WorldWideScience

Sample records for capitata diptera tephritidae

  1. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  2. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  3. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-01-12

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco.

  4. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  5. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  6. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  7. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  8. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano

    2016-12-01

    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field.

  9. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  10. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  11. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed.

  12. Ammonium Acetate Enhances the Attractiveness of a Variety of Protein-Based Baits to Female Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Smith, Trevor R; Fox, Abbie J; Vargas, Roger I

    2015-04-01

    Ammonia and its derivatives are used by female fruit flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally based control strategies such as food-based lures and insecticidal baits targeting pestiferous fruit fly species. In field cage studies conducted in Hawaii, we examined the behavioral response of laboratory-reared male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann), to seven commercially available protein baits and to beer waste, a relatively inexpensive and readily available substance. Each material was tested alone or in combination with either ammonium acetate or ammonium carbonate. For the majority of baits evaluated, the presence of ammonium acetate, but not ammonium carbonate, elicited a significantly greater level of response of female C. capitata compared with the protein baits alone. The addition of ammonium acetate to selected baits increased bait attractiveness to a level comparable with that elicited by the most widely used spinosad-based protein bait, GF-120. Our findings indicate that the addition of ammonium acetate to commercially available proteinaceous baits and to beer waste can greatly improve their attractiveness to C. capitata, potentially increasing the bait's effectiveness for fruit fly monitoring and suppression.

  13. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  14. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  15. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  16. Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile male sexual performance.

    Science.gov (United States)

    Ben Ami, Eyal; Yuval, Boaz; Jurkevitch, Edouard

    2010-01-01

    The sterile insect technique (SIT) is a method of biological control whereby millions of factory reared sterile male insects are released into the field. This technique is commonly used to combat the Mediterranean fruit fly (Ceratitis capitata, Diptera: Tephritidae). Sterile medfly males are less competent in attracting and mating with wild females, a property commonly linked to the irradiation process responsible for the sterilization. As bacteria are important partners in the fly's life cycle, we used molecular analytical methods to study the community structure of the gut microbiota in irradiated male medflies. We find that the sterilizing irradiation procedure affects the gut bacterial community structure of the Mediterranean fruit fly. Although the Enterobacteriaceae family remains the dominant bacterial group present in the gut, the levels of Klebsiella species decreases significantly in the days after sterilization. In addition, we detected substantial differences in some bacterial species between the mass rearing strain Vienna 8 and the wild strain. Most notable among these are the increased levels of the potentially pathogenic species Pseudomonas in the industrial strain. Testing the hypothesis that regenerating the original microbiota community could result in enhanced competitiveness of the sterile flies, we found that the addition of the bacterial species Klebsiella oxytoca to the postirradiation diet enables colonization of these bacteria in the gut while resulting in decreased levels of the Pseudomonas sp. Feeding on diets containing bacteria significantly improved sterile male performance in copulatory tests. Further studies will determine the feasibility of bacterial amelioration in SIT operations.

  17. Response of female Ceratitis capitata (Diptera: Tephritidae) to a spinosad bait and polymer matrix mixture with extended residual effect in Hawaii.

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Gomez, Luis E; Mau, Ronald F L; Vargas, Roger I

    2011-12-01

    The effectiveness of foliar applications of protein baits against pestiferous fruit flies (Tephritidae) can be adversely affected by a rapid loss of attractive volatile compounds and by rainfall due to the high water solubility of the baits. In a large coffee, Coffea arabica L., plantation in Hawaii with high and low populations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the relative attractiveness of GF-120 NF Naturalyte Fruit Fly Bait as either a 40% (vol:vol) spray solution (= GF-120 NF) or as a formulated proprietary amorphous polymer matrix (= GF-120 APM) was compared. The GF-120 APM formulations contained either, 25, 50, or 75% of GF-120 NF (wt:wt). All baits were tested in association with visually attractive yellow bait stations as a way of standardizing the evaluations. With both high and low C. capitata populations, significantly more females were attracted to the fresh sprayed GF-120 NF than to any of the three fresh GF-120 APM formulations. The attractiveness of GF-120 sprayed decreased significantly after 1 wk, whereas 1-wk-old GF-120 APM formulations were as attractive as similar fresh formulations. GF-120 APM 75% aged for 3 wk outperformed similarly-aged sprayed GF-120 NF with comparatively high C. capitata populations. With low populations, both GF-120 APM 75% and GF-120 APM 50% aged for 2 wk outperformed the similarly aged sprayed GF-120 NF. Combined findings indicate that APM mixed with either 50 or 75% GF-120 applied to bait stations can be attractive to female C. capitata for up to 3 wk longer than the standard sprayed GF-120 NF.

  18. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  19. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  20. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  1. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  2. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    Science.gov (United States)

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (Ptebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  3. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays.

  4. Photosensitizing effect of hematoporphyrin IX on immature stages of Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Massaldi, Ana; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2010-01-01

    Immature stages of Ceratitis capitata were tested as a model for hematoporphyrin IX (HP IX) phototoxicity. The lethal concentration 50 (LC(50)) of HP IX in the food was determined during postembryonic development until adult emergence as 0.173 mm (95% CI: 0.138-0.209). The corresponding HP IX LC(50) during the dispersal period alone was 0.536 mm (95% CI: 0.450-0.633). HP IX toxicity was compared against Phloxine B (PhB) (0.5 mm). HP IX elicited a mortality of 90.87%, which was mainly concentrated during prepupal and early pupal stages. PhB mortality was much lower (56.88%) and occurred mainly during the adult pharate stage. A direct correlation between light-dependent HP IX mortality, evidence of reactive oxygen species (ROS) and lipid peroxidation (conjugated dienes and thiobarbituric acid reactive substances) was established in C. capitata larvae. ROS were found to be very significant in both the brain and in the gut.

  5. Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality.

    Science.gov (United States)

    Ogaugwu, Christian E; Schetelig, Marc F; Wimmer, Ernst A

    2013-01-01

    Fruit fly pest species have been successfully controlled and managed via the Sterile Insect Technique (SIT), a control strategy that uses infertile matings of sterile males to wild females to reduce pest populations. Biological efficiency in the field is higher if only sterile males are released in SIT programs and production costs are also reduced. Sexing strains developed in the Mediterranean fruit fly Ceratitis capitata (medfly) through classical genetics are immensely beneficial to medfly SIT programs but exhibit reduced fertility and fitness. Moreover, transfer of such classical genetic systems to other tephritid species is difficult. Transgenic approaches can overcome this limitation of classical genetic sexing strains (GSSs), but had resulted so far in transgenic sexing strains (TSSs) with dominant lethality at late larval and pupal stages. Here we present a transgene-based female-specific lethality system for early embryonic sexing in medfly. The system utilizes the sex-specifically spliced transformer intron to restrict ectopic mRNA translation of the pro-apoptotic gene hid(Ala5) to females only. The expression of this lethal effector gene is driven by a tetracycline-repressible transactivator gene tTA that is under the control of promoters/enhancers of early-acting cellularization genes. Despite observed position effects on the sex-specific splicing, we could effectively establish this early-acting transgenic sexing system in the medfly C. capitata. After satisfactory performance in large scale tests, TSSs based on this system will offer cost-effective sexing once introduced into SIT programs. Moreover, this approach is straight forward to be developed also for other insect pest and vector species.

  6. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  7. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  8. Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Ogaugwu, Christian E; Wimmer, Ernst A

    2013-01-01

    The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest.

  9. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  10. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  11. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  12. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    Science.gov (United States)

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program.

  13. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  14. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  15. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  16. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  17. Pupal development of Ceratitis capitata (Diptera: Tephritidae) and Diachasmimorpha longicaudata (Hymenoptera: Braconidae) at different moisture values in four soil types.

    Science.gov (United States)

    Bento, F de M M; Marques, R N; Costa, M L Z; Walder, J M M; Silva, A P; Parra, J R P

    2010-08-01

    This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential. Pupal stage duration in C. capitata was influenced differently for males and females. In females, only soil type affected pupal stage duration, which was longer in a clay soil. In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil. As matric potential decreased, duration of the pupal stage of C. capitata males increased, regardless of soil type. C. capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils. The emergence of D. longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D. longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil. Always, the number of emerged adults was higher at higher moisture conditions. C. capitata and D. longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

  18. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  19. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  20. Development of a transgenic sexing system based on female-specific embryonic lethality in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is more efficient and cost-effective when only sterile males are released. A female-specific lethality system based on a female-specifically spliced intron was developed for transgenic sexing in Ceratitis capitata (Fu et al., 2007) possibly to overcome the fitness ...

  1. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  2. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  3. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  4. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  5. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae).

    Science.gov (United States)

    Steck, Gary J; Ekesi, Sunday

    2015-01-01

    Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis.

  6. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae)

    Science.gov (United States)

    Steck, Gary J.; Ekesi, Sunday

    2015-01-01

    Abstract Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis. PMID:26798272

  7. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  8. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae Massive and simultaneous production of Ceratitis capitata (Diptera: Tephritidae males and Diachasmimorpha longicaudata (Hymenoptera: Braconidae parasitoids

    Directory of Open Access Journals (Sweden)

    Silvia N. López

    2006-12-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F 1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.In the genetic sexing strain «Cast191», the females of Ceratitis capitata are homozygous for the mutation slow , slowing down their rate of development, and the males are heterozygous, having a normal rate of development. This feature made Cast191 capable of producing sterile males, on one hand, and parasitoids that are reared on the remaining larvae, on the other. The

  9. Quarantine treatment to Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) in orange fruits (Citrus sinensis).; Tratamento quarentenario para Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) em frutos de laranja (Citrus sinensis)

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno Miguel Mendes Soares de

    2005-07-01

    This work was carried out to evaluate the effect of thermal treatments (vapour heat and hot water) and irradiation on Ceratitis capitata eggs and larvae (first, second and third instars), in 'Valencia' oranges; the relation between temperature and exposition time to vapour heat and hot water on fruit fly immature; the relation among the different doses of radiation on fruit fly immature and evaluate the effect of the treatments (thermal treatments and irradiation) on the chemical composition of the fruits. It was evaluated the heat absorption and loose of heat by the fruit. For thermal treatments it was used temperatures of 44 and 46 deg C for 15,30,60, 90 and 120 minutes and a control. For irradiation were used the doses: 10,20, 30, 40, 50, 100, 150 and 200 Gy. By the results obtained it is possible to conclude that: to the control of eggs and larvae (first, second and third instars) the treatment with vapour heat was less efficient than the hot water treatment; the thermal treatments of C. capitata eggs and larvae (first and second and third instars) can be recommended with vapor heat at 46 deg C at 152.2 minutes or with hot water at 46 deg C at 84.8 minutes, achieving the quarantine request; third instar larvae are more tolerant to the thermal and irradiation treatments; the treatment with irradiation can be recommended for quarantine treatment of ali immature stages evaluated with the dose of 72.88 Gy; the dose of 50 Gy causes sterility to the adults emerged from ali immature stages irradiated; treatments do not cause any change in the chemical proprieties in the orange fruits var. 'Valencia'. (author)

  10. Treatment post harvest of Citrus sinensis infested with Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) using gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno M.M. Soares de; Bortoli, Sergio A. de, E-mail: nmendes@terra.com.b, E-mail: bortoli@fcav.unesp.b [UNESP, Jaboticabal, SP (Brazil). Faculdade de Ciencias Agrarias e Veterinarias. Depto. de Fitossanidade; Doria, Hayda O.S., E-mail: hosd75@terra.com.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Medicina. Dept. de Biologia; Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente

    2009-07-01

    This work was carried out to evaluate the effect of irradiation on fruit fly (Ceratitis capitata) eggs and larvae (first, second, third instars), in 'Valencia' oranges; and evaluate the effect of the irradiation on the chemical composition of the fruits. Fruits were artificially infested with the immature stages of the fruit fly and treated with 0, 10, 20, 30, 40, 50, 100, 150 and 200 Gy Cobalt-60 doses. By the results obtained it is possible to conclude that: third instar larvae are more tolerant to irradiation treatments; the dose of 50 Gy causes sterility to the adults emerged from all immature stages irradiated. (author)

  11. Intensity of Attack Caused by Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera, Tephritidae on Mandarin along the Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2011-01-01

    Full Text Available Along the Montenegrin seacoast, all cultivated citrus species (mandarin, orange, lemon,grapefruit, fig, loquat and ziziphus were detected as host plants of the Ceratitis capitata Wiedem.Among those found, in economic sense, the most important host plant is mandarinUnšiu.Intensity of the attack were monitored on mandarin in 2003 and 2004 in localities Baošići,Lastva Grbaljska and Bar, and was determined as higher in 2003. The first symptoms ofattack were detected, depending on locality, from middle of September until beginning ofOctober, one to two months earlier then in 2004. The maximum number of larvae per fruitwere detected in October and November (average from 13.44±0.16 to 22.82±0.13. Timeof the first symptoms appearence on mandarin in September and October 2003 and in November2004, indicate on crucial importance of alternative host plants (figs and loquat forreproduction and increasing of C. capitata population, because later during a season its intensityof attack on mandarin, depend largely on their presence.

  12. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model.

  13. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  14. Evaluación de colores para la oviposición de Ceratitis capitata (Diptera, Tephritidae en Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Suárez

    2013-04-01

    Full Text Available Ceratitis capitata es una de las principales plagas de la fruticultura mundial y en Argentina es la Mosca de los Frutos de mayor abundancia y distribución. El desarrollo de una trampa artificial de oviposición, puede ser una herramienta útil de monitoreo para hembras grávidas. El objetivo de este trabajo fue evaluar la capacidad atrayente para la oviposición de C. capitata sobre esferas de agar de color amarillo, rojo, verde, negro y sin color; en condiciones de laboratorio. Se observaron diferencias estadísticamente significativas, siendo las esferas rojas y negras las más atractivas sobre las verdes, amarillas y sin color. En laboratorio, la mayor atracción alcanzada por el rojo y negro sustentaría la hipótesis de que el fuerte contraste respecto al fondo incrementaría la atracción de los colores más oscuros.

  15. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  16. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing

  17. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  18. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  19. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  20. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  1. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  2. Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa (Diptera: Tephritidae), into southern China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Wu, Jiajiao; Chen, Hongjun; Zhang, Runjie

    2010-08-01

    Exotic fruit flies (Ceratitis spp.) are often serious agricultural pests. Here, we used, pathway analysis and Monte Carlo simulations to assess the risk of introduction of Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch, into southern China with fruit consignments and incoming travelers. Historical data, expert opinions, relevant literature, and archives were used to set appropriate parameters in the pathway analysis. Based on the ongoing quarantine/ inspection strategies of China, as well as the interception records, we estimated the annual number of each fruit fly species entering Guangdong province undetected with commercially imported fruit, and the associated risk. We also estimated the gross number of pests arriving at Guangdong ports with incoming travelers and the associated risk. Sensitivity analysis also was performed to test the impact of parameter changes and to assess how the risk could be reduced. Results showed that the risk of introduction of the three fruit fly species into southern China with fruit consignments, which are mostly transported by ship, exists but is relatively low. In contrast, the risk of introduction with incoming travelers is high and hence deserves intensive attention. Sensitivity analysis indicated that either ensuring all shipments meet current phytosanitary requirements or increasing the proportion of fruit imports sampled for inspection could substantially reduce the risk associated with commercial imports. Sensitivity analysis also provided justification for banning importation of fresh fruit by international travelers. Thus, inspection and quarantine in conjunction with intensive detection were important mitigation measures to reduce the risk of Ceratitis spp. introduced into China.

  3. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  4. Attraction of Ceratitis capitata (Diptera: Tephritidae) and Nontarget Insects to the Attractant BioLure and its Individual Components in Hawaii.

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  5. Insecticidal activity of a Moroccan strain of Streptomyces phaeochromogenes LD-37 on larvae, pupae and adults of the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Samri, S E; Baz, M; Ghalbane, I; El Messoussi, S; Zitouni, A; El Meziane, A; Barakate, M

    2017-04-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata, is considered the most important fruit pest worldwide. Its management is mainly based on the use of chemical insecticides. Although these conventional pesticides are effective at high doses, they cause considerable human health and environment problems. Thus, the aim of this study was to assess insecticidal activity of Moroccan actinobacteria against C. capitata. A total of 12 preselected actinobacteria isolated from various Moroccan habitats were screened for their insecticidal activity against larvae, pupae and adults of C. capitata. Four actinobacteria isolates were significantly active against the first-instar larvae, and nine were active against the medfly adult, while no significant mortality was obtained against the third-instar larval and pupal stages. Among the selected isolates, the biological screening revealed that strain Streptomyces LD-37, which showed 99.4% similarity with Streptomyces phaeochromogenes, exhibited the maximal corrected larval mortality of 98%. Moreover, the isolates AS1 and LD-37 showed the maximum significant corrected mortality against adults of 32.5 and 28.2%, respectively. The crude extract obtained from a fermented culture of strain S. phaeochromogenes LD-37 was separated into six fractions by thin layer chromatography. Fractions F3 and F4 caused a significant corrected larval mortality of 66.7 and 53.3%, respectively; whereas the maximum reduction in adult emergence was obtained with fraction F4. This finding could be useful for utilizing S. phaeochromogenes LD-37 as an alternative to chemical insecticides in pest management of C. capitata.

  6. Infectivity of Four Entomopathogenic Nematodes in Relation to Environmental Factors and Their Effects on the Biochemistry of the Medfly Ceratitis capitata (Wied.) (Diptera: Tephritidae).

    Science.gov (United States)

    Shaurub, E H; Soliman, N A; Hashem, A G; Abdel-Rahman, A M

    2015-12-01

    Late third instars of the medfly, Ceratitis capitata (Wied.), migrate from the host fruit into the soil and leaf litter beneath host trees, where they may become a target for entomopathogenic nematodes (EPNs). The effects of ultraviolet (UV) light, temperature, soil type (texture), and soil moisture level on infectivity of the four tested EPNs Heterorhabditis bacteriophora AS1, H. bacteriophora HP88, Steinernema carpocapsae ALL, and Steinernema riobrave ML29 to late third instars of C. capitata were evaluated. Biochemical alterations induced by the most virulent nematodes were quantified. The nematode infectivity decreased with increase in exposure time to UV light, whereas it increased with increase in temperature. Infectivity increased in sandy soil, whereas it decreased in silt and clay soils. Soils with high moisture levels decreased infectivity. Based on the 50% lethal concentration (LC50), H. bacteriophora AS1 and S. carpocapsae ALL were the most virulent heterorhabditid and steinernematid nematodes, respectively, with the highest virulence for H. bacteriophora AS1. The nematodes caused significant decline in total protein and cholesterol content of larvae and caused reduced activity of transaminases and phosphatases. In contrast, they significantly enhanced total glucose content. It can be concluded that the most optimum environmental conditions of the tested nematodes to elicit their infectivity against late third instars of C. capitata were sandy soil with 10% moisture level, ambient temperature of 25°C, and no exposure to UV. The EPNs tested can affect late third instars of C. capitata by targeting different biochemical molecules in different metabolic pathways. The interaction between them and the host larvae appears to be primarily nutritional.

  7. Captures of Wild Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Traps with Improved Multilure TMR Dispensers Weathered in California.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Morse, Joseph G; Grafton-Cardwell, Elizabeth E; Haviland, David R; Kabashima, John N; Faber, Ben A; Mackey, Bruce; Cook, Peter

    2016-04-01

    During 2012–2013, solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide were weathered during summer (8 wk) and winter (12 wk) in five California citrus-growing counties (Kern, Ventura, Orange, Tulare, and Riverside). In addition, TMR wafers without DDVP and with a Hercon Vaportape II insecticidal strip were compared with TMR dispensers with DDVP at Exeter and Riverside. Weathered treatments were shipped every week (overnight delivery) to Hawaii and frozen for a later bioassay in a 1,335-ha coffee plantation near Numila, Kauai Island, HI, where Mediterranean fruit fly, Ceratitis capitata (Wiedemann), oriental fruit fly, Bactrocera dorsalis Hendel, and melon fly, Bactrocera cucurbitae Coquillett, were all present. We compared trap captures of the three species, C. capitata, B. dorsalis, and B. cucurbitae, for the five different weathering locations. Captures of C. capitata, B. dorsalis, and B. cucurbitae with Mallet TMR dispensers (with DDVP) were not significantly different for the five locations. Captures with the Mallet TMR dispenser without DDVP and Vaportape were similar to those for Mallet TMR with DDVP, although there were some slight location differences. In conclusion, based on these results, the Mallet TMR dispenser could potentially be used in California habitats where large numbers of detection traps are currently deployed. Use of Vaportape with dispensers would not require them to be registered with US Environmental Protection Agency (EPA). Dispensers for use as Male Annihilation Technique (MAT) devices will be tested further in Hawaii.

  8. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  9. Effects of pesticides used on citrus grown in Spain on the mortality of Ceratitis capitata (Diptera: Tephritidae) Vienna-8 strain sterile males.

    Science.gov (United States)

    Juan-Blasco, María; Sabatier-Muñoz, Beatriz; Argilés, Rafael; Jacas, Josep A; Ortego, Félix; Urbaneja, Alberto

    2013-06-01

    Vienna-8 sterile males are currently released in Spain to reduce wild populations of the medfly. Because pesticides are required to maintain populations of some citrus key pests below economic thresholds, there is a need to evaluate the effects of pesticides commonly used in citrus on Vienna-8 males. Males were exposed to differently aged residues of eight pesticides. Abamectin, etofenprox, etoxazole, petroleum spray oil, pymetrozine, and pyriproxyfen resulted harmless to Vienna-8 males. However, fresh residues of chlorpyrifos and spinosad caused high mortalities and had residual effects until 21 and 28 d after treatment, respectively. Following the same method, the lethal effects of chlorpyrifos and spinosad on Ceratitis capitata (Wiedemann) wild-type (wt) males were determined. Surprisingly, these pesticides resulted more toxic for wt than for Vienna-8 males. To determine whether these results could be attributed to intrinsic characteristics of the pesticides or to behavioral differences among Vienna-8 and wt males, a topical application trial was conducted. Vienna-8 males were twice as susceptible to chlorpyrifos as wt males, whereas their susceptibility to spinosad was slightly lower. These results in intrinsic toxicity did not directly explain the differences observed in the extended-laboratory tests with these pesticides. We hypothesize that the lower flight activity ofVienna-8 males relative to wt conspecifics can explain the lower risk observed for Vienna-8 males in the residual tests. Our results should be taken into account when planning area-wide Sterile Insect Technique programs against C. capitata especially in those areas where treatments with chlorpyrifos are approved.

  10. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae

    Directory of Open Access Journals (Sweden)

    Silvia N. LÓPEZ

    2006-01-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.

  11. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  12. Fitness improvement of mass-reared sterile males of Ceratitis capitata (Vienna 8 strain) (Diptera: Tephritidae) after gut enrichment with probiotics.

    Science.gov (United States)

    Hamden, Heithem; Guerfali, Meriem M'Saad; Fadhl, Selma; Saidi, Mouldi; Chevrier, Claude

    2013-04-01

    Successful mass rearing is crucial for sterile insect technique programs. It has been shown that the sterilizing process using gammaradiation results in damage to midgut tissue, cellular organelles, and gut microbiota of flies. This can be responsible for the inferiority of sterile males compared with wild males. A bacteria-enhanced diet could contribute to the improvement of the fly's fitness. We investigated ways of increasing the competitiveness of mass-reared Mediterranean fruit fly, Ceratitis capitata (Wiedemann) sterile males. We tested the hypothesis that the addition of beneficial bacteria to the larvae's diet would lead to a significant increase in their levels in the gut of the sterile adults and consequently improve their size and fitness. As expected, enriching the diet of mass-rearing Vienna-8 strain larvae with beneficial bacteria (Klebsiella pneumonia, Enterobacter spp., and Citrobacter freundii) resulted in increase in the number of Enterobacteriacae communities inhabiting the male's gut and a subsequent significant increase in the size of males and other morphometric traits and enhanced sexual performance of males at emergence.

  13. The role of protein in the sexual behaviour of males of Ceratitis capitata (Diptera: Tephritidae: mating success, copula duration and number of copulations

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    2009-09-01

    Full Text Available In this paper, we investigated the influence of protein ingestion during the early adult phase on the sexual behavior of males of Ceratitis capitata (Wiedemann, 1824. The following parameters were evaluated: mating success (ability to be chosen by females, number of copulations, and copula duration. Experiments were carried out using a fifteen-year old laboratory lineage with the occasional introduction of wild flies. Two groups of adult males fed a high-protein diet during their larval phase were given either a high-protein diet (based on Brewer's yeast, concentration = 6.5 g/100 ml or a no-protein diet. Both groups of males were exposed to females fed either a high-protein diet or a no-protein diet and were subsequently evaluated for the parameters listed above. All experiments were conducted at 25ºC, 70% R.H. and with a photoperiod of L12:D12. The number of copulations was the only parameter affected by adult diet. Males fed a high-protein diet and exposed to females fed a no-protein diet had a greater number of copulations compared with males fed a no-protein diet.

  14. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  15. Improving the sterile sperm identification method for its implementation in the Area-wide Sterile Insect Technique Program against Ceratitis capitata (Diptera: Tephritidae) in Spain.

    Science.gov (United States)

    Juan-Blasco, M; Urbaneja, A; San Andrés, V; Castañera, P; Sabater-Muñoz, B

    2013-12-01

    The success of sterile males in area-wide sterile insect technique (aw-SIT) programs against Ceratitis capitata (Wiedemann) is currently measured by using indirect methods as the wild:sterile male ratio captured in monitoring traps. In the past decade, molecular techniques have been used to improve these methods. The development of a polymerase chain reaction-restriction fragment-length polymorphism-based method to identify the transfer of sterile sperm to wild females, the target of SIT, was considered a significant step in this direction. This method relies on identification of sperm by detecting the presence of Y chromosomes in spermathecae DNA extract complemented by the identification of the genetic origin of this sperm: Vienna-8 males or wild haplotype. However, the application of this protocol to aw-SIT programs is limited by handling time and personnel cost. The objective of this work was to obtain a high-throughput protocol to facilitate the routine measurement in a pest population of sterile sperm presence in wild females. The polymerase chain reaction-restriction fragment-length polymorphism markers previously developed were validated in Mediterranean fruit fly samples collected from various locations worldwide. A laboratory protocol previously published was modified to allow for the analysis of more samples at the same time. Preservation methods and preservation times commonly used for Mediterranean fruit fly female samples were assessed for their influence on the correct molecular detection of sterile sperm. This high-throughput methodology, as well as the results of sample management presented here, provide a robust, efficient, fast, and economical sterile sperm identification method ready to be used in all Mediterranean fruit fly SIT programs.

  16. Analysis of Seasonal Risk for Importation of the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae), via Air Passenger Traffic Arriving in Florida and California.

    Science.gov (United States)

    Szyniszewska, A M; Leppla, N C; Huang, Z; Tatem, A J

    2016-09-04

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is one of the most economically damaging pests in the world and has repeatedly invaded two major agricultural states in the United States, Florida and California, each time requiring costly eradication. The Mediterranean fruit fly gains entry primarily in infested fruit carried by airline passengers and, since Florida and California each receive about 13 million international passengers annually, the risk of Mediterranean fruit fly entering the United States is potentially very high. The risk of passengers bringing the pest into Florida or California from Mediterranean fruit fly-infested countries was determined with two novel models, one estimated seasonal variation in airline passenger number and the other defined the seasonal and spatial variability in Mediterranean fruit fly abundance. These models elucidated relationships among the risk factors for Mediterranean fruit fly introduction, such as amount of passenger traffic, routes traveled, season of travel, abundance of Mediterranean fruit fly in countries where flights departed, and risk of the pest arriving at destination airports. The risk of Mediterranean fruit fly being introduced into Florida was greatest from Colombia, Brazil, Panama, Venezuela, Argentina, and Ecuador during January-August, whereas primarily the risk to California was from Brazil, Panama, Colombia, and Italy in May-August. About three times more Mediterranean fruit flies were intercepted in passenger baggage at airports in Florida than California, although the data were compromised by a lack of systematic sampling and other limitations. Nevertheless, this study achieved the goal of analyzing available data on seasonal passenger flow and Mediterranean fruit fly population levels to determine when surveillance should be intensified at key airports in Florida and California.

  17. Trapping Female Medflies (Ceratitis capitata) by Broadcast of Male Calling Song

    Science.gov (United States)

    2003-07-01

    UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP022884 TITLE: Trapping Female Medflies [ Ceratitis capitata ] by Broadcast...component part numbers comprise the compilation report: ADP022883 thru ADP023022 UNCLASSIFIED Trapping Female Medflies ( Ceratitis capitata ) by...systems for Ceratitis capitata (Diptera: Tephritidae) in seven countries," J. Econ. Entomol. 92, 156-164. 2. Hendrichs, J., Franz, G., and Rendon, P

  18. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C

  19. Tratamento hidrotérmico na mortalidade de larvas de Ceratitis capitata (Weidmann, 1824 (Diptera: Tephritidae em tangerina (Citrus reticulata Blanco = Effect of hydrothermal treatment on the mortality of fruit fly (Ceratitis capitata Weidmann, 1824 (Diptera: Tephritidae larvae in tangerine fruit (Citrus reticulata Blanco

    Directory of Open Access Journals (Sweden)

    Edson Batista Lopes

    2008-12-01

    Full Text Available O objetivo dessa pesquisa foi avaliar a eficiência do tratamento hidrotérmico no controle de larvas de C. capitata em frutos de tangerina para fins quarentenários. Tangerinas da variedade ‘Dancy’ infestadas por larvas de Ceratitis capitata foram submetidas aostratamentos hidrotérmicos de 46±1°C e 50±1°C, em diferentes tempos de exposição. Para a temperatura de 46±1°C foram utilizados nove períodos de exposição: 0, 5, 10, 15, 20, 25, 30, 35 e 40 min. Na temperatura de 50±1°C, utilizaram-se sete tempos de exposição: 0, 5,10, 15, 20, 25 e 30 min., sendo o tempo (0 infestado e sem tratamento para as duas temperaturas. Cada tratamento foi composto de cinco repetições com dois frutos. Frutos maduros e semi-maduros infestados foram imersos em água quente, visando quantificar ototal de larvas vivas e mortas, sendo que, um grupo de frutos foi mantido sem imersão como controle. Os índices quarentenários, na temperatura de 46±1°C foram atingidos aos 32,0 e 35,3 min. para frutos maduros e semi-maduros, respectivamente. Na temperatura de50±1°C, os índices quarentenários foram atingidos aos 20,8 e 21,7 minutos para os frutos maduros e semi-maduros, respectivamente. A mortalidade das larvas de C. capitata foi crescente com o aumento da temperatura e o tempo de exposição.This research aimed to evaluate the efficiency of hydrothermaltreatment in the control of C. capitata larvae in tangerine fruit for quarantine safety. Tangerines fruits infested by larvae of Mediterranean fruit fly Ceratitis capitata were submitted to hydrothermal treatment at 46±1°C and 50±1°C for different exposure times. The fruits were selected in two maturity stages (ripe and semi-ripe and immersed in hot water. For temperature at 46±1°C, nine exposure times were used: 0, 5, 10, 15, 20, 25, 30, 35 and 40 minutes. The same procedure was used for temperature at 50±1°C, where the exposure times were: 0, 5, 10, 15, 20, 25 and 30 minutes. Infested

  20. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  1. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  2. Development of Rhagoletis indifferens Curran (Diptera:Tephritidae) in crabapple

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens, Curran, 1932 (Diptera: Tephritidae), was reared from naturally-infested Chinese crabapple, Malus spectabilis (Ait.) Borkh. (Rosaceae), in Washington state, U.S.A. Pupae from Chinese crabapple were smaller than those from sweet cherry, Prunus avium (...

  3. Hidrogenionic potential (pH of the attractant, trap density and control threshold for Ceratitis capitata (DIPTERA: TEPHRITIDAE on Hamlin oranges in São Paulo central region, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eduardo Branco Paiva

    2013-06-01

    Full Text Available This study evaluated the effect of initial pH values of 4.5, 6.5 and 8.5 of the attractant (protein bait Milhocina® and borax (sodium borate in the field, on the capture of fruit flies in McPhail traps, using 1, 2, 4 and 8 traps per hectare, in order to estimate control thresholds in a Hamlin orange grove in the central region of the state of São Paulo. The most abundant fruit fly species was Ceratitis capitata, comprising almost 99% of the fruit flies captured, of which 80% were females. The largest captures of C. capitata were found in traps baited with Milhocina® and borax at pH 8.5. Captures per trap for the four densities were similar, indicating that the population can be estimated with one trap per hectare in areas with high populations. It was found positive relationships between captures of C. capitata and the number of Hamlin oranges damaged, 2 and 3 weeks after capture. It was obtained equations that correlate captures and damage levels which can be used to estimate control thresholds. The average loss caused in Hamlin orange fruits by C. capitata was 2.5 tons per hectare or 7.5% of production.

  4. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  5. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Mackey, Bruce; Cook, Peter; Morse, Joseph G; Stark, John D

    2012-10-01

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP (2,2-dichlorovinyl dimethyl phosphate) insecticide were measured in traps as potential detection and male annihilation technique (MAT) devices. Comparisons were made with 1) liquid lure and insecticide formulations, 2) solid cones and plugs with an insecticidal strip, and 3) solid single and double lure wafers with DDVP for captures of Mediterranean fruit fly, Ceratitis capitata (Wiedemann); oriental fruit fly, Bactrocera dorsalis Hendel; and melon fly, B. cucurbitae Coquillett. Bucket and Jackson traps were tested in a coffee plantation near Eleele, Kauai Island, HI (trials at high populations) and avocado orchards near Kona, HI Island, HI (trials at low populations). Captures of all three species with Mallet TMR were not different from Mallet CMR; therefore, subsequent experiments did not include Mallet CMR because of higher production costs. In MAT trials near Eleele, HI captures in AWPM traps with Mallet TMR wafers were equal to any other solid lure (single or double) except the Mallet ME wafer. In survey trials near Kona, captures of C. capitata, B. cucurbitae, and B. dorsalis with Mallet TMR wafers were equal to those for the standard TML, ME, and C-L traps used in FL and CA. A solid Mallet TMR wafer is safer, more convenient to handle, and may be used in place of several individual lure and trap systems, potentially reducing costs of large survey and detection programs in Florida and California, and MAT programs in Hawaii.

  6. Determination of the dose of gamma radiation sterilization for assessment of biological parameters of male Ceratitis capitada (Diptera: Tephritidae), tsl - Vienna 8 strain; Determinacao da dose de radiacao gama esterilizante pela avaliacao dos parametros biologicos de machos de Ceratitis capitata (Diptera: Tephritidae), linhagem tsl - Vienna 8

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, Aline Cristina Pereira da

    2011-07-01

    The Vienna-8, tsl (temperature sensitive lethal) strain of Ceratitis capitata, by presenting mutations that facilitate the mass rearing and release only of sterile males in the field, has been used in (Sterile Insect Technique) programmes. The objective of this study was to determine the radiation dose that provides the highest level of sterility for Vienna-8, tsl males assessing their biological parameters that indicate the quality of sterile males to be released. Brown pupae (males) of the tsl strain were obtained from the mass rearing of the Food Irradiation and Radio entomology laboratory of CENA/USP, and they were irradiated (with gamma radiation - {sup 60}Co) 24 hours before the emergence at rates of 0, 30, 60, 90 and 120 Gy. The determination of the sterilizing dose was based on fertility of sexually mature females of the bisexual strain and not irradiated, mated with males of different treatments. Eggs were collected daily during 6 days, were counted and it was possible to estimate fecundity, and assess the hatching rate. The emergence and flight ability were determined by following the protocol of quality control manual for FAO/IAEA/USDA (2003). To assess the longevity under nutritional stress, the insects were kept a period of 48 h after emergence in the absence of water and food, and after this period, mortality was recorded. The size of the testes (left and right) was obtained by dissecting irradiated and non-irradiated males at the eighth day of life, and measure the testes in an ocular micrometer, considering the maximum length and width of each sample. To determine the sperm number was necessary to dissect the males and break their testicles. No difference was observed in emergence rate, flight ability and longevity of irradiated and non-irradiated males, nor in the fecundity of females mated with males of different treatments. The sterilizing dose that resulted in lower fertility of females was 120 Gy, with 1.5% hatching. Considering the parameters

  7. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition.

    Science.gov (United States)

    Follett, Peter A

    2009-06-01

    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  8. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae).

    Science.gov (United States)

    Elleuch, Jihen; Tounsi, Slim; Ben Hassen, Najeh Belguith; Lacoix, Marie Noël; Chandre, Fabrice; Jaoua, Samir; Zghal, Raida Zribi

    2015-01-01

    Bacillus thuringiensis is successfully used in pest management strategies as an eco-friendly bioinsecticide. Isolation and identification of new strains with a wide variety of target pests is an ever growing field. In this paper, new B. thuringiensis isolates were investigated to search for original strains active against diptera and able to produce novel toxins that could be used as an alternative for the commercial H14 strain. Biochemical and molecular characterization revealed a remarkable diversity among the studied strains. Using the PCR method, cry4C/Da1, cry30Ea, cry39A, cry40 and cry54 genes were detected in four isolates. Three strains, BLB355, BLB196 and BUPM109, showed feeble activities against Aedes aegypti larvae. Interestingly, spore-crystal mixtures of BLB361, BLB30 and BLB237 were found to be active against Ceratitis capitata with an LC50 value of about 65.375, 51.735 and 42.972 μg cm(-2), respectively. All the studied strains exhibited important mortality levels using culture supernatants against C. capitata larvae. This suggests that these strains produce a wide range of soluble factors active against C. capitata larvae.

  9. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  10. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  11. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae(Cocquillett)(Diptera:Tephritidae)

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  12. Controle da infestação natural de ceratitis capitata (Wied., 1824 (Diptera, Tephritidae em pêssegos(Prunus persica através das radiações gama Control of naturally infested peaches (Prunus persica by mediterranean fruit fly (Ceratitis capitata through the use of gamma radiation

    Directory of Open Access Journals (Sweden)

    V. Arthur

    1993-12-01

    Full Text Available Determinou-se a dose desinfestante de radiações gama para pêssegos, Prunus persica, infestados com larvas da mosca do Mediterrâneo, Ceratitis capitata. Utilizaram-se frutas de procedência conhecida no campo fazendo-se uma amostragem prévia, constatando-se que cada fruta continha em média nove larvas do último ínstar da mosca praga. As frutas foram irradiadas em uma fonte de Cobalto-60 com as seguintes doses de radiação gama: 0 (test., 25, 50, 100, 200, 400, 600, 800, 1000 e 1200 Gy, sob uma taxa de 58 Gy por minuto. Após a irradiação as frutas foram colocadas em câmaras climatizadas com a temperatura variando entre 23 e 27°C e a umidade relativa variando entre 65 e 75%. Aguardou-se que as larvas deixassem as frutas e se transformassem em pupas e adultos. A dose letal para larvas, pelos resultados obtidos no experimento, concluiu-se ser de 600 Gy. A dose letal para pupas provenientes de larvas irradiadas dentro das frutas foi de 50 Gy, impedindo totalmente a emergência de adultos.Determination of the dose of gamma radiation to disinfest peaches, Prunus pérsica infested with larvae of Ceratitis capitata (Wied., 1824 was made. Fruits were collected in the field, each one holding about nine larvae of the last instar of the fruit-fly. The fruits were irradiated with Cobalt-60 gamma radiation source at the following doses: 0 (control, 25, 50, 100, 200, 400, 600, 800, 1000 and 1200 Gy; at a dose rate of 58 Gy per minute. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted between 23 and 27°C, and relative humidity between 65 and 75 percent, until the larvae left the fruits and were transformed into pupae and adults. It was concluded that the lethal dose of gamma radiation for larvae at the last instar, in naturally infested peaches, was 600 Gy and the dose of 50 Gy inhibited completely the emergency of adults.

  13. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  14. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  15. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  16. Thermal death kinetics of Mediterranean, Malaysian, melon, and oriental fruit fly (Diptera: Tephritidae) eggs and third instars.

    Science.gov (United States)

    Armstrong, John W; Tang, Juming; Wang, Shaojin

    2009-04-01

    The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50 degrees C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian, Mediterranean (Hawaii and Israel strains), melon, Mexican, and oriental fruit fly eggs or third instars and wild Mediterranean fruit fly (Hawaii strain) eggs or third instars showed that oriental fruit fly was the most thermotolerant among the third instars, and the difference in heat tolerance between third instars and eggs was negligible at 50 degrees C.

  17. [Parasitic effect of Opius concolor (Spzl) (Hymenoptera, Braconidae) on an intermediate host Ceratitis capitata Wied (Diptera, Trypetidae)].

    Science.gov (United States)

    Ben Hamouda, M H; Ben Salah, H

    1984-01-01

    The parasitic incidence of Opius concolor (Hymenoptera, Braconidae) on a replacement host, Ceratitis capitata (Diptera, Trypetidae) was studied using polyacrylamide gel electrophoresis and immunoelectrophoresis methods. A noticeable modification of C. capitata proteins was observed when parasited by O. concolor. But the most important phenomenon is the finding of common antigens between the host and the parasite. These results are discussed with regard to trophic and parasitic behaviour of the parasite.

  18. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  19. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    Science.gov (United States)

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  20. Implications of Rhagoletis zephyria, 1894 (Diptera: Tephritidae), captures for apple maggot surveys and fly ecology in Washington state, U.S.A

    Science.gov (United States)

    The apple maggot, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), is an introduced quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in Washington state, U.S.A. A morphologically similar native fly, Rhagoletis zephyria Snow, 1894, infests snowberries (Symphoricarpos spp.) ...

  1. Temperature-mediated kill and oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the presence of Spinosad

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the...

  2. Impact of prolonged absence of low temperature on adult eclosion patterns of western cherry fruit fly (Diptera: Tephritidae)

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the U.S.A. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in ...

  3. Reduction in Emergence of Rhagoletis indifferens (Diptera: Tephritidae) from Sweet Cherries with Different Egg and Larval Distributions Using Newer Insecticides

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is the major insect pest of sweet cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. To reduce fly populations in unharvested fruit following the completion of commercial harvest, it is important to cont...

  4. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad

    Science.gov (United States)

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  5. The geographic distribution of Rhagoletis pomonella (Diptera:Tephritidae) in the western United States: Introduced species or native population?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a major pest of commercially grown domesticated apple (Malus domestica) in North America. The shift of the fly from its native host hawthorn (Crataegus mollis) to apple in the eastern U.S. is often cited as an example of inc...

  6. Oviposition preference and larval performance in Ceratitis capitata (Díptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    1997-12-01

    Full Text Available Experiments concerning oviposition preference were carried out on Ceratitis capitata to determine whether females are able to preferentially oviposit on natural hosts in which the larvae develop better. The results indicated that the females do not preferentially oviposit on hosts of better nutritive value for the larvae.

  7. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  8. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    Science.gov (United States)

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  9. Selection of a Bacillus pumilus strain highly active against Ceratitis capitata (Wiedemann) larvae.

    Science.gov (United States)

    Molina, C Alfonso; Caña-Roca, Juan F; Osuna, Antonio; Vilchez, Susana

    2010-03-01

    Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly (medfly), is one of the most important fruit pests worldwide. The medfly is a polyphagous species that causes losses in many crops, which leads to huge economic losses. Entomopathogenic bacteria belonging to the genus Bacillus have been proven to be safe, environmentally friendly, and cost-effective tools to control pest populations. As no control method for C. capitata based on these bacteria has been developed, isolation of novel strains is needed. Here, we report the isolation of 115 bacterial strains and the results of toxicity screening with adults and larvae of C. capitata. As a result of this analysis, we obtained a novel Bacillus pumilus strain, strain 15.1, that is highly toxic to C. capitata larvae. The toxicity of this strain for C. capitata was related to the sporulation process and was observed only when cultures were incubated at low temperatures before they were used in a bioassay. The mortality rate for C. capitata larvae ranged from 68 to 94% depending on the conditions under which the culture was kept before the bioassay. Toxicity was proven to be a special characteristic of the newly isolated strain, since other B. pumilus strains did not have a toxic effect on C. capitata larvae. The results of the present study suggest that B. pumilus 15.1 could be considered a strong candidate for developing strategies for biological control of C. capitata.

  10. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  11. Interaction between Tephritidae (Insecta, Diptera and plants of the family Asteraceae: new host and distribution records for the state of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Marcoandre Savaris

    2015-03-01

    Full Text Available Twenty species of Tephritidae (Diptera are recorded in association with capitula of plants in the family Asteraceae. The Tephritidae genus Tetreuaresta is registered for Rio Grande do Sul for the first time. Five species of Tephritidae are newly recorded for Rio Grande do Sul, and new hosts are recorded for the following fly species: Dioxyna chilensis (Macquart, Plaumannimyia dolores (Hering, Plaumannimyia imitatrix (Hering, Plaumannimyia miseta (Hering, Plaumannimyia pallens Hering, Tomoplagia incompleta (Williston, Tomoplagia matzenbacheri Prado, Norrbom & Lewinsohn, Tomoplagia reimoseri Hendel, Xanthaciura biocellata (Thomson and Xanthaciura chrysura (Thomson.

  12. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  13. Effects of acoustic waves on pupas of Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae); Efeitos das ondas acusticas em pupas de Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Adilson Camilo de

    2007-07-01

    The aim of this research has been to investigate the hypothesis that acoustic waves would provoke a measurable effect on a population of fruit flies, a treatment denominated sonication. Ionizing radiation, the causative agent for the treatment designated by irradiation has been used as a reference, as long as its effects on living beings and particularly on insects are widely known. This research also enquiries into the possible effects of acoustic waves and gamma rays. The experiments of sonication were carried out in the Laboratory of Entomology of the Instituto Biologico de Sao Paulo. The experiments of radiation were carried out in the Centro de Tecnologia das Radiacoes - IPEN, located within the campus of the University of Sao Paulo. It has been employed a Gamma cell source model 220 with average activity of 757.069 {+-} 293.484 curies (Ci) and an average doses rate of 3.106 {+-} 0.245 kilo grays per hour (kGy/h). Levels applied to the sonication treatment, in hertz and kilo Hertz were: 0 Hz (control) ; 5.0 Hz; 10.0 Hz; 20.0 Hz; 40.0 Hz; 60.0 Hz; 80.0 Hz; 1.0 k Hz; 2.0 k Hz; 10.0 k Hz; 15.0 k Hz e 20.0 k Hz. Irradiation doses applied in Grays were: 5.0 Gy; 7.5 Gy; 10.0 Gy; 12.5 Gy; 15 Gy; 50 Gy; 100 Gy; 150 Gy and 200 Gy. It has been used an acoustic tube made of glass - 40.6 cm in length and 9.1 cm in diameter - and sinusoidal waves originated from three acoustic sources, with response in decibels, which sound intensity varied from 93.60 {+-} 1.51 dB to 123.96 {+-} 0.23 dB. Final results have pointed to evidences that would justify the rejection of null hypothesis H{sub 0}, to which the average of the treatments due to acoustic waves do not differ significantly from each other.(author)

  14. Chilling and host plant/site associated eclosion times of western cherry fruit fly (Diptera:Tephritidae) and a host-specific parasitoid

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is native to bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ~100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of ad...

  15. Impact of planting dates on a seed maggot, Neotephritis finalis (Diptera: Tephritidae), and sunflower bud moth (Lepidoptera: Tortricidae) damage in cultivated sunflower

    Science.gov (United States)

    Neotephritis finalis (Loew) (Diptera: Tephritidae), and sunflower bud moth, Suleima helianthana (Riley) (Lepidoptera: Tortricidae) are major head-infesting insect pests of cultivated sunflower (Helianthus annuus L.). Planting date was evaluated as a cultural pest management strategy for control of N...

  16. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  17. Small-Scale Spatio-Temporal Distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) Using Probability Kriging.

    Science.gov (United States)

    Wang, S Q; Zhang, H Y; Li, Z L

    2016-10-01

    Understanding spatio-temporal distribution of pest in orchards can provide important information that could be used to design monitoring schemes and establish better means for pest control. In this study, the spatial and temporal distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) was assessed, and activity trends were evaluated by using probability kriging. Adults of B. minax were captured in two successive occurrences in a small-scale citrus orchard by using food bait traps, which were placed both inside and outside the orchard. The weekly spatial distribution of B. minax within the orchard and adjacent woods was examined using semivariogram parameters. The edge concentration was discovered during the most weeks in adult occurrence, and the population of the adults aggregated with high probability within a less-than-100-m-wide band on both of the sides of the orchard and the woods. The sequential probability kriged maps showed that the adults were estimated in the marginal zone with higher probability, especially in the early and peak stages. The feeding, ovipositing, and mating behaviors of B. minax are possible explanations for these spatio-temporal patterns. Therefore, spatial arrangement and distance to the forest edge of traps or spraying spot should be considered to enhance pest control on B. minax in small-scale orchards.

  18. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  19. Genetic relationship of the melon fly, Bactrocera cucurbitae (Diptera: Tephritidae) inferred from mitochondrial DNA

    Institute of Scientific and Technical Information of China (English)

    Yi Wu; Bruce A. McPheron; Jia-Jiao Wu; Zhi-Hong Li

    2012-01-01

    The melon fruit fly,Bactrocera cucurbitae (Coquillett) (Diptera:Tephritidae),has been the subject of worldwide quarantine and management efforts due to its widespread agricultural impact and potential for rapid range expansion.From its presumed native distribution in India,this species has spread throughout the hot-humid regions of the world.We provide information that reveals population structure,invasion history and population connectivity from 23 locations covering nine countries based on DNA sequences of the mitochondrial cytochrome oxidase I (COI) gene.Forty-two polymorphic sites were described among 38 haplotypes.The most common haplotype,H1,was observed in 73% of the samples distributed among all populations.Highest genetic diversity was seen within populations,and no isolation-by-distance was detected.The western regions (Nepal,Bangladesh,Thailand,Burma and China-west) showed higher haplotype diversity than eastern regions (Chins-east).China-Yunnan showed highest levels of genetic diversity in China.Haplotype diversity decreased with longitude from west to east.Together,these analyses suggest that B.cucurbitae has expanded from west to east within a limited geographic scale and recently invaded China through Yunnan Province.

  20. MORPHOMETRIC STUDY FOR IDENTIFICATION OF THE BACTROCERA DORSALIS COMPLEX (DIPTERA : TEPHRITIDAE USING WING IMAGE ANALYSIS

    Directory of Open Access Journals (Sweden)

    A. ADSAVAKULCHAI

    1999-01-01

    Full Text Available The Bactrocera dorsalis complex (Diptera: Tephritidae used in this study included B. dorsalis, B. arecae, B. propinqua, B. pyrifoliae, B. verbascifoliae, and three new species complexes are species E, species K and species P. Bactrocera tau was used as an out-group. A total of 424 adults, which emerged from pupae collected from natural populations in Thai land, were prepared for wing measurements. Morphometric analysis was performed on measurements of wing vein characters. Wing images were captured in digital format and taken through digital image processing to calculate the Euclidean distance between wing vein junctions. Discriminant and cluster analyses were used for dichotomy of classification processes. All 424 wing specimens were classified to species in terms of the percentage of "grouped" cases which yielded about 89.6% accurate identificati on compared with the formal description of these species. After clustering, the percentage of "grouped"cases yielded 100.0%, 98.9%, 98.1%, 95.2% and 84.6% accurate identification between the B. dorsalis complex and B. tau; B. arecae and Species E; B. dorsalis and B. verbascifoliae; B. propinqua and B. pyrifoliae; and species K and species P, respectively. This method of numerical taxonomy may be useful for practical identification of other groups of agricultural pests.

  1. Cold tolerance and disinfestation of Bactrocera invadens (Diptera: Tephritidae) in 'Hass' avocado.

    Science.gov (United States)

    Ware, A B; Du Toit, C L N; Mohamed, S A; Nderitu, P W; Ekasi, S

    2012-12-01

    Bactrocera invadens (Diptera: Tephritidae) has spread rapidly across Africa and currently poses a phytosanitary threat to the fruit industry of South Africa. In reaction a cold mitigating treatment to provide phytosanitary security to importing countries was developed in Nairobi, Kenya. Using laboratory reared fruit flies, the rate of development in 'Hass' avocado (Persea americana Miller) was determined at 28 degrees C. Fruit ripeness or softness was found to be a factor improving larval fruit fly survival. Using this information the egg and larval developmental stages were subjected to 2 degrees C cold treatment and it was found that the third instars were the most cold tolerant life stage and that it was expected that between 16 and 17 d treatment would provide phytosanitary security. There were no survivors in the treatment of an estimated 153,001 individuals in four replicates at an average fruit pulp temperature of 2 degrees C satisfying the Probit 9 level of efficiency at a confidence of >95%. These data provide evidence that a continuous cold treatment of 1.5 degrees C or lower for 18 d would provide phytosanitary security in that any consignment entering an importing country poses no risk of accidental importation of B. invadens.

  2. Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2014-09-01

    Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT.

  3. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  4. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Anna M Szyniszewska

    Full Text Available The Mediterranean fruit fly (Medfly is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  5. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Szyniszewska, Anna M; Tatem, Andrew J

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  6. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae.

    Directory of Open Access Journals (Sweden)

    William J Nash

    Full Text Available BACKGROUND: The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. METHODOLOGY/PRINCIPAL FINDINGS: We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein, to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively. Development in the presence of the novel carbohydrate lactose (milk sugar was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. CONCLUSIONS: The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  7. Seasonal distributions of the western cherry fruit fly (Diptera: Tephritidae) among host and nonhost fruit trees.

    Science.gov (United States)

    Yee, Wee L

    2014-01-01

    Seasonal distributions of the western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), in sweet cherry (Prunus avium (L.) L.) (major host), black hawthorn (occasional developmental host) (Crataegus douglasii Lindley), and other trees were determined in a ponderosa pine ecosystem in Washington state, USA. The hypothesis that most fly dispersal from cherry trees occurs after fruit senesce or drop was tested, with emphasis on movement to black hawthorn trees. Sweet cherry fruit developed earlier than black hawthorn, bitter cherry (common host), choke cherry, and apple fruit. Flies were usually captured first in sweet cherry trees but were caught in bitter cherry and other trees throughout the season. Peak fly capture periods in sweet cherry began around the same time or slightly earlier than in other trees. However, peak fly capture periods in black hawthorn and other nonsweet cherry trees continued after peak periods in sweet cherry ended, or relative fly numbers within sweet cherry declined more quickly than those within other trees. Larvae were reared from sweet and bitter cherry but not black hawthorn fruit. Results provide partial support for the hypothesis in that although R. indifferens commonly disperses from sweet cherry trees with fruit, it could disperse more, or more flies are retained in nonsweet cherry trees after than before sweet cherries drop. This could allow opportunities for the flies to use other fruit for larval development. Although R. indifferens infestation in black hawthorn was not detected, early season fly dispersal to this and other trees and fly presence in bitter cherry could make fly management in sweet cherry difficult.

  8. Half of the European fruit fly species barcoded (Diptera, Tephritidae; a feasibility test for molecular identification

    Directory of Open Access Journals (Sweden)

    John Smit

    2013-12-01

    Full Text Available A feasibility test of molecular identification of European fruit flies (Diptera: Tephritidae based on COI barcode sequences has been executed. A dataset containing 555 sequences of 135 ingroup species from three subfamilies and 42 genera and one single outgroup species has been analysed. 73.3% of all included species could be identified based on their COI barcode gene, based on similarity and distances. The low success rate is caused by singletons as well as some problematic groups: several species groups within the genus Terellia and especially the genus Urophora. With slightly more than 100 sequences - almost 20% of the total - this genus alone constitutes the larger part of the failure for molecular identification for this dataset. Deleting the singletons and Urophora results in a success-rate of 87.1% of all queries and 93.23% of the not discarded queries as correctly identified. Urophora is of special interest due to its economic importance as beneficial species for weed control, therefore it is desirable to have alternative markers for molecular identification.We demonstrate that the success of DNA barcoding for identification purposes strongly depends on the contents of the database used to blast against. Especially the necessity of including multiple specimens per species of geographically distinct populations and different ecologies for the understanding of the intra- versus interspecific variation is demonstrated. Furthermore thresholds and the distinction between true and false positives and negatives should not only be used to increase the reliability of the success of molecular identification but also to point out problematic groups, which should then be flagged in the reference database suggesting alternative methods for identification.

  9. Rhagoletis cerasi Loew (Diptera: Tephritidae – Biological Characteristics, Harmfulness, and Control

    Directory of Open Access Journals (Sweden)

    Svetomir Stamenković

    2012-01-01

    Full Text Available The European cherry fruit fly, Rhagoletis cerasi Loew (Diptera: Tephritidae, is a highlydestructive pest in sweet and sour cherry orchards with a distribution area throughoutEurope and the temperate regions of Asia. It occurs regularly in all production regions ofthese fruit species in Serbia, damaging up to 10% of cherries in commercial production,while damage can go up to 100% in orchards and on solitary threes unprotected by controlmeasures.In Serbia, European cherry fruit fly most often attacks and damages fruits of the lateripeningcultivars of sweet cherry (Van, Stela, Hedelfinger, Bing, Lambert, Drogan’s Yellow.After a sweet cherry harvest, adults migrate to sour cherry where they continue feedingand ovipositing in half-mature sour cherries (prevailingly the domestic ecotype Oblačinska.During their activity period, larvae damage the fruits, so that they can no longer be consumedeither fresh or processed. The high percentage of sour cherries damaged by R. cerasihas become a factor limiting exports because the intensity of infestation of this fruitexceeds permissible limits. Pesticide use for controlling this pest, especially in integratedproduction, is based on a very poor selection of insecticides which cause problems withresidual ecotoxicity. Consequently, alternative measures for controlling European cherryfruit fly have been intensively studied over the past few years.This work surveys up-to-date results of various studies on the European cherry fruit flyas a very important pest in Serbia and other South and Mid-European countries. The workcontains detailed descriptions of its biological characteristics, flight phenology, infestationintensity and possibilities of fly control in sweet and sour cherry production areas.

  10. Hymenopterous parasitoids attacking Acanthiophilus helianthi Rossi (Diptera: Tephritidae pupae in Kohgiluyeh Safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2016-12-01

    Full Text Available The Safflower capsule fly (SCF, Acanthiophilus helianthi Rossi (Diptera: Tephritidae is the most destructive insect pest attacking the Safflower Carthamus tinctorius L. plant which are cultivated as an oil crop. It is mainly controlled through application of broad-spectrum insecticides, which can adversely affect safflower farms ecosystem and consequently human health. Since a first step in setting up an integrated pest management program is to assess the biological control agents within the ecosystem. Therefore, in this research work the pupal parasitoids of Safflower capsule fly a main insect pest attacking Safflower plants were identified. The impact of these parasitoids against this pest was evaluated on the varying pest generations and within different locations in Kohgiluyeh province during 2008-2009 seasons. Pupal parasitoid adults of SCF were recorded from fieldreared pupae, which had been collected from heavily infested small flower heads of the first generation as well from large flower heads of the second and third generations. Rate of parasitism on A. helianthi pupae was estimated as the number of parasitoids over the total count of parasitoids and flies. Ten hymenopterous species belonging to different families parasitizing insect pupae were screened as follows: Bracon hebetor (Spinola, 1808 and Bracon luteator (Spinola, 1808 (Braconidae; Isocolus tinctorious (Melika and Gharaei, 2006 (Cynipidae; Pronotalia carlinarum (Szelenyi and Erdos, 1951 (Eulophidae; Eurytoma acroptilae (Zerova, 1986 (Eurytomidae; Ormyrus orientalis (Walker, 1871 (Ormyridae; Colotrechnus viridis (Masi, 1921 and Pteromalus sp. (Walker, 1976 (Pteromalidae; and Antistrophoplex conthurnatus (Zerova, 2000 and Microdontomenus annulatus (Masi, 1899 (Torymidae. The average parasitization rate was 23±1 as revealed through the present study. The highest parasitization rate occurred during the first generation in all localities tested, as well as in years. Statistical

  11. The Process of Intromission in the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidiae

    Directory of Open Access Journals (Sweden)

    William G. Eberhard

    1995-01-01

    Full Text Available The distiphallus of the male of Ceratitis capitata is folded back 180° onto the basiphallus during the early stages of intromission, and is then unfolded within the female. Repeated folding and unfolding may occur within the female. Two membranous sacs on the distiphallus are capable of rhythmic cycles of inflation and deflation. Inflations of the sac near the base of the distiphallus probably help propel the aedeagus deeper into the female, along with periodic stiffening of the basiphallus; inflation of the larger, distal sac may drive the genital rod (which does not transfer sperm into the ventral receptacle.

  12. Determination of Opiinae parasitoids (Hymenoptera: Braconidae) associated with crop infesting Bactrocera spp. (Diptera: Tephritidae) using COI and Cyt b sequences

    Science.gov (United States)

    Shariff, Safiah; Yaakop, Salmah; Zain, Badrul Munir Md.

    2013-11-01

    Members of the Opiinae subfamily (Hymenoptera: Braconidae) are well known as important parasitoids of fruit fly larvae (Diptera: Tephritidae). They are widely used as biological control agents of fruit flies, especially the Bactrocera Macquart species that infest fruits. In this study, the larvae of fruit flies were collected from infested crops including star fruit, guava, wax apple and ridge gourd. The parasitized larvae were then reared under laboratory conditions until emergence of the adult parasitoids. Additionally, Malaise trap also was used to collect parasitoid species. The general concept of the multiplex PCR has been performed is to amplify two mitochondrial DNA markers, namely cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) simultaneously. Therefore, the lengthy process of reaction will be reduced. The status of the fruit fly species has also been confirmed by using COI marker on the early stage of the larvae. Maximum parsimony (MP) and Bayesian Inference (BI) were implemented to help and support the identification of Opiinae species. The result obtained from this study showed three parasitoid genera of the Opiinae viz. Fopius Wharton, Psyttalia Walker and Diachasmimorpha Viereck. Each genus has been determined by clustering together in a similar clade according to their infested crops. Therefore, accurate determination of parasitoids and the fruit fries species was highly useful and necessary for successful biological control of Bactrocera species.

  13. Optimizing methyl-eugenol aromatherapy to maximize posttreatment effects to enhance mating competitiveness of male Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan ul; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2015-10-01

    Methyl-eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural phytochemical, did enhance male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) mating competitiveness 3 d after ingestion. Enhanced male mating competitiveness can significantly increase the effectiveness of the sterile insect technique (SIT). ME application to mass reared sterile flies by feeding is infeasible. ME application by aromatherapy however, would be a very practical way of ME application in fly emergence and release facilities. This approach was shown to enhance mating competitiveness of B. carambolae 3 d posttreatment (DPT). Despite this added benefit, every additional day of delaying release will reduce sterile fly quality and will add cost to SIT application. The present study was planned to assess the effects of ME-aromatherapy on male B. carambolae mating competitiveness 1DPT and 2DPT. ME aromatherapy 1DPT or 2DPT did enhance mating competitiveness of B. carambolae males whereas ME feeding 1DPT and 2DPT did not. Male mating competitiveness was enhanced by the ME aromatherapy irrespective if they received 1DPT, 2DPT or 3DPT. ME aromatherapy, being a viable approach for its application, did enhance mating competitiveness of male B. carambolae 1 d posttreatment as ME feeding did 3 d after ingestion.

  14. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Pimentel, R.; Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  15. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  16. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  17. A new mechanised cultural practice to reduce Ceratitis capitata Wied. populations in area-wide IPM

    Directory of Open Access Journals (Sweden)

    P. Chueca

    2013-11-01

    Full Text Available The Mediterranean fruit fly (or medfly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae, affects most of the fruit species grown in temperate and tropical climate regions, causing significant economic damage. One of the classical cultural strategies against this pest is to gather and bury the remaining fruit after harvest, but this is economically unfeasible today. Wood shredders already available in current Spanish groves can be used to grind or crush fruits laying on the soil as an alternative to this practice and to the use of pesticides in area-wide integrated pest management (IPM. With the purpose of evaluating this alternative, the initial step of this study was to perform laboratory tests to assess the efficacy of crushing and grinding as a method for controlling medflies. The results showed that grinding was 78% effective against larval stages, while crushing resulted in a 17% efficacy, leading us to choose the first alternative. As a second step, the operational parameters (type of cutting tool, shaft rotation speed and tractor speed of the wood shredders were adjusted to efficiently carry out this practice under field conditions. Finally, the effect of the mechanised grinding of fallen fruit on C. capitata populations was evaluated for two consecutive years in commercial citrus orchards. The results showed a significant 27-46% reduction in C. capitata populations the following spring, thus demonstrating that the newly proposed mechanised alternative can be included in the current area-wide IPM of the pest in Spain.

  18. Transcriptome analysis in Ceratitis capitata to unveil genes involved in ageing-maturation process

    Directory of Open Access Journals (Sweden)

    V. San Andrés

    2013-07-01

    Full Text Available The sterile insect technique (SIT is widely used in integrated programmes against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae. Information on the age distribution of insects, and more particularly, the knowledge of wild female reproductive status (mature or not at the time of the sterile male release is one of the key factors for the success of the SIT. In recent years, sequencing analysis has become an important tool in molecular biology. In this work we present a genome-wide expression analysis based on SSH (substractive sequence hybridization and EST (expressed sequence tag sequencing and macroarray expression analysis to identify signature genes related to the ageing-maturing process in C. capitata, leading to the successful identification of new putative candidate genes of reproductive status in medfly that would serve as molecular markers for ageing. We have sorted out 94 unigenes from 873 single-pass ESTs, of which 57% have homology with known genes. Ageing-maturing process in C. capitata presents a marked expression pattern accompanied by the increase of transcription level of genes involved in reproduction (vitellogenins, chorion proteins and male-specific serum proteins. Other identified cDNAs (43% with a differential expression pattern would be also candidates but deserve further studies, as they belong to the unknown function class.

  19. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-03-16

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  20. Impact of Prolonged Absence of Low Temperature on Adult Eclosion Patterns of Western Cherry Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Neven, Lisa G; Yee, Wee L

    2017-03-25

    Western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the United States. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in tropical export markets because cold temperatures, below 5 °C, in those regions appear insufficient to complete diapause. However, it is unclear how prolonged absence of cold exposure affects diapause termination in R. indifferens. Here, we examined this question by exposing R. indifferens pupae for 40 wk to simulated temperate and tropical conditions of 23 or 26 °C, 40 or 80% RH, and a photoperiod of 16:8 or 12:12 (L:D) h. Eclosion patterns among fly groups in the four conditions did not differ. For all groups, fly eclosion from pupae not exposed to cold exhibited a bimodal distribution. The first major peak, comprising 3.2% of the total fly emergence, occurred at 1-10 wk. The second major peak, comprising the remaining 96.8%, occurred at a mode of ∼30 wk. Based on responses to no cold and cold (3 ± 1.5 °C) exposures, there were three distinct pupal diapause groups: the first eclosion group was likely nondiapausing pupae; the second eclosion group was likely diapausing pupae; a third group that remained viable but did not produce adults after 40 wk may represent prolonged dormancy pupae. We suggest that eclosion of adults after prolonged absence of cold exposure needs to be incorporated into models for potential fly establishment in warm climates.

  1. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit.

    Science.gov (United States)

    Hallman, Guy J; Thomas, Donald B

    2011-02-01

    Methyl bromide fumigation is widely used as a phytosanitary treatment. Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is a quarantine pest of several fruit, including citrus (Citrus spp.), exported from Texas, Mexico, and Central America. Recently, live larvae have been found with supposedly correctly fumigated citrus fruit. This research investigates the efficacy of the previously approved U.S. Department of Agriculture-Animal and Plant Health Inspection Service treatment schedule: 40 g/m3 methyl bromide at 21-29.4 degrees C for 2 h. Tolerance ofA. ludens to methyl bromide in descending order when fumigated in grapefruit (Citrus X paradisi Macfad.) is third instar > second instar > first instar > egg. Two infestation techniques were compared: insertion into fruit of third instars reared in diet and oviposition by adult A. ludens into fruit and development to the third instar. Inserted larvae were statistically more likely to survive fumigation than oviposited larvae. When fruit were held at ambient temperature, 0.23 +/- 0.12% of larvae were still observed to be moving 4 d postfumigation. Temperatures between 21.9 and 27.2 degrees C were positively related to efficacy measured as larvae moving 24 h after fumigation, pupariation, and adult emergence. Coating grapefruit with Pearl Lustr 2-3 h before fumigation did not significantly affect the proportion of third instars moving 24 h after fumigation, pupariating, or emerging as adults. In conclusion, fumigation with 40 g/m3 methyl bromide for 2 h at fruit temperatures >26.7 degrees C is not found to be inefficacious for A. ludens. Although a few larvae may be found moving >24 h postfumigation, they do not pupariate.

  2. Influence of media type and moisture on adult development and pupal mortality in Rhagoletis indifferens (Diptera: Tephritidae).

    Science.gov (United States)

    Yee, Wee L

    2013-06-01

    The influence of media type and moisture on adult development and pupal mortality in western cherry fruit fly, Rhagoletis indifferens Curran (Diptera:Tephritidae), was assessed using the pupal-adult and the larval-pupal stage. Inside containers, a higher percent of flies that emerged from dry loam was deformed (44.2%, 1-cm-depth loam; 84.4%, 5-cm-depth loam) than flies from 16% moist loam and dry and 16% moist lab soil (peat moss-sand mix) (0-14.9%). Percent of flies deformed from dry sand (22.1%, 1-cm depth; 49.5%, 5-cm depth) was greater than from 16% moist sand and dry and 16% moist peat moss (0-10.5%). Percents of flies deformed from 8% moist loam, lab soil, sand, and peat moss (0-5.8%) did not differ. Pupae suffered higher mortality at 7 and 14 d after larvae were dropped onto dry loam and dry sand (68.2-94.0%) than dry lab soil and dry peat moss (3.0-53.0%); respective mortalities at 21 and 28 d were similar (81.3-96.0 versus 64.7-97.9%). Pupal mortality in moist media was lower (0.5-40.3%) than in dry media. In outdoor tests, pupal mortality was also higher in dry loam than other dry media. In nature, 60.9% of pupae in dry sandy loams in late summer were dead. Results suggest R. indifferens has not yet evolved to fully cope with dry soils and that pupation in media with traits similar to those of peat moss or a peat moss-sand mix could reduce negative effects of dry environments on fly survival.

  3. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera:Tephritidae) to metabolic stress disinfection and disinfestation treatment

    Science.gov (United States)

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment o...

  4. How functional genomics will impact fruit fly pest control: the example of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Scolari, Francesca; Gomulski, Ludvik M; Gabrieli, Paolo; Manni, Mosè; Savini, Grazia; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The highly invasive agricultural insect pest Ceratitis capitata (Diptera: Tephritidae) is the most thoroughly studied tephritid fruit fly at the genetic and molecular levels. It has become a model for the analysis of fruit fly invasions and for the development of area-wide integrated pest management (AW-IPM) programmes based on the environmentally-friendly Sterile Insect Technique (SIT). Extensive transcriptome resources and the recently released genome sequence are making it possible to unravel several aspects of the medfly reproductive biology and behaviour, opening new opportunities for comparative genomics and barcoding for species identification. New genes, promotors and regulatory sequences are becoming available for the development/improvement of highly competitive sexing strains, for the monitoring of sterile males released in the field and for determining the mating status of wild females. The tools developed in this species have been transferred to other tephritids that are also the subject of SIT programmes.

  5. Threshold Concentration of Limonoids (Azamax) for Preventing Infestation by Mediterranean Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Forim, M R; Sá, I C G

    2015-04-01

    This study identified the threshold concentration of limonoids for the complete inhibition of oviposition of Ceratitis capitata (Wiedemann) in grapes 'Itália.' Choice and no-choice experiments with the insect were performed. The three no-choice bioassays were conducted following a completely randomized design with 18 treatments (three densities of insects [one, two, or three females]×five concentrations of limonoids and control) and 20 replicates. In a free choice bioassay, two fruits per cage (a treatment grape and a control) were provided for ovipositing. Three densities of insects (one, two, or three females) were used, with 15 replicates. Bioassays were conducted at 25±2°C, 60±10% relative humidity, and a photoperiod of 14:10 (L:D) h. The inhibition of oviposition of C. capitata was concentration dependent, with infestation occurring at lower concentrations of azadirachtin (+3-tigloylazadirachtol) and complete inhibition occurring at concentrations at or exceeding 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol), maintaining protective effects even at the most densely populated treatment (three females per fruit). When the pest had a free choice of host grapes (treatment vs. control), severe inhibition was observed at concentrations≥50 ppm azadirachtin (+14.3 ppm of 3-tigloylazadirachtol). We conclude that a threshold concentration of 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol) is capable of preventing grape infestation. This concentration is likely to provide a reliable level of protection, as the experimental population density of three females per fruit usually does not occur in the field and wild flies usually have more host options.

  6. Population dynamics of oriental fruit fly Bactrocera dorsalis(Diptera:Tephritidae)in Xishuangbanna,Yunnan Province,China

    Institute of Scientific and Technical Information of China (English)

    YE Hui; LIU Jianhong

    2007-01-01

    Annual monitoring of the population dynamics of the oriental fruit fly Bactrocera dorsalis(Hendel)(Diptera:Tephritidae)in Xishuangbanna,southern Yunnan,was conducted by using methyl eugenol-baited traps in 1997,2000,and 2003,and factors including temperature,rainfall,and host species with respect to the population fluctuation were analyzed systematically.The results showed that the fruit fly was present all year round in Xishuangbanna.Its population remained at a lower level from November to February,and increased from March until it reached a peak in June or July,depending on the rainfall that year.Afterward,the fly population declined remarkably until October.Temperature,rainfall,and host fruits were major factors comprehensively influencing the population fluctuation.The monthly mean temperature was in a range of temperatures suitable for development and reproduction of the fly.But the monthly mean minimum temperature from December to February was lower than the suitable temperature range,which was suggested a possible reason for the lower populations in winter months.Rainfall was another essential factor influencing the population fluctuations.The population was depressed when the monthly rainfall amount was lower than 50 mm,but increased when rainfall ranged from 100 mm to 200 mm.When the monthly rainfall amount was higher than 250 mm,the fruit fly population was reduced remarkably.The heavy rain in July and August explained the decreasing population.Mango,orange,pear,longan,and peach were found to be the main host species of the fly in Xishuangbanna.Among them,mango and longan were most preferred by the fly.Therefore,the planted areas,fruiting period,and production exerted essential effects on the fly population fluctuations,which were regarded as another major factor influencing the fly population in that area.Briefly,temperature,monthly rainfall,and the host species,through the way of their functions,the influence strength,as well as the period that they

  7. Including climate change in pest risk assessment: the peach fruit fly, Bactrocera zonata (Diptera: Tephritidae).

    Science.gov (United States)

    Ni, W L; Li, Z H; Chen, H J; Wan, F H; Qu, W W; Zhang, Z; Kriticos, D J

    2012-04-01

    Bactrocera zonata (Saunders) is one of the most harmful species of Tephritidae. It causes extensive damage in Asia and threatens many countries located along or near the Mediterranean Sea. The climate mapping program, CLIMEX 3.0, and the GIS software, ArcGIS 9.3, were used to model the current and future potential geographical distribution of B. zonata. The model predicts that, under current climatic conditions, B. zonata will be able to establish itself throughout much of the tropics and subtropics, including some parts of the USA, southern China, southeastern Australia and northern New Zealand. Climate change scenarios for the 2070s indicate that the potential distribution of B. zonata will expand poleward into areas which are currently too cold. The main factors limiting the pest's range expansion are cold, hot and dry stress. The model's predictions of the numbers of generations produced annually by B. zonata were consistent with values previously recorded for the pest's occurrence in Egypt. The ROC curve and the AUC (an AUC of 0.912) were obtained to evaluate the performance of the CLIMEX model in this study. The analysis of this information indicated a high degree of accuracy for the CLIMEX model. The significant increases in the potential distribution of B. zonata projected under the climate change scenarios considered in this study suggest that biosecurity authorities should consider the effects of climate change when undertaking pest risk assessments. To prevent the introduction and spread of B. zonata, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions.

  8. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Directory of Open Access Journals (Sweden)

    Mónica Ordax

    Full Text Available Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly Ceratitis capitata (Diptera: Tephritidae, one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  9. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Science.gov (United States)

    Ordax, Mónica; Piquer-Salcedo, Jaime E; Santander, Ricardo D; Sabater-Muñoz, Beatriz; Biosca, Elena G; López, María M; Marco-Noales, Ester

    2015-01-01

    Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly) Ceratitis capitata (Diptera: Tephritidae), one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i) E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii) medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  10. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  11. Psyttalia cf. concolor (Hymenoptera: Braconidae) for biological control of olive fruit fly (Diptera: Tephritidae) in California.

    Science.gov (United States)

    Yokoyama, Victoria Y; Rendón, Pedro A; Sivinski, John

    2008-06-01

    The larval parasitoid, Psyttalia cf. concolor (Szépligeti), reared on Mediterranean fruit fly, Ceratitis capitata (Weidemann), by the USDA-APHIS-PPQ, Guatemala City, Guatemala, was imported into California for biological control of olive fruit fly, Bactrocera oleae (Gmelin), in olives, Olea europaea L. Mean percentage parasitism of olive fruit fly third instars infesting fruit in field cages ranged from 7.0 in Grapevine to 59.7 in Santa Barbara and in free releases ranged from 0 in Grapevine to 10.6 in Santa Barbara after 4- to 6-d exposures. In the laboratory, more parasitoids developed to adults in olive fruit fly larvae that were 11-13 d old than in larvae 8-10 d old. Adult parasitoids lived significantly longer when provided with water than adults without water in environmental chambers at 5 degrees C, 85% RH; 15 degrees C, 65% RH; 25 degrees C, 25% RH; and 35 degrees C, 25% RH. Adult parasitoids lived for 48 d with honey for food and water and 32 d with food and sugar solution at 15 degrees C and 65% RH. Survival of adult parasitoids without food and water in greenhouse tests was approximately 4 d in a simulated coastal climate and 1 d in a simulated inland valley climate and was significantly increased by providing food and water. The parasitoid did not develop in the beneficial seedhead fly, Chaetorellia succinea (Costa), in yellow star thistle. The rate of parasitism of walnut husk fly, Rhagoletis completa Cresson, larvae in green walnut husks was 28.4% in laboratory no-choice tests. In choice tests, the rate of parasitism of walnut husk fly versus olive fruit fly larvae in olives was 11.5 and 24.2%, respectively.

  12. Controlled-release panel traps for the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Leonhardt, B A; Cunningham, R T; Chambers, D L; Avery, J W; Harte, E M

    1994-10-01

    Solid, controlled-release dispensers containing 2 g of the synthetic attractant trimedlure now are used in Jackson traps to detect the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Panel traps consisting of trimedlure mixed in a sticky substance and spread on the surfaces of a plastic panel are used to delineate the limits of discovered insect infestations in California. We describe the development of controlled-release, polymeric panels that prolong release of trimedlure and a highly attractive analog, ceralure. Attractants were incorporated in a polyethylene matrix to form panels and in a polymer coating on cardboard panels that then were evaluated by biological and chemical assay. In addition, commercial polymer matrix panels were evaluated. Field bioassay tests conducted in Hilo, HI, using released flies and in Guatemala in a natural population showed that the polyethylene matrix panel became brittle and cracked during field exposure and that release rates of the attractants were relatively low. The coated cardboard panels were stable under field conditions and yielded high fly captures for up to 6 wk. Farma Tech commercial panels containing 12.3 and 23.4 g of trimedlure remained highly attractive throughout a 134-d test in Hawaii and appear to be a long-lasting alternative to panels coated with trimedlure in Stikem. The cost of the relatively high dose of trimedlure is offset by the prolonged active life of the panel. Commercial panels from AgriSense (10 g trimedlure and 10 g ceralure) released the attractants at a slower rate and were less attractive.

  13. Area-wide suppression of the Mediterranean fruit fly, Ceratitis capitata, and the Oriental fruit fly, Bactrocera dorsalis, in Kamuela, Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Piñero, Jaime C; Mau, Ronald F L; Jang, Eric B; Klungness, Lester M; McInnis, Donald O; Harris, Ernest B; McQuate, Grant T; Bautista, Renato C; Wong, Lyle

    2010-01-01

    The United States Department of Agriculture's Agricultural Research Service initiated an area-wide fruit fly management program in Hawaii in 2000. The first demonstration site was established in Kamuela, Hawaii, USA. This paper documents suppression of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in a 40 km2 area containing urban, rural and agricultural zones during a 6 year period. The suppression techniques included sanitation, GF-120 NF Naturalyte Fruit Fly Bait sprays, male annihilation, Biolure traps, and parasitoids against C. capitata and B. dorsalis. In addition, small numbers of sterile males were released against B. dorsalis. Substantial reductions in fruit infestation levels were achieved for both species (90.7 and 60.7% for C. capitata and B. dorsalis, respectively) throughout the treatment period. Fruit fly captures in the 40 km2 treatment area were significantly lower during the 6 year period than those recorded in three non-treated areas. The strategy of combining suppression techniques in an area-wide approach is discussed.

  14. Detection of an apple-infesting popoulation of Rhagoletis pomonella (Walsh) 1867 (Diptera: Tephritidae) in the state of Colorado, USA

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella (Walsh) 1867 (Tephritidae), is an economically important pest of apples (Malus domesica Borkh.) (Rosaceae) throughout much of the United States. The fly is endemic to the eastern U.S., where its primary host plants are several species of native hawthorns (C...

  15. Combining field phenological observations with distribution data to model the potential distribution of the fruit fly Ceratitis rosa Karsch (Diptera: Tephritidae).

    Science.gov (United States)

    de Villiers, M; Hattingh, V; Kriticos, D J

    2013-02-01

    Despite the potential for phenological and abundance data to improve the reliability of species niche models, they are seldom used. The aim of this study was to combine information on the distribution, relative abundance and seasonal phenology of Natal fruit fly, Ceratitis rosa Karsch (Diptera: Tephritidae), in South Africa to model its potential global distribution. Bucket traps, baited with Biolure, were used to trap C. rosa in different climatic regions of South Africa over a two-year period. A CLIMEX niche model of the potential global distribution of C. rosa was fitted using the collected trapping data and other distribution records from South Africa. Independent distribution records for elsewhere in Africa were reserved for model validation. The CLIMEX model results conformed well to the South African trapping data, including information on relative abundance and seasonal phenology, as well as to the pattern of presence records of the species elsewhere in Africa. The model suggests that under recent historical conditions a large part of South America, Central America, Mexico and southern USA may be climatically suitable for establishment of C. rosa. In Europe, climatically suitable habitat is restricted to coastal regions of the Mediterranean, in Asia, mostly to the southern and south eastern countries, and in Australia mostly to the wetter south and east. The independent cross-validation provided by South African relative abundance and seasonal phenology data, central African distribution data and relevant species specific biological information provides greater confidence in the modelled potential distribution of C. rosa.

  16. Insecticidal activity of the leaf essential oil of Peperomia borbonensis Miq. (Piperaceae) and its major components against the melon fly Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Dorla, Emmanuelle; Bialecki, Anne; Deuscher, Zoé; Allibert, Agathe; Grondin, Isabelle; Deguine, Jean-Philippe; Laurent, Philippe

    2017-03-08

    The essential oil from leaves of Peperomia borbonensis from Réunion Island was obtained by hydrodistillation and characterized using GC-FID, GC-MS and NMR. The main components were myristicin (39.5%) and elemicin (26.6%). The essential oil (EO) of Peperomia borbonensis and its major compounds (myristicin and elemicin), pure or in a mixture, were evaluated for their insecticidal activity against Bactrocera cucurbitae (Diptera: Tephritidae) using a filter paper impregnated bioassay. The concentrations necessary to kill 50% (LC50 ) and 90% (LC90 ) of the flies in three hours were determined. The LC50 was 0.23 ± 0.009 mg/cm² and the LC90 was 0.34 ± 0.015 mg/cm² for the EO. The median lethal time (LT50 ) was determined to compare the toxicity of EO and the major constituents. The EO was the most potent insecticide (LT50 = 98 ± 2 min), followed by the mixture of myristicin and elemicin (1.4:1) (LT50 = 127± 2 min) indicating that the efficiency of the EO is potentiated by minor compounds and emphasizing one of the major assets of EOs against pure molecules. This article is protected by copyright. All rights reserved.

  17. Insecticidal effects of various concentrations of selected extractions of Cestrum parqui on adult and immature Ceratitis capitata.

    Science.gov (United States)

    Zapata, Nelson; Budia, Flor; Viñuela, Elisa; Medina, Pilar

    2006-04-01

    Aqueous extracts of Cestrum parqui L'Héritier (Solanaceae) were evaluated at different concentrations in several stages of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). For adults, the study was extended to extracts obtained with several solvents of an increasing degree of polarity. Aqueous extracts from C. parqui showed a high toxicity to neonate larvae when ingested through diet, inhibiting pupation at a concentration above 0.6%. Lower concentrations delayed the larval development and reduced the percentages of pupae formed and adult emergence. An LC50 = 0.9% after 3 d of continuous ingestion of C. parqui aqueous extracts could be calculated, whereas extracts obtained with organic compounds were nearly innocuous except with the use of the solvent methanol/water (80:20), the more polar of those tested, that killed 12.5% of adults. Aqueous extracts were also harmful to adults by diminishing the reproductive potential, which implies a significant effect on the offspring. Egg contact with insecticide or dipping third instars did not cause any adverse effect, supporting the hypothesis that only by means of ingestion can the toxic compounds of C. parqui reach the target. Our results showed that C. parqui components causing C. capitata mortality are mostly dissolved in water and not in organic solvents, which point out their polar character.

  18. Cloning, sequence identification and expression profile analysis of α-L-fucosidase gene from the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Intra, Jari; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-04-01

    The Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae) is one of the most destructive agricultural pests, a polyphagus insect of relevant economic importance and is widespread in many regions around the world. It is the best-studied fruit fly pest at genetic and molecular level and much has been learned on its ecology and behaviour. An α-L-fucosidase has been recently hypothesized to be involved in sperm-egg interactions in Drosophila melanogaster and in other Drosophila species. Here, a complete cDNA encoding a putative α-L-fucosidase of the medfly was amplified using the reverse polymerase chain reaction (RT-PCR) with degenerate based on the conserved coding sequence information of several insect α-L-fucosidases, cloned and sequenced (GenBank accession no. FJ177429). The coding region consisted of 1482 bp which encoded a 485-residues protein (named CcFUCA) with a predicted molecular mass of 56.1 kDa. The deduced protein sequence showed 75% amino acid identity to D. melanogaster α-L-fucosidase, and in fact the phylogenetic tree analysis revealed that CcFUCA had closer relationships with the α-L-fucosidases of drosophilid species. The tissue expression analysis indicated that CcFuca was expressed in a single transcript in all tissues, suggesting a ubiquitous localization pattern of the encoded protein. Our findings provide novel insights on a gene encoding a protein potentially involved in primary gamete interactions in C. capitata.

  19. Nitric oxide synthase-dependent NADPH-diaphorase activity in the optic lobes of male and female Ceratitis capitata mutants

    Directory of Open Access Journals (Sweden)

    E Roda

    2009-06-01

    Full Text Available Nitric oxide (NO is acknowledged as a messenger molecule in the nervous system with a pivotal role in the modulation of the chemosensory information. It has been shown to be present in the optic lobes of several insect species. In the present study, we used males and females from four different strains of the medfly Ceratitis capitata (Diptera, Tephritidae: or; or,wp (both orange eyed; w,M360 and w,Heraklion (both white eyed, as models to further clarify the involvement of NO in the mutants’ visual system and differences in its activity and localization in the sexes. Comparison of the localization pattern of NO synthase (NOS, through NADPH-diaphorase (NADPHd staining, in the optic lobes of the four strains, revealed a stronger reaction intensity in the retina and in the neuropile region lamina than in medulla and lobula. Interestingly, the intensity of NADPHd staining differs, at least in some strains, in the optic lobes of the two sexes; all the areas are generally strongly labelled in the males of the or and w,M360 strains, whereas the w,Heraklion and or,wp mutants do not show evident sexdependent NADPHd staining. Taken as a whole, our data point to NO as a likely transmitter candidate in the visual information processes in insects, with a possible correlation among NOS distribution, eye pigmentation and visual function in C. capitata males. Moreover, NO could influence behavioural differences linked to vision in the two sexes.

  20. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  1. Rhythmicity of Bactrocera cucurbitae (Diptera:Tephritidae) attraction to cuelure: Insights from an interruptable lure and computer vision

    Science.gov (United States)

    We describe and validate an Agent-Based Simulation (ABS) of invasive insects and use it to investigate the time to extirpation of Ceratitis capitata using data from seven outbreaks that occurred in California from 2008-2010. Results are compared with the length of intervention and quarantine imposed...

  2. Temperature-dependent development and survival of Brazilian populations of the Mediterranean fruit fly, Ceratitis capitata, from tropical, subtropical and temperate regions.

    Science.gov (United States)

    Ricalde, Marcelo P; Nava, Dori E; Loeck, Alci E; Donatti, Michele G

    2012-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the principal exotic pests affecting Brazilian production in the northeastern and southeastern regions of Brazil. In the south, it is has potential as a serious threat to temperate-climate fruit farms, since it is already found in urban and suburban communities in this region. We studied the biological characteristics of C. capitata populations from Pelotas-RS (temperate climate), Petrolina-PE (tropical), and Campinas-SP (subtropical). Ceratitis capitata biology was studied under controlled temperature (15, 20, 25, 30, and 35 ± 1 °C), 70 ± 10% RH, and 14:10 L:D photoperiod. The duration and survival rate of the egg, larval, and pupal stages were evaluated and the thermal requirements of these three populations were determined. The duration and survival of these developmental stages varied with temperature, with similar values for the three populations, except for some variation in the egg phase. Egg to adult developmental time for all three populations was inversely proportional to temperature; from 15 to 30 °C developmental time varied from 71.2 to 17.1, 70.2 to 17.1, and 68.5 to 16.9 days, respectively. Survival during development was affected at 15 to 30 °C, and differed significantly from survival at 20 to 25 °C. At 35 °C, immature stages did not develop. The basal temperature and degree-day requirement were similar for all immature stages except for the egg stage. The basal temperatures and thermal constants were 9.30 and 350, 8.47 and 341, and 9.60 °C and 328 degree-days for the Pelotas, Petrolina, and Campinas populations, respectively. Results suggested that survival and thermal requirements are similar for these tropical, subtropical, and temperate populations of C. capitata, and demonstrate the species' capacity to adapt to different climate conditions.

  3. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  4. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    , Rhagoletis sp. Loew and Hexachaeta sp. Loew. A. A. fraterculus was the only species common to the four orchards, occurring in a frequency higher than 80%. This is the first record of A. montei in the state of Paraná. A. fraterculus, A. sororcula and C. capitata had the highest frequency, abundance, dominance and constancy, and are therefore considered predominant species. The highest diversity index (H'=0.4360 occurred in the orchard 2, differing significantly from all orchards (t test, P<0.05. The Margalef index values were low (close to or below 0.5 confirming that there are predominant species. Regarding the similarity of species between the orchards, that was determined by the coefficient of Jaccard and the Bray-Curtius index, the orchard 4, where occurred only two species (96% of A. fraterculus and 4% of A. pseudoparallela, forms a distinct group from other orchard sampled, where there were four species of Tephritidae.

  5. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  6. Implementing a spinosad-based local bait station to control Bactrocera cucurbitae (Diptera: Tephritidae) in high rainfall areas of Reunion Island.

    Science.gov (United States)

    Delpoux, Camille; Deguine, Jean-Philippe

    2015-01-01

    Three species of fruit flies cause serious damage to cucurbit crops on Reunion Island: Bactrocera cucurbitae (Diptera: Tephritidae) (Coquillett 1899), Dacus ciliatus (Loew 1901), and Dacus demmerezi (Bezzi 1917). To control them, a program of agroecological management of cucurbit flies has been implemented based on the application of Synéis-appât, especially spot sprays on corn borders. However, the high rainfall on Reunion Island limits the long-term efficiency of the bait; in addition, this method cannot be used for large chayote trellises, because corn borders cannot be planted around them. The aim of this study was to design a bait station adapted to prevailing conditions on Reunion Island. An 'umbrella trap' tested in Taiwan was used as a reference to compare its efficacy with our local bait station. Experiments were conducted in field cages on B. cucurbitae to test different characteristics of bait stations and to construct one using local materials. Results were validated in the field. The attractiveness of the bait station was related mainly to the color of the external surface, yellow being the most attractive color. The efficacy of the bait station with respect to fly mortality was found to be linked to the accessibility of the bait, and direct application of Synéis-appât on the bait station was found to be the most efficient. In the field, B. cucurbitae were more attracted to the local bait station than to the umbrella trap, while the two other fly species displayed equal attraction to both trap types. Our local bait station is a useful alternative to spot sprays of Synéis-appât and is now included in a local pest management program and is well accepted by farmers.

  7. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  8. Chilling and Host Plant/Site-Associated Eclosion Times of Western Cherry Fruit Fly (Diptera: Tephritidae) and a Host-Specific Parasitoid.

    Science.gov (United States)

    Yee, Wee L; Goughnour, Robert B; Hood, Glen R; Forbes, Andrew A; Feder, Jeffrey L

    2015-08-01

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is an endemic herbivore of bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ∼100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of adult R. indifferens from sweet and bitter cherry differ according to the phenology of their respective host plants and if eclosion times of the host-specific parasitoid Diachasma muliebre (Muesebeck) (Hymenoptera: Braconidae) attacking bitter and sweet cherry flies differ according to the eclosion phenology of their fly hosts. Fly pupae from sweet and bitter cherry fruit were collected from sympatric and allopatric sites in Washington state, and chilled at 5°C. Because timing of eclosion in R. indifferens depends on chill duration, eclosion time in wasps could also vary with chill duration. To account for this, fly pupae were chilled for 1, 2, 2.5, 3, 4, 6, or 8 mo. Both flies and wasps eclosed earlier with longer chill durations. Eclosion times of sweet and bitter cherry flies from a sympatric site in central Washington did not differ. However, at allopatric sites in northwestern and central Washington, bitter cherry flies eclosed later than sweet and bitter cherry flies at the sympatric site. Correspondingly, D. muliebre parasitizing a more isolated bitter cherry fly population eclosed later than D. muliebre parasitizing earlier-emerging sweet and bitter cherry fly populations. These results provide evidence for D. muliebre rapidly responding to changes in host plant shifts by R. indifferens.

  9. Seasonal Abundance of Mango Fruit Flies (Diptera: Tephritidae) and Ecological Implications for Their Management in Mango and Cashew Orchards in Benin (Centre & North).

    Science.gov (United States)

    Vayssières, J-F; De Meyer, M; Ouagoussounon, I; Sinzogan, A; Adandonon, A; Korie, S; Wargui, R; Anato, F; Houngbo, H; Didier, C; De Bon, H; Goergen, G

    2015-10-01

    We report the results of a large-scale (six orchards) and long-term (5-yr) study on seasonal population fluctuations of fruit flies (Diptera Tephritidae) in mango (2005-2009) and cashew (2007-2009) orchards in the Borgou Department, Benin.During the five consecutive years of mango fruit fly monitoring, 25 tephritid species were captured including three species of Bactrocera, 11 of Ceratitis, and 11 of Dacus, which is represented by 2,138,150 specimens in mango orchards. We observed significant differences in Bactrocera dorsalis (Hendel) counts between "high" and "low" mango production years from 2005 to 2008 but not in Ceratitis cosyra (Walker) counts. The native species, C. cosyra, the most abundant species during the dry season, peaked beginning of May, while the exotic species, B. dorsalis, the most abundant species during the rainy season, peaked in June. Preliminary results underlined the role of nine species of wild hosts and seven species of cultivated ones around mango orchards that played an important role in maintaining B. dorsalis in this Sudan zone all year round. The presence of C. cosyra stretched over 9 mo.During the first 14 wk of tephritid monitoring on cashew orchards situated near mango orchards, most flies (62%) were captured in traps positioned in cashew orchards, showing the strong interest of an early fly control on cashew before the mango season. According to these results, in the Sudan zone, effective and compatible control methods as proposed by the IPM package validated by the West African Fruit Fly Initiative project against mango fruit flies are proposed for a large regional tephritid control program in same zones of West Africa.

  10. Pattern of association between endemic Hawaiian fruit flies (Diptera, Tephritidae) and their symbiotic bacteria: Evidence of cospeciation events and proposal of "Candidatus Stammerula trupaneae".

    Science.gov (United States)

    Viale, E; Martinez-Sañudo, I; Brown, J M; Simonato, M; Girolami, V; Squartini, A; Bressan, A; Faccoli, M; Mazzon, L

    2015-09-01

    Several insect lineages have evolved mutualistic association with symbiotic bacteria. This is the case of some species of mealybugs, whiteflies, weevils, tsetse flies, cockroaches, termites, carpenter ants, aphids and fruit flies. Some species of Tephritinae, the most specialized subfamily of fruit flies (Diptera: Tephritidae), harbour co-evolved vertically transmitted, bacterial symbionts in their midgut, known as "Candidatus Stammerula spp.". The 25 described endemic species of Hawaiian tephritids, plus at least three undescribed species, are taxonomically distributed among three genera: the cosmopolitan genus Trupanea (21 described spp.), the endemic genus Phaeogramma (2 spp.) and the Nearctic genus Neotephritis (2 spp.). We examined the presence of symbiotic bacteria in the endemic tephritids of the Hawaiian Islands, which represent a spectacular example of adaptive radiation, and tested the concordant evolution between host and symbiont phylogenies. We detected through PCR assays the presence of specific symbiotic bacteria, designated as "Candidatus Stammerula trupaneae", from 35 individuals of 15 species. The phylogeny of the insect host was reconstructed based on two regions of the mitochondrial DNA (16S rDNA and COI-tRNALeu-COII), while the bacterial 16S rRNA was used for the symbiont analysis. Host and symbiont phylogenies were then compared and evaluated for patterns of cophylogeny and strict cospeciation. Topological congruence between Hawaiian Tephritinae and their symbiotic bacteria phylogenies suggests a limited, but significant degree of host-symbiont cospeciation. We also explored the character reconstruction of three host traits, as island location, host lineage, and host tissue attacked, based on the symbiont phylogenies under the hypothesis of cospeciation.

  11. Attraction and mortality of Bactrocera dorsalis (Diptera: Tephritidae) to STATIC Spinosad ME weathered under operational conditions in California and Florida: a reduced-risk male annihilation treatment.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Hoffman, Kevin; Mercogliano, Juan; Smith, Trevor R; Hammond, Jack; Davis, Bobbie J; Brodie, Matt; Dripps, James E

    2014-08-01

    Studies were conducted in 2013-2014 to quantify attraction, feeding, and mortality of male oriental fruit flies, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to STATIC Spinosad ME a reduced-risk male annihilation treatment (MAT) formulation consisting of an amorphous polymer matrix in combination with methyl eugenol (ME) and spinosad compared with the standard treatment of Min-U-Gel mixed with ME and naled (Dibrom). Our approach used a behavioral methodology for evaluation of slow-acting reduced-risk insecticides. ME treatments were weathered for 1, 7, 14, 21, and 28 d under operational conditions in California and Florida and shipped to Hawaii for bioassays. In field tests using bucket traps to attract and capture wild males, and in toxicity studies conducted in 1-m(3) cages using released males of controlled ages, STATIC Spinosad ME performed equally as well to the standard formulation of Min-U-Gel ME with naled for material aged up to 28 d in both California and Florida. In laboratory feeding tests in which individual males were exposed for 5 min to the different ME treatments, mortality induced by STATIC Spinosad ME recorded at 24 h did not differ from mortality caused by Min-U-Gel ME with naled at 1, 7, 14, and 21 d in California and was equal to or higher for all weathered time periods in Florida during two trials. Spinosad has low contact toxicity, and when mixed with an attractant and slow release matrix, offers a reduced-risk alternative for eradication of B. dorsalis and related ME attracted species, without many of the potential negative effects to humans and nontargets associated with broad-spectrum contact insecticides such as naled.

  12. Mortality and oviposition of western cherry fruit fly (Diptera: Tephritidae) exposed to different insecticide baits for varying periods in the presence and absence of food.

    Science.gov (United States)

    Yee, Wee L

    2011-02-01

    Spinosad bait is used to control western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), by killing flies before they oviposit. However, effects of different insecticide baits on management of reproductively mature flies are largely unknown. Objectives here were to determine mortality and oviposition of reproductively mature R. indifferens exposed to different insecticide baits for varying periods in the presence and absence of dried yeast extract and sucrose food. Spinosad bait (spinosad in a mix of protein, sugar, and other ingredients) was compared with acetamiprid, thiamethoxam, and imidacloprid in sucrose or Nu-Lure + sucrose bait. When flies were exposed to treatments and then offered cherries, Prunus avium (L.) L., for oviposition or when they were exposed to treatments and cherries simultaneously, both thiamethoxam bait and imidacloprid bait resulted in higher mortality and lower oviposition than spinosad bait and acetamiprid bait. Exposures to thiamethoxam bait and imidacloprid bait for six and 24 h were similarly effective, but 6-h exposures to spinosad bait and acetamiprid bait were less effective than 24-h exposures. There was little difference between sucrose and Nu-Lure + sucrose baits. When food was present, thiamethoxam bait and imidacloprid bait caused greater mortality and lower oviposition than spinosad bait and acetamiprid bait, but when food was absent, patterns were less consistent. Because of its ability to kill flies sooner after it is exposed to flies when food is present or absent, thiamethoxam or imidacloprid in sucrose or Nu-Lure bait may reduce infestations in cherries more than spinosad bait when mature R. indifferens are present in orchards.

  13. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira

    2013-09-01

    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  14. Identification and expression profiling of Ceratitis capitata genes coding for β-hexosaminidases.

    Science.gov (United States)

    Pasini, Maria E; Intra, Jari; Gomulski, Ludvik M; Calvenzani, Valentina; Petroni, Katia; Briani, Federica; Perotti, Maria Elisa

    2011-02-15

    The goal of this study was to identify the genes coding for β-N-acetylhexosaminidases in the Mediterranean fruit fly (medfly) Ceratitis capitata, one of the most destructive agricultural pests, belonging to the Tephritidae family, order Diptera. Two dimeric β-N-acetylhexosaminidases, HEXA and HEXB, have been recently identified on Drosophila sperm. These enzymes are involved in egg binding through interactions with complementary carbohydrates on the surface of the egg shell. Three genes, Hexosaminidase 1 (Hexo1), Hexosaminidase 2 (Hexo2) and fused lobes (fdl), encode for HEXA and HEXB subunits. The availability of C. capitata EST libraries derived from embryos and adult heads allowed us to identify three sequences homologous to the D. melanogaster Hexo1, Hexo2 and fdl genes. Here, we report the expression profile analysis of CcHexo1, CcHexo2 and Ccfdld in several tissues, organs and stages. Ccfdl expression was highest in heads of both sexes and in whole adult females. In the testis and ovary the three genes showed distinct spatial and temporal expression patterns. All the mRNAs were detectable in early stages of spermatogenesis; CcHexo2 and Ccfdl were also expressed in early elongating spermatid cysts. All three genes are expressed in the ovarian nurse cells. CcHexo1 and Ccfdl are stage specific, since they have been observed in stages 12 and 13 during oocyte growth, when programmed cell death occurs in nurse cells. The expression pattern of the three genes in medfly gonads suggests that, as their Drosophila counterparts, they may encode for proteins involved in gametogenesis and fertilization.

  15. Delivery of Nucleic Acids through Embryo Microinjection in the Worldwide Agricultural Pest Insect, Ceratitis capitata.

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca

    2016-10-01

    The Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is a pest species with extremely high agricultural relevance. This is due to its reproductive behavior: females damage the external surface of fruits and vegetables when they lay eggs and the hatched larvae feed on their pulp. Wild C. capitata populations are traditionally controlled through insecticide spraying and/or eco-friendly approaches, the most successful being the Sterile Insect Technique (SIT). The SIT relies on mass-rearing, radiation-based sterilization and field release of males that retain their capacity to mate but are not able to generate fertile progeny. The advent and the subsequent rapid development of biotechnological tools, together with the availability of the medfly genome sequence, has greatly boosted our understanding of the biology of this species. This favored the proliferation of new strategies for genome manipulation, which can be applied to population control. In this context, embryo microinjection plays a dual role in expanding the toolbox for medfly control. The ability to interfere with the function of genes that regulate key biological processes, indeed, expands our understanding of the molecular machinery underlying medfly invasiveness. Furthermore, the ability to achieve germ-line transformation facilitates the production of multiple transgenic strains that can be tested for future field applications in novel SIT settings. Indeed, genetic manipulation can be used to confer desirable traits that can, for example, be used to monitor sterile male performance in the field, or that can result in early life-stage lethality. Here we describe a method to microinject nucleic acids into medfly embryos to achieve these two main goals.

  16. 中国海南寡鬃实蝇属一新种(双翅目,实蝇科,寡鬃实蝇亚科)%A NEW SPECIES OF THE GENUS DACUS FABRICIUS (DIPTERA,TEPHRITIDAE, DACINAE) FROM HAINAN, CHINA

    Institute of Scientific and Technical Information of China (English)

    林明光; 汪兴鉴; 曾玲

    2011-01-01

    记述采自中国海南省双翅目Diptera实蝇科Tephritidae寡鬃实蝇属Dacus Fabricius l新种,二点棍腹实蝇Dacus(Callantra) bimaculatus sp.nov.,并提供其形态特征图.模式标本保存于海南出入境检验检疫局热带植物隔离检疫中心标本馆.%A new species of the genus Dacus Fabricius (Diptera,Tephritidae,Dacinae),D.(Calantra) bimaculatus sp.nov.,is described from the Hainan Province of China.The holotype is deposited in the Insect Museum,Center for Tropical Plant Quarantine,Hainan Entry-Exit Inspection and Quarantine Bureau,Haikou,China.

  17. DEZ ANOS DE PESQUISAS SOBRE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO ESTADO DO AMAPÁ: AVANÇOS OBTIDOS E DESAFIOS FUTUROS.

    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus

    2013-12-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p157-168

  18. Research progress on the bacterial and fungal symbionts in fruit flies( Diptera: Tephritidae)%实蝇共生菌研究进展

    Institute of Scientific and Technical Information of China (English)

    柳丽君; 李志红; 戴阳

    2011-01-01

    实蝇类昆虫(双翅目Diptera:实蝇科Tephritidae)是重要的农业害虫,为害农作物茎秆和水果,严重影响农业生产和果蔬贸易,被许多国家列为重要的检疫性有害生物.实蝇共生菌对宿主实蝇的取食、生殖、发育及环境适应能力具有重要作用.目前,已有21个属的共生细菌(Enterobacter、Klebsiellal、Citrobacter、Pseudomonas、Providencia、Erwinia、Acetobacter、Serratia、Proteus、Hafnia、Cedecea、Arthrobacter、Lactobacillus、Micrococcus、Streptococcus、Staphylococcus、Vibrio、Hafnia、Deinococcacea、Bacillus、Wolbachia)以及1个属的共生真菌(Candida)被鉴定.其中,肺炎杆菌Klebsiella pneumoniae、产酸克雷伯氏菌Klebsiella oxytoca、成团泛菌Papa agglomerans、费氏柠檬酸杆菌Citrobter freundii、阴沟肠杆菌Enterobacter cloacae和沃尔巴克氏体Wolbachia普遍存在于实蝇中且备受大家的关注.Wolbachia作为初级共生菌,主要分布于宿主的卵巢和产卵器中;其他次级共生菌则主要分布于宿主的消化道内.共生菌与宿主种群、宿主的地理分布、寄主植物以及宿主入侵能力之间的关系尚未明确.研究实蝇共生菌,对于发现新的实蝇诱饵,提高不育实蝇的环境适应性,以及提出新的实蝇防治技术具有重要意义.本文概述了实蝇共生菌的分布、种类、生物学特性、功能以及相关的研究方法,提出了研究中有待解决的问题,并探讨了下一步的研究热点.

  19. Identification of pheromone components and their binding affinity to the odorant binding protein CcapOBP83a-2 of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, P; He, X L; Woodcock, C; Pickett, J A; Field, L M; Birkett, M A; Kalinova, B; Gomulski, L M; Scolari, F; Gasperi, G; Malacrida, A R; Zhou, J J

    2014-05-01

    The Mediterranean fruit fly (or medfly), Ceratitis capitata (Wiedemann; Diptera: Tephritidae), is a serious pest of agriculture worldwide, displaying a very wide larval host range with more than 250 different species of fruit and vegetables. Olfaction plays a key role in the invasive potential of this species. Unfortunately, the pheromone communication system of the medfly is complex and still not well established. In this study, we report the isolation of chemicals emitted by sexually mature individuals during the "calling" period and the electrophysiological responses that these compounds elicit on the antennae of male and female flies. Fifteen compounds with electrophysiological activity were isolated and identified in male emissions by gas chromatography coupled to electroantennography (GC-EAG). Within the group of 15 identified compounds, 11 elicited a response in antennae of both sexes, whilst 4 elicited a response only in female antennae. The binding affinity of these compounds, plus 4 additional compounds known to be behaviourally active from other studies, was measured using C. capitata OBP, CcapOBP83a-2. This OBP has a high homology to Drosophila melanogaster OBPs OS-E and OS-F, which are associated with trichoid sensilla and co-expressed with the well-studied Drosophila pheromone binding protein LUSH. The results provide evidence of involvement of CcapOBP83a-2 in the medfly's odorant perception and its wider specificity for (E,E)-α-farnesene, one of the five major compounds in medfly male pheromone emission. This represents the first step in the clarification of the C. capitata and pheromone reception pathway, and a starting point for further studies aimed towards the creation of new powerful attractants or repellents applicable in the actual control strategies.

  20. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  1. Captures of wild Ceratitis capitata Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in traps with improved multi-lure TMR-Dispensers weathered in California

    Science.gov (United States)

    During 2012-2013 two “attract and kill” systems were weathered in California as potential detection and male annihilation treatments (MAT). Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide...

  2. Susceptibility of low-chill blueberry cultivars to Mediterranean fruit fly, oriental fruit fly, and melon fly (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Zee, Francis T; Hamasaki, Randall T; Hummer, Kim; Nakamoto, Stuart T

    2011-04-01

    No-choice tests were conducted to determine whether fruit of southern highbush blueberry, Vaccinium corymbosum L., hybrids are hosts for three invasive tephritid fruit flies in Hawaii. Fruit of various blueberry cultivars was exposed to gravid female flies of Bactrocera dorsalis Hendel (oriental fruit fly), Ceratitis capitata (Wiedemann) (Mediterranean fruit fly), or Bactrocera cucurbitae Coquillet (melon fly) in screen cages outdoors for 6 h and then held on sand in the laboratory for 2 wk for pupal development and adult emergence. Each of the 15 blueberry cultivars tested were infested by oriental fruit fly and Mediterranean fruit fly, confirming that these fruit flies will oviposit on blueberry fruit and that blueberry is a suitable host for fly development. However, there was significant cultivar variation in susceptibility to fruit fly infestation. For oriental fruit fly, 'Sapphire' fruit produced an average of 1.42 puparia per g, twice as high as that of the next most susceptible cultivar 'Emerald' (0.70 puparia per g). 'Legacy', 'Biloxi', and 'Spring High' were least susceptible to infestation, producing only 0.20-0.25 oriental fruit fly puparia per g of fruit. For Mediterranean fruit fly, 'Blue Crisp' produced 0.50 puparia per g of fruit, whereas 'Sharpblue' produced only 0.03 puparia per g of fruit. Blueberry was a marginal host for melon fly. This information will aid in development of pest management recommendations for blueberry cultivars as planting of low-chill cultivars expands to areas with subtropical and tropical fruit flies. Planting of fruit fly resistant cultivars may result in lower infestation levels and less crop loss.

  3. Efectos de la edad de la generación parental en la biología reproductiva de Ceratitis capitata Wied. (Diptera: Trypetidae)

    OpenAIRE

    Andrés, Mª.P.; Muñiz, Mariano

    1993-01-01

    Se ha realizado un estudio con parejas aisladas de Ceratitis capitata Wied. para determinar la influencia de la edad de los padres, tanto en la calidad de las pupas, fecundidad, fertilidad y longevidad de los adultos de la primera generación filial, como en el desarrollo larvario, actividad reproductora y eficacia biológica de los descendientes originados por adultos de edad avanzada en cuatro generaciones sucesivas. De los resultados obtenidos se deduce que la edad de los prog...

  4. 桔小实蝇在中国云南省的分布%DISTRIBUTION OF THE ORIENTAL FRUIT FLY (DIPTERA: TEPHRITIDAE) IN YUNNAN PROVINCE

    Institute of Scientific and Technical Information of China (English)

    叶辉

    2001-01-01

    The Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae), is a serious pest insect for vegetables and fruits in Yunnan Province. The trap experiments located in 12 counties of Yunnan indicated that, the geographical distribution of Oriental fruit fly there could be plotted as three distribution zones. To the south of Guannan, Yuanjiang and Rulin is the annual distribution zone. In this region, the Oriental fruit fly completed 4 - 5 generations per year, and infested the local vegetables and fruits all the year around. To the north of Luku, Dayiao and Qujing is the zone without the insect, where the Oriental fruit fly was not trapped and no fruits infested by the fly were found during the present study. The region between the above two zones was the seasonal distribution zone for the insect. The fruit fly occurred only during May to December in this area, and completed 2 - 3 generations in this period.The peak abundance of the oriental fruit fly took place from June in Jinghong to October in Yiaoan, along the altitude graduates from the south to the north. In elevation, the Oriental fruit fly was trapped at altitude of 500 - 2300 m above sea level, in which high trap catches appeared between 500 - 1 000 m. It is proposed that the variations of the fruit fly distribution in altitude and latitude are principally correlated with local temperatures and host plants.%在云南12个县的诱捕试验表明,桔小实蝇在云南的分布可以划分为3个区域.广南、元江和瑞丽以南的地区为该虫常年发生区.在该区域内,桔小实蝇年发生4-5代,可对瓜果形成周年危害.位于六库、大姚和曲靖以北的地区为该虫的非分布区.本试验未能在该地区诱捕到桔小实蝇或桔小实蝇受害果.位于上述两区域之间的区域为桔小实蝇季节性分布区.桔小实蝇在该地区年发生2-3代,出现于5-11月.桔小实蝇在分布区内不同地区的发生高峰期,由南向北

  5. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets

    Science.gov (United States)

    Background The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family ...

  6. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Directory of Open Access Journals (Sweden)

    Marco Salvemini

    Full Text Available The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  7. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Science.gov (United States)

    Salvemini, Marco; Arunkumar, Kallare P; Nagaraju, Javaregowda; Sanges, Remo; Petrella, Valeria; Tomar, Archana; Zhang, Hongyu; Zheng, Weiwei; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  8. Age-stage, two-sex life tables of Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) with a discussion on the problem of applying female age-specific life tables to insect populations

    Institute of Scientific and Technical Information of China (English)

    Yu-Bing Huang; Hsin Chi

    2012-01-01

    Age-stage,two-sex life tables of the melon fly,Bactrocera cucurbitae ( Coquillett) (Diptera:Tephritidae),reared on cucumber (Cucumis sativus L.),sponge gourd (Luffa cylindrica Roem) and a carrot medium (mashed Daucus carota L.mixed with sucrose and yeast hydrolysate) were constructed under laboratory conditions at 25 ± 1 ℃,65% ± 0.5%relative humidity,and a photoperiod 12 ∶ 12h (L ∶ D).The intrinsic rates of increase of B.cucurbitae were 0.144 6,0.141 2 and 0.068 8 days on cucumber,sponge gourd,and carrot medium,respectively.The highest net reproduction rate was 172 offspring per fly reared on sponge gourd.The mean generation times of B.cucurbitae ranged from 34 days reared on cucumber to 56 days reared on carrot medium.The life history raw data was analyzed using the traditional female age-specific life table and compared to results obtained using the age-stage,two-sex life table.When the age-specific female life table is applied to an age-stage-structured two-sex population,survival and fecundity curves will be improperly manipulated due to an inability to include variation in preadult development time.We discussed different interpretations of the relationship between the net reproductive rate and the intrinsic rate of increase to clarify possible misunderstanding in the literature.

  9. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  10. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2015-04-01

    Full Text Available Fruit flies (Diptera: Tephritidae are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas.

  11. Bioefficacy of Alpinia galanga (Zingiberaceae) rhizome extracts, (E)-p-acetoxycinnamyl alcohol, and (E)-p-coumaryl alcohol ethyl ether against Bactrocera dorsalis (Diptera: Tephritidae) and the impact on detoxification enzyme activities.

    Science.gov (United States)

    Sukhirun, N; Pluempanupat, W; Bullangpoti, V; Koul, O

    2011-10-01

    The application of insecticides to control oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae), is a principal component of the current management of these fruit flies. However, we evaluated four extracts of Alpinia galanga Wild Linn (Zingiberaceae) rhizomes against adult flies and found hexane and ethanol extracts to be most effective (LC50 = 4,866 and 6,337 ppm, respectively, after 24 h). This suggested that both nonpolar and polar compounds could be active in the candidate plant. Accordingly, the hexane extract was further processed to isolate nonpolar active compounds from this plant source. Two compounds, (E)-p-acetoxycinnamyl alcohol and (E)-p-coumaryl alcohol ethyl ether, were identified as active ingredients and found to be more active than total hexane extract (LC50 = 3,654 and 4,044 ppm, respectively, after 24 h). The data suggested that the compounds were not synergistic but may have some additive effect in a mixture. The activity of the hexane extract against detoxification enzymes, carboxylesterase (CE) and glutathione transferase (GST) also was determined in vitro. CE was inhibited by 70%, whereas GST was not significantly inhibited. Insect CEs mediate insecticide resistance via their induction; therefore, inhibition of these enzymes by plant allelochemicals could be a useful alternative approach for the management of the pest in the field.

  12. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  13. The significance of genetic polymorphisms within and between founder populations of Ceratitis capitata (Wied. from Argentina.

    Directory of Open Access Journals (Sweden)

    Alicia Basso

    Full Text Available BACKGROUND: The Mediterranean fruit fly Ceratitis Capitata (DIPTERA: Tephritidae is a major agricultural pest in Argentina. One main cause for the success of non-contaminant control programs based on genetic strategies is compatibility between natural and laboratory germplasms. A comprehensive characterization of the fruit fly based on genetic studies and compatibility analysis was undertaken on two founder populations from the provinces of Buenos Aires and Mendoza, used in pioneering sterile male technique control programmes in our country. The locations are 1,000 km apart from each other. METHODOLOGY/PRINCIPAL FINDINGS: We compared the genetic composition of both populations based on cytological, physiological and morphological characterization. Compatibility studies were performed in order to determine the presence of isolation barriers. Results indicate that the Buenos Aires germplasm described previously is partially different from that of the Mendoza population. Both laboratory colonies are a reservoir of mutational and cytological polymorphisms. Some sexual chromosome variants such as the XL and the YL resulting from attachment of a B-chromosome to the X-chromosome or Y-chromosome behave as a lethal sex-linked factor. Our results also show incompatibility between both germplasms and pre-zygotic isolation barriers between them. Our evidence is consistent with the fact that polymorphisms are responsible for the lack of compatibility. CONCLUSIONS: The genetic control mechanism should be directly produced in the germplasm of the target population in order to favour mating conditions. This is an additional requirement for the biological as well as economic success of control programs based on genetic strategies such as the sterile insect technique. The analysis of representative samples also revealed natural auto-control mechanisms which could be used in modifying pest population dynamics.

  14. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  15. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  16. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  17. Insecticide, Sugar and Diet Effects on Feeding and Mortality in Rhagoletis indifferens (Dipt., Tephritidae)

    Science.gov (United States)

    The effects of spinosad bait and various insecticides, the presence of sugar in insecticides, and diet on feeding responses and mortality in western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), were determined. Diet was defined as feeding on sugar only or yeast extract +...

  18. Sexual communication in Tephritidae-current knowledge and potential applications for integrated pest management

    Science.gov (United States)

    Diptera Tephritidae are an enormous threat to fruit and vegetable production throughout the world, causing both quantitative and qualitative losses. Investigating mating behavioural sequences could help to unravel mate choice dynamics, adding useful information to build behaviour-based control strat...

  19. Aggression in Tephritidae Flies: Where, When, Why? Future Directions for Research in Integrated Pest Management.

    Science.gov (United States)

    Benelli, Giovanni

    2014-12-30

    True fruit flies (Diptera: Tephritidae) include over 4000 species, many of which constitute enormous threats to fruit and vegetable production worldwide. A number of Tephritidae are lekking species, forming aggregations in which males fight to defend a small territory where they court females and mate. Male-male contests also occur in non-lekking species, characterized by resource defense polygyny. Tephritidae females display agonistic behavior to maintain single oviposition sites and reduce larval competition for food. Here, how, where, when and why aggressive interactions occur in Tephritidae flies is reviewed. A number of neglected issues deserving further research are highlighted, with a special focus on diel periodicity of aggression, cues evoking aggressive behavior, the role of previous experience on fighting success and the evolution of behavioral lateralization of aggressive displays. In the final section, future directions to exploit this knowledge in Integrated Pest Management, with particular emphasis on enhancement of Sterile Insect Technique and interspecific competitive displacement in the field are suggested.

  20. Effects of within-generation thermal history on the flight performance of Ceratitis capitata: colder is better.

    Science.gov (United States)

    Esterhuizen, Nanike; Clusella-Trullas, Susana; van Daalen, Corne E; Schoombie, Ruben E; Boardman, Leigh; Terblanche, John S

    2014-10-01

    The influence of thermal history on temperature-dependent flight performance was investigated in an invasive agricultural pest insect, Ceratitis capitata (Diptera: Tephritidae). Flies were exposed to one of four developmental acclimation temperatures (Tacc: 15, 20, 25, 30°C) during their pupal stage and tested at these temperatures (Ttest) as adults using a full-factorial study design. Major factors influencing flight performance included sex, body mass, Ttest and the interaction between Ttest and Tacc. Successful flight performance increased with increasing Ttest across all acclimation groups (from 10% at 15°C to 77% at 30°C). Although Tacc did not affect flight performance independently, it did have a significant interaction effect with Ttest. Multiple comparisons showed that flies which had been acclimated to 15°C and 20°C performed better than those acclimated to 25°C and 30°C when tested at cold temperatures, but warm-acclimated flies did not outperform cold-acclimated flies at warmer temperatures. This provides partial support for the 'colder is better' hypothesis. To explain these results, several flight-related traits were examined to determine whether Tacc influenced flight performance as a consequence of changes in body or wing morphology, whole-animal metabolic rate or cytochrome c oxidase enzyme activity. Although significant effects of Tacc could be detected in several of the traits examined, with an emphasis on sex-related differences, increased flight performance could not be explained solely on the basis of changes in any of these traits. Overall, these results are important for understanding dispersal physiology despite the fact that the mechanisms of acclimation-related changes in flight performance remain unresolved.

  1. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    Science.gov (United States)

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  2. Quarantine treatment against mediterranean fruit fly (Ceratitis capitata Wiedemann) in mangoes haden variety (Mangifera indica) with gamma irradiation (Co 60)

    OpenAIRE

    Peña C., María E.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Guillen E., Rafael; Servicio Nacional de Sanidad Agraria - SENASA.; Arias A., Gladys C.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Tephritidae fruit flies are among the most damaging pests of fruit crops worldwide Ceratitis capitata Wiedemann, for instance, can infest more than 250 fruit and vegetable crop species, and constitutes the main phytosanitary restrict for export purposes. The investigation was carried out in a SENASA’s Production Center of Sterile Fruit Flies and PIMU’s laboratory; it was supervised by an OIEA’s irradiation expert. This research comprised two stages: 1) Determine the minimum irradiation dose t...

  3. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  4. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  5. First register of fruit flies (Diptera: Tephritidae in star fruit in Teresina, Altos and Parnaiba, state of Piaui, Brazil/ Primeiro registro de moscas-das-frutas (Diptera: Tephritidae em carambola nos municípios de Teresina, Altos e Parnaíba no estado do Piauí

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo Soares

    2007-08-01

    Full Text Available The present work aims to register the occurrence of the fruit flies associated to star fruit (Averrhoa carambola L. in three counties of the state of Piaui, as well as to determine the frequency and the index of infestation of these insects. The fruits had been collected during the months of August and September 2005, and had been placed in plastic trays with sterilized soil, stored in metal cages, and left in environmental temperature at the laboratory. Until emergency, the adults had been kept in bottles with alcohol 70% and later identified in the species level. The biggest index of infestation (flies/fruit of C. capitata has occurred in the county of Altos (3.66, followed by Teresina and Parnaiba that had presented index of infestation of 2.18 and 0.016, respectively. C. capitata was the most frequent species in all the counties, presenting frequencies of 100%, 96.5%, and 100% in Teresina, Altos and Parnaiba, respectively. Ceratitis capitata is registered for the first time in star fruit in Teresina, Altos and Parnaiba, state of the Piaui. Anastrepha fraterculus is registered for the first time in the county of Altos. A. fraterculus and C. capitata occur simultaneously in star fruits.O presente trabalho visou conhecer as espécies de moscas-das-frutas associadas à carambola (Averrhoa carambola L. em três municípios do Estado do Piauí, bem como determinar a freqüência e o índice de infestação desses insetos. Os frutos foram coletados durante os meses de agosto e setembro de 2005, colocados em bandejas plásticas com solo esterilizado, armazenados em gaiolas metálicas e deixados em temperatura ambiente no laboratório. Até a emergência dos adultos, estes foram acondicionados em frascos contendo álcool 70% e posteriormente identificados em nível de espécie. O maior índice de infestação (moscas/fruto de C. capitata ocorreu no município de Altos (3,66, seguido pelos municípios de Teresina e Parnaíba que apresentaram

  6. 啤酒废酵母酶解生产橘小实蝇引诱蛋白研究%Production of Protein Bait for Bactrocera dorsalis ( Diptera: Tephritidae) by Using Beer Waste Yeast

    Institute of Scientific and Technical Information of China (English)

    杜迎刚; 李云玲; 季清娥

    2012-01-01

    [ Objective ] The aim was to optimize the production conditions of protein bait for Bactrocera dorsalis ( Diptera: Tephritidae) by u-sing beer waste yeast. [ Method] Production conditions of protein bait for Bactrocera dorsalis by using beer waste yeast like yeast concentration , enzyme amount, hydrolysis temperature, hydrolysis time, hydrolysis pH and hydrolysis product' pH were optimized with orthogonal design by outdoor small-cage bioassay. [Result] The best attractiveness to females and males could be attained with the processes that the third thickness mother beer waste yeast liquid was treated with 15.0 g/kg papain at 67. 5 ℃ and pH 6.5 for 27 and 24 hours, respectively. The bio-assays also showed that the protein hydrolysate with pH 8. 5 could reach its highest attractiveness. [ Conclusion] The research provides theoretical basis for the development of protein bait for Bactrocera dorsalis.%[目的]优化啤酒废酵母酶解生产橘小实蝇引诱蛋白的条件.[方法]采用室外小笼子生物测定法,通过正交试验设计对啤酒废酵母酶解生产橘小实蝇引诱蛋白的影响因素(酵母浓度、酶量、水解温度、水解时间、水解pH和水解产物pH)进行了优化.[结果]将酵母母液稀释3倍后加入15.0 g/kg木瓜蛋白酶,在pH 6.5、温度67.5℃条件下保温水解24 h得到的水解蛋白于pH 8.5时对橘小实蝇雄性的引诱活性最强,水解27 h对橘小实蝇雌性的引诱活性最强.[结论]为开发橘小实蝇蛋白诱剂提供了理论依据.

  7. Performance of a Genetically Modified Strain of the Mediterranean Fruit Fly (Diptera: Tephritidae) for Area-Wide Integrated Pest Management With the Sterile Insect Technique.

    Science.gov (United States)

    Ramírez-Santos, Edwin M; Rendón, Pedro; Ruiz-Montoya, Lorena; Toledo, Jorge; Liedo, Pablo

    2016-12-23

    The genetically modified strain of Ceratitis capitata (Wiedemann) VIENNA 8 1260 has two morphological markers that exhibit fluorescence in body and sperm. To assess the feasibility of its use in area-wide integrated pest management (AW-IPM) programs using the sterile insect technique, its rearing performance and quality control profile under small, medium, and large scales was evaluated, as well as in field cages. The VIENNA 8 1260 strain had a lower yield than the control strains, VIENNA 8 with D53 inversion (VIENNA 8) and without D53 inversion (VIENNA 8 D53-). At mass-rearing scale, yield gradually increased in three generations without reaching the control strain values. The VIENNA 8 1260 strain was stable in the genetic sexing mechanism (>99.9%) and expression of fluorescence (100%). In field cages, the VIENNA 8 1260 males reduced the mating potential of wild males in the same magnitude as the VIENNA 8, when evaluated in independent cage tests. However, the relative sterility index and the strain male relative performance index of VIENNA 8 1260 males were significantly lower than those of the VIENNA 8. There were no significant differences in longevity of these strains. The potential application of the VIENNA 8 1260 in AW-IPM programs is further discussed.

  8. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  9. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  10. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  11. Revised irradiation doses to control melon fly, Mediterranean fruit fly, and oriental fruit fly (Diptera: Tephritidae) and a generic dose for tephritid fruit flies.

    Science.gov (United States)

    Follett, Peter A; Armstrong, John W

    2004-08-01

    Currently approved irradiation quarantine treatment doses for Bactrocera cucurbitae (Coquillet), melon fly; Ceratitis capitata (Wiedemann), Mediterranean fruit fly; and Bactrocera dorsalis (Hendel), oriental fruit fly, infesting fruits and vegetables for export from Hawaii to the continental United States are 210, 225, and 250 Gy, respectively. Irradiation studies were initiated to determine whether these doses could be reduced to lower treatment costs, minimize any adverse effects on quality, and support a proposed generic irradiation dose of 150 Gy for fruit flies. Dose-response tests were conducted with late third instars of wild and laboratory strains of the three fruit fly species, both in diet and in fruit. After x-ray irradiation treatment, data were taken on adult emergence, and adult female fecundity and fertility. Melon fly was the most tolerant of the three species to irradiation, and oriental fruit fly was more tolerant than Mediterranean fruit fly. Laboratory and wild strains of each species were equally tolerant of irradiation, and larvae were more tolerant when irradiated in fruit compared with artificial diet. An irradiation dose of 150 Gy applied to 93,666 melon fly late third instars in papayas resulted in no survival to the adult stage, indicating that this dose is sufficient to provide quarantine security. Irradiation doses of 100 and 125 Gy applied to 31,920 Mediterranean fruit fly and 55,743 oriental fruit fly late third instars, respectively, also resulted in no survival to the adult stage. Results support a proposed generic irradiation quarantine treatment dose of 150 Gy for all tephritid fruit flies.

  12. Wing loading and extra loading capacity of adults of the Chinese citrus fruit fly, Bactrocera (Tetradacus) minax ( Diptera: Tephritidae)%柑橘大实蝇成虫的翅载和额外负载能力

    Institute of Scientific and Technical Information of China (English)

    黄秀琴; 李正跃; 李传仁; Gilles BOITEAU; 桂连友

    2012-01-01

    Effective management of the Chinese citrus fruit fly, Bactrocera ( Tetradacus) minax (Enderlein) ( Diptera: Tephritidae) , is hindered by a lack of knowledge about its movements. By measuring the wing loading and extra loading capacity of adults of the Chinese citrus fruit fly, we determined the effect of weight of extra loading electronic tags on the ratio of upward to downward flights of flies, in order to provide technical parameters for making the feasibility of electronic tag for tracking natural movement of B. minax using harmonic radar technology. The wing loading of the Chinese citrus fruit fly was found not to decrease with increasing size over a wide range of individual sizes and independent of sex. The results indicate that an average wing loading of adults of Chinese citrus fruit fly is about 11 mg after normal food uptake alternated with food deprivation (only water is supplied). It is estimated from our results in a large screened cage that 7. 3 mg ( representing about 23% of adult' s weight) extra loading for the technique has no or minimal impact on the number of upward flights of adults of Chinese citrus fruit fly. The results further suggest that when we determine the feasibility of tags for the tracking of natural movement of B. minax using harmonic radar technology, the weight of electronic tags should be no more than 7. 3 mg.%对柑橘大实蝇Bactrocera(Tetradacus)minax (Enderlein)的有效管理受阻于对其成虫运动行为的较少的认识.通过测定其成虫翅载能力和忍受额外负载重量的能力,从而确定其成虫所携带不同的额外负载的电子标签重量对其正常起飞的影响程度,为制作合适的昆虫谐波雷达的电子标签提供技术参数.其雌雄成虫的翅载能力并没有随着成虫个体重量增加而降低,也没有因为性别不同而存在差异.成虫经过正常取食和饥饿(只喂清水)变化处理,其成虫平均净载重量约为11 mg.来自网室成虫忍受额外负载

  13. The gene chip detection technique for the Mediterranean fly, Ceratitis capitata, and its related species (Diptera: Tephritidae)%地中海实蝇及其近缘种基因芯片检测研究

    Institute of Scientific and Technical Information of China (English)

    李文芬; 余道坚; 颜亨梅; 李建光; 徐浪; 任鲁风

    2008-01-01

    本研究选择线粒体DNA(mtDNA)细胞色素氧化酶Ⅰ基因(COⅠ)为分子标记基因,以双翅目实蝇科昆虫DNA序列为目标,建立了我国进境植物检疫害虫地中海实蝇Ceratitis capitata、芒果小条实蝇C.cosyra和纳塔尔小条实蝇C.rosa等生物芯片检测方法.地中海实蝇及其近缘种检测芯片由检测探针(实蝇科通用探针1条.小条实蝇属通用探针1条,地中海实蝇、芒果小条实蝇和纳塔尔小条实蝇近缘种探针2条和种特异探针4条)、质控探针(定位点探针、阳性质控、阴性质控和空白对照探针各1条)组成.芯片检测结果表明,检测探针特异性强,能实现上述3种实蝇的种类快速区分和准确鉴定;检测方法稳定性好,地中海实蝇不同虫态(卵、幼虫、蛹和成虫)和不同地理种群检测结果完全一致.地中海实蝇生物芯片检测技术将为我国进口果蔬中检疫性实蝇快速筛查和种类鉴定提供检测方法,同时,还可应用到其他属的实蝇以及相关害虫的检疫中,为有害生物的快速鉴定提供了新方法.

  14. Glycosidases in the plasma membrane of Ceratitis capitata spermatozoa.

    Science.gov (United States)

    Intra, Jari; De Caro, Daniela; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-02-01

    Fruit flies in the family Tephritidae are rated among the world's most destructive agricultural pests. The Mediterranean fruit fly Ceratitis capitata is emerging as a model organism to study the fertilization in Insects. Three integral proteins with glycosidase activity are present in the plasma membrane of spermatozoa. The glycosidases have been purified and characterized. We have demonstrated the presence of three enzymes, a β-N-acetylhexosaminidase, an α-mannosidase and an α-l-fucosidase. The molecular mass of the native enzymes estimated by gel filtration was 160 kDa for β-N-acetylhexosaminidase, 310 kDa for α-mannosidase and 140 kDa for α-l-fucosidase. SDS-PAGE showed that β-N-acetylhexosaminidase is a dimer of a single protein of 73 kDa, α-mannosidase consists of six subunits with different molecular weights and α-l-fucosidase is a dimer made up by two different monomers. Characterization of the purified enzymes included glycosylation pattern, pI, optimal pH, substrate preference, kinetic properties and thermal stability. Soluble forms similar to the sperm associated glycosidases are present. Polyclonal antibodies raised against synthetic peptides designed from the predicted products of the Drosophila melanogaster genes encoding β-N-acetylhexosaminidase and α-l-fucosidase were used. Immunofluorescence labelling of spermatozoa showed that the enzymes are present in the sperm plasma membrane overlying the acrosome and the tail. This work represents the first report on the characterization in C. capitata of sperm proteins that are potentially involved in primary gamete recognition.

  15. Aggression in Tephritidae Flies: Where, When, Why? Future Directions for Research in Integrated Pest Management

    Directory of Open Access Journals (Sweden)

    Giovanni Benelli

    2014-12-01

    Full Text Available True fruit flies (Diptera: Tephritidae include over 4000 species, many of which constitute enormous threats to fruit and vegetable production worldwide. A number of Tephritidae are lekking species, forming aggregations in which males fight to defend a small territory where they court females and mate. Male-male contests also occur in non-lekking species, characterized by resource defense polygyny. Tephritidae females display agonistic behavior to maintain single oviposition sites and reduce larval competition for food. Here, how, where, when and why aggressive interactions occur in Tephritidae flies is reviewed. A number of neglected issues deserving further research are highlighted, with a special focus on diel periodicity of aggression, cues evoking aggressive behavior, the role of previous experience on fighting success and the evolution of behavioral lateralization of aggressive displays. In the final section, future directions to exploit this knowledge in Integrated Pest Management, with particular emphasis on enhancement of Sterile Insect Technique and interspecific competitive displacement in the field are suggested.

  16. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    Science.gov (United States)

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  17. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  18. Biological control of olive fruit fly (Diptera: Tephritidae) by releases of Psyttalia cf. concolor (Hymenoptera: Braconidae) in California, parasitoid longevity in presence of the host, and host status of Walnut Husk Fly

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, Victoria Y., E-mail: vyokoyama@fresno.ars.usda.go [U.S. Department of Agriculture (USDA/ARS/SJVASC), Parlier, CA (United States). Agricultural Research Service. Subtropical Horticulture Research Station; Rendon, Pedro A., E-mail: prendon@aphisguate.co [U.S. Department of Agriculture (USDA/APHIS), Guatemala City (Guatemala). Center for Plant Health Science and Technology. Animal and Plant Health Inspection.; Sivinski, John, E-mail: jsivinski@gainesville.usda.ufl.ed [U.S. Department of Agriculture (USDA/ARS/CMAVE), Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural and Veterinary Entomology

    2006-07-01

    The larval parasitoid, Psyttalia cf. concolor, collected from tephritids infesting coffee in Kenya and reared on Mediterranean fruit fly, Ceratitis capitata Weidemann, in Guatemala by USDA-APHIS, PPQ, was imported into California for biological control of olive fruit fly, Bactrocera oleae (Gmelin), in olives, Olea europaea. Free releases of the parasitoids were made in olive trees infested with olive fruit fly at a coastal and inland valley location during the fall and early winter of 2005. The relative humidity during the releases was significantly higher at the coastal location. Mean percentage parasitism ranged from 0.5 to 4 and 1.5 to 30 at the coastal and inland valley locations respectively, based on same season recovery of the F1 generation. One parasitoid was found in infested olives in the next crop of the following year in San Jose. Survival of the parasitoid in the greenhouse in the presence of olive fruit fly infested olives was not significantly different than in the presence of non-infested olives. The greatest number of progeny was produced from female parasitoids that were 12-16 d old. In laboratory tests, a few individuals of the parasitoid successfully completed one life cycle in walnut husk fly, Rhagoletis completa Cresson, infested English walnuts, Juglans regia L. (author)

  19. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  20. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata.

    Science.gov (United States)

    de Souza, João Maria Gomes Alencar; de Lima-Filho, Paulo Augusto; Molina, Wagner Franco; de Almeida, Lúcia Maria; de Gouveia, Milson Bezerra; de Macêdo, Francisco Pepino; Laumann, Raul Alberto; Paranhos, Beatriz Aguiar Jordão

    2015-01-01

    The sterile insect technique (SIT) is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann): (1) wild males, (2) irradiated with Co-60 (steriles), and (3) irradiated (steriles) and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild), based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings' shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  1. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    João Maria Gomes Alencar de Souza

    2015-01-01

    Full Text Available The sterile insect technique (SIT is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann: (1 wild males, (2 irradiated with Co-60 (steriles, and (3 irradiated (steriles and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild, based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings’ shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  2. Male-specific phosphorylated SR proteins in adult flies of the Mediterranean fruitfly Ceratitis capitata.

    Science.gov (United States)

    Saccone, Giuseppe; Louis, Christos; Zhang, Hongyou; Petrella, Valeria; Di Natale, Manuela; Perri, Maria; Salvemini, Marco

    2014-01-01

    Alternative splicing is a widely used mechanism of gene regulation in sex determination pathways of Insects. In species from orders as distant as Diptera, Hymenoptera and Coleoptera, female differentiation relies on the activities of conserved splicing regulators, TRA and TRA-2, promoting female-specific expression of the global effector doublesex (dsx). Less understood is to what extent post-translational modifications of splicing regulators plays a role in this pathway. In Drosophila melanogaster phosphorylation of TRA, TRA-2 and the general RBP1 factor by the LAMMER kinase doa (darkener of apricot) is required for proper female sex determination. To explore whether this is a general feature of the pathway we examined sex-specific differences in phosphorylation levels of SR splicing factors in the dipteran species D. melanogaster, Ceratitis capitata (Medfly) and Musca domestica (Housefly). We found a distinct and reproducible pattern of male-specific phosphorylation on protein extracts enriched for SR proteins in C. capitata suggesting that differential phosphorylation may also contribute to the regulation of sex-specific splicing in the Medfly.

  3. Ammonia Formulations and Capture of Anastrepha Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted in numbers to protein baits. Synthetic lures based on the principle components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important ...

  4. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

    Science.gov (United States)

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  5. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  6. Managing the pepper maggot (Diptera: Tephritidae) using perimeter trap cropping.

    Science.gov (United States)

    Boucher, T Jude; Ashley, Richard; Durgy, Robert; Sciabarrasi, Michael; Calderwood, William

    2003-04-01

    A perimeter trap crop barrier of hot cherry peppers, border-row insecticide applications, and a combination of the two management strategies were evaluated to see if they could protect a centrally located main crop of bell peppers from oviposition and infestation by the pepper maggot, Zonosemata electa (Say). In large plots, the main cash crop of bell peppers was protected from the majority of the oviposition and infestation by all three barriers. The combination sprayed/trap crop barrier provided the best protection against both oviposition and infestation and resulted in over 98% pest-free fruit at harvest. Maggots infested only 1.7% of the main crop fruit when protected by a sprayed or unsprayed trap crop barrier, compared with 15.4% in control plots. The perimeter sprayed/trap crop strategy was employed in three commercial fields in 2000 and 2001. The combination barrier resulted in superior insect control and reduced insecticide use at all commercial locations, compared with the same farms' past history or to farms using conventional and integrated pest management (IPM) methods. Economic analysis showed that the technique is more cost effective and profitable than relying on whole-field insecticide applications to control the pepper maggot. Farmer users were surveyed and found the perimeter trap crop technique simple to use, with many hard-to-measure benefits associated with worker protection issues, marketing, personnel/management relations, pest control and the environment. Use of the perimeter trap crop technique as part of an IPM or organic program can help improve crop quality and overall farm profitability, while reducing pesticide use and the possibility of secondary pest outbreaks.

  7. The fruit flies (Tephritidae) of Ontario

    Science.gov (United States)

    Thirteen species of Tephritidae are newly recorded from Ontario, and alternative format keys are provided to the 31 genera and 72 species of fruit fly now known from, or likely to occur, in the province. Standard dichotomous keys to genera, and simplified field keys to genera and species are provide...

  8. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  9. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus.

  10. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  11. In vivo bioinsecticidal activity toward Ceratitis capitata (fruit fly) and Callosobruchus maculatus (cowpea weevil) and in vitro bioinsecticidal activity toward different orders of insect pests of a trypsin inhibitor purified from tamarind tree (Tamarindus indica) seeds.

    Science.gov (United States)

    Araújo, Carina L; Bezerra, Ingrid W L; Oliveira, Adeliana S; Moura, Fabiano T; Macedo, Leonardo L P; Gomes, Carlos E M; Barbosa, Aulus E A D; Macedo, Francisco P; Souza, Tánia M S; Franco, Octavio L; Bloch-J, Carlos; Sales, Mauricio P

    2005-06-01

    A proteinaceous inhibitor with high activity against trypsin-like serine proteinases was purified from seeds of the tamarind tree (Tamarindus indica) by gel filtration on Shephacryl S-200 followed by a reverse-phase HPLC Vidac C18 TP. The inhibitor, called the tamarind trypsin inhibitor (TTI), showed a Mr of 21.42 kDa by mass spectrometry analysis. TTI was a noncompetitive inhibitor with a Ki value of 1.7 x 10(-9) M. In vitro bioinsecticidal activity against insect digestive enzymes from different orders showed that TTI had remarkable activity against enzymes from coleopteran, Anthonomus grandis (29.6%), Zabrotes subfasciatus (51.6%), Callosobruchus maculatus (86.7%), Rhyzopertha dominica(88.2%), and lepidopteron, Plodia interpuncptella (26.7%), Alabama argillacea (53.8%), and Spodoptera frugiperda (75.5%). Also, digestive enzymes from Diptera, Ceratitis capitata (fruit fly), were inhibited (52.9%). In vivo bioinsecticidal assays toward C. capitata and C. maculatus larvae were developed. The concentration of TTI (w/w) in the artificial seed necessary to cause 50% mortality (LD50) of larvae was 3.6%, and that to reduce mass larvae by 50.0% (ED50) was 3.2%. Furthermore, the mass C. capitata larvae were affected at 53.2% and produced approximately 34% mortality at a level of 4.0% (w/w) of TTI incorporated in artificial diets.

  12. Cuticular hydrocarbons corroborate the distinction between lowland and highland Natal fruit fly (Tephritidae, Ceratitis rosa) populations

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ekesi, Sunday; Meyer, Marc De

    2015-01-01

    Abstract The cuticular hydrocarbons (CHs) and morphology of two Ceratitis rosa Karsch (Diptera: Tephritidae) populations, putatively belonging to two cryptic taxa, were analysed. The chemical profiles were characterised by two-dimensional gas chromatography with mass spectrometric detection. CHs of Ceratitis rosa that originated from the lowlands and highlands of Kenya comprised of n-alkanes, monomethylalkanes, dimethylalkanes and unsaturated hydrocarbons in the range of the carbon backbone from C14 to C37. Hydrocarbons containing C29, C31, C33 and C35 carbon atoms predominated in these two populations. 2-Methyltriacontane was the predominant compound in both populations. Quantitative differences in the distribution of hydrocarbons of different chain lengths, mainly the C22, C32, C33 and C34 compounds of these two populations, were observed despite indistinct qualitative differences in these hydrocarbons. Morphological analyses of male legs confirmed that the flies belong to different morphotypes of Ceratitis rosa previously labelled as R1 and R2 for lowland and highland populations, respectively. A statistical analysis of the CH compositions of the putative R1 and R2 species showed distinct interspecific identities, with several CHs specific for each of the lowland and highland populations. This study supports a hypothesis that the taxon Ceratitis rosa consists of at least two biological species. PMID:26798275

  13. The putative-farnesoic acid O-methyl transferase (FAMeT) gene of Ceratitis capitata: characterization and pre-imaginal life expression.

    Science.gov (United States)

    Vannini, Laura; Ciolfi, Silvia; Spinsanti, Giacomo; Panti, Cristina; Frati, Francesco; Dallai, Romano

    2010-02-01

    Farnesoic acid O-methyl transferase (FAMeT) is the enzyme involved in the penultimate step of insect juvenile hormone (JH) biosynthesis and is thus a key regulator in insect development and reproduction. We report the characterization of the putative-FAMeT in the medfly or Mediterranean fruit fly, Ceratitis capitata. This gene was identified by suppressive subtractive hybridization and completely sequenced by the screening of a medfly cDNA library. The obtained sequence was analyzed for conserved protein domain identification and its expression profile was evaluated by quantitative Real-Time PCR in medfly pre-imaginal life. The tissue expression of the isolated gene was verified by in situ hybridization on third instar larvae sections. The characterization of the isolated gene pointed out several typical features of methyl transferase genes. The pre-imaginal putative-FAMeT expression levels were consistent with JH titer change in Diptera. As recognized in some crustaceans, this gene seems to be widely expressed in the medfly as well. Ceratitis capitata is one of the most relevant agricultural pests against which insecticides and the sterile insect technique (SIT) are extensively used in spite of the well-known limitations of these approaches. Although results are not conclusive for the physiological role of the isolated gene, they suggest the characterization of a new gene in the Mediterranean fruit fly potentially involved in JH biosynthesis and may, therefore, have implications for pest control.

  14. СКЛЕРИТЫ И МУСКУЛАТУРА ГЕНИТАЛИЙ САМЦОВ ВЫСШИХ TEPHRITOIDEA (DIPTERA: TEPHRITIDAE, OTITIDAE, ULIDIIDAE И PLATYSTOMATIDAE)

    OpenAIRE

    ГАЛИНСКАЯ ТАТЬЯНА ВЛАДИМИРОВНА; ОВЧИННИКОВА ОЛЬГА ГЕОРГИЕВНА

    2015-01-01

    В статье рассматривается мускулатура гениталий мух надсемейства Tephritoidea, мускулатура генителай самцов была ранее изучена только у двух видов Tephritidae, у одного вида Platystomatidae, у одного вида Pallopteridae, и у трех видов Ulidiidae. Рассматриваются различные точки зрения на гомологию некоторых склеритов гениталий самцов Tephritoidea; изучение мускулатуры генитального аппарата....

  15. Anticancer properties of Thymbra capitata and Helichrysum italicum essential oils

    Directory of Open Access Journals (Sweden)

    Juliana Poças

    2014-06-01

    It has long been recognised that some EOs have antimicrobial, antibacterial, antioxidant, antiviral, antimycotic, antiparasitic, insecticidal activities. However, studies into their anti-tumoral activities are scarce. This study, indicates that Thymbra capitata and Helichrysum italicum EOs exhibited antitumor activity against RKO and MCF7 cells, deserving further research into both the mechanism of the observed anti-tumour activity and potential cancer therapeutic applications.

  16. Behavioral effects of plant essential oils on Ceratitis capitata males – risk versus reward

    Science.gov (United States)

    Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, these roles include male-targeted attractants for traps and aromatherapy exposure for increased mating success. Essential oils that affect C. capitata behavior may be from either host or non-host pl...

  17. Hypolipidemic effects of aqueous extract of Acalypha capitata leaves in rats fed on high cholesterol diet

    Institute of Scientific and Technical Information of China (English)

    Nnodim Johnkennedy; Emejulu Adamma; Nwadike Constance Nnedimma

    2011-01-01

    Objective:To evaluate the hypolipidemic effects of aqueous extract of Acalypha capitata (A. capitata) leaves in rats fed on high cholesterol diet. Methods:Cholesterol diet was administered to Wistar rats at a dose of 40 mg per 0.2 mL 3 times daily for 14 days while the control received distilled water. These animals were treated with extract of A. capitata at doses of 100 and 200 mg/kg. Lipid profiles were observed and compared. Results:Administration of A. capitata caused significant decrease in cholesterol, triglyceride and low density lipoprotein-cholesterol when compared with the control (P<0.05) which was dose dependent. Also, it was observed that high density lipoprotein-cholesterol was significantly increased when compared with the control. Conclusions:This observation suggests that the leaf extract of A. capitata could probably serve as a potential natural product for treatment of hyperlipidaemia.

  18. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes

    2003-01-01

    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  19. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate compounds caused 100% of mortality of immature stages and adults. The new insecticides showed more potential to substitute organophosphate compounds in bait sprays for adult control.

  20. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study was to determine the effect on the Anastrepha obliqua (Macquart, 1835 larvae performance of different kinds and amounts of carbohydrates in the diet. Larvae were individually reared until pupation in test tubes containing one of the artificial diets to be tested. The basic composition of the diets to be tested included 2.5 g agar, 3.25 g brewer's yeast and several different amounts of flour and sucrose. The suitability of the artificial diet for A. obliqua was tested evaluating the larvae and pupae survival (% and the larvae, pupae and larvae-adults periods of development. The diet containing flour (2 g and sucrose (2 g and the diet containing only sucrose (5.5 g have shown the best results regarding larval performance. All tested diets presented similar or superior results as compared to diets used in other studies. The importance of flour and its nutritional value for the larvae was discussed.

  1. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain information about the age of sexual maturation of A. sororcula in the laboratory and to describe its reproductive behavior. The males reached sexual maturity between 7 and 18 days after emergence, with most of the individuals becoming sexually mature between 10 and 13 days of age. They exhibited signalling behavior to the females, characterized by the distension of the pleural area of the abdomen, forming a small pouch on each side, and by the protrusion of a tiny membranous pouch of rectal cuticle that surrounds the anal area. During this display, the males produced rapid movements of vibration of the wings, producing audible sounds. A droplet was liberated from the anal area during the vibration movements of the wings. After attracting the females, the males accomplished a series of elaborated movements of courtship behavior. The females reached sexual maturation between 14 and 24 days after emergence, with the majority becoming sexually mature at 19 days. The daily exhibition of sexual activities was confined almost exclusively to the period of 16:00-17:30h. A. sororcula presented a sharp protandry pattern.

  2. The preparation of the rice coral Montipora capitata nubbins for application in coral-reef ecotoxicology.

    Science.gov (United States)

    Vijayavel, K; Richmond, R H

    2012-04-01

    Securing adequate and appropriate source material for coral-reef ecotoxicology studies is a significant impediment to conducting various experiments supporting the goal of conserving coral-reef ecosystems. Collecting colonies from wild stocks may be counter to protecting coral reef populations. To address this issue the rice coral Montipora capitata was used to generate sufficient genetically identical nubbins for research purposes. Growth and survival rates of these laboratory-prepared M. capitata nubbins were studied over a period of 90 days. The resulting data support the conclusion that the laboratory-prepared M. capitata nubbins showed successful growth and survival rates and are the best solution to solve the source material issue for lab experimentation. This paper describes the laboratory method used for the preparation and maintenance of these M. capitata nubbins and discusses the benefits and difficulties of using these nubbins in ecotoxicity studies.

  3. Isolation and characterization of microsatellite loci in tropical forage Stylosanthes capitata Vogel.

    Science.gov (United States)

    Santos, M O; Sassaki, R P; Chiari, L; Resende, R M S; DE Souza, A P

    2009-01-01

    Stylosanthes capitata is an important tropical pasture legume. Knowledge of genetic diversity and structure of S. capitata populations is of great importance for the conservation and germplasm management of this species. Thus, eight microsatellite markers were developed from an S. capitata-enriched library. They were characterized in 20 accessions from the germplasm collection of the Empresa Brasileira de Pesquisa Agropecuária (Embrapa). The observed and expected heterozygosities ranged from 0.16 to 0.85 and from 0.40 to 0.85, respectively. These microsatellites are the first set of molecular markers from this species and will contribute towards studies of genetic diversity, conservation and breeding of S. capitata.

  4. 实蝇科昆虫交配行为的研究进展%Review of reproductive behavior in the family Tephritidae

    Institute of Scientific and Technical Information of China (English)

    周鹏; 杨洪; 金道超

    2015-01-01

    实蝇科隶属双翅目,寄主范围广,其中250 余种实蝇具有经济意义,很多种类具有入侵性,是一类危害严重的农业害虫.本文综述了实蝇科昆虫的求偶场(lek)行为、交配行为、性选择、多重交配、精子竞争,交配行为对引诱剂和SIT应用的影响等,并对研究中存在的问题和进一步研究的方向进行了讨论.%The insect family Tephritidae, belonging to the order Diptera, has a wide host plant range. More than 250 species are economically important. Many species are invasive. This paper reviews the advances in the research on the insects' lek behavior, mating behavior, sexual selection, multiple mating and sperm com-petition. It also investigates the impact of cure lure on the mating behavior and the influence of the mating be-havior on the effectiveness of Sterile Insect Technique (SIT) . The paper also discusses the existing problems and the directions for future research.

  5. Caracterização química da amêndoa de coquinho-azedo (Butia capitata var capitata Chemical characterization of nut of Butia capitata var capitata

    Directory of Open Access Journals (Sweden)

    Juliana Pereira Faria

    2008-06-01

    Full Text Available A palmeira Butia capitata var capitata produz o coquinho-azedo, fruto de odor agradável e penetrante, cuja polpa é aproveitada para a produção de um suco saboroso na região norte de Minas Gerais. As sementes apresentam uma amêndoa cuja exploração ainda é bastante limitada. O objetivo deste trabalho foi determinar a composição da amêndoa do coquinho-azedo, visando a avaliar suas possibilidades de uso. Na amêndoa, a composição química (umidade, proteínas, lipídios, cinzas e fibras foi determinada por métodos gravimétricos. Os teores dos principais minerais foram avaliados por espectrofotometria de emissão atômica com fonte de plasma indutivo, e a composição dos ácidos graxos presentes na gordura da semente foi determinada por cromatografia a gás. A amêndoa do coquinho-azedo apresentou 9,9 % de umidade e 57,8 % de lipídios totais, 25,8 % de fibra detergente neutro, 17,6 % de fibra detergente ácido e 1,6 % de cinzas em base seca. A gordura extraída da amêndoa de coquinho-azedo apresentou elevados teores de ácido láurico (42,1 %, que foi seguido pelo ácido oléico (16,9 %. Predominaram os ácidos graxos saturados (78,9 %, principalmente os de cadeia média (C6-C12.The Butia capitata palm tree produce a very aromatic fruit named "coquinho-azedo", which freeze pulp is frequently used to produce agreeable juice in north of Minas Gerais, Brazil. "Coquinho-azedo" kernel contains a nut that is not frequently explored. The purpose of the present study was the chemical characterization of "coquinho-azedo" nut to evaluate the possibilities of its use. The moisture, lipids, ash and fiber contents were determined by gravimetric methods. The mineral profile was characterized by inductively coupled plasma spectrophotometer and the fatty acids profile was characterized by gas chromatography. The coquinho-azedo nut presented 9,9 % of moisture, 57,8 % of total lipid, 25,8 % of neutral detergent fiber, 17,6 % of acid detergent fiber

  6. Nonhost status of mangosteen to Bactrocera dorsalis and Bactrocera carambolae (Diptera:Tephritidae) in Thailand

    Science.gov (United States)

    Postharvest quarantine treatments (irradiation or vapor heat) are used to control fruit flies and other pests in mangosteen (Garcinia mangostana L) exported to the United States and Japan from Thailand. No-choice tests were conducted in the laboratory to determine whether Thai mangosteen is a host f...

  7. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  8. Determination of lipase activity in the larval midgut of Bacterocera oleae Gmelin (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    S Delkash-Roudsari

    2014-02-01

    Full Text Available In the current study, digestive lipase activity was determined and characterized in the third larval instars of olive fly, Bactericera oleae as the first time in dipteran order. By using two sample fractions, it was found that the enzyme had higher activity in membrane-bound fraction than that of soluble fraction. Optimal pH of soluble lipase was found to be 4 and 6 but membrane-bound lipase showed pH 4 as optimal value. Optimal temperatures for soluble and membrane-bound lipase were obtained to be 35 and 50 °C, respectively. Activities of digestive soluble and membrane-bound lipases decreased by using various mono- and di-valent ions. Since, fruits of olive are full of various oils, digestive lipases of B. oleae larvae have critical role in their digestion. So, these enzymes might be a good target for developing inhibitors and resistant varieties.

  9. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae)

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  10. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  11. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  12. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  13. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  14. Oral and Topical Toxicity of Fipronil to Melon Fly and Oriental Fruit Fly (Diptera: Tephritidae)

    Science.gov (United States)

    BACKGROUND: The objective of this study was to develop basic oral and topical toxicity data for Fipronil in Solulys protein bait to wild melon fly, Bactrocera cucurbitae (Coquillett) and the oriental fruit fly, Bactrocera dorsalis (Hendel). RESULTS: For the oral study, both females and males were ...

  15. Habitat-specific flight period in the cherry fruit fly Rhagoletis cingulata (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Teixeira, Luís A F; Isaacs, Rufus; Gut, Larry J

    2007-12-01

    Flight periods of the cherry fruit fly, Rhagoletis cingulata (Loew), were compared in the major sweet and tart cherry-growing regions of Michigan, among neglected orchards, managed orchards, and natural areas containing the ancestral host, black cherry. Traps were deployed from early June to late September 2005 and 2006. Captures indicated that cherry fruit fly has an early flight (June-July) in neglected orchards, a mid-season flight peaking immediately after harvest (June-August) in managed orchards, and an extended flight covering most of the season (June-September) in natural areas. We found that the period of fruit infestation mirrored the flight period in neglected and managed orchards. In natural areas, we found infestation late in the season only. The relative emergence periods for adults reared from pupae collected from the three habitats and maintained under the same conditions coincided with adult flight periods for each habitat. We also studied factors related to fruit availability that may have a role in shaping the flight periods. Fruit abundance decreased rapidly early in the season in neglected orchards, whereas in managed orchards, fruit left after harvest remained on the trees until late August. Measurements of fruit size and skin firmness revealed that fly activity in neglected and managed orchards began immediately after fruit increased in size and skin firmness decreased, whereas in natural areas, the flight began before fruit matured. In managed orchards, fruit harvest and insecticide sprays likely maintain the late flight period of resident fly populations by preventing the use of fruit earlier in the season. However, a significant proportion of these resident flies may still emerge before harvest and increase the risk of costly fruit infestation.

  16. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  17. Higher phylogeny of frugivorous flies (Diptera, Tephritidae, Dacini): localised partition conflicts and a novel generic classification.

    Science.gov (United States)

    Virgilio, Massimiliano; Jordaens, Kurt; Verwimp, Christophe; White, Ian M; De Meyer, Marc

    2015-04-01

    The phylogenetic relationships within and among subtribes of the fruit fly tribe Dacini (Ceratitidina, Dacina, Gastrozonina) were investigated by sequencing four mitochondrial and one nuclear gene fragment. Bayesian, maximum likelihood and maximum parsimony analyses were implemented on two datasets. The first, aiming at obtaining the strongest phylogenetic signal (yet, having lower taxon coverage), consisted of 98 vouchers and 2338 concatenated base pairs (bp). The second, aiming at obtaining the largest taxonomic coverage (yet, providing lower resolution), included 159 vouchers and 1200 concatenated bp. Phylogenetic relationships inferred by different tree reconstruction methods were largely congruent and showed a general agreement between concatenated tree topologies. Yet, local conflicts in phylogenetic signals evidenced a number of critical sectors in the phylogeny of Dacini fruit flies. All three Dacini subtribes were recovered as monophyletic. Yet, within the subtribe Ceratitidina only Perilampsis and Capparimyia formed well-resolved monophyletic groups while Ceratitis and Trirhithrum did not. Carpophthoromyia was paraphyletic because it included Trirhithrum demeyeri and Ceratitis connexa. Complex phylogenetic relationships and localised conflict in phylogenetic signals were observed within subtribe Dacina with (a) Dacus, (b) Bactrocera (Zeugodacus) and (c) all other Bactrocera species forming separate clades. The subgenus Bactrocera (Zeugodacus) is therefore raised to generic rank (Zeugodacus Hendel stat. nov.). Additionally, Bactrocera subgenera grouped under the Zeugodacus group should be considered under new generic combinations. Although there are indications that Zeugodacus and Dacus are sister groups, the exact relationship between Zeugodacus stat. nov., Dacus and Bactrocera still needs to be properly resolved.

  18. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  19. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  20. Novel toxicity of Bacillus thuringiensis strains against the melon fruit fly, Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Shishir, Md Asaduzzaman; Akter, Asma; Bodiuzzaman, Md; Hossain, M Aftab; Alam, Md Musfiqul; Khan, Shakil Ahmed; Khan, Shakila Nargis; Hoq, M Mozammel

    2015-01-01

    Bactrocera cucurbitae (melon fruit fly) is one of the most detrimental vegetable-damaging pests in Bangladesh. The toxicity of Bacillus thuringiensis (Bt) has been reported against a few genera of Bactrocera in addition to numerous other insect species. Bt strains, harbouring cry1A-type genes were, therefore, assayed in vivo against the 3(rd) instar larvae of B. cucurbitae in this study. The biotype-based prevalence of cry1 and cry1A genes was calculated to be 30.8% and 11.16%, respectively, of the test strains (n=224) while their prevalence was greatest in biotype kurstaki. Though three indigenous Bt strains from biotype kurstaki with close genetic relationship exhibited higher toxicity, maximum mortalities were recorded for Btk HD-73 (96%) and the indigenous Bt JSc1 (93%). LC50 and LC99 values were determined to be 6.81 and 8.32 for Bt JSc1, 7.30 and 7.92 for Bt SSc2, and 6.99 and 7.67 for Btk HD-73, respectively. The cause of toxicity and its variation among the strains was found to be correlated with the synergistic toxic effects of cry1, cry2, cry3 and cry9 gene products, i.e. relevant Cry proteins. The novel toxicity of the B. thuringiensis strains against B. cucurbitae revealed in the present study thus will help in developing efficient and eco-friendly control measures such as Bt biopesticides and transgenic Bt cucurbits.

  1. Host-plant finding by the asparagus fly, Plioreocepta poeciloptera (Diptera: Tephritidae), a monophagous, monovoltine tephritid.

    Science.gov (United States)

    Thibout, E; Pierre, D; Mondy, N; Lecomte, C; Biémont, J C; Auger, J

    2005-10-01

    The role of various olfactory and visual stimuli was studied in host-plant finding by the asparagus fly Plioreocepta poeciloptera (Schrank), a monophagous monovoltine tephritid causing serious damage to asparagus spears. Volatiles released by asparagus plants were extracted by diethyl ether after cryotrapping concentration, and identified by gas chromatography-mass spectrometry. Twelve of the 13 compounds identified were tested using electroantennography to measure the response of the fly. Behavioural response was analysed using two different flight tunnels according to circadian rhythm, age and sex of adults, presence of the plant and of different coloured lures, presence of a male congener, or exposure to four pure asparagus odour compounds that elicited responses in electroantennography, i.e. hexanal, (E)-2-hexenal, (Z)-2-hexen-1-ol and decanal. Data showed that males locate the host plant more quickly than females. Females are attracted mainly by the blend of plant odour and male pheromone. Both sexes respond to a complex of stimuli only during the afternoon. These findings will be helpful in developing new and effective approaches to control this pest insect.

  2. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  3. Volatile host fruit odors as attractants for the oriental fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Cornelius, M L; Duan, J J; Messing, R H

    2000-02-01

    We examined the responses of oriental fruit flies, Bactrocera dorsalis Hendel, to the odors of different stages and types of fruit presented on potted trees in a field cage. Females were most attracted to odors of soft, ripe fruit. Odors of common guava were more attractive to females than papaya and starfruit, and equally as attractive as strawberry guava, orange, and mango. In field tests, McPhail traps baited with mango, common guava, and orange captured equal numbers of females. Traps baited with mango were compared with 2 commercially available fruit fly traps. McPhail traps baited with mango captured more females than visual fruit-mimicking sticky traps (Ladd traps) and equal numbers of females as McPhail traps baited with protein odors. Results from this study indicate that host fruit volatiles could be used as lures for capturing oriental fruit flies in orchards.

  4. A new species and new records of Cryptodacus (Diptera: Tephritidae) from Colombia, Bolivia and Peru

    Science.gov (United States)

    Cryptodacus bernardoi Rodriguez & Rodriguez, new species, is described from Colombia. It was reared from fruits of Phoradendron sp. near piperoides (Kunth) Trel. New distribution records are reported for Cryptodacus ornatus Norrbom from Colombia and Peru, for Cryptodacus trinotatus Norrbom & Korytko...

  5. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  6. Populations of Bactrocera oleae (Diptera: Tephritidae) and Its Parasitoids in Himalayan Asia

    Science.gov (United States)

    For a biological control program against olive fruit fly, Bactrocera oleae Rossi, olives were collected in the Himalayan foothills (China, Nepal, India, and Pakistan) to discover new natural enemies. Wild olives, Olea europaea ssp. cuspidata (Wall ex. G. Don), were sparsely distributed and fly-infes...

  7. New species of Rhagoletotrypeta (Diptera: Tephritidae) from the Dominican Republic and southern Brazil and Paraguay

    Science.gov (United States)

    Rhagoletotrypeta chapecensis Norrbom & Savaris, new species, and R. gelabertae Norrbom & Savaris, new species, are described and illustrated from specimens from southern Brazil (Paraná, Santa Catarina) and Paraguay, and from the Dominican Republic, respectively. The larvae of R. chapecensis develop ...

  8. Male Fruit Fly, Bactrocera tau (Diptera; Tephritidae) attractants from Elsholtzia pubescens Bth

    NARCIS (Netherlands)

    Hasyim, A.; Muryati,; Mizu Istianto,; Kogel, de W.J.

    2007-01-01

    Studies on the ability of different plant extracts to attract male fruit flies indicated that an extract of Elsholtzia pubescens attracted male Bactrocera tau fruit flies in Passion fruit orchards in West Sumatra, Indonesia. Analyses of the plant extract showed that the major compound present was Ca

  9. Host susceptibility of citrus cultivars to Queensland fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Lloyd, A C; Hamacek, E L; Smith, D; Kopittke, R A; Gu, H

    2013-04-01

    Citrus crops are considered to be relatively poor hosts for Queensland fruit fly, Bactrocera tryoni (Froggatt), as for other tephritid species. Australian citrus growers and crop consultants have reported observable differences in susceptibility of different citrus cultivars under commercial growing conditions. In this study we conducted laboratory tests and field surveys to determine susceptibility to B. tryoni of six citrus cultivars [(Eureka lemon (Citrus limon (L.) Osbeck); Navel and Valencia oranges (C. sinensis (L.) Osbeck); and Imperial, Ellendale, and Murcott mandarins (C. reticulata Blanco). The host susceptibility of these citrus cultivars was quantified by a Host Susceptibility Index, which is defined as the number of adult flies produced per gram of fruit infested at a calculated rate of one egg per gram of fruit. The HSI was ranked as Murcott (0.083) > Imperial (0.052) > Navel (0.026) - Ellendale (0.020) > Valencia (0.008) > Eureka (yellow) (0.002) > Eureka (green) (0). Results of the laboratory study were in agreement with the level of field infestation in the four citrus cultivars (Eureka lemon, Imperial, Ellendale, and Murcott mandarins) that were surveyed from commercial orchards under baiting treatments against fruit flies in the Central Burnett district of Queensland. Field surveys of citrus hosts from the habitats not subject to fruit fly management showed that the numbers of fruit flies produced per gram of fruit were much lower, compared with the more susceptible noncitrus hosts, such as guava (Psidium guajava L.), cherry guava (P. littorale Raddi), mulberry (Morus nigra L.), loquat (Eriobotrya japonica (Thunb.) Lindl.), and pear (Pyrus communis L.). Therefore, the major citrus crops commercially cultivated in Australia have a relatively low susceptibility to B. tryoni, with Eureka lemons being a particularly poor host for this tephritid fruit fly.

  10. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  11. Reproductive maturity of cherry fruit fly (Diptera: Tephritidae) in managed and natural habitats.

    Science.gov (United States)

    Teixeira, Luís A F; Gut, Larry J; Isaacs, Rufus; Alston, Diane G

    2009-08-01

    We studied the timing of reproductive maturity of cherry fruit fly, Rhagoletis cingulata (Loew), a key pest of sweet and tart cherries in the eastern United States. To determine when cherry fruit fly females become reproductively mature in managed and natural habitats, we deployed traps in sweet and tart cherry orchards and nearby stands of the ancestral host tree, black cherry. Flies were removed from the traps and females were dissected to determine the presence of fully developed eggs. We found that capture of reproductively mature female flies occurred earlier in orchards that are not sprayed with insecticides than in sprayed orchards or in black cherry tree sites. In addition, the gap between the flights of immature and mature females in unmanaged sweet or tart cherry orchards was shorter than in managed orchards or black cherry tree sites. We also determined fruit color, size, and skin hardness to characterize the progression of fruit maturity. We found that fruit became mature earlier in sweet and tart cherry orchards than in black cherry tree sites. This study indicates that the timing of female reproductive maturity is plastic and varies among cherry fruit fly populations present in distinct habitats. Variation in the timing of reproductive maturity is related to the fruit maturity period of distinct host plant species and to orchard management.

  12. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Narit Thaochan

    2015-12-01

    Full Text Available The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering and Bactrocera tryoni (Froggatt, was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria which was prominent in all clones. The total bacterial community consisted of Proteobacteria (more than 75% of clones, except in the crop of B. cacuminata where more than 50% of clones belonged to Firmicutes. Firmicutes gave the number of the secondary community structure in the fly’s gut. Four orders, Alpha-, Beta-, Delta- and Gammaproteobacteria and the phyla Firmicutes and Actinobacteria were found in both fruit fly species, while the order Epsilonproteobacteria and the phylum Bacteroidetes were found only in B. tryoni. Two phyla, Actinobacteria and Bacteroidetes, were rare and less frequent in the flies. There was a greater diversity of bacteria in the crop of the two fruit fly species than in the midgut. The midgut of B. tryoni females and the midgut of B. cacuminata males had the lowest bacterial diversity.

  13. Fruit fly (Diptera: Tephritidae) host status determination: critical conceptual, methodological, and regulatory considerations.

    Science.gov (United States)

    Aluja, Martín; Mangan, Robert L

    2008-01-01

    Although fruit fly host status determination/designation lies at the heart of strategic decisions on national and international trade of fruit and vegetables, all attempts thus far to define host plant status have been contentious and as a result long-standing disputes between commercial partners throughout the world have lingered over decades. Part of the problem is that too little effort has been devoted to understanding the underlying mechanisms involved in host plant use by fruit flies and that instead economic and political interests usually prevail. Here we review the most important evolutionary, biological, ecological, physiological, and behavioral aspects that drive host use by fruit flies, and then construct a flow diagram rooted in these fundamentals that outlines a series of steps and definitions to determine if a particular fruit or vegetable (and cultivars thereof) is a natural host, or a conditional (potential, artificial) host, or a nonhost. Along the way, we incorporate risk analysis considerations and propose that the underlying complexity determining host plant utilization by fruit flies requires a flexible systems approach capable of realistically dealing with fly/host/environment/geographic variability on a case-by-case basis.

  14. Potential geographical distribution of Rhagoletis pomonella (Diptera: Tephritidae)in China

    Institute of Scientific and Technical Information of China (English)

    Jian Geng; Zhi-Hong Li; Edwin G. Rajotte; Fang-Hao Wan; Xiao-Yu Lu; Zhi-Ling Wang

    2011-01-01

    Apple maggot fly, Rhagoletis pomonella (Walsh) is a major pest causing considerable economic losses of fruits in North America. During the development of international trade, apple maggot fly has become a threat to Chinese agriculture. In this study, CLIMEX and ArcGIS were used to predict the potential geographical distribution of apple maggot fly in China. The parameters used in CLIMEX for apple maggot fly were derived from ecological data and the present geographical distribution of apple maggot fly in North America. Then the potential distribution map in China was presented based on the adjusted values of these parameters. The results showed that apple maggot fly has a wide potential distribution area in China; 47.5% of 748 meteorological stations presented high or medium suitability of pest establishment. These high suitable stations are mainly located in northeast, southwest and northwest of China, such as Liaoning, Shandong,Gansu and Shaanxi Provinces. These areas are also the central regions of apple, pear and peach production in China. Two hundred and twenty-five stations (30.1%) in western and southern China, such as Tibet, Qinghai, Guangdong, Guangxi, Hainan and Taiwan,were unsuitable for establishment of apple maggot fly populations. In order to prevent the introduction of apple maggot fly in China, the present plant quarantine measures should be enhanced, especially in the areas with high suitability for the presence of apple maggot fly.

  15. Overwintering survival of olive fruit fly (Diptera: Tephritidae) and two introduced parasitoids in California.

    Science.gov (United States)

    Wang, Xin-Geng; Levy, Karmit; Nadel, Hannah; Johnson, Marshall W; Blanchet, Arnaud; Argov, Yael; Pickett, Charles H; Daane, Kent M

    2013-06-01

    The overwintering survival and development of olive fruit fly, Bactrocera oleae (Rossi), and the endoparasitoids, Psyttalia humilis Silvestri and P. lounsburyi (Silvestri), were investigated at sites in California's interior valley and coastal region. In the interior valley, adult flies survived up to 4-6 mo during the winter when food was provided. Adult female flies could oviposit in late fall and early winter on nonharvested fruit and, although egg survival was low (0.23-8.50%), a portion of the overwintered cohort developed into adults the following spring; percentage of survival was negatively correlated to daily minimum temperature. P. humilis and P. lounsburyi successfully oviposited into host larvae in late fall, and their progeny developed into adults the following spring, although with a low percentage (0-11.9%) survivorship. Overwintering survival of puparia of the olive fruit fly and immature larvae of P. humilis and P. lounsburyi (inside host puparia), buried in the soil, were tested at an interior valley and coastal site. Survival of olive fruit fly ranged from 0 to 60% and was affected by the trial date and soil moisture. Overwintering survival of both the fruit fly and tested parasitoids was lower at the colder interior valley than the coastal site; P. humilis immature stages had the highest mortality levels while B. oleae pupae had the lowest mortality levels. The spring emergence pattern of the tested insects was well predicted by a degree-day model. We discuss factors potentially impeding establishment of introduced olive fruit fly parasitoids in California and elsewhere.

  16. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  17. Paraffin wax emulsion for increased rainfastness of insecticidal bait to control Rhagoletis pomonella (Diptera: Tephritidae).

    Science.gov (United States)

    Teixeira, Luís A F; Wise, John C; Gut, Larry J; Isaacs, Rufus

    2009-06-01

    In regions with a humid summer climate, the use of water-soluble bait to control apple maggot is often limited by rainfall. We studied increasing the rainfastness of GF-120 fruit fly bait by adding paraffin wax emulsion. First, we verified that adding 10% wax to a mixture containing 16.7% GF-120 did not reduce the mortality of female apple maggot compared with GF-120 without wax. In addition, we determined that fly mortality caused by GF-120 plus wax subjected to simulated rain was similar to that caused by GF-120 without wax not subjected to rain. Other assays showed that higher fly mortality resulted from increasing the proportion of wax from 10 to 15%, and lower mortality resulted from decreasing GF-120 from 16.7 to 10 or 5%. The availability of spinosad on or near droplets of a mixture consisting of 5, 10, or 15% GF-120 and 15% wax was determined before and after the droplets were subjected to three 15-min periods of simulated rain. We found an initial steep decline in dislodgeable spinosad and smaller decreases after subsequent periods of rain. In a small-plot field trial, fruit infestation by apple maggot in plots treated with a mixture consisting of 16.7% GF-120 and 19.2% wax was less than in plots treated with 16.7% GF-120 without wax but not less than in control plots. Overall, we found that adding paraffin wax emulsion to GF-120 increased rainfastness in laboratory bioassays, and specifically that it retained the active ingredient spinosad. However, our field data suggest that optimal rainfastness requires the development of mixtures with > 19.2% wax, which may preclude application using standard spray equipment.

  18. Population dynamics of safflower capsule flies (Diptera: Tephritidae in Kohgiluyeh safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2015-08-01

    Full Text Available Oilseeds such as flax, canola, safflower, soybean and sunflower, which are annual plants, provide the world’s major source of vegetable oils, although the highest oil yield comes from oil-bearing tree fruits. One of the most popular oil seeds is safflower (Carthamus tinctorius L., which belongs to the Asteraceae family. Due to the ability of this plant to grow in dry and semi-dry conditions, safflower oil has the potential to be a commercially profitable product in Iran. Seasonal populations of safflower capsule flies were studied in Kohgiluyeh safflower farms, Iran, from March to May in 2008 and 2009. Four yellow sticky traps were used to monitor populations of fruit flies in the safflower farms. Traps were checked once a week during the sampling period. The traps were emptied weekly into insect collection vials containing 70% ethanol. Data were analysed with a two-way ANOVA. The relation between abiotic factors and species abundance was analysed with multiple linear regression. The results emphasized that Acanthiophilus helianthi was the most serious pest of safflower under the ecological conditions found in Gachsaran, being present in the field throughout three months of the year (March to May. Chaetorellia carthami was present in safflower fields from March to May, but in significant numbers only during April and May. Terellia luteola was present in safflower fields from March to May and in significant numbers only in late April, it does not seem to be a serious pest in safflower farms under Gachsaran’s ecological conditions.

  19. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  20. A new species and new records of Cryptodacus (Diptera: Tephritidae) from Colombia, Bolivia and Peru.

    Science.gov (United States)

    Rodriguez, Pedro Alexander; Rodriguez, Erick J; Norrbom, Allen L; Arévalo, Emilio

    2016-05-16

    Cryptodacus bernardoi Rodriguez & Rodriguez, new species, is described from Colombia. It was reared from fruits of Phoradendron sp. near piperoides (Kunth) Trel. New distribution records are reported for Cryptodacus ornatus Norrbom from Colombia and Peru, for Cryptodacus trinotatus Norrbom & Korytkowski from Colombia, and for Cryptodacus obliquus Hendel from Bolivia and Peru. The female abdomen and terminalia of C. obliquus is described for the first time. The Norrbom & Korytkowski (2008)`s key to species was modified to include C. bernardoi n. sp.

  1. Analyses of volatiles produced by the African fruit fly species complex ( Diptera , Tephritidae )

    OpenAIRE

    Břízová, Radka; Vaníčková, Lucie; Faťarová, Mária; Ekesi, Sunday; Hoskovec,Michal; Kalinová, Blanka

    2015-01-01

    Abstract Ceratitis fasciventris , Ceratitis anonae and Ceratitis rosa are polyphagous agricultural pests originating from the African continent. The taxonomy of this group (the so-called Ceratitis FAR complex) is unclear. To clarify the taxonomic relationships, male and female-produced volatiles presumably involved in pre-mating communication were studied using comprehensive two-dimensional gas chromatography with time-of-flight mass spectrometry (GC×GC-TOFMS) followed by multivariate analysi...

  2. Ketertarikan Bactrocera carambolae (Diptera: Tephritidae pada Senyawa Volatil Olahan Limbah Kakao

    Directory of Open Access Journals (Sweden)

    Dyah Rini Indriyanti

    2013-03-01

    Full Text Available Tanaman kakao (Theobroma cacao menghasilkan biji. Biji ditutupi oleh pulp pada saat dipanen, kemudian difermentasi selama tiga hari untuk diambil biji kakao dan dihasilkan limbah cair. Penelitian ini bertujuan untuk menguji ketertarikan lalat buah pada olahan limbah kakao dan mengidentifikasi senyawa kimia volatil yang menarik lalat buah. Penelitian dilakukan di laboratorium, dimulai dari pengolahan limbah kakao, pengujian ketertarikan B. carambolae pada limbah dan mengidentifikasi senyawa volatil olahan limbah kakao. Hasil penelitian menunjukkan bahwa jantan dan betina B. carambolae tertarik pada limbah. Olahan limbah kakao berisi berbagai senyawa volatil yakni: amonia; etil-2-hidroksi propanoat ; 7-dodesenil asetat; senyawa asetamida; 3,5-dihidroksi-2-metil-5,6-dihidropiran; hidroksi metilfurfurol; dan derivat-1-undekuna.The cocoa plants (Theobroma cacao produce seeds. The seeds are covered by pulp when it is harvested. Then these seeds were fermented for three days to transform them becoming cocoa seeds and the fermentation would produce liquid wastes. The study aims to test the attractiveness of fruit flies to the processed liquid cocoa wastes and to identify the chemical compounds which attract fruit flies. The study was conducted in the laboratory, beginning from the processing of cocoa wastes, the testing of the attractiveness of B. carambolae to wastes and to identify the chemical compounds of the processed cocoa wastes. The result showed that males and females B. carambolae were attracted to the wastes.The processed cocoa wastes contain various chemical compounds, i.e. ammonia; ethyl-2-hydroxy propanoate; 7-dodecenyl acetate; acetamide compounds; 3,5 dihydroxy-2-methyl-5,6-dihydropyrane; hydroxyl methylfurfurol; and 1-undecyne derivates.

  3. Laboratory longevity and competitiveness of Dacus ciliatus Loew (Diptera: Tephritidae) following sub-sterilizing gamma irradiation.

    Science.gov (United States)

    Nemny-Lavy, E; Nestel, D; Rempoulakis, P

    2016-06-01

    The effect of a sub-sterilizing gamma radiation dose on Dacus ciliatus adults was investigated to assess the suitability of the sterile insect technique (SIT) as an alternative method to control this pest. Late pupae (48 h prior to adult emergence) from a laboratory strain were irradiated with 120 Gy of gamma rays emitted by a 60Co source. Following adult emergence, the mortality of irradiated and non-irradiated cohorts was recorded. Over a period of 50 days after emergence, no significant negative effects of irradiation upon the longevity of male or female laboratory flies were observed. A laboratory competitiveness study (Fried test), using irradiated laboratory and wild males at a ratio of 3:1 was conducted to assess the ability of irradiated males to reduce the egg hatch rates of a wild population. The overall competitiveness was found to be ca. 0.32, suggesting a reduced, but satisfactory, quality of irradiated laboratory as compared with wild males. Based on the above findings, we calculated and proposed effective male release ratios for field application of SIT against D. ciliatus.

  4. Effect of Low-Temperature Phosphine Fumigation on the Survival of Bactrocera correcta (Diptera: Tephritidae).

    Science.gov (United States)

    Liu, Tao; Li, Li; Zhang, Fanhua; Gong, Shaorun; Li, Tianxiu; Zhan, Guoping; Wang, Yuejin

    2015-08-01

    This laboratory-based study examined the effects of low-temperature phosphine fumigation on the survival of the eggs and larvae of the guava fruit fly, Bactrocera correcta (Bezzi). Individual flies at different developmental stages, from 6-h-old eggs to third instars, were exposed to 0.92 mg/liter phosphine for 1-7 d at 5°C. We found that 12-h-old eggs and third instars were the most tolerant to phosphine. Increasing phosphine concentrations from 0.46 to 4.56 mg/liter increased mortality in these two stages. However, increased exposure times were required to achieve equal mortality rates in 12-h-old eggs and third instars when phosphine concentrations were ≥4.56 and ≥3.65 mg/liter, respectively. C(n)t = k expression was obtained at 50, 90, and 99% mortality levels, and the toxicity index (n) ranged from 0.43 to 0.77 for the two stages. The synergistic effects of a controlled atmosphere (CA) with elevated CO(2) levels were also investigated, and we found that a CO(2) concentration between 10% and 15% under CA conditions was optimal for low-temperature phosphine fumigation.

  5. Bacterial communities associated with invasive populations of Bactrocera dorsalis (Diptera: Tephritidae) in China.

    Science.gov (United States)

    Liu, L J; Martinez-Sañudo, I; Mazzon, L; Prabhakar, C S; Girolami, V; Deng, Y L; Dai, Y; Li, Z H

    2016-12-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) is a destructive insect pest of a wide range of fruits and vegetables. This pest is an invasive species and is currently distributed in some provinces of China. To recover the symbiotic bacteria of B. dorsalis from different invasion regions in China, we researched the bacterial diversity of this fruit fly among one laboratory colony (Guangdong, China) and 15 wild populations (14 sites in China and one site in Thailand) using DNA-based approaches. The construction of 16S rRNA gene libraries allowed the identification of 24 operational taxonomic units of associated bacteria at the 3% distance level, and these were affiliated with 3 phyla, 5 families, and 13 genera. The higher bacterial diversity was recovered in wild populations compared with the laboratory colony and in samples from early term invasion regions compared with samples from late term invasion regions. Moreover, Klebsiella pneumoniae and Providencia sp. were two of the most frequently recovered bacteria, present in flies collected from three different regions in China where B. dorsalis is invasive. This study for the first time provides a systemic investigation of the symbiotic bacteria of B. dorsalis from different invasion regions in China.

  6. Phylogenetic relationships between flies of the Tephritinae subfamily (Diptera, Tephritidae) and their symbiotic bacteria.

    Science.gov (United States)

    Mazzon, Luca; Martinez-Sañudo, Isabel; Simonato, Mauro; Squartini, Andrea; Savio, Claudia; Girolami, Vincenzo

    2010-07-01

    The Tephritinae is considered the most specialized subfamily of fruit flies, predominantly infesting flowerheads of Asteraceae. Some species are known to host specific non-culturable symbiont bacteria ("Candidatus Stammerula spp.") in the midgut. In this work we (i) examined the phylogenetic relationships among the insect hosts, (ii) investigated the presence of bacteria in other hitherto unexamined species, and (iii) evaluated the phylogenetic congruence between insects and symbionts. A total of 33 Tephritinae species in 17 different genera were analyzed. Two regions of the mitochondrial DNA (16S rDNA and COI-tRNALeu-COII) were examined in the insect host, while the 16S was analyzed in the bacteria. From the phylogenetic trees, four of the five tribes considered were statistically supported by each of the clustering methods used. Species belonging to the tribe Noeetini never clustered at significant levels. The phylogenetic COI-tRNALeu-COII tree showed internal nodes more highly supported than the 16S phylogeny. The analysis of the distribution of symbiosis across the subfamily has highlighted the presence of bacteria only in the tribe Tephritini and in the genus Noeeta from the tribe Noeetini. A cophylogenetic analysis revealed a substantial congruence between hosts and symbionts. The interesting exceptions can be justified by events like losses, duplications and hosts switching opportunities, which are likely to arise during the biological cycle of the fly in consideration of the extracellular status of these symbionts.

  7. A new species of Molynocoelia Giglio-Tos (Diptera: Tephritidae) from Ecuador

    Science.gov (United States)

    Molynocoelia erwini, a new species of fruit fly from Ecuador is described and illustrated. It differs from its previously known congeners in wing pattern (not banded, distal half brown), scutal and scutellar markings, and male femoral setation....

  8. Methods to Break Seed Dormancy of Rhynchosia capitata, a Summer Annual Weed Métodos para Romper la Dormancia de Rhynchosia capitata, una Maleza Anual de Verano

    Directory of Open Access Journals (Sweden)

    Hafiz Haider Ali

    2011-09-01

    Full Text Available Dormancy of weed seeds is a significant feature contributing to their survival rate since it helps the weeds to avoid herbicides and other weeding practices along with unfavorable environmental conditions. We investigated the effects of different dormancy breaking treatments on the germination of Rhynchosia capitata, a common summer annual weed, which is emerging as a weed threat in Pakistan. Seeds were soaked in thiourea, KNO3, HCl, HNO3, and H2SO4, and they were also mechanically scarified (sandpaper. Results indicated that R. capitata seeds show signs of physical dormancy that is mainly due to the impermeability of their coat. Mechanical scarification and acid scarification (soaking of seeds in H2SO4 for 60 and 80 min and in HCl for 12 and 15 h were very efficient in breaking dormancy and promoting germination. Seed soaking in HNO3 for 1 to 5 d showed little effect whereas various concentrations of thiourea and KNO3 were ineffective in breaking R. capitata seed dormancy.La dormancia seminal de las malezas es un rasgo significativo contribuyente a su tasa de supervivencia, puesto que ayuda a las malezas a evitar herbicidas y otras prácticas de desmalezado junto con condiciones ambientales desfavorables. Investigamos los efectos de diferentes tratamientos para romper dormancia sobre la germinación de Rhynchosia capitata, una maleza anual estival común en Paquistán. Las semillas se sumergieron en tiourea, KNO3, HCl, HNO3 y H2SO4 y además fueron escarificadas mecánicamente (papel lija. Los resultados indicaron que las semillas de R. capitata muestran signos de dormancia física principalmente debido a impermeabilidad de su cubierta. Escarificación mecánica y ácida (inmersión de semillas en H2SO4 por 60 y 80 min y en HCl por 12 y 15 h fueron muy eficientes para romper dormancia y promover germinación. Las semillas sumergidas en HNO3 por 1 a 5 días mostraron poco efecto, mientras diversas concentraciones de tiourea y KNO3 fueron

  9. Susceptibility of the Mediterranean fruit fly (Ceratitis capitata) and the Natal fruit fly (Ceratitis rosa) to entomopathogenic nematodes.

    Science.gov (United States)

    Malan, Antoinette P; Manrakhan, Aruna

    2009-01-01

    The potential of entomopathogenic nematodes, Heterorhabditis bacteriophora, Heterorhabditis zealandica and Steinernema khoisanae, to infect pupariating larvae, pupae and adults of Ceratitis capitata and Ceratitis rosa was investigated in laboratory bioassays. Pupariating larvae and adult flies were susceptible to nematode infection, with no infection recorded for the pupae. Pupariating larvae of C. capitata were generally more susceptible to infection than those of C. rosa. Significantly more larvae of C. capitata were infected by H. bacteriophora. For C. rosa, highest infectivity of larvae was obtained with H. zealandica. In contrast, adults of both species were highly infected by S. khoisanae.

  10. Laboratory evaluation of the chemosterilant lufenuron against Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons.

    Science.gov (United States)

    Four species of tephritid fruit flies, Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons were evaluated for toxic, developmental, and physiological responses to the chemosterilant lufenuorn incorporated in an agar adult diet and a liquid larval diet. No significant mortality o...

  11. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Directory of Open Access Journals (Sweden)

    Nagwa Mohamed Ammar

    2014-06-01

    Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  12. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Institute of Scientific and Technical Information of China (English)

    Nagwa Mohamed Ammar; Mohammed Said Hefnawy; Sahar Youssef Al-Okbi; Doha Abdou Mohamed; Nabil Khamis El-Sayed; Amira Ahmed El-Anssary; Tom Mabry

    2014-01-01

    Objective: To study the antioxidant and anti-inflammatory activity of Butia capitata (B. capitata) leaf extracts along with phytochemical analysis of the proposed bioactive constituents.Methods:organic solvents and screened for their anti-inflammatory activities in tested animals and in-vitro antioxidant effect. An extensive phytochemical investigation of the bioactive extracts through paper chromatography, thin layer chromatography, column chromatography, gas-liquid chromatography (GLC), high pressure liquid chromatography and spectral analysis. GC-Mass, ultraviolet, hydrogen and carbon nuclear magnetic resonance, electron ionization-mass spectrometry, heteronuclear multiple bond correlation and heteronuclear multiple quantum correlation were carried out.Results:Results showed that different extracts possess promising antioxidant effect and Different successive extracts of B. capitata Becc. leaves were prepared with selective significant anti-inflammatory activity with variable degrees. The results of the phytochemical investigation of the bioactive extracts revealed the presence of volatile substances, lipoidal matter, α-tocopherol, free sugars, polysaccharides and flavonoidal compounds.Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  13. Invasive infection due to Saprochaete capitata in a young patient with hematological malignancies

    Science.gov (United States)

    Parahym, Ana Maria Rabelo de Carvalho; Rolim, Pedro José; da Silva, Carolina Maria; Domingos, Igor de Farias; Gonçalves, Sarah Santos; Leite, Edinalva Pereira; de Morais, Vera Lúcia Lins; Macêdo, Danielle Patrícia Cerqueira; de Lima, Reginaldo Gonçalves; Neves, Rejane Pereira

    2015-01-01

    We report a case of invasive infection due to Saprochaete capitata in a patient with hematological malignancies after chemotherapy treatment and empiric antifungal therapy with caspofungin. Although severely immunocompromised the patient survived been treated with amphotericin B lipid complex associated with voriconazole. PMID:26273269

  14. Soil application of Beauveria bassiana to control Ceratitis capitata in semi field conditions.

    Science.gov (United States)

    Ali, Ali; Sermann, Helga; Lerche, Sandra; Büttner, Carmen

    2009-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) is a highly polyphagous pest of economic importance cultures in Syria, as in many other parts of the world. The potential of the entomopathogenic fungus Beauveria bassiona BALS (VUIL.) strain 412 against adults of Mediterranean fruit fly C. capitata was evaluated in semi field conditions during the summer. Soil (5-7 cm high) was filled into plastic container (27 cm x 32 cm). In one container 75 pupae, two days before emergency, were spread uniformly on the soil. Then the pupae were covered with soil (4-5 cm layer). After that, 30 ml suspension of fungal spores (4 x 10(8) spores/ml) was applied to the soil surface using a dash bottle. This corresponded to a spore density of 1.3 x 10(7) spores/cm2 on soil. Water and food (1:4 yeast, sucrose) were placed in the cages for the emerged flies. The semi-field evaluation of B. bassiana revealed a fly mortality of about 46% compared to 16% in the control. In addition 72% of dead flies were moulded in the treatment. These results indicated that the entomopathogenic fungus B. bassiana was pathogen against the adults of C. capitata not only in the laboratory condition but also under field condition. That means B. bassiana could decrease the offspring of C. capitata. Therefore B. bassiana could be an effective factor to control C. capitata in combination with other control methods, used in IPM program in the field.

  15. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 3.0

    Science.gov (United States)

    The Mediterranean fruit fly (Medfly), Ceratitis capitata (Wiedemann), causes direct damage to fruits and vegetables through oviposition and larval feeding. Rigorous quarantine procedures are currently enforced to prevent domestic and transnational spread of Medfly. Accessible and reliable informatio...

  16. Effects of parental age on the fecundity, fertility and longevity of the Mediterranean fruit fly, Ceratitis capitata Wied.

    OpenAIRE

    Muñiz, M.

    1986-01-01

    Investigations with single pair mating have been conducted in order to study the influence of parental age on the adult progeny's longevity and reproductive parameters of t he Mediterranean fruit fly, Ceratitis capitata Wied.

  17. Generation and characterization of Brassica rapa ssp. pekinensis – B. oleracea var. capitata monosomic and disomic alien addition lines

    Indian Academy of Sciences (India)

    Ai xia Gu; Shu Xing Shen; Yan Hua Wang; Jian Jun Zhao; Shu Xin Xuan; Xue Ping Chen; Xiao Feng Li; Shuang Xia Luo; Yu Jing Zhao

    2015-09-01

    Five monosomic alien addition lines (MAALs) of Brassica rapa ssp. pekinensis – B. oleracea var. capitata were obtained by hybridization and backcrossing between B. rapa ssp. pekinensis (female parent) and B. oleracea var. capitata. The alien linkage groups were identified using 42 B. oleracea var. capitata linkage group-specific markers as B. oleracea linkage groups C2, C3, C6, C7 and C8. Based on the chromosomal karyotype of root tip cells, these five MAALs added individual chromosomes from B. oleracea var. capitata: chr 1 (the longest), chr 2 or 3, chr 5 (small locus of 25S rDNA), chr 7 (satellite-carrying) and chr 9 (the shortest). Five disomic alien addition lines were then generated by selfing their corresponding MAALs.

  18. Diets based on soybean protein for Mediterranean fruit fly

    Energy Technology Data Exchange (ETDEWEB)

    Sobrinho, Raimundo Braga [Embrapa Agroindustria Tropical, Rua Dra. Sara Mesquita, 2270, CEP 60511-110 Fortaleza, CE (Brazil)]. E-mail: braga@cnpat.embrapa.br; Caceres, Carlos; Islam, Amirul; Wornoayporn, Vivat [Food and Agriculture Organization (FAO), International Atomic Energy Agency (IAEA), Agriculture and Biotechnology Laboratory, A-2444 Seibersdorf (Austria)]. E-mail: C.Caceres@iaea.org; Enkerlin, Walter [Insect Pest Control Section, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, Vienna (Austria)]. E-mail: W.Enkerlin@iaea.org

    2006-04-15

    The objective of this work was to develop suitable and economic diets for mass rearing Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae). Diets containing sugar beet bagasse, wheat bran, brewer yeast, and others with wheat bran and palletized soybean protein from Brazil were tested. Diets based on soybean protein have shown promising results regarding pupal recovery, pupal weight and adult emergence. Soybean bagasse in the form of pellets with 60% of protein can be a very important substitute for other expensive sources of protein. (author)

  19. SYSTEMATIC STUDIES IN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, PAPILLIFERAE AND MICROPHYLLAE ESTUDIOS SISTEMÁTICOS EN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, MICROPHYLEAE Y PAPILLIFERAE

    Directory of Open Access Journals (Sweden)

    María Mercedes Arbo

    2010-11-01

    Full Text Available

    Turnera L. includes around 100 American species and two African ones, arranged in nine series. In this paper, the following four series embracing 21 species are revised: Annulares, Capitatae, Microphyllae and Papilliferae. Six new taxa are described: Thatschbachii, Thatschbachii var. miniata, Tmaracasana,and T.princeps of the seriesCapitatae, Tasymmetrica of the series Microphyllae, and Tcaatingana of the series Papilliferae. The species of these four series share the common features of simple and glandular hairs, generally well-developed floral peduncle, absent pedicel, linear or elliptic prophylls, generally warty or granulate fruit, and a floral tube, appendicular in nature, in that it is the product of the fusion of the lower part of the calyx and corolla, with the staminal filaments adnate only at the base. In the series Annulares,
    Microphyllae and Papilliferae the leaves and young stems are fragrant, the scent being produced by the glandular hairs, and the floral peduncle is shortly adnate to the petiole. Three
    series, Annulares, Capitatae and Microphyllae, have leaves with generally well developed stipules and a disjunct geographical distribution. The series Annulares and Capitatae have nectaries and villous or hirsute styles, while Microphyllae and Papilliferae lack nectaries and their styles are glabrous or somewhat pilose. In some species of Microphyllae the staminal filaments are joined at the base, forming an annular structure 0,05-0,50 mm high. The seeds are peculiar in Annulares, being very short, with a central, prominent and slightly concave chalaza. In the series Capitatae, the flowers are gathered in short, capitate inflorescences, the length of the peduncles being variable or sometimes wanting, and the seeds are obovoid, reticulate or striate. The leaves of Microphyllae are small, with the stipules adnate to the foliar
    base; setiform glandular hairs, similar to those of

  20. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  1. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  2. Inter-specific coral chimerism: Genetically distinct multicellular structures associated with tissue loss in Montipora capitata

    Science.gov (United States)

    Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.

    2011-01-01

    Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  3. Inter-specific coral chimerism: genetically distinct multicellular structures associated with tissue loss in Montipora capitata.

    Directory of Open Access Journals (Sweden)

    Thierry M Work

    Full Text Available Montipora white syndrome (MWS results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR, while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata. Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  4. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  5. Sensitivity of Ceratitis capitata eggs irradiated in artificial diet and in mango fruits; Sensibilidade de ovos de Ceratitis capitata (WIED.,1824) irradiados em dieta artificial e em frutos de manga (Mangifera indica L.)

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Yasuoka, S.T.; Amorim, E.O.; Sato, M.E.; Suplicy Filho, N. [Instituto Biologico, Campinas, SP (Brazil); Faria, J.T. de [Delegacia Federal de Agricultura, Sao Paulo, SP (Brazil)

    1996-01-01

    The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four-, and forty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of Haden, Tommy and Keith cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67 Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation. (author). 11 refs., 3 tabs.

  6. Global establishment risk of economically important fruit fly species (Tephritidae).

    Science.gov (United States)

    Qin, Yujia; Paini, Dean R; Wang, Cong; Fang, Yan; Li, Zhihong

    2015-01-01

    The global invasion of Tephritidae (fruit flies) attracts a great deal of attention in the field of plant quarantine and invasion biology because of their economic importance. Predicting which one in hundreds of potential invasive fruit fly species is most likely to establish in a region presents a significant challenge, but can be facilitated using a self organising map (SOM), which is able to analyse species associations to rank large numbers of species simultaneously with an index of establishment. A global presence/absence dataset including 180 economically significant fruit fly species in 118 countries was analysed using a SOM. We compare and contrast ranked lists from six countries selected from each continent, and also show that those countries geographically close were clustered together by the SOM analysis because they have similar fruit fly assemblages. These closely clustered countries therefore represent greater threats to each other as sources of invasive fruit fly species. Finally, we indicate how this SOM method could be utilized as an initial screen to support prioritizing fruit fly species for further research into their potential to invade a region.

  7. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  8. Effect of the essential volatile oils isolated from Thymbra capitata (L. Cav. on olive and sunflower oils

    Directory of Open Access Journals (Sweden)

    Pedro, L.

    2003-09-01

    Full Text Available The chemical composition of the volatile constituents of the oils isolated from different parts of Thymbra capitata collected at different developmental stages were analysed by GC and GC/MS. The antioxidant ability of the oils isolated from T. capitata was evaluated determining the peroxide values, on olive and sunflower oils, stored at 60 ºC. These peroxide values were compared with those obtained when BHT, carvacrol and control (without adding antioxidants were used and subjected to the same conditions. The best yield oil was obtained from the whole aerial part of T. capitata collected during the flowering phase. The major component of the oils was carvacrol. Relative high amounts of p-cymene, γ-terpinene and β-caryophyllene were also found. BHT revealed to be the best antioxidant when the olive oil was used. On sunflower oil, the antioxidant ability of BHT was not so evident, being the carvacrol-rich essential oils of T. capitata or carvacrol more important antioxidants.Se analizaron, mediante GC y GC/MS, los componentes volátiles de aceites aislados de las distintas partes de la Thymbra capitata, recogida en diferentes etapas de desarrollo. Se evaluó la actividad antioxidante de estos aceites de la T. capitata, midiendo el índice de peróxidos, en aceites de oliva y girasol, almacenados a 60 ºC. Estos índices de peróxidos se compararon con los obtenidos cuando no se agregó ningún antioxidante (control y cuando se utilizó BHT o carvacrol, en las mismas condiciones de almacenamiento. El mayor rendimiento en aceite se obtuvo de la parte aérea de T. capitata recogida durante la etapa de floración. El componente mayoritario de los aceites fue el carvacrol. También se encontraron, cantidades relativamente elevadas, de p-cimeno, γ-terpineno y β-cariofileno. El mejor antioxidante para el aceite de oliva resultó ser el BHT. En el aceite del girasol, la actividad antioxidante del BHT no fue tan evidente, mientras que el

  9. Diets based on soybean protein for Mediterranean fruit fly Dietas baseadas em proteína de soja para moscas do Mediterrâneo

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-04-01

    Full Text Available The objective of this work was to develop suitable and economic diets for mass rearing Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae. Diets containing sugar beet bagase, wheat bran, brewer yeast, and others with wheat bran and palletized soybean protein from Brazil were tested. Diets based on soybean protein have shown promising results regarding pupal recovery, pupal weight and adult emergence. Soybean bagase in the form of pellets with 60% of protein can be a very important substitute for other expensive sources of protein.O objetivo deste trabalho foi desenvolver dietas adequadas e econômicas para a criação massal de moscas de frutas do Mediterrâneo, Ceratitis capitata (Diptera: Tephritidae. Foram testados dietas com bagaço de beterraba açucareira, farelo de trigo, levedura de cerveja e outras dietas de farelo de trigo e proteína de soja prensada brasileira. Dietas compostas por proteína de soja apresentaram resultados positivos de recuperação de pupas, pesos de pupa e emergência de adultos. O bagaço de soja, na forma de pellet com 60% de proteína, pode ser um importante substituto de outras fontes de proteína.

  10. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  11. Estimating SIT-driven population reduction in the Mediterranean fruit fly, Ceratitis capitata, from sterile mating.

    Science.gov (United States)

    Juan-Blasco, M; Sabater-Muñoz, B; Pla, I; Argilés, R; Castañera, P; Jacas, J A; Ibáñez-Gual, M V; Urbaneja, A

    2014-04-01

    Area-wide sterile insect technique (SIT) programs assume that offspring reduction of the target population correlates with the mating success of the sterile males released. However, there is a lack of monitoring tools to prove the success of these programs in real-time. Field-cage tests were conducted under the environmental conditions of the Mediterranean coast of Spain to estimate: (a) the mating success of sterile Vienna-8 (V8) Ceratitis capitata males using molecular markers and (b) their efficacy to reduce C. capitata populations under six release ratios of wild females to wild males to V8 males (1:0:0, 1:1:0, 1:1:1, 1:1:5, 1:1:10, and 1:1:20). Statistical models were developed to predict: (a) the number of females captured in traps, (b) sperm ID (sterile or not) in spermathecae of the trapped females, and (c) the viable offspring produced, using release ratio and temperature as predictors. The number of females captured was affected by relative humidity. However, its influence in the model was low. Female captures were significantly higher in ratios 1:0:0 compared to ratios where V8 males were released. The proportion of V8 sperm in spermathecae increased with temperature and with the number of V8 males released, but leveled off between ratios 1:1:10 and 1:1:20. In all seasons, except winter (no offspring), viable offspring increased with temperature and was lowest for ratio 1:1:20. For the first time, a strong negative relationship between proportion of V8 sperm detected by molecular tools and C. capitata offspring was established. The models obtained should contribute to enhance the efficacy of SIT programs against this pest.

  12. Phytotoxic Effects of Cinnamic Acid on Cabbage (Brassica oleracea var. capitata

    Directory of Open Access Journals (Sweden)

    Singh, N. B.

    2013-04-01

    Full Text Available The present study deals with the effects of exogenous application of cinnamic acid (CA on growth and metabolism in growing seedlings of Brassica oleracea var. capitata (cabbage in hydroponic culture. CA was added at 0.5, 1.0 and 1.5 mM concentrations. CA has shown inhibitory effects on shoot and root length, fresh and dry weight of seedlings. CA significantly decreased the photosynthetic pigments, nitrate reductase activity and protein content. Graded concentrations of CA increased lipid peroxidation and sugar content. The increasing concentrations of CA significantly increased the antioxidative enzyme activities viz. superoxide dismutase, catalase, peroxidase against the oxidative stress caused by CA.

  13. Sex and the single embryo: early deveopment in the Mediterranean fruit fly, Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Zacharopoulou Antigone

    2010-01-01

    Full Text Available Abstract Background In embryos the maternal-to-zygotic transition (MTZ integrates post-transcriptional regulation of maternal transcripts with transcriptional activation of the zygotic genome. Although the molecular mechanisms underlying this event are being clarified in Drosophila melanogaster, little is know about the embryogenic processes in other insect species. The recent publication of expressed sequence tags (ESTs from embryos of the global pest species Ceratitis capitata (medfly has enabled the investigation of embryogenesis in this species and has allowed a comparison of the embryogenic processes in these two related dipteran species, C. capitata and D. melanogaster, that shared a common ancestor 80-100 mya. Results Using a novel PCR-based sexing method, which takes advantage of a putative LTR retrotransposon MITE insertion on the medfly Y chromosome, the transcriptomes of individual early male and female embryos were analysed using RT-PCR. This study is focused on two crucial aspects of the onset of embryonic development: sex determination and cellular blastoderm formation. Together with the three known medfly genes (Cctransformer, Cctransformer2 and Ccdoublesex, the expression patterns of other medfly genes that are similar to the D. melanogaster sex-determination genes (sisterlessA, groucho, deadpan, Sex-lethal, female lethal d, sans fille and intersex and four cellular blastoderm formation genes (Rho1, spaghetti squash, slow-as-molasses and serendipity-α were analyzed, allowing us to sketch a preliminary outline of the embryonic process in the medfly. Furthermore, a putative homologue of the Zelda gene has been considered, which in D. melanogaster encodes a DNA-binding factor responsible for the maternal-to-zygotic transition. Conclusions Our novel sexing method facilitates the study of i when the MTZ transition occurs in males and females of C. capitata, ii when and how the maternal information of "female-development" is

  14. Survival of Wild Adults of Ceratitis capitata (Wiedemann under Natural Winter Conditions in North East Spain

    Directory of Open Access Journals (Sweden)

    E. Peñarrubia-María

    2012-01-01

    Full Text Available The overwintering of the Mediterranean fruit fly (medfly, Ceratitis capitata (Wiedemann at the northern limits of its geographic distribution is not yet well known. With the aim of estimating the survival rate of medfly adults in northeast Spain under natural winter conditions, a two-winter-season trial was carried out. A control was carried out in a climatic chamber at 25°C. The results showed that medfly adults were unable to survive the entire winter season in the Girona area. Climatic conditions, including the daily minimum temperature, daily maximum temperature and the high rainfall, appeared to be involved in adult mortality in winter.

  15. Attraction and Electroantennography responses of the male Mediterranean Fruit Fly, Ceratitis capitata, to natural essential oils and synthetic blends.

    Science.gov (United States)

    Field experiments and long range bioassays were used to understand the difference in attractiveness among various natural essential oils for the Mediterranean Fruit Fly, Ceratitis capitata. Using electroantennography, we have selected various antennally active chemicals and tested their role in the ...

  16. MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 1.1

    Science.gov (United States)

    This monograph is a compendium of all plant species reported as hosts of C. capitata (or potential hosts based on mere appearance on some lists). There are 353 species (312 have valid genera and species names and 41 have species identified as "sp." or "spp.") included in the monograph; 79 species ha...

  17. Potential geographical distributions of the fruit flies Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa in China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Zhang, Runjie

    2009-10-01

    There have been relatively few attempts to model the distributions of the fruit flies Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch in China, but the geographic distributions of these species are of considerable concern in terms of biosecurity. In this study, two different modeling methods (genetic algorithm for rule-set prediction [GARP] and maximum entropy species distribution modeling [Maxent]) were used to predict the potential distributions of these three fly species in China, by using distribution records and a set of environmental predictor variables. The results showed that Maxent performed well, compared with modeling by GARP, at each test threshold. For all three species, the results predicted by Maxent agreed with the observed distributions in Africa and in other parts of the world. In China, C. capitata seems to have the highest number of favorable habitat areas, relative to C. cosyra and C. rosa, i.e., Yunnan, Guizhou, Guangxi, Guangdong, Hainan, Fujian, Sichuan and Chongqing, whereas C. cosyra has the smallest range of suitable areas, i.e., Yunnan, some parts of Hainan and Sichuan. The suitable areas for C. rosa are mainly restricted to Yunnan, Hainan, southern Guangdong, and a few areas of Sichuan. The indications are that on the whole, Southwest and South China are the areas with the highest risk for establishment from these three fly species. Jackknife tests reveal that environmental variables associated with temperature have the strongest influence on the potential distributions of all three species relative to other variables.

  18. The Mediterranean fruit fly (Ceratitis capitata in Iran: genetic diversity and comparison with other countries

    Directory of Open Access Journals (Sweden)

    M. Rajabiyan

    2015-04-01

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (Wiedemann is an economically important pest on fruits all over the world. The origin of this fly is thought to be from Africa, but it has recently expanded its distribution in many geographic regions including Iran. Due to the wide spread of this pest in Iran and its serious damage to fruit on trees, including citrus orchards of northern Iran, the present study was conducted firstly to investigate genetic diversity within populations of C. capitata based on the sequences of three mitochondrial DNA (mtDNA genes including cytochrome C oxidase I (COI, NAHD dehydrogenase subunits 4 and 5 (ND4 and ND5 and secondly to compare the Iranian haplotypes with those found in other countries. Results of this study indicated low levels of genetic diversity (four, four and three haplotypes among different populations of this pest, respectively for the COI, ND4 and ND5 genes in northern Iranian populations. The genetic similarity and very low levels of genetic diversity of northern Iranian populations suggest that the pest colonisation occurred relatively recently. In addition, haplotypes of Mazandaran province are similar to haplotypes of those countries that have recently been infected by this pest.

  19. Population genetics of Ceratitis capitata in South Africa: implications for dispersal and pest management.

    Science.gov (United States)

    Karsten, Minette; van Vuuren, Bettine Jansen; Barnaud, Adeline; Terblanche, John S

    2013-01-01

    The invasive Mediterranean fruit fly (medfly), Ceratitis capitata, is one of the major agricultural and economical pests globally. Understanding invasion risk and mitigation of medfly in agricultural landscapes requires knowledge of its population structure and dispersal patterns. Here, estimates of dispersal ability are provided in medfly from South Africa at three spatial scales using molecular approaches. Individuals were genotyped at 11 polymorphic microsatellite loci and a subset of individuals were also sequenced for the mitochondrial cytochrome oxidase subunit I gene. Our results show that South African medfly populations are generally characterized by high levels of genetic diversity and limited population differentiation at all spatial scales. This suggests high levels of gene flow among sampling locations. However, natural dispersal in C. capitata has been shown to rarely exceed 10 km. Therefore, documented levels of high gene flow in the present study, even between distant populations (>1600 km), are likely the result of human-mediated dispersal or at least some form of long-distance jump dispersal. These findings may have broad applicability to other global fruit production areas and have significant implications for ongoing pest management practices, such as the sterile insect technique.

  20. Morphological characterization of the antennal lobes in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Solari, Paolo; Corda, Valentina; Sollai, Giorgia; Kreissl, Sabine; Galizia, C Giovanni; Crnjar, Roberto

    2016-02-01

    The medfly Ceratitis capitata is one of the most important pests for horticulture worldwide. The knowledge about anatomy and function of the medfly olfactory system is still limited. The first brain structure to process olfactory information in insects is the antennal lobe (AL), which is composed of its functional and morphological units, the olfactory glomeruli. Here, we present a morphological three-dimensional reconstruction of AL glomeruli in adult brains. We used unilateral antennal backfills of olfactory receptor neurons (ORNs) with neural tracers, revealing the AL structure. We recorded confocal stacks acquired from whole-mount specimens, and analyzed them with the software AMIRA. The ALs in C. capitata are organized in glomeruli which are more tightly packed in the anterior part than the posterior one. Axons of ORNs bilaterally connect the ALs through a commissure between the two ALs. This commissure is formed by several distinct fascicles. Contralateral dye transfer suggests the presence of gap junctions connecting ORNs from both antennae. There was no statistical difference between the average volumes of female ALs (204,166 ± 12,554 μm(3)) and of male ALs (190,287 ± 11,823 μm(3)). In most specimens, we counted 53 glomeruli in each AL, seven of which were sexually dimorphic in size.

  1. Metallothionein induction and antioxidative responses in the estuarine polychaeta Capitella capitata (Capitellidae)

    Institute of Scientific and Technical Information of China (English)

    Suriya J; S Bharathiraja; V Sekar; R Rajasekaran

    2012-01-01

    Objective: To evaluate the antioxidant response induced by copper (Cu) exposure inCapitella capitata. The capacity of Cu bioaccumulation was also evaluated through the metal quantification. Methods: Worms were exposed to different concentrations of Cu 50, 100, and 200 μg/L for 7, 14 and 21 days respectively. In all the assays, control groups were run in parallel, employing only saline water (10%). The concentrations of Cu in the digested acidic solutions of worms were determined by using the inductively coupled plasma-Optical emission spectrophotometry. The total protein content and other anti oxidant enzyme activities such as superoxide dismutase (SOD), catalase (CAT) and glutathione S-transferase (GST) were recorded for the experiment period. Results: Bioaccumulation of Cu metals in polychaetes was increased parallel to exposure time. A peak concentration (197.30±12.32 μg/g) of metallothioneins (MTs) was registered at 14th day of 100 μg/L group compared to control group (37.29 μg/g). Catalase activities (CAT) in Cu treated-worms were increased significantly (P<0.05) after 7 and 14 days of exposure. The concentration of Cu had significant (P<0.05) influences on the activity of SOD. The same physiological activity was recorded in GST evaluation. Conclusions: These results of biochemical variables in C. capitata suggest us a useful model species for monitoring of environmental disturbance by heavy metal pollution. Antioxidant defenses were confirmed as sensitive biomarkers for metal stress in polychaete worms.

  2. Bleached Porites compressa and Montipora capitata corals catabolize δ13C-enriched lipids

    Science.gov (United States)

    Grottoli, Andréa G.; Rodrigues, Lisa J.

    2011-09-01

    Corals rely on stored energy reserves (i.e., lipids, carbohydrates, and protein) to survive bleaching events. To better understand the physiological implications of coral bleaching on lipid catabolism and/or synthesis, we measured the δ13C of coral total lipids (δ13CTL) in experimentally bleached (treatment) and non-bleached (control) Porites compressa and Montipora capitata corals immediately after bleaching and after 1.5 and 4 months of recovery on the reef. Overall δ13CTL values in treatment corals were significantly lower than in control corals because of a 1.9 and 3.4‰ decrease in δ13CTL immediately after bleaching in P. compressa and M. capitata, respectively. The decrease in δ13CTL coincided with decreases in total lipid concentration, indicating that corals catabolized δ13C-enriched lipids. Since storage lipids are primarily depleted during bleaching, we hypothesize that they are isotopically enriched relative to other lipid classes. This work further helps clarify our understanding of changes to coral metabolism and biogeochemistry when bleached and helps elucidate how lipid classes may influence recovery from bleaching and ultimately coral survival.

  3. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  4. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  5. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  6. Espessura da polpa como condicionante do parasitismo de mosca-das-frutas (Diptera:Tephritidae por Hymenoptera: braconidae Fruit pulp thickness conditioning fruit fly (Diptera:Tephritidae parasitism by Hymenoptera: braconidae

    Directory of Open Access Journals (Sweden)

    Eduardo Rodrigues Hickel

    2002-12-01

    Full Text Available Dentre as estratégias de manejo integrado de mosca-das-frutas está a manutenção de refúgios, vizinhos aos pomares, para proliferação de inimigos naturais. Objetivando verificar quais hospedeiros de mosca-das-frutas seriam mais adequados para incrementar o controle natural, estabeleceu-se uma correlação entre o nível de parasitismo e a espessura da polpa de frutos. Frutos em maturação de café (Coffea arabica, jabuticaba (Myrciaria cauliflora, cajá-mirim (Spondias lutea e laranja (Citrus aurantium foram coletados e mantidos em bandejas plásticas sobre uma camada de areia. As pupas de mosca-das-frutas retiradas da areia foram mantidas em estufa incubadora para emergência dos adultos. O diâmetro dos frutos e das sementes foi medido para se calcular a espessura da polpa. O café, com 1,8mm de polpa, foi o hospedeiro em que ocorreu maior índice de parasitismo de mosca-das-frutas (13,73%. O nível de parasitismo apresentou uma correlação negativa com a espessura da polpa dos frutos, sendo os frutos de polpa fina mais adequados para proliferação de parasitóides de mosca-das-frutas.One of the strategies for fruit fly integrated pest management is the refugee maintenance, near the orchards, for fruit fly natural enemies proliferation. With the aim to check the most suitable fruit fly hosts to increment natural control, a correlation was established between the parasitism level and the fruit pulp thickness. Ripening fruits of coffee (Coffea arabica, jabuticaba (Myrciaria cauliflora, cajá-mirim (Spondias lutea, and orange (Citrus aurantium were collected and maintained in plastic trays over a sand layer. The fruit fly pupae were taken from the sand and put in B.O.D. for adult emergence. The fruit and seed diameter were measure to estimate the fruit pulp thickness. The coffee bean, with 1.8mm of pulp was the fruit fly host with the greatest parasitism level (13.37%. The level of parasitism showed a negative relation with the fruit pulp thickness, and the thin pulp fruits were the most suitable hosts for fruit fly parasitoids proliferation.

  7. Effects of Curcuma longa extracts on mortality and fecundity of Bactrocera zonata (Diptera: Tephritidae Efeitos dos extratos de Curcuma longa sobre mortalidade e fecundidade de Bactrocera zonata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Abdul Rauf Siddiqi

    2011-12-01

    Full Text Available The peach fruit fly, Bactrocera zonata, is a significant pest of fruit and vegetable crops in South East Asia and Pacific region. Ccontrol strategies of fruit flies, relying chiefly on insecticides, have serious environmental consequences, disturbing the agro-ecosystem as well as eliminating natural enemies. This study was oriented at exploring the potential of turmeric, Curcuma longa, extracts to control the peach fruit fly. Freshly emerged female adults of Bactrocera zonata were continuously fed for 16 days on diet containing 1000, 500 and 250 ppm of acetone extract of Curcuma longa separately in laboratory cages. The extract caused 85.00, 66.67 and 56.67 percent mortality at 1000, 500 and 250 ppm respectively. The surviving females were mated and allowed to reproduce on clean guava fruits in separate cages. The inhibition in pupal progeny was 67.90, 60.74 and 51.96 percent in the flies fed on 1000, 500 and 250 ppm, the inhibition observed in adult progeny was 84.68, 79.03 and 67.74 percent, respectively.A mosca do pêssego, Bactrocera zonata, é uma importante praga das frutas e produtos hortícolas no Sudeste Asiático e Pacífico. As estratégias de controle de moscas-das-frutas, que se baseia principalmente no uso de inseticidas, têm consequências ambientais graves, perturbando o agroecossistema, bem como eliminando os inimigos naturais. Este estudo foi orientado a explorar as potencialidades dos extratos de açafrão Curcuma longa para controle de B. zonata. Após a emergência, adultos de fêmeas de B. zonata foram continuamente alimentados, durante 16 dias, com dieta contendo 1000, 500 e 250 ppm de extrato acetônico de C. longa separadamente em gaiolas no laboratório. O extrato causou 85,00, 66,67 e 56,67 % de mortalidade em 1000, 500 e 250 ppm, respectivamente. As fêmeas foram acasaladas e postas para ovipositar separadamente em goiabas dentro das gaiolas. A inibição na progênie pupal foi 67,90, 60,74 e 51,96 % nos insetos alimentados em 1000, 500 e 250 ppm, a inibição observada na progênie adulta foi 84,68, 79,03 e 67,74%, respectivamente.

  8. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the evaluated cage models: Medium, Large and Mission, Medium model showed the best results when assessing the number of eggs/female/day with an average of 11.4. The cage that showed lower results was Mission model with an average of 4.6 eggs/female/day. The Large cages showed values lower than the Medium cages but the differences were not significant. Good values recorded in the Medium cages were likely due to their structure, with the inside of the cage divided into several compartments, which improves the distribution of adult flies and prevents early mortality due to the overcrowding of the base or the roof of the cage.

  9. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima

    2012-08-01

    Full Text Available Um estudo foi conduzido no período de junho de 2007 a janeiro de 2008, em pomares comerciais de manga das variedades: Tommy Atkins, Haden e Palmer sendo 3 ha de cada cultivar, localizado na região do Bom Intento no Município de Boa Vista. Os espécimes de moscas-das-frutas foram coletados, por meio de armadilhas, confeccionadas com garrafas pet, que foram penduradas na copa das árvores a 1,60 m de altura. Como atrativo alimentar foi utilizado 200 mL de suco de maracujá a 30%. Foram utilizadas nove armadilhas, sendo uma armadilha por hectare. Semanalmente as armadilhas eram examinadas, ocasião em que se substituía o atrativo e os insetos capturados retirados e colocados em frascos de vidro devidamente etiquetados e transportados ao Laboratório de Entomologia do Centro de Ciências Agrárias da Universidade Federal de Roraima. As identificações dos espécimes foram feitas no Instituto Nacional de Pesquisa da Amazônia - INPA. No período de oito meses foram coletados 24 espécimes adultos do gênero Anastrepha (nove fêmeas e 15 machos. Quatro espécies foram identificadas: A. serpentina, A. striata, A. obliqua e A. turpinae. A maior frequência foi A. serpentina (44,44%, seguida de A. striata e A. obliqua ambas com 22,22% e A. turpinae com 11,11%. Os meses de maior ocorrência de Anastrepha spp. foram junho, julho e agosto. Este é o primeiro registro da espécie Anastrepha turpinae Stone, 1942, em Roraima. The study was done during th period of June 2007 to January of 2008, in commercial mango orchards having: 3 ha of cv. Tommy Atkins, 3 ha of cv. Haden. and 3 ha of cv. Palmer, located at Bom Intento in the municipal district of Boa Vista - RR. The specimens of fruit flies were collected, by trapping, made with transparent bottles pet, which were hung in the cup of the trees at 1.60 m of height. 200 mL of passion fruit juice (30% was used as an attractant feed; 9 traps were used, being one trap for hectare. Weekly The traps were examined weekly, during which the bait was substituted and the capture insects removed, placed in labeled glass flasks properly and transported to the Laboratory of Entomology, Centro de Ciências Agrárias, Universidade Federal de Roraima - UFRR. The identification of the specimens was done at the Instituto Nacional de Pesquisa da Amazônia - INPA. a - INPA. During the period of eight months 24 adult specimens of Anastrepha were collected (9 females and 15 males. Four species were identified: A. serpentina, A. striata, A. obliqua and A. turpinae. The highest frequency of trapped insects was A. serpentina (44.44%, followed by A. striata and A. obliqua with 22.22%, and A. turpinae with 11.11%. The months of highest occurrence of Anastrepha spp., were June, July, and August. This is the first documentation of the specie Anastrepha turpinae Stone, 1942, in Roraima.

  10. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  11. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  12. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  13. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    Science.gov (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  14. Managing Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae), Using Spinosad-Based Protein Bait Sprays in Papaya Orchards in Hawaii

    Science.gov (United States)

    The efficacy of GF-120 Fruit Fly Bait was evaluated as a control of female oriental fruit fly, Bactrocera dorsalis (Hendel) in papaya orchards in Hawaii. Two important components of this study were field sanitation and mass trapping using the male-specific lure methyl eugenol. Three different spray ...

  15. Genetic Diversity of Bactrocera dorsalis (Diptera: Tephritidae) on the Hawaiian Islands: Implications for an Introduction Pathway Into California.

    Science.gov (United States)

    Barr, Norman B; Ledezma, Lisa A; Leblanc, Luc; San Jose, Michael; Rubinoff, Daniel; Geib, Scott M; Fujita, Brian; Bartels, David W; Garza, Daniel; Kerr, Peter; Hauser, Martin; Gaimari, Stephen

    2014-10-01

    Population genetic diversity of the oriental fruit fly, Bactrocera dorsalis (Hendel), on the Hawaiian islands of Oahu, Maui, Kauai, and Hawaii (the Big Island) was estimated using DNA sequences of the mitochondrial cytochrome c oxidase subunit I gene. In total, 932 flies representing 36 sampled sites across the four islands were sequenced for a 1,500-bp fragment of the gene named the C1500 marker. Genetic variation was low on the Hawaiian Islands with >96% of flies having just two haplotypes: C1500-Haplotype 1 (63.2%) or C1500-Haplotype 2 (33.3%). The other 33 flies (3.5%) had haplotypes similar to the two dominant haplotypes. No population structure was detected among the islands or within islands. The two haplotypes were present at similar frequencies at each sample site, suggesting that flies on the various islands can be considered one population. Comparison of the Hawaiian data set to DNA sequences of 165 flies from outbreaks in California between 2006 and 2012 indicates that a single-source introduction pathway of Hawaiian origin cannot explain many of the flies in California. Hawaii, however, could not be excluded as a maternal source for 69 flies. There was no clear geographic association for Hawaiian or non-Hawaiian haplotypes in the Bay Area or Los Angeles Basin over time. This suggests that California experienced multiple, independent introductions from different sources.

  16. Genetic structure and colonization history of the fruit fly Bactrocera tau (Diptera: Tephritidae) in China and Southeast Asia.

    Science.gov (United States)

    Shi, W; Kerdelhué, C; Ye, H

    2014-06-01

    Bactrocera tau (Walker), a major invasive pest worldwide, was first described in Fujian (China) in 1849 and has dispersed to tropical and subtropical Asia and the South Pacific region. Few data are available on its colonization history and expansion processes. This pilot study attempted to reconstruct the colonization history and pathways of this pest in China and neighboring Southeast Asian countries based on mitochondrial DNA. Results of the study showed six genetic groups corresponding to geographical characteristics, although the pattern was relatively weak. Homogeneous genetic patterns were observed within southern and central China, and northern Vietnam. Continuous colonization from the coast of southern China to inland regions of China and northern Vietnam was suggested. Strong genetic structure was observed in western China, Thailand, and Laos. The isolation of four of the six groups was most probably attributable to major topographical barriers of western China. Yunnan acted as a contact zone of B. tau in China and neighboring Southeast Asia. The absence of isolation by distance and the overall low phylogeographic structure of B. tau suggested that long distance dispersal events and human activities could play a major role in the colonization and expansion patterns of B. tau. By analyzing the genetic diversity, gene flow, haplotype phylogeny, and demographic history of 23 fly populations, we hypothesized that B. tau could have been introduced long ago in southern China, from which it further expanded or that southern China could correspond to the native range of this species.

  17. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae and Their Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs, 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp was longer than those of B. melastomatos (15,954 bp and B. umbrosa (15,898 bp. This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa. Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8, which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3 and nad6 (NADH dehydrogenase subunit 6 genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine-loop was absent in trnF (phenylalanine and DHU (dihydrouracil-loop was absent in trnS1 (serine S1. In B. umbrosa, trnN (asparagine, trnC (cysteine and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes, with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  18. Enhancement of attraction of alpha-ionol to male Bactrocera latifrons (Diptera: Tephritidae) by addition of a synergist, cade oil.

    Science.gov (United States)

    McQuate, G T; Peck, S L

    2001-02-01

    Male lures are known for many tephritid fruit fly species and are often preferred over food bait based traps for detection trapping because of their high specificity and ability to attract flies over a wide area. Alpha-ionol has been identified as a male lure for the tephritid fruit fly Bactrocera latifrons (Hendel). The attraction of this compound to male B. latifrons individuals, however, is not as strong as is the attraction of other tephritid fruit fly species to their respective male lures. Cade oil, an essential oil produced by destructive distillation of juniper (Juniperus oxycedrus L.) twigs, synergizes the attraction of alpha-ionol to male B. latifrons. Catches of male B. latifrons at traps baited with a mixture of alpha-ionol and cade oil were more than three times greater than at traps baited with alpha-ionol alone. Substitution of alpha-ionol + cade oil for alpha-ionol alone in detection programs could considerably improve the chance of detecting invading or incipient populations of B. latifrons. However, detection programs should not rely solely on this lure but also make use of protein baited traps as well as fruit collections. Further work with fractions of cade oil may help to identify the active ingredient(s), which could help to further improve this male lure for B. latifrons.

  19. Active ingredients in cade oil that synergize attractiveness of alpha-ionol to male Bactrocera latifrons (Diptera: Tephritidae).

    Science.gov (United States)

    McQuate, Grant T; Keum, Young Soo; Sylva, Charmaine D; Li, Qing X; Jang, Eric B

    2004-06-01

    Cade oil, a commercially available essential oil produced by destructive distillation of juniper, Juniperus oxycedrus L., twigs, is known to synergize the attractancy of alpha-ionol to male Bactrocera latifrons (Hendel). Through chemical fractionation and outdoor olfactometer-based bioassays, seven compounds in cade oil were identified that potentially could provide some level of synergism. Tests with sterile laboratory flies showed that four of the seven compounds (eugenol, isoeugenol, 2-methoxy-4-ethylphenol, and 2-methoxy-4-propylphenol), together with a closely related compound not found in cade oil, 2-methoxy-4-methylphenol, are capable of synergizing the attractiveness of alpha-ionol to male B. latifrons under field conditions. The similarity in structures of these five synergistic compounds shows that there is a response to a core 2-methoxyphenol structure, with fly response little affected by some variation in the composition of the side chain on the number 4 carbon. Because identified synergists were structurally similar, only one compound, eugenol, was selected for further field studies. In an 8-wk weathering test, using released sterile flies, traps baited with alpha-ionol + eugenol had catches comparable with catches at traps baited with alpha-ionol + cade oil, with catches generally increased with a higher eugenol loading. For both eugenol and cade oil, catches tended to be better when these synergists were deployed on separate wicks from the alpha-ionol. Eugenol and alpha-ionol, however, were unable to provide attraction comparable with that of cade oil and alpha-ionol in tests with wild fly populations.

  20. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  1. Soil moisture and relative humidity effects during post-diapause on emergence of western cherry fruit fly (Diptera: Tephritidae)

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a pest of sweet cherry, Prunus avium (L.) L., in western North America that is found in relatively moist and dry habitats. In this study, fly pupae from Kennewick and Roslyn in Washington state, U.S.A., were used to test the hypotheses tha...

  2. Oviposition in Sweet Cherry by Reproductively Mature Western Cherry Fruit Fly (Tephritidae:Diptera) Fed Spinosad and Neonicotinoid Insecticide Baits

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. Spinosad bait is applied weekly to kill flies before they develop eggs, but its effects on oviposition by flies that are reproductively mature are unknown. ...

  3. Pupal Mortality and Adult Emergence of Western Cherry Fruit Fly (Diptera: Tephritidae) Exposed to the Fungus Muscodor albus (Xylariales: Xylariaceae)

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of sweet cherry, Prunus avium (L.) L., that is conventionally controlled using insecticides. One alternative to the use of insecticides for fly control could be fumigation of the fly’s overwintering habitat using the fungus Mus...

  4. Differences in body size and egg loads of Rhagoletis indifferens (Diptera: Tephritidae) from introduced and native cherries

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens Curran, infests introduced, domesticated sweet [Prunus avium (L.) L.] and tart cherries (Prunus cerasus L.) as well as native bitter cherry, Prunus emarginata (Douglas) Eaton. Bitter cherries are smaller than sweet and tart cherries and this coul...

  5. Use of alpha-ionol + cade oil for detection and monitoring of Bactrocera latifrons (Diptera: Tephritidae) populations

    Energy Technology Data Exchange (ETDEWEB)

    McQuate, Grant T.; Jang, Eric B., E-mail: grant.mcquate@ars.usda.go, E-mail: eric.jang@ars.usda.go [U.S. Department of Agriculture (USDA/ARS), Hilo, HI (United States). Pacific Basin Agricultural Research Center; Bokonon-Ganta, Aime H., E-mail: aimehbg@hawaii.ed [University of Hawaii (CTAHR/PEPS/UH), Honolulu, HI (United States). Coll. of Tropical Agriculture and Human Resources. Dept. of Plant and Environmental Protection Sciences

    2006-07-01

    Bactrocera latifrons (Hendel) is a tephritid fruit fly that primarily infests solanaceous fruits. Although primarily of Asian distribution, it has invaded Hawaii and, more recently, the continent of Africa (Tanzania and Kenya). Male B. latifrons uniquely respond to alpha-ionol + cade oil, rather than to either methyl eugenol or cuelure, to which males of the majority of other Dacine fruit flies respond. Here we present research results detailing the age of male B. latifrons response to alpha-ionol + cade oil, the persistence of wick attractiveness, and the effectiveness of alpha-ionol + cade oil in detecting B. latifrons populations. Based on wind tunnel studies with wild flies, male response steadily increased from 5% at age 2 to 45% at age 28, with male response exceeding 50% of the peak response by Day 7 and exceeding 75% and 90% by days 14 and 21, respectively. The attractiveness of wicks treated with 2.0 ml alpha-ionol and 1.0 ml cade oil (on separate wicks) declined over time, with wick response reduced to about 50% of the fresh catch after 6 1/2 weeks. Based on concurrent alpha-ionol + cade oil based trapping and collections of turkey berry, Solanum torvum (Solanaceae), fruits, the presence of B. latifrons was detected at the time of fruit collection, 75.5 % of the time. (author)

  6. Differences in body size and egg loads of Rhagoletis indifferens (Diptera: Tephritidae) from introduced and native cherries.

    Science.gov (United States)

    Yee, Wee L; Goughnour, Robert B; Feder, Jeffrey L

    2011-12-01

    The western cherry fruit fly, Rhagoletis indifferens Curran, infests introduced, domesticated sweet [Prunus avium (L.) L.], and tart cherries (Prunus cerasus L.) as well as native bitter cherry, Prunus emarginata (Douglas) Eaton. Bitter cherries are smaller than sweet and tart cherries and this could affect various life history traits of flies. The objectives of the current study were to determine 1) if body size and egg loads of flies infesting sweet, tart, and bitter cherries differ from one another; and 2) if any observed body size differences are genetically based or caused by the host fruit environment. Pupae and adults of both sexes reared from larval-infested sweet and tart cherries collected in Washington and Montana were larger than those reared from bitter cherries. In addition, flies of both sexes caught on traps in sweet and tart cherry trees were larger than those caught in bitter cherry trees and females trapped from sweet and tart cherry trees had 54.0-98.8% more eggs. The progeny of flies from naturally-infested sweet and bitter cherries reared for one generation in the laboratory on sweet cherry did not differ in size. The same also was true for progeny of sweet and bitter cherry flies reared in the field on bitter cherry. The results suggest that the larger body sizes of flies from sweet and tart cherries than bitter cherries in the field are caused by host fruit and not genetic factors.

  7. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  8. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  9. Attraction of wild-like and colony-reared Bactrocera cucurbitae (Diptera: Tephritidae) to Cuelure in the field

    Science.gov (United States)

    The attraction of wild tephritids to semiochemical-based lures are the ideal basis for trap network design in detection programs, but in practice, mass-reared colony insects are usually used to determine trap efficiency. For Bactrocera cucurbitae Coquillett, a lower response by wild males compared w...

  10. Integration of insecticidal, phagostimulatory, and visual elements of an attract-and-kill system for apple maggot fly (Diptera: Tephritidae)

    Science.gov (United States)

    In development of a trap-based control system for apple maggot fly, we evaluated lethality of spinosad in cylindrical and contoured controlled-release caps atop visually stimulating sphere bases. For both trap styles, spinosad at or near 1.0% (a.i.) proved to be a useful and relatively durable fly-...

  11. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  12. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  13. Seasonal changes in english walnut (Juglans regia L.) (Juglandaceae), fruit properties and host use patterns by Rhagoletis zoqui (Diptera: Tephritidae)

    Science.gov (United States)

    Rhagoletis zoqui Bush is a Neosubtropical, univoltine, frugivorous tephritid fly that exploits both native Juglans spp. and the introduced, Palearctic English walnut, Juglans regia. The seasonal development of commercial J. regia fruit and the pattern of host exploitation by R. zoqui were tracked ov...

  14. Cuelure but not zingerone make the sex pheromone of male Bactrocera tryoni (Tephritidae: Diptera) more attractive to females.

    Science.gov (United States)

    Kumaran, Nagalingam; Hayes, R Andrew; Clarke, Anthony R

    2014-09-01

    In tephritid fruit flies of the genus Bactrocera Macquart, a group of plant derived compounds (sensu amplo 'male lures') enhance the mating success of males that have consumed them. For flies responding to the male lure methyl eugenol, this is due to the accumulation of chemicals derived from the male lure in the male rectal gland (site of pheromone synthesis) and the subsequent release of an attractive pheromone. Cuelure, raspberry ketone and zingerone are a second, related group of male lures to which many Bactrocera species respond. Raspberry ketone and cuelure are both known to accumulate in the rectal gland of males as raspberry ketone, but it is not known if the emitted male pheromone is subsequently altered in complexity or is more attractive to females. Using Bactrocera tryoni as our test insect, and cuelure and zingerone as our test chemicals, we assess: (i) lure accumulation in the rectal gland; (ii) if the lures are released exclusively in association with the male pheromone; and (iii) if the pheromone of lure-fed males is more attractive to females than the pheromone of lure-unfed males. As previously documented, we found cuelure was stored in its hydroxyl form of raspberry ketone, while zingerone was stored largely in an unaltered state. Small but consistent amounts of raspberry ketone and β-(4-hydroxy-3-methoxyphenyl)-propionic acid were also detected in zingerone-fed flies. Males released the ingested lures or their analogues, along with endogenous pheromone chemicals, only during the dusk courtship period. More females responded to squashed rectal glands extracted from flies fed on cuelure than to glands from control flies, while more females responded to the pheromone of calling cuelure-fed males than to control males. The response to zingerone treatments in both cases was not different from the control. The results show that male B. tryoni release ingested lures as part of their pheromone blend and, at least for cuelure, this attracts more females.

  15. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico

    Science.gov (United States)

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  16. Olive fruit fly (Diptera: Tephritidae) populations in relation to region, trap type, season, and availability of fruit.

    Science.gov (United States)

    Yokoyama, Victoria Y; Miller, Gina T; Stewart-Leslie, Judy; Rice, Richard E; Phillips, Phil A

    2006-12-01

    Olive fruit fly, Bactrocera oleae (Gmelin), was monitored with adult captures by season and trap type, and was related to fruit volume and nonharvested fruit to elucidate the occurrence of the newly introduced pest in California. The highest numbers of adults captured in ChamP traps in olive trees, Olea europaea, were in October in an inland valley location, and in September in a coastal location. Comparisons of trap types showed that the number of olive fruit fly adults captured in Pherocon AM traps in a commercial orchard was significantly greater than in ChamP traps. A significantly greater number of females were captured in Pherocon AM traps with bait packets and pheromone lures than traps with pheromone lures alone, while a significantly greater number of adults and males were captured in traps with pheromone lures alone. Significantly more adults were captured in ChamP traps with bait packets and pheromone lures versus traps with bait packets alone. Fruit volume increased by four times from mid-June to mid-November. Olive fruit fly was found to oviposit on small olive fruit fruit set, the maximum number of ovipositional sites per fruit occurred in October, and the greatest number of pupae and adults were reared from fruit collected in September and October. The highest numbers of pupae were collected from nonharvested fruit in March when high numbers of adults were captured in the same orchard.

  17. The oviposition of the chili fruit fly (Bactrocera latifrons Hendel (Diptera: Tephritidae with reference to reproductive capacity

    Directory of Open Access Journals (Sweden)

    Anothai Wingsanoi

    2012-11-01

    Full Text Available The chili fruit fly, Bactrocera latifrons Hendel, is a serious pest of chili fruit production in Thailand. To determine theeffective control planning of the fly population, the oviposition related to reproductive capacity of the female were observed.The female ovary was daily dissected through the entire life span and the eggs inside the ovary were examined and counted.There were 44.84±19.60 eggs/ovary. The oviposition of female was simultaneously conducted. Eggs inside the ovarypresented on 8th day and the female oviposited on 10th day of the life span. The female laid 4.25±2.28 eggs, which was 12.45±9.56 fold less than the reproductive capacity. The female longevity was 31.1±8.40 days and the oviposition period was 40days.

  18. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  19. Response of the pearly eye melon fly Bactrocera cucurbitae(Coquillett)(Diptera:Tephritidae) mutant to host-associated visual cues

    Science.gov (United States)

    We report on a pearly eye mutant (PEM) line generated from a single male Bactrocera cucurbitae collected in Kapoho, Hawaii. Crossing experiments with colony wild-type flies indicate that the locus controlling this trait is autosomal and the mutant allele is recessive. Experiments with females to ass...

  20. Case 3693 Cryptodacus Hendel, 1914 (Insecta: Diptera: Tephritidae): Proposed suppression of Cryptodacus Gundlach, 1862 (Reptilia, Serpentes, Colubridae)

    Science.gov (United States)

    Norrbom, Allen L.; McDiarmid, Roy W.; Chen, Xiao-Lin; David, King J.; De Meyer, Marc; Freidberg, Amnon; Han, Ho-Yeon; Steck, Gary J.; Thompson, F. Christian; White, Ian M.; Zucchi, Roberto A.

    2015-01-01

    The purpose of this application, under Article 23.9.3, is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier, unused name Crypto- dacus Gundlach, 1862, currently a junior synonym of Arrhyton Günther, 1858, a genus of snakes, under the plenary power of the Commission, in the interest of nomenclatural stability. Cryptodacus Gundlach has not been used as a valid name since 1883, whereas Cryptodacus Hendel has been used in a significant body of literature relating to fruit fly systematics, morphology and phylogeny and is the currently used name in various name and molecular databases. 

  1. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development.

  2. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    Science.gov (United States)

    Park, Soo J; Morelli, Renata; Hanssen, Benjamin L; Jamie, Joanne F; Jamie, Ian M; Siderhurst, Matthew S; Taylor, Phillip W

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl) and ethers (methyl ether, trimethylsilyl ether) in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC), and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  3. Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae based on 454 pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Ailin Wang

    Full Text Available The citrus fruit fly Bactrocera minax is associated with diverse bacterial communities. We used a 454 pyrosequencing technology to study in depth the microbial communities associated with gut and reproductive organs of Bactrocera minax. Our dataset consisted of 100,749 reads with an average length of 400 bp. The saturated rarefaction curves and species richness indices indicate that the sampling was comprehensive. We found highly diverse bacterial communities, with individual sample containing approximately 361 microbial operational taxonomic units (OTUs. A total of 17 bacterial phyla were obtained from the flies. A phylogenetic analysis of 16S rDNA revealed that Proteobacteria was dominant in all samples (75%-95%. Actinobacteria and Firmicutes were also commonly found in the total clones. Klebsiella, Citrobacter, Enterobacter, and Serratia were the major genera. However, bacterial diversity (Chao1, Shannon and Simpson indices and community structure (PCA analysis varied across samples. Female ovary has the most diverse bacteria, followed by male testis, and the bacteria diversity of reproductive organs is richer than that of the gut. The observed variation can be caused by sex and tissue, possibly to meet the host's physiological demands.

  4. Olive fruit fly (Diptera: Tephritidae) in California: longevity, oviposition, and development in canning olives in the laboratory and greenhouse.

    Science.gov (United States)

    Yokoyama, Victoria Y

    2012-02-01

    The biology of olive fruit fly, Bactrocera oleae (Rossi), was studied in the laboratory, greenhouse, and in canning olives, Olea europaea L., in relation to California regional climates. Adults survived in laboratory tests at constant temperatures and relative humidities of 5 degrees C and 83%; 15 degrees C and 59%; 25 degrees C and 30%; and 35 degrees C and 29% for 15, 6, 3, and 2 d without provisions of food and water and for 37, 63, 25, and 4 d with provisions, respectively. In a divided greenhouse, adults survived for 8-11 d in the warm side (36 degrees C and 31% RH daytime); and in the cool side (26 degrees C and 63% RH daytime) 10 d without provisions and 203 d with provisions. A significantly greater number of adults survived in the cool side than the warm side, and with provisions than without. First and last eggs were oviposited in olive fruit when females were 6 and 90 d old, respectively. The highest number of eggs was 55 per day in 10 olive fruit oviposited by 10 28 d-old females, with maximum egg production by 13-37 d-old females. A significantly greater number of ovipositional sites occurred in all sizes of immature green fruit when exposed to adults in cages for 5 d than 2 d. Adults emerged from fruit with a height of > or = 1.0 cm or a volume of > or = 0.2 cm3. More than seven adults per 15 fruit emerged from field infested fruit with a height of 1.1 cm and volume of 0.1 cm3. Larval length was significantly different among the first, second, and third instars and ranged from 0.7 to 1.6, 2.4-4.3, and 4.8-5.6 mm at 14 degrees C; 0.8-1.1, 1.9-2.9, and 3.9-4.4 mm at 21 degrees C, and 0.7-1.3, 2.4-2.9, and 4.4-4.8 mm at 26 degrees C, respectively. Survival of pupae to the adult stage was significantly lower at 26 degrees C than 14 degrees C or 21 degrees C. The period of adult emergence began at 38, 14, and 11 d over a period of 8, 5, and 1 d at 14, 21, and 26 degrees C, respectively. Findings were related to the occurrence and control of California olive fruit fly infestations.

  5. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco

    2014-10-01

    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  6. Alternative fumigants to methyl bromide for killing pupae and preventing emergence of apple maggot fly (Diptera:Tephritidae)

    Science.gov (United States)

    Effects of methyl bromide, ECO2FUME (phosphine gas + CO2), Vapam (sodium methyldithiocarbamate), chloropicrin, Telone II (1, 3 dichloropropene), and chloropicrin + Telone II on killing the pupae and preventing adult emergence of apple maggot fly, Rhagoletis pomonella (Walsh) was determined. In an e...

  7. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2012-06-01

    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  8. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  9. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures

    Science.gov (United States)

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  10. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Wang Jin-Jun

    2010-10-01

    Full Text Available Abstract Background Quantitative real-time reverse transcriptase PCR (RT-qPCR has been widely used for quantification of mRNA as a way to determine key genes involved in different biological processes. For accurate gene quantification analysis, normalization of RT-qPCR data is absolutely essential. To date, normalization is most frequently achieved by the use of internal controls, often referred to as reference genes. However, several studies have shown that the reference genes used for the quantification of mRNA expression can be affected by the experimental set-up or cell type resulting in variation of the expression level of these key genes. Therefore, the evaluation of reference genes is critical for gene expression profiling, which is often neglected in gene expression studies of insects. For this purpose, ten candidate reference genes were investigated in three different tissues (midgut, Malpighian tubules, and fat body of the oriental fruit fly, Bactrocera dorsalis (Hendel. Results Two different programs, geNorm and Normfinder, were used to analyze the data. According to geNorm, α-TUB + ACT5 are the most appropriate reference genes for gene expression profiling across the three different tissues in the female flies, while ACT3 + α-TUB are considered as the best for males. Furthermore, we evaluated the stability of the candidate reference genes to determine the sexual differences in the same tissue. In the midgut and Malpighian tubules, ACT2 + α-TUB are the best choice for both males and females. However, α-TUB + ACT1 are the best pair for fat body. Meanwhile, the results calculated by Normfinder are quite the same as the results with geNorm; α-TUB is always one of the most stable genes in each sample validated by the two programs. Conclusions In this study, we validated the suitable reference genes for gene expression profiling in different tissues of B. dorsalis. Moreover, appropriate reference genes were selected out for gene expression profiling of the same tissues taking the sexual differences into consideration. This work not only formed a solid basis for future gene expression study in B. dorsalis, but also will serve as a resource to screen reference genes for gene expression studies in any other insects.

  11. Are apple and hawthorn fruit volatiles more attractive than ammonium carbonate to Rhagoletis pomonella (Diptera: Tephritidae) in Washington state?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the U.S. In the eastern U.S. where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonel...

  12. Ammonium carbonate is more attractive than apple and hawthorn fruit volatile lures to Rhagoletis pomonella (Diptera: Tephritidae) in Washington State.

    Science.gov (United States)

    Yee, Wee L; Nash, Meralee J; Goughnour, Robert B; Cha, Dong H; Linn, Charles E; Feder, Jeffrey L

    2014-08-01

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the United States. In the eastern United States where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonella. However, the opposite may be true in the western United States. Here, we determined whether newly identified western apple and western hawthorn fruit volatiles are more attractive than ammonium carbonate (AC) to R. pomonella in apple, black hawthorn, and ornamental hawthorn trees in western Washington State. In all three host trees, sticky red sphere or yellow panel traps baited with AC generally caught more flies than traps baited with lures containing the four newly developed fruit blends (modified eastern apple, western apple, western ornamental hawthorn, and western black hawthorn) or two older blends (eastern apple and eastern downy hawthorn). Fruit volatiles also displayed more variation among trapping studies conducted at different sites, in different host trees, and across years than AC. The results imply that traps baited with AC represent the best approach to monitoring R. pomonella in Washington State.

  13. RHAGOLETIS COMPLETA (DIPTERA; TEPHRITIDAE DISTRIBUTION, FLIGHT DYNAMICS AND INFLUENCE ON WALNUT KERNEL QUALITY IN THE CONTINENTAL CROATIA

    Directory of Open Access Journals (Sweden)

    Božena Barić

    2015-06-01

    Full Text Available Walnut husk fly (WHF, Rhagoletis completa Cresson 1929 is an invasive species spreading quickly and damaging walnuts in Croatia and neighbouring countries. We researched distribution of this pest in the continental part of Croatia, flight dynamics in Međimurje County and its influence on quality of walnut kernels. CSALOMON®PALz traps were used for monitoring the spread and flight dynamics of R. completa. Weight and the protein content of kernels and the presence of mycotoxin contamination were measured. Walnut husk fly was found in six counties (Istria County: pest reconfirmation, Zagreb County, The City of Zagreb, Varaždin County, Međimurje County and Koprivnica-Križevci County. The presence of the fly was not confirmed on one site in Koprivnica-Križevci County (locality Ferdinandovac and in the eastern part of Croatia (Vukovar-Srijem County: Vinkovci locality. The flight dynamics showed rapid increase in number of adults only a year after the introduction into new area. The weight of infested kernels was 5.81% lower compared to not infested. Protein content was 14.04% in infested kernels and 17.31% in not infested kernels. There was no difference in mycotoxins levels. Additional researches on mycotoxin levels in stored nuts, ovipositional preferences of walnut husk fly and protection measures against this pest are suggested.

  14. Cryptodacus Hendel, 1914 (Insecta: Diptera: TEPHRITIDAE): Proposed conservation by suppression of Cryptodacus Gundlach, 1862 (Reptilia: Serpentes: COLUBRIDAE)

    Science.gov (United States)

    The purpose of this application under Articles 78.1, 80.2.2, and 81.2.1 is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier name Cryptodacus Gundlach, 1862, currently a junior synonym of A...

  15. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  16. Histologia y morfologia del sistema reproductor en hembras de Rhagoletis conversa (Brethes y de Rhagoletis nova (Schimer (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Verónica Flores Rojas

    1987-01-01

    Full Text Available The histology and morphology of the reproductive system of females of Rhagoletis conversa (Brèthes and Rhagoletis nova (Schiner were studied. These species parasitize wild and cultivated Solanaceae respectively. Adult females of both species were collected in natural populations in the Central Zone of Chile. In order to study the development of ovaries the females collected were sacrificed at different ages. Once obtained, ovaries were preparedfor optical microscopy by using histological and squash standard techniques. Results show that within each one of ovarioles it can be observed follicles arranged in line and showing different stages of maduration. It can be described about 6 follicle stages in the ovarioles studied. Ovaries of both species show a very similar structure. However, females of Rhagoletis nova show an ovipositor wider than R. conversa. The number of ovarioles of R. nova is also higher than in R. conversa.

  17. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness.

    Science.gov (United States)

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis

    2013-04-01

    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  18. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com machos virgens co-específicos como atrativo.

  19. Historical perspective on the synonymization of the four major pest species belonging to the Bactrocera dorsalis species complex (Diptera, Tephritidae).

    Science.gov (United States)

    Hee, Alvin K W; Wee, Suk-Ling; Nishida, Ritsuo; Ono, Hajime; Hendrichs, Jorge; Haymer, David S; Tan, Keng-Hong

    2015-01-01

    An FAO/IAEA-sponsored coordinated research project on integrative taxonomy, involving close to 50 researchers from at least 20 countries, culminated in a significant breakthrough in the recognition that four major pest species, Bactrocera dorsalis, Bactrocera philippinensis, Bactrocera papayae and Bactrocera invadens, belong to the same biological species, Bactrocera dorsalis. The successful conclusion of this initiative is expected to significantly facilitate global agricultural trade, primarily through the lifting of quarantine restrictions that have long affected many countries, especially those in regions such as Asia and Africa that have large potential for fresh fruit and vegetable commodity exports. This work stems from two taxonomic studies: a revision in 1994 that significantly increased the number of described species in the Bactrocera dorsalis species complex; and the description in 2005 of Bactrocera invadens, then newly incursive in Africa. While taxonomically valid species, many biologists considered that these were different names for one biological species. Many disagreements confounded attempts to develop a solution for resolving this taxonomic issue, before the FAO/IAEA project commenced. Crucial to understanding the success of that initiative is an accounting of the historical events and perspectives leading up to the international, multidisciplinary collaborative efforts that successfully achieved the final synonymization. This review highlights the 21 year journey taken to achieve this outcome.

  20. Ecotoxicology of pesticides on natural enemies of olive groves. Potential of ecdysone agonists for controlling Bactrocera oleae (Rossi) (Diptera: Tephritidae)

    OpenAIRE

    2012-01-01

    Pesticide applications are still one of the most common control methods against the main olive grove pests and diseases: the olive fruit fly, Bactrocera oleae (Rossi), the olive moth, Prays oleae (Bernard), the black scale, Saissetia oleae (Olivier), and the olive leaf spot, caused by the fungus Spilocaea oleagina Fries. However, and because the new pesticide legislation is aimed at an integrated pest and disease management, it is still important to evaluate and to know the ecotoxicology of p...

  1. Notes on the frugivorous fruit fly (Diptera: Tephritidae fauna of western Africa, with description of a new Dacus species

    Directory of Open Access Journals (Sweden)

    Kim F.M. Goodger

    2013-07-01

    Full Text Available The species richness of the frugivorous fruit fly fauna of western African (in particular of Ivory Coast, Ghana, Togo, Benin and Nigeria is discussed. The diversity is compared at a national level and between the ecoregions within the national boundaries of the study area. A new species, Dacus goergeni sp. nov. is described and additional taxonomic notes are presented.

  2. Monitoring and Varietal Screening Cucurbit Fruit Fly, Bactrocera cucurbitae Coquillett (Diptera: Tephritidae on Cucumber in Bhaktapur and Kathmandu, Nepal

    Directory of Open Access Journals (Sweden)

    Ranju Maharjan

    2015-12-01

    Full Text Available Monitoring of cucurbit fruit fly by using four different types of traps was conducted in Sipadole VDC of Bhaktapur district during 2012 to observe the population dynamics. Three different types of fruit flies were recorded, in which the number of B. cucurbitae dominated to other species. Only B. cucurbitae damaged the cucumber, which was trapped 92.68%, 87.05%, 90.61%, and 69.38% in cue-lure, banana pulp bait, sticky traps and fly catcher, respectively. The highest number of fruit flies (167.5 male fruit flies/3traps was recorded in cue-lure trap during the first week of September, which coincided with 85.45% RH and 21.67°C and 25.04°C minimum and maximum temperature, respectively. Positive relation of temperature, relative humidity and fruit fly catches was observed. Thus, cue-lure was the most effective traps for monitoring of fruit fly population. In varietal screening, among the six different varieties of cucumber, i.e. Kathmandu local, Kusle, Kamini, Malini, Kasinda and Mahyco Green Long, they were highly significant difference in yield. Kamini gave the highest marketable fruit 26.66 mt/ha yield and the lowest by Kusle (5.05 mt/ha. All the varieties were affected by cucurbit fruit fly. The highest number of unmarketable fruit set was observed in Kamini (22.29 fruits/plant.

  3. Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ Diversity of fruit flies in citrus groves in the municipality of Araruama, RJ

    Directory of Open Access Journals (Sweden)

    Jorge Ferreira de Souza

    2008-04-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck e tangerina (Citrus reticulata Blanco, no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.This study was aimed at determining the species of Tephritidae and Lonchaeidae (Diptera: Tephritoidea that occur on groves of sweet orange (Citrus sinensis Osbeck and tangerine (Citrus reticulata Blanco in the municipality of Araruama, state of Rio de Janeiro, Brazil, from December, 2002 to November, 2003. The specimens were collected by McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruits samples of six varieties of citrus. In the traps the total of 2,543 adults of Tephritoidea (1,430 females and 1,023 males was captured, being ten species of Tephritidae, four species and two morphotypes of Lonchaeidae. From the Tephritidae caught by the McPhail, four species (Anastrepha fraterculus, A. obliqua, A. sororcula and Ceratitis capitata infested citric fruits while the Lonchaeidae, the morphotypes did not infest

  4. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  5. Plastid transformation in cabbage (Brassica oleracea L. var. capitata L.) by the biolistic process.

    Science.gov (United States)

    Tseng, Menq-Jiau; Yang, Ming-Te; Chu, Wan-Ru; Liu, Cheng-Wei

    2014-01-01

    Cabbage (Brassica oleracea L. var. capitata L.) is one of the most important vegetable crops grown worldwide. Scientists are using biotechnology in addition to traditional breeding methods to develop new cabbage varieties with desirable traits. Recent biotechnological advances in chloroplast transformation technology have opened new avenues for crop improvement. In 2007, we developed a stable plastid transformation system for cabbage and reported the successful transformation of the cry1Ab gene into the cabbage chloroplast genome. This chapter describes the methods for cabbage transformation using biolistic procedures. The following sections are included in this protocol: preparation of donor materials, coating gold particles with DNA, biolistic bombardment, as well as the regeneration and selection of transplastomic cabbage plants. The establishment of a plastid transformation system for cabbage offers new possibilities for introducing new agronomic and horticultural traits into Brassica crops.

  6. Origanum vulgare and Thymbra capitata Essential Oils from Spain: Determination of Aromatic Profile and Bioactivities.

    Science.gov (United States)

    Carrasco, Alejandro; Perez, Enrique; Cutillas, Ana-Belen; Martinez-Gutierrez, Ramiro; Tomas, Virginia; Tudela, Jose

    2016-01-01

    Oregano (Thymbra capitata and Origanum vulgare) essential oils (EOs), cultivated and extracted in the South-East of Spain, were analysed by GC/MS to determine their composition. (E)-β-Caryophyllene (0.5-4.9%), thymol (0.2-5.8%), p-cymene (3.8-8.2%), γ-terpinene (2.1-10.7%) and carvacrol (58.7-77.4%) were determined as the main molecules. This characterisation was completed with enantioselective gas chromatography, where (-)-(E)-β-caryophyllene, (+)-a- pinene and (+)-β-pinene were determined as the main enantiomers. Antioxidant activity was evaluated positively by several methods, accounting for activity against free radicals and reducing power. Important inhibitory activity on lipoxygenase (LOX) and acetylcholinesterase (AChE) was observed supporting potential anti-inflammatory, anti-Alzheimer and insecticidal activities, mainly due to carvacrol. These properties support the potential use of oregano EOs as natural cosmetic and natural pharmaceutical ingredients.

  7. Experimental and DFT studies on the antioxidant activity of a C-glycoside from Rhynchosia capitata

    Science.gov (United States)

    Praveena, R.; Sadasivam, K.; Kumaresan, R.; Deepha, V.; Sivakumar, Raman

    2013-02-01

    Rhynchosia capitata (=Glycine capitata) Heyne ex roth, was found to possess polyphenolics including flavonoids, which acts as potential antioxidant. The study of ethanolic extract of roots and leaves reveals that the leaves possess high polyphenolics including flavonoids than roots. This was also confirmed by DPPH radical scavenging activity. Leaf powder of the plant was extracted with different solvents by soxhlet apparatus in the order of increasing polarity. The DPPH scavenging activity of methanol fraction was found to be high compared to the crude extract and other fractions. Nitric oxide scavenging activity was dominant in chloroform fraction compared to methanol fraction. Presence of flavonoids especially vitexin, a C-glycoside in methanol and chloroform fractions were confirmed by high pressure thin layer chromatography (HPTLC) analysis. The structural and molecular characteristics of naturally occurring flavonoid, vitexin was investigated in gas phase using density functional theory (DFT) approach with B3LYP/6-311G(d,p) level of theory. Analysis of bond dissociation enthalpy (BDE) reveals that the OH site that requires minimum energy for dissociation is 4'-OH from B-ring. To explore the radical scavenging activity of vitexin, the adiabatic ionization potential, electron affinity, hardness, softness, electronegativity and electrophilic index properties were computed and interpreted. The nonvalidity of Koopman's theorem has been verified by the computation of Eo and Ev energy magnitudes. Interestingly, from BDE calculations it was observed that BDE for 4'-OH, 5-OH and 7-OH are comparatively low for vitexin than its aglycone apigenin and this may be due to the presence of C-8 glucoside in vitexin. To substantiate this, plot of frontier molecular orbital and spin density distribution analysis for neutral and the corresponding radical species for the compound vitexin have been presented.

  8. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, Paolo; Scolari, Francesca; Gomulski, Ludvik M; Falchetto, Marco; Manni, Mosè; Gabrieli, Paolo; Field, Linda M; Zhou, Jing-Jiang; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The Mediterranean fruit fly, Ceratitis capitata (medfly), is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs). A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs) were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera Bactrocera and

  9. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Paolo Siciliano

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (medfly, is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs. A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera

  10. An agent-based simulation of extirpation of Ceratitis capitata applied to invasions in California.

    Science.gov (United States)

    Manoukis, Nicholas C; Hoffman, Kevin

    2014-01-01

    We present an agent-based simulation (ABS) of Ceratitis capitata ("Medfly") developed for estimating the time to extirpation of this pest in areas where quarantines and eradication treatments were immediately imposed. We use the ABS, implemented in the program MED-FOES, to study seven different outbreaks that occurred in Southern California from 2008 to 2010. Results are compared with the length of intervention and quarantine imposed by the State, based on a linear developmental model (thermal unit accumulation, or "degree-day"). MED-FOES is a useful tool for invasive species managers as it incorporates more information from the known biology of the Medfly, and includes the important feature of being demographically explicit, providing significant improvements over simple degree-day calculations. While there was general agreement between the length of quarantine by degree-day and the time to extirpation indicated by MED-FOES, the ABS suggests that the margin of safety varies among cases and that in two cases the quarantine may have been excessively long. We also examined changes in the number of individuals over time in MED-FOES and conducted a sensitivity analysis for one of the outbreaks to explore the role of various input parameters on simulation outcomes. While our implementation of the ABS in this work is motivated by C. capitata and takes extirpation as a postulate, the simulation is very flexible and can be used to study a variety of questions on the invasion biology of pest insects and methods proposed to manage or eradicate such species.

  11. Landing and Oviposition Responses of Rhagoletis indifferens (Dipt., Tephritidae) on Sweet Cherry Treated with Kaolin- and Limestone-Based Products

    Science.gov (United States)

    Kaolin- and limestone-based products were compared for their effects on landing and oviposition on sweet cherry by Rhagoletis indifferens Curran (Dipt., Tephritidae). Surround (95% calcined kaolin), Cocoon (100% hydrous kaolin), Eclipse (>97% limestone), and Purshade (62.5% limestone) were studied....

  12. Germination ecology of Rhynchosia capitata: an emerging summer weed in Asia Ecologia da germinação de Rhynchosia capitata: planta daninha emergente durante o verão na Ásia

    Directory of Open Access Journals (Sweden)

    H.H. Ali

    2013-06-01

    Full Text Available Rhynchosia capitata is becoming an increasing problem in summer crops, such as cotton, soybean, pearl millet and mungbean in many Asian countries. Laboratory and greenhouse studies have been conducted to determine the effects of several environmental factors on seed germination patterns and seedling emergence of R. capitata. We investigated whether the diverse ecological factors such as temperature, light, salinity, moisture stress, pH, and soil depth affected germination and seedling emergence of R. capitata. Germination increased as temperature increased from 25ºC and significantly reduced at 45ºC. Presence or absence of light did not influence germination. Germination of R. capitata was sensitive to increased salt and moisture stress, as well as to seed burial depth. Only 48% of seeds germinated at 150 mM salt concentration compared to 100% in control (distilled water. Similarly, 15% of seeds germinated at an osmotic potential of ‑0.8 MPa compared to 88% at ‑0.2 MPa. The optimum pH for seed germination of R. capitata was 7 (98% germination, but the seeds also germinated at lower level of pH 5 (85% and at higher level of pH 10 (75%. In seed burial trial, maximum seedling emergence of 93% occurred at 2 cm depth, and seedling did not emerge from a depth of 12 cm. The high germination ability of R. capitata under a wide range of ecological factors suggests that this species is likely to be the one to cause more problems in a near future, if not managed appropriately.A Rhynchosia capitata vem se tornando um problema crescente para culturas de verão como algodão, soja, milheto e feijão-mungo em muitos países asiáticos. Foram feitos estudos de laboratório e estufa para determinar os efeitos de vários fatores ambientais sobre os padrões de germinação das sementes e emergência das plântulas de R. capitata. Diversos fatores ecológicos, tais como, temperatura, luz, salinidade, estresse hídrico, pH e profundidade do solo foram

  13. SENSIBILIDADE DE OVOS DE Ceratitis capitata (WIED., 1824 IRRADIADOS EM DIETA ARTIFICIAL E EM FRUTOS DE MANGA (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    A RAGA

    1996-01-01

    Full Text Available O objetivo deste trabalho foi determinar as doses de radiação gama que impedissem a emergência de adultos de Ceratitis capitata, a partir de ovos irradiados em dieta artificial e em frutos de manga. Quinhentos ovos de 6, 12, 24 e 48 horas de idade foram irradiados em cada dose. A infestação artificial de ovos ocorreu em mangas das cultivares Haden, Tommy Atkins ou Keitt. Um aumento da radioresistência de ovos foi observado durante o desenvolvimento embrionário, e para ovos de 48 horas em dieta artificial, foi estimado um Probit 9 de 24,67Gy. Não foi observada influência significativa dos frutos de manga na eficiência da irradiação dos ovos, quando comparada com os testes em dieta artificial.The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata (Wied. adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four- and fourty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of `Haden', `Tommy Atkins' and `Keitt' cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation.

  14. Genomic structure and expression analysis of the RNase kappa family ortholog gene in the insect Ceratitis capitata.

    Science.gov (United States)

    Rampias, Theodoros N; Fragoulis, Emmanuel G; Sideris, Diamantis C

    2008-12-01

    Cc RNase is the founding member of the recently identified RNase kappa family, which is represented by a single ortholog in a wide range of animal taxonomic groups. Although the precise biological role of this protein is still unknown, it has been shown that the recombinant proteins isolated so far from the insect Ceratitis capitata and from human exhibit ribonucleolytic activity. In this work, we report the genomic organization and molecular evolution of the RNase kappa gene from various animal species, as well as expression analysis of the ortholog gene in C. capitata. The high degree of amino acid sequence similarity, in combination with the fact that exon sizes and intronic positions are extremely conserved among RNase kappa orthologs in 15 diverse genomes from sea anemone to human, imply a very significant biological function for this enzyme. In C. capitata, two forms of RNase kappa mRNA (0.9 and 1.5 kb) with various lengths of 3' UTR were identified as alternative products of a single gene, resulting from the use of different polyadenylation signals. Both transcripts are expressed in all insect tissues and developmental stages. Sequence analysis of the extended region of the longer transcript revealed the existence of three mRNA instability motifs (AUUUA) and five poly(U) tracts, whose functional importance in RNase kappa mRNA decay remains to be explored.

  15. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros Attractiveness of food baits to the fruit flies in citrus orchard

    Directory of Open Access Journals (Sweden)

    Adalton Raga

    2006-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritoidea são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied. e Ceratitis capitata (Wied.. O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atrativos testados foram: proteínas hidrolisadas comerciais Bio Anastrepha, Isca Mosca e Aumax®, todas diluídas em água a 5%; melaço a 7% isoladamente e melaço a 7% em mistura com suco de laranja a 10%. Foram utilizados semanalmente, 400mL da solução atrativa por frasco plástico McPhail instalado na copa de laranjeiras da variedade 'Pêra Rio'. As soluções eram renovadas semanalmente, ocasião em que os adultos eram coletados e çevados ao laboratório para contagem, sexagem e identificação. Foram capturados 1.821 adultos de Tephritoidea, sendo 892 de Anastrepha spp., 731 de C. capitata e 198 de Neosilba spp. Para essas espécies, as proteínas Bio Anastrepha e Isca Mosca foram altamente eficientes e semelhantes entre si, capturando 44,5% e 41,3% dos adultos de Tephritidae respectivamente. Não houve diferença entre as espécies de Tephritidae analisadas por sexo capturadas em Bio Anastrepha, Aumax® e melaço. Aumax®, melaço isoladamente e melaço + suco de laranja atraíram apenas 4,6%, 1,3% e 1,2% do total de adultos de Tephritidae, respectivamente. Melaço isoladamente e melaço com suco de laranja foram mais eficazes na atratividade de Zaprionus indianus (Gupta (Diptera: Drosophilidae.Fruit flies (Diptera: Tephritoidea are key pests in citrus production in the State of São Paulo, Brazil, mainly Anastrepha fraterculus (Wied. and Ceratitis capitata (Wied.. The objective of this study was to evaluate food baits to monitor fruit fly

  16. Respuesta de ecotipos de Stylosanthes capitata a dosis de cobre en solución nutritiva

    Directory of Open Access Journals (Sweden)

    Pizarro Esteban A.

    1986-09-01

    Full Text Available La solución nutritiva de Arnon y Hoagland se modificó a 1/10 para simular las condiciones de acidez y fertilidad del suelo de las sabanas bien drenadas isohipertérmicas de los Llanos Orientales de Colombia. Se usaron seis concentraciones de cobre (0,0.05, 0.1, 0.2, 0.4 Y 0.8 ppm. la solución nutritiva se renovó cada 15 días y se aplicaron nitrógeno (14 ppm/semana e hierro (1 ppm, 3/semana. La cantidad de materia seca producida por los ecotipos y el cultivar Capica en los tratamientos de 0.2, 0.4 Y0.8 ppm Cu, fue relativamente te nula. La producción de materia seca de la parte aérea, raíz y total de la planta fue diferente en los ecotipos de S capitata. Así mismo hubo diferencias significativas en la concentración, absorción y translocación del cobre por lo ecotipos y el cultivar Capica. El requerimiento diferencial de cobre, manifestado en la producción de materia seca en la parte aérea en el nivel 0.05 ppr por los ecotipos CIAT 1693 y 1728 por el cultivar Capica (CIAT 102801, se define como el resultado de las relaciones evolutivas de cada ecotipo con el nivel de cobre disponible en la solución del suelo.In the greenhouse ecotypes of Stylosanthes capitata were cultivated to observe their behavior under different copper concentrations. A nutrient solution based on Arnon and Hoagland's (1/10 was used to simulate the acidity and the fertility of well drained savannas of the Eastern Planes of Colombia. Six concentrations of copper were used (O, 0.05, 0.1, 0.2, 0.4 and 0.8 ppm with rewal of the nutrient solution every 15 days, and applications of nitrogen (14 ppm/week and iron (1 ppm, three times/week. The dry matter quantity produced by the ecotypes and the Capica cultivar under treatments of 0.2, 0.4 and 0.8 ppm Cu, relatively nill. A differential behavior of Stylosanthes capitata ecotypes responses to applied copper was observed in relation to dry matter production in aerial, part, root and total plant. So, there were significant

  17. New genetic tools for improving SIT in Ceratitis capitata: embryonic lethality and sperm marking

    Energy Technology Data Exchange (ETDEWEB)

    Schetelig, Marc F.; Wimmer, Ernst A. [Georg-August-University, Gottingen (Germany). Johann-Friedrich Blumenbach Institute of Zoology and Anthropology. Gottingen Center for Molecular Biosciences; Scolari, Francesca; Gasperi, Giuliano [Universita di Pavia (Italy). Dipt. di Biologia Animale; Handler, Ernst A. [U.S. Department of Agriculture (USDA/ARS), Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural and Veterinary Entomology

    2006-07-01

    Environment friendly sterile insect technique (SIT) is being applied effectively as a component of area-wide integrated pest management (AW-IPM) for Ceratitis capitata since 1970s. Nevertheless improved biological strategies are needed to increase the efficacy of AW-IPM. Transgenic approaches should increase and widen the applicability of such programmes to different pest species. In this respect two major strategies are followed: First an approach to cause sterility was designed without interfering with spermatogenesis to maintain males and their sperm as competitive as possible. We followed a strategy, which is based on the expression of a lethal factor under the control of a promoter that is active at early blastoderm stages. The system employs the ectopic expression of a hyperactive pro apoptotic gene that causes embryo-specific lethality when driven by the tetracycline-controlled trans activator tTA under the regulation of a cellularization gene enhancer/promoter. The system has been tested successfully in Drosophila melanogaster (Horn and Wimmer 2003). We tried the direct transfer of the Drosophila system to Ceratitis capitata by injecting the respective constructs that carry Drosophila-derived promoters. Unfortunately, the cellularization specific promoters from Drosophila seem not functional in Ceratitis. Therefore, the corresponding enhancers/promoters from Ceratitis were isolated and subsequently the tTA was brought independently under the control of each enhancer/promoter region. These constructs were injected in Ceratitis for further evaluation. Second, we have engineered a medfly strain carrying a sperm marking system. This strain carries two fluorescent markers. One (turboGFP) marker is under the control of the spermatogenesis specific b2-tubulin promoter from Ceratitis and is therefore sperm specifically expressed. The second (DsRed) is under the control of the poly ubiquitin promoter of Drosophila. Released males from this strain could be

  18. Sublethal effect of neem extract on mediterranean fruit fly adults Efeito subletal de extratos de Azadirachta indica Sobre adultos de Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Márcio Alves Silva

    2013-03-01

    Full Text Available The sublethal effect of extracts of Azadirachta indica on Ceratitis capitata was evaluated. Two pairs of flies were treated in plastic tubes with cotton placed in plastic cages. An artificial diet (hydrolyzed protein + sugar was provided ad libitum. The extracts affected significantly the longevity of C. capitata. The pre-oviposition period were not significantly affected by the extracts. The A. indica branches extracted with dichloromethane (888 ppm affected significantly the fecundity and fertility, reducing the number of eggs laid to approximately 80 % and the egg hatching by 30 % at the 8th day. Therefore, the neem branches extracted with dichloromethane affected the reproduction of C. capitata.Neste estudo, avaliou-se o efeito subletal de extratos de Azadirachta indica sobre Ceratitis capitata. Os tratamentos em um tubo plástico com algodão foram expostos para dois casais numa gaiola plástica. Nessa gaiola, também foi fornecida dieta artificial (proteína hidrolisada + açúcar ad libitum. Os extratos afetaram significativamente a longevidade de C. capitata. O período de pré-oviposição não foi significativamente afetado pelos extratos. Em contrapartida, o extrato de ramos em diclorometano (888 ppm afetou a fecundidade e a fertilidade, reduzindo em 80% o número de ovos colocados e a viabilidade dos ovos em 30%, no 8º dia. Portanto, o extrato de ramos em diclorometano afeta a reprodução de C. capitata.

  19. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata) in hydroponics.

    Science.gov (United States)

    Ali, Sajid; Shahbaz, Muhammad; Shahzad, Ahmad Naeem; Khan, Hafiz Azhar Ali; Anees, Moazzam; Haider, Muhammad Saleem; Fatima, Ammara

    2015-01-01

    Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata) to elevated Cu(2+) levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu(2+) levels, although it was substantially decreased at ≥5 µ M Cu(2+) in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu(2+) indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu(2+) the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins).

  20. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata in hydroponics

    Directory of Open Access Journals (Sweden)

    Sajid Ali

    2015-08-01

    Full Text Available Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata to elevated Cu2+ levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu2+ levels, although it was substantially decreased at ≥5 µ M Cu2+ in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu2+ indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu2+ the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins.

  1. The nitrogen and nitrate economy of butterhead lettuce (Lactuca sativa var capitata L).

    Science.gov (United States)

    Broadley, Martin R; Seginer, Ido; Burns, Amanda; Escobar-Gutiérrez, Abraham J; Burns, Ian G; White, Philip J

    2003-09-01

    Quantifying and simulating the relationships between crop growth, total-nitrogen (total-N) and nitrate-N (NO3--N) concentration can improve crop nutritional husbandry. In this study, the relationship between shoot relative growth rate (RGR) and shoot total-N, organic-N and NO3--N concentration of hydroponically-grown lettuce (Lactuca sativa var. capitata L. cv. Kennedy) was described and simulated. Plants were grown hydroponically for up to 74 d. Nitrogen was supplied throughout (control; T1), or removed at 35 d (T2) and 54 d (T3), respectively, after sowing. The organic-N and NO3--N concentration declined in the shoots of control plants with growth, until commercial maturity approached when organic-N and NO3--N concentration increased. There were sub-linear relationships between both total-N and organic-N concentration, and shoot RGR, in the N-limited treatments, i.e. shoot RGR approached an asymptote at high shoot N concentration. The proportional effects of total-N and organic-N concentration on shoot RGR were independent of plant age. A dynamic simulation model ('Nicolet'), derived previously under different conditions, was used to simulate the growth, dry matter content, organic-N, and NO3--N concentration of lettuce grown under the extreme N-stress conditions experienced by the plants. In view of the largely successful fitting of the model to experimental data, the model was used to interpret the results. Suggestions for model improvement are made.

  2. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Ludvik M Gomulski

    Full Text Available Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  3. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Gomulski, Ludvik M; Dimopoulos, George; Xi, Zhiyong; Scolari, Francesca; Gabrieli, Paolo; Siciliano, Paolo; Clarke, Anthony R; Malacrida, Anna R; Gasperi, Giuliano

    2012-01-01

    Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  4. Sperm storage and use in polyandrous females of the globally invasive fruitfly, Ceratitis capitata.

    Science.gov (United States)

    Bertin, Sabrina; Scolari, Francesca; Guglielmino, Carmela R; Bonizzoni, Mariangela; Bonomi, Angelica; Marchini, Daniela; Gomulski, Ludvik M; Gasperi, Giuliano; Malacrida, Anna R; Matessi, Carlo

    2010-11-01

    The medfly, Ceratitis capitata, is an invasive species in which polyandry, associated with sperm precedence, is a common behaviour in the wild. In this species, characterized by internal fertilization, we disclose how the sperm from two males are stored in the female storage organs and how they are used in terms of paternity outcome. The experiments were designed to furnish comparable and unbiased estimates of sperm numbers and progeny in twice-mated females. Results are incorporated in a model through which it is possible to relate the amount of stored sperm with the progeny of twice-mated females. The results show that polyandrous medfly females conserve equal amounts of sperm from the two males to fertilize their eggs. However, we observed a clear advantage of the second male's sperm in siring progeny, which interestingly decreases in favor of the first male as ovipositions progress. The results enable us to exclude differential sperm mortality and suggest that it is the mechanics governing the storage organs which causes the initial, but decreasing second male sperm precedence during the female reproductive life. These outcomes allow us to correlate sperm use in polyandrous females with the mating strategies and invasiveness of this fly.

  5. Thermotolerance and HSP70 expression in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Kalosaka, Katerina; Soumaka, Elisavet; Politis, Nikos; Mintzas, Anastassios C

    2009-06-01

    The relationship between Hsp70 expression and thermotolerance has been well documented in Drosophila melanogaster. However, there is limited information on this relationship in other insect species. In this report we describe the Hsp70-thermotolerance relationship in one of the major fruit fly pests, Ceratitis capitata (medfly). Hsp70 expression and thermotolerance were assayed at a range of temperatures in several stages of medfly development. The most thermotolerant stage was found to be the late larval stage (100% survival at 41 degrees C) followed by adult flies and late embryos (100% survival at 39 degrees C). These three stages showed a positive relationship between Hsp70 expression and thermotolerance. Mid-larval and mid-embryonic stages were found less thermotolerant and the Hsp70-thermotolerance relationship was not evident. Early embryos did not express Hsp70 at any temperature and exhibited the lowest thermotolerance. The relationship between Hsp70 and inducible thermotolerance was also studied in late larvae. A pretreatment at 37-39 degrees C increased thermotolerance at higher temperatures by approximately 1 degrees C. In parallel, the pretreatment increased Hsp70 expression suggesting a close link between Hsp70 expression and inducible thermotolerance. The increased Hsp70 levels after pretreatment were found to be due to the increased levels of the hsp70 RNA.

  6. Formation and structural organization of the egg-sperm bundle of the scleractinian coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, J. L.; Weatherby, T. M.; Waller, R. G.; Gates, R. D.

    2011-06-01

    The majority of scleractinian corals are hermaphrodites that broadcast spawn their gametes separately or packaged as egg-sperm bundles during spawning events that are timed to the lunar cycle. The egg-sperm bundle is an efficient way of transporting gametes to the ocean surface where fertilization takes place, while minimizing sperm dilution and maximizing the opportunity for gamete encounters during a spawning event. To date, there are few studies that focus on the formation and structure of egg-sperm bundle. This study explores formation, ultrastructure, and longevity of the egg-sperm bundle in Montipora capitata, a major reef building coral in Hawai`i. Our results show that the egg-sperm bundle is formed by a mucus layer secreted by the oocytes. The sperm package is located at the center of each bundle, possibly reflecting the development of male and female gametes in different mesenteries. Once the egg-sperm bundle has reached the ocean surface, it breaks open within 10-35 min, depending on the environmental conditions (i.e., wind, water turbulence). Although the bundle has an ephemeral life span, the formation of an egg-sperm bundle is a fundamental part of the reproductive process that could be strongly influenced by climate change and deterioration of water quality (due to anthropogenic effects) and thus requires further investigation.

  7. Tabanid flies (Insecta: Diptera from Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Kailash Chandra

    2015-08-01

    Full Text Available The paper presents an account on the Tabanidae (Diptera from Chhattisgarh, which includes 16 species representing five genera under three subfamilies: Pangoniinae, Chrysopsinae and Tabaninae. Among these species, Haematopota latifascia Ricardo is new addition to the fauna of Chhattisgarh. The distributional area of the collection localities, key characters are also provided. 

  8. Nieuwe en zeldzame vliegen voor de Nederlandse fauna (Diptera)

    NARCIS (Netherlands)

    Aartsen, van B.

    1997-01-01

    New and rare flies for the Dutch fauna (Diptera) In this paper an overview is given of captures of rare and interesting Diptera, belonging to different families, mainly from the years 19941996. In total 46 species are presented, of which 13 are new to the Dutch fauna (marked with an *), viz.: Spania

  9. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.

    2002-01-01

    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  10. Nitrate reductase activity in cabbage (Brassica oleracae var. capitata seedlings affected by the different nitrogen fertilizer forms

    Directory of Open Access Journals (Sweden)

    Metin Turan

    2013-12-01

    Full Text Available The effect of different nitrogen fertilizer (potassium nitrate, ammonium nitrate, ammonium sulphate, urea and farmyard manure on nitrate reductase activity in cabbage (Brassica oleracea var. capitata seedlings were studied. pH of the plant growth niedia was higher in the nitrate fertilizer treatment than the ammonium and other fertilizer forms. NO3--N application increased NRA in plant, but NH4+-N decreased NRA in plant. Harvesting date and different fertilizer doses increased NRA while NH4+-N decreased plant nitrate uptake. There was a significant relationship between NRA and fertilizer types.

  11. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain

    Science.gov (United States)

    Augustinos, Antonios A.; Rajamohan, Arun; Kyritsis, Georgios A.; Zacharopoulou, Antigone; Haq, Ihsan ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M. M.

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper. PMID:27537351

  12. Chill-coma recovery time, age and sex determine lipid profiles in Ceratitis capitata tissues.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Fagali, Natalia Soledad; Rabossi, Alejandro; Catalá, Ángel; Quesada-Allué, Luis Alberto

    2016-04-01

    The remodeling of membrane composition by changes in phospholipid head groups and fatty acids (FA) degree of unsaturation has been associated with the maintenance of membrane homeostasis under stress conditions. Overall lipid levels and the composition of cuticle lipids also influence insect stress resistance and tissue protection. In a previous study, we demonstrated differences in survival, behavior and Cu/Zn superoxide dismutase gene expression between subgroups of Ceratitis capitata flies that had a reversible recovery from chill-coma and those that developed chilling-injury. Here, we analyzed lipid profiles from comparable subgroups of 15 and 30-day-old flies separated according to their recovery time after a chill-coma treatment. Neutral and polar lipid classes of chill-coma subgroups were separated by thin layer chromatography and quantified by densitometry. FA composition of polar lipids of chill-coma subgroups and non-stressed flies was evaluated using gas chromatography coupled to mass spectrometry. Higher amounts of neutral lipids such as triglycerides, diacylglycerol, wax esters, sterol esters and free esters were found in male flies that recovered faster from chill-coma compared to slower flies. A multivariate analysis revealed changes in patterns of storage and cuticle lipids among subgroups both in males and females. FA unsaturation increased after cold exposure, and was higher in thorax of slower subgroups compared to faster subgroups. The changes in neutral lipid patterns and FA composition depended on recovery time, sex, age and body-part, and were not specifically associated with the development of chilling-injury. An analysis of phospholipid classes showed that the phosphatidylcholine to lysophosphatidylcholine ratio (PC/LPC) was significantly higher, or showed a tendency, in subgroups that may have developed chilling-injury compared to those with a reversible recovery from coma.

  13. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain.

    Science.gov (United States)

    Augustinos, Antonios A; Rajamohan, Arun; Kyritsis, Georgios A; Zacharopoulou, Antigone; Haq, Ihsan Ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M M

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper.

  14. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann),Version 2.0

    Science.gov (United States)

    MEDHOST,Version 2.0 is the second revision of:"MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly,Ceratitis capitata(Wiedemann),Version 1.0," which was released in 1998 as a Windows-based executable database and listed all plant species reported as hosts of Medit...

  15. Insecticidal Activity of Basil Oil, trans-Anethole, Estragole, and Linalool to Adults of Ceratitis capitata, Bactrocera dorsalis, and B. cucurbitae

    Science.gov (United States)

    Pest tephritid fruit flies, Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and B. cucurbitae (Cocquillett) are among the species of economic significance. Their management has primarily relied on the use of food baits, male attractants and their combinations with insecticides. Basil o...

  16. Assessment of differences between X and gamma rays in order to validate a new generation of irradiators for insect sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago; Walder, Julio M.M., E-mail: piaui@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil); Parker, Andrew G.; Jessup, Andrew; Orozco-Davila, Dina; Islam, Amirul; Dammalage, Thilakasiri, E-mail: A.Jessup@iaea.or [Joint FAO/IAEA-UN A-2444, Seibersdorf (Austria). Insect Pest Control Subprogramme; Pereira, Rui, E-mail: R.Cardoso-Pereira@iaea.or [Joint FAO/IAEA-UN, Vienna (Austria). Insect Pest Control Subprogramme

    2009-07-01

    Recent fears of terrorism provoked an increase in delays and denials of transboundary shipments of radioisotopes. This represents a serious constraint to sterile insect technique (SIT) programs around the world as they rely on the use of ionizing energy from radioisotopes for insect sterilization. In order to validate a novel Xray irradiator, a series of studies on Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) were carried out, comparing the relative biological effectiveness (RBE) between X-rays and traditional gamma radiation from {sup 60}Co. Male C. capitata pupae and pupae of both sexes of A. fraterculus, both 24 to 48 h before adult emergence, were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Estimated mean doses of 91.2 Gy of X and 124.9 Gy of gamma radiation induced 99% sterility in C. capitata males. Irradiated A. fraterculus were 99% sterile at about 40-60 Gy for both radiation treatments. Standard quality control parameters were not significantly affected by the two types of radiation. There were no significant differences between X and gamma radiation regarding mating indices. The RBE did not differ significantly between the tested X and gamma radiation, and X-rays are as biologically effective for SIT purposes as gamma rays are. This work confirms the suitability of this new generation of X-ray irradiators for pest control programs in UN Member States. (author)

  17. Hole diameters in pet bottles used for fruit fly capture

    Directory of Open Access Journals (Sweden)

    Maurico Paulo Batistella Pasini

    2015-05-01

    Full Text Available Two experiments were conducted during the period from 31 January to 6 March 2012 in Santa Maria, Rio Grande do Sul State, Brazil to determine the efficiency of different hole diameters in PET trap bottles on pests in guava and persimmon orchards. In a randomised block design in a factorial scheme, we assessed the average number adults of Anastrepha fraterculus, Ceratitis capitata (Diptera: Tephitidae and Zaprionus indianus (Diptera: Drosophilidae infruits thatemerged in two situations (in the plant and on the soil; we also assessed the number of captured adults in trap bottlesunder two conditions, different hole diameters and different days after placement of the attractive solution. Smaller diameter sizescaptured more A. fraterculus, C. capitata and Z. indianusadults. The 1.0 cm diameter was the most efficient hole size in reducing the adult emergence of Tephritidae to Z. indianus, whereas the smallest diameter hole sizes, 0.6 and 0.8 cm, showed the highest efficiencies in controlling adult emergence in persimmon fruit and guava fruit.

  18. Tissue loss (white syndrome) in the coral Montipora capitata is a dynamic disease with multiple host responses and potential causes

    Science.gov (United States)

    Work, Thierry M.; Russell, Robin; Aeby, Greta S.

    2012-01-01

    Tissue loss diseases or white syndromes (WS) are some of the most important coral diseases because they result in significant colony mortality and morbidity, threatening dominant Acroporidae in the Caribbean and Pacific. The causes of WS remain elusive in part because few have examined affected corals at the cellular level. We studied the cellular changes associated with WS over time in a dominant Hawaiian coral, Montipora capitata, and showed that: (i) WS has rapidly progressing (acute) phases mainly associated with ciliates or slowly progressing (chronic) phases mainly associated with helminths or chimeric parasites; (ii) these phases interchanged and waxed and waned; (iii) WS could be a systemic disease associated with chimeric parasitism or a localized disease associated with helminths or ciliates; (iv) corals responded to ciliates mainly with necrosis and to helminths or chimeric parasites with wound repair; (v) mixed infections were uncommon; and (vi) other than cyanobacteria, prokaryotes associated with cell death were not seen. Recognizing potential agents associated with disease at the cellular level and the host response to those agents offers a logical deductive rationale to further explore the role of such agents in the pathogenesis of WS in M. capitata and helps explain manifestation of gross lesions. This approach has broad applicability to the study of the pathogenesis of coral diseases in the field and under experimental settings.

  19. Cloning and purification of protein kinase CK2 recombinant alpha and beta subunits from the Mediterranean fly Ceratitis capitata.

    Science.gov (United States)

    Kouyanou-Koutsoukou, Sophia; Baier, Andrea; Kolaitis, Regina-Maria; Maniatopoulou, Evanthia; Thanopoulou, Konstantina; Szyszka, Ryszard

    2011-10-01

    The Mediterranean fruit fly Ceratitis capitata is an insect capable of wreaking extensive damage to a wide range of fruit crops. Protein kinase CK2 is a ubiquitous Ser/Thr kinase that is highly conserved among eukaryotes; it is a heterotetramer composed of two catalytic (α) and a dimer of regulatory (β) subunits. We present here the construction of the cDNA molecules of the CK2α and CK2β subunits from the medfly C. capitata by the 5'/3' RACE and RT-PCR methods, respectively. CcCK2α catalytic subunit presents the characteristic and conserved features of a typical protein kinase, similar to the regulatory CcCK2β subunit, that also possess the conserved features of regulatory CK2β subunits, as revealed by comparison of their predicted amino acid sequences with other eukaryotic species. The recombinant CcCK2α and CcCK2β proteins were purified by affinity chromatography to homogeneity, after overexpression in Escherichia coli. CcCK2α is capable to utilize GTP and its activity and is inhibited by polyanions and stimulated by polycations in phosphorylation assays, using purified acidic ribosomal protein P1 as a substrate.

  20. 地中海实蝇幼虫分子鉴定%Molecular identification for larvae of Ceratitis capitata

    Institute of Scientific and Technical Information of China (English)

    叶军; 周国梁; 易建平; 吴家教; 阮长浩; 梁帆; 郑建中; 王文兵

    2007-01-01

    通过对从秘鲁进口的葡萄中截获实蝇类幼虫进行ITS区和线粒体CO Ⅰ,COⅡ,COⅢ、ND5基因序列的扩增和测序,并与GenBank中对应的序列进行比对,结果表明,截获样品ITS区序列和地中海实蝇Ceratitis capitata(Wiedemann)同源性为95.16%(其中ITS1为99.52%,ITS2为86.2%),线粒体COⅠ,COⅡ,COⅢ,ND5基因序列和地中海实蝇C.capitata同源性为100%,99.9%,99.5%,99.8%;基于CO Ⅰ序列构建的系统发育树中,幼虫样品和地中海实蝇最为接近.根据序列分析和系统发育关系分析的结果,将截获的实蝇类幼虫鉴定为地中海实蝇C.capitata.

  1. Toxicity of naturally occurring Bio-fly and chitosan compounds to control the Mediterranean fruit fly Ceratitis capitata (Wiedemann).

    Science.gov (United States)

    Rabea, E I; Nasr, H M; Badawy, M E I; El-Gendy, I R

    2015-01-01

    The efficacy of five compounds of a biopolymer chitosan and Bio-fly (Beauveria bassiana fungus) as biopesticide was evaluated on Ceratitis capitata under laboratory conditions. The inhibitory effects on acetylcholinesterase (AChE) and adenosinetriphosphatase (ATPase) as biochemical indicators were also determined in vivo. The results indicated that B. bassiana based Bio-fly exhibited significant toxicity against C. capitata (LC50 = 3008 and 3126 mg/L after 48 h in females and males, respectively) followed by the derivatives of chitosan, N-(4-propylbenzyl)chitosan and N-(2-nitrobenzyl)chitosan. Bio-fly displayed remarkable inhibition of AChE activity (IC50 = 2220 mg/L) while N-(2-chloro,6-flourobenzyl)chitosan, N-(4-propylbenzyl)chitosan and N-(3,4-methylenedioxybenzyl) chitosan had no significant difference in inhibitory action. In adult males, N-(2-nitrobenzyl)chitosan exhibited the highest inhibitory action (IC50 = 6569 mg/L). In addition, the toxic effects of the tested compounds on the activity of ATPase indicated that highly significant inhibition was found with N-(4-propylbenzyl)chitosan with an IC50 of 8194 and 8035 mg/L, in females and males, respectively.

  2. Highly differentiated populations of the freshwater diatom Sellaphora capitata suggest limited dispersal and opportunities for allopatric speciation.

    Science.gov (United States)

    Evans, Katharine M; Chepurnov, Victor A; Sluiman, Hans J; Thomas, Sindu J; Spears, Bryan M; Mann, David G

    2009-08-01

    The diversities and distributions of diatoms are much more complex than was ever imagined. To understand the underlying mechanisms, research must focus on evolutionary processes occurring at a population level and employ sufficiently informative molecular markers. Using ten microsatellites and ITS rDNA sequence data, we investigated the genetic structure of populations of the benthic freshwater diatom Sellaphora capitata (until 2004 a cryptic entity within the S. pupula agg. species complex). This is the first time that microsatellites have been used to investigate the genetic structure of any freshwater or benthic microalga. Using an integrated approach (morphology, DNA barcoding and specificity of the microsatellite primers), we verified the identity of 70 S. capitata isolates obtained from lakes in the UK, Belgium and Australia. Standardized F'(ST) values were very high (>0.4) and in Bayesian analyses, isolates clustered according to their country of origin, with limited evidence of admixture. However, selected isolates from all countries were sexually compatible, a result consistent with limited ITS divergence. Considering the apparent absence of desiccation-resistant resting stages in most diatoms, we conclude that such levels of differentiation are likely to be a consequence of limited dispersal. With restricted dispersal, previously unacknowledged opportunities for allopatric speciation exist, which may help to explain the huge extant diversity of diatoms.

  3. Conserved metallomics in two insect families evolving separately for a hundred million years.

    Science.gov (United States)

    Rempoulakis, Polychronis; Afshar, Negar; Osorio, Beatriz; Barajas-Aceves, Martha; Szular, Joanna; Ahmad, Sohel; Dammalage, Thilakasiri; Tomas, Ulysses Sto; Nemny-Lavy, Esther; Salomon, Mor; Vreysen, Marc J B; Nestel, David; Missirlis, Fanis

    2014-12-01

    Μetal cofactors are required for enzymatic catalysis and structural stability of many proteins. Physiological metal requirements underpin the evolution of cellular and systemic regulatory mechanisms for metal uptake, storage and excretion. Considering the role of metal biology in animal evolution, this paper asks whether metal content is conserved between different fruit flies. A similar metal homeostasis was previously observed in Drosophilidae flies cultivated on the same larval medium. Each species accumulated in the order of 200 µg iron and zinc and approximately ten-fold less manganese and copper per gram dry weight of the adult insect. In this paper, data on the metal content in fourteen species of Tephritidae, which are major agricultural pests worldwide, are presented. These fruit flies can be polyphagous (e.g., Ceratitis capitata) or strictly monophagous (e.g., Bactrocera oleae) or oligophagous (e.g., Anastrepha grandis) and were maintained in the laboratory on five distinct diets based on olive oil, carrot, wheat bran, zucchini and molasses, respectively. The data indicate that overall metal content and distribution between the Tephritidae and Drosophilidae species was similar. Reduced metal concentration was observed in B. oleae. Feeding the polyphagous C. capitata with the diet of B. oleae resulted in a significant quantitative reduction of all metals. Thus, dietary components affect metal content in some Tephritidae. Nevertheless, although the evidence suggests some fruit fly species evolved preferences in the use or storage of particular metals, no metal concentration varied in order of magnitude between these two families of Diptera that evolved independently for over 100 million years.

  4. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. 'Clemenules'

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Miquel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Palou, Lluis [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain)]. E-mail: lluis.palou@ivia.es; Angel del Rio, Miguel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Jacas, Josep-Anton [Departament de Ciencies Experimentals, Universitat Jaume I (UJI), Campus del Riu Sec, E-12071 Castello de la Plana (Spain)

    2007-10-15

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  5. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. ‘Clemenules’

    Science.gov (United States)

    Alonso, Miquel; Palou, Lluís; Ángel del Río, Miguel; Jacas, Josep-Anton

    2007-10-01

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  6. Insecticidal activity of basil oil, trans-anethole, estragole, and linalool to adult fruit flies of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae.

    Science.gov (United States)

    Chang, Chiou Ling; Cho, Il Kyu; Li, Qing X

    2009-02-01

    Basil oil and its three major active constituents (trans-anethole, estragole, and linalool) obtained from basil (Oscimum basilicum L.) were tested on three tephritid fruit fly species [Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and Bactrocera cucurbitae (Coquillett)] for insecticidal activity. All test chemicals acted fast and showed a steep dose-response relationship. The lethal times for 90% mortality/knockdown (LT90) of the three fly species to 10% of the test chemicals were between 8 and 38 min. The toxic action of basil oil in C. capitata occurred significantly faster than in B. cucurbitae but slightly faster than in B. dorsalis. Estragole acted faster in B. dorsalis than in C. capitata and B. cucurbitae. Linalool action was faster in B. dorsalis and C. capitata than in B. cucurbitae. trans-Anethole action was similar to all three species. Methyl eugenol acted faster in C. capitata and B. cucurbitae than in B. dorsalis. When linalool was mixed with cuelure (attractant to B. cucurbitae male), its potency to the three fly species decreased as the concentration of cuelure increased. This was due to linalool hydrolysis catalyzed by acetic acid from cuelure degradation, which was confirmed by chemical analysis. When methyl eugenol (B. dorsalis male attractant) was mixed with basil oil, trans-anethole, estragole, or linalool, it did not affect the toxicity of basil oil and linalool to B. dorsalis, but it did significantly decrease the toxicity of trans-anethole and estragole. Structural similarity between methyl eugenol and trans-anethole and estragole suggests that methyl eugenol might act at a site similar to that of trans-anethole and estragole and serve as an antagonist if an action site exists. Methyl eugenol also may play a physiological role on the toxicity reduction.

  7. Metalimnobia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo

    2016-06-30

    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  8. Numerous transitions of sex chromosomes in Diptera.

    Science.gov (United States)

    Vicoso, Beatriz; Bachtrog, Doris

    2015-04-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  9. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  10. Antioxidant and Antiproliferative Activities of the Essential Oils from Thymbra capitata and Thymus Species Grown in Portugal

    Directory of Open Access Journals (Sweden)

    Maria Graça Miguel

    2015-01-01

    Full Text Available The antioxidant and antiproliferative activities of the essential oils from Thymbra capitata and Thymus species grown in Portugal were evaluated. Thymbra and Thymus essential oils were grouped into two clusters: Cluster I in which carvacrol, thymol, p-cymene, α-terpineol, and γ-terpinene dominated and Cluster II in which thymol and carvacrol were absent and the main constituent was linalool. The ability for scavenging ABTS•+ and peroxyl free radicals as well as for preventing the growth of THP-1 leukemia cells was better in essential oils with the highest contents of thymol and carvacrol. These results show the importance of these two terpene-phenolic compounds as antioxidants and cytotoxic agents against THP-1 cells.

  11. Transcriptional profiles of mating-responsive genes from testes and male accessory glands of the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Francesca Scolari

    Full Text Available BACKGROUND: Insect seminal fluid is a complex mixture of proteins, carbohydrates and lipids, produced in the male reproductive tract. This seminal fluid is transferred together with the spermatozoa during mating and induces post-mating changes in the female. Molecular characterization of seminal fluid proteins in the Mediterranean fruit fly, Ceratitis capitata, is limited, although studies suggest that some of these proteins are biologically active. METHODOLOGY/PRINCIPAL FINDINGS: We report on the functional annotation of 5914 high quality expressed sequence tags (ESTs from the testes and male accessory glands, to identify transcripts encoding putative secreted peptides that might elicit post-mating responses in females. The ESTs were assembled into 3344 contigs, of which over 33% produced no hits against the nr database, and thus may represent novel or rapidly evolving sequences. Extraction of the coding sequences resulted in a total of 3371 putative peptides. The annotated dataset is available as a hyperlinked spreadsheet. Four hundred peptides were identified with putative secretory activity, including odorant binding proteins, protease inhibitor domain-containing peptides, antigen 5 proteins, mucins, and immunity-related sequences. Quantitative RT-PCR-based analyses of a subset of putative secretory protein-encoding transcripts from accessory glands indicated changes in their abundance after one or more copulations when compared to virgin males of the same age. These changes in abundance, particularly evident after the third mating, may be related to the requirement to replenish proteins to be transferred to the female. CONCLUSIONS/SIGNIFICANCE: We have developed the first large-scale dataset for novel studies on functions and processes associated with the reproductive biology of Ceratitis capitata. The identified genes may help study genome evolution, in light of the high adaptive potential of the medfly. In addition, studies of male

  12. Revision of the family Nothybidae (Diptera: Schizophora).

    Science.gov (United States)

    Lonsdale, O; Marshall, S A

    2016-04-05

    The family Nothybidae (Diptera: Schizophora) is revised. The family consists of 11 species in the single genus Nothybus Rondani, which occurs in Papua New Guinea, Nepal and much of the Oriental Region. Three species are described as new: N. absens spec. nov. (China), N. cataractus spec. nov. (Laos, Thailand) and N. procerus spec. nov. (India). Nothybus longithorax Rondani, 1875 is treated as a junior synonym of N. longicollis (Walker, 1856). Nothybus decorus Meijere, 1924 syn. nov. is included as a junior synonym of N. lineifer Enderlein, 1922.

  13. Rhipidia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2016-07-07

    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  14. Butia capitata (Mart. Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr. Noblick comb. nov (Arecaceae

    Directory of Open Access Journals (Sweden)

    BRUNO F. SANT'ANNA-SANTOS

    2015-03-01

    Full Text Available The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  15. Butia capitata (Mart.) Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr.) Noblick comb. nov (Arecaceae).

    Science.gov (United States)

    Sant'anna-Santos, Bruno F; Carvalho Júnior, Wellington G O; Amaral, Vanessa B

    2015-03-01

    The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  16. Novel RNA viruses producing simultaneous covert infections in Ceratitis capitata. Correlations between viral titers and host fitness, and implications for SIT programs.

    Science.gov (United States)

    Llopis-Giménez, Angel; Maria González, Rosa; Millán-Leiva, Anabel; Catalá, Marta; Llacer, Elena; Urbaneja, Alberto; Herrero, Salvador

    2017-02-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata is a highly polyphagous pest, which infests multiple species of fruits and vegetables worldwide. In addition to the traditional control with chemical insecticides, sterile insect technique (SIT) has been implemented in integrated programs worldwide, and has become an essential measure for the control of this pest. A key issue for SIT is to release sterile males that are sufficiently competitive with males from the wild population. Using sequence information available in public databases, three novel picornaviruses infecting medflies were discovered and named as C. capitata iflavirus 1 and 2 (CcaIV1 and CcaIV2), and C. capitata noravirus (CcaNV). Additional analyses have revealed the presence of CcaIV2 and CcaNV covertly infecting most of the medfly strains used in the different SIT programs around the world, as well as in field captures in the east of Spain. High viral titers of CcaNV were associated with a reduction in the lifespan of males released to the field for the control of this pest, suggesting the possibility that CcaNV may impair the fitness of sterile flies produced by SIT programs.

  17. Eggs of Ephestia kuehniella and Ceratitis capitata, and motile stages of the astigmatid mites Tyrophagus putrescentiae and Carpoglyphus lactis as factitious foods for Orius spp.

    Science.gov (United States)

    Bonte, Jochem; de Walle, Anaïs Van; Conlong, Des; De Clercq, Patrick

    2015-11-17

    Several factitious foods were assessed for rearing the anthocorid predators Orius thripoborus (Hesse) and Orius naivashae (Poppius) (Hemiptera: Anthocoridae) in the laboratory. Developmental and reproductive traits of both Orius species were examined when offered frozen eggs of the Mediterranean flour moth, Ephestia kuehniella Zeller, frozen processed eggs of the medfly, Ceratitis capitata Wiedemann, or mixed motile stages of the astigmatid mites Tyrophagus putrescentiae (Schrank) or Carpoglyphus lactis (L). Whereas C. lactis and T. putresecentiae proved to be an inferior food for rearing O. thripoborus and O. naivashae, eggs of C. capitata eggs fully supported development and reproduction of both predators. Results on medfly eggs were similar or slightly inferior to those on E. kuehniella eggs, which is the standard food for culturing these anthocorid bugs. O. thripoborus could be maintained for four consecutive generations on C. capitata eggs indicating that processed medfly eggs can be a suitable and cheaper alternative to E. kuehniella eggs for prolonged rearing of these Orius spp. This article is protected by copyright. All rights reserved.

  18. Composition and anti-insect activity of essential oils from Tagetes L. species (Asteraceae, Helenieae) on Ceratitis capitata Wiedemann and Triatoma infestans Klug.

    Science.gov (United States)

    López, Sandra B; López, María L; Aragón, Liliana M; Tereschuk, María L; Slanis, Alberto C; Feresin, Gabriela E; Zygadlo, Julio A; Tapia, Alejandro A

    2011-05-25

    Essential oils from four species of the genus Tagetes L. (Asteraceae, Helenieae) collected in Tucumán province, Argentina, were evaluated for their chemical composition, toxicity, and olfactory activity on Mediterranean fruit fly Ceratitis capitata Wiedemann adults and for repellent properties on Triatoma infestans (Klug) (Chagas disease vector). Yields of essential oils range from 0.2 to 0.8% (v/w). The same main constituents among Tagetes minuta L., Tagestes rupestris Cabrera, and Tagetes terniflora Kunth, (cis-trans)-ocimenes, (cis-trans)-tagetones, and (cis-trans)-ocimenones showed important differences in their relative compositions. Tagetes filifolia Lag. was characterized by the recognized phenylpropanoids methylchavicol and trans-anethole as the main components. LD(50) was ≤20 μg/insect in topical bioassays. T. rupestris was the most toxic to C. capitata females, whereas the other oils presented similar toxicities against males and females. Tagetes rupestris oil attracted both sexes of C. capitata at 5 μg, whereas T. minuta showed opposite activities between males (attractant) and females (repellent). Oils from T. minuta and T. filifolia were the most repellent to T. infestans. The results suggest that compositions of essential oils influence their insecticidal and olfactory properties. The essential oils from Tagetes species show an important potential as infochemical agents on insects' behaviors. This study highlights the chemical variability of essential oils as a source of variation of anti-insect properties.

  19. Recombination rate predicts inversion size in Diptera.

    Science.gov (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A

    1999-09-01

    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  20. Caracterização molecular de populações de Butia capitata (Arecaceae do Sul do Brasil através de marcadores AFLP Molecular characterization of Butia capitata populations (Arecaceae in Southern Brazil estimated by AFLP analysis

    Directory of Open Access Journals (Sweden)

    Miriam Valli Buttow

    2010-03-01

    Full Text Available O gênero Butia (Arecaceae é um pequeno gênero subtropical com espécies no sul da América do Sul, considerado ornamental. Além disso, seus frutos são apreciados pelo sabor e aroma peculiares. Porém, no Rio Grande do Sul, as populações naturais sofrem com o avanço das atividades rurais e da construção imobiliária. O objetivo deste trabalho foi caracterizar oito populações de Butia capitata ocorrentes no Rio Grande do Sul através de marcadores moleculares do tipo AFLP. Pela análise molecular da variância, foi possível verificar que 83,68% da variabilidade genética são atribuídos à variação entre populações e 13,67% são atribuídos a diferenças entre populações dentro de regiões. A análise comparativa entre as oito populações feita de duas a duas demonstrou que são significativas as diferenças entre 15 populações, com média de 14,72% da variação molecular atribuída às diferenças entre populações. Este resultado indica a presença de variabilidade genética distribuída entre todas as populações, sem subdivisão decorrente de isolamento geográfico.The Butia genus (Arecaceae is a small genus with subtropical species distributed in South America widely used as an ornamental plant. Besides, its fruits are appreciated for its unique flavor and aroma. But in some regions in Rio Grande do Sul State natural populations suffer with progress of building and rural activities. The aim of this study, therefore, was characterizing eight populations of Butia capitata through AFLP markers. By analysis of molecular variance was possible to verify that 83.68% of genetic variability is attributed to variation among populations and 13.67% is attributed to differences among populations within regions. In the pair-wise analysis, differences between 15 populations were significant, with an average of 14.72% of molecular variation attributed to differences between populations. This result indicates the presence of genetic

  1. A Role of Corazonin Receptor in Larval-Pupal Transition and Pupariation in the Oriental Fruit Fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae)

    Science.gov (United States)

    Hou, Qiu-Li; Jiang, Hong-Bo; Gui, Shun-Hua; Chen, Er-Hu; Wei, Dan-Dan; Li, Hui-Min; Wang, Jin-Jun; Smagghe, Guy

    2017-01-01

    Corazonin (Crz) is a neuropeptide hormone, but also a neuropeptide modulator that is internally released within the CNS, and it has a widespread distribution in insects with diverse physiological functions. Here, we identified and cloned the cDNAs of Bactrocera dorsalis that encode Crz and its receptor CrzR. Mature BdCrz has 11 residues with a unique Ser11 substitution (instead of the typical Asn) and a His in the evolutionary variable position 7. The BdCrzR cDNA encodes a putative protein of 608 amino acids with 7 putative transmembrane domains, typical for the structure of G-protein-coupled receptors. When expressed in Chinese hamster ovary (CHO) cells, the BdCrzR exhibited a high sensitivity and selectivity for Crz (EC50 ≈ 52.5 nM). With qPCR, the developmental stage and tissue-specific expression profiles in B. dorsalis demonstrated that both BdCrz and BdCrzR were highly expressed in the larval stage, and BdCrzR peaked in 2-day-old 3rd-instar larvae, suggesting that the BdCrzR may play an important role in the larval-pupal transition behavior. Immunochemical localization confirmed the production of Crz in the central nervous system (CNS), specifically by a group of three neurons in the dorso-lateral protocerebrum and eight pairs of lateral neurons in the ventral nerve cord. qPCR analysis located the BdCrzR in both the CNS and epitracheal gland, containing the Inka cells. Importantly, dsRNA-BdCrzR-mediated gene-silencing caused a delay in larval-pupal transition and pupariation, and this phenomenon agreed with a delayed expression of tyrosine hydroxylase and dopa-decarboxylase genes. We speculate that CrzR-silencing blocked dopamine synthesis, resulting in the inhibition of pupariation and cuticular melanization. Finally, injection of Crz in head-ligated larvae could rescue the effects. These findings provide a new insight into the roles of Crz signaling pathway components in B. dorsalis and support an important role of CrzR in larval-pupal transition and pupariation behavior. PMID:28261106

  2. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae)

    Science.gov (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  3. EAG and behavioral responses of the Caribbean fruit fly (Diptera:Tephritidae) to terminal diamines in a food-based lure.

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies utilize a food-based synthetic lure consisting of ammonium acetate and putrescine (1, 4 diaminobutane). Identification of additional attractant chemicals may lead to development of a more effective trapping system. This study, conducted with the...

  4. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico

    Science.gov (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  5. Cage study of spinosad-based bait efficacy on Bactrocera cucurbitae, Dacus ciliatus, and Dacus demmerezi (Diptera: Tephritidae) in Reunion Island.

    Science.gov (United States)

    Deguine, Jean-Philippe; Douraguia, Elisabeth; Atiama-Nurbel, Toulassi; Chiroleu, Fréderic; Quilici, Serge

    2012-08-01

    On Reunion Island, Bactrocera cucurbitae (Coquillett), Dacus ciliatus (Loew), and Dacus demmerezi (Bezzi) cause severe damage to Cucurbit crops. The aim of the study was to test in field cages the effectiveness of Synéis-appât (Dow AgroSciences), a spinosad-based bait (0.02% of spinosad) on both attraction and mortality of young adults (6-9 d old) of these three species. The effects of gender were also evaluated for all species whereas the effects of protein deprivation were tested with B. cucurbitae only. For the first 15 min after application, significantly more B. cucurbitae adults (21.7 +/- 1.8%) were attracted to the bait than D. demmerezi (7.6 +/- 2.4%) and D. ciliatus (2.7 +/- 1.4%); the subsequent response (30-75 min after bait application) of D. demmerezi was statistically similar to that recorded for B. cucurbitae; whereas the response ofD. ciliatus to the bait was consistently significantly lower. Adult mortality was significantly higher for B. cucurbitae (94.6 +/- 0.7%) than for D. demmerezi (85.7 +/- 2.1%), and was significantly higher for the latter than for D. ciliatus (60.4 +/- 4.4%). Sex had no significant effect on the mortality rate for each species. The efficiency of the bait was the same for B. cucurbitae adults regardless whether or not the diet included proteins. Overall, Synéis-appât appears to be more effective against B. cucurbitae and B. demmerezi than against D. ciliatus. In Reunion Island, this bait could constitute a useful component in the framework of Integrated Pest Management.

  6. Age of Response of Male Bactrocera latifrons (Diptera: Tephritidae) to ¿-ionol + Cade Oil Relative to Age of Sexual Maturity

    Science.gov (United States)

    Although males of the majority of Dacine fruit flies respond to either methyl eugenol or cuelure, B. latifrons shows little to no response to these lures. Instead, B. latifrons responds to '-ionol, with the response synergistically enhanced by the addition of cade oil. To further understand the ef...

  7. MONITORAMENTO POPULACIONAL DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE MANGA (Mangifera indica L. NO MUNICÍPIO DE JABOTICABAL – SP

    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini

    2013-05-01

    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o monitoramento de adultos de Anastrepha spp. foram instaladas aleatoriamente cinco armadilhas adesivas amarelas em um pomar experimental composto por uma coleção de variedades de manga. Estas armadilhas foram substituídas a cada quinze dias, e conduzidas ao Laboratório de Seletividade Ecológica do Departamento de Fitossanidade (FCAV/UNESP para avaliação dos espécimes amostrados. Os dados meteorológicos foram registrados pelo Posto Meteorológico da FCAV/UNESP, situado a aproximadamente 200 m da área estudada. Os resultados obtidos permitiram concluir que a maior e mais consistente densidade populacional do gênero Anastrepha está compreendida entre as estações da primavera e do verão, relacionada principalmente a presença de frutos maduros. A fraca correlação positiva é observada entre temperatura máxima (°C e umidade relativa média (% para com a densidade populacional de Anastrepha spp. Há moderada correlação positiva entre as temperaturas mínima e média (°C e precipitação pluviométrica acumulada (mm para com a flutuação populacional da referida praga.

  8. Bionomics of Bactrocera (Bactrocera) philippinensis (Drew & Hancock) ( Diptera: Tephritidae)%菲律宾实蝇生物学特性研究

    Institute of Scientific and Technical Information of China (English)

    焦懿; 陈枝楠; 陈志粦

    2011-01-01

    The fruit fly, Bactrocera (Bactrocera) philippinensis (Drew & Hancock ), is an important quarantine pest. It has been reported to damage many fruits seriously, such as mango Mangifera indica L., papaya Carica papaya L. and jackfruit Artocarpus heterophyllus Lam. The bionomics of the fruit fly was systematically observed and studied in the laboratory. The results showed that their emergence percentage was 93.93% during 6- 18 h. Their adult activity, longevity, mating and oviposition were related significantly to temperature and light. The adult longevity was prolonged by supplementary nutrition. The suitable temperature of their development and fecundity was 25℃ -30℃. The fruit fly laid 627.35 and 652.57 eggs on average at 25℃ and 30℃, respectively. The thermal threshold temperature and the effective accumulated temperature for the development were 14. 31℃ and 450. 43 day-degree, respectively. The developmental duration was correlated negatively with temperature (r = -0.9005). This study provided the important basic information for the technique of quarantine treatment and field control of the fruit fly.%菲律宾实蝇 Bactrocera (Bactrocera)philippinensis(Drew & Hancock)是重要的检疫性有害生物,严重危害芒果Mangifera indica L.、木瓜 Carica papaya L.和菠萝蜜Artocarpus heterophyllus Lam.等水果.本文在室内实验条件下对菲律宾实蝇生物学特性进行了较为系统的研究.结果表明:菲律宾实蝇在6~18 h羽化率达93.93%.成虫活动、寿命、交配和产卵与温度、光照密切相关.补充营养能显著延长成虫寿命.菲律宾实蝇生长、发育和繁殖的适宜温度为25~30℃.25℃和30℃时平均产卵量分别为627.35粒和652.57粒.发育起点温度和世代有效积温分别为14.31℃和450.43日·度.温度与发育历期呈显著的负相关(r=-0.9005).本研究为菲律宾实蝇的检疫处理和田间防治技术研究提供了重要的基础资料.

  9. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  10. Revision of Heringina Aczél, 1940 (Diptera: Tephritidae), with description of a new species from Iran and Turkey.

    Science.gov (United States)

    Namin, Saeed Mohamadzade; Korneyev, Severyn V

    2015-04-23

    The genus Heringina Aczél, 1940 is revised and shown to belong to the Tephritis group of genera and is closely related to Tephritis and Multireticula. Literature records are revised, and available collection material is listed. The genus includes two species: H. guttata (Fallén 1814) originally described from the sand dunes of southern Sweden and occurring from the Baltic region through Ukraine and Caucasus to Turkey, Iran, Kazakhstan, and Kyrgyzstan, and Heringina arezoana sp. nov., found in Iran and eastern Turkey. Both species are described, illustrated, and keyed. Host plants and localization of larvae remain unknown; adult flies of both species are commonly swept from (but never reared) flower heads of Helichrysum arenarium. Other records of host plants listed by Boie (1847) and repeated in most important European monographs, are obviously based on misidentified flies. Possible relationships of Heringina with Tephritis and Multireticula are discussed.

  11. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  12. Weathering and Chemical Degradation of Methyl Eugenol and Raspberry Ketone Solid Dispensers for Detection, Monitoring, and Male Annihilation of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Nkomo, Eddie; Cook, Peter J; Mackey, Bruce; Stark, John D

    2015-08-01

    Solid male lure dispensers containing methyl eugenol (ME) and raspberry ketone (RK), or mixtures of the lures (ME + RK), and dimethyl dichloro-vinyl phosphate (DDVP) were evaluated in area-wide pest management bucket or Jackson traps in commercial papaya (Carica papaya L.) orchards where both oriental fruit fly, Bactrocera dorsalis (Hendel), and melon fly, Bactrocera cucurbitae (Coquillett), are pests. Captures of B. dorsalis with fresh wafers in Jackson and bucket traps were significantly higher on the basis of ME concentration (Mallet ME [56%] > Mallet MR [31.2%] > Mallet MC [23.1%]). Captures of B. cucurbitae with fresh wafers in Jackson and bucket traps were not different regardless of concentration of RK (Mallet BR [20.1%] = Mallet MR [18.3%] = Mallet MC [15.9%]). Captures of B. dorsalis with fresh wafers, compared with weathered wafers, were significantly different after week 12; captures of B. cucurbitae were not significantly different after 16 wk. Chemical analyses revealed presence of RK in dispensers in constant amounts throughout the 16-wk trial. Degradation of both ME and DDVP over time was predicted with a high level of confidence by nonlinear asymptotic exponential decay curves. Results provide supportive data to deploy solid ME and RK wafers (with DDVP) in fruit fly traps for detection programs, as is the current practice with solid TML dispensers placed in Jackson traps. Wafers with ME and RK might be used in place of two separate traps for detection of both ME and RK responding fruit flies and could potentially reduce cost of materials and labor by 50%.

  13. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-01-10

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  14. Weathering and chemical degradation of methyl eugenol and raspberry ketone solid dispensers for detection, monitoring and male annihilation of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii

    Science.gov (United States)

    Solid male lure dispensers containing methyl eugenol (ME) and raspberry ketone (RK), or mixtures of the lures (ME + RK), and dimethyl dichloro-vinyl phosphate (DDVP) were evaluated in AWPM bucket or Jackson traps in commercial papaya (Carica papaya L.) orchards where both oriental fruit fly, Bactroc...

  15. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae)

    Science.gov (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  16. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  17. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  18. Population fluctuation of adult males of the fruit fly, Bactrocera tau Walker (Diptera: Tephritidae) in passion fruit orchards in relation to abiotic factors and sanitation

    NARCIS (Netherlands)

    Hasyim, A.; Muryati, M.; Kogel, de W.J.

    2008-01-01

    Fruit fly (Bactrocera tau) is the most destructive pest on some fruits in Indonesia. Monitoring of the pest population is essential as one of the procedures in the IPM concept. The study aimed to investigate the seasonal fluctuation of adult males of B. tau and their damage on passion fruits in rela

  19. Seasonal amounts of nutrients in Western cherry fruit fly (Diptera: Tephritidae) and their relation to nutrient availability on cherry plant surfaces.

    Science.gov (United States)

    Yee, Wee L; Chapman, Peter S

    2008-10-01

    Relatively little is known about the nutritional ecology of fruit flies in the genus Rhagoletis. In this study, nutrient amounts in male and female western cherry fruit fly, Rhagoletis indifferens Curran, and availability of nitrogen and sugar on surfaces of leaves, fruit, and extrafloral nectaries (EFNs) of sweet cherry trees, were determined from late May to late June 2005 and of sugar from EFNs from mid-May to late June 2007 in Washington state. Protein amounts in male and female flies did not differ over the season. Nitrogen was present on leaves, fruit, and EFNs during the sampling period, but amounts on leaves and fruit were lower in late May than the rest of the season. Sugar amounts in flies did not differ over the season. Sugar was present on leaf, fruit, and EFN surfaces all season, but amounts on all three were lower in late May than later in the season. Fructose and glucose were the predominant sugars on all plant surfaces, but sucrose was also present in nectar from EFNs. In outdoor and field cage experiments in 2004 and 2006, more flies survived when cherry branches with leaves and fruit were present than absent. Results suggest that R. indifferens maintains stable protein and sugar levels throughout the season because sufficient amounts of nutrients are found in cherry trees during this time and that increases in nutrient availability caused by ripening and damaged cherries later in the season do not result in increased amounts of nutrients in flies.

  20. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  1. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  2. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2012-08-01

    Full Text Available Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri; similarly, establishment of Bactrocera dorsalis (Hendel in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan, Diachasmimorpha longicaudata (Ashmead and Fopius vandenboschi (Fullaway were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa. Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more recent successes against Bactrocera spp. and related tephritids, and outline simple rearing and release methods to facilitate this goal.

  3. Spatial dynamics of two oriental fruit fly (Diptera: Tephritidae) parasitoids, Fopius arisanus and Diachasmimorpha longicaudata (Hymenoptera: Braconidae), in a Guava orchard in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Stark, John D; Banks, John; Leblanc, Luc; Manoukis, Nicholas C; Peck, Steven

    2013-10-01

    We examined spatial patterns of both sexes of oriental fruit fly, Bactrocera dorsalis (Hendel), and its two most abundant parasitoids, Fopius arisanus (Sonan) and Diachasmimorpha longicaudata (Ashmead) in a commercial guava (Psidium guajava L.) orchard. Oriental fruit fly spatial patterns were initially random, but became highly aggregated with host fruit ripening and the subsequent colonization of, first, F. arisanus (egg-pupal parasitoid) and, second, D. longicaudata (larval-pupal parasitoid). There was a significant positive relationship between populations of oriental fruit fly and F. arisanus during each of the F. arisanus increases, a pattern not exhibited between oriental fruit fly and D. longicaudata. Generally, highest total numbers of males and females (oriental fruit fly, F. arisanus, and D. longicaudata) occurred on or about the same date. There was a significant positive correlation between male and female populations of all three species; we measured a lag of 2-4 wk between increases of female F. arisanus and conspecific males. There was a similar trend in one of the two years for the second most abundant species, D. longicaudata, but no sign of a time lag between the sexes for oriental fruit fly. Spatially, we found a significant positive relationship between numbers of F. arisanus in blocks and the average number in adjoining blocks. We did not find the same effect for oriental fruit fly and D. longicaudata, possibly a result of lower overall numbers of the latter two species or less movement of F. arisanus within the field.

  4. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  5. Evaluation of SPLAT with Spinosad and Methyl Eugenol or Cue-Lure for "Attract-and-Kill" of Oriental and Melon Fruit Flies (Diptera: Tephritidae) in Hawaii

    Science.gov (United States)

    SPLAT(TM) ME (methyl eugenol) and C-L (cue-lure) “attract and kill” sprayable formulations containing spinosad were compared to other formulations under Hawaiian weather conditions against Bactrocera dorsalis (Hendel), oriental fruit fly, and B. cucurbitae (Coquillett), melon fly, respectively. Fie...

  6. Performance of Methyl Eugenol + Matrix + Toxicant combinations under field conditions in Hawaii and California for trapping B. dorsalis (Diptera:Tephritidae).

    Science.gov (United States)

    New solid formulations containing methyl eugenol and either naled or DDVP toxicants were compared to the standard formulations on cotton wicks in large scale field evaluation in Hawaii. Two “reduced risk” toxicants (spinosad and Rynaxypyr®) were also evaluated. In one test the solid lure-toxicant-ma...

  7. Evaluation of Cuelure and Methyl Eugenol solid lure and insecticide dispensers for fruit fly (Diptera: Tephritidae) monitoring and control in Tahiti

    Science.gov (United States)

    Performance of solid male lure (cuelure (C-L)/raspberry ketone (RK) - against Bactrocera tyroni (Froggatt), and methyl eugenol (ME) - against oriental fruit fly, B. dorsalis (Hendel) and insecticide formulations, were evaluated in Tahiti Island (French Polynesia), as alternatives to current monitori...

  8. Effects of Methyl Eugenol Feeding on Mating Compatibility of Asian Population of Bactrocera dorsalis (Diptera: Tephritidae) with African Population and with B. carambolae.

    Science.gov (United States)

    Haq, Ihsan Ul; Vreysen, Marc J B; Schutze, Mark; Hendrichs, Jorge; Shelly, Todd

    2016-02-01

    Males of some species included in the Bactrocera dorsalis complex are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl) benzene), a natural compound occurring in a variety of plant species. ME feeding of males of the B. dorsalis complex is known to enhance their mating competitiveness. Within B. dorsalis, recent studies show that Asian and African populations of B. dorsalis are sexually compatible, while populations of B. dorsalis and Bactrocera carambolae are relatively incompatible. The objectives of this study were to examine whether ME feeding by males affects mating compatibility between Asian and African populations of B. dorsalis and ME feeding reduces male mating incompatibility between B. dorsalis (Asian population) and B. carambolae. The data confirmed that Asian and African populations of B. dorsalis are sexually compatible for mating and showed that ME feeding only increased the number of matings. Though ME feeding also increased the number of matings of B. dorsalis (Asian population) and B. carambolae males but the sexual incompatibility between both species was not reduced by treatment with ME. These results conform to the efforts resolving the biological species limits among B. dorsalis complex and have implications for fruit fly control programs in fields and horticultural trade.

  9. Gene flow and genetic structure of Bactrocera carambolae (Diptera, Tephritidae) among geographical differences and sister species, B. dorsalis, inferred from microsatellite DNA data.

    Science.gov (United States)

    Aketarawong, Nidchaya; Isasawin, Siriwan; Sojikul, Punchapat; Thanaphum, Sujinda

    2015-01-01

    The Carambola fruit fly, Bactrocera carambolae, is an invasive pest in Southeast Asia. It has been introduced into areas in South America such as Suriname and Brazil. Bactrocera carambolae belongs to the Bactrocera dorsalis species complex, and seems to be separated from Bactrocera dorsalis based on morphological and multilocus phylogenetic studies. Even though the Carambola fruit fly is an important quarantine species and has an impact on international trade, knowledge of the molecular ecology of Bactrocera carambolae, concerning species status and pest management aspects, is lacking. Seven populations sampled from the known geographical areas of Bactrocera carambolae including Southeast Asia (i.e., Indonesia, Malaysia, Thailand) and South America (i.e., Suriname), were genotyped using eight microsatellite DNA markers. Genetic variation, genetic structure, and genetic network among populations illustrated that the Suriname samples were genetically differentiated from Southeast Asian populations. The genetic network revealed that samples from West Sumatra (Pekanbaru, PK) and Java (Jakarta, JK) were presumably the source populations of Bactrocera carambolae in Suriname, which was congruent with human migration records between the two continents. Additionally, three populations of Bactrocera dorsalis were included to better understand the species boundary. The genetic structure between the two species was significantly separated and approximately 11% of total individuals were detected as admixed (0.100 ≤ Q ≤ 0.900). The genetic network showed connections between Bactrocera carambolae and Bactrocera dorsalis groups throughout Depok (DP), JK, and Nakhon Sri Thammarat (NT) populations. These data supported the hypothesis that the reproductive isolation between the two species may be leaky. Although the morphology and monophyly of nuclear and mitochondrial DNA sequences in previous studies showed discrete entities, the hypothesis of semipermeable boundaries may not be rejected. Alleles at microsatellite loci could be introgressed rather than other nuclear and mitochondrial DNA. Bactrocera carambolae may be an incipient rather than a distinct species of Bactrocera dorsalis. Regarding the pest management aspect, the genetic sexing Salaya5 strain (SY5) was included for comparison with wild populations. The SY5 strain was genetically assigned to the Bactrocera carambolae cluster. Likewise, the genetic network showed that the strain shared greatest genetic similarity to JK, suggesting that SY5 did not divert away from its original genetic makeup. Under laboratory conditions, at least 12 generations apart, selection did not strongly affect genetic compatibility between the strain and wild populations. This knowledge further confirms the potential utilization of the Salaya5 strain in regional programs of area-wide integrated pest management using SIT.

  10. Genetic analysis of oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) populations based on mitochondrial cox1 and nad1 gene sequences from India and other Asian countries.

    Science.gov (United States)

    Choudhary, Jaipal S; Naaz, Naiyar; Prabhakar, Chandra S; Lemtur, Moanaro

    2016-10-01

    The study examined the genetic diversity and demographic history of Bactrocera dorsalis, a destructive and polyphagous insect pest of fruit crops in diverse geographic regions of India. 19 widely dispersed populations of the fly from India and other Asian countries were analysed using partial sequences of mitochondrial cytochrome oxidase I (cox1) and NADH dehydrogenase 1 (nad1) genes to investigate genetic diversity, genetic structure, and demographic history in the region. Genetic diversity indices [number of haplotypes (H), haloptype diversity (Hd), nucleotide diversity (π) and average number of nucleotide difference (k)] of populations revealed that B. dorsalis maintains fairly high level of genetic diversity without isolation by distance among the geographic regions. Demographic analysis showed significant (negative) Tajimas' D and Fu's F S with non significant sum of squared deviations (SSD) values, which indicate the possibility of recent sudden expansion of species and is further supported through distinctively star-like distribution structure of haplotypes among populations. Thus, the results indicate that both ongoing and historical factors have played important role in determining the genetic structure and diversity of the species in India. Consequently, sterile insect technique (SIT) could be a possible management strategy of species in the regions.

  11. Potential for hypobaric storage as a phytosanitary treatment: mortality of Rhagoletis pomonella (Diptera: Tephritidae) in apples and effects on fruit quality.

    Science.gov (United States)

    Hulasare, Rajshekhar; Payton, Mark E; Hallman, Guy J; Phillips, Thomas W

    2013-06-01

    The efficacy of low-oxygen atmospheres using low pressure, referred to as hypobaric conditions, to kill egg and third-instar Rhagoletis pomonella (Walsh) in apples was investigated. Infested apples were exposed to 3.33 and 6.67 kPa in glass jars at 25 and 30 degrees C for times ranging from 3 to 120 h. Probit analyses and lethal dose ratio tests were performed to determine differences in lethal time values. Eggs were more tolerant of low pressure compared with third-instar R. pomonella. Mortality of eggs and larvae increased with increase in time of exposure to low pressure and temperature. Lower pressures increased percent mortality of eggs, but these values were not significantly different at the pressures tested in this investigation. The LT99 for R. pomonella eggs at 3.33 kPa was 105.98 and 51.46 h, respectively, at 25 and 30 degrees C, which was a significant effect of the higher temperature on egg mortality. Investigation into consumer acceptance of low-pressure-treated apples was done with 'Red Delicious' and 'Golden Delicious'. Apples exposed to 3.33 kPa at 25 and 30 degrees C for 3 and 5 d were stored at 1 degrees C for 2 wk and presented to a sensory panel for evaluation. The panelists rated treated apples with untreated controls for external and internal appearance and taste. Golden Delicious apples were unaffected for all three sensory factors across both temperatures and exposure times. Although taste was unaffected for Red Delicious, the internal and external appearances deteriorated. Use of low pressure for disinfestation and preservation of apples is a potential nonchemical alternative to chemical fumigants such as methyl bromide and phosphine.

  12. Enhancing male sexual success in a lekking fly (Ananstrepha suspensa (Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality

    Science.gov (United States)

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual su...

  13. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype.

    Science.gov (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M

    2004-12-01

    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  14. Comparative analysis of development and survival of two Natal fruit fly Ceratitis rosa Karsch (Diptera, Tephritidae) populations from Kenya and South Africa.

    Science.gov (United States)

    Tanga, Chrysantus M; Manrakhan, Aruna; Daneel, John-Henry; Mohamed, Samira A; Fathiya, Khamis; Ekesi, Sunday

    2015-01-01

    Comparative analysis of development and survivorship of two geographically divergent populations of the Natal fruit fly Ceratitis rosa Karsch designated as Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya and South Africa were studied at seven constant temperatures (10, 15, 20, 25, 30, 33, 35 °C). Temperature range for development and survival of both populations was 15-35 °C. The developmental duration was found to significantly decrease with increasing temperature for Ceratitis rosa R1 and Ceratitis rosa R2 from both countries. Survivorship of all the immature stages of Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya was highest over the range of 20-30 °C (87-95%) and lowest at 15 and 35 °C (61-76%). Survivorship of larvae of Ceratitis rosa R1 and Ceratitis rosa R2 from South Africa was lowest at 35 °C (22%) and 33 °C (0.33%), respectively. Results from temperature summation models showed that Ceratitis rosa R2 (egg, larva and pupa) from both countries were better adapted to low temperatures than R1, based on lower developmental threshold. Minimum larval temperature threshold for Kenyan populations were 11.27 °C and 6.34 °C (R1 and R2, respectively) compared to 8.99 °C and 7.74 °C (R1 and R2, respectively) for the South African populations. Total degree-day (DD) accumulation for the Kenyan populations were estimated at 302.75 (Ceratitis rosa R1) and 413.53 (Ceratitis rosa R2) compared to 287.35 (Ceratitis rosa R1) and 344.3 (Ceratitis rosa R2) for the South African populations. These results demonstrate that Ceratitis rosa R1 and Ceratitis rosa R2 from both countries were physiologically distinct in their response to different temperature regimes and support the existence of two genetically distinct populations of Ceratitis rosa. It also suggests the need for taxonomic revision of Ceratitis rosa, however, additional information on morphological characterization of Ceratitis rosa R1 and Ceratitis rosa R2 is needed.

  15. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  16. Demographic Analysis of Sex Ratio on Population Growth of Bactrocera dorsalis (Diptera: Tephritidae) With Discussion of Control Efficacy Using Male Annihilation.

    Science.gov (United States)

    Yu-Bing Huang, Kevin; Atlihan, Remzi; Gökçe, Ayhan; Yu-Bing Huang, Joyce; Chi, Hsin

    2016-09-30

    The life table data for the oriental fruit fly, Bactrocera dorsalis (Hendel), at different adult sex ratios (1♀: 1♂, 1♀: 50♂, 50♀: 1♂ free-choice mating, and 50♀: 1♂ no-choice mating) were collected to determine the effects of sex-ratio manipulation on current pest control procedures. At 1♀: 1♂, females mated, on average, 2.3 times during their lifetime with a mean fecundity (F) of 1,122 eggs. The net reproductive rate (R0), intrinsic rate of increase (r), finite rate (λ), and mean generation time (T) were 561.0 offspring, 0.1693 d(-)  (1), 1.1844 d(-)  (1), and 37.4 d, respectively. At 50♀: 1♂ free-choice mating, males mated 46.7 times during their lifetime, while at 50♀: 1♂ no-choice mating, males mated on average 50 times during their lifetime, and all females mating only once in both treatments. The values for F, r, and λ were significantly lower for both 50♀: 1♂ treatments than those in the 1♀: 1♂ group; the R0 values, however, were either equal to or even higher than those in the 1♀: 1♂ treatment. In the male-biased sex ratio (1♀: 50♂), fecundity was the highest (1,610 eggs) and female average life span the longest (166 d), while the R0 was the lowest (31.6 offspring) among all treatments. Population projections showed that even at a sex ratio of 50♀: 1♂, B. dorsalis could still produce a large number of offspring. These findings demonstrate that management strategies for controlling B. dorsalis could be properly evaluated by using demographic methods. Because female annihilation appears to be a more effective control strategy, it should be considered as a viable alternative.

  17. Host plant oviposition preference of Bactrocera cucurbitae (Coquillett) (Diptera : Tephritidae)%瓜实蝇对寄主植物的产卵选择性

    Institute of Scientific and Technical Information of China (English)

    彭帅; 郑丽霞; 吴伟坚

    2013-01-01

    The melon fruit fly, Bactrocera cucurbitae ( Coquillett) has been reported to damage more than 100 host plants and is a major pest of cucurbitaceous vegetables. Choice oviposition experiments were conducted under laboratory conditions to help assess host plant specificity of the fruit fly. Six host species: Momordica charantiap, Luffa cylindrical, Cucumis sativus, Cucurbita moschata, Carica papaya and Cucurbita pepo were tested. Oviposition rates were highest on M. charantiap (56. 18% of eggs) and C. sativus (29. 00% ) , with low rates on C. papaya (1. 85% ) and C. moschata (0. 00% ) . In contrast, Oviposition rates were highest on C. sativus ( 34. 64% ) , C. pepo ( 30. 37% ) and C. moschata (18. 05% ) , with low rates on C. papaya (0. 60% ) when the fruit peel were pared. Oviposition rates of B. cucurbitae females on fruits with peel had a significant negative correlation with the hardness of peel, and the correlation coefficient was - 0. 8772. The results imply that in addition to the in - built chemical compounds, plants have physical barrier like hard fruit peel, which impact melon fruit fly oviposition.%瓜实蝇Bactrocera cucurbitae (Coquillett)可危害100多种寄主植物,是葫芦科蔬菜的重要害虫.为了探明瓜实蝇的寄主特异性,在实验室条件下研究了瓜实蝇对黄瓜Cucumis sativus、苦瓜Momordica charantiap、丝瓜Luffa cylindrica、南瓜Cucurbita moschata、番木瓜Carica papaya和西葫芦Cucurbita pepo的产卵选择性.瓜实蝇在苦瓜和黄瓜上的产卵比率较高,分别为56.18%和29.00%,在番木瓜和南瓜上产卵比率较低,分别为1.85%和0.00%,但是在去掉果皮后,黄瓜、西葫芦和南瓜的产卵比率较高,分别达到34.64%、30.37%和18.05%,在番木瓜上的产卵率较低仅为0.60%.瓜实蝇雌虫在带皮果实上的产卵比率与果皮硬度呈显著的负相关关系,相关系数为-0.8772结果表明除了自身的化合物之外,植物具有的物理屏障如坚硬的表皮会影响瓜实蝇产卵.

  18. Inclusion of Specialist and Generalist Stimuli in Attract-and-Kill Programs: Their Relative Efficacy in Apple Maggot Fly (Diptera: Tephritidae) Pest Management.

    Science.gov (United States)

    Morrison, William R; Lee, Doo-Hyung; Reissig, W Harvey; Combs, David; Leahy, Kathleen; Tuttle, Arthur; Cooley, Daniel; Leskey, Tracy C

    2016-08-01

    Investigating the chemical ecology of agricultural systems continues to be a salient part of integrated pest management programs. Apple maggot fly, a key pest of apple in eastern North America, is a visual specialist with attraction to host fruit-mimicking cues. These cues have been incorporated into red spherical traps used for both monitoring and behaviorally based management. Incorporating generalist or specialist olfactory cues can potentially increase the overall success of this management system. The primary aim of this study was to evaluate the attractiveness of a generalist olfactory cue, ammonium carbonate, and the specialist olfactory cue, a five-component apple volatile blend, when included as a component of a red attracticidal sphere system. Secondly, we assessed how critical it was to maintain minimal deviation from the optimal, full-round specialist visual stimulus provided by red spheres. Finally, attracticidal spheres were deployed with specialist olfactory cues in commercial apple orchards to evaluate their potential for effective management of apple maggot. Ammonium carbonate did not increase residency, feeding time, or mortality in the laboratory-based trials. Field deployment of specialist olfactory cues increased apple maggot captures on red spheres, while the generalist cue did not. Apple maggot tolerated some deviation from the optimal visual stimulus without reducing captures on red spheres. Attracticidal spheres hung in perimeter trees in orchards resulted in acceptable and statistically identical levels of control compared with standard insecticide programs used by growers. Overall, our study contributes valuable information for developing a reliable attract-and-kill system for apple maggot.

  19. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  20. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  1. Avaliação de populações de Butia capitata de Santa Vitória do Palmar Performance of populations of Butia capitata of Santa Vitória do Palmar

    Directory of Open Access Journals (Sweden)

    Elisane Schwartz

    2010-09-01

    Full Text Available O gênero Butia pertence à família Arecaceae e possui cinco espécies com ocorrência no Rio Grande do Sul. A espécie Butia capitata está recebendo atenção especial, não só pelo seu uso no consumo in natura como também em formas processadas. No entanto, mesmo sendo uma espécie que tem sua utilização registrada desde os tempos pré-históricos, vem sendo explorada apenas de modo extrativista, como a maioria das espécies de frutíferas nativas. Além disso, a espécie está seriamente comprometida em médio prazo pela ausência de regeneração natural e com risco muito alto de extinção num futuro próximo. Nesse sentido, o objetivo deste trabalho foi comparar os frutos, a partir de parâmetros químicos e físicos, e também observar os dados produtivos das plantas de três populações de butiazeiros do município de Santa Vitória do Palmar-RS. Os dados foram obtidos em experimentos conduzidos na safra de 2005/2006 e na safra de 2006/2007, em três propriedades localizadas em Santa Vitória do Palmar. Os resultados permitiram verificar que as propriedades e ou variações genéticas entre as populações de Butia capitata avaliadas propiciaram variabilidade para duração do ciclo, coloração da epiderme dos frutos, volume de suco produzido, relação entre sólidos solúveis totais e acidez titulável, características biométricas de fruto e produtividade anual. Uma das populações, denominada Celina, apresentou maior produtividade e rendimento industrial. As populações Celina e São José apresentaram as melhores características biométricas de fruto. A população Aguiar apresentou a melhor relação entre sólidos solúveis totais e acidez titulável.The genus Butia belongs to the Arecaceae family and shows five species occurring in Rio Grande de Sul. The specie Butia capitata requires special attention, not just for its use as fresh consumption but also as processed product. However, even having its use recorded since

  2. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  3. Are all eggs created equal? A case study from the Hawaiian reef-building coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, Jacqueline L.; Bidigare, Robert R.; Barshis, Daniel J.; Alamaru, Ada; Hédouin, Laetitia; Hernández-Pech, Xavier; Kandel, Frederique; Leon Soon, Sherril; Roth, Melissa S.; Rodrigues, Lisa J.; Grottoli, Andrea G.; Portocarrero, Claudia; Wagenhauser, Stephanie A.; Buttler, Fenina; Gates, Ruth D.

    2013-03-01

    Parental effects have been largely unexplored in marine organisms and may play a significant role in dictating the phenotypic range of traits in coral offspring, influencing their ability to survive environmental challenges. This study explored parental effects and life-stage differences in the Hawaiian reef-building coral Montipora capitata from different environments by examining the biochemical composition of mature coral colonies and their eggs. Our results indicate that there are large biochemical differences between adults and eggs, with the latter containing higher concentration of lipids (mostly wax esters), ubiquitinated proteins (which may indicate high turnover rate of proteins) and antioxidants (e.g., manganese superoxide dismutase). Adults displayed high phenotypic plasticity, with corals from a high-light environment having more wax esters, lighter tissue δ13C signatures and higher Symbiodinium densities than adults from the low-light environment who had higher content of accessory pigments. A green-algal pigment (α-carotene) and powerful antioxidant was present in eggs; it is unclear whether this pigment is acquired from heterotrophic food sources or from endolithic green algae living in the adult coral skeletons. Despite the broad phenotypic plasticity displayed by adults, parental investment in the context of provisioning of energy reserves and antioxidant defense was the same in eggs from the different sites. Such equality in investment maximizes the capacity of all embryos and larvae to cope with challenging conditions associated with floating at the surface and to disperse successfully until an appropriate habitat for settlement is found.

  4. PRESENCE OF THE MEDITERRANEAN FRUIT FLY(Ceratitis capitata Wied. IN SELECTED OLIVE ORCHARDS OF CENTRAL DALMATIA

    Directory of Open Access Journals (Sweden)

    M. Bjeliš

    2007-12-01

    Full Text Available Mediterranean fruit fly (Ceratitis capitata Wiedemann is a regular pest of large number of cultivated and wild host plants in Dalmatia. However, this pest does not develop either inside fruits of cultivated olive - Olea europaea sativa or wild olive „ mastrinka“ - Olea europaea oleaster. The main objective of this research was to prove regular presence, time of appearance and flight duration of the Mediterranean fruit fly inside selected orchards of central Dalmatia. During the four years of research, from 2001 to 2004 by using of traps and parapheromone trimedlure, the regular presence of the Mediterranean fruit fly was proved inside four selected orchards on the area of cities of Split and Kaštela, with differences in adult caught between localities and years. During the 2001 year, on the three locations in the area of city of Kaštela, the highest capture during the total research period was recorded, while on the locations in Split, the highest capture was recorded during 2003 year, but also significant during 2001 year. The lowest number of adult, less than 5 flies/trap was captured on all four locations during 2002 year.

  5. Size relationships of different body parts in the three dipteran species Drosophila melanogaster, Ceratitis capitata and Musca domestica.

    Science.gov (United States)

    Siomava, Natalia; Wimmer, Ernst A; Posnien, Nico

    2016-06-01

    Body size is an integral feature of an organism that influences many aspects of life such as fecundity, life span and mating success. Size of individual organs and the entire body size represent quantitative traits with a large reaction norm, which are influenced by various environmental factors. In the model system Drosophila melanogaster, pupal size and adult traits, such as tibia and thorax length or wing size, accurately estimate the overall body size. However, it is unclear whether these traits can be used in other flies. Therefore, we studied changes in size of pupae and adult organs in response to different rearing temperatures and densities for D. melanogaster, Ceratitis capitata and Musca domestica. We confirm a clear sexual size dimorphism (SSD) for Drosophila and show that the SSD is less uniform in the other species. Moreover, the size response to changing growth conditions is sex dependent. Comparison of static and evolutionary allometries of the studied traits revealed that response to the same environmental variable is genotype specific but has similarities between species of the same order. We conclude that the value of adult traits as estimators of the absolute body size may differ among species and the use of a single trait may result in wrong assumptions. Therefore, we suggest using a body size coefficient computed from several individual measurements. Our data is of special importance for monitoring activities of natural populations of the three dipteran flies, since they are harmful species causing economical damage (Drosophila, Ceratitis) or transferring diseases (Musca).

  6. Impact of the Mediterranean fruit fly (medfly) Ceratitis capitata on different peach cultivars: the possible role of peach volatile compounds.

    Science.gov (United States)

    Tabilio, Maria Rosaria; Fiorini, Dennis; Marcantoni, Enrico; Materazzi, Stefano; Delfini, Maurizio; De Salvador, Flavio Roberto; Musmeci, Sergio

    2013-09-01

    The relationship between susceptibility of different peach cultivars (cvs) to the Mediterranean fruit fly (medfly), Ceratitis capitata, and the volatile composition of ripe fruit of each cv has been investigated, since understanding the fruit-insect interaction mechanism is crucial for developing control strategies for such a pest. Volatile compounds were analyzed by SPME-GC-MS in three cvs highly susceptible to medfly attack (Fair Time, Flaminia, Sicilia Piatta), and in two less susceptible cvs (Percoca Romagnola 7 and Doctor Davis). Among the volatile compounds detected, 88 could be identified. The main differences found in the volatile composition of the cvs, concerned the relative abundance of esters. The least susceptible cvs, above all Percoca Romagnola 7, contained the higher amounts of hexenyl, hexyl, 3-methylbutyl, butyl and 2-methylpropyl esters; among these, some C6 derivatives detected, such as (Z)-3-hexenyl acetate, are known to act as priming agents, enhancing plant defence response to insects. Instead, a lower relative content of methyl esters, such as methyl hexanoate and methyl octanoate, known to act as medfly pheromone and attractant respectively, was found in the least susceptible cvs.

  7. Molecular cloning and primary sequence analysis of a gene encoding a putative shitinase gene in Brassica oleracea var.capitata

    Institute of Scientific and Technical Information of China (English)

    TANGGUOQING; YONGYANBAI; 等

    1996-01-01

    Chitinase,which catalyzes the hydrolysis of the β-1,4-acetyl-D-glucosamine linkages of the fungal cell wall polymer chitin,is involved in inducible plants defense system.By construction of cabbage(Brassica oleracea var. capitata) genomic library and screening the library with pRCH8,a probe of rice chitinase gene fragment,a chitinase genomic sequence was isolated.The complete uncleotide sequence of the putative cabbage chitinase gene (cabch29) was determined,with its longest open reading frame (ORF) encoding a polypeptide of 413 aa.This polypeptide consists of a 21 aa N-terminal signal peptide,two chitin-binding domains different from those of other classes of plant chitinases,and a catalytic domain.Homology analysis illustrated that this cabch29 gene has 58.8% identity at the nucleotide level with the pRCH8 ORF probe and has 50% identity at the amino acid level tiwh the catalytic domains of chitinase from bean,maize and sugar beet.Meanwhile,several kinds of cis-elements,such as TATA box,CAAT box,GATA motif,ASF-1 binding site,wound-response elements and AATAAA,have also been discovered in the flanking region of cabch29 gene.

  8. Pathogenicity and characterization of a novel Bacillus cereus sensu lato isolate toxic to the Mediterranean fruit fly Ceratitis capitata Wied.

    Science.gov (United States)

    Ruiu, Luca; Falchi, Giovanni; Floris, Ignazio; Marche, Maria Giovanna; Mura, Maria Elena; Satta, Alberto

    2015-03-01

    The lethal and sub-lethal effects of sporulated cultures of a novel Bacillus cereus sensu lato strain lacking detectable cry genes and identified through morphological and genetic analyses, have been studied on the Mediterranean fruit fly Ceratitis capitata. The lethal effects on young larvae were concentration dependent, with a median lethal concentration (LC50) of 4.48 × 10(8)spores/g of diet. Sporulated cultures of this strain significantly extended development time and reduced immature survival, and the size of emerging fly adults. Besides spores, the toxicity has been associated to the insoluble extra-spore fraction characterized through a proteomic approach. The profile of the extra-spore protein fraction (ES) showed major protein bands within the 35-65 kDa range. The results of mass spectrometry analysis highlighted the presence of putative virulence factors, including members of protein families previously associated to the insecticidal action of other microbial entomopathogens. These proteins include metalloproteases, peptidases and other enzymes.

  9. Rehydration of forensically important larval Diptera specimens.

    Science.gov (United States)

    Sanford, Michelle R; Pechal, Jennifer L; Tomberlin, Jeffery K

    2011-01-01

    Established procedures for collecting and preserving evidence are essential for all forensic disciplines to be accepted in court and by the forensic community at large. Entomological evidence, such as Diptera larvae, are primarily preserved in ethanol, which can evaporate over time, resulting in the dehydration of specimens. In this study, methods used for rehydrating specimens were compared. The changes in larval specimens with respect to larval length and weight for three forensically important blow fly (Diptera: Calliphoridae) species in North America were quantified. Phormia regina (Meigen), Cochliomyia macellaria (F.), and Chrysomya rufifacies (Macquart) third-instar larvae were collected from various decomposing animals and preserved with three preservation methods (80% ethanol, 70% isopropyl alcohol, and hot-water kill then 80% ethanol). Preservative solutions were allowed to evaporate. Rehydration was attempted with either of the following: 80% ethanol, commercial trisodium phosphate substitute solution, or 0.5% trisodium phosphate solution. All three methods partially restored weight and length of specimens recorded before preservation. Analysis of variance results indicated that effects of preservation, rehydration treatment, and collection animal were different in each species. The interaction between preservative method and rehydration treatment had a significant effect on both P. regina and C. macellaria larval length and weight. In addition, there was a significant interaction effect of collection animal on larval C. macellaria measurements. No significant effect was observed in C. rufifacies larval length or weight among the preservatives or treatments. These methods could be used to establish a standard operating procedure for dealing with dehydrated larval specimens in forensic investigations.

  10. Analysis of survival, gene expression and behavior following chill-coma in the medfly Ceratitis capitata: effects of population heterogeneity and age.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2014-12-01

    The medfly Ceratitis capitata is an agricultural pest distributed worldwide thanks, in part, to its phenotypic plasticity of thermal tolerance. Cold exposure has been shown to reduce C. capitata survival, which may affect its distribution in areas with subfreezing temperatures. When insects are increasingly cooled, they attain a critical thermal threshold and enter a chill-coma state characterized by cessation of movement. It is not clear how a rapid cold exposure affects the physiological state of medflies, and how this is influenced by age and population heterogeneity. In order to approach these questions, C. capitata single-sex laboratory populations of 15 and 30 days old were subjected to a chill-coma recovery assay, and separated according to their recovery time in three subgroups: Fast-Subgroups, Intermediate-Subgroups, and Slow-Subgroups. Thereafter, we analyzed their survival, behavioral, and gene expression outputs. In female and old male populations, we found that flies with the slowest recovery time had a reduced life expectancy, a higher initial mortality rate, and a worse climbing performance compared with flies that recovered faster. Therefore, we were able to separate subgroups that developed chilling-injury from subgroups that had a reversible full recovery after cold exposure. The gene expression analysis of the heat shock protein genes hsp70 and hsp83 showed no clear association with the parameters studied. Interestingly, thorax expression levels of the Cu/Zn superoxide dismutase gene were elevated during the recovery phase in the Fast-Subgroups, but remained constant in the Slow-Subgroups that developed chilling-injury. On the other hand, none of the young male subgroups seemed to have suffered irreversible damage. Thus, we concluded that depending on age and population heterogeneity, chill-coma recovery time points out significant differences on individual cold tolerance. Moreover, the inability to properly induce the antioxidant defense system

  11. Discovery of the chitinozoans Belonechitina capitata from the Shiala Formation of northeastern Garhwal-Kumaon Tethys Himalaya, Pithoragarh District, Uttrakhand, India

    Institute of Scientific and Technical Information of China (English)

    H.N. Sinha; Jacques Verniers

    2016-01-01

    Belonechitina capitata, a typically middle to late Ordovician chitinozoan index taxon was for the first time recovered from the northeastern Kumaon region, a part of Garhwal-Kumaon Tethys basin of the Himalaya, India. This species is of great biostratigraphic importance and has already been reported from Avalonia, Baltica and northern Gondwana. The study area was during Ordovician, part of a low-palaeolatitudinal Gondwana region. The vesicles of recovered forms are black and fragmentary. This is principally attributed to intense tectonic activity during the Himalayan orogenic movement which resulted into high thermal alteration. The chitinozoans are found along with melanosclerites.

  12. Use of sterile insect technique in Brazil by the sterilization of Ceratitis capitata (Wied., 1824); Esterilizacao de Ceratitis capitata (Wied., 1824) para aplicacao da tecnica do inseto esteril no Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Okeese, G.O.; Kitomer, T.J.; Gayaradus, L.B.; Etrigan, M. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)]. E-mail: jamuga@cena.usp.br; Jansen, C.W.J.H.; Houlahar, H.L. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil)

    2006-07-01

    The Sterile Insect Technique is a method of pest control allowed in Integrated Pest Management programs in fruit growing, where sterile insects released compete in mate process against fertile wild ones, generating a gradative population reduction. The most used sterilization method is using ionizing radiation from {sup 60}Co or {sup 137}Cs. For efficient application of SIT, an important item is the sterilizing dose. This must be as lower as possible in order to preserve insect behavior. In this work, it was studied the reproductive potential of fruit fly Ceratitis capitata, tsl VIENNA 8 strain, irradiated with different doses of gamma radiation. This strain has been used in population suppression programs at fruit-growing areas from Northeast of Brazil, through a partnership between CENA and Bio factory MOSCAMED Brazil, intending only sterile male releases. Radiation source used was a {sup 60}Co irradiator, with 17.2 x 1012 Bq. Individualized couples were distributed in a randomized delineament with 10 replicates for each treatment and eggs were collected for fifteen days. With 9 and 10 days old, pupae were irradiated with doses ranging from 30 to 120 Gy. All averages of emerged adult's percentages were higher than 90%. In regards to fecundity, different doses did not affect the number of eggs laid, being the overall mean around 30 eggs/couple/day. Fertility data showed that as radiation dose increases, sterility increases. It was concluded that the dose of 90 Gy can be used in Brazil, since to SIT programs a dose is chosen witch prevents an egg hatch higher than 1%. (author)

  13. A new species of Culcua Walker (Diptera: Stratiomyidae) from Vietnam

    Science.gov (United States)

    A new species of Culcua Walker (Diptera: Stratiomyidae), C. lingafelteri Woodley, new species, is described from northern Vietnam. It is diagnosed relative to other species using the recent revision of the genus by Rozkošný and Kozánek (2007). This is the first species of Culcua reported from Viet...

  14. Checklist of the family Simuliidae (Diptera of Finland

    Directory of Open Access Journals (Sweden)

    Jari Ilmonen

    2014-09-01

    Full Text Available A checklist of the family Simuliidae (Diptera is provided for Finland and recognizes 56 species. One new record has been added (Simulium latipes and one name sunken in synonymy (Simulium carpathicum. Furthermore, Simulium tsheburovae is treated as a doubtful record.

  15. Six new species of Microdon Meigen from Madagascar (Diptera: Syrphidae).

    Science.gov (United States)

    Reemer, Menno; Bot, Sander

    2015-10-28

    Six new species of the myrmecophilous hoverfly genus Microdon Meigen (Diptera: Syrphidae) are described from Madagascar. Redescriptions are given for the three other Madagascan species of this genus. Keys are presented to the Madagascan genera of the subfamily Microdontinae and to the Madagascan species of Microdon.

  16. Anopheles (Anopheles) pseudopunctipennis Theobald (Diptera: Culicidae): Neotype Designation and Description

    Science.gov (United States)

    2004-01-01

    Diptera Ð Culicidae). Guayaquil Univ., Guayaquil, Ecuador. Levi-Castillo, R. 1945. Los anofelinos de la Republica del Ecuador, vol. 1: 1Ð172. Artes ...BritishMuseumNatural History, Lon- don, England. Vargas, L., and A. Martinez Palacios. 1956. Anofelinos mexicanos . Taxonomia y distribucion. Secretaria

  17. Surface ultrastructure of third-instar Megaselia scalaris (Diptera: Phoridae

    Directory of Open Access Journals (Sweden)

    Sukontason Kabkaew L

    2002-01-01

    Full Text Available We describe some ultrastructure of the third-instar Megaselia scalaris (Diptera: Phoridae using scanning electron microscopy, with the cephalic segment, anterior spiracle and posterior spiracle being emphasized. This study provides the taxonomic information of this larval species, which may be useful to differentiate from other closely-related species.

  18. World catalog of extant and fossil Corethrellidae (Diptera).

    Science.gov (United States)

    Borkent, Art

    2014-05-20

    A world catalog of extant and fossil frog-biting midges (Diptera: Corethrellidae) provides full type information, known life stages, and distribution of each species. There are 105 extant and seven fossil species of Corethrellidae but unnamed species are known from Costa Rica, Colombia and Madagascar. New information on types and other important specimens are provided.

  19. Scanning electron microscopy of the male genitalia of Sarcophagidae (Diptera

    Directory of Open Access Journals (Sweden)

    Hugo de Souza Lopes

    1990-03-01

    Full Text Available The male genitalia of nine species of Sarcophagidae (Diptera - Goniophyto honsuensis Rohdendorf, 1962, Tricharaea brevicornis (Wiedemann, 1830, Chaetoravinia derelicta (Walker, 1852, Austrohartigia spinigena (Rondani, 1864, Chrysagria duodecimpunctata Townsend, 1935, Boettcheria bisetosa Parker, 1914, Lipoptilocnema lanei Townsend, 1934, L. crispina (Lopes, 1938 and Euboettcheria alvarengai Lopes & Tibana, 1982 - were examined by scanning electron microscope (SEM and the main morphological features are descirbed.