind energy,water energy,coal and so on in northwest region,which is the important base of the wind power,water power and coal power.To promote the high-efficient consumption of wind power in the large-scale power base of northwest region,the further research of technology,economy and other issues is required.Overall considering the harmonious development of the wind power,water power and coal power,and combining the actual conditions in northwest region,the wind power grid connection in northwest region and the induced share mechanism of ancillary service cost and expense for the peak-load regulation have been focusedly studied.Based on the analysis of the stakeholders related to the coordinated operation of wind power,water power and coal power,the assistant service framework for the promotion of high-efficient wind power consumption is proposed.According to the principle of equity of right and obligation based on the idea "Who get benefits paid",the cost analysis model of paid peaking service considering the wind power grid connection is proposed,and furthermore the share mechanism that the paid peaking cost be solely shared in each Province for the thermal power and centralizedly shared in the grid for the water power is established.The analysis results of the example has proved the effectiveness of the proposed method.%西北地区风能、水能、煤炭等资源丰富,是中国重要的风电、水电与煤电基地.为促进西北大型风电基地的高效消纳,需要深入研究技术、经济等方面面临的问题.统筹考虑了风电与水电、煤电协调发展,结合西北地区实际情况,重点研究西北风电并网后,由此引起的调峰辅助服务成本与费用分摊机制.基于风电与水电、煤电协调运行利益相关方的分析,提出了促进风电高效消纳的辅助服务框架.基于“谁受益、谁付费”的权利与义务对等原则,提出了考虑风电并网的有偿调

  3. Downregulation of miR-320a/383-sponge-like long non-coding RNA NLC1-C (narcolepsy candidate-region 1 genes) is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation.

    Science.gov (United States)

    Lü, M; Tian, H; Cao, Y-X; He, X; Chen, L; Song, X; Ping, P; Huang, H; Sun, F

    2015-01-01

    Long non-coding RNAs (lncRNAs), which are extensively transcribed from the genome, have been proposed to be key regulators of diverse biological processes. However, little is known about the role of lncRNAs in regulating spermatogenesis in human males. Here, using microarray technology, we show altered expression of lncRNAs in the testes of infertile men with maturation arrest (MA) or hypospermatogenesis (Hypo), with 757 and 2370 differentially down-regulated and 475 and 163 up-regulated lncRNAs in MA and Hypo, respectively. These findings were confirmed by quantitative real-time PCR (qRT-PCR) assays on select lncRNAs, including HOTTIP, imsrna320, imsrna292 and NLC1-C (narcolepsy candidate-region 1 genes). Interestingly, NLC1-C, also known as long intergenic non-protein-coding RNA162 (LINC00162), was down-regulated in the cytoplasm and accumulated in the nucleus of spermatogonia and primary spermatocytes in the testes of infertile men with mixed patterns of MA compared with normal control. The accumulation of NLC1-C in the nucleus repressed miR-320a and miR-383 transcript and promoted testicular embryonal carcinoma cell proliferation by binding to Nucleolin. Here, we define a novel mechanism by which lncRNAs modulate miRNA expression at the transcriptional level by binding to RNA-binding proteins to regulate human spermatogenesis. PMID:26539909

  4. Reduced capacity of alternative sigmas to melt promoters ensures stringent promoter recognition.

    Science.gov (United States)

    Koo, Byoung-Mo; Rhodius, Virgil A; Nonaka, Gen; deHaseth, Pieter L; Gross, Carol A

    2009-10-15

    In bacteria, multiple sigmas direct RNA polymerase to distinct sets of promoters. Housekeeping sigmas direct transcription from thousands of promoters, whereas most alternative sigmas are more selective, recognizing more highly conserved promoter motifs. For sigma(32) and sigma(28), two Escherichia coli Group 3 sigmas, altering a few residues in Region 2.3, the portion of sigma implicated in promoter melting, to those universally conserved in housekeeping sigmas relaxed their stringent promoter requirements and significantly enhanced melting of suboptimal promoters. All Group 3 sigmas and the more divergent Group 4 sigmas have nonconserved amino acids at these positions and rarely transcribe >100 promoters. We suggest that the balance of "melting" and "recognition" functions of sigmas is critical to setting the stringency of promoter recognition. Divergent sigmas may generally use a nonoptimal Region 2.3 to increase promoter stringency, enabling them to mount a focused response to altered conditions. PMID:19833768

  5. The rcsA promoter of Pantoea stewartii subsp. stewartii features a low-level constitutive promoter and an EsaR quorum-sensing-regulated promoter.

    Science.gov (United States)

    Carlier, Aurelien L; von Bodman, S B

    2006-06-01

    The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions. PMID:16740966

  6. The rcsA Promoter of Pantoea stewartii subsp. stewartii Features a Low-Level Constitutive Promoter and an EsaR Quorum-Sensing-Regulated Promoter

    OpenAIRE

    Carlier, Aurelien L; von Bodman, S B

    2006-01-01

    The upstream region of the Pantoea stewartii rcsA gene features two promoters, one for constitutive basal-level expression and a second autoregulated promoter for induced expression. The EsaR quorum-sensing repressor binds to a site centered between the two promoters, blocking transcription elongation from the regulated promoter under noninducing conditions.

  7. UN MARCO PARA LA PROMOCIÓN DE COOPERATIVAS EN EL CONTEXTO DE PLANES DE DESARROLLO TERRITORIAL DE REGIONES DESFAVORECIDAS/A FRAME FOR THE PROMOTION OF CO-OPERATIVES IN THE CONTEXT OF PLANS OF TERRITORIAL DEVELOPMENT OF DISADVANTAGED REGIONS

    Directory of Open Access Journals (Sweden)

    Jorge COQUE MARTÍNEZ

    2007-05-01

    Full Text Available Este artículo propone un marco para orientar programas de promoción de cooperativas en regiones desfavorecidas, con base en la concepción de estas empresas como esencialmente participativas. Para ello, se han combinado elementos de Dirección Estratégica y de Investigación-Acción Participativa que permiten estructurar procesos de intervención según cuatro ámbitos fundamentales de análisis, decisión y actuación: (1 elección de las barreras limitantes del desarrollo empresarial cooperativo sobre las que se quiere incidir, tras diagnosticar la situación de las cooperativas objetivo de un determinado programa y la del entorno de éstas; (2 determinación de los instrumentos más adecuados de intervención, vinculados a la disminución de las barreras determinadas en el punto anterior; (3 selección de los actores de promoción y reparto de papeles, en función de sus capacidades y otros rasgos que determinan quiénes son más adecuados para aplicar determinados instrumentos; (4 adecuación continua del programa a medida que las cooperativas promovidas van recorriendo las diferentes etapas de su ciclo de vida./This article proposes a framework in order to guide co-operative promotion programs in disadvantaged regions, based on understanding these enterprises as essentially participatory. Strategic Management and Participatory Research-Action elements have been combined so that they allow to structure intervention processes according to four basic spheres of analysis, decision and action: (1 selecting the barriers that limit the co-operative entrepreneurial development to have a bearing on, after diagnosing the situation of co-operatives which are the object of a certain program and its environment; (2 determining the most adequate tools of intervention in order to reduce the barriers that had been determined in the former point; (3 selecting the agents of promotion, and sharing roles among them according to their capabilities and other

  8. Health promoting outdoor environments

    DEFF Research Database (Denmark)

    Stigsdotter, Anna Ulrika Karlsson; Ekholm, Ola; Schipperijn, Jasper;

    2010-01-01

    AIMS: To investigate the associations between green space and health, health-related quality of life and stress, respectively. METHODS: Data were derived from the 2005 Danish Health Interview Survey and are based on a region-stratified random sample of 21,832 adults. Data were collected via face-...... life was found. Further, the results indicate awareness among Danes that green spaces may be of importance in managing stress and that green spaces may play an important role as health-promoting environments....

  9. SLC2 A9基因启动子区多态性位点与缺血性卒中的关系%Correlation between single nucleotide polymorphisms in SLC2A9 promoter region and ischemic stroke

    Institute of Scientific and Technical Information of China (English)

    林绍鹏; 江慧琳; 陈晓辉

    2014-01-01

    identified , and their distribution in this population were in Hardy -Weinberg equilibrium (P>0.05).There were significant differences in allele frequencies of SNP 2, SNP5 and SNP7 in the SLC2A9 promoter region between patients and controls ( P<0.05) .Bioinfomatic analysis showed that the sequence including wild -type al-leles of SNP5 had a potential GATA-1 transcriptional element .However, the sequence including mutant -type alleles of SNP5 had no potential transcriptional element .The sequence including two SNP alleles of SNP 7 had the same transcrip-tional elements.Conclusion These SNPs in SLC2A9 promoter region may be used as screening objects for ischemic stroke.

  10. AGRIEMAS project. Pilot project for promotion of environmental management system in the small and medium industries alimentary of region Abruzzo (Italy); Il progetto AGRIEMAS: un progetto pilota per la promozione di un sistema comunitario di ecogestione e audit nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo

    Energy Technology Data Exchange (ETDEWEB)

    Luciani, R.; Andriola, L.; Brunetti, N. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Ambiente; Vignati, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Energia; Paci, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Innovazione; Iacoboni, S.; Bonfitto, E. [ARSAA - Agenzia Regionale per i Servizi di Sviluppo Agricolo (Italy)

    1999-07-01

    The topic discussed in this report can be inserted within the context of case studies carried out by ENEA (National Agency for New Technology, Energy and the Environment) in the promotion of environmental management systems (EMAS - ISO14000). EMAS has a voluntary character; it intends to replace conflicting relations between control authority and firm with relations centred on a dialogue and action agreed upon by the parties, on the basis of impartial and reliable information. The report about AGRIEMAS pilot project illustrates the procedure for applying this regulation to the small and medium food industries of Region Abruzzo. [Italian] L'argomento del rappprto si inserisce nel contesto degli studi effettuati dall'ENEA nell'ambito della promozione dei sistemi di gestione ambientale (EMAS-ISO14000). Lo strumento EMAS, che ha carattere di volontarieta', intende sostituire un rapporto di tipo conflittuale fra autorita' di controllo e impresa con un rapporto centrato su un dialogo ed un'azione concertata tra le parti, sulle basi di un'informativa obiettiva ed affidabile. Il rapporto sul progetto pilota AGRIEMAS illustra il percorso per l'applicazione del regolamento EMAS nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo.

  11. Sustainable regional development in Austria. The role of regional institutions by implementing a sustainable regional pathway.

    OpenAIRE

    Gaube, Veronika; Sedlacek, Sabine

    2002-01-01

    According to the current focus of the regional policy of the European Union on sustainable regional development the question arises - what are the key-elements to achieve a sustainable regional pathway? The identification of these key-factors is a challenge for the regional policy in each member state. One elementary key-factor is the promotion of new technologies as part of a regional innovation strategy. Regional institutions which support environmental improvements within regions can be id...

  12. Comparative integromics on FZD7 orthologs: conserved binding sites for PU.1, SP1, CCAAT-box and TCF/LEF/SOX transcription factors within 5'-promoter region of mammalian FZD7 orthologs.

    Science.gov (United States)

    Katoh, Masuko; Katoh, Masaru

    2007-03-01

    that the binding sites for PU.1, SP1/Krüppel-like, CCAAT-box, and TCF/LEF/SOX transcription factors were conserved among 5'-promoter regions of mammalian FZD7 orthologs. PMID:17273804

  13. Structure of an APC3–APC16 Complex: Insights into Assembly of the Anaphase-Promoting Complex/Cyclosome

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, Masaya; Yu, Shanshan; Qiao, Renping; Weissmann, Florian; Miller, Darcie J.; VanderLinden, Ryan; Brown, Nicholas G.; Frye, Jeremiah J.; Peters, Jan-Michael; Schulman, Brenda A. (SJCH); (IMP)

    2015-08-21

    The anaphase-promoting complex/cyclosome (APC/C) is a massive E3 ligase that controls mitosis by catalyzing ubiquitination of key cell cycle regulatory proteins. The APC/C assembly contains two subcomplexes: the “Platform” centers around a cullin-RING-like E3 ligase catalytic core; the “Arc Lamp” is a hub that mediates transient association with regulators and ubiquitination substrates. The Arc Lamp contains the small subunits APC16, CDC26, and APC13, and tetratricopeptide repeat (TPR) proteins (APC7, APC3, APC6, and APC8) that homodimerize and stack with quasi-2-fold symmetry. Within the APC/C complex, APC3 serves as center for regulation. APC3's TPR motifs recruit substrate-binding coactivators, CDC20 and CDH1, via their C-terminal conserved Ile-Arg (IR) tail sequences. Human APC3 also binds APC16 and APC7 and contains a > 200-residue loop that is heavily phosphorylated during mitosis, although the basis for APC3 interactions and whether loop phosphorylation is required for ubiquitination are unclear. Here, we map the basis for human APC3 assembly with APC16 and APC7, report crystal structures of APC3Δloop alone and in complex with the C-terminal domain of APC16, and test roles of APC3's loop and IR tail binding surfaces in APC/C-catalyzed ubiquitination. The structures show how one APC16 binds asymmetrically to the symmetric APC3 dimer and, together with biochemistry and prior data, explain how APC16 recruits APC7 to APC3, show how APC3's C-terminal domain is rearranged in the full APC/C assembly, and visualize residues in the IR tail binding cleft important for coactivator-dependent ubiquitination. Overall, the results provide insights into assembly, regulation, and interactions of TPR proteins and the APC/C.

  14. Regionalism in Services

    OpenAIRE

    Gootiiz, Batshur; MATTOO, Aaditya

    2015-01-01

    Can regionalism do what multilateralism has so far failed to do—promote greater openness of services markets? Although previous research has pointed to the wider and deeper legal commitments under regional agreements as proof that it can, no previous study has assessed the impact of such agreements on applied policies. This paper focuses on the Association of Southeast Asian Nations (ASEAN), where ...

  15. Can regional policy affect firms' innovation potential in lagging regions?

    OpenAIRE

    Amnon Frenkel

    2000-01-01

    The initiation of innovation in lagging regions has become one of the most pressing issues in regional policy. Several studies have attempted to identify the factors that influence the creation and development of product innovation in firms located in lagging regions. The identification of these factors could assist regional decision-makers in promoting technological innovation in such regions. The research question investigated in this study is whether the effectiveness of such regional poli...

  16. Health promotion: a global perspective.

    Science.gov (United States)

    Kickbusch, I

    1986-01-01

    The first part of this paper reviews the work of the World Health Organization's Regional Office for Europe undertaken to clarify the relevance of health promotion for all member states and regions. This work led to a definition of "health" as the ability to realize aspirations and satisfy needs and to change or cope with the environment. Health promotion was considered to 1) involve the population as a whole in the context of everyday lives, 2) be directed towards action on the determinants of health, 3) combine diverse but complementary methods or approaches, 4) aim for effective and concrete public participation, and 5) involve health professionals. Areas covered by health promotion activities include 1) access to health, 2) development of an environment conductive to health, 3) strengthening of social networks and social supports, 4) promoting positive health behavior and appropriate coping strategies, and 5) increasing knowledge and disseminating information. The next section of the paper traces the development of the concept of health promotion from its roots in health education, and the third section presents a brief history of public health to contextualize this development. The differences between the old and new approaches to public health are presented (the new role of the health sector is to ensure access to health, create advocacy for health, and move beyond health care through intersectoral action and public participation), and the new "forcefield" of public health that emerges from a conceptualization of health promotion is described. This forcefield, illustrated as a triangle linking healthy public policy, health promotion, and community action, works at all levels and is the framework for the development of appropriate strategies. It is concluded that in many cases public health will have to be reorganized as will the health care system as a whole. Health must be viewed as a social project linked to political responsibilities not as a medical

  17. Bridging Integration Gaps: Scenarios and Policy Recommendations to Promote Physical Infrastructure and Reduce Intra-Regional Trade Costs Title: Cómo Reducir las Brechas de integración: Escenarios y Recomendaciones de Políticas para Promover la Infraestructura Física y Reducir los Costes del Comercio Intrarregional

    OpenAIRE

    Economic Commission for Latin America and the Caribbean (ECLAC); Inter-American Development Bank (IDB); World Bank (WB); Comisión Económica para América Latina y el Caribe (CEPAL)

    2010-01-01

    This policy brief is intended to serve as the basis for the discussion of the Ministers of Finance on action needed to promote physical infrastructure and reduce intra-regional trade costs, in the context of the Third Meeting of the Finance Ministers of the Americas and the Caribbean held in Lima (Perú), on May 28, 2010. It is argued that the Latin American and Caribbean region must bridge three interrelated policy gaps in order to advance its integration agenda. First, despite advances in tr...

  18. Identification of a region which directs the monocytic activity of the colony-stimulating factor 1 (macrophage colony-stimulating factor) receptor promoter and binds PEBP2/CBF (AML1).

    OpenAIRE

    Zhang, D E; Fujioka, K.; Hetherington, C J; Shapiro, L H; CHEN, H. M.; Look, A T; Tenen, D. G.

    1994-01-01

    The receptor for the macrophage colony-stimulating factor (or colony-stimulating factor 1 [CSF-1]) is expressed from different promoters in monocytic cells and placental trophoblasts. We have demonstrated that the monocyte-specific expression of the CSF-1 receptor is regulated at the level of transcription by a tissue-specific promoter whose activity is stimulated by the monocyte/B-cell-specific transcription factor PU.1 (D.-E. Zhang, C.J. Hetherington, H.-M. Chen, and D.G. Tenen, Mol. Cell. ...

  19. Community structure of soybean plant growth-promoting rhizobacteria in the black soil region of Northeast China%东北黑土区大豆根际促生菌群落组成研究

    Institute of Scientific and Technical Information of China (English)

    王志刚; 徐伟慧; 莫继先; 肖静; 孙剑秋; 王建丽

    2012-01-01

    As the black soil area of Northeast China is major soybean producing areas, it is important for the sustainable development of agriculture to study the soybean plant growth-promoting rhizobacteria (PGPR). For explaining the community structure of soybean PGPR in the black soil region of Northeast China, we chose four sample stations including Ewenki Autonomous Banner in Inner Mongolia Autonomous Region, Hailun City in Heilongjiang Province, Keshan County in Heilongjiang Province and Hongxinglong Farms in Heilongjiang Province, analyzed community composition of nitrogen-fixing bacteria, phosphate-dissolving bacteria, phosphate-solubilizing bacteria and silicate bacteria in soybean rhizosphere, and interpreted correspondence relationship between PGPR strains and areas. The results showed a large number of PGPR in soybean rhizosphere. The quantity of nitrogen-fixing bacteria reached to 104 cfu·g-1, these of phosphate-dissolving bacteria and phosphate-solubilizing bacteria reached to 105 cfu·g-1, and that of silicate bacteria reached to 103 cfu·g-1. Species groups of nitrogen-fixing bacteria, phosphate-dissolving bacteria, phosphate-solubilizing bacteria and silicate bacteria in soybean rhizosphere consisted of 5, 6, 7 and 4 species respectively. Shannon-Weiner biodiversity indices of nitrogen-fixing bacteria, phosphate-dissolving bacteria, phosphate-solubilizing bacteria and silicate bacteria were higher in soybean rhizosphere, which were in ranges of 0.94~1.60, 0.83~1.52, 1.07~1.67 and 0.52~0.96.Biodiversity indices of PGPR were more than 2 in sampling stations. Analysis on correspondence relationship between PGPR strains and areas indicated typical PGPR of different sampling stations. Nitrogen-fixing bacteria LLN8 (Azotobacter beijerinckia indica), phosphate-dissolving bacteria DHS13 (Micrococcus), phosphate-dissolving bacteria DHS19 (Pseudomonas), nitrogen-fixing bacteria LLN1 (A. Chrooco-ccum) and phosphate-dissolving bacteria DHS5 (Azotobacter) were

  20. Sun exposure related methylation in malignant and non-malignant skin lesions.

    Science.gov (United States)

    Sathyanarayana, Ubaradka G; Moore, Angela Yen; Li, Lin; Padar, Asha; Majmudar, Kuntal; Stastny, Victor; Makarla, Prakash; Suzuki, Makoto; Minna, John D; Feng, Ziding; Gazdar, Adi F

    2007-01-01

    We investigated the aberrant promoter methylation status of 12 genes in skin lesions, both malignant (basal cell carcinomas (BCCs), n=68 and squamous cell carcinomas (SCCs), n=35) and non-malignant (tags, n=58) skin lesions and compared the results of lesions from sun exposed (SE) and sun protected (SP) regions. Methylation was studied using a methylation specific PCR (MSP) and methylation of CDH1 was also measured using a semi-quantitative fluorescence based real-time MSP method. The methylation index (MI) was calculated as the methylated fraction of the genes examined. In this report, we found high frequencies of methylation of several known or suspected tumor suppressor genes in tags and skin cancers. Among the 12 genes, for the cadherin genes CDH1 and CDH3 and for two of the laminin 5 encoding genes LAMA3 and LAMC2 methylation frequencies greater than 30% were noted in one or more specimen types. We investigated whether methylation was tumor related. Surprisingly, the differences in the methylation profile of genes among the three specimen types were modest, and the MI, indicators of overall methylation frequencies, was nearly identical. However, significant differences were noted in the frequencies of methylation among the three specimen types for the genes RASSF1A (P=0.002), CDH1 (P=0.007) and one or more of three CAD genes (P=0.02). Methylation was highly significantly related to sun exposure, and sun protected specimens had little or no methylation. As methylation of CDH1 was completely SE specific we analyzed all the skin samples using a semi-quantitative real-time PCR assay for the CDH1 gene. The concordance between standard MSP and real-time MSP for all the samples (n=161) was 75% (P<0.0001). While weak signals were detected in the SP samples by real time PCR, the differences between SE and SP specimens were 148 fold for tags and 390 fold for BCCs. These differences were highly significant (P<0.0001). These findings suggest that methylation commences in

  1. South Asia's health promotion kaleidoscope.

    Science.gov (United States)

    Mukhopadhyay, Alok

    2007-01-01

    South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region. PMID:18372876

  2. DNA损伤修复基因在胃癌组织中的异常甲基化改变%Promoter region methylation of DNA damage repair genes in human gastric cancer

    Institute of Scientific and Technical Information of China (English)

    郭贺; 闫文姬; 杨云生; 郭明洲

    2014-01-01

    目的 联合检测7个DNA损伤修复基因在胃癌组织中的异常甲基化改变.方法 收集解放军总医院胃癌手术标本70例,酚-氯仿法提取DNA后,经亚硫酸氢盐处理,甲基化特异性聚合酶链反应(MSP)方法检测标本中MLH1,CHFR,MGMT,FANCF,Rassf1A,BRCA1和GSTpi基因启动子区CpG岛的甲基化状况.结果 7个DNA损伤修复基因的甲基化率分别如下:MLH1 22.9%(16/70),CHFR 47.1% (33/70),MGMT 34.3% (24/70),FANCF 11.4%(8/70),RASSF1A 7.1%(5/70),BRCA1 1.4% (1/70),GSTpi 0% (0/70).临床资料分析显示CHFR的甲基化与患者年龄、胃癌肿瘤大小和分化程度相关.基因间相关性分析显示CHFR的甲基化分别与MLH1和MGMT基因的甲基化相关.结论 MLH1,CHFR和MGMT基因在胃癌组织中频繁甲基化,而FANCF、RASSF1A、BRCA1和GSTpi基因在胃癌组织中甲基化率低,MLH1,CHFR和MGMT基因在胃癌的发生发展中可能起重要作用.联合检测上述3个基因的甲基化可能对胃癌的诊断提供帮助.%Objective To detect the status of promoter region methylation of damage repair genes in gastric cancer and analyze its association with clinicopathologic characteristics.Methods A total of 70 human gastric cancer tissue samples representing all stages of disease were obtained from surgical resection specimens.DNA was extracted with the phenol-chloroform method.The technique of methylation specific polymerase chain reaction (MSP) was used to examine the methylation status of MLH1,CHFR,MGMT,FANCF,Rassf1A,BRCA1 and GSTpi in gastric cancer specimens.And MSP products were analyzed with 2% agarose gel electrophoresis.Results The methylation rates of DNA damage related genes in human gastric cancer were as follows:MLH1 22.9% (16/70),CHFR 47.1% (33/70),MGMT 34.3% (24/70),FANCF 11.4% (8/70),RASSF1A 7.1% (5/70),BRCA1 1.4% (1/70) and GSTpi0% (0/70).And CHFR methylation was correlated with patient age (< 60 year) (P =0.035),tumor size (diameter ≥5 cm) (P =0

  3. DNA signals at isoform promoters.

    Science.gov (United States)

    Dai, Zhiming; Xiong, Yuanyan; Dai, Xianhua

    2016-01-01

    Transcriptional heterogeneity is extensive in the genome, and most genes express variable transcript isoforms. However, whether variable transcript isoforms of one gene are regulated by common promoter elements remain to be elucidated. Here, we investigated whether isoform promoters of one gene have separated DNA signals for transcription and translation initiation. We found that TATA box and nucleosome-disfavored DNA sequences are prevalent in distinct transcript isoform promoters of one gene. These DNA signals are conserved among species. Transcript isoform has a RNA-determined unstructured region around its start site. We found that these DNA/RNA features facilitate isoform transcription and translation. These results suggest a DNA-encoded mechanism by which transcript isoform is generated. PMID:27353836

  4. Promoter Region Hypermethylation and mRNA Expression of MGMT and p16 Genes in Tissue and Blood Samples of Human Premalignant Oral Lesions and Oral Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Vikram Bhatia

    2014-01-01

    Full Text Available Promoter methylation and relative gene expression of O6-methyguanine-DNA-methyltransferase (MGMT and p16 genes were examined in tissue and blood samples of patients with premalignant oral lesions (PMOLs and oral squamous cell carcinoma (OSCC. Methylation-specific PCR and reverse transcriptase PCR were performed in 146 tissue and blood samples from controls and patients with PMOLs and OSCC. In PMOL group, significant promoter methylation of MGMT and p16 genes was observed in 59% (P=0.0010 and 57% (P=0.0016 of tissue samples, respectively, and 39% (P=0.0135 and 33% (P=0.0074 of blood samples, respectively. Promoter methylation of both genes was more frequent in patients with OSCC, that is, 76% (P=0.0001 and 82% (P=0.0001 in tissue and 57% (P=0.0002 and 70% (P=0.0001 in blood, respectively. Significant downregulation of MGMT and p16 mRNA expression was observed in both tissue and blood samples from patients with PMOLs and OSCC. Hypermethylation-induced transcriptional silencing of MGMT and p16 genes in both precancer and cancer suggests important role of these changes in progression of premalignant state to malignancy. Results support use of blood as potential surrogate to tissue samples for screening or diagnosing PMOLs and early OSCC.

  5. Promoter Region Hypermethylation and mRNA Expression of MGMT and p16 Genes in Tissue and Blood Samples of Human Premalignant Oral Lesions and Oral Squamous Cell Carcinoma

    Science.gov (United States)

    Bhatia, Vikram; Makker, Annu; Tewari, Shikha; Yadu, Alka; Shilpi, Priyanka; Kumar, Sandeep; Agarwal, S. P.; Goel, Sudhir K.

    2014-01-01

    Promoter methylation and relative gene expression of O6-methyguanine-DNA-methyltransferase (MGMT) and p16 genes were examined in tissue and blood samples of patients with premalignant oral lesions (PMOLs) and oral squamous cell carcinoma (OSCC). Methylation-specific PCR and reverse transcriptase PCR were performed in 146 tissue and blood samples from controls and patients with PMOLs and OSCC. In PMOL group, significant promoter methylation of MGMT and p16 genes was observed in 59% (P = 0.0010) and 57% (P = 0.0016) of tissue samples, respectively, and 39% (P = 0.0135) and 33% (P = 0.0074) of blood samples, respectively. Promoter methylation of both genes was more frequent in patients with OSCC, that is, 76% (P = 0.0001) and 82% (P = 0.0001) in tissue and 57% (P = 0.0002) and 70% (P = 0.0001) in blood, respectively. Significant downregulation of MGMT and p16 mRNA expression was observed in both tissue and blood samples from patients with PMOLs and OSCC. Hypermethylation-induced transcriptional silencing of MGMT and p16 genes in both precancer and cancer suggests important role of these changes in progression of premalignant state to malignancy. Results support use of blood as potential surrogate to tissue samples for screening or diagnosing PMOLs and early OSCC. PMID:24991542

  6. 先天性双侧输精管缺如患者CFTR基因启动子区域基因突变检测%Detection of promoter region of CFTR gene in Chinese congenital bilateral absence of vas deferens

    Institute of Scientific and Technical Information of China (English)

    吴晓; 张炎; 杨晓健; 陈石涛; 袁萍; 张滨

    2015-01-01

    目的 探讨先天性双侧输精管缺如患者囊性纤维化跨膜转导因子(CFTR)基因启动子区域的基因突变情况.方法 采用PCR技术结合DNA直接测序的方法检测2013年5月至2015年1月于中山大学附属第三医院诊断明确的11例先天性双侧输精管缺如汉族患者及50名健康已生育汉族男性的CFTR基因5'端ATG上游3.8 kb的启动子区域的突变情况,并在NCBI和Cystic Fibrosis Mutation Database在线比对,利用Transfac在线预测及系统发生足迹法联合已经报道的转录因子作用元件,探讨所检测之碱基变异与启动子调控作用的关系.结果 11例汉族先天性双侧输精管缺如患者中发现c.-8G>C(1例)、c.-966T> G(7例)2个已知CFTR启动子区域的多态性位点及c.-195C>A(1例)1个单核苷酸位点变异,其中,c.-195C>A位于物种间启动子保守区域.结论 除外多态性位点,在中国汉族先天性双侧输精管缺如患者CFTR基因启动子区域检测到一个单核苷酸变异,其与疾病发生的关系仍需进一步行生物学实验验证.%Objective To detect the variants in the promoter region of the CFTR gene in congenital bilateral absence of vas deferens (CBAVD).Methods A total of 11 CBAVD patients and 50 healthy men as control were enrolled in the study from May 2013 to January 2015.Sanger sequencing was performed in the promoter region of 3.8 kb of the CFTR gene on the PCR products.The genome sequence of the CFTR gene was compared and analyzed with the website of NCBI and Cystic Fibrosis Mutation Database.Also,Transfac and phylogenetic footprinting method was used to investigate the relationship between the promoter region variants and the transcription factors function components.Results SNP of c.-8G > C (n =1) and c.-966T > G(n =7),as well as one single nucleotide variant of c.-195C > A (n =1) were identified in the promoter region of the CBAVD patients,of which c.-195C > A was in the conserved domains of the promoter

  7. Promoting East-West Interaction Exclusive interview with Dr.Cao Yushu,Deputy Director of the Office of the Leading Group for Western Region Development at the State Council

    Institute of Scientific and Technical Information of China (English)

    陈伟

    2008-01-01

    Economic growth and environmental "friendliness" are the dual missions of China’s grand western development. In the past eight years,China has seen the gap between eastern and western regions still widening while also taking on the arduous task of protecting nature,ecology and environment in the western region. How has western development fared in the past eight years? What difficulties and challenges are being encountered? The development of the western region poses the single greatest difficulty facing China’s regional economic development,but how can we advance along a "sound and fast" development path? The establishment of economic zones in Chengdu and Chongqing,Guanzhong and North Bay has opened up new possibilities and expectations for western China’s economic development.

  8. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994; 3. Promocja nauki i techniki ochrony srodowiska morza i przymorza. Swinoujscie 12-14 pazdziernik 1994

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-12-31

    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit.

  9. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  10. Sport Promotion Strategies

    OpenAIRE

    Alexandru Lucian MIHAI

    2013-01-01

    In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing ...

  11. How Promotions Work

    OpenAIRE

    Robert C. Blattberg; Richard Briesch; Fox, Edward J.

    1995-01-01

    By synthesizing findings across the sales promotion literature, this article helps the reader understand how promotions work. We identify and explain empirical generalizations related to sales promotion; that is, effects that have been found consistently in multiple studies involving different researchers. We also identify issues which have generated conflicting findings in the research, as well as important sales promotion topics that have not yet been studied. This overview of the research ...

  12. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka

    2012-01-01

    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  13. Developing a Promotional Video

    Science.gov (United States)

    Epley, Hannah K.

    2014-01-01

    There is a need for Extension professionals to show clientele the benefits of their program. This article shares how promotional videos are one way of reaching audiences online. An example is given on how a promotional video has been used and developed using iMovie software. Tips are offered for how professionals can create a promotional video and…

  14. O programa nacional de alimentação escolar como promotor de hábitos alimentares regionais The national school food program as a promoter of regional food habits

    Directory of Open Access Journals (Sweden)

    Lorena Gonçalves Chaves

    2009-12-01

    Full Text Available OBJETIVO: O presente estudo analisa a utilização de alimentos e preparações regionais nos cardápios da alimentação escolar do ensino público brasileiro, bem como sua freqüência e sua elaboração por nutricionistas, sendo um estudo transversal e qualitativo. MÉTODOS: Os cardápios analisados foram oficialmente solicitados pelo Fundo Nacional de Desenvolvimento da Educação aos municípios e estados de todo o País. Do cálculo amostral, dos 2 962 cardápios recebidos foram analisados 370, distribuídos proporcionalmente às regiões brasileiras, tomando-se como critério os cardápios do ensino fundamental da área urbana. RESULTADOS: Dos cardápios analisados, 63% a 87,8% foram elaborados por nutricionista. Entre as regiões, destaca-se a Sul, já que 86,5% dos cardápios contemplam pelo menos uma preparação regional no período de uma semana, enquanto na região Norte esse percentual cai para 38%. A região Norte apresentou menor relação entre o número de cardápios elaborados por nutricionista e número de preparações regionais, enquanto que a região Sul apresentou maior relação. CONCLUSÃO: É necessário que os responsáveis pelo Programa incentivem e contemplem as preparações típicas ao hábito alimentar de cada região no cardápio da alimentação escolar e reforcem os meios de fiscalização desta prática.OBJECTIVE: This cross-sectional and qualitative study analyzes the use of regional foods and preparations in the school menus of Brazilian public schools, as well as their frequency and the presence of dietitians. METHODS: The analyzed menus had been officially requested by the governmental area related to education in Brazil to the cities and the states of the entire country. For the sample, of the 2,962 menus received, 370 were analyzed, distributed proportionally by Brazilian regions. The criterion was the menus of the elementary schools located in urban areas. RESULTS: From the analyzed menus, 63 to 87

  15. WHO Health Promotion Glossary: new terms.

    Science.gov (United States)

    Smith, Ben J; Tang, Kwok Cho; Nutbeam, Don

    2006-12-01

    The WHO Health Promotion Glossary was written to facilitate understanding, communication and cooperation among those engaged in health promotion at the local, regional, national and global levels. Two editions of the Glossary have been released, the first in 1986 and the second in 1998, and continued revision of the document is necessary to promote consensus regarding meanings and to take account of developments in thinking and practice. In this update 10 new terms that are to be included in the Glossary are presented. Criteria for the inclusion of terms in the Glossary are that they differentiate health promotion from other health concepts, or have a specific application or meaning when used in relation to health promotion. The terms defined here are: burden of disease; capacity building; evidence-based health promotion; global health; health impact assessment; needs assessment; self-efficacy; social marketing; sustainable health promotion strategies, and; wellness. WHO will continue to periodically update the Health Promotion Glossary to ensure its relevance to the international health promotion community. PMID:16963461

  16. Influence of TP53 and CDH1 genes in hepatocellular cancer spheroid formation and culture: a model system to understand cancer cell growth mechanics

    OpenAIRE

    Pomo, Joseph M.; Taylor, Robert M; Gullapalli, Rama R

    2016-01-01

    Background Spheroid based culture methods are gaining prominence to elucidate the role of the microenvironment in liver carcinogenesis. Additionally, the phenomenon of epithelial-mesenchymal transition also plays an important role in determining the metastatic potential of liver cancer. Tumor spheroids are thus important models to understand the basic biology of liver cancer. Methods We cultured, characterized and examined the formation of compact 3-D micro-tumor spheroids in five hepatocellu...

  17. CDH1 and IL1-beta expression dictates FAK and MAPKK-dependent cross-talk between cancer cells and human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Al-toub, Mashael; Vishnubalaji, Radhakrishnan; Hamam, Rimi;

    2015-01-01

    comprehensive investigation of the cross-talk between human MSCs (hMSCs) and 12 cancer cell lines derived from breast, prostate, colon, head/neck and skin. METHODS: Human bone marrow-derived MSC line expressing green fluorescence protein (GFP) (hMSC-GFP) were co-cultured with the following cancer cell lines...... using Nikon BioStation IM-Q. Stable expression of mCherry, and luciferase genes was achieved using lentiviral technology. IL1-Beta neutralizing experiments were conducted using soluble recombinant IL-1R (srIL-1R). Changes in gene expression in sorted hMSCs were assessed using Agilent microarray platform...

  18. Ciclo celular y neurodegeneración: implicación de la E3 ubitiquina ligasa APC/C-Cdh1en la excitotoxicidad

    OpenAIRE

    Maestre Ferrín, Carolina

    2009-01-01

    [ES]La división celular es un proceso esencial que permite el desarrollo de un individuo pluricelular adulto a partir de una única célula, así como la regeneración de los tejidos, que necesitan el reemplazo de las células que van perdiendo.Durante el ciclo celular, todos los componentes de la célula madre deben duplicarse y repartirse entre las células hijas. El DNA ha de replicarse una única vez en cada ciclo y de forma exacta, y las cromátidas hermanas producidas han de segregarse a cada un...

  19. CDH1 and IL1-beta expression dictates FAK and MAPKK-dependent cross-talk between cancer cells and human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Al-toub, Mashael; Vishnubalaji, Radhakrishnan; Hamam, Rimi;

    2015-01-01

    : (MCF7, BT-20, BT-474, MDA-MB-468, T-47D, SK-BR-3, MDA-MB-231, PC-3, HT-29, MDA-MB-435s, and FaDu) and changes in their morphology were assessed using fluorescent microscopy. For cellular tracking, cells were labeled with Vybrant DiO, DiL, and DiD lipophilic dyes. Time-lapse microscopy was conducted...... signaling pathways related to bone formation, FAK and MAPKK signaling. Co-culturing hMSCs with MCF7 cells increased their growth evidenced by increase in Ki67 and PCNA staining in tumor cells in direct contact with hMSCs niche. On the other hand, co-culturing hMSCs with FaDu, HT-29 or MDA-MB-231 cells led...

  20. Analysis of the Cotton E6 Promoter

    Institute of Scientific and Technical Information of China (English)

    WU Aimin; LIU Jinyuan

    2005-01-01

    An E6 gene from sea island cotton (Gossypium barbadense) was expressed specifically in cotton fiber cells to transfer functions to cultivated species for better transgenic engineering. The regulatory activity of the E6 promoter region was then studied by isolating a 614-bp fragment of the 5'-flanking region from upland cotton (Gossypium hirsutum CRI-12) to produce a green fluorescent protein (GFP) reporter construct for analysis of tissue-specific expression in transgenic tobacco seedlings. Fluorescent analyses indicate that the relatively short E6 promoter is sufficient to direct green fluorescent protein expression specifically in the leaf trichomes (hair cells) of the transgenic tobacco plants. As cotton fibers are also unicellular trichomes that differentiate from epidermal cells of developing cotton ovules, the result suggests that the relatively short E6 promoter can serve as a fiber-specific expression promoter for genetic engineering to improve cotton fiber quality.

  1. Osteo-Promoter Database (OPD – Promoter analysis in skeletal cells

    Directory of Open Access Journals (Sweden)

    Benayahu Dafna

    2005-03-01

    Full Text Available Abstract Background Increasing our knowledge about the complex expression of genes in skeletal tissue will provide a better understanding of the physiology of skeletal cells. The study summarizes transcriptional regulation factors interacting and cooperating at promoter regions that regulate gene expression. Specifically, we analyzed A/T rich elements along the promoter sequences. Description The Osteo-Promoter Database (OPD is a collection of genes and promoters expressed in skeletal cells. We have compiled a new viewer, OPD, as unique database developed and created as an accessible tool for skeletal promoter sequences. OPD can navigate to identify genes specific to skeletal cDNA databases and promoter analysis sites. OPD offers exclusive access to facilitate a dynamic extraction of promoters' gene-specific analyses in skeletal tissue. The data on promoters included in OPD contains cloned promoters or predicted promoters that were analyzed by bioinformatics tools. OPD offers MAR-analysis, which allocates A/T rich elements along these promoter sequences. Conclusion The analysis leads to a better insight of proteins that bind to DNA, regulate DNA, and function in chromatin remodeling. The OPD is a distinctive tool for understanding the complex function of chromatin remodeling and transcriptional regulation of specific gene expression in skeletal tissue.

  2. Fiscal 1999 geothermal development promotion survey report. Data processing (No. B-5 - Musadake region - Phase 3); 1999 nendo chinetsu kaihatsu sokushin chosa data shori hokokusho. No. B-5 Musadake chiiki (Dai 3 ji)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-01-01

    A comprehensive analysis was conducted into the results of a survey on the state of existence of geothermal energy resources in the Musadake region, Shibetsu-gun, Hokkaido. The region was volcanically active in the period from the Neogene period into the quaternary, with some volcanos still active even today. The geological structure on the whole is characterized by the Musadake/Mt. Shitabanupuri fault which is the major structure running NNE-SSW and having a folding structure. It is inferred that Musadake is the heat source responsible for the underground temperature distribution in this region. The maximum temperature of 274 degrees C is recorded at borehole N11-MD-3 in the northeastern part of Musadake, and the temperature falls rapidly as the distance from the borehole increases. Ejection of geothermal fluids is observed at boreholes N11-MD-3 and N11-MD-4. It is inferred that the deep-seated geothermal water is of the neutral Cl type with Cl concentration estimated at approximately 12,000 mg/liter. Steam composition is characterized by a gas concentration level that is as high as 3-4 vol.%. The gas is composedly mainly of CO2 and contains some hydrocarbons. Fluids in this region are classified into water mixing into deep-seated geothermal water and groundwater originating in meteoric water. (NEDO)

  3. Promoter architectures and developmental gene regulation.

    Science.gov (United States)

    Haberle, Vanja; Lenhard, Boris

    2016-09-01

    Core promoters are minimal regions sufficient to direct accurate initiation of transcription and are crucial for regulation of gene expression. They are highly diverse in terms of associated core promoter motifs, underlying sequence composition and patterns of transcription initiation. Distinctive features of promoters are also seen at the chromatin level, including nucleosome positioning patterns and presence of specific histone modifications. Recent advances in identifying and characterizing promoters using next-generation sequencing-based technologies have provided the basis for their classification into functional groups and have shed light on their modes of regulation, with important implications for transcriptional regulation in development. This review discusses the methodology and the results of genome-wide studies that provided insight into the diversity of RNA polymerase II promoter architectures in vertebrates and other Metazoa, and the association of these architectures with distinct modes of regulation in embryonic development and differentiation. PMID:26783721

  4. Promotion and Development of Tourism in Cameroon

    OpenAIRE

    Frida-Tolonen, Frida

    2014-01-01

    This Bachelor’s thesis is aimed to achieve a main goal which is at Promoting and developing tourism in Cameroon. This work will give a broad overview of issues in tourism in Africa and Cameroon, suggesting guidelines to assist countries such as Cameroon, Namibia, Nigeria, to develop a more coherent structure for tourism. Tourism can only develop sustainably if it is united into the country’s overall economic, social and physical planning policies and enhancing regional promotion and effective...

  5. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  6. Report on the project for spread/promotion of technology for the industrial waste optimized treatment in the Asian region; Asia chiiki sangyo haikibutsu tekiseika shori gijutsu nado fukyu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The International Symposium `98 on the industrial waste problem in the Asian region was held in Tokyo on February 18, 1998. MITI commented on the present situation of the industrial waste problem in Japan and Japan`s environmental tackling toward the Asian region, and also Asian countries (China, the Philippines, Thailand and Korea) made reports. Japan reported on environmental preservation measures taken in the industrial circle, the industrial waste problem at companies which advanced into Asian countries, effects of the Basel Convention (which restricts border-crossing movement of harmful wastes) on recycle activities, Japan`s role in Asia, etc. In the panel discussion, discussions were made on human interchange in the informatization, recycling technology, shortage of personnel concerned with environmental protection, construction of a network in the Asian region and Japan` s role, etc. As to the treatment system for waste, the necessity was recognized of studying systems which meet with actual states of each country. It is also necessary to go on with discussing how the system should be for cooperation between governments and private companies. Importance of the recycle and information exchange was emphasized. 10 refs., 14 figs., 27 tabs.

  7. Successful event promotions

    OpenAIRE

    Vitikainen, Anna; Pakarinen, Siiri

    2015-01-01

    The field of event promotions is a growing industry. As it is still a new area of business, the information available is broad and not very detailed. Promotions are usually seen as a bigger field in advertising and specific information about event promotions is more difficult to find. Today marketing is shifting from basic, traditional advertising to digital marketing and telling the brands’ story by creating an unforgettable and positive experience. Companies are trying to come up with new w...

  8. Is Lamb Promotion Working?

    OpenAIRE

    Capps, Oral, Jr.; Williams, Gary W.

    2007-01-01

    This objective of this study is to determine whether the advertising and promotion dollars collected and spent by the American Lamb Board on lamb promotion since the inception of the Lamb Checkoff Program have effectively increased lamb consumption in the United States. The main conclusion is that program has resulted in roughly 7.6 additional pounds of total lamb consumption per dollar spent on advertising and promotion and $41.59 in additional lamb sales per dollar spent on advertising and ...

  9. Strategic Promotion and Compensation.

    OpenAIRE

    Bernhardt, Dan

    1995-01-01

    Within a hierarchical firm structure, this paper details how the composition of a worker's skills and the nonobservability of a worker's ability affect wage and promotion paths. Promotion-based compensation schemes derive naturally from the worker's asymmetrically observed ability. Promotion takes place over time and is inefficient since employers strategically exploit their knowledge of an able worker's ability. Conversely, employers may be unable to efficiently demote and retain bad manager...

  10. Food waste and promotions

    OpenAIRE

    LE BORGNE, Guillaume; Sirieix, Lucie; Costa, Sandrine

    2014-01-01

    This research builds a conceptual framework to analyze the links between promotions and food waste, based on the results of a qualitative study on 20 French consumers. More precisely, we study how promotions may increase food waste, but also how this wastage may change consumer’s perception of promotions. ....French Abstract : Cet article propose un cadre conceptuel pour l’analyse des liens entre les promotions et le gaspillage alimentaire, basé sur les résultats d’une enquête qualitative men...

  11. Analysis of promotions

    Directory of Open Access Journals (Sweden)

    V.V. Bozhkova

    2011-03-01

    Full Text Available Article describes the classification of promotions and determining the effectiveness of specific measures to stimulate sales (which isnt possible practically in most advertising companies.

  12. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo

    2012-10-01

    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  13. Evaluating Regional Development Agencies (RDAs) assistance on Spanish regional economic growth

    OpenAIRE

    Urueña, Baudelio

    2005-01-01

    In the process of decentralisation of regional policy, the European Union is delegating greater responsibility to Regional Governments in the promotion of regional economic growth and development. Regional Development Agencies (RDAs) would play a significant role as public agencies coordinating economic growth, promotion and development strategies in their respective territorial areas. In recent years, regional policy evaluation has been a theme under much debate internationally much of which...

  14. Methylation profile of the promoter CpG islands of 31 genes that may contribute to colorectal carcinogenesis

    Institute of Scientific and Technical Information of China (English)

    Xiao-Li Xu; Jing-De Zhu; Jian Yu; Hong-Yu Zhang; Meng-Hong Sun; Jun Gu; Xiang Du; Da-Ren Shi; Peng Wang; Zhen-Hua Yang

    2004-01-01

    AIM: To establish the methylation profile of the promoter CpG islands of 31 genes that might play etiological roles in colon carcinogenesis.METHODS: The methylation specific PCR in conjunction of sequencing verification was used to establish the methylationprofile of the promoter CpG islands of 31 genes in colorectal cancer (n = 65), the neighboring non-cancerous tissues (n = 5), colorectal adenoma (n = 8), and normal mucosa (n = 1). Immunohistochemically, expression of 10 genes was assessed on the home-made tissue microarrays of tissues from 58 patients. The correlation of tumor specific changes with each of clinical-pathologic features was scrutinized with relevant statistic tools.RESULTS: In comparison with the normal mucosa of the non-cancer patients, the following 14 genes displayed no tumor associated changes: breast cancer 1, early onset (BRCA1), cadherin 1, type 1, E-cadherin (epithelial) (CDH1),death-associated protein kinase 1 (DAPK1), DNA (cytosine5-)-methyltransferase 1 (DNMT1), melanoma antigen, family A, 1 (directs expression of antigen MZ2-E) (MAGEA1), tumor suppressor candidate 3 (N33), cyclin-dependent kinase inhibitor 1A (p21, Cip1) (p21WAF1), cyclin-dependent kinase inhibitor 1B (p27, Kip1) (p27KIP1) , phosphatase and tensin homlog (mutated in multiple advanced cancers 1) (PTEN), retinoic acid receptor, beta (RAR-, Ras association (RalGDS/AF-6)domain family 1 C (RASSF1C), secreted frizzled-related protein 1 (SFRP1), tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinfiammatory) (TIMP3),and von Hippel-Lindau syndrome (VHL). The rest 17 targets exhibited to various extents the tumor associated changes.As changes in methylation of the following genes occurred marginally, their impact on the formation of colorectal cancer were trivial: adenomatous polyposis coli (APC) (8%, 5/65),Ras association (RalGDS/AF-6) domain family 1A (RASSF1A) (3%, 2/65) and cyclin-dependent kinase inhibitor 2A,alternated reading frame (p14ARF) (6%, 4

  15. Desenvolvimento regional: a diversidade regional como potencialidade

    Directory of Open Access Journals (Sweden)

    Virginia Elisabeta Etges

    2013-03-01

    Full Text Available Ao longo da segunda metade do século XX o debate sobre desenvolvimento regional no Brasil recebeu atenção especial, principalmente, entre economistas e geógrafos. Dois enfoques principais se destacam no debate: um, que entende a promoção do desenvolvimento regional a partir da redução/eliminação das desigualdades regionais; outro, que propõe a compreensão da diversidade regional como potencialidade para o desenvolvimento de regiões. O primeiro foi e continua sendo hegemônico, evidenciado tanto em trabalhos científicos quanto em documentos norteadores das políticas públicas na área. Já o segundo evidencia-se mais claramente a partir da década de 1990, período em que o conceito de região é retomado sob um novo enfoque. Neste trabalho pretende-se explicitar o significado de cada uma dessas concepções, no intuito de contribuir para a qualificação da discussão sobre desenvolvimento regional.Palavras-chave | Desenvolvimento regional; diversidade regional; potencialidades; região.Código JEL | O18; R11; R58. REGIONAL DEVELOPMENT: REGIONAL DIVERSITY AS POTENTIALAbstractThroughout the second half of the twentieth century the debate on regional development in Brazil received special attention, especially among economists and geographers. Two main approaches stand out in the debate: one that understands the promotion of regional development from the reduction / elimination of regional inequalities, and the other proposes the understanding of regional diversity and potentiality for developing regions. The first was and still remains hegemonic, being evidenced both in scientific papers and in documents guiding public policies in the area. The latter is evidenced most clearly from the 1990s on, a period when the concept of region is resumed under a new approach. This paper aims to clarify the meaning of each of these concepts in order to contribute to the qualification of the discussion on regional development.Keywords | Regional

  16. The Statistical Research of Regional R&D Activities and Policy Decision Research of Promoting Economic Development%区域R&D活动统计分析与促进经济发展对策研究

    Institute of Scientific and Technical Information of China (English)

    陈志斌; 施建军

    2003-01-01

    Ever since the English scholar Friedman brought forward the concept of technological innovation system in 1987, schoIars all over the world have carried out researches on the nation's overall competitiveness from the perspective of technological innovation system. They have tried to prove that technological innovation system has a vital effect on the enhancement of a nation' s technology level, economic development and overall power, and that its core, the R&D activities, play a fundamental and decisive role in economic development. In this paper, the authors will compare Jiangsu's R&D expenditore from such indices as resource, input and output with that of Beijing, Shanghai, Shandong, Guangdong and Shanxi,the other provinces and cities also on the top six list. Concluding applicable experience from advanced R&D development and examining on the relationship between regional R&D development and regional economic development will Provide reference for the enactment of R&D development policies for economic development.

  17. A functional polymorphism in the promoter region of microRNA-146a is associated with the risk of Alzheimer disease and the rate of cognitive decline in patients.

    Directory of Open Access Journals (Sweden)

    Lili Cui

    Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.

  18. Prometaphase APCcdh1 activity prevents non-disjunction in mammalian oocytes.

    Science.gov (United States)

    Reis, Alexandra; Madgwick, Suzanne; Chang, Heng-Yu; Nabti, Ibtissem; Levasseur, Mark; Jones, Keith T

    2007-10-01

    The first female meiotic division (meiosis I, MI) is uniquely prone to chromosome segregation errors through non-disjunction, resulting in trisomies and early pregnancy loss. Here, we show a fundamental difference in the control of mammalian meiosis that may underlie such susceptibility. It involves a reversal in the well-established timing of activation of the anaphase-promoting complex (APC) by its co-activators cdc20 and cdh1. APC(cdh1) was active first, during prometaphase I, and was needed in order to allow homologue congression, as loss of cdh1 speeded up MI, leading to premature chromosome segregation and a non-disjunction phenotype. APC(cdh1) targeted cdc20 for degradation, but did not target securin or cyclin B1. These were degraded later in MI through APC(cdc20), making cdc20 re-synthesis essential for successful meiotic progression. The switch from APC(cdh1) to APC(cdc20) activity was controlled by increasing CDK1 and cdh1 loss. These findings demonstrate a fundamentally different mechanism of control for the first meiotic division in mammalian oocytes that is not observed in meioses of other species. PMID:17891138

  19. [Novel bidirectional promoter from human genome].

    Science.gov (United States)

    Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

    2011-01-01

    In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells. PMID:21790010

  20. COGNITION ON WORK OF INVESTMENT PROMOTION

    Institute of Scientific and Technical Information of China (English)

    王孝华

    2009-01-01

    @@ FIRST CHAPTER As I was working as an investment promotion director for many years in an investment promotion board and an administrative committee of APEC Science and Technology Industrial Zone,Mong with my colleagues,we have developed over 150 joint ventures and WOFEs(wholly Owned Foreign Enterprises).As a result,I am well awflYe of the key issues that foreign Investors need,wish,like and also what they dislike as well,along with the reasons,rationale and the principle guiding them.I'd like to present my cognitions on work of investment promotion through summarizing my working experience and study recognition for these years,and hopefully to create a guide for how to make well-done on investment promotion job on which every regional govemment puts more attention and emphasis for it could assist and accelerate its local economy.

  1. Internet promotion of Puumala

    OpenAIRE

    Smirnova, Natalia

    2015-01-01

    Nowadays, the industry of tourism widely uses the Internet as a promotion channel. There are many types of internet promotion. The main goal of this paper is to analyse the ways of promotion Puumala, the small municipality of Eastern Finland, on the Internet for Russian customers. Carrying out this research, the methods I employed are an interview and an online survey. Thus, due to this information and the facts taken from the interview with manager of Tour Center I have been able to dete...

  2. THE PROMOTIONAL ACTIVITY IN THE TOURISTIC SECTOR

    Directory of Open Access Journals (Sweden)

    Costel Iliuta Negricea

    2008-05-01

    Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.

  3. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    citizen’s health, health habits and health concerns merge within the educational framework. Through empirical findings, based on 20 qualitative interviews and participatory observation studies from four schools, I show that there are widespread ideas, among teachers as well as students, that professional......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are...... conceived in a specific educational setting; namely the Danish social and health education programme. Here, health promotion is formally conceived as a qualification aimed at citizens and patients - and not at the students themselves. However, as the paper will demonstrate, conceptions of student’s and...

  4. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are...... conceived in a specific educational setting; namely the Danish social and health education programme. Here, health promotion is formally conceived as a qualification aimed at citizens and patients - and not at the students themselves. However, as the paper will demonstrate, conceptions of student’s and...... citizen’s health, health habits and health concerns merge within the educational framework. Through empirical findings, based on 20 qualitative interviews and participatory observation studies from four schools, I show that there are widespread ideas, among teachers as well as students, that professional...

  5. Promoting Renewable Energy Technologies

    DEFF Research Database (Denmark)

    Olsen, Ole Jess; Skytte, Klaus

    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies....

  6. Promoting Global Health

    OpenAIRE

    Margaret A. Winker, MD; Lorraine E. Ferris, PhD, LLM

    2015-01-01

    The Editor-in-Chief of the International Journal of MCH and AIDS (IJMA) is a member of the World Association of Medical Editors (WAME). The Editorial Board of IJMA believes it is important that the statement on promoting global health and this accompanying editorial is brought to the attention of our readers. Medical journal editors have a social responsibility to promote global health by publishing, whenever possible, research that furthers health worldwide.

  7. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

    2010-10-20

    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  8. 东北亚区域贸易合作对东北老工业基地开放型经济发展的推动研究%The Promotation Research of Northeast Asia Regional Trade Cooperation to the Northeast Old Industrial Base of the Open Economy Development

    Institute of Scientific and Technical Information of China (English)

    潘宏

    2014-01-01

    〔Abstract〕 At present , the overall situation of the trade between the old northeastern industrial base of China and the countries of Northeast Asia is good , but there are also some problems such as commercial scale is not large , unbalanced development in different re-gions . Northeast of China did not form a unified regional market , and lack of product brand awareness . The export proportion of the pri-mary products is too large , the relatively low export proportion of mechanical and electrical products , import proportion of raw materials and resource products is too large , the dependence on the external resources is strong , the effect of the state-owned enterprises is not fully ex-ert and so on . Therefore , the cooperation pattern between the old northeastern industrial base of China and the countries of Northeast Asian needs further promotion from complementary to the strategy , including science and technology cooperation , environmental cooperation , strengthen cultural exchanges , to promote the establishment of the mechanism of political mutual trust and to promote cooperation system ar-rangement and so on .%当前,东北老工业基地与东北亚各国之间的贸易发展总体态势良好,但也存在贸易规模不大、地区发展不平衡、东北地区没有形成统一的区域市场、缺乏产品的品牌意识、初级产品出口比重过大,机电产品出口比重偏低、原材料和资源类产品进口比重大,对外资源依赖性强、国有企业的作用没有得到充分发挥等方面的问题,对此,东北老工业基地与东北亚国家合作的模式需进一步从互补型提升至战略型,主要包括科技合作、环境合作、加强文化交流,促进政治互信机制的建立、推动合作制度安排等。

  9. TOURISM PROMOTION FOR UNKNOWN AREAS IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Fotache Lacramioara

    2013-12-01

    Full Text Available The paper is an effort to unknown areas identity affirmation, through collaborative development of advertising mix, with an emphasis on virtual platforms as admissible solution for increasing visibility. Based upon comparative effective analysis of categories of communication particularities, it is suggested a positioning strategic solution, via virtual advertising platform as unique, integrated, complex and very attractive tourism product promotion, fitted for the internal and international tourism circuit. The active promotion of the specified territorial identity will launch a brand with an impact among tourists by using marketing techniques and innovating technical means and prioritizing tourism as a principal vector of local and regional development.

  10. Promoção e vigilância da saúde no contexto da regionalização da assistência à saúde no SUS Health promotion and surveillance in the context of health care regionalization in the Unified National Health System in Brazil

    Directory of Open Access Journals (Sweden)

    Carmen Fontes Teixeira

    2002-01-01

    Full Text Available O presente trabalho discute os limites e possibilidades de implementação de práticas de promoção e vigilância da saúde, levando em conta a proposta de regionalização contida na Norma Operacional da Assistência à Saúde (NOAS, adotada pelo Ministério de Saúde em 2001. Caracteriza essa proposta como uma oportunidade para se avançar na construção de sistemas microrregionais que garantam a integralidade da atenção à saúde, de acordo com a capacidade operacional do Sistema Único de Saúde em cada região e Estado do país. Em seguida analisa a contribuição das diversas propostas de mudança nas práticas de saúde para o desenvolvimento da promoção, prevenção de riscos e agravos, e reorientação da assistência individual e coletiva, na medida em que venham a ser incorporadas ao processo de implementação da NOAS nos diversos Estados da Federação.This article discusses the limits and possibilities in the implementation of health promotion and surveillance measures, in light of the regionalization proposal contained in the Health Care Operational Norm (NOAS adopted by the Brazilian Ministry of Health in 2001. The proposal is characterized as an opportunity to move forward in the establishment of micro-regional systems guaranteeing integral health care, in keeping with the operational capacity of the Unified National Health System in each Region and State of the country. The article goes on to analyze the contribution of various proposals for change in health practices for the development of health promotion, prevention of risks and diseases, and reorientation of individual and collective care as they are incorporated into the NOAS implementation process in various States of the country.

  11. Regions & Cohesion

    OpenAIRE

    KOFF, Harlan; Maganda, Carmen

    2012-01-01

    The journal of the Consortium for Comparative Research on Regional Integration and Social Cohesion (RISC), a cross-regional, interdisciplinary, and multi-lingual network of socially conscious and prestigious research institutes in Europe, North America, South America, Africa, and Asia. Due to the dramatic changes in global affairs related to regional integration, studies can no longer be limited to the analysis of economic competitiveness and political power in global geopolitics. Regions and...

  12. A single-copy galK promoter cloning vector suitable for cloning strong promoters

    DEFF Research Database (Denmark)

    Dandanell, Gert; Court, Donald L.; Hammer, Karin

    1986-01-01

    We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...

  13. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  14. [Prevention in regional policy].

    Science.gov (United States)

    Masi, M; Caponetti, A

    2006-01-01

    Prevention, safety and health promotion represent fondamental issues in the Regional policy. With this regard, the implementation of the Regional policy has been thought as the promotion of an integrated system which links different fields such as health, work-related information and education, job orientation and work in general. It is recommended that a good standard of prevention is achieved through the synergic actions and the collaborations among all the different actors playing a role in safety and prevention in workplace, including occupational physicians, safety and prevention operators, safety representatives for workers, trade unions, employers associations and public institutions. It is also necessary to adopt a strategy in order to decrease the number of misdiagnosed occupational diseases as well as to promote the "culture of safety in workplaces", increasing the awareness of all figures, with special focus on employers category. All this has to be set in the new scenario of the nowadays work characterized by the progressive increase of atypical job contracts, renewing the emphasis on the necessity of keeping joined "the right to a job with the right to health". PMID:17144418

  15. Health-promoting schools

    DEFF Research Database (Denmark)

    Kwan, Stella Y L; Petersen, Poul Erik; Pine, Cynthia M;

    2005-01-01

    them to develop lifelong sustainable attitudes and skills. Poor oral health can have a detrimental effect on children's quality of life, their performance at school and their success in later life. This paper examines the global need for promoting oral health through schools. The WHO Global School...

  16. Promoting Healthy Dietary Behaviors.

    Science.gov (United States)

    Perry, Cheryl L.; Story, Mary; Lytle, Leslie A.

    This chapter reviews the research on promoting healthy dietary behaviors in all youth, not just those who exhibit problems such as obesity or eating disorders. The first section of this chapter presents a rationale for addressing healthy dietary behavior with children and adolescents, on the basis of the impact of these behaviors on short- and…

  17. Promoters of Corynebacterium glutamicum

    Czech Academy of Sciences Publication Activity Database

    Pátek, Miroslav; Nešvera, Jan; Guyonvarch, A.; Reyes, O.; Leblon, G.

    2003-01-01

    Roč. 104, - (2003), s. 311-323. ISSN 0168-1656 R&D Projects: GA AV ČR IPP1050128; GA ČR GA525/01/0916 Institutional research plan: CEZ:AV0Z5020903 Keywords : corynebacterium glutamicum * promoters * transcriptional regulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.543, year: 2003

  18. Promoting La Cultura Hispana

    Science.gov (United States)

    Pluviose, David

    2007-01-01

    Launched in 1985 at Arizona State University, the Hispanic Research Center's (HRC) efforts to promote Latino and Chicano art and issues have flourished in recent years. In 2004, the HRC hosted the Arizona International Latina/o Arts Festival in collaboration with the Mesa Southwest Museum. The HRC has also founded a mentoring institute for…

  19. Dynamic usage of transcription start sites within core promoters

    DEFF Research Database (Denmark)

    Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro;

    2006-01-01

    BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites is...

  20. Using Regional American Short Stories to Promote Student Collaboration

    Science.gov (United States)

    Smyth, Theoni Soublis; Hansen, Angela

    2010-01-01

    Collaboration and the appreciation for multiple perspectives have become increasingly important. The current political and economic condition in the United States and globally has exemplified the urgency for people of many different backgrounds and ideologies to work together to find solutions to world problems such as climate change and economic…

  1. Regional Cooperation for the Promotion of Nuclear Power Business

    International Nuclear Information System (INIS)

    In the early year of nuclear power business in Korea, it was proceeded smoothly under the good situation in general. But in mid-1987 on the way of democratization in the country, mass demonstration of residents around the nuclear power plant and unfavorable groundless attitude to nuclear power plant presented US great deal of adversities. Upon this historical turning point KEPCO and government could provide the law on support for areas surrounding power plant and we recognized that the nuclear power business is only possible under the good-established, mutual cooperation between the utility and the surrounding communities and the enhancement of public understanding is inevitable than before. In order to secure these goals with the present recognition heartily, we firstly have to operate the plant safely to lay up the trust foundation and secondly to enhance the common understanding by giving more information of nuclear power especially contribution on national economic growth and environment preservation and, thirdly to do our best for the establishment of new era of co-prosperity between the utility and surrounding communities by strengthening the rational supports. By implementing all of these without any problems, the communities become more affluent than before and the conversion of the image of our corporation as a national entity will become widespread, so that it will be easy to find the necessary construction sites, as well as to operate existing plants, smoothly. Eventually we, as the public corporation, could carryout he social responsibility and contribute to the national economic growth, which leads to the final goal of community cooperation

  2. Analysis of the Corynebacterium glutamicum dapA Promoter

    OpenAIRE

    Vašicová, Pavla; Pátek, Miroslav; Nešvera, Jan; Sahm, Hermann; Eikmanns, Bernhard

    1999-01-01

    Deletion and mutational analysis of the promoter P-dapA from Corynebacterium glutamicum was performed to identify regions and particular nucleotides important for its function. An extended −10 region and a stretch of six T’s at positions −55 to −50 were found to be the most important elements in the promoter function. The results of mutational analysis of P-dapA are consistent with the conclusions of statistical computer-aided analysis of 44 C. glutamicum promoter sequences.

  3. Changing regional images; are regional marketing campaigns successful?

    OpenAIRE

    Wilhelm J. Meester; Pellenbarg, Pieter H.

    2001-01-01

    An important element in the urban and regional development strategy of many local and regional governments is geographical marketing. The process of geographical marketing combines promotional, spatial and organisational activities, and can be aimed at various groups. In 1989 a marketing campaign was started by the province of Groningen, in the northern part of the Netherlands. This campaign, which is still being carried on, has used various means of communication: advertisements in newspaper...

  4. Analysis of the sericin1 promoter and assisted detection of exogenous gene expression efficiency in the silkworm Bombyx mori L.

    OpenAIRE

    Ye, Lupeng; Qian, Qiujie; Zhang, Yuyu; You, Zhengying; Che, Jiaqian; Song, Jia; Zhong, Boxiong

    2015-01-01

    In genetics, the promoter is one of the most important regulatory elements controlling the spatiotemporal expression of a target gene. However, most studies have focused on core or proximal promoter regions, and information on regions that are more distant from the 5′-flanking region of the proximal promoter is often lacking. Here, approximately 4-kb of the sericin1 (Ser1) promoter was predicted to contain many potential transcriptional factor binding sites (TFBSs). Transgenic experiments hav...

  5. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author)

  6. Promoters of Escherichia coli versus promoter islands: function and structure comparison.

    Directory of Open Access Journals (Sweden)

    Valeriy V Panyukov

    Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

  7. Mainstreaming regionalism

    OpenAIRE

    Closa, Carlos

    2015-01-01

    The consolidation of regionalism as a broad field of research attracting scholars across disciplines demands an inquiry on its scientific foundations. This inquiry should consider the object of research, the methods and the theories used. First, regionalism scholars lack a consensually agreed definition of their subject. Second, research focusses mainly in case studies, led by area specialists and comparative research is a rather occasional methodological occurrence. Finally, regionalism has ...

  8. Direct and indirect effects in the regulation of overlapping promoters.

    Science.gov (United States)

    Bendtsen, Kristian Moss; Erdossy, János; Csiszovszki, Zsolt; Svenningsen, Sine Lo; Sneppen, Kim; Krishna, Sandeep; Semsey, Szabolcs

    2011-09-01

    Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion of RNA polymerase in the promoter region, activation often requires a surface on the regulatory protein to contact RNAP and thus facilitate transcription initiation. RNAP itself is also a DNA binding protein, therefore it can function as a transcriptional repressor. Searching the Escherichia coli promoter database we found that ∼14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used for both activation and repression of promoter transcription, depending on the context. These findings can be exploited in the construction of synthetic networks. PMID:21609952

  9. Synthetic promoter libraries for Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Rytter, Jakob Vang; Helmark, Søren; Chen, Jun;

    2014-01-01

    The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

  10. Regions and the Territorial Cohesion

    OpenAIRE

    Ioan Ianos; Irina Saghin; Gabriel Pascariu

    2013-01-01

    Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial...

  11. Regions and the Territorial Cohesion

    Directory of Open Access Journals (Sweden)

    Ioan Ianos

    2013-08-01

    Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.

  12. Guarded Type Promotion

    DEFF Research Database (Denmark)

    Winther, Johnni

    2011-01-01

    In Java, explicit casts are ubiquitous since they bridge the gap between compile-time and runtime type safety. Since casts potentially throw a ClassCastException, many programmers use a defensive programming style of guarded casts. In this programming style casts are protected by a preceding...... conditional using the instanceof operator and thus the cast type is redundantly mentioned twice. We propose a new typing rule for Java called Guarded Type Promotion aimed at eliminating the need for the explicit casts when guarded. This new typing rule is backward compatible and has been fully implemented in...... a Java 6 compiler. Through our extensive testing of real-life code we show that guarded casts account for approximately one fourth of all casts and that Guarded Type Promotion can eliminate the need for 95 percent of these guarded casts....

  13. Advancement & Promotion Review: 2003

    CERN Multimedia

    2003-01-01

    Advancement, exceptional advancement and promotion decisions were made at the end of June, following the procedures published in Weekly Bulletin No. 13/2003. These decisions were included, where applicable, in the salaries for the month of July 2003. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions are now published on the HR Division website and are accessible for consultation only at the following address: http://cern.ch/hr-div/internal/personnel/advlist_2003.asp It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2003. Final decisions will be applied retroactively to 1 July 2003. Human Resources Division Tel:...

  14. ADVANCEMENT & PROMOTION REVIEW: 2002

    CERN Multimedia

    2002-01-01

    Advancement, exceptional advancement and promotion decisions were made at the beginning of July, under the new career structure scheme and following the procedures published in Weekly Bulletin No. 11/2002. These decisions were included, where applicable, in the salaries for the month of July 2002. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions will be published this year on the HR Division website and are accessible for consultation only at the following address : http://cern.ch/hr-div/internal/personnel/advlist.asp It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2002. Final decisions will be applied retroactivel...

  15. [Promoting Living Kidney Transplantation].

    Science.gov (United States)

    Lin, Chiu-Chu

    2016-04-01

    Kidney transplantation is the best approach for treating patients with end stage renal disease, offering patients the best chance of returning to normal health. While the techniques used in kidney transplantation surgery are mature and highly successful, there is a severe shortage of donor organs. Statistics show a serious imbalance between organ donations and patients on the waiting list for organ transplantation. Moreover, evidence from empirical studies has shown a better transplantation outcome for patients who receive living donor transplantation than for those who receive organs from cadavers. Although using relatives as donors offers an effective way to reduce the problem of organ shortage, this strategy faces many challenges and many other factors affect the promotion of living donor transplantation. This article elaborates how cultural and psychological factors, kidney transplantation awareness, and ethics and laws impact upon living kidney donations and then proposes coping strategies for promoting living kidney transplantation. PMID:27026555

  16. PROMOTION, SWITCHING BARRIERS, AND LOYALTY

    Directory of Open Access Journals (Sweden)

    Gu-Shin Tung

    2011-06-01

    Full Text Available This paper investigates the causal relationships among promotion effects, switching barriers, and loyalty in the department stores. The relationship between switching barriers and loyalty reveals partially the same results as the switching barriers theory of Jones et al. (2000. The reasons arise from “too often” and “too similar” sales promotion programs of competitive department stores in Taiwan, leading the promotion effects to not contribute to the attractiveness of competitors. The promotion effects have a positive and significant influence on loyalty, which is consistent with the prior literature. Promotion effects are also the most important weight to loyalty in our tested model but it reveals a seeming loyalty, because the loyalty depends on the reward of promotion. The negative relationship between promotion effects and attractiveness of alternative supports the promotion effects, which can lower the attractiveness of competitors, but these similar promotion plans are not attributed to interpersonal relationships.

  17. School health promotion and teacher professional identity

    OpenAIRE

    Jourdan, Didier; Simar, Carine; Deasy, Christine; Carvalho, Graça Simões; McNamara, Patricia Mannix

    2016-01-01

    PURPOSE – Health and education are inextricably linked. Health promotion sits somewhat uncomfortably within schools, often remaining a marginal aspect of teachers’ work. The purpose of this paper is to examine the compatibility of an HP-initiative with teacher professional identity. DESIGN/METHODOLOGY/APPROACH – A qualitative research design was adopted consisting of semi-structured interviews. In total, 49 teachers in two school districts in the Auvergne region in central France were int...

  18. Promoting Health, Producing Moralisms?

    DEFF Research Database (Denmark)

    Brogaard Kristensen, Dorthe; Askegaard, Søren; Hauge Jeppesen, Lene; Anker, Thomas Boysen

    2010-01-01

    Based on an ethnographic study of 25 Danish consumers, the aim of this paper is threefold. Firstly, based on a critique of traditional approaches to consumer health campaigning, it argues for a more socially diversified approach for understanding consumer construction and pursuit of healthy behav...... behaviour. Secondly, it presents a typology of discourses that are employed by consumers in constructing their (health oriented) food consumption. Thirdly, it addresses certain social and moral dilemmas inherent in consumer health promotional campaigns....

  19. Bicycle Promotion Plan

    Energy Technology Data Exchange (ETDEWEB)

    Simone, G. A.

    1981-03-09

    The objective of this Bicycle Promotion Plan is to outline a set of recommendations and supporting strategies for implementation by the US DOE toward increased use of the bicycle for energy conservation. The recommendations are designed in such a way as to function in concert with: (1) bicycle programs administered by other Federal government agencies; and (2) related programs and activities already sponsored by DOE. The approach to preparation of the Plan involved a review of all current and planned bicycle promotion programs at the Federal level as well as a review of the array of lierature on the subject. The UniWorld project staff also interacted with several DOE program offices, in order to determine the extent to which they might appropriately contribute to the implementation of bicycle promotional efforts. A synthesis of all the information gathered was published in January of 1981 as a part of the project (The Bicycle Program Review). Based upon this information and an examination of the barriers to bicycle use identified by bicycle transportation specialists in the field, UniWorld developed a series of the most potentially effective recommendations and program strategies for implementation by DOE. The recommendations address activities that could be undertaken in conjunction with existing DOE programs, new developments that might be considered to fulfill critical needs in the field, and interagency efforts that DOE could play a role in.

  20. Reference: REGION1OSOSEM [PLACE

    Lifescience Database Archive (English)

    Full Text Available ic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulat...REGION1OSOSEM Hattori T, Terada t, Hamasuna S Regulation of the Osem gene by abscis...ion by abscisic acid and VP1 Plant J 7: 913-925 (1995) PubMed: 7599651; GenBank: U22102 ...

  1. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Directory of Open Access Journals (Sweden)

    Stephanie E Hesselson

    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  2. Logistics Systems from the Regional Perspective

    OpenAIRE

    Enno Lend

    2006-01-01

    Regional development depends on the complex approach to the business environment, where the logistics system can either promote or restrict the economic development at the same time. Logistics and transport system can simultaneously be a promotional factor of the innovation in the regions and it can be itself the subject to technological and process innovation as well. The logistics system of the islands in Western Estonia is an integral business environment re-integrating institutions with p...

  3. Isolation and characterization of active promoters from Gluconacetobacter diazotrophicus strain PAL5 using a promoter-trapping plasmid.

    Science.gov (United States)

    Schwab, Stefan; Pessoa, Cristiane Alves; de Lima Bergami, Amanda Aparecida; de Azevedo Figueiredo, Nathália Lima; Dos Santos Teixeira, Kátia Regina; Baldani, José Ivo

    2016-07-01

    Gluconacetobacter diazotrophicus is a nitrogen-fixing, endophytic bacterium that has the potential to promote plant growth and increase yield. Genetically modified strains might get more benefits to host plants, including through expression of useful proteins, such as Cry toxins from B. thuringiensis, or enzymes involved in phytohormone production, proteins with antagonistic activity for phytopathogens, or that improve nutrient utilization by the plant. For that, expression systems for G. diazotrophicus are needed, which requires active promoters fused to foreign (or innate) genes. This article describes the construction of a G. diazotrophicus PAL5 promoter library using a promoter-less lacZ-bearing vector, and the identification of six active promoters through β-galactosidase activity assays, sequencing and localization in the bacterial genome. The characterized promoters, which are located on distinct regions of the bacterial genome and encoding either sense or antisense transcripts, present variable expression strengths and might be used in the future for expressing useful proteins. PMID:26914247

  4. Exome-based Variant Detection in Core Promoters.

    Science.gov (United States)

    Kim, Yeong C; Cui, Jian; Luo, Jiangtao; Xiao, Fengxia; Downs, Bradley; Wang, San Ming

    2016-01-01

    Core promoter controls the initiation of transcription. Core promoter sequence change can disrupt transcriptional regulation, lead to impairment of gene expression and ultimately diseases. Therefore, comprehensive characterization of core promoters is essential to understand normal and abnormal gene expression in biomedical studies. Here we report the development of EVDC (Exome-based Variant Detection in Core promoters) method for genome-scale analysis of core-promoter sequence variation. This method is based on the fact that exome sequences contain the sequences not only from coding exons but also from non-coding region including core promoters generated by random fragmentation in exome sequencing process. Using exome data from three cell types of CD4+ T cells, CD19+ B cells and neutrophils of a single individual, we characterized the features of core promoter-mapped exome sequences, and analysed core-promoter variation in this individual genome. We also compared the core promoters between YRI (Yoruba in Ibadan, Nigeria) and the CEU (Utah residents of European decedent) populations using the exome data generated by the 1000 Genome project, and observed much higher variation in YRI population than in CEU population. Our study demonstrates that the EVDC method provides a simple but powerful means for genome-wile de novo characterization of core promoter sequence variation. PMID:27464681

  5. Investigations of Escherichia coli promoter sequences with artificial neural networks: new signals discovered upstream of the transcriptional startpoint

    DEFF Research Database (Denmark)

    Pedersen, Anders Gorm; Engelbrecht, Jacob

    1995-01-01

    along the promoter region. The spacing of all signals correspond to the helical periodicity of DNA, meaning that the signals are all present on the same face of the DNA helix in the promoter region. This is consistent with a model where the RNA polymerase contacts the promoter on one side of the DNA...

  6. Preferences for regional brands of food products

    OpenAIRE

    Ladislav Skořepa; Kamil Pícha

    2011-01-01

    The article deals with results of several marketing surveys related to the promotion of Czech products in the regional food market as well as to the consumers’ awareness of regional brands. An important part of consumers prefers regional food and food products, is interested in their ingredients and their health impact. Food quality and safety and support to regional producers become important factors in consumers’ decision-making. The article summarizes results of particular surveys done in ...

  7. Polimorfismo del promotor del gen TNF-α (p-TNF-α bovino y su asociación con la resistencia del huesped a la diseminación del virus de la leucosis - Polymorphism of the TNF-α (p-TNF-α bovine gene promoter region and its association with host resistance to bovine leukemia virus infectio

    Directory of Open Access Journals (Sweden)

    LENDEZ, Pamela Anahí

    2010-11-01

    demonstrated that G/G homocigosis in site -824 of the TNF-α promoter region could be associated to lymphosarcoma development. On the other hand, allele *902 of BoLA DRB3.2 gene of the Type II major histocompatibilty complex is associated with viral dissemination, resistance and low proviral load.The aim of this study was to analyze the relationship between the TNF-α promoter region polymorphism and the presence in the infected animals of the resistance allele BoLA DRB3.2*902. Sixty animals, carriers or not of allele *902, were selected and the mutationin the mentioned region was identified by PCR-RFLP. Preliminary datasuggest that A/A and A/G are associated to the presence of the resistance allele *902. No homozygous G/G was found among *902 carriers, suggesting a negative association between the polymorphism and the presence of the BLV resistance allle. A larger number of animals should be analyzed.

  8. Promoting Linguistic Diversity

    DEFF Research Database (Denmark)

    Daryai-Hansen, Petra Gilliyard

    2005-01-01

    To face up to the omnipresence of ‘Anglo-American’, conferences on language policy today address the issue of promoting linguistic diversity. This especially applies to contemporary Europe. Nevertheless, these conferences, which can be regarded as a kind of laboratories or academic microcosm, do...... not subscribe to clear language policies. Consequently, the predominant language is here, as elsewhere, the Anglo-American. This article outlines the deep division between the postulate of linguistic diversity and reality, and is a call for soul-searching....

  9. Renewable energy sources (promotion)

    International Nuclear Information System (INIS)

    Permission to present a Bill to establish an independent commission directly responsible for the research, development and demonstration of clean, renewable, alternative sources of energy (to nuclear energy) is requested. The paragraphs of the preamble to the Bill are summarized by the Member seeking permission. The main reason for promoting renewable energy sources is opposition to the nuclear industry. One objection was raised. However, permission was granted to present the Bill and it was read for the first time with a second reading ordered for 7 March 1986. The Bill itself is not reprinted but the permission and question are reported verbatim. (U.K.)

  10. Promotion and Relegation

    OpenAIRE

    Stefan Szymanski; Stephen Ross

    2001-01-01

    One of the most distinctive differences between team sports in Europe and North America is the institution of promotion and relegation. This paper looks into the history of why this institution developed in Europe but not North America, and considers what effects it may have on the competitive balance of the leagues. While dominance of the leagues by a small number of wealthy teams is a more severe problem in Europe, its effects are mitigated by the opportunity for new teams to enter from bel...

  11. THE PROMOTION OF INNOVATIVE PRODUCTS

    OpenAIRE

    ALYABEDEVA I.

    2012-01-01

    The article aims to consider the issues of the innovative products promotion. Peculiarities of innovative market and its future progress, key factors connected with the promotion of innovative products success are analyzed. Here are also suggested the successful marketing strategies variants of the innovative products promotion.

  12. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  13. Artificial Promoters for Metabolic Optimization

    DEFF Research Database (Denmark)

    Jensen, Peter Ruhdal; Hammer, Karin

    1998-01-01

    -organisms were constructed using synthetic degenerated oligonucleotides. From this work, a promoter library was obtained for Lactococcus lactis, containing numerous individual promoters and covering a wide range of promoter activities. Importantly, the range of promoter activities was covered in small steps...... of activity change. Promoter libraries generated by this approach allow for optimization of gene expression and for experimental control analysis in a wide range of biological systems by choosing from the promoter library promoters giving, e.g., 25%, 50%, 200%, and 400% of the normal expression level...... level is then, in principle, ready for use in the industrial fermentation process; another advantage is that the system can be used to optimize the expression of different enzymes within the same cell. (C) 1998 John Wiley & Sons, Inc....

  14. Novel Synthetic Promoters from the Cestrum Yellow Leaf Curling Virus.

    Science.gov (United States)

    Sahoo, Dipak Kumar; Sarkar, Shayan; Maiti, Indu B; Dey, Nrisingha

    2016-01-01

    Constitutive promoters direct gene expression uniformly in most tissues and cells at all stages of plant growth and development; they confer steady levels of transgene expression in plant cells and hence their demand is high in plant biology. The gene silencing due to promoter homology can be avoided by either using diverse promoters isolated from different plant and viral genomes or by designing synthetic promoters. The aim of this chapter was to describe the basic protocols needed to develop and analyze novel, synthetic, nearly constitutive promoters from Cestrum yellow leaf curling virus (CmYLCV) through promoter/leader deletion and activating cis-sequence analysis. We also describe the methods to evaluate the strength of the promoters efficiently in various transient expression systems like agroinfiltration assay, gene-gun method, and assay in tobacco protoplasts. Besides, the detailed methods for developing transgenic plants (tobacco and Arabidopsis) for evaluation of the promoter using the GUS reporter gene are also described. The detailed procedure for electrophoretic mobility shift assay (EMSA) coupled with super-shift EMSA analysis are also described for showing the binding of tobacco transcription factor, TGA1a to cis-elements in the CmYLCV distal promoter region. PMID:27557764

  15. Association study between serotonin transPorter Promoter region gene PolymorPhism and biPolar disor-der%5-羟色胺转运体启动子区域基因多态性位点与双相障碍的关联研究

    Institute of Scientific and Technical Information of China (English)

    宋莎菲; 李炜东

    2016-01-01

    Objective:To explore the genetic association between polymorphisms in serotonin transporter promoter region(5-HTTLPR)gene and bipolar disorder. Method:The subjects in this study were the people from the Han nationality in northwest China,including 153 persons from 51 families. DNA blood samples were extracted from every subject. Polymerase chain reaction was performed to amplify sites of 5-HTTLPR genes and agarose gel electrophoresis method was used to get genotype. Then polymorphisms in serotonin transporter pro-moter region gene and bipolar disorder from individual families was studied based on linkage disequilibrium a-nalysis. Results:Genotypes(L/ L,L/ LG ,S/ L,S/ S,S/ LG )or alleles(L,LG ,S)were not statistically signifi-cant between the patient group and their biological parents(χ2 = 3. 732,P > 0. 05;χ2 = 0. 633,P > 0. 05). Gen-otype-base haplotype relative(GHRR)and transmission disequilibrium test(TDT)statistical analysis did not show association between bipolar disorder and this polymorphism locus in the 5-HTT gene(GHRR:P > 0. 05;TDT:χ2 = 2. 418,P > 0. 05). Conclusion:The polymorphism of 5-HTTLPR gene does not play a principal effect on the pathogenesis of bipolar disorder in Han population from northwest China,but the minor gene inter-action of it can not be exclude.%目的:探讨5-羟色胺转运体蛋白基因启动子区域(5-HTTLPR)位点多态性与双相障碍之间的遗传学联系。方法:以中国西北地区汉族人群中51例双相障碍患者(患者组)的核心家系(父母组102名)共153人为研究对象;取每个成员血液样本 DNA,应用聚合酶链反应技术扩增5-HTTLPR 位点,以琼脂糖凝胶电泳法进行基因分型,对5-HTTLPR 位点多态性与双相障碍之间分子遗传学联系进行以家系为基础的连锁不平衡分析。结果:无论5-HTTLPR 位点各种基因型(L/ L、L/ LG、S/ L、S/ S、S/ LG )还是等位基因(L、LG、S)频率在患者组和父母组比较

  16. TRYPTOPHAN PROMOTES CHARITABLE DONATING

    Directory of Open Access Journals (Sweden)

    Laura eSteenbergen

    2014-12-01

    Full Text Available The link between serotonin (5-HT and one of the most important elements of prosocial behavior, charity, has remained largely uninvestigated. In the present study, we tested whether charitable donating can be promoted by administering the food supplement L-Tryptophan (TRP, the biochemical precursor of 5-HT. Participants were compared with respect to the amount of money they donated when given the opportunity to make a charitable donation. As expected, compared to a neutral placebo, TRP appears to increase the participants’ willingness to donate money to a charity. This result supports the idea that the food we eat may act as a cognitive enhancer modulating the way we think and perceive the world and others.

  17. Promoting household energy conservation

    International Nuclear Information System (INIS)

    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  18. Ambient oxygen promotes tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Ho Joong Sung

    Full Text Available Oxygen serves as an essential factor for oxidative stress, and it has been shown to be a mutagen in bacteria. While it is well established that ambient oxygen can also cause genomic instability in cultured mammalian cells, its effect on de novo tumorigenesis at the organismal level is unclear. Herein, by decreasing ambient oxygen exposure, we report a ∼50% increase in the median tumor-free survival time of p53-/- mice. In the thymus, reducing oxygen exposure decreased the levels of oxidative DNA damage and RAG recombinase, both of which are known to promote lymphomagenesis in p53-/- mice. Oxygen is further shown to be associated with genomic instability in two additional cancer models involving the APC tumor suppressor gene and chemical carcinogenesis. Together, these observations represent the first report directly testing the effect of ambient oxygen on de novo tumorigenesis and provide important physiologic evidence demonstrating its critical role in increasing genomic instability in vivo.

  19. Identiifcation and validation of root-speciifc promoters in rice

    Institute of Scientific and Technical Information of China (English)

    HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying

    2015-01-01

    Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).

  20. Characterization of a Maize Wip1 Promoter in Transgenic Plants

    Directory of Open Access Journals (Sweden)

    Shengxue Zhang

    2013-12-01

    Full Text Available The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1 several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2 the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3 the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4 the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5 there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6 the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5'-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5'-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs in the 5'-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity.

  1. The value of non monetary-based retail promotions

    DEFF Research Database (Denmark)

    Corsi, Armando Maria; Mueller Loose, Simone; Lockshin, Larry

    purchases. Findings: The in-store analysis confirmed that the closer an advertising message is to a product, the higher is the impact on consumers’ choices. In particular, the study found that regional messages had a larger effect compared to the environmental message. Secondly, verbal shelf talkers tend to...... predict effects of in-store promotion campaigns. They are a particularly suitable market research method to pre-test promotional campaigns....

  2. Transcriptional analysis of the human PAX9 promoter

    OpenAIRE

    Carolina Vieira de Almeida; Simone Caixeta de Andrade; Cristiane Pereira Borges Saito; Liza Lima Ramenzoni; Sergio Roberto Peres Line

    2010-01-01

    OBJECTIVES: PAX9 belongs to the Pax family of transcriptional factor genes. This gene is expressed in embryonic tissues such as somites, pharyngeal pouch endoderm, distal limb buds and neural crest-derived mesenchyme. Polymorphisms in the upstream promoter region of the human PAX9 have been associated with human non-syndromic tooth agenesis. In the present study, we verified the in vitro mRNA expression of this gene and the luciferase activity of two constructs containing promoter sequences o...

  3. Between vision and reality: promoting innovation through technoparks in Kazakhstan

    OpenAIRE

    Radošević, S; Myrzakhmet, M.

    2006-01-01

    A common motivation for the technopark movement is the belief that technoparks promote innovation and economic growth at regional and/or national levels. The paper analyses the role of technoparks as instruments of innovation promotion in Kazakhstan using data from a firm survey and interviews. Our results suggest that, unlike what is assumed in the innovation policy literature, technoparks do not house firms dealing with the commercialisation of innovations that are ready for introduction to...

  4. Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

    Directory of Open Access Journals (Sweden)

    Steven E Weicksel

    Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

  5. IGF-1基因启动子区CA重复序列多态性与代谢综合征关系研究%Association of CA repeats polymorphism in the promoter region of IGF-1 gene with metabolic syndrome

    Institute of Scientific and Technical Information of China (English)

    杨敏; 向红丁; 陈伟; 凌伟

    2011-01-01

    目的 探讨胰岛素样生长因子1(IGF-1)基因启动子区CA重复序列多态性与代谢综合征(MS)的关系.方法 收集北京市东城区常住人口1047例,采用2005年国际糖尿病联盟标准诊断代谢综合征.将受试者的基因组DNA应用聚合酶链反应扩增,再通过选择不同长度的纯合子样本测序确定CA重复的次数,以确定等位基因.同时测量身高、体重、腰围、血糖、血脂、胰岛素及血IGF-1.结果 (CA)19纯合组MS患病率显著低于不携带(CA)19组(9.1% vs 24.0%,x2=18.05,P<0.01)及(CA)19杂合组(9.1% vs 18.3%,x2=8.55,P<0.01);三组间血IGF-1水平差异有统计学意义[(114.0±52.6)μg/L vs(136.6±80.5)μg/L vs(129.2±49.1)μg/L,F=3.16,P<0.05],(CA)19纯合组血IGF-1水平低于不携带(CA)19组及(CA)19杂合组.三组间体重指数(BMI)、腰围(WC)、甘油三酯(TG)、空腹胰岛素(Fins)、2hIns及胰岛素敏感性指数(ISI)差异均有统计学意义(P<0.05),(CA)19纯合组的BMI、WC、TG、FIns、2hIns均低于另两组,而ISI高于另两组.结论 IGF-1基因启动子区CA重复序列多态性与汉族人群MS发病有关.%Objective To explore the relationship between CA repeats polymorphism in the promoter region of IGF-1 gene and MS in the Han nationality.Methods 1047 subjects were recruited from general population of Dongcheng District in Beijing.MS was diagnosed based on the criteria for MS in 2005 by IDF.Genomic DNA was extracted by standard methods.PCR,Genescan,Genotyper and direct sequencing were conducted to screen CA repeats polymorphism in the promoter region of the human IGF-1 gene.Levels of plasma glucose,lipids,serum insulin and IGF-1 were determined.BMI and ISI were calculated.Results The prevalence of MS in (CA) 19 homozygote was lower than that in (CA) 19 heterozygote (9.1% vs 18.3%,x2 = 8.55,P < 0.01) and without (CA) 19 (9.1% vs 24.0%,x2 = 18.05,P < 0.01).The level of serum IGF-1 had differences among the three groups [ (114.0 ± 52.6) μg/L vs

  6. Haplotyping of GH1 Gene Proximal to Promoter Region and the Association with Adult Height in Chinese Han Population%中国汉族人群GH1基因启动子区单体型及与身高的关系

    Institute of Scientific and Technical Information of China (English)

    葛芸英; 陈松; 张广峰

    2016-01-01

    目的:研究中国汉族人群GH1基因启动子区域的单核苷酸多态性及其在中国汉族人群中的分布规律,建立其单体型分析方法并探索与成年人身高间的关系,为今后个体身高特征推测研究奠定基础。方法采用直接测序法进行SNP检测,获得其分型数据;采用等位位点特异性PCR方法和基于人群的单体型推断方法分别进行单体型分析,并采用Haplo.stats软件构建单体型与身高的广义线性模型。结果GH1基因启动子区域含有多个SNP位点,在前人研究的基础上发现了−261、−250、+20三个新SNP位点;找到−278、−57、−6三个标签SNP位点,以最常见的单体型GTA为参照,TTA、GGG、TTG携带者的身高更矮(P<0.05),差异具有统计学意义。结论基于人群的单体型推断方法是一种比较准确可行的方法,可以在后续的研究中单独使用,不需要再进行复杂费时的等位位点特异性PCR操作;GH1基因启动子区域在中国汉族人群中表现出高度多态性,并存在一定的人种差异;GH1基因启动子区域的序列及单体型与身高存在一定的关系。%ABATRACT:ObjectiveThe aim of this study is to investigate the single nucleotide polymorphisms (SNPs) located at the GH1 gene proximal to promoter region in Chinese Han population, and to explore its haplotype association with adult height.MethodsSNP typing was performed by direct DNA sequencing in a control Chinese population of 109 unrelated male adults. By using both allele-speciifc PCR and the Haploview software, the haplotypes on the basis of the SNPs were obtained. Haplo.stats software was employed to analyze the association between haplotype and adult height.Results69 samples were successfully genotyped with 34 samples bearing at least two polymorphic sites. 13 SNPs were found in the GH1 gene proximal to promoter region in Chinese Han population, and three of them located at sites of −261,

  7. New origin firing is inhibited by APC/CCdh1 activation in S-phase after severe replication stress.

    Science.gov (United States)

    Ercilla, Amaia; Llopis, Alba; Feu, Sonia; Aranda, Sergi; Ernfors, Patrik; Freire, Raimundo; Agell, Neus

    2016-06-01

    Defects in DNA replication and repair are known to promote genomic instability, a hallmark of cancer cells. Thus, eukaryotic cells have developed complex mechanisms to ensure accurate duplication of their genomes. While DNA damage response has been extensively studied in tumour cells, the pathways implicated in the response to replication stress are less well understood especially in non-transformed cells. Here we show that in non-transformed cells, APC/C(Cdh1) is activated upon severe replication stress. Activation of APC/C(Cdh1) prevents new origin firing and induces permanent arrest in S-phase. Moreover, Rad51-mediated homologous recombination is also impaired under these conditions. APC/C(Cdh1) activation in S-phase occurs after replication forks have been processed into double strand breaks. Remarkably, this activation, which correlates with decreased Emi1 levels, is not prevented by ATR/ATM inhibition, but it is abrogated in cells depleted of p53 or p21. Importantly, we found that the lack of APC/C(Cdh1) activity correlated with an increase in genomic instability. Taken together, our results define a new APC/C(Cdh1) function that prevents cell cycle resumption after prolonged replication stress by inhibiting origin firing, which may act as an additional mechanism in safeguarding genome integrity. PMID:26939887

  8. Evolution of the leukotoxin promoter in genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Davies, Robert L; Kuhnert, Peter; Frey, Joachim; Christensen, Henrik; Bisgaard, Magne; Olsen, John E

    2009-01-01

    region has occurred. The rate of evolution estimated branch by branch suggests that the conserved promoter may be affected to different extents by the types of natural selection that potentially operate in regulatory regions. Tandem repeats upstream of the core promoter were confined to M. haemolytica...... with a strong association between the sequence of the repeat units, the number of repeat units per promoter, and the phylogenetic history of this species. Conclusion: The mode of evolution of the intergenic regions upstream of the leukotoxin genes appears to be highly dependent on the lifestyle of the...... bacterium. Transition from avirulence to virulence has occurred at least once in M. haemolytica with some evolutionary success of bovine serotype A1/A6 strains. Our analysis suggests that changes in cis-regulatory systems have contributed to the derived virulence phenotype by allowing phase...

  9. 7 CFR 1205.319 - Cotton-producing region.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region:...

  10. Predicting strength and function for promoters of the Escherichia coli alternative sigma factor, sigmaE.

    Science.gov (United States)

    Rhodius, Virgil A; Mutalik, Vivek K

    2010-02-16

    Sequenced bacterial genomes provide a wealth of information but little understanding of transcriptional regulatory circuits largely because accurate prediction of promoters is difficult. We examined two important issues for accurate promoter prediction: (1) the ability to predict promoter strength and (2) the sequence properties that distinguish between active and weak/inactive promoters. We addressed promoter prediction using natural core promoters recognized by the well-studied alternative sigma factor, Escherichia coli sigma(E), as a representative of group 4 sigmas, the largest sigma group. To evaluate the contribution of sequence to promoter strength and function, we used modular position weight matrix models comprised of each promoter motif and a penalty score for suboptimal motif location. We find that a combination of select modules is moderately predictive of promoter strength and that imposing minimal motif scores distinguished active from weak/inactive promoters. The combined -35/-10 score is the most important predictor of activity. Our models also identified key sequence features associated with active promoters. A conserved "AAC" motif in the -35 region is likely to be a general predictor of function for promoters recognized by group 4 sigmas. These results provide valuable insights into sequences that govern promoter strength, distinguish active and inactive promoters for the first time, and are applicable to both in vivo and in vitro measures of promoter strength. PMID:20133665

  11. Functional analysis of a reproductive organ predominant expressing promoter in cotton plants

    Institute of Scientific and Technical Information of China (English)

    REN Maozhi; CHEN Quanjia; LI Li; ZHANG Rui; GUO Sandui

    2005-01-01

    Transgenic Bt insect-resistant cotton plants have high insect resistance in the early stage of development, but relatively low resistance in the late stage. Substituting a reproductive organ-specific promoter for the CaMV35S promoter presently being used could be an ideal solution. For the first time, the promoter sequence of ADP-ribosylation factor 1 (arf1) gene was isolated from Gossypium hirsutumY18 by means of inverse PCR. The sequencing result discovered the unique structure of the arf1 promoter, including four promoter-specific elements, the initiator, TATA box, CAAT box and GC box, and also an intron in 5′-untranslation region. Four plant expression vectors were constructed for functional analysis of the promoter. Based on the pBI121 plant expression vector, four truncated arf1 promoters took the place of the CaMV35S promoter. These vectors were different only in their promoter regions. They were introduced into cotton plants via pollen tube pathway. Histochemical GUS staining and fluorescence quantitative analyses were performed to examine the expression patterns of the GUS gene driven by the 4 arf1 truncated promoters in transgenic cotton plants respectively. The results showed that the arf1 promoter was a typical reproductive organ-specific promoter. Hopefully, the arf1 promoter can be a regulatory element for designing cotton reproductive organs with desired characteristics.

  12. TERT Promoter Mutations in Thyroid Cancer.

    Science.gov (United States)

    Alzahrani, Ali S; Alsaadi, Rawan; Murugan, Avaniyapuram Kannan; Sadiq, Bakr Bin

    2016-06-01

    Two mutations (C228T and C250T) in the promoter region of the telomerase reverse transcriptase (TERT) have recently been described in different types of cancer including follicular cell-derived thyroid cancer (TC). In this paper, we reviewed the rates of these mutations in different types and subtypes of TC, their association with a number of clinical and histopathological features and outcome of TC, and their potential diagnostic and prognostic roles in TC. The overall rate of these mutations in TC is about 14 % with least prevalence in the well-differentiated subtypes of papillary thyroid cancer (10-13 %). Their rates increase significantly with increasing aggressiveness of TC reaching about 40 % in the undifferentiated and anaplastic thyroid cancers. There is also clear association with increasing age of patients at the time of diagnosis of TC. The evidence is compelling but with some conflicting results for associations between TERT promoter mutations and tumor size, extrathyroidal invasion, distant metastases, high tumor TNM stage, BRAF (V600E) mutation, recurrence, and mortality. A couple of studies reported a potential diagnostic role for TERT promoter mutations in thyroid nodules with indeterminate cytology of fine needle aspiration biopsy. These studies showed 100 % specificity but very low sensitivity of 7-10 %. The sensitivity increases significantly when TERT promoter mutation testing is combined with other gene mutations, particularly BRAF (V600E) and RAS mutations. Although TERT promoter mutations seem to play significant roles in the pathogenesis of TC, the mechanisms by which they contribute to carcinogenesis remain elusive and future work is needed to fully assess the roles, interactions, and impact of these mutations on the pathogenesis, diagnosis, prognosis, and therapeutics of TC. PMID:26902827

  13. Health promotion for trachoma control

    OpenAIRE

    John Buchan; Anthony Solomon; Hannah Kuper; Marcia Zondervan

    2004-01-01

    Introduction Although progress has been made in refining the surgical and antibiotic components of the SAFE strategy, without effective health promotion it will be difficult to eliminate blinding trachoma by 2020. Health promotion is a cornerstone of each of the four components of the SAFE strategy. It includes: explaining the disease process and the need for trichiasis surgery to an often reluctant population (S) encouraging acceptance of mass antibiotic distribution (A) promoting ...

  14. Finding Signals for Plant Promoters

    Institute of Scientific and Technical Information of China (English)

    Weimou Zheng

    2003-01-01

    The strongest signal of plant promoter is searched with the model of single motif with two types. It turns out that the dominant type is the TATA-box. The other type may be called TATA-less signal, and may be used in gene finders for promoter recognition. While the TATA signals are very close for the monocot and the dicot, their TATA-less signals are significantly different. A general and flexible multi-motif model is also proposed for promoter analysis based on dynamic programming. By extending the Gibbs sampler to the dynamic programming and introducing temperature, an efficient algorithm is developed for searching signals in plant promoters.

  15. Oxytocin promotes human ethnocentrism.

    Science.gov (United States)

    De Dreu, Carsten K W; Greer, Lindred L; Van Kleef, Gerben A; Shalvi, Shaul; Handgraaf, Michel J J

    2011-01-25

    Human ethnocentrism--the tendency to view one's group as centrally important and superior to other groups--creates intergroup bias that fuels prejudice, xenophobia, and intergroup violence. Grounded in the idea that ethnocentrism also facilitates within-group trust, cooperation, and coordination, we conjecture that ethnocentrism may be modulated by brain oxytocin, a peptide shown to promote cooperation among in-group members. In double-blind, placebo-controlled designs, males self-administered oxytocin or placebo and privately performed computer-guided tasks to gauge different manifestations of ethnocentric in-group favoritism as well as out-group derogation. Experiments 1 and 2 used the Implicit Association Test to assess in-group favoritism and out-group derogation. Experiment 3 used the infrahumanization task to assess the extent to which humans ascribe secondary, uniquely human emotions to their in-group and to an out-group. Experiments 4 and 5 confronted participants with the option to save the life of a larger collective by sacrificing one individual, nominated as in-group or as out-group. Results show that oxytocin creates intergroup bias because oxytocin motivates in-group favoritism and, to a lesser extent, out-group derogation. These findings call into question the view of oxytocin as an indiscriminate "love drug" or "cuddle chemical" and suggest that oxytocin has a role in the emergence of intergroup conflict and violence. PMID:21220339

  16. Ethnopoly promotes tolerance

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    On Friday 23 April, 225 primary school children from the eight schools in Meyrin-Cointrin and their accompanying adults took part in a big game of Ethnopoly. Private individuals, associations, administrations, shopkeepers and CERN all opened their doors to them to talk about their countries, their customs and what they are doing to promote tolerance and integration.   The CERN stand set up at ForumMeyrin for the Ethnopoly game. Scurrying from one place to another, the 10 and 11 year olds were made aware of the rich cultural diversity of their commune, which is home to 130 different nationalities. Physicists and engineers from CERN took up residence in the Forum Meyrin for the day in order to talk to the children about the advantages of international collaboration, a subject dear to the Organization's heart. They welcomed around fifty children in the course of the day, conveying to them a message of tolerance: despite their differences, the 10,000 scientists and other members of the CERN...

  17. Isolation of the promoters of Atlantic salmon MHCII genes.

    Science.gov (United States)

    Syed, Mohasina; Vestrheim, Olav; Mikkelsen, Birthe; Lundin, Maria

    2003-01-01

    The major histocompatibility complex class II (MHCII) has a central role in the immune response of vertebrates with its function of presenting antigenic peptides to the T-cell receptors. We have isolated the promoters and intron 1 of MHCIIalpha and MHCIIbeta genes of Atlantic salmon. To isolate these promoters, we constructed an Atlantic salmon ( Salmo salar) promoter finder kit (analogous to the commercially available "human promoter finder kit"). By nucleotide sequence alignment of known MHCII promoter regions, we identified the 3 conserved regulatory X, X2, and Y boxes in the salmon promoters. The W box was not found. In contrast, a salmon-specific putative W box was identified. Both of the isolated Atlantic salmon MHCIIalpha and beta promoters (included in patent applications by Genomar A/S, Oslo, Norway) were found to be functional since they both gave positive yellow fluorescence protein signal when inserted as promoters in the pEYFP-1 reporter plasmid and transfected into the salmon head kidney cell line (SHK-1). PMID:14502397

  18. Common promoter elements in odorant and vomeronasal receptor genes.

    Directory of Open Access Journals (Sweden)

    Jussara S Michaloski

    Full Text Available In mammals, odorants and pheromones are detected by hundreds of odorant receptors (ORs and vomeronasal receptors (V1Rs and V2Rs expressed by sensory neurons that are respectively located in the main olfactory epithelium and in the vomeronasal organ. Even though these two olfactory systems are functionally and anatomically separate, their sensory neurons show a common mechanism of receptor gene regulation: each neuron expresses a single receptor gene from a single allele. The mechanisms underlying OR and VR gene expression remain unclear. Here we investigated if OR and V1R genes share common sequences in their promoter regions.We conducted a comparative analysis of promoter regions of 39 mouse V1R genes and found motifs that are common to a large number of promoters. We then searched mouse OR promoter regions for motifs that resemble the ones found in the V1R promoters. We identified motifs that are present in both the V1R and OR promoter regions. Some of these motifs correspond to the known O/E like binding sites while others resemble binding sites for transcriptional repressors. We show that one of these motifs specifically interacts with proteins extracted from both nuclei from olfactory and vomeronasal neurons. Our study is the first to identify motifs that resemble binding sites for repressors in the promoters of OR and V1R genes. Analysis of these motifs and of the proteins that bind to these motifs should reveal important aspects of the mechanisms of OR/V1R gene regulation.

  19. Molecular evolution of the E8 promoter in tomato and some of its relative wild species

    Indian Academy of Sciences (India)

    Lingxia Zhao; Liya Lu; Lida Zhang; Aoxue Wang; Ning Wang; Zhuobin Liang; Xiaowen Lu; Kexuan Tang

    2009-03-01

    The E8 gene is related to ethylene biosynthesis in plants. To explore the effect of the expression pattern of the E8 gene on different E8 promoters, the molecular evolution of E8 promoters was investigated. A total of 16 E8 promoters were cloned from 16 accessions of seven tomato species, and were further analysed. The results from 19 E8 promoters including three previously cloned E8 promoters (X13437, DQ317599 and AF515784) showed that the size of the E8 promoters varied from 2101 bp (LA2150) to 2256 bp (LA2192); their sequences shared 69.9% homology and the average A/T content was 74.9%. Slide-window analysis divided E8 promoters into three regions – A, B and C – and the sequence identity in these regions was 72.5%, 41.2% and 70.8%, respectively. By searching the cis-elements of E8 promoters in the PLACE database, mutant nucleotides were found in some functional elements, and deletions or insertions were also found in regions responsible for ethylene biosysnthesis (–1702 to –1274) and the negative effect region (–1253 to –936). Our results indicate that the size of the functional region for ethylene biosynthesis in the E8 promoter could be shortened from 429 bp to 113 bp (–1612 to –1500). The results of molecular evolution analysis showed that the 19 E8 promoters could be classified into four clade groups, which is basically consistent with evolution of the tomato genome. Southern blot analysis results showed that the copy number of E8 promoters in tomato and some other wild species changed from 1 to 4. Taken together, our study provides important information for further elucidating the E8 gene expression pattern in tomato, analysing functional elements in the E8 promoter and reconstructing the potent E8 promoter.

  20. Methylation profiles of thirty four promoter-CpG islands and concordant methylation behaviours of sixteen genes that may contribute to carcinogenesis of astrocytoma

    Directory of Open Access Journals (Sweden)

    Wang Yifei

    2004-09-01

    Full Text Available Abstract Background Astrocytoma is a common aggressive intracranial tumor and presents a formidable challenge in the clinic. Association of altered DNA methylation patterns of the promoter CpG islands with the expression profile of cancer-related genes, has been found in many human tumors. Therefore, DNA methylation status as such may serve as an epigenetic biomarker for both diagnosis and prognosis of human tumors, including astrocytoma. Methods We used the methylation specific PCR in conjunction with sequencing verification to establish the methylation profile of the promoter CpG island of thirty four genes in astrocytoma tissues from fifty three patients (The WHO grading:. I: 14, II: 15, III: 12 and IV: 12 cases, respectively. In addition, compatible tissues (normal tissues distant from lesion from three non-astrocytoma patients were included as the control. Results Seventeen genes (ABL, APC, APAF1, BRCA1, CSPG2, DAPK1, hMLH1, LKB1, PTEN, p14ARF, p15INK4b, p27KIP1, p57KIP2, RASSF1C, RB1, SURVIVIN, and VHL displayed a uniformly unmethylated pattern in all the astrocytoma and non-astrocytoma tissues examined. However, the MAGEA1 gene that was inactivated and hypermethylated in non-astrocytoma tissues, was partially demethylated in 24.5% of the astrocytoma tissues (co-existence of the hypermethylated and demethylated alleles. Of the astrocytoma associated hypermethylated genes, the methylation pattern of the CDH13, cyclin a1, DBCCR1, EPO, MYOD1, and p16INK4a genes changed in no more than 5.66% (3/53 of astrocytoma tissues compared to non-astrocytoma controls, while the RASSF1A, p73, AR, MGMT, CDH1, OCT6,, MT1A, WT1, and IRF7 genes were more frequently hypermethylated in 69.8%, 47.2%, 41.5%, 35.8%, 32%, 30.2%, 30.2%, 30.2% and 26.4% of astrocytoma tissues, respectively. Demethylation mediated inducible expression of the CDH13, MAGEA1, MGMT, p73 and RASSF1A genes was established in an astrocytoma cell line (U251, demonstrating that expression of

  1. Methylation profiles of thirty four promoter-CpG islands and concordant methylation behaviours of sixteen genes that may contribute to carcinogenesis of astrocytoma

    International Nuclear Information System (INIS)

    Astrocytoma is a common aggressive intracranial tumor and presents a formidable challenge in the clinic. Association of altered DNA methylation patterns of the promoter CpG islands with the expression profile of cancer-related genes, has been found in many human tumors. Therefore, DNA methylation status as such may serve as an epigenetic biomarker for both diagnosis and prognosis of human tumors, including astrocytoma. We used the methylation specific PCR in conjunction with sequencing verification to establish the methylation profile of the promoter CpG island of thirty four genes in astrocytoma tissues from fifty three patients (The WHO grading:. I: 14, II: 15, III: 12 and IV: 12 cases, respectively). In addition, compatible tissues (normal tissues distant from lesion) from three non-astrocytoma patients were included as the control. Seventeen genes (ABL, APC, APAF1, BRCA1, CSPG2, DAPK1, hMLH1, LKB1, PTEN, p14ARF, p15INK4b, p27KIP1, p57KIP2, RASSF1C, RB1, SURVIVIN, and VHL) displayed a uniformly unmethylated pattern in all the astrocytoma and non-astrocytoma tissues examined. However, the MAGEA1 gene that was inactivated and hypermethylated in non-astrocytoma tissues, was partially demethylated in 24.5% of the astrocytoma tissues (co-existence of the hypermethylated and demethylated alleles). Of the astrocytoma associated hypermethylated genes, the methylation pattern of the CDH13, cyclin a1, DBCCR1, EPO, MYOD1, and p16INK4a genes changed in no more than 5.66% (3/53) of astrocytoma tissues compared to non-astrocytoma controls, while the RASSF1A, p73, AR, MGMT, CDH1, OCT6,, MT1A, WT1, and IRF7 genes were more frequently hypermethylated in 69.8%, 47.2%, 41.5%, 35.8%, 32%, 30.2%, 30.2%, 30.2% and 26.4% of astrocytoma tissues, respectively. Demethylation mediated inducible expression of the CDH13, MAGEA1, MGMT, p73 and RASSF1A genes was established in an astrocytoma cell line (U251), demonstrating that expression of these genes is likely regulated by DNA methylation

  2. PROMOTION STRATEGIES IN WINE MARKETING

    Directory of Open Access Journals (Sweden)

    Ştefan MATEI

    2014-06-01

    Full Text Available Marketing has proven to be very useful instrument in the wine industry, in fostering comprehensive, cohesive and effective strategies which wineries require to effectively compete in today’s almost saturated wine market. But within wine marketing, the promotion strategy, from our point of view, is the most important component of the winery that can ensure the success in the market or can shorten the life cycle of the product. This being said, the aim of the paper is twofold. Firstly, to determine and analyze the steps that are required to create a promotion strategy in the wine industry, by comparing different approaches. Secondly, to identify the instruments of the promotional mix that helps a winery to implement its promotional strategy. Bearing that in mind, the paper starts with some theoretical aspects regarding the promotion strategy and ends by providing a brief overview of the main findings.

  3. Literature promotion in Public Libraries

    DEFF Research Database (Denmark)

    Kann-Christensen, Nanna; Balling, Gitte

    2011-01-01

    This article discusses a model that can be used in order to analyse notions on literature promotion in public libraries. The model integrates different issues which interact with how literature promotion is understood and thought of in public libraries. Besides cultural policy we regard the logics...... of new public management (NPM) and professional logics in the field of public libraries. Cultural policy along with the identification of underlying logics present among politicians, government officials, managers and librarians/promoters of literature, play an important part in creating an...... understanding of literature promotion in Danish libraries. Thus the basic premise for the development of the model is that cultural policy (Policy) has an important influence on notions on literature promotion and other activities in public libraries, but that cultural policy must be seen in some kind of...

  4. Promoter polymorphisms regulating corticotrophin-releasing hormone transcription in vitro.

    Science.gov (United States)

    Wagner, U; Wahle, M; Moritz, F; Wagner, U; Häntzschel, H; Baerwald, C G O

    2006-02-01

    To investigate whether polymorphisms in the corticotrophin-releasing hormone (CRH) promoter are associated with altered CRH gene regulation, we studied the reactivity of three recently described promoter variants in vitro. The 3625 bp variants A1B1, A2B1 and A2B2 of the human CRH promoter were cloned in the 5' region to a luciferase reporter gene and transiently transfected into both mouse anterior pituitary cells AtT-20D16vF2 and pheochromocytoma cells PC12. Incubation with 8-Br-cAMP alone or in combination with cytokines significantly enhanced the promoter activity in both cell lines studied by up to 22-fold. However, dexamethasone antagonised cAMP effects on CRH expression in AtT-20 cells while showing no effect on PC12 cells, indicating that tissue-specific factors play a crucial role. Among the haplotypes studied, A1B1 exhibited the greatest reactivity on various stimuli. Electric mobility shift assay (EMSA) was performed to study whether the described polymorphic nucleotide sequences in the 5' region of the hCRH gene interfere with binding of nuclear proteins. A specific DNA protein complex was detected at position -2353 bp for the wild type sequence only, possibly interfering with a binding site for the activating transcription factor 6 (ATF6). Taken together, this is the first study to demonstrate that CRH promoter reactivity varies between the compound promoter alleles. PMID:16523405

  5. Constructing and Analyzing Fusion Promoter of Partial Sericin 1 and Bombyx A3 Cytoplasmic Actin

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Previous report showed that the 209 bp DNA sequence upstream of the sericin 1 transcriptional start site (-586 to -378 bp) is involved in promoting transcription and responsible for the tissue specificity of sericin 1 promoter in silkworm Bombyx mori. In the present study, this 209 bp sequence exhibited enhancive effect by assembling in two different locations of ubiquitous Bombyx A3 cytoplasmic actin promoter. Sf-9 cells were transfected with recombinant plasmids using Cellfectin reagent. Firefly luciferase gene located downstream of fusion promoter was considered as a reporter, whereas the activity of the co-transfected Renilla luciferase gene (pGL2-SV40) provides an internal control. This 209 bp region up-regulates the strength of A3 promoter significantly (P < 0.01) when it enters into A3 promoter with respect to the position in sericin 1 gene promoter. This 209-bp fragment was almost functionless when being located upstream of A3 promoter.

  6. Characterization of structural and free energy properties of promoters associated with Primary and Operon TSS in Helicobacter pylori genome and their orthologs

    Indian Academy of Sciences (India)

    Aditya Kumar; Manju Bansal

    2012-07-01

    Promoter regions in the genomes of all domains of life show similar trends in several structural properties such as stability, bendability, curvature, etc. In current study we analysed the stability and bendability of various classes of promoter regions (based on the recent identification of different classes of transcription start sites) of Helicobacter pylori 26695 strain. It is found that primary TSS and operon-associated TSS promoters show significantly strong features in their promoter regions. DNA free-energy-based promoter prediction tool PromPredict was used to annotate promoters of different classes, and very high recall values (∼80%) are obtained for primary TSS. Orthologous genes from other strains of H. pylori show conservation of structural properties in promoter regions as well as coding regions. PromPredict annotates promoters of orthologous genes with very high recall and precision.

  7. The Reinvention of Terroir in Food Place Promotion

    DEFF Research Database (Denmark)

    Gyimóthy, Szilvia

    2016-01-01

    Place marketers around the world are increasingly drawing on local food and regional specialties to emphasize the unique and authentic character of a given locality. This paper addresses how Danish rural tourism destinations exploit the discourses of the New Nordic Food movement as differentiator...... discourse analysis of the tourism promotional material of two coastal destination in Denmark (The Wadden Sea Region and the island of Funen), it demonstrates how new touristic place identities are reconfigured along cosmopolitan food cultures....

  8. Fiscal Decentralization Policy in Promoting Indonesia Human Development

    OpenAIRE

    Ady Soejoto; Waspodo Tjipto Subroto; Suyanto

    2015-01-01

    Goal of this research is promoting human development in Indonesia through fiscal decentralization. In general, funds decentralization, economic growth, public expenditure, and a decline in total poor population in the autonomous region provide significant positive effect on human development index (HDI), thus increasing decentralization funds as balance grants to autonomous regions can be used to finance local expenditure, especially public social expenditure in education and health increased...

  9. Isolation and characterization of the murine Nanog gene promoter

    Institute of Scientific and Technical Information of China (English)

    Da Yong WU; Zhen YAO

    2005-01-01

    Nanog protein is expressed in the interior cells of compacted morulae and maintained till epiblasts but downregulated by implantation stage. It is also expressed in embryonic stem cells, embryonic carcinoma cells and embryonic germ cells but disappeared in differentiated ES cells. In this study, we have isolated, sequenced, and performed the first characterization of the Nanog promoter. The transcription start sites were mapped by primer extension analysis. Two promoter regions were found upstream the transcription start sites and the expression of major Nanog promoter/reporter gene construct is abolished in differentiated F9 EC cells as compared to the undifferentiated counterpart. We also showed that a putative octamer motif (ATGCAAAA) is necessary for the major promoter activity. Gel shift and supershift assays showed that Oct-1, Oct-4 and Oct-6 protein selectively bind to the octamer motif.

  10. Modeling promoter grammars with evolving hidden Markov models

    DEFF Research Database (Denmark)

    Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben;

    2008-01-01

    , we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk......MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures...

  11. Direct and indirect effects in the regulation of overlapping promoters

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt;

    2011-01-01

    Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion of...... RNA polymerase in the promoter region, activation often requires a surface on the regulatory protein to contact RNAP and thus facilitate transcription initiation. RNAP itself is also a DNA binding protein, therefore it can function as a transcriptional repressor. Searching the Escherichia coli...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be...

  12. Photovoltaic module with adhesion promoter

    Science.gov (United States)

    Xavier, Grace

    2013-10-08

    Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.

  13. Ets factors regulate the polycystic kidney disease-1 promoter

    International Nuclear Information System (INIS)

    The Ets family of transcription factors consists of a group of highly conserved sequence-specific DNA binding proteins that functionally cooperate with other transcription factors to regulate a number of diverse cellular processes including proliferation, differentiation, and apoptosis. We have analyzed a 3.3 kb 5'-upstream region of the human PKD1 promoter, using transient transfection in HEK293T cells and Drosophila SL2 cells, to demonstrate that the PKD1 promoter is a target of Ets family transcription factors. Our studies showed that PKD1 promoter-luciferase reporter gene expression is downregulated by cotransfected Fli-1 and is upregulated by cotransfected Ets-1. Using deletion constructs, we demonstrated that the sequences responding to Fli-1 and Ets-1 lie within the -200 to +33 bp proximal promoter. This region was found to contain two putative Ets response elements (EREs): an upstream (Ets-A) sequence 5'-CGGAA-3' (-181 to -185) and a downstream (Ets-B) sequence 5'-CGGAT-3' (-129 to -133). Site-directed mutagenesis indicated that both EREs are functional. A Fli-1 DNA binding domain mutant construct (W321R), which is incapable of binding DNA, was unable to inhibit basal promoter activity. In contrast, a Fli-1 DNA binding domain truncation mutant construct, which only contains the DNA binding domain and lacks the transactivation domain, was able to inhibit. These results suggest that the effect of Fli-1 is through direct binding to these EREs. Direct binding of Fli-1 and Ets-1 to the Ets-A and Ets-B sites was supported by electrophoretic mobility shift assays. Lastly, competition between Fli-1 and Ets-1 for the two EREs was demonstrated by showing that increasing amounts of Ets-1 could overcome Fli-1 repression of promoter activity. Taken together, these experiments define the proximal PKD1 promoter region as a potential target of Ets family transcription factors

  14. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga

    2010-10-01

    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  15. Poverty Reduction and the Promotion of Social Equity

    OpenAIRE

    Inter-American Development Bank (IDB)

    2002-01-01

    This is the strategy profile of the Inter-American Development Bank on Poverty Reduction and the Promotion of Social Equity. The proposed strategy will start by considering the recent developments in the region, and lessons learned in the fight against poverty and in social equity advancement. In particular, it will take into account the experiences obtained from previous strategies.

  16. Promoting Growth in Sub-Saharan Africa; Learning What Works

    OpenAIRE

    Dhaneshwar Ghura; Anupam Basu; Anthony A. Calamitsis

    2000-01-01

    Africa is the world’s poorest continent, but amid all the bad news, there is hope for change. This pamphlet examines the lessons to be learned from some of the more successful economies south of the Sahara, and discusses a policy framework to promote sustainable economic growth and reduce poverty across the region.

  17. Promoting Community Language Learning in the United Kingdom

    Science.gov (United States)

    Handley, Sharon

    2011-01-01

    The COLT (Community and Lesser Taught Languages) project is a consortium of five UK universities, working with various other regional organisations to set up replicable projects and structures to promote languages in North West England. It received funding under the UK's national "Routes into Languages" initiative. One objective was to promote…

  18. Cinema ed enogastronomia nel portale turistico della Regione Toscana

    Directory of Open Access Journals (Sweden)

    Gian Luigi Corinto

    2016-05-01

    The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.

  19. Prediction of fine-tuned promoter activity from DNA sequence

    Science.gov (United States)

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael

    2016-01-01

    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  20. PARTICULARITIES OF MODERN PHARMACEUTICAL PROMOTION

    Directory of Open Access Journals (Sweden)

    Юрий Владимирович Тарасов

    2014-02-01

    Full Text Available Pharmaceutical products market is one of the most saturated consumers’ markets. Characteristic features of it are: high competition, fierce struggle for the customer, specific technologies of promotion. In conditions of globalization and increase in competition both in world pharmaceutical market and in the market of medicines and goods of medical purpose in Russia modern marketing techniques of promotion of the products to the end consumers are the key tools for strengthening market positions – both of producers of pharmaceutical goods and their suppliers, distributors, big whole-sale companies. Among main tools of promotion are: advertising, public relations, stimulation of sales on the market of medicines, personal sales, computer technologies. The article describes different technologies of promotion of medicines: indoor-advertising, hot lines, pharmaceutical exhibitions, packing. DOI: http://dx.doi.org/10.12731/2218-7405-2013-12-1

  1. Does Labor Diversity Promote Entrepreneurship?

    OpenAIRE

    Marino, Marianna; Parrotta, Pierpaolo; Pozzoli, Dario

    2012-01-01

    We find evidence that workforce educational diversity promotes entrepreneurial behavior of employees as well as the formation of new firms, whereas diversity in demographics hinders transitions to selfemployment. Ethnic diversity favors entrepreneurship in financial and business services.

  2. Does Labor Diversity Promote Entrepreneurship?

    DEFF Research Database (Denmark)

    Marino, Marianna; Parrotta, Pierpaolo; Pozzoli, Dario

    We find evidence that workforce educational diversity promotes entrepreneurial behavior of employees as well as the formation of new firms, whereas diversity in demographics hinders transitions to selfemployment. Ethnic diversity favors entrepreneurship in financial and business services....

  3. Fining Signals for Plant Promoters

    Institute of Scientific and Technical Information of China (English)

    WeimouZheng

    2003-01-01

    The strongest signal of plant promoter is searched with the model of single motif with two types.It turns out that the dominant type is the TATA-box.The other type may be called TATA-less signal,and may be used in gene finders for promoter recognition.While the TATA signals are very close for the monocot and the dicot,their TATA-less signals are significantly different.A general and flexible multi-motif model is also proposed for promoter analysis based on dynamic programming.By extending the Gibbs sampler to the dynamic programming and introducing temperature,an efficient algorithm is developed for searching signals in plant promoters.

  4. Social deprivation and exposure to health promotion. A study of the distribution of health promotion resources to schools in England

    Directory of Open Access Journals (Sweden)

    Reidpath Daniel D

    2010-08-01

    Full Text Available Abstract Background Area deprivation is a known determinant of health. It is also known that area deprivation is associated with lower impact health promotion. It is less well known, however, whether deprived areas are less responsive to health promotion, or whether they are less exposed. Using data from a national, school-based campaign to promote vaccination against the human papilloma virus (HPV, the relationship between area deprivation and exposure was examined. Methods Taking advantage of a health promotion campaign to provide information to schools about HPV vaccination, a cross sectional study was conducted to examine the relationship between area level, social deprivation, and take-up of (i.e., exposure to available health promotion material. The sample was 4,750 schools across England, including government maintained and independent schools. The relationship between area deprivation and exposure was examined using bi- and multivariate logistic regression. Results It was found that schools in the least deprived quintile had 1.32 times the odds of requesting health promotion materials than schools in the most deprived areas (p = .01. This effect was independent of the school size, the type of school, and the geographic region. Conclusion The relationship between area deprivation and the impact of health promotion may be due, at least in part, to differential levels of exposure. The study was limited in scope, pointing to the need for more research, but also points to potentially important policy implications.

  5. 7 CFR 1150.114 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.114 Promotion. Promotion means actions such as paid advertising, sales... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion. 1150.114 Section 1150.114...

  6. Health promotion and dental caries

    OpenAIRE

    Marisa Maltz; Juliana Jobim Jardim; Luana Severo Alves

    2010-01-01

    The central idea of the Brazilian health system is to prevent the establishment of disease or detect it as early as possible. Prevention and treatment of dental caries are related to behavioral factors, including dietary and oral hygiene habits, which are related to many chronic diseases. Dental health promotion therefore should be fully integrated into broadly based health-promoting strategies and actions such as food and health policies, and general hygiene (including oral hygiene), among o...

  7. External recruitment versus internal promotion

    OpenAIRE

    Chan, William

    1996-01-01

    This article analyzes the choice between internal promotion and external recruitment within the framework of an economic contest. Opening up the competition for a position to external candidates reduces the chance of promotion for existing workers and, therefore, their incentive to work. Increasing the prize for winning can maintain incentives but is limited by moral hazard and potentially disruptive office politics. Alternatively, a competitive handicap can be awarded to existing workers to ...

  8. The Promotion of Solar Vehicles

    OpenAIRE

    Wilfried Puwein

    1991-01-01

    Solar vehicles, which do not rely on the public electricity system, significantly ease the ecological problems connected with individual automotive transportation. If the public electricity system is to be used to reload the batteries the ecological benefits are reduced. The high costs of producing batteries and the generation of electricity in photovoltaic facilities presumably lower the benefits of promoting solar vehicles below that of promoting public transportation.

  9. The Promotion of Banking Services

    OpenAIRE

    IVAN Rica

    2012-01-01

    The purpose of the scientific approach is to demonstrate the usefulness of the adoption of modern promotion techniques in the actual financialbanking sector, in addition to the classical techniques. To achieve this end, the investigation of the Romanianfinancial-banking sector has been deeply conducted, by evaluating the market relations existing between the financial and banking institutions and individuals, as well as promotional techniques adopted by banks, during the communication process...

  10. Promotional Chat on the Internet

    OpenAIRE

    Dina Mayzlin

    2006-01-01

    Chat rooms, recommendation sites, and customer review sections allow consumers to overcome geographic boundaries and to communicate based on mutual interests. However, marketers also have incentives to supply promotional chat or reviews in order to influence the consumers' evaluation of their products. Moreover, firms can disguise their promotion as consumer recommendations due to the anonymity afforded by online communities. We explore this new setting where advertising and word of mouth bec...

  11. Genetic and epigenetic similarities and differences between childhood and adult AML

    DEFF Research Database (Denmark)

    Juhl-Christensen, Caroline; Ommen, Hans Beier; Aggerholm, Anni;

    2012-01-01

    The biology of acute myeloid leukemia (AML) is complex and includes both genetic and epigenetic aberrations. We addressed the combined consequences of promoter hypermethylation of p15, CDH1, ER, MDR1, and RARB2 and mutation of NPM1, CEBPA, FLT3, and WT1 in a Danish cohort of 70 pediatric and 383...

  12. Promotion of development and introduction

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    In order to promote effectively and smoothly development and introduction of oil substituting energies, comprehensive investigations for improving the energy demand and supply structures and investigations on development infrastructures will be conducted. Investigations will also be given on promoting improvements in overseas coal import base infrastructures, and demand/supply improvement, development and utilization of overseas energies. Investigations and guidance will be given on forming visions to improve demand/supply structures and to introduce and promote technologies thereof. In order to deepen further the understanding and recognition by the nation on oil substituting energies, such publicity activities will be carried out as provision of information, and promotion on popularization and education of energy demand/supply improving systems. For the purpose of promoting international exchanges, information exchange will be promoted on improving the energy demand/supply structures, so is on international information exchange. International cooperative operations on coal utilization, international cooperation on alcohol utilization technologies, and assistance to holding the world energy conferences will be carried out, and an Asia-Pacific Coal Demand and Supply Seminar will be held. In addition, training operations for coal engineers will be performed.

  13. Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization

    Institute of Scientific and Technical Information of China (English)

    Ti Liu; Tianhong Wang; Xian Li; Xuan Liu

    2008-01-01

    To improve heterologous gene expression in Trichoderma reesei, a set of optimal artificial cellobiohydrolase I gene (cbh1) promoters was obtained. The region from-677 to -724 with three potential glucose repressor binding sites was deleted. Then the region from-620 to-820 of the modified cbh1 promoter, including the CCAAT box and the Ace2 binding site, was repeatedly inserted into the modified cbh1 promoter, obtaining promoters with copy numbers 2, 4,and 6. The results showed that the glucose repression effects were abolished and the expression level of the glucuronidase (gus) reporter gene regulated by these multi-copy promoters was markedly enhanced as the copy number increased simultaneously. The data showed the great promise of using the promoter artificial modification strategy to increase heterologous gene expression in filamentous fungi and provided a set of optional high-expression vectors for gene function investigation and strain modification.

  14. Regional Development in China: Interregional Transportation Infrastructure and Regional Comparative Advantage

    OpenAIRE

    Lining He; Faye Duchin

    2007-01-01

    Significant economic disparities among China's Eastern, Central, and Western regions pose unequivocal challenges to social equality and political stability in the country. A major impediment to economic development, especially in the poor, remote Western region, is the shortage of transportation infrastructure. The Chinese government has committed to substantial investment for improving the accessibility of this vast, land-locked region as a mechanism for promoting its development. The paper ...

  15. Regional identities and competitiveness in a globalised environment: New challenges for Greek regions.

    OpenAIRE

    Nikoli, Anastasia; Zigouri, Fotini

    2011-01-01

    Over the last decades, at a European level, efforts have been made so that regions become capable of sustainable economic growth, with great social cohesion and better distribution of wealth, while at the same time under open market conditions, they are being exposed to external competitiveness. In order to survive and gain advantage from globalised economies, regions have to (re)form and promote a competitive profile that differentiates them from other regions and promises potentials of furt...

  16. The Integration of Regions in Romania: a Case Study of the Regional Development Fund

    OpenAIRE

    Ana Rodica Stãiculescu; Alexandru-Petru Lisievici-Brezeanu

    2012-01-01

    This paper aims to explore the way in witch the objective of making regions visible actors at the European level can be achieved in Romania through the absorption of Structural funds. Firstly, we will highlight the importance of coherent and effective policies for the development of regions. Secondly, we will examine the way in which the actors involved in the implementation of regional development project can promote a proactive and transparent dialogue. Previous studies have shown that a we...

  17. Challenges Towards Sustainable Tourism for Regional Development of Vlore Region

    Directory of Open Access Journals (Sweden)

    Aleks Prifti

    2013-04-01

    Full Text Available Vlora has great potential for regional development. Tourism can be as a catalyst for theeconomic growth but still have many challenges for sustainable tourism regionaldevelopment. Regional development is one ofthe most important dimensions and key ofEU policy, which is designedto: ensure convergence between the different member statesand regions; ensure regional competitiveness and employment;ensure territorialcooperation. Vlora has all the potential to bean attractive tourismdestination. Resourcesthat it can use to create its distinctive image for tourists are numerous. Across geography,which has spread Vlora region, there are monuments, archaeological item and rare naturalmonuments, natural sites and attractions centuries. Way to understand these apparentlyalready clarified is joining with the tourism environment. Return tourism potential in realestate assets for the rapid development andprosperity of the region, is one of theobjectives with which to measure the role of state institutions, businesses, investitures andpolicies that support, promote, stimulate and develop the sector oh tourism. Tourismdevelopment is facing many challenges related to development and the control urbanity,decentralization process, thegeographical distribution of tourism, exploitation of allresources and tourist potential, the protection of natural and cultural heritage.

  18. Challenges Towards Sustainable Tourism for Regional Development of Vlore Region

    Directory of Open Access Journals (Sweden)

    Aleks Prifti

    2013-04-01

    Full Text Available Vlora has great potential for regional development. Tourism can be as a catalyst for theeconomic growth but still have many challenges for sustainable tourism regionaldevelopment. Regional development is one ofthe most important dimensions and key ofEU policy, which is designedto: ensure convergence between the different member statesand regions; ensure regional competitiveness and employment;ensure territorialcooperation. Vlora has all the potential to bean attractive tourismdestination. Resourcesthat it can use to create its distinctive image for tourists are numerous. Across geography,which has spread Vlora region, there are monuments, archaeological item and rare naturalmonuments, natural sites and attractions centuries. Way to understand these apparentlyalready clarified is joining with the tourism environment. Return tourism potential in realestate assets for the rapid development andprosperity of the region, is one of theobjectives with which to measure the role of state institutions, businesses, investitures andpolicies that support, promote, stimulate and develop the sector oh tourism. Tourismdevelopment is facing many challenges related to development and the control urbanity,decentralization process, thegeographical distribution of tourism, exploitation of allresources and tourist potential, the protection of natural and cultural heritage

  19. Regulation of ALF promoter activity in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dan Li

    Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

  20. Transcriptional Auto-Regulation of RUNX1 P1 Promoter.

    Directory of Open Access Journals (Sweden)

    Milka Martinez

    Full Text Available RUNX1 a member of the family of runt related transcription factors (RUNX, is essential for hematopoiesis. The expression of RUNX1 gene is controlled by two promoters; the distal P1 promoter and the proximal P2 promoter. Several isoforms of RUNX1 mRNA are generated through the use of both promoters and alternative splicing. These isoforms not only differs in their temporal expression pattern but also exhibit differences in tissue specificity. The RUNX1 isoforms derived from P2 are expressed in a variety of tissues, but expression of P1-derived isoform is restricted to cells of hematopoietic lineage. However, the control of hematopoietic-cell specific expression is poorly understood. Here we report regulation of P1-derived RUNX1 mRNA by RUNX1 protein. In silico analysis of P1 promoter revealed presence of two evolutionary conserved RUNX motifs, 0.6kb upstream of the transcription start site, and three RUNX motifs within 170bp of the 5'UTR. Transcriptional contribution of these RUNX motifs was studied in myeloid and T-cells. RUNX1 genomic fragment containing all sites show very low basal activity in both cell types. Mutation or deletion of RUNX motifs in the UTR enhances basal activity of the RUNX1 promoter. Chromatin immunoprecipitation revealed that RUNX1 protein is recruited to these sites. Overexpression of RUNX1 in non-hematopoietic cells results in a dose dependent activation of the RUNX1 P1 promoter. We also demonstrate that RUNX1 protein regulates transcription of endogenous RUNX1 mRNA in T-cell. Finally we show that SCL transcription factor is recruited to regions containing RUNX motifs in the promoter and the UTR and regulates activity of the RUNX1 P1 promoter in vitro. Thus, multiple lines of evidence show that RUNX1 protein regulates its own gene transcription.